HMGB1 expression suppressor, prophylactic or therapeutic drug for acute lung injury, acute respiratory distress syndrome or sepsis, or method for ameliorating such disease
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- DEXON PHARM INC
- Filing Date
- 2023-05-20
- Publication Date
- 2026-05-27
Smart Images
Figure 00000000_0000_ABST
Abstract
Description
[Technical field]
[0001] The present invention relates to an HMGB1 expression regulator; a preventive or therapeutic agent for acute lung injury, acute respiratory distress syndrome, or sepsis; and a method for ameliorating acute lung injury, acute respiratory distress syndrome, or sepsis. [Background technology]
[0002] High-mobility group box 1 (HMGB1) protein is released extracellularly upon necrosis of all nucleated cells, and from dendritic cells, macrophages, etc., upon normal activation of viable cells. HMGB1 is normally accumulated mostly in the nucleus, but is released into the cytoplasm when cells are stimulated with lipopolysaccharide or infected with bacteria, and is even released extracellularly during inflammatory responses and infections.
[0003] Research into microRNA (miRNA) has progressed, and the functions and target genes of miRNAs involved in HMGB1 are becoming clear (see Non-Patent Documents 1 and 2). Non-Patent Document 1 describes that miR-142-3p inhibits the HMGB1-mediated NF-kB signaling pathway, thereby inhibiting apoptosis and inflammation of chondrocytes in osteoarthritis.
[0004] Non-patent document 2 describes that the expression of miR-22-3p is negatively correlated with the expression of HMGB1 in human arteriosclerosis obliterans (ASO) tissue, that miR-22-3p is an important molecule that targets HMGB1 and regulates the proliferation and migration of human arterial vascular smooth muscle cells (HASMC), and that miR-22-3p and HMGB1 are therapeutic targets in the treatment of human arteriosclerosis obliterans (ASO).
[0005] Here, HMGB1 is known to be involved in acute lung injury and sepsis. For example, Non-Patent Document 3 describes that HMGB1 is a late inflammatory mediator associated with sepsis, malignant tumors, and immune diseases, and that HMGB1 and autophagy are involved in the pathogenesis of many lung diseases, including acute lung injury (ALI).
[0006] On the other hand, it is known that isolated exosomes are involved in acute lung injury, acute respiratory distress syndrome (ARDS) or sepsis. For example, Patent Document 1 describes isolated exosomes, which are (i) containing one or more markers selected from the group consisting of ALIX, TSG101, TGFBR2, SMAD1, SMAD2, SMAD3, SMAD5 and CD105; and / or (ii) not containing one or more markers selected from the group consisting of FLOT1, CD9, CD81, CAV1, EGFR, AKT1 and AKT2. [Prior art documents] [Patent documents]
[0007] [Patent Document 1] Patent Publication No. 2021-020908 [Non-patent literature]
[0008] [Non-Patent Document 1] inflammation, (2016) 39, 1718-1728 [Non-Patent Document 2] Cell. Physiol. Biochem., (2017) 42, 2492-2506 [Non-Patent Document 3] Med Sci Monit, (2019) 25: 1828-1837 Summary of the Invention [Problem to be solved by the invention]
[0009] Patent Document 1 does not mention HMGB1. Although Non-Patent Documents 1 and 2 describe the functions of miRNAs and target genes related to HMGB1 vasculitis, there is no description of administering these miRNAs as therapeutic agents for acute lung injury, acute respiratory distress syndrome, or sepsis. Non-Patent Document 3 describes the association between HMGB1 and acute lung injury, acute respiratory distress syndrome, or sepsis, but does not describe the relationship between HMGB1 and microparticles or miRNA.
[0010] An object of the present invention is to provide a novel HMGB1 expression regulator that can regulate HMGB1 expression using miRNA derived from microparticles. [Means for solving the problem]
[0011] The present inventors have found that microparticles containing specific microRNAs are able to control (suppress, inhibit, etc.) the expression of HMGB1 protein and / or the HMGB1 gene (Hmgb1).
[0012] Specifically, the present invention and preferred configurations of the present invention are as follows.
[0013] [1] An agent for controlling HMGB1 expression, the expression control agent comprises microparticles; The microparticles contain miRNA that targets a gene involved in the expression of HMGB1. HMGB1 expression regulator. [2] The HMGB1 expression regulator described in [1], wherein the microparticles are exosomes. [3] The HMGB1 expression regulator according to [1], wherein the miRNA targeting a gene involved in HMGB1 expression includes at least one type of the HMGB1-related miRNA group described below. HMGB1-related miRNAs: hsa-let-7b-5p、hsa-let-7e-5p、hsa-let-7g-5p、hsa-miR-100-5p、hsa-miR-103a-3p、hsa-miR-106b-5p、hsa-miR-107、hsa-miR-1179、hsa-miR-1183、hsa-miR-1236-3p、hsa-miR-1237-3p、hsa-miR-1247-3p、hsa-miR-129-5p、hsa-miR-1304-3p、hsa-miR-1307-3p、hsa-miR-141-3p、hsa-miR-142-3p、hsa-miR-142-5p、hsa-miR-145-5p、hsa-miR-148a-3p、hsa-miR-148b-3p、hsa-miR-150-5p、hsa-miR-17-5p、hsa-miR-181d-5p、hsa-miR-186-3p、hsa-miR-186-5p、hsa-miR-18a-3p、hsa-miR-1913、hsa-miR-193b-3p、hsa-miR-1976、hsa-miR-204-5p、hsa-miR-205-5p、hsa-miR-206、hsa-miR-20a-5p、hsa-miR-20b-5p、hsa-miR-211-5p、hsa-miR-212-5p、hsa-miR-218-5p、hsa-miR-22-3p、hsa-miR-24-3p、hsa-miR-26b-5p、hsa-miR-300、hsa-miR-302c-3p、hsa-miR-324-3p、hsa-miR-328-3p、hsa-miR-329-3p、hsa-miR-340-5p、hsa-miR-34a-5p、hsa-miR-362-3p、hsa-miR-373-3p、hsa-miR-381-3p、hsa-miR-410-3p、hsa-miR-4275、hsa-miR-4284、hsa-miR-4324、hsa-miR-4460、hsa-miR-4532、hsa-miR-4638-5p、hsa-miR-4673、hsa-miR-4691-5p、hsa-miR-4707-3p、hsa-miR-4727-3p、hsa-miR-4793-5p、hsa-miR-495-3p、hsa-miR-505-3p、hsa-miR-512-3p、hsa-miR-5193、hsa-miR-5196-3p、hsa-miR-520a-3p, hsa-miR-520d-3p, hsa-miR-520h, hsa-miR-539-3p, hsa-miR-582-5 p, hsa-miR-652-3p, hsa-miR-660-3p, hsa-miR-665, hsa-miR-92a-3p, hsa-miR-93-5p. , [4] An HMGB1 expression regulator as described in [1], wherein the miRNA targeting a gene involved in HMGB1 expression includes at least one of hsa-let-7b-5p, hsa-miR-100-5p, hsa-miR-129-5p, hsa-miR-142-3p, hsa-miR-22-3p, hsa-miR-34a-5p and hsa-miR-92a-3p. [5] An HMGB1 expression regulator according to [1], wherein the miRNA targeting a gene involved in HMGB1 expression includes at least hsa-let-7b-5p. [6] An HMGB1 expression regulator described in [1], wherein the microparticles contain miRNA that targets a gene involved in HMGB1 expression at a concentration higher than that of the culture supernatant of dental pulp-derived stem cells. [7] The microparticles are isolated by purification from the culture supernatant of dental pulp-derived stem cells; An HMGB1 expression regulator described in [1], wherein the microparticles do not contain components other than exosomes from the culture supernatant of dental pulp-derived stem cells. [8] A preventive or therapeutic drug for acute lung injury, acute respiratory distress syndrome or sepsis, which comprises the HMGB1 expression regulator described in [1] as an active ingredient. [9] A method for improving acute lung injury, acute respiratory distress syndrome or sepsis, comprising administering an effective amount of an HMGB1 expression regulator described in [1], or an effective amount of a preventive or therapeutic agent for acute lung injury, acute respiratory distress syndrome or sepsis described in [8], to a subject who has developed acute lung injury, acute respiratory distress syndrome or sepsis. Effect of the Invention
[0014] According to the present invention, it is possible to provide a novel HMGB1 expression regulator that can regulate HMGB1 expression using miRNA derived from microparticles. [Brief description of the drawings]
[0015] [Figure 1] Figure 1 is a heat map showing the expression levels of miRNAs expressed in exosomes (HMGB1 expression regulator of Example 1) purified from the culture supernatant of dental pulp-derived stem cells that target genes related to HMGB1 expression. [Diagram 2] FIG. 2 is a graph showing the amount of HMGB1 gene expression quantified in each case. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0016] The present invention will be described in detail below. The following description of the constituent elements may be based on representative embodiments or specific examples, but the present invention is not limited to such embodiments. In this specification, a numerical range expressed using "~" means a range including the numerical values before and after "~" as the lower and upper limits.
