Compounds and methods for modulating UBE3a-ats

Abstract

To provide compounds, methods and pharmaceutical compositions for treating neurogenetic diseases such as Angelman Syndrome (AS).SOLUTION: The disclosure provides a compound, a method and a pharmaceutical composition for reducing the amount or activity of UBE3A-ATS, an endogenous antisense transcript of ubiquitin protein ligase E3A (UBE3A), in a cell or subject, and in certain cases, for increasing the expression of paternal UBE3A and the amount of UBE3A protein in a cell or subject. Such a compound, method, and pharmaceutical composition are useful to ameliorate at least one symptom or hallmark of a neurogenetic disorder. Such symptoms and hallmarks include developmental delays, ataxia, speech impairment, sleep problems, seizures, and EEG abnormalities. Such neurogenetic disorders include Angelman Syndrome.SELECTED DRAWING: None

Description

[Technical field]

[0001] Sequence Listing This application has been filed in electronic format with a Sequence Listing, which is provided as a file with the filename BIOL0349WOSEQ_ST25.tst, created on March 16, 2020, and having a size of 1.87 MB. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

[0002] Compounds, methods, and pharmaceutical compositions are provided for reducing the amount or activity of UBE3A-ATS, an endogenous antisense transcript of Ubiquitin Protein Ligase E3A (UBE3A), in a cell or subject, and in certain cases for increasing the expression of paternally derived UBE3A and the amount of UBE3A protein in a cell or subject. Such compounds, methods, and pharmaceutical compositions are useful for improving at least one symptom or characteristic of a neurogenetic disease. Such symptoms and characteristics include developmental delay, ataxia, speech disorder, sleep disorder, seizures, and EEG abnormalities. Such neurogenetic diseases include Angelman syndrome. [Background technology]

[0003] Angelman syndrome (AS) is a developmental disorder that affects approximately 1 / 15,000 live births and is caused by a deficiency in ubiquitin protein ligase E3A (UBE3A). Of the two copies of the UBE3A gene in neurons, the maternally inherited one is normally expressed, while the paternally inherited one is subject to genetic imprinting and silencing. Angelman syndrome occurs when a functional copy of the UBE3A gene is not inherited from the mother due to either a mutation, deletion, paternal uniparental disomy, or an imprinting defect on chromosome 15. See Buiting,et al.,“Angelman Syndrome-insights into a rare neurogenetic disorder”,Nature Rev.Neuro.,2016,12:584-593.

[0004] Patients with Angelman syndrome experience developmental delays and speech impairments, and commonly experience sleep disorders, seizures, and EEG abnormalities. The disorder is usually diagnosed in the first few years of life, and genetic testing can confirm the diagnosis. However, treatments for Angelman syndrome are limited and primarily focused on symptomatic treatments. See Williams, CA et al., Genet. Med., 12:385-395, 2010.

[0005] Recently, topoisomerase inhibitors currently used in cancer therapy have been found to "unsilence" paternally inherited UBE3A expression in both neuronal cell cultures and mice. See Huang, H. et al., Nature, 481:185-189, 2012. However, the exact mechanism by which paternally inherited UBE3A expression is unsilenced, and topoisomerase inhibitors are nonspecific and are known to induce DNA damage, such as single- and double-strand breaks, raising safety concerns.

[0006] There are currently no acceptable options for the treatment of neurogenetic diseases such as AS. It is therefore an object of the present invention to provide compounds, methods and pharmaceutical compositions for the treatment of such diseases. Summary of the Invention

[0007] Provided herein are compounds for reducing the amount or activity of UBE3A-ATS RNA. The present invention provides compounds, methods, and pharmaceutical compositions, and in certain embodiments, compounds, methods, and pharmaceutical compositions that increase expression of paternally derived UBE3A RNA or protein in a cell or a subject. In certain embodiments, the subject has a neurogenetic disease. In certain embodiments, the subject has Angelman Syndrome (AS). In certain embodiments, the subject has UBE3A-ATS. The compound useful for reducing the expression of RNA or a part thereof is an oligomeric compound. In certain embodiments, the compound useful for reducing the expression of UBE3A-ATS RNA or a part thereof is a modified oligonucleotide. In certain embodiments, the compound useful for increasing the expression of paternally derived UBE3A RNA or a protein thereof is an oligomeric compound. In certain embodiments, the compound useful for increasing the expression of paternally derived UBE3A RNA or a protein thereof is a modified oligonucleotide.

[0008] Also provided is a method useful for improving at least one symptom or characteristic of a neurogenetic disease. In certain embodiments, the neurogenetic disease is Angelman syndrome. In certain embodiments, the symptom or characteristic comprises developmental delay, ataxia, speech disorder, sleep disorder, seizures, and / or EEG abnormalities. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0009] It should be understood that both the general description above and the detailed description below are merely exemplary and explanatory, and not limiting. In this specification, the use of the singular includes the plural, unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless expressly stated otherwise. Furthermore, the use of the term "including" and other forms such as "includes" and "included" is not limiting. Furthermore, terms such as "element" or "component" include both elements and components that include one unit and elements and components that include two or more subunits, unless expressly stated otherwise.

[0010] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter of the invention described. All documents or portions of documents cited in this application, including but not limited to patents, patent applications, articles, books, and papers, are expressly incorporated herein by reference in their entirety with respect to the portions of the documents discussed herein.

[0011] definition Unless specific definitions are given, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, patent applications, published patent applications, and other publications and other data referenced throughout this disclosure are incorporated herein by reference in their entirety.

[0012] Unless otherwise indicated, the following terms have the following meanings.

[0013] definition As used herein, "2'-deoxynucleoside" refers to a nucleoside that includes a 2'-H(H) deoxyribosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside and includes a 2'-β-D-deoxyribosyl sugar moiety having a β-D configuration as found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside may include a modified nucleobase or may include an RNA nucleobase (e.g., uracil).

[0014] As used herein, "2'-MOE" or "2'-MOE sugar moiety" means a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. As used herein, "MOE" means methoxyethyl. Unless otherwise specified, 2'-MOE has a β-D stereochemical configuration.

[0015] As used herein, "2'-MOE nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety.

[0016] As used herein, "2'-OMe" or "2'-O-methyl sugar moiety" means a 2'-OCH group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise specified, 2'-OMe has a β-D stereochemical configuration.

[0017] As used herein, "2'-OMe nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.

[0018] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted sugar moiety. As used herein with respect to the sugar moiety, "2'-substituted" refers to a sugar moiety that includes at least one 2'-substituent group other than H or OH.

[0019] As used herein, "5-methylcytosine" means a cytosine modified with a methyl group attached to position 5. 5-methylcytosine is a modified nucleobase.

[0020] As used herein, "administering" means giving a pharmaceutical agent to a subject.

[0021] As used herein, "antisense activity" refers to any detectable and / or measurable change resulting from hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid, compared to the target nucleic acid level or target protein level in the absence of the antisense compound.

[0022] As used herein, "antisense compound" means an oligomeric compound capable of obtaining at least one antisense activity.

[0023] As used herein with respect to treatment, "ameliorate" refers to an improvement in at least one symptom compared to the same symptom in the absence of treatment. In certain embodiments, the improvement is a reduction in the severity or frequency of the symptom, or a delay in the onset or progression of the severity or frequency of the symptom. In certain embodiments, the symptom or characteristic includes developmental delay, ataxia, speech disorder, sleep disorder, seizures, and EEG abnormalities.

[0024] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.

[0025] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety having two rings, the second ring being formed via a bridge connecting two of the atoms to form a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not include a furanosyl moiety.

[0026] As used herein, "cleavable moiety" means a bond or group that is cleaved under physiological conditions, e.g., inside a cell, a subject, or a human.

[0027] As used herein with respect to oligonucleotides, "complementary" means that at least 70% of the nucleobases of the oligonucleotide or one or more regions thereof and the target nucleic acid or one or more regions thereof can hydrogen bond with each other when the nucleobase sequences of the oligonucleotide and the other nucleic acid are aligned in reverse orientation. As used herein, complementary nucleobases refer to nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G). Complementary oligonucleotides and / or target nucleic acids need not have complementary nucleobases at each nucleoside. Rather, some mismatches are allowed. As used herein with respect to an oligonucleotide or portion thereof, "fully complementary" or "100% complementary" means that an oligonucleotide or portion thereof is complementary to another oligonucleotide or target nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.

[0028] As used herein, "conjugate group" refers to a group of atoms directly or indirectly attached to an oligonucleotide. Conjugate groups include conjugate moieties and conjugate linkers that attach the conjugate moieties to the oligonucleotide.

[0029] As used herein, "conjugate linker" refers to a group of atoms that includes at least one bond that connects, for example, a conjugate group with an oligonucleotide.

[0030] As used herein, "conjugate moiety" means a group of atoms attached to an oligonucleotide via a conjugate linker.

[0031] As used herein in the context of oligonucleotides, "contiguous" refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to one another. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to one another in a sequence.

[0032] As used herein, "constrained ethyl" or "cEt" or "cEt modified sugar moiety" means a β-D ribosyl bicyclic sugar moiety in which the second ring of the bicyclic sugar is formed by a bridge connecting the 4' and 2' carbons of the β-D ribosyl sugar moiety, the bridge having the formula: 4'-CH(CH3)-O-2', and the methyl group of the bridge is in the S configuration.

[0033] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt modified sugar moiety.

[0034] As used herein, "chiral enriched population" refers to a plurality of molecules of the same molecular formula, in which the number or ratio of molecules in the population having a particular stereochemical configuration at a particular chiral center is greater than the number or ratio of molecules expected to have the same particular stereochemical configuration at the same particular chiral center in the population if that particular chiral center is stereorandom. A chiral enriched population of molecules having multiple chiral centers within each molecule can include one or more stereorandom chiral centers. In certain embodiments, the molecule is a modified oligonucleotide. In certain embodiments, the molecule is a compound that includes a modified oligonucleotide compound.

[0035] As used herein, a "gapmer" refers to a modified oligonucleotide having an internal region having multiple nucleosides that support RNase H cleavage, located between external regions having one or more nucleosides, where the nucleosides that make up the internal region are chemically distinct from one or more nucleosides that make up the external regions. The internal region may be referred to as a "gap" and the external regions may be referred to as "wings." Unless otherwise indicated, a "gapmer" refers to a sugar motif. Unless otherwise indicated, the sugar moiety of each nucleoside of the gap is a 2'-β-D-deoxyribosyl sugar moiety. Thus, the term "MOE gapmer" refers to a gapmer that comprises a gap consisting of 2'-β-D-deoxynucleosides and wings that include 2'-MOE nucleosides. Unless otherwise indicated, a MOE gapmer may contain one or more modified internucleoside linkages and / or modified nucleobases, although such modifications do not necessarily follow a gapmer pattern of sugar modifications.

[0036] As used herein, a "hot spot region" is a range of nucleobases on a target nucleic acid that is susceptible to oligomeric compound-mediated reduction in the amount or activity of the target nucleic acid.

[0037] As used herein, "hybridization" refers to the pairing or annealing of complementary oligonucleotides and / or nucleic acids. Although not limited to a particular mechanism, the most common hybridization mechanism involves hydrogen bonding, which can be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding between complementary nucleobases.