[0017] [HMGB1 expression regulator] The HMGB1 expression regulator of the present invention is an HMGB1 expression regulator that comprises microparticles, and the microparticles comprise miRNA that targets a gene involved in HMGB1 expression. The HMGB1 expression regulator of the present invention can regulate HMGB1 expression using microparticle-derived miRNA, and as a result, the HMGB1 expression regulator of the present invention can preferably ameliorate, and more preferably prevent or treat, acute lung injury, acute respiratory distress syndrome, or sepsis. Preferred embodiments of the HMGB1 expression regulator of the present invention are described below.
[0018] <Acute lung injury, acute respiratory distress syndrome, sepsis> Acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) are conditions in which shortness of breath or difficulty in breathing suddenly appears during the course of sepsis or pneumonia, or after aspiration or multiple trauma (injury to multiple parts of the body), and a chest X-ray shows shadows (infiltration) in both lungs. The partial pressure of oxygen in arterial blood decreases (hypoxemia), and depending on the level, it is called acute lung injury or acute respiratory distress syndrome. Sepsis is a condition in which bacteria enter the bloodstream due to a viral or bacterial infection and grow, causing organ damage and potentially leading to death. There is no established, highly effective treatment for sepsis.
[0019] <Small particles> The HMGB1 expression regulator of the present invention comprises microparticles. In the present invention, the microparticles contain miRNA that targets a gene involved in the expression of HMGB1. The microparticles are derived from dental pulp-derived stem cells, etc., for example, by secretion, budding, or dispersion from mesenchymal stem cells such as dental pulp-derived stem cells, and are exuded, released, or dropped off into a cell culture medium. The microparticles are preferably contained in the culture supernatant of dental pulp-derived stem cells, etc., and are more preferably microparticles derived from the culture supernatant of dental pulp-derived stem cells. However, the microparticles derived from the culture supernatant of dental pulp-derived stem cells do not necessarily have to be obtained from the culture supernatant of dental pulp-derived stem cells. For example, even if the microparticles inside dental pulp-derived stem cells are isolated by any method, they can be said to be microparticles derived from the culture supernatant of dental pulp-derived stem cells, as long as they are the same as the microparticles that can be isolated from the culture supernatant of dental pulp-derived stem cells. The microparticles derived from the culture supernatant of dental pulp-derived stem cells or the like may be used in a state contained in the culture supernatant, or may be used in a state purified from the culture supernatant. It is preferable that the microparticles are microparticles purified from the culture supernatant. The origin of the microparticles can be determined by a known method. For example, the microparticles can be determined to be derived from any stem cell, such as dental pulp-derived stem cells, adipose-derived stem cells, bone marrow-derived stem cells, or umbilical cord-derived stem cells, by the method described in J Stem Cell Res Ther (2018) 8:2. Specifically, the origin of each microparticle can be determined based on the miRNA pattern of the microparticles.
[0020] (miRNA) In the present invention, the microparticles contain miRNA that targets a gene involved in the expression of HMGB1. In the present invention, miRNA (MicroRNAs) is an RNA molecule having, for example, 21 to 25 bases (nucleotides). miRNA can regulate gene expression by degrading target gene (target) mRNA or suppressing it at the decoding stage. In the present invention, miRNA may be, for example, a single-stranded (monomer) or a double-stranded (dimer). In addition, in the present invention, miRNA is preferably a mature miRNA cleaved by a ribonuclease such as Dicer.
[0021] The sequences of the miRNAs described herein, such as hsa-let-7b-5p, are registered in a known database (e.g., the miRBase database) in association with the accession numbers, and a person skilled in the art can uniquely determine the sequence. For example, the accession number of hsa-let-7b-5p is MIMAT0000063, and the sequence is registered in the miRBase database. Hereinafter, the accession numbers of each miRNA will be omitted. However, the miRNA in this specification also includes variants that differ from mature miRNAs such as hsa-let-7b-5p by about 1 to 5 bases. In addition, each miRNA in this specification includes a polynucleotide consisting of a base sequence having identity to the base sequence of each miRNA (e.g., hsa-let-7b-5p), or a polynucleotide consisting of a complementary base sequence thereof, and has the function of the miRNA in the present invention. "Identity" refers to the degree of identity when the sequences to be compared are appropriately aligned, and means the occurrence rate (%) of exact amino acid matches between the sequences. The alignment can be performed by using any algorithm such as BLAST. The identity is, for example, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or about 99%. A polynucleotide consisting of a base sequence having identity may have, for example, a point mutation, deletion, and / or addition in the base sequence of the miRNA. The number of bases of the point mutations, etc. is, for example, 1 to 5, 1 to 3, 1 to 2, or 1. In addition, the polynucleotide consisting of a complementary base sequence is, for example, a polynucleotide that hybridizes with a polynucleotide consisting of a base sequence of miRNA under stringent conditions, and includes a polynucleotide having the function of miRNA in the present invention. The stringent conditions are not particularly limited, but may include, for example, the conditions described in
[0028] of JP 2017-184642 A, the contents of which are incorporated herein by reference.
[0022] In the present invention, the microparticles preferably contain miRNA that targets a gene involved in HMGB1 expression at a concentration higher than that of the culture supernatant of dental pulp-derived stem cells. Preferred embodiments of the miRNA contained in the microparticles are described below.
[0023] -miRNA targeting genes related to HMGB1 expression- HMGB1 is released extracellularly upon necrosis of all nucleated cells, and from dendritic cells, macrophages, etc., upon normal activation of viable cells. When released extracellularly, HMGB1 induces host defense responses, such as innate immunity and hemostasis, in localized or transient cases, and is also thought to play an important role in repair. However, when HMGB1 acts systemically, it becomes a mediator of shock and disseminated intravascular coagulation (DIC). HMGB1 is mainly present in the nucleus and has been identified as a protein that plays a role in stabilizing the chromatin structure and gene transcription. A portion of HMGB1 is also present in the cytoplasm and is involved in the recognition of nucleic acids taken up from outside the cell and the induction of autophagy. Furthermore, HMGB1 is released from the nucleus to the extracellular space in response to inflammatory stimuli such as lipopolysaccharide or following cell death. In particular, HMGB1 released to the extracellular space is recognized by innate immune receptors such as Toll-like receptors, and is therefore involved in inflammation during sepsis, autoimmune diseases, ischemic reperfusion, and organ transplantation. In fact, administration of HMGB1 neutralizing antibodies can alleviate the pathology of these diseases. Cytoplasmic HMGB1 is important for the suppression of lipopolysaccharide-induced (LPS)-induced sepsis and Listeria monocytogenes infection (PNAS (2013) vol. 110, no. 51, 20699-20704).
[0024] Here, miR-142-3p inhibits chondrocyte apoptosis and inflammation in osteoarthritis by inhibiting the HMGB1-mediated NF-kB signaling pathway (inflammation, (2016) 39, 1718-1728). The expression of miR-22-3p is negatively correlated with the expression of HMGB1 in human arteriosclerosis obliterans (ASO) tissues. miR-22-3p is an important molecule that targets HMGB1 to regulate the proliferation and migration of human arterial vascular smooth muscle cells (HASMCs), and miR-22-3p and HMGB1 are therapeutic targets for the treatment of human arteriosclerosis obliterans (ASO) (Cell. Physiol. Biochem., (2017) 42, 2492-2506). The inflammatory mediator HMGB1 is a direct target of miR-129-5p, which suppresses apoptosis and inflammatory responses via the HMGB1 / TLR4 / NF-κB pathway (Biosci Rep. (2020) 40 (3)).
[0025] On the other hand, Non-Patent Document 3 (Med Sci Monit, (2019) 25: 1828-1837) describes that HMGB1 is a late inflammatory mediator associated with sepsis, malignant tumors, and immune diseases, and that HMGB1 and autophagy are involved in the pathogenesis of many lung diseases, including acute lung injury (ALI). Therefore, HMGB1 expression inhibitors can be used as preventive or therapeutic agents for acute lung injury and acute respiratory distress syndrome.
[0026] Sepsis begins when a pathogen invades the body and causes inflammation throughout the body. This inflammatory response involves the "keyhole (RAGE) into which AGE, a glycosylated protein, gets stuck." The invasion of pathogens triggers the production of HMGB1, which stimulates RAGE to progress to sepsis. In other words, when infected with a pathogen or virus, HMGB1 produced in the body binds to the keyhole (RAGE) and sepsis develops. A substance called the RAGE aptamer can suppress death from sepsis in animals by blocking the keyhole by capping RAGE and inhibiting the binding of HMGB1 to RAGE (Oxidative Medicine and Cellular Longevity, (2021) Article ID 9932311). Plasma histidine-rich glycoprotein (HRG) strongly suppresses the release of HMGB1 and suppresses the production of excessive inflammatory cytokines. The protective effect of HRG on vascular endothelial cells leads to the development of a treatment for sepsis (J.isci.(2020) Volume 23, Issue 6, 101180). Therefore, HMGB1 expression inhibitors can be used as preventive or therapeutic agents for sepsis.
[0027] Based on the above, miRNAs that target genes involved in HMGB1 expression (the HMGB1-related miRNA group described below) are effective as therapeutic agents for vasculitis, and therefore are also effective as preventive or therapeutic agents for acute lung injury, acute respiratory distress syndrome, or sepsis. HMGB1-related miRNAs: hsa-let-7b-5p、hsa-let-7e-5p、hsa-let-7g-5p、hsa-miR-100-5p、hsa-miR-103a-3p、hsa-miR-106b-5p、hsa-miR-107、hsa-miR-1179、hsa-miR-1183、hsa-miR-1236-3p、hsa-miR-1237-3p、hsa-miR-1247-3p、hsa-miR-129-5p、hsa-miR-1304-3p、hsa-miR-1307-3p、hsa-miR-141-3p、hsa-miR-142-3p、hsa-miR-142-5p、hsa-miR-145-5p、hsa-miR-148a-3p、hsa-miR-148b-3p、hsa-miR-150-5p、hsa-miR-17-5p、hsa-miR-181d-5p、hsa-miR-186-3p、hsa-miR-186-5p、hsa-miR-18a-3p、hsa-miR-1913、hsa-miR-193b-3p、hsa-miR-1976、hsa-miR-204-5p、hsa-miR-205-5p、hsa-miR-206、hsa-miR-20a-5p、hsa-miR-20b-5p、hsa-miR-211-5p、hsa-miR-212-5p、hsa-miR-218-5p、hsa-miR-22-3p、hsa-miR-24-3p、hsa-miR-26b-5p、hsa-miR-300、hsa-miR-302c-3p、hsa-miR-324-3p、hsa-miR-328-3p、hsa-miR-329-3p、hsa-miR-340-5p、hsa-miR-34a-5p、hsa-miR-362-3p、hsa-miR-373-3p、hsa-miR-381-3p、hsa-miR-410-3p、hsa-miR-4275、hsa-miR-4284、hsa-miR-4324、hsa-miR-4460、hsa-miR-4532、hsa-miR-4638-5p、hsa-miR-4673、hsa-miR-4691-5p、hsa-miR-4707-3p、hsa-miR-4727-3p、hsa-miR-4793-5p、hsa-miR-495-3p、hsa-miR-505-3p、hsa-miR-512-3p、hsa-miR-5193、hsa-miR-5196-3p、hsa-miR-520a-3p, hsa-miR-520d-3p, hsa-miR-520h, hsa-miR-539-3p, hsa-miR-582-5 p, hsa-miR-652-3p, hsa-miR-660-3p, hsa-miR-665, hsa-miR-92a-3p, hsa-miR-93-5p. ,
[0028] Among the HMGB1-related miRNAs, in addition to the above-mentioned miR-142-3p, miR-22-3p, and hsa-miR-129-5p, the following specific miRNAs are known to be able to improve vasculitis and are therefore also effective as preventive or therapeutic agents for acute lung injury, acute respiratory distress syndrome, or sepsis.
[0029] (1-1)hsa-let-7b-5p related Overexpression of let-7a and let-7b suppresses oxLDL-induced endothelial cell apoptosis, NO deficiency, excessive production of reactive oxygen species, increased expression of LOX-1, and downregulation of endothelial nitric oxide synthase (eNOS). let-7a and let-7b have a protective effect against endothelial cell injury caused by oxidized low-density lipoprotein (Plos one (2014) 9, (9): e106540). Secreted exosomal miRs (miR-210, miR-23a-3p, miR-424, let-7f, miR-30b, miR-30c, miR-126, miR-21, miR-132, miR-130a-3p, miR-214, miR-378, miR-126, miR-133, let-7b-5p) induce cardiac angiogenesis and revascularization and protect against myocardial ischemia by increasing blood flow to the ischemic myocardium (Heart Failure Revies, (2021) 26 (1), 205-213).
[0030] (1-2)hsa-miR-100-5p-related miR-100-5p enriched in hucMSC-exo could protect cardiomyocytes from H / R-induced pyroptosis and injury by suppressing FOXO3 expression, inhibiting NLRP3 inflammasome activation, and inhibiting cytokine release (Front. Bioeng. Biotechnol. (2021) 8. 615850). miR-100-5p targets FZD5 and negatively regulates its expression. hUCMSC-Ex-miR-100-5p suppressed cell proliferation and inflammatory responses by regulating FZD5 in eosinophils. hUCMSC-Ex-miR-100-5p suppressed cell proliferation and inflammatory responses via the Wnt / β-catenin pathway in eosinophils. hUCMSC-Ex-miR-100-5p reduced atherosclerotic plaque area and inflammation in mice (Acta. Biochim. Biophys. sin. (2021) 53 (9): 1166-1176).
[0031] (1-3)hsa-miR-92a-3p related miR-92a-3p targets SIRT6. Knockdown of miR-92a-3p promotes SIRT6 expression and inactivates the MAPK signaling pathway. miR-92a-3p promotes ox-LDL-induced apoptosis of HUVECs by regulating the SIRT6 / MAPK signaling pathway (Brazilian Journal of Medical and Biological Research (2021) 54 (3): e9386). It is speculated that proatherogenic stimuli promote the release of EMVs containing miR-92a-3p as messengers carrying renewable signals, which are then taken up by further downstream target cells in the blood to promote angiogenesis in the context of vascular injury (Circ. Res. (2019);124: 575-587). Forced overexpression of miR-92a in endothelial cells inhibited angiogenesis in vitro and in vivo. In mouse models of limb ischemia and myocardial infarction, systemic administration of antigommia designed to block miR-92a promoted blood vessel growth and led to functional recovery of the injured tissue (Science (2009) 324 (5935): 1710-1713). Inhibition of miR-92a increases endothelial proliferation and migration in vitro and suppresses neointimal proliferation after vascular injury in vivo (Basic Res. Cardiol. (2012) 107: 296).
[0032] (1-4)hsa-miR-34a-5p related miR-34a induces senescence by inhibiting Sirt1 and inhibits angiogenesis by EPCs (endothelial progenitor cells) (Am. J. Physiol. Endocrinol. Metab. (2010) 299: E110-E116). Inhibition of miR-34a suppresses age-related cardiomyocyte death and functional decline in vivo. miR-34a is induced after acute myocardial infarction, and its inhibition promotes recovery of myocardial contractility after acute myocardial infarction (Nature (2013) 495, 107-110).