[0038] As used herein, "internucleoside bond" refers to a covalent bond between consecutive nucleosides in an oligonucleotide.As used herein, "modified internucleoside bond" refers to any internucleoside bond other than a phosphodiester internucleoside bond.A "phosphorothioate internucleoside bond" is a modified internucleoside bond in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside bond is replaced with a sulfur atom.

[0039] As used herein, "linker nucleoside" refers to a nucleoside that directly or indirectly connects an oligonucleotide to a conjugate moiety. The linker nucleoside is located within the conjugate linker of an oligomeric compound. The linker nucleoside is not considered to be part of the oligonucleotide moiety of an oligomeric compound, even if it is adjacent to the oligonucleotide.

[0040] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety having modifications, such as substituents, that do not form a bridge between two atoms of the sugar to form a second ring.

[0041] As used herein, "mismatch" or "non-complementary" means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligomeric compounds are aligned.

[0042] As used herein, a "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0043] As used herein, "neurogenetic disease" means a condition of the nervous system caused by inherited genetic factors, including, but not limited to, mutations, deletions, uniparental disomy, or imprinting defects.

[0044] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. As used herein, "unmodified nucleobase" includes adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, "modified nucleobase" is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-methylcytosine" is one of the modified nucleobases. A universal base is a nucleobase that can pair with any one of the five unmodified nucleobases. As used herein, "nucleobase sequence" refers to the order of consecutive nucleobases in a target nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkage modifications.

[0045] As used herein, "nucleoside" refers to a compound that includes a nucleobase and a sugar moiety. The nucleobase and sugar moieties are each independently unmodified or modified. As used herein, "modified nucleoside" refers to a nucleoside that includes a modified nucleobase and / or a modified sugar moiety. Modified nucleosides include abasic nucleosides that do not include a nucleobase. As used herein, "linked nucleosides" are nucleosides that are linked in a contiguous sequence (i.e., there are no additional nucleosides between the linked nucleosides).

[0046] As used herein, "oligomeric compound" refers to an oligonucleotide and optionally one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound may or may not be paired with a second oligomeric compound that is complementary to the first oligomeric compound. A "single-stranded oligomeric compound" is an unpaired oligomeric compound. The term "oligomeric duplex" refers to a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a "double-stranded oligomeric compound".

[0047] As used herein, "oligonucleotide" refers to a chain of linked nucleosides linked via internucleoside linkages, where each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise indicated, an oligonucleotide is composed of 8-50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modifications.

[0048] As used herein, "pharmaceutical acceptable carriers or diluents" refers to any substance suitable for use in administration to animals. Certain such carriers allow the pharmaceutical composition to be formulated, for example, as pills, tablets, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutical acceptable carriers or diluents are sterile water, sterile saline, sterile buffer, or sterile artificial cerebrospinal fluid.

[0049] As used herein, "pharmaceutically acceptable salts" refers to physiologically and pharma- ceutically acceptable salts of a compound that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects to the parent compound.

[0050] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition can include an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in a particular cell line.

[0051] As used herein, "prodrug" refers to an ex vivo form of a therapeutic agent that is converted to a different form within a subject or its cells. Typically, conversion of the prodrug within the subject is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in the cells or tissues and / or by physiological conditions.

[0052] As used herein, "reducing or inhibiting the amount or activity," "reducing the amount or activity," or "inhibiting the amount or activity" refers to a reduction or blocking of transcriptional expression or activity compared to transcriptional expression or activity in an untreated or control sample, and does not necessarily indicate a complete loss of transcriptional expression or activity.

[0053] As used herein, "RNA" refers to any RNA transcript, including endogenous antisense transcripts (e.g., UBE3A-ATS) that do not code for proteins, and includes pre-mRNA and mature mRNA, unless otherwise specified.

[0054] As used herein, "RNAi compounds" refers to antisense compounds that act, at least in part, through RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi compounds include, but are not limited to, double-stranded siRNAs, single-stranded RNAs (ssRNAs), and microRNAs, including microRNA mimics. In certain embodiments, RNAi compounds regulate the amount, activity, and / or splicing of a target nucleic acid. The term RNAi compounds excludes antisense compounds that act through RNaseH.

[0055] As used herein with respect to oligonucleotides, "self-complementary" means an oligonucleotide that at least partially hybridizes to itself.

[0056] As used herein, "standard cellular assay" refers to the assay described in Example 1 and reasonable modifications thereof.

[0057] As used herein in the context of a population of molecules of the same molecular formula, a "stereorandom chiral center" refers to a chiral center that has a random stereochemical configuration. For example, in a population of molecules that includes stereorandom chiral centers, the number of molecules that have stereorandom chiral centers in the (S) configuration may be, but is not necessarily, the same as the number of molecules that have stereorandom chiral centers in the (R) configuration. The stereochemical configuration of a chiral center is considered random when it is the result of a synthetic method that is not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is a stereorandom phosphorothioate internucleoside linkage.

[0058] As used herein, "subject" means a human or non-human animal.

[0059] As used herein, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H)β-D-ribosyl moiety as found in RNA (an "unmodified RNA sugar moiety"), or a 2'-H(H)β-D-deoxyribosyl sugar moiety as found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, one oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.

[0060] As used herein, "sugar surrogate" refers to a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as, for example, an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide. Osides can be incorporated at one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to a complementary oligomeric compound or to a target nucleic acid.

[0061] As used herein, "symptom or characteristic" refers to any physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptom is evident to the subject or a medical professional examining or testing said subject. In certain embodiments, the characteristic is evident by invasive diagnostic testing, including but not limited to post-mortem examination.

[0062] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid which an antisense compound is designed to affect.

[0063] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0064] As used herein, "terminal group" means a chemical group or group of atoms that is covalently attached to the end of an oligonucleotide.

[0065] As used herein, a "therapeutically effective amount" refers to an amount of an agent that confers a therapeutic effect on a subject, e.g., ameliorates a symptom or characteristic of a disease.

[0066] Specific Embodiments The present disclosure provides the following non-limiting numbered embodiments:

[0067] Embodiment 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of said modified oligonucleotide is at least 90% complementary to an equal length portion of UBE3A-ATS RNA, and said modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage.

[0068] Embodiment 2. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, 18, 19, or 20 consecutive nucleobases of any of SEQ ID NOs: 17-2762, 2786-2863, 2872-2904.

[0069] Embodiment 3. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 12, 13, 14, 15, 16, 17, or 18 consecutive nucleobases of any of SEQ ID NOs: 2763-2785 or 2864-2871.

[0070] Embodiment 4. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 contiguous nucleobases that are complementary to an equal length portion of nucleobases 461,413 to 461,487 of SEQ ID NO:1, an equal length portion of nucleobases 468,968 to 469,013 of SEQ ID NO:1, or an equal length portion of nucleobases 483,965 to 484,003 of SEQ ID NO:1.

[0071] Embodiment 5. The compound comprises 12 to 30 linked nucleosides, SEQ ID NOs: 1053, 1329, 1501, 1576, 1873, 1949, 2025, 2096, 2245, 2512, 2591, 2680 to 2682, and 2844, SEQ ID NO: 376, 377, 2751-2756, 2773-2776, 2872, 2873, 2876-2878, or An oligomeric compound comprising a modified oligonucleotide having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleobases of a sequence selected from SEQ ID NOs: 172, 764-770, 995, 1445, 1668, 1743, 2255, 2595, and 2762-2767.

[0072] Embodiment 6. The oligomeric compound of any of embodiments 1-5, wherein the modified oligonucleotide has a nucleobase sequence that is at least 80%, 85%, 90%, 95%, or 100% complementary to the nucleobase sequence of SEQ ID NO:1, SEQ ID NO:2915, or SEQ ID NO:2916 when measured across the entire nucleobase sequence of the modified oligonucleotide.

[0073] Embodiment 7. The oligomeric compound according to any one of embodiments 1 to 6, wherein said modified oligonucleotide comprises at least one modified nucleoside.

[0074] Embodiment 8. The oligomeric compound of embodiment 7, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a modified sugar moiety.

[0075] Embodiment 9. The oligomeric compound of embodiment 8, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety.

[0076] Embodiment 10. The oligomeric compound of embodiment 9, wherein the modified oligonucleotide comprises at least one modified nucleoside comprising a bicyclic sugar moiety having a 2'-4' bridge, wherein the 2'-4' bridge is selected from -O-CH2- and -O-CH(CH3)-.

[0077] Embodiment 11. The oligomeric compound of any of embodiments 7 to 10, wherein the modified oligonucleotide comprises at least one modified nucleoside that comprises a non-bicyclic modified sugar moiety.

[0078] Embodiment 12 The oligomeric compound of embodiment 11, wherein said non-bicyclic modified sugar moiety is a 2'-MOE or a 2'-OMe modified sugar moiety.

[0079] Embodiment 13 The oligomeric compound of embodiment 7 or 8, wherein said modified oligonucleotide comprises at least one modified nucleoside that comprises a sugar surrogate.

[0080] Embodiment 14. The oligomeric compound of embodiment 13, wherein said modified oligonucleotide comprises at least one modified nucleoside comprising a sugar surrogate selected from morpholino and PNA.

[0081] Embodiment 15. The oligomeric compound of any one of embodiments 1-8 or 11-14, wherein the modified oligonucleotide does not contain a bicyclic sugar moiety.

[0082] Embodiment 16. The modified oligonucleotide of any one of embodiments 1 to 15 is a gapmer. 2. The oligomeric compound according to claim 1 .

[0083] Embodiment 17. The modified oligonucleotide comprises: a 5' region consisting of 1 to 6 linked 5' region nucleosides; a central region consisting of 6 to 10 linked central region nucleosides; a 3' region consisting of 1 to 6 linked 3' region nucleosides; 17. The oligomeric compound of any of embodiments 1-16, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0084] Embodiment 18. The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of five linked 3' region nucleosides; The oligomeric compound of embodiment 17, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprises a 2'-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0085] Embodiment 19. The modified oligonucleotide comprises: a 5' region consisting of four linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of six linked 3' region nucleosides; The oligomeric compound of embodiment 17, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprise a 2'-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0086] Embodiment 20. The modified oligonucleotide comprises: a 5' region consisting of six linked 5' region nucleosides; a central region consisting of 10 linked central region nucleosides; a 3' region consisting of four linked 3' region nucleosides; The oligomeric compound of embodiment 17, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprise a 2'-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0087] Embodiment 21. The modified oligonucleotide comprises: a 5' region consisting of five linked 5' region nucleosides; a central region consisting of eight linked central region nucleosides; a 3' region consisting of five linked 3' region nucleosides; The oligomeric compound of embodiment 17, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprise a 2'-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0088] Embodiment 22. The modified oligonucleotide comprises: a 5' region consisting of four linked 5' region nucleosides; a central region consisting of eight linked central region nucleosides; a 3' region consisting of six linked 3' region nucleosides; The oligomeric compound of embodiment 17, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprise a 2'-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0089] Embodiment 23. The modified oligonucleotide comprises: a 5' region consisting of four linked 5' region nucleosides; a central region consisting of eight linked central region nucleosides; a 3' region consisting of six linked 3' region nucleosides; The oligomeric compound of embodiment 17, wherein each of the 5' region nucleosides and each of the 3' region nucleosides comprise a 2'-MOE modified sugar moiety, and each of the central region nucleosides comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0090] Embodiment 24. The oligomeric compound of any one of embodiments 1 to 23, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0091] Embodiment 25. The oligomeric compound of embodiment 24, wherein each internucleoside linkage of said modified oligonucleotide is a modified internucleoside linkage.

[0092] Embodiment 26 The oligomeric compound of embodiment 24 or 25, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0093] Embodiment 27. The oligomeric compound of embodiment 24 or 26, wherein the modified oligonucleotide comprises at least one phosphodiester internucleoside linkage.

[0094] Embodiment 28. The oligomeric compound of any of embodiments 24, 26, or 27, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage or a phosphorothioate internucleoside linkage.

[0095] Embodiment 29. The modified oligonucleotide has an internucleoside linkage motif selected from among: sooooossssssssssss, soooooosssssssssss, sooooossssssssss, soooosssssssssss, soooosssssssssss, soooosssssssssss, or sooosssssssssss, provided that: The oligomeric compound according to embodiments 1-24 or 27-28, wherein s is a phosphorothioate internucleoside linkage and o is a phosphodiester internucleoside linkage.

[0096] Embodiment 30. The oligomeric compound of any one of embodiments 1 to 29, wherein the modified oligonucleotide comprises a modified nucleobase.

[0097] Embodiment 31 The oligomeric compound of embodiment 30, wherein the modified nucleobase is 5-methylcytosine.

[0098] Embodiment 32. The oligomeric compound of any one of embodiments 1 to 31, wherein the modified oligonucleotide consists of 12 to 30, 12 to 22, 12 to 20, 14 to 18, 14 to 20, 15 to 17, 15 to 25, 16 to 20, 18 to 22, or 18 to 20 linked nucleosides.

[0099] Embodiment 33. The oligomeric compound of any one of embodiments 1 to 32, wherein the modified oligonucleotide consists of 18 linked nucleosides.

[0100] Embodiment 34. The oligomeric compound of any one of embodiments 1-2, 4, or 6-32, wherein the modified oligonucleotide consists of 20 linked nucleosides.

[0101] Embodiment 35. The oligomeric compound according to any one of embodiments 1 to 34, which consists of the modified oligonucleotide.

[0102] Embodiment 36. The oligomeric compound of any of embodiments 1-34, comprising a conjugate group comprising a conjugate moiety and a conjugate linker.

[0103] Embodiment 37. The oligomeric compound of embodiment 36, wherein the conjugate linker consists of a single bond.

[0104] Embodiment 38 The oligomeric compound of embodiment 36, wherein the conjugate linker is cleavable.

[0105] Embodiment 39. The oligomeric compound of embodiment 36, wherein the conjugate linker comprises 1 to 3 linker nucleosides.

[0106] Embodiment 40. The oligomeric compound of any of embodiments 36-39, wherein the conjugate group is attached to the modified oligonucleotide at the 5' end of the modified oligonucleotide.

[0107] Embodiment 41. The oligomeric compound of any of embodiments 36-39, wherein the conjugate group is attached to the modified oligonucleotide at the 3' end of the modified oligonucleotide.

[0108] Embodiment 42. The oligomeric compound of any one of embodiments 1-34 or 36-41, comprising a terminal group.

[0109] Embodiment 43. The oligomeric compound of any one of embodiments 1 to 42, wherein the oligomeric compound is a single-stranded oligomeric compound.

[0110] Embodiment 44. The oligomeric compound of any one of embodiments 1-38 or 40-43, wherein the oligomeric compound does not comprise a linker nucleoside.

[0111] Embodiment 45. An oligomeric duplex comprising an oligomeric compound according to any one of embodiments 1-42 or 44.

[0112] Embodiment 46. An antisense compound comprising or consisting of an oligomeric compound according to any one of embodiments 1-44, or an oligomeric duplex according to embodiment 45.

[0113] Embodiment 47. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 1-44, or an oligomeric duplex according to embodiment 45, and a pharma- ceutically acceptable carrier or diluent.

[0114] Embodiment 48. The pharmaceutical composition of embodiment 47, wherein the pharma- ceutical acceptable diluent is artificial cerebrospinal fluid.

[0115] Embodiment 49. The pharmaceutical composition of embodiment 48, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide and phosphate buffered saline.

[0116] Embodiment 50. The pharmaceutical composition according to any one of embodiments 47 to 50 is administered to a subject. The method includes:

[0117] Embodiment 51. A method for treating a disease associated with UBE3A-ATS, comprising administering to an individual having or at risk of developing a disease associated with UBE3A-ATS a therapeutically effective amount of a pharmaceutical composition according to any one of embodiments 47 to 49, thereby treating said disease associated with UBE3A-ATS.

[0118] Embodiment 52 The method of embodiment 51, wherein the UBE3A-ATS associated disease is Angelman syndrome.

[0119] Embodiment 53. The method of any one of embodiments 50-52, wherein at least one symptom or feature of the UBE3A-ATS associated disease is ameliorated.

[0120] Embodiment 54 The method of embodiment 53, wherein the symptom or characteristic is developmental delay, ataxia, speech disorder, sleep disorder, seizures, or EEG abnormalities.

[0121] Embodiment 55. A modified oligonucleotide based on the following chemical structure: [ka] (Sequence 1949), or a salt thereof.

[0122] Embodiment 56. A modified oligonucleotide based on the following chemical structure: [ka] (Sequence number 1949).

[0123] Embodiment 57. A modified oligonucleotide based on the following chemical structure: [ka] (Sequence 2751), or a salt thereof.

[0124] Embodiment 58. A modified oligonucleotide based on the following chemical structure: [ka] (Sequence number 2751).

[0125] Embodiment 59. A modified oligonucleotide based on the following chemical structure: [ka] (SEQ ID NO: 2752), or a salt thereof.

[0126] Embodiment 60. A modified oligonucleotide corresponding to the following chemical structure: [ka] (Sequence number 2752).

[0127] Embodiment 61. A modified oligonucleotide based on the following chemical structure: [ka] (SEQ ID NO: 765), or a salt thereof.

[0128] Embodiment 62. A modified oligonucleotide based on the following chemical structure: [ka] (Sequence number 765).

[0129] Embodiment 63. A modified oligonucleotide based on the following chemical structure: [ka] (SEQ ID NO: 2866), or a salt thereof.

[0130] Embodiment 64. A modified oligonucleotide based on the following chemical structure: [ka] (Sequence number 2866).

[0131] Embodiment 65. A modified oligonucleotide based on the following chemical structure: [ka] (SEQ ID NO: 2873), or a salt thereof.

[0132] Embodiment 66. A modified oligonucleotide based on the following chemical structure: [ka] (Sequence number 2873).

[0133] Embodiment 67. The modified oligonucleotide of any of embodiments 55, 57, 59, 61, 63, or 65, which is a sodium salt of the chemical structure.

[0134] Embodiment 68. A pharmaceutical composition comprising the modified oligonucleotide of any one of embodiments 55 to 67 and a pharma- ceutically acceptable carrier or diluent.

[0135] Embodiment 69. The pharmaceutical composition of embodiment 68, wherein the pharma- ceutical acceptable diluent is artificial cerebrospinal fluid.

[0136] Embodiment 70 The pharmaceutical composition of embodiment 69, consisting essentially of the modified oligonucleotide and artificial cerebrospinal fluid.

[0137] Embodiment 71. A compound having the following chemical representation: m C es A eo T eo m C eo A eo T ds G ds A ds T ds m C ds T ds T ds G ds G ds T ds A eo A eo G es G es m C e A modified oligonucleotide based on (SEQ ID NO: 1949), provided that: A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase; G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, The compound comprising the modified oligonucleotide, wherein o is a phosphodiester internucleoside linkage.

[0138] Embodiment 72. A compound having the following chemical notation: T es m C eo A eo m C eo m C eo A eo T ds T ds T ds T dsG ds A ds m C ds m C ds T ds T ds m C eo T es T es A e A modified oligonucleotide based on (SEQ ID NO: 2751), provided that: A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase; G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, The compound comprising the modified oligonucleotide, wherein o is a phosphodiester internucleoside linkage.

[0139] Embodiment 73. A compound having the following chemical notation: T es T eo m C eo A eo m C eo m C eo A ds T ds T ds T ds T ds G ds A ds m C ds m C ds T ds T eo m C es T es T e A modified oligonucleotide based on (SEQ ID NO: 2752), provided that: A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase; G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, The compound comprising the modified oligonucleotide, wherein o is a phosphodiester internucleoside linkage.

[0140] Embodiment 74. A compound having the following chemical notation: es m C eo A eo T eo A eo m C eo m C ds m C ds A ds G ds G ds G ds T ds A ds G ds G ds A eo T es T es m C e A modified oligonucleotide based on (SEQ ID NO: 765), provided that: A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase; G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, The compound comprising the modified oligonucleotide, wherein o is a phosphodiester internucleoside linkage.

[0141] Embodiment 75. A compound having the following chemical representation: es m C eo G eo m C es A ds A ds T ds G ds T ds A ds T ds m C ds A eo G eo G eo m C es A es A e A modified oligonucleotide based on (SEQ ID NO: 2866), provided that: A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase; G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, The compound comprising the modified oligonucleotide, wherein o is a phosphodiester internucleoside linkage.

[0142] Embodiment 76. A compound having the following chemical representation: es m C eo m C eo A eo T eo T ds T ds T ds G ds A ds m C ds m C ds T ds T ds m C ds T eo T eo Aes G es m C e A modified oligonucleotide based on (SEQ ID NO: 2873), provided that: A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase; G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, The compound comprising the modified oligonucleotide, wherein o is a phosphodiester internucleoside linkage.

[0143] Embodiment 77. The compound of any one of embodiments 71-76, comprising the modified oligonucleotide covalently attached to a conjugate group.

[0144] Embodiment 78. A pharmaceutical composition according to any one of embodiments 71 to 77, and a pharma- ceutically acceptable diluent or carrier.

[0145] Embodiment 79. The pharmaceutical composition of embodiment 78, wherein the pharma- ceutical acceptable diluent is artificial cerebrospinal fluid.

[0146] Embodiment 80 The pharmaceutical composition of embodiment 79, consisting essentially of the modified oligonucleotide and artificial cerebrospinal fluid.

[0147] Embodiment 81. A chirally enriched population of modified oligonucleotides according to any of embodiments 55 to 67, wherein the population is enriched for modified oligonucleotides comprising at least one particular phosphorothioate internucleoside linkage having a particular stereochemical configuration.

[0148] Embodiment 82. The chirally enriched population of embodiment 81, wherein the population is enriched for modified oligonucleotides containing at least one specific phosphorothioate internucleoside linkage having an (Sp) configuration.

[0149] Embodiment 83. The chirally enriched population of embodiment 81, wherein the population is enriched for modified oligonucleotides containing at least one particular phosphorothioate internucleoside linkage having an (Rp) configuration.

[0150] Embodiment 84. The chirally enriched population of embodiment 81, wherein the population is enriched for modified oligonucleotides having a particular independently selected stereochemical configuration at each phosphorothioate internucleoside linkage.

[0151] Embodiment 85. The chirally enriched population of embodiment 84, wherein the population is enriched for modified oligonucleotides having an (Sp) configuration at each phosphorothioate internucleoside linkage.

[0152] Embodiment 86. The chirally enriched population of embodiment 84, wherein the population is enriched for modified oligonucleotides having an (Rp) configuration at each phosphorothioate internucleoside linkage.