[0033] In the present invention, when the microparticles contain miRNA targeting a gene involved in HMGB1 expression (preferably the HMGB1 gene), they preferably function as an expression regulator of the gene involved in HMGB1 expression. It is more preferable that the microparticles are HMGB1 expression inhibitors. In this case, in the present invention, the microparticles preferably contain at least one of hsa-let-7b-5p, hsa-miR-100-5p, hsa-miR-129-5p, hsa-miR-142-3p, hsa-miR-22-3p, hsa-miR-34a-5p and hsa-miR-92a-3p, more preferably at least hsa-let-7b-5p, and more preferably hsa It is particularly preferred that the miR-129-5p, hsa-miR-142-3p, hsa-miR-22-3p, hsa-miR-34a-5p and hsa-miR-92a-3p are included, and it is even more preferred that the miR-129-5p, hsa-miR-142-3p, hsa-miR-22-3p, hsa-miR-34a-5p and hsa-miR-92a-3p are included.
[0034] The microparticles preferably contain at least one of the miRNAs that target genes related to HMGB1 expression, as a Log2Ratio of the read count number obtained by analysis using IMOTA, of 2.0 or more, more preferably 4.0 or more, and particularly preferably 6.0 or more. The microparticles preferably contain hsa-let-7b-5p, hsa-miR-100-5p, hsa-miR-129-5p, hsa-miR-142-3p, hsa-miR-22-3p, hsa-miR-34a-5p, and hsa-miR-92a-3p, each independently, as a Log2Ratio of the read count number obtained by analysis using IMOTA, of 4.0 or more, more preferably 10.0 or more, particularly preferably 12.0 or more, and more particularly preferably 15.0 or more. It is more preferable that hsa-let-7b-5p, hsa-miR-100-5p and hsa-miR-92a-3p are all 12.0 or more.
[0035] The microparticles preferably have an expression level of hsa-let-7b-5p that is 1.1 times or more, more preferably 1.5 times or more, and particularly preferably 2 times or more, higher than that of exosomes obtained from the culture supernatant of adipose-derived stem cells or exosomes obtained from the culture supernatant of umbilical cord-derived stem cells.
[0036] It is preferable that the HMGB1 expression inhibitor can suppress the expression of the HMGB1 gene in any cell to less than 0.8-fold the normal level (compared to untreated cells), more preferably to less than 0.6-fold, and particularly preferably to less than 0.55-fold.
[0037] (Type of miRNA) Here, the microparticles derived from the culture supernatant of dental pulp-derived stem cells contain about 2600 types of small RNA. Of these, about 1800 types are miRNA. Of these miRNAs, 180 to 200 types of miRNAs are highly abundant. The miRNAs highly abundant in the microparticles derived from dental pulp-derived stem cells are characterized by the fact that they contain many microRNAs related to the treatment of cranial nerve diseases and vasculitis, which was not previously known and is a new finding by the present inventor. This characteristic is significantly different from the types of miRNAs highly abundant in other microparticles of mesenchymal stem cells. For example, the miRNAs highly abundant in the microparticles of adipose-derived stem cells and microparticles of umbilical cord-derived stem cells hardly contain microRNAs related to the treatment of cranial nerve diseases and vasculitis.
[0038] The microparticles preferably contain two or more types of miRNA that target genes involved in HMGB1 expression, more preferably 10 or more types, even more preferably 30 or more types, particularly preferably 50 or more types, and even more particularly preferably 100 or more types.
[0039] (Types of microparticles) The microparticle is preferably at least one type selected from the group consisting of exosomes, microvesicles, membrane particles, membrane vesicles, ectosomes, and exovesicles, or microvesicles, and is more preferably an exosome. The diameter of the microparticles is preferably from 10 to 1000 nm, more preferably from 30 to 500 nm, and particularly preferably from 50 to 150 nm. Furthermore, it is desirable that the surface of the microparticles contains a molecule called tetraspanin, such as CD9, CD63, or CD81, and this may be CD9 alone, CD63 alone, or CD81 alone, or any combination of two or three of these. Hereinafter, a preferred embodiment in which exosomes are used as the microparticles will be described, but the microparticles used in the present invention are not limited to exosomes.
[0040] Exosomes are preferably extracellular vesicles that are released from cells upon fusion of multivesicular bodies with the plasma membrane. The surface of the exosome preferably contains lipids and proteins derived from the cell membrane of dental pulp-derived stem cells. It is preferable that the exosomes contain intracellular substances of dental pulp-derived stem cells, such as nucleic acids (microRNA, messenger RNA, DNA, etc.) and proteins. Exosomes are known to be used for cell-to-cell communication by transporting genetic information from one cell to another. Exosomes are easily traceable and can be targeted to specific regions.
[0041] (Fine particle content) The content of the microparticles in the microparticle composition is not particularly limited. 8 It is preferable to have 1.0×10 8 More preferably, it contains 2.0×10 8 It is particularly preferable that the number of the particles is 2.5×10 or more. 8 More particularly preferably, it contains 1.0×10 9 It is even more particularly preferred that it contains more than one. The concentration of the microparticles in the microparticle composition is not particularly limited. 8It is preferable to have more than 2.0 × 10 8 More preferably, it contains 4.0×10 8 It is particularly preferable that the concentration is 5.0×10 8 More preferably, the concentration is 2.0×10 9 It is even more particularly preferred that it contains more than 100 / mL. A preferred embodiment of the HMGB1 expression regulator of the present invention contains such a large amount or high concentration of microparticles, thereby making it possible to maintain a high amount of miRNA that targets a gene involved in HMGB1 expression.
[0042] <Other ingredients> In addition to the microparticles, the microparticle composition may contain other components depending on the type of animal to which it is administered and the purpose, within the range that does not impair the effects of the present invention. Examples of other components include nutritional components, antibiotics, cytokines, protective agents, carriers, excipients, disintegrants, buffers, emulsifiers, suspending agents, soothing agents, stabilizers, preservatives, and antiseptics. Examples of nutritional components include fatty acids and vitamins. Examples of antibiotics include penicillin, streptomycin, and gentamicin. Carriers can include materials known as pharma- ceutically acceptable carriers. The microparticle composition may be the culture supernatant of dental pulp-derived stem cells itself or the microparticles themselves, or may be a pharmaceutical composition further comprising a pharma- ceutically acceptable carrier, excipient, etc. The purpose of the pharmaceutical composition is to facilitate the administration of the microparticles to a subject.
[0043] The pharma- ceutically acceptable carrier is preferably a carrier (including diluents) that does not cause significant irritation to the subject of administration and does not suppress the biological activity and properties of the compound administered. Examples of carriers include propylene glycol; (physiological) saline; emulsion; buffer; culture medium, such as DMEM or RPMI; and cryopreservation medium containing components that remove free radicals.
[0044] The microparticle composition may contain an active ingredient of a conventionally known therapeutic agent for acute lung injury, acute respiratory distress syndrome, or sepsis. Those skilled in the art can appropriately modify the composition according to the intended use, the subject of administration, and the like.
[0045] On the other hand, it is preferred that the microparticle composition be free of certain substances. For example, the microparticle composition preferably does not include dental pulp-derived stem cells. In addition, the microparticle composition preferably does not contain MCP-1. However, the microparticle composition may contain cytokines other than MCP-1. Examples of other cytokines include those described in
[0014] to
[0020] of JP 2018-023343 A. Furthermore, the microparticle composition preferably does not contain Siglec 9. However, it may contain other sialic acid-binding immunoglobulin-like lectins other than Siglec 9. It is preferable that the microparticle composition is substantially free of serum (fetal bovine serum, human serum, sheep serum, etc.) In addition, it is preferable that the microparticle composition is substantially free of conventional serum substitutes such as knockout serum replacement (KSR). In the microparticle composition, the contents (solid contents) of the other components described above are each preferably 1% by mass or less, more preferably 0.1% by mass or less, and particularly preferably 0.01% by mass or less.
[0046] <Method of manufacturing microparticles> The method for producing the microparticles is not particularly limited. The HMGB1 expression regulator of the present invention may be prepared by preparing a culture supernatant of dental pulp-derived stem cells or the like, and then purifying microparticles from the culture supernatant of dental pulp-derived stem cells. Alternatively, the HMGB1 expression regulator of the present invention may be prepared by purifying microparticles from the culture supernatant of dental pulp-derived stem cells obtained commercially. Furthermore, the HMGB1 expression regulator of the present invention may be prepared by receiving a composition containing culture supernatant of dental pulp-derived stem cells that had been discarded (or by appropriately purifying the composition), purifying microparticles therefrom.