[0153] Embodiment 87. The chirally enriched population of embodiment 84, wherein the population is enriched for modified oligonucleotides having an (Rp) configuration at one particular phosphorothioate internucleoside linkage and an (Sp) configuration at the remaining phosphorothioate internucleoside linkages.

[0154] Embodiment 88. The chirally enriched population of embodiment 81 or 84, wherein the population is enriched for modified oligonucleotides having at least three consecutive phosphorothioate internucleoside linkages in the 5' to 3' direction in the Sp, Sp, and Rp configuration.

[0155] Embodiment 89. A chirally enriched population of modified oligonucleotides according to any of embodiments 55-67, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

[0156] I. Specific Oligonucleotides In certain embodiments, provided herein are oligomeric compounds comprising oligonucleotides consisting of linked nucleosides. The oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. Modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA. That is, modified oligonucleotides contain at least one modified nucleoside (nucleoside containing a modified sugar and / or modified nucleobase) and / or one or more modified internucleoside linkages.

[0157] A. Certain Modified Nucleosides A modified nucleoside contains a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase.

[0158] 1. Specific sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may contain one or more substitutions that correspond to the substitutions of other types of substituted sugar moieties.

[0159] In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety comprising a furanosyl ring bearing one or more substituents, none of which bridges two atoms of the furanosyl ring to form a bicyclic structure. Such non-bridging substituents may be at any position of the furanosyl, including but not limited to, substituents at the 2', 4', and / or 5' positions. In certain embodiments, one or more of the non-bridging substituents of the non-bicyclic modified sugar moiety is branched. Examples of suitable 2'-substituents for non-bicyclic sugar moieties include, but are not limited to, 2'-F, 2'-OCH3 ("OMe" or "O-methyl"), and 2'-O(CH2)2OCH3 ("MOE"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-C1-C2, or 2'-OCH3 ("O-C1-C2"). 10 Alkoxy, O-C1~C 10 Substituted alkoxy, O-C1-C 10 Alkyl, O-C1~C 10 Substituted alkyl, S-alkyl, N(R m )-Alkyl, O-Alkenyl, S-Alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ) or OCH2C(=O)-N(R m )(R n ), where each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10Alkyl and the 2'-substituents described in US 6,531,584 to Cook et al., US 5,859,221 to Cook et al., and US 6,005,087 to Cook et al. These 2'-substituents in certain embodiments may be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro(NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl. Suitable 4'-substituents for non-bicyclic modified sugar moieties include 4'-substituted aryl, ... Examples of substituents include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in WO 2015 / 106128 by Manoharan et al. Examples of suitable 5'-substituents for non-bicyclic modified sugar moieties include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy. In certain embodiments, non-bicyclic modified sugar moieties include multiple non-bridging sugar substituents, such as 2'-F-5'-methyl sugar moieties, as well as modified sugar moieties and modified nucleosides described in WO 2008 / 101157 by Migawa et al. and US 2013 / 0203836 by Rajeev et al.

[0160] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is selected from the group consisting of F, NH2, N3, OCF 3、 OCH3, O(CH2)3NH2, CH2CH=CH2, OCH2CH=CH2, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamides (OCH2C(=O)-N(R m )(R n ) ... m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10 It is an alkyl.

[0161] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is F, OCF 3、 and a sugar moiety comprising a non-bridging 2'-substituent selected from OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0162] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.

[0163] Certain modified sugar moieties include substituents that bridge two atoms of a furanosyl ring to form a second ring, thereby providing a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety includes a bridge between the 4' and 2' furanose ring atoms. Such 4'-2' bridged sugar substituents include, but are not limited to, 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2-N(R)-2', 4'-CH(CHOCH3)-O-2' ("constrained MOE" or "cMOE") and analogs thereof (see, e.g., US 7,399,845 by Seth et al., US 7,569,686 by Bhat et al., US 7,741,457 by Swayze et al., and US 8,022,193 by Swayze et al.), 4'-C(CH3)(CH3)-O-2' and analogs thereof (see, e.g., US 8,278,283 by Seth et al.), 4'-CH2-N(OCH3)-2' and analogs thereof (see, e.g., US 8,278,425 by Prakash et al.), 4'-CH2-ON(CH3)-2' (see, e.g., US 7,696,345 by Allerson et al., and US 8,124,745 by Allerson et al.), 4'-CH2-C(H)(CH3)-2' (see, e.g., US 7,696,345 by Allerson et al., and US 8,124,745 by Allerson et al.), 4'-CH2-C(H)(CH3)-2' (see, e.g., Zhou, et al., J. Org. Chem., 2009, 74, 118-134), 4'-CH2-C(=CH2)-2' and analogs thereof (see, e.g., US 8,278,426), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', where each R, R a , and R b are independently H, a protecting group, or C1-C 12 and alkyl (see, for example, US Pat. No. 7,427,672 to Imanishi et al.).

[0164] In certain embodiments, such a 4'-2' bridge is a 1-4 bond independently selected from the following: Independently containing the group: -[C(R a )(R b )] n -,-[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-; During the ceremony, x is 0, 1, or 2; n is 1, 2, 3, or 4; Each R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); Each J1 and J2 is independently H, C1 to C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 aminoalkyl, or a protecting group.

[0165] Further bicyclic sugar moieties are known in the art, see, for example, Freier et al., Nucleic Acids Research, 1997, 25(22), 4429-4443; Albaek et al., J. Org. Chem., 2006, 71, 7731-7740; Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., Chem. Commun., 1998, 4, 455-456; al., J. Am. Chem. Soc., 2007, 129, 8362-8379; US 7,053,207 by Wengel et al., US 6,268,490 by Imanishi et al., US 6,770,748 by Imanishi et al., US RE 44,779 by Imanishi et al., US 6,794,499 by Wengel et al., US 6,670,461 by Wengel et al., US 7,034,133 by Wengel et al., US 8,080,644 by Wengel et al., US 8,034,909 by Wengel et al., US 8,153,365 by Wengel et al., US 7,572,582 by Wengel et al., US 6,525,191 by Ramasamy et al., WO 2007 by Torsten et al. WO 2004 / 106356 by Wengel et al., WO 1999 / 014226 by Seth et al. See US Patent Application Publication Nos. 2007 / 134181, US 7,547,684 to Seth et al., US 7,666,854 to Seth et al., US 8,088,746 to Seth et al., US 7,750,131 to Seth et al., US 8,030,467 to Seth et al., US 8,268,980 to Seth et al., US 8,546,556 to Seth et al., US 8,530,640 to Seth et al., US 9,012,421 to Migawa et al., and US 8,501,805 to Seth et al., as well as U.S. Patent Application Publication Nos. US 2008 / 0039618 to Anderson et al. and US 2015 / 0191727 to Migawa et al.

[0166] In certain embodiments, the bicyclic sugar moiety and nucleosides that include such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described above) are It may be in the -L or β-D configuration.

[0167] [ka] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that have shown antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. When the position of a particular bicyclic nucleoside (e.g., LNA or cEt) is specified in the exemplary embodiments of this specification, they are in the β-D configuration unless otherwise specified.

[0168] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substitutions and one or more bridging sugar substitutions (eg, 5'-substituted and 4'-2' bridging sugars).

[0169] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, an oxygen atom of the sugar moiety is replaced, for example, with a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridged and / or non-bridged substitutions as described herein above. For example, certain sugar surrogates include a 4'-sulfur atom and substitutions at the 2' position (see, e.g., Bhat et al., US 7,875,733 and Bhat et al., US 7,939,677) and / or 5' position.

[0170] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms. For example, in certain embodiments, the sugar surrogate comprises a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include, but are not limited to, hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA") (see, eg, Leumann, CJ. Bioorg. & Med. Chem. 2002, 10, 841-854), Fluoro-HNA: [ka] ("F-HNA", see, e.g., (see, e.g., US 8,088,904 to Swayze et al., US 8,440,803 to Swayze et al., US 8,796,437 to Swayze et al., and US 9,005,906 to Swayze et al. F-HNA can also be referred to as F-THP or 3'-fluorotetrahydropyran), and further modified THP compounds having the formula: [ka] wherein for each of the modified THP nucleosides above, independently Bx is a nucleobase moiety, T3 and T4 are each independently an internucleoside linking group that connects the modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group that connects the modified THP nucleoside to the remainder of the oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linkage conjugate group, or a 5' or 3' terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; Each of R1 and R2 is hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.

[0171] In certain embodiments, modified THP nucleosides are provided in which q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided in which one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0172] In certain embodiments, the sugar surrogate comprises a ring having more than five atoms and more than one heteroatom. For example, nucleosides containing morpholino sugar moieties and their use in oligonucleotides have been reported (see, for example, Braasch et al., Biochemistry, 2002, 41, 4503-4510, as well as US 5,698,685 by Summerton et al., US 5,166,315 by Summerton et al., US 5,185,444 by Summerton et al., and US 5,034,506 by Summerton et al.). As used herein, the term "morpholino" refers to a sugar surrogate having the following structure: [ka]

[0173] In certain embodiments, morpholinos can be modified, for example, by adding or altering various substituents to the morpholino structure. Such sugar surrogates are referred to herein as "modified morpholinos."

[0174] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides that comprise such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and the nucleosides and oligonucleotides described in WO 2011 / 133876 by Manoharan et al.

[0175] Many other bicyclic and tricyclic sugars and sugar surrogate ring structures that can be used in modified nucleosides are known in the art.

[0176] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotide comprises one or more nucleosides that comprise unmodified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that comprise modified nucleobase.In certain embodiments, modified oligonucleotide comprises one or more nucleosides that do not comprise nucleobase, which is called abasic nucleoside.

[0177] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and O-6 substituted purines. In certain embodiments, the modified nucleobase is selected from 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (-C≡C-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and Other 8-substituted purines, 5-halo, especially 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one and 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp).Modified nucleobases also include those in which the purine or pyrimidine base is replaced with other heterocycles such as 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in US 3,687,808 by Merigan et al., The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, JI, Ed., John Wiley & Sons, 1990, 858-859; Englisch. Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443, Chapters 6 and 15 are included. Can be obtained.

[0178] Publications which teach the preparation of certain of the above and other modified nucleobases include, but are not limited to, US 2003 / 0158403 to Manoharan et al., US 2003 / 0175906 to Manoharan et al., US 4,845,205 to Dinh et al., US 5,130,302 to Spielvogel et al., US 5,134,066 to Rogers et al., US 5,175,273 to Bischofberger et al., US 5,367,066 to Urdea et al., US 5,432,272 to Benner et al., US 5,434,257 to Matteucci et al., US 5,457,187 to Gmeiner et al., US 5,459,255 to Cook et al., US 5,459,255 to Froehler et al. 5,484,908, US 5,502,177 by Matteucci et al., US 5,525,711 by Hawkins et al., US 5,552,540 by Haralambidis et al., US 5,587,469 by Cook et al., US 5,594,121 by Froehler et al., US 5,596,091 by Switzer et al., US 5,614,617 by Cook et al., US 5,645,985 by Froehler et al., US 5,681,941 by Cook et al., US 5,811,534 by Cook et al., US 5,750,692 by Cook et al., US 5,948,903 by Cook et al., US 5,587,470 by Cook et al., US 5,587,470 by Cook et al. US 5,457,191 by Matteucci et al., US 5,763,588 by Froehler et al., US 5,830,653 by Cook et al. No. 5,808,027 by Cook et al., No. 6,166,199 by Cook et al., and U.S. Pat. No. 6,005,096 by Matteucci et al.

[0179] 3. Specific modified internucleoside linkages In certain embodiments, the nucleosides of modified oligonucleotides can be linked together using any internucleoside bond.Two main classes of internucleoside linkages are defined by the presence or absence of phosphorus atom.Exemplary phosphorus-containing internucleoside bond include, but are not limited to, phosphodiester, including phosphodiester bond ("P(O2)=O") (also called unmodified or natural bond), phosphotriester, methylphosphonate, phosphoramidate, and phosphorothioate ("P(O2)=S"), and phosphorodithioate ("HS-P=S"). Representative non-phosphorus-containing internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester (-OC(=O)-S-), thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH2-O-), and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). The use of modified internucleoside linkages, as compared to natural phosphate linkages, can alter (usually increase) the nuclease resistance of oligonucleotides. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for the preparation of phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those of skill in the art.

[0180] Representative internucleoside linkages having a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages having a chiral center can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages or as a population of modified oligonucleotides containing phosphorothioate linkages of a specific stereochemical configuration. In certain embodiments, the population of modified oligonucleotides contains phosphorothioate internucleoside linkages, in which all of the phosphorothioate internucleoside linkages are stereorandom. Such modified oligonucleotides can be produced using synthetic methods that result in random selection of the stereochemical configuration of each phosphorothioate linkage. However, as is well understood by those skilled in the art, each phosphorothioate of each oligonucleotide molecule has a defined stereochemical configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that include one or more specific phosphorothioate internucleoside linkages of a specific, independently selected stereochemical configuration. In certain embodiments, the specific configuration of the specific phosphorothioate linkages is present in at least 65% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate linkages is present in at least 70% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate linkages is present in at least 80% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate linkages is present in at least 90% of the molecules in the population. In certain embodiments, the specific configuration of the specific phosphorothioate linkages is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be produced using synthetic methods well known in the art, such as those described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nuc. Acid. Res. 42, 13456 (2014), and WO2017 / 015555. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one designated phosphorothioate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one designated phosphorothioate in the (Rp) configuration. In certain embodiments, the modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulas (wherein "B" represents a nucleobase):

[0181] [ka] Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein can be stereorandom or of a specific stereochemical configuration.

[0182] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Further neutral internucleoside linkages include siloxanes (dialkylsiloxanes), carboxylates, carboxamides, sulfides, sulfonates, and amides (e.g., Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Additionally, neutral internucleoside linkages include nonionic linkages containing mixed N, O, S, and CH2 component moieties.

[0183] B. Specific Motifs In certain embodiments, modified oligonucleotides include one or more modified nucleosides that include modified sugar moieties. In certain embodiments, modified oligonucleotides include one or more modified nucleosides that contain modified nucleobases. In certain embodiments, modified oligonucleotides include one or more modified internucleoside linkages. In such embodiments, modified, unmodified, and differently modified sugar moieties, nucleobases, and / or internucleoside linkages of modified oligonucleotides define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of each other. Thus, modified oligonucleotides can be described by their sugar motif, nucleobase motif, and / or internucleobase linkage motif (as used herein, nucleobase motif describes the modification to the nucleobases independent of the sequence of the nucleobases).

[0184] 1. Specific glyco-motifs In certain embodiments, oligonucleotides contain one or more modified and / or unmodified sugar moieties arranged along the oligonucleotide or portions thereof in a defined pattern or sugar modification motif, in certain instances, such sugar motifs include, but are not limited to, any of the sugar modifications discussed herein.

[0185] In certain embodiments, the modified oligonucleotides have a gapmer motif defined by two exterior regions or "wings" and a central or internal region or "gap." The three regions of the gapmer sugar motif (the 5'-wing, the gap, and the 3'-wing) form a contiguous sequence of nucleosides, with at least a portion of the sugar moiety of each nucleoside of the wing being different from at least a portion of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moiety of the nucleoside of each wing closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) is different from the sugar moiety of the adjacent gap nucleoside, thereby defining a boundary between each wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap comprises one or more nucleosides having a sugar moiety that is different from the sugar moieties of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as each other (symmetric sugar gapmer). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric sugar gapmer).

[0186] In certain embodiments, each wing of a gapmer comprises from 1 to 6 bicyclic nucleosides. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides of each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least three nucleosides of each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least four nucleosides of each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least five nucleosides of each wing of a gapmer comprise a modified sugar moiety.

[0187] In certain such embodiments, the gapmer gap comprises 7-12 nucleosides. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety.

[0188] In certain embodiments, the gapmer is a deoxy gapmer. in which a nucleoside on the gap side of each wing / gap junction comprises a 2'-deoxyribosyl sugar moiety and a nucleoside on the wing side of each wing / gap junction comprises a modified sugar moiety. In certain embodiments, each nucleoside of the gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, exactly one nucleoside of the gap comprises a modified sugar moiety and each remaining nucleoside of the gap comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0189] In certain embodiments, a modified oligonucleotide comprises or consists of a portion having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside throughout the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises or consists of a portion having a fully modified sugar motif, where each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide comprises the same 2'-modification.

[0190] Here, the lengths (number of nucleosides) of the three regions of a gapmer can be given by the notation [number of nucleosides in the 5'-wing]-[number of nucleosides in the gap]-[number of nucleosides in the 3'-wing]. Thus, a 3-10-3 gapmer is composed of three linked nucleosides in each wing and ten linked nucleosides in the gap. When such nomenclature is followed by a specific modification, the modification is a modification of each sugar moiety in each wing, with the gap nucleosides containing a 2'-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer is composed of five linked 2'-MOE nucleosides in the 5'-wing, ten linked 2'-β-D-deoxynucleosides in the gap, and five linked 2'-MOE nucleosides in the 3'-wing. A 3-10-3 cEt gapmer is composed of three linked cEt nucleosides in the 5'-wing, ten linked 2'-β-D-deoxynucleosides in the gap, and three linked cEt nucleosides in the 3'-wing. A 5-8-5 gapmer is composed of five linked nucleosides with modified sugar moieties in the 5'-wing, eight linked 2'-β-D-deoxynucleosides in the gap, and five linked nucleosides with modified sugar moieties in the 3'-wing. A 5-8-5 mixed gapmer has at least two different modified sugar moieties in the 5'- and / or 3'-wings.

[0191] In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 4-10-6 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 6-10-4 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 5-8-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 6-8-4 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 4-8-6 MOE gapmer. In certain embodiments, the modified oligonucleotide is an XYZ MOE gapmer, where X and Z are independently selected from 1, 2, 3, 4, 5, or 6, and Y is 7, 8, 9, 10, or 11.

[0192] 2. Specific Nucleobase Motifs In certain embodiments, the oligonucleotides contain modified and / or unmodified nucleobases arranged along the oligonucleotide or portions thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases of the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all of the cytosine nucleobases are 5-methylcytosine and all of the other nucleobases of the modified oligonucleotide are unmodified nucleobases.

[0193] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is located at the 3' end of the oligonucleotide. In certain embodiments, the block is located within 3 nucleosides of the 3' end of the oligonucleotide. In certain such embodiments, the block is located at the 5' end of the oligonucleotide. In certain embodiments, the block is located within 3 nucleotides of the 5' end of the oligonucleotide.

[0194] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is located within the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.

[0195] 3. Specific internucleoside linkage motifs In certain embodiments, the oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged along the oligonucleotide or portions thereof in a defined pattern or motif. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P(O2)=O). In certain embodiments, each internucleoside linkage group of the modified oligonucleotide is a phosphorothioate internucleoside linkage (P(O2)=S). In certain embodiments, each internucleoside linkage of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from a stereorandom phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all of the internucleoside linkages within the gap are modified. In certain such embodiments, some or all of the internucleoside linkages in the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, which at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all phosphorothioate linkages are stereorandom. In certain embodiments, all phosphorothioate linkages in the wings are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that comprise such internucleoside linkage motifs.

[0196] In certain embodiments, the modified oligonucleotide has the internucleoside linkage motif sooooosssssssssss, where each "s" is a phosphorothioate nucleoside. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif sooooosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif sooooossssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif sooooosssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif soooosssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have the internucleoside linkage motif sooossssssssssoooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have the internucleoside linkage motif sooosssssssssoooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0197] C. Specific Total Length The length of the oligonucleotide can be increased or decreased without losing activity. See, e.g., Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309,1992, a series of antisense oligonucleotides ranging from 13 to 25 nucleobases in length were tested for their ability to induce cleavage of target RNA in an oocyte injection model. Oligonucleotides 25 nucleobases in length containing 8 or 11 mismatched bases near the termini were able to induce specific cleavage of the target mRNA, although to a lesser extent than antisense oligonucleotides containing no mismatches. Similarly, target-specific cleavage was obtained using oligonucleotides consisting of 13 nucleobases, including those with one or three mismatches.

[0198] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have any of a variety of ranges of lengths. In certain embodiments, oligonucleotides consist of X to Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain such embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, with the proviso that X is equal to or less than Y. For example, in certain embodiments, the oligonucleotides are 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28 , 12~29 pieces, 12~30 pieces, 13~14 pieces, 13~15 pieces, 13~16 pieces, 13~17 pieces, 13~18 pieces, 13~19 pieces, 13~20 pieces, 13~2 1 piece, 13~22 pieces, 13~23 pieces, 13~24 pieces, 13~25 pieces, 13~26 pieces, 13~27 pieces, 13~28 pieces, 13~29 pieces, 13~30 pieces, 14~ 15 pieces, 14~16 pieces, 14~17 pieces, 14~18 pieces, 14~19 pieces, 14~20 pieces, 14~21 pieces, 14~22 pieces, 14~23 pieces, 14~24 pieces, 1 4~25 pieces, 14~26 pieces, 14~27 pieces, 14~28 pieces, 14~29 pieces, 14~30 pieces, 15~16 pieces, 15~17 pieces, 15~18 pieces, 15~19 pieces , 15~20 pieces, 15~21 pieces, 15~22 pieces, 15~23 pieces, 15~24 pieces, 15~25 pieces, 15~26 pieces, 15~27 pieces, 15~28 pieces, 15~2 9 pieces, 15~30 pieces, 16~17 pieces, 16~18 pieces, 16~19 pieces, 16~20 pieces, 16~21 pieces, 16~22 pieces, 16~23 pieces, 16~24 pieces, 16~ 25 pieces, 16~26 pieces, 16~27 pieces, 16~28 pieces, 16~29 pieces, 16~30 pieces, 17~18 pieces, 17~19 pieces, 17~20 pieces, 17~21 pieces, 17~22 pieces, 17~23 pieces, 17~24 pieces , 17~25 pieces, 17~26 pieces, 17~27 pieces, 17~28 pieces, 17~29 pieces, 17~30 pieces, 18~19 pieces, 18~20 pieces, 18~21 pieces, 18~22 pieces, 18~23 pieces, 18~24 pieces, 18 ~25 pieces, 18~26 pieces, 18~27 pieces, 18~28 pieces, 18~29 pieces, 18~30 pieces, 19~20 pieces, 19~21 pieces, 19~22 pieces, 19~23 pieces, 19~24 pieces, 19~25 pieces, 19~26 pieces, 19~29 pieces, 19~28 pieces, 19~29 pieces, 19~30 pieces, 20~21 pieces, 20~22 pieces, 20~23 pieces, 20~24 pieces, 20~25 pieces, 20~26 pieces, 20~27 pieces, 20~28 pieces, 2 0~29 pieces, 20~30 pieces, 21~22 pieces, 21~23 pieces, 21~24 pieces, 21~25 pieces, 21~26 pieces, 21~27 pieces, 21~28 pieces, 21~29 pieces, 21~30 pieces, 22~23 pieces, 22~2 4 pieces, 22~25 pieces, 22~26 pieces, 22~27 pieces, 22~28 pieces, 22~29 pieces, 22~30 pieces, 23~24 pieces, 23~25 pieces, 23~26 pieces, 23~27 pieces, 23~28 pieces, 23~29 pieces, It may consist of 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked nucleosides.