[0047] (Method for preparing culture supernatant of dental pulp-derived stem cells, etc.) The culture supernatant of dental pulp-derived stem cells or the like is not particularly limited. The culture supernatant of dental pulp-derived stem cells, etc. is preferably substantially free of serum. For example, the culture supernatant of dental pulp-derived stem cells, etc. preferably contains 1% by mass or less of serum, more preferably 0.1% by mass or less, and particularly preferably 0.01% by mass or less.
[0048] Dental pulp-derived stem cells may be derived from humans or non-human animals. Examples of non-human animals include the same animals (biological species) to which the HMGB1 expression regulator of the present invention is administered, as described below, and mammals are preferred.
[0049] There are no particular limitations on the dental pulp-derived stem cells used in the culture supernatant. Stem cells from exfoliated deciduous teeth, stem cells from deciduous teeth obtained by other methods, and dental pulp stem cells from permanent teeth (DPSCs) can be used. In addition to human deciduous tooth pulp stem cells and human permanent tooth pulp stem cells, dental pulp stem cells derived from animals other than humans, such as porcine deciduous tooth pulp stem cells, can be used. In addition to exosomes, dental pulp-derived stem cells can produce various cytokines, such as vascular endothelial growth factor (VEGF), hepatocyte growth factor (HGF), insulin-like growth factor (IGF), platelet-derived growth factor (PDGF), transforming growth factor-beta (TGF-β)-1 and -3, TGF-α, KGF, HBEGF, SPARC, other growth factors, and chemokines, as well as many other bioactive substances. In the present invention, it is particularly preferable that the dental pulp-derived stem cells used in the culture supernatant of dental pulp-derived stem cells are dental pulp-derived stem cells that contain a large amount of protein, and it is preferable to use deciduous dental pulp stem cells. That is, in the present invention, it is preferable to use the culture supernatant of deciduous dental pulp stem cells.
[0050] The dental pulp-derived stem cells used in the present invention may be natural or genetically modified, so long as they can achieve the intended treatment. In particular, in the present invention, immortalized stem cells derived from dental pulp can be used. By using immortalized stem cells capable of virtually unlimited proliferation, the amount and composition of biological factors contained in the stem cell culture supernatant can be stabilized for a long period of time. There are no particular limitations on the immortalized stem cells derived from dental pulp. The immortalized stem cells are preferably non-cancerous immortalized stem cells. The immortalized stem cells derived from dental pulp can be prepared by adding the following low molecular weight compounds (inhibitors) alone or in combination to dental pulp-derived stem cells and culturing them. The TGFβ receptor inhibitor is not particularly limited as long as it has an effect of inhibiting the function of the transforming growth factor (TGF) β receptor, and examples thereof include 2-(5-benzo[1,3]dioxol-4-yl-2-tert-butyl-1H-imidazol-4-yl)-6-methylpyridine, 3-(6-methylpyridin-2-yl)-4-(4-quinolyl)-1-phenylthiocarbamoyl-1H-pyridine, and the like. Examples of such compounds include pyrazole (A-83-01), 2-[(5-chloro-2-fluorophenyl)pteridin-4-yl]pyridin-4-ylamine (SD-208), 3-[(pyridin-2-yl)-4-(4-quinonyl)]-1H-pyrazole, 2-(3-(6-methylpyridin-2-yl)-1H-pyrazol-4-yl)-1,5-naphthyridine (Merck), and SB431542 (Sigma-Aldrich). A-83-01 is preferred. ROCK inhibitors are not particularly limited as long as they have the effect of inhibiting the function of Rho-binding kinase. Examples of ROCK inhibitors include GSK269962A (Axonmedchem), Fasudil hydrochloride (Tocris Bioscience), Y-27632, and H-1152 (all Fujifilm Wako Pure Chemical Industries, Ltd.). Y-27632 is preferred. The GSK3 inhibitor is not particularly limited as long as it inhibits GSK-3 (Glycogen synthase kinase 3), and examples thereof include A 1070722, BIO, and BIO-acetoxime (all from TOCRIS). The MEK inhibitor is not particularly limited as long as it has the effect of inhibiting the function of MEK (MAP kinase-ERK kinase), and examples thereof include AZD6244, CI-1040 (PD184352), PD0325901, RDEA119 (BAY86-9766), SL327, U0126-EtOH (all from Selleck), PD98059, U0124, U0125 (all from Cosmo Bio Co., Ltd.), etc.
[0051] When the HMGB1 expression regulator of the present invention is used in regenerative medicine, due to requirements of the Act on Safety Assurance of Regenerative Medicine, the culture supernatant of dental pulp-derived stem cells or these immortalized stem cells, and the composition containing microparticles derived therefrom, should not contain somatic stem cells other than dental pulp-derived stem cells, etc. The microparticle composition may contain mesenchymal stem cells or other somatic stem cells other than dental pulp-derived stem cells, etc., but preferably does not contain them. Examples of somatic stem cells other than mesenchymal stem cells include, but are not limited to, stem cells derived from the dermal system, digestive system, bone marrow system, nervous system, etc. Examples of somatic stem cells from the dermal system include epithelial stem cells, hair follicle stem cells, etc. Examples of somatic stem cells from the digestive system include pancreatic (general) stem cells, hepatic stem cells, etc. Examples of somatic stem cells from the bone marrow system (other than mesenchymal stem cells) include hematopoietic stem cells, etc. Examples of somatic stem cells from the nervous system include neural stem cells, retinal stem cells, etc. The microparticle composition may contain stem cells other than somatic stem cells, but preferably does not contain them. Stem cells other than somatic stem cells include embryonic stem cells (ES cells), induced pluripotent stem cells (iPS cells), and embryonic carcinoma cells (EC cells).
[0052] The method for preparing the culture supernatant of dental pulp-derived stem cells or immortalized stem cells is not particularly limited, and any conventional method can be used. The culture supernatant of dental pulp-derived stem cells, etc. is a culture solution obtained by culturing dental pulp-derived stem cells. For example, the culture supernatant usable in the present invention can be obtained by separating and removing cellular components after culturing dental pulp-derived stem cells. Culture supernatants that have been appropriately subjected to various treatments (e.g., centrifugation, concentration, solvent replacement, dialysis, freezing, drying, lyophilization, dilution, desalting, storage, etc.) may also be used.
[0053] Dental pulp-derived stem cells for obtaining the culture supernatant of dental pulp-derived stem cells can be selected by a conventional method, and can be selected based on the size or morphology of the cells, or as adhesive cells. Dental pulp cells collected from shed deciduous or permanent teeth can be selected as adhesive cells or their subcultured cells. The culture supernatant of dental pulp-derived stem cells can be obtained by culturing the selected stem cells.
[0054] It is preferable that the "culture supernatant of dental pulp-derived stem cells, etc." is a culture medium that does not contain the cells themselves obtained by culturing dental pulp-derived stem cells, etc. In one embodiment, the culture supernatant of dental pulp-derived stem cells used in the present invention does not contain cells (regardless of the type of cell) as a whole. This characteristic clearly distinguishes the composition of this embodiment from various compositions that contain dental pulp-derived stem cells, as well as dental pulp-derived stem cells themselves. A typical example of this embodiment is a composition that does not contain dental pulp-derived stem cells and is composed only of the culture supernatant of dental pulp-derived stem cells. The culture supernatant of dental pulp-derived stem cells used in the present invention may contain both culture supernatants of stem cells derived from deciduous dental pulp and stem cells derived from adult dental pulp. The culture supernatant of dental pulp-derived stem cells used in the present invention preferably contains the culture supernatant of stem cells derived from deciduous dental pulp as an active ingredient, more preferably contains 50% by mass or more, and preferably contains 90% by mass or more. It is more preferable that the culture supernatant of dental pulp-derived stem cells used in the present invention is a composition composed only of the culture supernatant of stem cells derived from deciduous dental pulp.
[0055] A basal medium or a basal medium to which serum or the like has been added can be used as the culture medium for dental pulp-derived stem cells to obtain the culture supernatant. In addition to Dulbecco's Modified Eagle Medium (DMEM), Iscove's Modified Dulbecco's Medium (IMDM) (GIBCO, etc.), Ham's F12 Medium (HamF12) (SIGMA, GIBCO, etc.), RPMI1640 medium, etc. can be used as the basal medium. Examples of components that can be added to the medium include serum (fetal bovine serum, human serum, sheep serum, etc.), serum substitutes (knockout serum replacement (KSR), etc.), bovine serum albumin (BSA), antibiotics, various vitamins, and various minerals. However, in order to prepare a serum-free "culture supernatant of dental pulp-derived stem cells", it is advisable to use a serum-free medium throughout the entire process or for the last or subsequent few subcultures. For example, a serum-free culture supernatant of dental pulp-derived stem cells can be prepared by culturing dental pulp-derived stem cells in a medium that does not contain serum (serum-free medium). A serum-free culture supernatant of dental pulp-derived stem cells can also be obtained by performing one or more subcultures and culturing the last or subsequent few subcultures in a serum-free medium. On the other hand, a serum-free culture supernatant of dental pulp-derived stem cells can also be obtained by removing serum from the collected culture supernatant using dialysis or solvent replacement using a column.
[0056] The conditions commonly used for culturing dental pulp-derived stem cells to obtain the culture supernatant can be applied as is. The method for preparing the culture supernatant of dental pulp-derived stem cells may be the same as the cell culture method described below, except that the steps of isolating and selecting stem cells are appropriately adjusted according to the type of stem cells. Isolation and selection of dental pulp-derived stem cells according to the type of stem cells can be appropriately performed by those skilled in the art. In addition, special conditions may be applied to the culture of dental pulp-derived stem cells in order to produce a large amount of microparticles such as exosomes. Examples of the special conditions include low temperature conditions, low oxygen conditions, microgravity conditions, and co-culture with some kind of stimuli.
[0057] The culture supernatant of dental pulp-derived stem cells used in the present invention for preparing microparticles such as exosomes may contain other components in addition to the culture supernatant of dental pulp-derived stem cells, but it is preferable that it is substantially free of other components. However, each type of additive used in preparing exosomes may be added to the culture supernatant of dental pulp-derived stem cells and then stored.
[0058] (Preparation of Microparticles) The microparticles can be prepared by purifying the microparticles from the culture supernatant of dental pulp-derived stem cells or the like.
[0059] The purification of the microparticles is preferably separation of a fraction containing the microparticles from the culture supernatant of dental pulp-derived stem cells, and more preferably isolation of the microparticles. The microparticles can be isolated by separating them from non-associated components based on a property of the microparticle, for example, the microparticles can be isolated based on molecular weight, size, morphology, composition or biological activity. In the present invention, the microparticles can be purified by separating a specific fraction (e.g., precipitate) containing a large amount of microparticles obtained by centrifuging the culture supernatant of dental pulp-derived stem cells. Unnecessary components (insoluble components) in fractions other than the specified fraction may be removed. The removal of the solvent, dispersion medium, and unnecessary components from the microparticle composition does not have to be complete. Exemplary conditions for centrifugation are 100 to 20,000 g for 1 to 30 minutes. In the present invention, microparticles can be purified by filtering the culture supernatant of dental pulp-derived stem cells or a centrifuged product thereof. Unnecessary components can be removed by filtering. In addition, by using a filtering membrane with an appropriate pore size, removal of unnecessary components and sterilization can be performed simultaneously. The material and pore size of the filtering membrane used for filtering are not particularly limited. Filtration can be performed using a filtering membrane with an appropriate molecular weight or size cutoff by a known method. From the viewpoint of easy separation of exosomes, the pore size of the filtering membrane is preferably 10 to 1000 nm, more preferably 30 to 500 nm, and particularly preferably 50 to 150 nm. In the present invention, the culture supernatant of dental pulp-derived stem cells or its centrifuged or filtered product can be separated using a further separation means such as column chromatography. For example, high performance liquid chromatography (HPLC) using various columns can be used. The column can be a size exclusion column or a binding column. One or more properties or biological activities of the microparticles can be used to track the microparticles (or their activity) in each fraction at each processing step. For example, light scattering, refractive index, dynamic light scattering, or UV-visible light detectors can be used to track the microparticles. Or, specific enzyme activity, etc. can be used to track activity in each fraction. As a method for purifying microparticles, the methods described in
[0034] to
[0064] of JP2019-524824A may be used, the contents of which are incorporated herein by reference.
[0060] The final form of the microparticle composition is not particularly limited. For example, the microparticle composition may be in the form of microparticles packed in a container together with a solvent or dispersion medium; in the form of microparticles gelled together with a gel and packed in a container; or in the form of microparticles frozen and / or dried to solidify and formulated or packed in a container. Examples of the container include tubes, centrifuge tubes, bags, etc. suitable for cryopreservation. The freezing temperature may be, for example, -20°C to -196°C.
[0061] The HMGB1 expression regulator of the present invention has the advantages of being easy to mass-produce, being able to utilize stem cell culture fluid that was previously discarded as industrial waste, and being able to reduce the disposal cost of stem cell culture fluid, compared to conventional compositions that can be used as therapeutic or preventive drugs for acute lung injury, acute respiratory distress syndrome, or sepsis. In particular, when the culture supernatant of dental pulp-derived stem cells is a culture supernatant of human dental pulp-derived stem cells, the HMGB1 expression regulator of the present invention has the advantage of being highly safe from an immunological standpoint and having few ethical issues when applied to humans. When the culture supernatant of dental pulp-derived stem cells is a culture supernatant of dental pulp-derived stem cells from a patient with acute lung injury, acute respiratory distress syndrome, or sepsis, the safety of applying the HMGB1 expression regulator of the present invention to the patient will be increased and there will be fewer ethical issues. When the HMGB1 expression regulator of the present invention is derived from the culture supernatant of dental pulp-derived stem cells, it can also be used in restorative medicine. In particular, compositions containing microparticles derived from the culture supernatant of dental pulp-derived stem cells and the like are preferably used in restorative medicine. Here, in regenerative medicine based on stem cell transplantation, it is known that stem cells are not the main players in regeneration, but rather that the liquid components produced by stem cells repair organs together with the patient's own stem cells. The difficult problems associated with conventional stem cell transplantation, such as canceration, standardization, administration method, storage, and culture method, are solved, and restorative medicine is possible using the culture supernatant of dental pulp-derived stem cells or a composition using microparticles derived therefrom. Compared to stem cell transplantation, when the HMGB1 expression regulator of the present invention is used, tumorigenesis is unlikely to occur because cells are not transplanted, and it can be said to be safer. In addition, the HMGB1 expression regulator of the present invention has the advantage of being of a constant standardized quality. It can be used at low cost because it can be mass-produced and an efficient administration method can be selected.
[0062] [Preventive or therapeutic drugs for acute lung injury, acute respiratory distress syndrome, or sepsis] The preventive or therapeutic agent for acute lung injury, acute respiratory distress syndrome, or sepsis of the present invention contains the HMGB1 expression regulator of the present invention as an active ingredient. As used herein, "prevention" refers to preventing the onset of a disease (herein, acute lung injury, acute respiratory distress syndrome, or sepsis). Additionally, as used herein, "treatment" refers to alleviating, suppressing, or preventing the progression of symptoms of an established disease, and improving symptoms.
[0063] [Methods for improving acute lung injury, acute respiratory distress syndrome, or sepsis] The method of the present invention for improving acute lung injury, acute respiratory distress syndrome, or sepsis comprises administering an effective amount of an HMGB1 expression regulator of the present invention, or an effective amount of a preventive or therapeutic agent for acute lung injury, acute respiratory distress syndrome, or sepsis of the present invention, to a subject who has developed acute lung injury, acute respiratory distress syndrome, or sepsis.