[0199] D. Certain Modified Oligonucleotides In certain embodiments, the above modifications (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modification motif and overall length. In certain embodiments, each such parameter is independent of each other. Thus, unless otherwise indicated, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages in the wing regions of the sugar gapmer may be the same or different from each other, and may be the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleobases, independent of the gapmer pattern of sugar modification. Unless otherwise indicated, any modification is independent of the nucleobase sequence.

[0200] E. Specific Populations of Modified Oligonucleotides A population of modified oligonucleotides, where all modified oligonucleotides in the population have the same molecular formula, can be a stereorandom population or a chiral enriched population. All chiral centers of all modified oligonucleotides are stereorandom in a stereorandom population. In a chiral enriched population, at least one specific chiral center is not stereorandom in the modified oligonucleotides of the population. In certain embodiments, the modified oligonucleotides of the chiral enriched population are enriched for β-D ribosyl sugar moieties and all phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides of the chiral enriched population are enriched for both β-D ribosyl sugar moieties of a specific stereochemical configuration and at least one specific phosphorothioate internucleoside linkage.

[0201] F. Nucleotide Sequence In certain embodiments, oligonucleotides (unmodified or modified oligonucleotides) are further described by their nucleobase sequences. In certain embodiments, the oligonucleotides have a nucleobase sequence that is complementary to an identified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain such embodiments, a portion of the oligonucleotide has a nucleobase sequence that is complementary to an identified reference nucleic acid, such as a second oligonucleotide or a target nucleic acid. In certain embodiments, the nucleobase sequence of a portion or the entire length of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a nucleic acid, such as a second oligonucleotide or a target nucleic acid.

[0202] II. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds consisting of an oligonucleotide (modified or unmodified) and optionally one or more conjugate groups and / or terminal groups. A conjugate group consists of one or more conjugate moieties and a conjugate linker that connects the conjugate moieties to the oligonucleotide. The conjugate group can be attached to one or both termini of the oligonucleotide and / or any internal site. In certain embodiments, the conjugate group is attached to the 2' position of the nucleoside of the modified oligonucleotide. In certain embodiments, the conjugate group attached to one or both termini of the oligonucleotide is a terminal group. In certain such embodiments, the conjugate group or terminal group is attached to the 3' and / or 5' termini of the oligonucleotide. In certain such embodiments, the conjugate group (or terminal group) is attached to the 3' terminus of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 3' terminus of the oligonucleotide. In certain embodiments, the conjugate group (or terminal group) is attached to the 5' terminus of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' terminus of the oligonucleotide.

[0203] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate moiety, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides that are independently modified or unmodified.

[0204] A. Specific Conjugation Groups In certain embodiments, oligonucleotides are covalently linked to one or more conjugate groups.In certain embodiments, the conjugate group modifies one or more properties of the bound oligonucleotide, including but not limited to pharmacodynamic properties, pharmacokinetic properties, stability properties, binding properties, absorption properties, tissue distribution properties, cellular distribution properties, cellular uptake properties, charge properties and clearance properties.In certain embodiments, the conjugate group gives the bound oligonucleotide new properties, such as fluorophores or reporter groups that allow the detection of the oligonucleotide. Certain conjugate groups and moieties have been previously described, for example, cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), choline acids (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., J. Am. Chem. Soc., 1999, 660, 307-309), and the like. et al., Bioorg. Med. Chem. Let., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecane-diol) or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654, Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid, palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; doi:10.1038 / mtna.2014.72 and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620).

[0205] In certain embodiments, the conjugate group can be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0206] In certain embodiments, the conjugate group can be selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, provided that the alkyl chain has one or more unsaturated bonds.

[0207] 1. Conjugate moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, sugars, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

[0208] In certain embodiments, the conjugate moiety includes an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazine, chlorothiazide, diazepines, indo-methicin, barbiturates, cephalosporins, sulfa drugs, antidiabetic drugs, antibacterial drugs, or antibiotics.

[0209] 2. Conjugation Linker Conjugate moiety is linked to oligonucleotide via conjugate linker.In certain oligomeric compounds, conjugate linker is single bond (i.e., conjugate moiety is directly linked to oligonucleotide via single bond).In certain embodiments, conjugate linker comprises a chain structure such as hydrocarbyl chain or oligomer of repeating units such as ethylene glycol, nucleoside or amino acid unit.

[0210] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0211] In certain embodiments, the conjugate linker, including the conjugate linker described above, is a bifunctional linking moiety, known in the art to be useful for attaching a conjugate group to a parent compound, such as an oligonucleotide provided herein. In general, the bifunctional linking moiety includes at least two functional groups. One of the functional groups is selected to bind to a specific site on the parent compound, and the other is selected to bind to the conjugate group. Examples of functional groups used in the bifunctional linking moiety include, but are not limited to, an electrophilic group for reacting with a nucleophilic group and a nucleophilic group for reacting with an electrophilic group. In certain embodiments, the bifunctional linking moiety includes one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0212] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include, but are not limited to, substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl or substituted or unsubstituted C2-C 10 Alkynyl is included, where a non-limiting list of preferred substituents includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

[0213] In certain embodiments, the conjugate linker comprises 1-10 linker nucleosides. In certain embodiments, the conjugate linker comprises 2-5 linker nucleosides. In certain embodiments, the conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, the conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise modified sugar moieties. In certain embodiments, the linker nucleosides are unmodified. In certain embodiments, the linker nucleoside comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. It is generally desirable for the linker nucleoside to be cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker nucleosides are generally linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0214] As used herein, linker nucleosides are not considered part of the oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and / or a specific percentage complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker nucleosides, these linker nucleosides are not counted in the length of the oligonucleotide and are not used in determining the percentage complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker nucleosides adjacent to the nucleosides of the modified oligonucleotide. The total number of adjacent linked nucleosides in such an oligomeric compound is greater than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of adjacent linked nucleosides in such an oligomeric compound is 30 or less. Unless otherwise stated, the conjugate linker comprises 10 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 5 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 3 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 2 or less linker nucleosides. In certain embodiments, the conjugate linker comprises 1 or less linker nucleoside.

[0215] In certain embodiments, it is desirable that the conjugate group is cleaved from the oligonucleotide. For example, in certain situations, oligomeric compounds that contain certain conjugate moieties are more likely to be taken up by certain cell types, but it is desirable that the conjugate group is cleaved to release the unconjugated or parent oligonucleotide after the oligomeric compound is taken up. Thus, certain conjugate linkers can include one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond. In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or more than four cleavable bonds. In certain embodiments, the cleavable moiety is selectively cleaved inside the cell or in an intracellular compartment such as a lysosome. In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme such as a nuclease.

[0216] In certain embodiments, the cleavable bond is selected from among an amide bond, an ester bond, an ether bond, an ester bond at one or both ends of a phosphodiester bond, a phosphate ester bond, a carbamate bond, or a disulfide bond. In certain embodiments, the cleavable bond is an ester bond at one or both ends of a phosphodiester bond. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate or a phosphodiester bond between an oligonucleotide and a conjugate moiety or a conjugate group.

[0217] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside linked to either the 3' or 5' terminal nucleoside of the oligonucleotide by a phosphodiester internucleoside bond and covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate bond. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0218] 3. Cell targeting moiety In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the conjugate group has the general formula: [ka] In the formula, n is 1 to about 3; when n is 1, m is 0; when n is 2 or more, m is 1; j is 1 or 0; and k is 1 or 0.

[0219] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.

[0220] In certain embodiments, the conjugate group comprises a cell-targeting moiety having at least one tethered ligand. In certain embodiments, the cell-targeting moiety comprises two tethered ligands covalently attached to the branching group. In certain embodiments, the cell-targeting moiety comprises three tethered ligands covalently attached to the branching group.

[0221] B. Specific End Groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include 5'-phosphates, including but not limited to 5'-vinyl phosphonates. In certain embodiments, the terminal group comprises one or more abasic nucleosides and / or inverted nucleosides. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides. In certain such embodiments, the 2'-linked nucleosides are abasic nucleosides.

[0222] III. Oligomeric Duplexes In certain embodiments, the oligomeric compounds described herein comprise an oligonucleotide having a nucleobase sequence that is complementary to the nucleobase sequence of a target nucleic acid. In certain embodiments, the oligomeric compound pairs with a second oligomeric compound to form an oligomeric duplex. Such an oligomeric duplex comprises a first oligomeric compound having a portion complementary to the target nucleic acid and a second oligomeric compound having a portion complementary to the first oligomeric compound. In certain embodiments, the first oligomeric compound of the oligomeric duplex comprises or consists of (1) a modified or unmodified oligonucleotide and optionally a conjugate group, and (2) a second modified or unmodified oligonucleotide and optionally a conjugate group. One or both oligomeric compounds of the oligomeric duplex may comprise a conjugate group. The oligonucleotide of each oligomeric compound of the oligomeric duplex may comprise a non-complementary overhanging nucleoside.

[0223] IV. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes are capable of conferring at least one antisense activity upon hybridization to a target nucleic acid. Such oligomeric compounds and oligomeric duplexes are antisense compounds. An antisense compound has antisense activity when it reduces or inhibits the amount or activity of a target nucleic acid by 25% or more in a standard cell assay. In certain embodiments, an antisense compound selectively affects one or more target nucleic acids. Such an antisense compound comprises a nucleobase sequence that hybridizes to one or more target nucleic acids to provide one or more desired antisense activities, and does not hybridize to one or more non-target nucleic acids or does not hybridize to one or more non-target nucleic acids in such a way that it results in significant undesired antisense activity.

[0224] In certain antisense activities, hybridization of an antisense compound to a target nucleic acid recruits a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNaseH-mediated cleavage of the target nucleic acid. RNaseH is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA of such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, antisense compounds are described herein as being "DNA-like" enough to induce RNaseH activity. In certain embodiments, one or more non-DNA-like nucleosides within the gap of a gapmer are tolerated.

[0225] In certain antisense activity, antisense compound or part of antisense compound is incorporated into RNA-induced silencing complex (RISC), and finally target nucleic acid is cleaved.For example, certain antisense compound causes cleavage of target nucleic acid by Argonaute.Antisense compound that is incorporated into RISC is RNAi compound.RNAi compound can be double-stranded (siRNA) or single-stranded (ssRNA).