[0064] There are no particular limitations on the step of administering the HMGB1 expression regulator of the present invention to a subject who has developed acute lung injury, acute respiratory distress syndrome, or sepsis. The administration method may include spraying or inhalation into the oral cavity, nasal cavity or airway, drip, topical administration, nasal drops, etc., and preferably is less invasive. The local administration method is preferably injection. Also, electroporation is preferred, which applies a voltage (electric pulse) to the skin surface to temporarily open minute holes in the cell membrane, allowing the active ingredient to penetrate to the dermis layer, which cannot be reached by normal care. When administering locally, the administration may include intravenous administration, intraarterial administration, intraportal administration, intradermal administration, subcutaneous administration, intramuscular administration, intraperitoneal administration, etc., and intraarterial administration, intravenous administration, subcutaneous administration, or intraperitoneal administration is more preferred. Also, various formulation techniques can be used to change the in vivo distribution of microparticles.Many methods of changing in vivo distribution are known to those skilled in the art.Examples of such methods include, for example, protection of exosomes in vesicles composed of substances such as proteins, lipids (e.g., liposomes), carbohydrates or synthetic polymers. When administered to a subject who has developed acute lung injury, acute respiratory distress syndrome, or sepsis, the HMGB1 expression regulator of the present invention may circulate within the subject's body and reach a specific tissue. There are no particular limitations on the number of administrations and the administration interval. The number of administrations can be at least once a week, preferably at least 5 times, more preferably at least 6 times, and particularly preferably at least 7 times. The administration interval is preferably one hour to one week, more preferably half a day to one week, and particularly preferably one day (once a day). However, it can be appropriately adjusted depending on the organism species to be administered and the symptoms of the subject to be administered. The HMGB1 expression regulator of the present invention is preferably used for administering microparticles to a subject suffering from acute lung injury, acute respiratory distress syndrome, or sepsis at least once a week over the effective therapeutic period. When the subject is a human, the more frequent the administration per week, the more preferable, with administration at least five times a week over the effective therapeutic period being preferred, and daily administration being preferred. 2.0×10 9 When using a culture supernatant of dental pulp-derived stem cells at a concentration of 100 cells / ml, in a mouse model, the amount is preferably 0.1 to 5 ml per mouse (approximately 25 g), more preferably 0.3 to 3 ml, and even more preferably 0.5 to 1 ml. 0.1×10 8 When microparticles at a concentration of particles / μg are used, in a mouse model, the amount is preferably 1 to 50 μg per mouse (approximately 25 g), more preferably 3 to 30 μg, and even more preferably 5 to 25 μg. The preferred range of the dose per body weight for other animals can be calculated proportionally from the dose per body weight (about 25 g) for the model mouse, but can be adjusted appropriately depending on the symptoms of the subject.
[0065] There are no particular limitations on the animals (biological species) to which the HMGB1 expression regulator of the present invention is administered. The animals to which the HMGB1 expression regulator of the present invention is administered are preferably mammals, birds (chickens, quails, ducks, etc.), and fish (salmon, trout, tuna, bonito, etc.). The mammals may be either humans or non-human mammals, with humans being particularly preferred. The non-human mammals are more preferably cows, pigs, horses, goats, sheep, monkeys, dogs, cats, mice, rats, guinea pigs, and hamsters.
[0066] The HMGB1 expression regulator of the present invention may be used in combination with conventionally known therapeutic agents for acute lung injury, acute respiratory distress syndrome, or sepsis, specifically, for example, conventionally known steroids, immunosuppressants, biological agents (e.g., tricizumab, TNF inhibitors), antiplatelet agents, antihistamines / antiallergic agents, NSAIDs (nonsteroidal anti-inflammatory drugs), etc. EXAMPLES
[0067] The features of the present invention will be explained in more detail below with reference to examples and comparative examples or reference examples. The materials, amounts used, ratios, processing contents, processing procedures, etc. shown in the following examples can be appropriately changed without departing from the spirit of the present invention. Therefore, the scope of the present invention should not be interpreted as being limited by the specific examples shown below.
[0068] [Example 1] <Preparation of culture supernatant of dental pulp-derived stem cells> The culture supernatant of human deciduous dental pulp stem cells was prepared and separated according to the method described in Example 6 of Patent No. 6296622, except that DMEM medium was used instead of the DMEM / HamF12 mixed medium. In the primary culture, fetal bovine serum (FBS) was added and cultured, and in the subculture, the primary culture medium was used to culture the supernatant of the subculture medium so that it did not contain FBS, and the culture supernatant of deciduous dental pulp stem cells was prepared. Note that DMEM is Dulbecco's modified Eagle's medium, and F12 is Ham's F12 medium.
[0069] <Exosome preparation> Exosomes from dental pulp-derived stem cells were purified from the culture supernatant of the obtained dental pulp-derived stem cells using the following method. The culture supernatant (100 mL) of deciduous dental pulp stem cells was filtered through a 0.22 micrometer pore size filter, and the solution was centrifuged at 100,000 × g for 60 min at 4 ° C. The supernatant was decanted, and the exosome-enriched pellet was resuspended in phosphate-buffered saline (PBS). The resuspended sample was centrifuged at 100,000 × g for 60 min. The pellet was again collected from the bottom of the centrifuge tube as the concentrated sample (approximately 100 μl). Protein concentration was determined by a micro BSA protein assay kit (Pierce, Rockford, IL). The composition containing exosomes (concentrated solution) was stored at -80 ° C. A composition containing exosomes purified from the culture supernatant of dental pulp-derived stem cells was used as the expression regulator of Example 1 (microparticle composition sample).
[0070] The average particle size and concentration of the microparticles contained in the expression control agent of Example 1 were evaluated using a nanoparticle analysis system NanoSight (manufactured by Nippon Quantum Design Co., Ltd.). The microparticles contained in the expression regulator of Example 1 had an average particle size of 50 to 150 nm. The expression regulator of Example 1 was 1.0×10 9 A high-concentration exosome solution of 2.0×10 9 It was a highly concentrated exosome solution (cells / ml). In addition, the components of the expression regulator obtained in Example 1 were analyzed by a known method. As a result, it was found that the expression regulator in Example 1 does not contain stem cells derived from dental pulp, does not contain MCP-1, and does not contain Siglec 9. Therefore, it was found that the active ingredient of the expression regulator in Example 1 is an active ingredient different from MCP-1 and Siglec 9, which are active ingredients of the culture supernatant of mesenchymal stem cells, and their analogues.
[0071] [Comparative Example 1] <Preparation of culture supernatant of umbilical cord-derived stem cells> A culture supernatant of umbilical cord-derived stem cells was prepared in accordance with Example 1, except that human umbilical cord-derived stem cells were used instead of deciduous dental pulp stem cells, and a composition containing exosomes purified from umbilical cord-derived stem cells (microparticle composition of Comparative Example 1) was prepared.
[0072] [Test Example 1]: MicroRNA expressed in exosomes The small RNA contained in the microparticle composition of Example 1 was analyzed by next-generation sequencing (NGS). The NGS analysis identified 1,787 miRNAs contained in the microparticle composition of Example 1 (exosomes of dental pulp-derived stem cells). The results are shown in Table 1 below.
[0073] [Table 1]
[0074] [Test Case 2]: Search for disease-related microRNAs We searched for microRNAs related to diseases. IMOTA (Interactive Multi-Omics-Tissue Atlas) was used to extract miRNAs related to diseases. IMOTA is an interactive multi-omics atlas that can investigate the interactions and expression levels of miRNAs, mRNAs, and proteins in each tissue and cell (Nucleic Acids Research, Volume 46, Issue D1, 4 January 2018, Pages D770-D775, "IMOTA: an interactive multi-omics tissue atlas for the analysis of human miRNA-target interactions"). Here, we searched for microRNAs that control proteins and / or genes related to acute lung injury or sepsis, or microRNAs that control proteins and / or genes that are targets of therapeutic drugs. In this Test Example 2, we searched for miRNAs that target genes related to the expression of HMGB1.