[0226] In certain embodiments, the hybridization of an antisense compound to a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in a change in the splicing of the target nucleic acid. In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in the inhibition of the binding interaction of the target nucleic acid with a protein or other nucleic acid. In certain embodiments, the hybridization of an antisense compound to a target nucleic acid results in a change in the translation of the target nucleic acid.

[0227] Antisense activity can be observed directly or indirectly, hi certain embodiments, observing or detecting antisense activity involves observing or detecting a change in the amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of splice variants of the nucleic acid or protein, and / or a change in the phenotype of a cell or subject.

[0228] V. Specific Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a portion complementary to the target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain such embodiments, the target nucleic acid is selected from endogenous antisense transcripts that do not encode a protein (such as UBE3A-ATS), mature mRNAs, and pre-mRNAs that comprise introns, exons, and untranslated regions. In certain embodiments, the target RNA is an antisense transcript. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain such embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, the target region is located at least 50% within an intron. In certain embodiments, the target nucleic acid is an RNA transcript of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain such embodiments, the target non-coding RNA is a long non-coding RNA. The RNA molecule is selected from short coding RNA, short non-coding RNA, and intronic RNA molecules.

[0229] A. Complementarity / mismatch with target nucleic acid It is possible to introduce mismatched bases without abolishing activity. For example, Gautschi et al (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated that an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA can reduce the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, the oligonucleotide also showed strong antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of 14 nucleobase tandem oligonucleotides, as well as 28 nucleobase and 42 nucleobase oligonucleotides consisting of two or three sequences of the tandem oligonucleotides, respectively, for their ability to stop the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, although to a lesser degree than either the 28 nucleobase or the 42 nucleobase oligonucleotides.

[0230] In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide.In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid.In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and includes a portion that is 100% or completely complementary to the target nucleic acid.In certain embodiments, the completely complementary portion has a length of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleobases.

[0231] In certain embodiments, the oligonucleotide comprises one or more mismatched nucleobases with respect to the target nucleic acid. In certain embodiments, such mismatches reduce the antisense activity against the target, but more significantly reduce the activity against non-targets. Thus, in certain embodiments, the selectivity of the oligonucleotide is improved. In certain embodiments, the mismatches are specifically located within the oligonucleotide having a gapmer motif. In certain embodiments, the mismatches are at positions 1, 2, 3, 4, 5, 6, 7, or 8 from the 5' end of the gap region. In certain embodiments, the mismatches are at positions 9, 8, 7, 6, 5, 4, 3, 2, or 1 from the 3' end of the gap region. In certain embodiments, the mismatches are at positions 1, 2, 3, or 4 from the 5' end of the wing region. In certain embodiments, the mismatches are at positions 4, 3, 2, or 1 from the 3' end of the wing region.

[0232] B. UBE3A-ATS In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide or a portion thereof that is complementary to a target nucleic acid, where the target nucleic acid is UBE3A-ATS. In certain embodiments, the UBE3A-ATS nucleic acid has a sequence as set forth in SEQ ID NO: 1 (GENBANK Accession No. NC_000015.10_TRUNC_24821647_25441028), SEQ ID NO: 2915 (Ensemble gene number ENSG00000224078), or SEQ ID NO: 2916 (cDNA of Ensemble transcript ENST00000554726.1).

[0233] In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1, SEQ ID NO:2915, or SEQ ID NO:2916 can reduce UBE3A-ATS in cells. In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1 can increase UBE3A RNA or protein in a cell. In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1, SEQ ID NO:2915, or SEQ ID NO:2916 can increase paternally derived UBE3A RNA or protein in a cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is present in a subject. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1, SEQ ID NO:2915, or SEQ ID NO:2916 can ameliorate one or more symptoms or characteristics of a neurogenetic disease when administered to a subject. In certain embodiments, the neurogenetic disease is AS. In certain embodiments, the symptom or characteristic is selected from developmental delay, ataxia, speech disorder, sleep disorder, seizures, and EEG abnormalities.

[0234] In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1, SEQ ID NO:2915, or SEQ ID NO:2916 can reduce the amount of UBE3A-ATS RNA detectable in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1, SEQ ID NO:2915, or SEQ ID NO:2916 can increase the amount of UBE3A protein detectable in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1, SEQ ID NO:2915, or SEQ ID NO:2916 can reduce the amount of UBE3A-ATS RNA detectable in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, oligomeric compounds complementary to SEQ ID NO:1, SEQ ID NO:2915, or SEQ ID NO:2916 can increase the amount of UBE3A protein detectable in the CSF of a subject by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0235] C. Specific target nucleic acids in specific tissues In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide that comprises a portion complementary to a target nucleic acid, and the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is a cell or tissue that constitutes the central nervous system. Such tissues include the cortex, hippocampus, and spinal cord.

[0236] VI. Certain Pharmaceutical Compositions In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, each of the one or more oligomeric compounds comprises a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharma- ceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of sterile saline and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0237] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists of the modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0238] In certain embodiments, the pharmaceutical composition comprises one or more oligomeric compounds and one or more excipients, in certain such embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0239] In certain embodiments, the oligomeric compounds can be mixed with pharma- ceutically acceptable active and / or inactive substances to prepare pharmaceutical compositions or formulations. The composition and method for formulating a pharmaceutical composition depends on a number of criteria, including, but not limited to, the route of administration, the extent of the disease, or the dosage.

[0240] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include any pharma- ceutically acceptable salts of oligomeric compounds, esters of oligomeric compounds, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds, including one or more oligonucleotides, can provide (directly or indirectly) biologically active metabolites or residues thereof when administered to a subject, including a human. Thus, for example, the present disclosure is directed to pharma- ceutically acceptable salts of oligomeric compounds, prodrugs, pharma- ceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharma- ceutically acceptable salts include, but are not limited to, sodium and potassium salts. In certain embodiments, the prodrugs include one or more conjugate groups attached to the oligonucleotide, which are cleaved by endogenous nucleases in the body.

[0241] Lipid moieties are used in various ways in nucleic acid therapy. In certain such methods, nucleic acids such as oligomeric compounds are introduced into preformed liposomes or lipoplexes prepared from a mixture of cationic lipids and neutral lipids. In certain methods, DNA complexes with mono- or polycationic lipids are formed in the absence of neutral lipids. In certain embodiments, the lipid moieties are selected to increase the distribution of pharmaceuticals to certain cells or tissues. In certain embodiments, the lipid moieties are selected to increase the distribution of pharmaceuticals to adipose tissue. In certain embodiments, the lipid moieties are selected to increase the distribution of pharmaceuticals to muscle tissue.

[0242] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for the preparation of certain pharmaceutical compositions, including those that include hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethylsulfoxide, are used.

[0243] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents of the present invention to a particular tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0244] In certain embodiments, the pharmaceutical compositions provided herein include a co-solvent system. Certain such co-solvent systems include, for example, benzyl alcohol, a non-polar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such co-solvent systems are suitable for hydrophobic compounds. A non-limiting example of such a co-solvent system is the VPD co-solvent system, which is a solution of 3 w / v% benzyl alcohol, 8 w / v% of the non-polar surfactant Polysorbate 80™, and 65 w / v% polyethylene glycol 300 in absolute ethanol. The proportions of such co-solvent systems can be varied significantly without significantly changing their solubility and toxicity characteristics. Furthermore, the identity of the co-solvent components can be changed, e.g., other surfactants can be used in place of Polysorbate 80™, the fraction size of the polyethylene glycol can be changed, other biocompatible polymers can replace the polyethylene glycol, e.g., polyvinylpyrrolidone, and other sugars or polysaccharides can replace dextrose.

[0245] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for injection administration (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution, such as water or a physiologically compatible buffer, such as Hank's solution, Ringer's solution, or physiological saline buffer, etc. In certain embodiments, other ingredients (e.g., ingredients that aid in solubility or act as preservatives) are included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, etc. Certain pharmaceutical compositions for injection are provided in unit dosage form, for example, in ampoules or in multi-dose containers. Certain pharmaceutical compositions for injection are suspensions, solutions, or emulsions in oily or aqueous vehicles and may contain formulatory agents, such as suspending agents, stabilizing agents, and / or dispersing agents. Particular solvents suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils such as sesame oil, synthetic fatty acid esters, such as ethyl oleate or triglycerides, and liposomes.

[0246] Under certain conditions, certain compounds disclosed herein act as acids. Such compounds may be depicted or described in a protonated (free acid) form, or in a form associated with an ionized cationic (salt) form, but aqueous solutions of such compounds exist in equilibrium between such forms. For example, the phosphate bonds of an oligonucleotide in aqueous solution exist in equilibrium between free acid, anionic, and salt forms. Unless otherwise stated, the compounds described herein are intended to include all such forms. Furthermore, a particular oligonucleotide has several such bonds, each of which is in equilibrium. Thus, an oligonucleotide in solution exists as a collection of each form in multiple positions, all of which are in equilibrium. The term "oligonucleotide" is intended to include all such forms. A depicted structure necessarily represents a single form. However, unless otherwise stated, such drawings are equally intended to include each corresponding form. In this specification, when a structure showing the free acid of a compound is followed by the term "or a salt thereof," it is intended to explicitly include all such forms, which may be fully or partially protonated / deprotonated / associated with a cation. In certain instances, one or more specific cations are identified.

[0247] In certain embodiments, the modified oligonucleotide or oligomeric compound is present in an aqueous solution containing sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in an aqueous solution containing potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is present in water. In certain such embodiments, the pH of the solution is adjusted with NaOH and / or HCl to obtain the desired pH.

[0248] Certain specific dosages are described herein. The dosages may be in the form of dosage units. For clarity of explanation, a dose (or dosage unit) of a modified oligonucleotide or oligomeric compound in milligrams refers to the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As stated above, in an aqueous solution, the free acid is in equilibrium with the anionic and salt forms. However, for purposes of calculating the dose, it is assumed that the modified oligonucleotide or oligomeric compound exists as a solvent-free, sodium acetate-free, anhydrous free acid. For example, when the modified oligonucleotide or oligomeric compound is in a solution containing sodium (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or fully deprotonated and associated with Na+ ions. However, the mass of the protons is counted in the weight of the dose, and the mass of the Na+ ions is not counted in the weight of the dose. Thus, for example, a dose or dosage unit of 100 mg of Compound No. 1263518 is equal to the number of fully protonated molecules weighing 100 mg. This is equivalent to 106 mg of solvent-free, sodium acetate-free, anhydrous sodiated Compound No. 1263518. When an oligomeric compound contains a conjugate group, the mass of the conjugate group is included in calculating the dosage of such an oligomeric compound. When the conjugate group also contains an acid, the conjugate group is assumed to be fully protonated for the purposes of calculating the dosage.