[0075] The miRNAs expressed in exosomes purified from the culture supernatant of dental pulp-derived stem cells targeting genes related to HMGB1 expression were the following HMGB1-related miRNA group (78 types). HMGB1-related miRNAs: hsa-let-7b-5p、hsa-let-7e-5p、hsa-let-7g-5p、hsa-miR-100-5p、hsa-miR-103a-3p、hsa-miR-106b-5p、hsa-miR-107、hsa-miR-1179、hsa-miR-1183、hsa-miR-1236-3p、hsa-miR-1237-3p、hsa-miR-1247-3p、hsa-miR-129-5p、hsa-miR-1304-3p、hsa-miR-1307-3p、hsa-miR-141-3p、hsa-miR-142-3p、hsa-miR-142-5p、hsa-miR-145-5p、hsa-miR-148a-3p、hsa-miR-148b-3p、hsa-miR-150-5p、hsa-miR-17-5p、hsa-miR-181d-5p、hsa-miR-186-3p、hsa-miR-186-5p、hsa-miR-18a-3p、hsa-miR-1913、hsa-miR-193b-3p、hsa-miR-1976、hsa-miR-204-5p、hsa-miR-205-5p、hsa-miR-206、hsa-miR-20a-5p、hsa-miR-20b-5p、hsa-miR-211-5p、hsa-miR-212-5p、hsa-miR-218-5p、hsa-miR-22-3p、hsa-miR-24-3p、hsa-miR-26b-5p、hsa-miR-300、hsa-miR-302c-3p、hsa-miR-324-3p、hsa-miR-328-3p、hsa-miR-329-3p、hsa-miR-340-5p、hsa-miR-34a-5p、hsa-miR-362-3p、hsa-miR-373-3p、hsa-miR-381-3p、hsa-miR-410-3p、hsa-miR-4275、hsa-miR-4284、hsa-miR-4324、hsa-miR-4460、hsa-miR-4532、hsa-miR-4638-5p、hsa-miR-4673、hsa-miR-4691-5p、hsa-miR-4707-3p、hsa-miR-4727-3p、hsa-miR-4793-5p、hsa-miR-495-3p、hsa-miR-505-3p、hsa-miR-512-3p、hsa-miR-5193、hsa-miR-5196-3p、hsa-miR-520a-3p, hsa-miR-520d-3p, hsa-miR-520h, hsa-miR-539-3p, hsa-miR-582-5 p, hsa-miR-652-3p, hsa-miR-660-3p, hsa-miR-665, hsa-miR-92a-3p, hsa-miR-93-5p. , Therefore, it was found that the expression regulator of the present invention can be used as an expression regulator of HMGB1.
[0076] The results of comparing the expression levels of miRNAs expressed in exosomes of dental pulp-derived stem cells are shown in the heat map in Figure 1. The concentration in the heat map is shown as the log ratio of the read count value.
[0077] 1, it was found that the expression inhibitor of the present invention contains a high concentration of HMGB1-related miRNA. Therefore, the expression inhibitor of the present invention can control the expression of HMGB1 and / or the HMGB1 gene (Hmgb1).
[0078] [Test Example 3]: Confirmation of inhibition of HMGB1 expression Using a vasculitis model of human umbilical vein endothelial cells (HUVEC), inhibition of HMGB1 expression was confirmed by the following method. After seeding, the HUVEC cells were cultured for 18 hours at 37°C and 5% CO. Then, the HUVEC cells were sealed in a BBL GasPakTM anaerobic system (Becton Dickinson Microbiology Systems, Cockeysville, MD, USA) and cultured in low oxygen for 24 hours, resulting in an oxygen concentration of 2% in the culture environment of the HUVEC cells. 24 hours later, the expression control agent of Example 1 (exosomes purified from dental pulp-derived stem cells) or the microparticle composition prepared in Comparative Example 1 (exosomes purified from umbilical cord-derived stem cells) was administered at 10,000 exosomes per HUVEC cell. After 48 hours, the expression level of the HMGB1 gene was quantified by qPCR using the following primer set. HMGB1: HMG1(HMGB1) Human qPCR Primer Pair (NM_002128) GCGAAGAAACTGGGAGAGATGTG / GCATCAGGCTTTCCTTTAGCTCG
[0079] [Reference Example 1]: Low oxygen untreated The HMGB1 gene expression level was quantified by qPCR in the same manner as in Example 1, except that the 24-hour hypoxic culture of HUVEC cells was replaced with 24-hour culture at 37°C and 5% CO and no microparticle composition was added.
[0080] [Reference Example 2]: No microparticles after low-oxygen culture The expression level of the HMGB1 gene was quantified by qPCR in the same manner as in Example 1, except that the microparticle composition was not added.
[0081] Fig. 2 is a graph showing the amount of HMGB1 gene expression quantified in each example. Fig. 2 shows that the HMGB1 expression inhibitor of the present invention can significantly suppress the amount of HMGB1 gene expression.
Claims
1. An HMGB1 expression inhibitor, The expression inhibitor comprises fine particles, The aforementioned microparticles contain miRNAs that target genes related to HMGB1 expression. An HMGB1 expression inhibitor.
2. The HMGB1 expression inhibitor according to claim 1, wherein the microparticles are exosomes.
3. The HMGB1 expression inhibitor according to claim 1, wherein the miRNA targeting the gene related to HMGB1 expression includes at least one from the following HMGB1-related miRNA group. HMGB1-related miRNA group: hsa-let-7b-5p、hsa-let-7e-5p、hsa-let-7g-5p、hsa-miR-100-5p、hsa-miR-103a-3p、hsa-miR-106b-5p、hsa-miR-107、hsa-miR-1179、hsa-miR-1183、hsa-miR-1236-3p、hsa-miR-1237-3p、hsa-miR-1247-3p、hsa-miR-129-5p、hsa-miR-1304-3p、hsa-miR-1307-3p、hsa-miR-141-3p、hsa-miR-142-3p、hsa-miR-142-5p、hsa-miR-145-5p、hsa-miR-148a-3p、hsa-miR-148b-3p、hsa-miR-150-5p、hsa-miR-17-5p、hsa-miR-181d-5p、hsa-miR-186-3p、hsa-miR-186-5p、hsa-miR-18a-3p、hsa-miR-1913、hsa-miR-193b-3p、hsa-miR-1976、hsa-miR-204-5p、hsa-miR-205-5p、hsa-miR-206、hsa-miR-20a-5p、hsa-miR-20b-5p、hsa-miR-211-5p、hsa-miR-212-5p、hsa-miR-218-5p、hsa-miR-22-3p、hsa-miR-24-3p、hsa-miR-26b-5p、hsa-miR-300、hsa-miR-302c-3p、hsa-miR-324-3p、hsa-miR-328-3p、hsa-miR-329-3p、hsa-miR-340-5p、hsa-miR-34a-5p、hsa-miR-362-3p、hsa-miR-373-3p、hsa-miR-381-3p、hsa-miR-410-3p、hsa-miR-4275、hsa-miR-4284、hsa-miR-4324、hsa-miR-4460、hsa-miR-4532、hsa-miR-4638-5p、hsa-miR-4673、hsa-miR-4691-5p、hsa-miR-4707-3p、hsa-miR-4727-3p、hsa-miR-4793-5p、hsa-miR-495-3p、hsa-miR-505-3p、hsa-miR-512-3p、hsa-miR-5193、hsa-miR-5196-3p、hsa-miR-520a-3p, hsa-miR-520d-3p, hsa-miR-520h, hsa-miR-539-3p, hsa-miR-582-5p, hsa-miR-652-3p, hsa-miR-660-3p, hsa-miR-665, hsa-miR-92a-3p, hsa-miR-93-5p.
4. The HMGB1 expression inhibitor according to claim 1, wherein the miRNA targeting the gene related to HMGB1 expression comprises at least one of hsa-let-7b-5p, hsa-miR-100-5p, hsa-miR-129-5p, hsa-miR-142-3p, hsa-miR-22-3p, hsa-miR-34a-5p, and hsa-miR-92a-3p.
5. The HMGB1 expression inhibitor according to claim 1, wherein the miRNA targeting the gene related to HMGB1 expression comprises at least hsa-let-7b-5p.
6. The HMGB1 expression inhibitor according to claim 1, wherein the fine particles contain miRNA targeting a gene related to HMGB1 expression at a higher concentration than the culture supernatant of dental pulp-derived stem cells.
7. The aforementioned fine particles are fine particles purified and isolated from the culture supernatant of dental pulp-derived stem cells. The HMGB1 expression inhibitor according to claim 1, wherein the fine particles do not contain the components obtained by removing the exosomes from the culture supernatant of the dental pulp-derived stem cells.
8. A prophylactic or therapeutic agent for acute lung injury, acute respiratory distress syndrome, or sepsis, comprising the HMGB1 expression inhibitor described in claim 1 as an active ingredient.
9. A method for improving acute lung injury, acute respiratory distress syndrome, or sepsis, comprising administering an effective amount of the HMGB1 expression inhibitor described in claim 1, or an effective amount of the prophylactic or therapeutic agent for acute lung injury, acute respiratory distress syndrome, or sepsis described in claim 8, to a subject who has developed acute lung injury, acute respiratory distress syndrome, or sepsis.