[0249] VII. Specific Compositions 1. Compound number 1065645 In certain embodiments, compound number 1065645 is a 5-10-5 MOE gapmer having a sequence (5' to 3') of CATCATGATCTTGGTAAGGC (SEQ ID NO: 1949), wherein each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, and nucleosides 2-3, 3-4, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 10-12, 10-13, 10-14, 10-15, 11-16, 12-17, 13-18, 14-19, 15-20, 21-22, 22-23, 23-24, 24-25, 25-26, 26-27, 28-29, 29-30, 30-31, 31-32, 32-33, 33-34, 34-35, 35-36, 36-37, 37-38, 38-40, 39-51, 39-62, 39-73, 39-84, 39-91, 39-102, 39-114, 39-126, 39-136, 39-148, 39-151, 39-162, 39-176, 39-188, 39-194, 40-196, 40-198, 41-42, 42-43 The internucleoside linkages between nucleosides 5-6, 16-17, and 17-18 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0250] In certain embodiments, compound number 1065645 is represented by the following chemical notation: m C es A eo T eo m C eo A eo T ds G ds A ds T ds m C ds T ds T ds G ds G ds T ds A eo A eo G es G es m C e (SEQ ID NO: 1949), except A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase; G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0251] In certain embodiments, compound number 1065645 is represented by the following chemical structure: [ka] (Sequence number 1949).

[0252] Structure 1. Compound number 1065645 In certain embodiments, the sodium salt of compound 1065645 is represented by the following chemical structure: [ka] (Sequence number 1949).

[0253] Structure 2. Sodium salt of compound number 1065645 2. Compound number 1263517 In certain embodiments, compound number 1263517 has the sequence (5' to 3') of TCACCATTTTGACCTTCTTA (SEQ ID NO: 2751). a 6-10-4 MOE gapmer, characterized as being one in which each of nucleosides 1-6 and 17-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 7-16 is a 2'-β-D-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0254] In certain embodiments, compound number 1263517 is represented by the following chemical notation:es m C eo A eo m C eo m C eo A eo T ds T ds T ds T ds G ds A ds m C ds m C ds T ds T ds m C eo T es T es A e (SEQ ID NO: 2751), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase; G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0255] In certain embodiments, compound 1263517 is represented by the following chemical structure: [ka] (Sequence number 2751).

[0256] Structure 3. Compound number 1263517 In certain embodiments, the sodium salt of compound 1263517 is represented by the following chemical structure: [ka] (Sequence number 2751).

[0257] Structure 4. Sodium salt of compound number 1263517 3. Compound number 1263518 In a particular embodiment, compound number 1263518 is a 6-10-4 MOE gapmer having the sequence (5' to 3') of TTCACCATTTTGACCTTCTT (SEQ ID NO: 2752), wherein each of nucleosides 1-6 and 17-20 (5' to 3') is a 2'-MOE nucleoside and each of nucleosides 7-16 is a 2'-β-D -deoxynucleosides, the internucleoside linkages between nucleosides 2-3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester internucleoside linkages, and the internucleoside linkages between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0258] In certain embodiments, compound 1263518 is represented by the following chemical designation: es T eo m C eo A eo m C eo m C eo A ds T ds T ds T ds T ds G ds A ds m C ds m C ds T ds T eo m C es T es T e (SEQ ID NO: 2752), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase; G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0259] In certain embodiments, compound 1263518 is represented by the following chemical structure: [ka] (Sequence number 2752).

[0260] Structure 5. Compound number 1263518 In certain embodiments, the sodium salt of compound 1263518 is represented by the following chemical structure: [ka] (Sequence number 2752).

[0261] Structure 6. Sodium salt of compound number 1263518 4. Compound number 1263533 In certain embodiments, compound number 1263533 has the sequence (5' to 3') of GCATACCCAGGGTAGGATTC (SEQ ID NO:765). a 6-10-4 MOE gapmer, characterized as being one in which each of nucleosides 1-6 and 17-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 7-16 is a 2'-β-D-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 3-4, 4-5, 5-6, 6-7, and 17-18 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1-2, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 15-16, 16-17, 18-19, and 19-20 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0262] In certain embodiments, compound number 1263533 is represented by the following chemical designation: es m C eo A eo T eo A eo m C eo m C ds m C ds A ds G ds G ds G ds T ds A ds G ds G ds A eo T es T es m C e (SEQ ID NO: 765), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase; G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0263] In certain embodiments, compound 1263533 is represented by the following chemical structure: [ka] (Sequence number 765).

[0264] Structure 7. Compound number 1263533 In certain embodiments, the sodium salt of compound 1263533 is represented by the following chemical structure: [ka] (Sequence number 765).

[0265] Structure 8. Sodium salt of compound number 1263533 5. Compound number 1273039 In certain embodiments, compound number 1273039 has the sequence (5' to 3') of GCATACCCAGGGTAGGATTC (SEQ ID NO: 2866). a 4-8-6 MOE gapmer, characterized as being one in which each of nucleosides 1-4 and 13-18 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 5-12 is a 2'-β-D-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 3-4, 13-14, 14-15, and 15-16 are phosphodiester internucleoside linkages, the internucleoside linkages between nucleosides 1-2, 4-5, 5-6, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 16-17, and 17-18 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0266] In certain embodiments, compound number 1273039 is represented by the following chemical designation:es m C eo G eo m C es A ds A ds T ds G ds T ds A ds T ds m C ds A eo G eo G eo m C es A es A e (SEQ ID NO: 2866), except that A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase; G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0267] In certain embodiments, compound 1273039 is represented by the following chemical structure: [ka] (Sequence number 2866).

[0268] Structure 9. Compound number 1273039 In certain embodiments, the sodium salt of compound 1273039 is represented by the following chemical structure: [ka] (Sequence number 2866).

[0269] Structure 10. Sodium salt of compound number 1273039 6. Compound number 1273062 In certain embodiments, compound number 1273062 is a 5-10-5 MOE gapmer having a sequence (5' to 3') of ACCATTTTGACCTTCTTAGC (SEQ ID NO: 2873), wherein each of nucleosides 1-5 and 16-20 (5' to 3') is a 2'-MOE nucleoside, each of nucleosides 6-15 is a 2'-β-D-deoxynucleoside, the internucleoside linkages between nucleosides 2-3, 3-4, 4-5, 5-6, 16-17, and 17-18 are phosphodiester internucleoside linkages, and nucleosides 1-2, 6-7, 7-8, 8-9, 9-10, 10-11, 11-12, 12-13, 13-14, 14-15, 16-16, 17-18, 18-19, 19-20, 21-22, 22-23, 23-24, 24-25, 25-26, 26-27, 27-28, 28-29, 30-31, 31-32, 32-33, 33-34, 34-35, 35-36, 37-38, 38-39, 39-40, 41-41, 42-42, 43-43, 44-44, 45-45, 46-46, 47-48, 48-50, 49-51, 52-53, 54-55, 55-56, 56-57, 57-58, 58-60 The internucleoside linkages between 12, 12-13, 13-14, 14-15, 15-16, 18-19, and 19-20 are characterized as being phosphorothioate internucleoside linkages and each cytosine is a 5-methylcytosine.

[0270] In certain embodiments, compound number 1273062 is represented by the following chemical designation: es m C eo m C eo A eo T eo T ds T ds T ds G ds A ds m C ds m C ds T ds T ds m C ds T eo T eo A es G es m C e (SEQ ID NO: 2873), where A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase; G is a guanine nucleobase, T is a thymine nucleobase, e is a 2'-MOE sugar moiety; d is a 2'-β-D-deoxyribosyl sugar moiety, s is a phosphorothioate internucleoside linkage, o is a phosphodiester internucleoside linkage.

[0271] In certain embodiments, compound 1273062 is represented by the following chemical structure: [ka] (Sequence number 2873).

[0272] Structure 11. Compound number 1273062 In certain embodiments, the sodium salt of compound 1273062 is represented by the following chemical structure: [ka] (Sequence number 2873).

[0273] Structure 12. Sodium salt of compound number 1273062 VIII. Specific Comparison Compounds In certain embodiments, compound number 1219022, an alternative of which (compound number 586_9) is shown in WO2017 / 081223 (hereby incorporated by reference), was used as a comparison compound. Compound number 1219022 is a mixed LNA / DNA oligonucleotide having a sugar motif (5' to 3') of llddldldddddddddllll, where each "l" represents an LNA sugar moiety and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, and a sequence (5' to 3') of AAATTATTTATACACCATCA (SEQ ID NO: 2905), where each "C" is a 5-methylcytosine, and where each internucleoside linkage is a phosphorothioate internucleoside linkage. Compound number 586_9 has cytosines at positions 13, 15, and 16, whereas compound number 1219022 has 5-methylcytosines at these positions. According to Wan and Seth, "introduction of a 5-methyl group to cytosine reduces the immunostimulatory profile and also improves nuclease stability of certain DNA oligonucleotides" (J. Med. Chem. 2016, 59, 9645-9667).

[0274] In certain embodiments, compound number 1219023, an alternative of which (compound number 572_7) is shown in WO2017 / 081223 (hereby incorporated by reference), was used as a comparison compound. Compound number 1219023 is a mixed LNA / DNA oligonucleotide having a sugar motif (5' to 3') of lllddldddddddddlll, where each "l" represents an LNA sugar moiety and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, and a sequence (5' to 3') of TTTATCAATATCTTCTCA (SEQ ID NO: 2906), where each "C" is a 5-methylcytosine, and where each internucleoside linkage is a phosphorothioate internucleoside linkage. Compound number 572_7 has cytosines at positions 12 and 15, whereas compound number 1219023 has 5-methylcytosines at these positions.

[0275] In certain embodiments, compound number 1219024, an alternative of which (compound number 591_1) is shown in WO2017 / 081223 (hereby incorporated by reference), was used as a comparison compound. Compound number 1219024 is a mixed LNA / DNA oligonucleotide having a sugar motif (5' to 3') of ldldlddddddddddddll, where each "l" represents an LNA sugar moiety and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, and a sequence (5' to 3') of GCACATTCTTTCTATACCT (SEQ ID NO: 2907), where each "C" is a 5-methylcytosine, and where each internucleoside linkage is a phosphorothioate internucleoside linkage. Compound No. 591_1 has cytosines at positions 2, 4, 8, 12 and 17, whereas compound No. 1219024 has 5-methylcytosines at these positions.

[0276] In certain embodiments, compound number 1219025, an alternative of which (compound number 169_52) is shown in WO2017 / 081223 (hereby incorporated by reference), was used as a comparison compound. Compound number 1219025 is a mixed LNA / DNA oligonucleotide having a sugar motif (5' to 3') of lldllddddddddddll, where each "l" represents an LNA sugar moiety and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, and a sequence (5' to 3') of TTATAGCCATTCTATCT (SEQ ID NO: 2908), where each "C" is a 5-methylcytosine, and where each internucleoside linkage is a phosphorothioate internucleoside linkage. Compound No. 169_52 has cytosines at positions 7, 8, and 12, whereas compound No. 1219025 has 5-methylcytosines at these positions.

[0277] In a particular embodiment, the alternative (compound number 624_5) is described in WO2017 / 0812 Compound No. 1219026, shown in US Pat. No. 23 (hereby incorporated by reference), was used as a comparative compound. Compound No. 1219026 is a mixed LNA / DNA oligonucleotide having a sugar motif (5' to 3') of ldlllddddddddllll, where each "l" represents an LNA sugar moiety and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, and a sequence (5' to 3') of CTCAAAGATCATTCTCA (SEQ ID NO: 2909), where each "C" is a 5-methylcytosine, and where each internucleoside linkage is a phosphorothioate internucleoside linkage. Compound No. 624_5 has a cytosine at position 10, whereas compound No. 1219026 has a 5-methylcytosine at that position.

[0278] In certain embodiments, compound number 1219027, an alternative of which (compound number 626_8) is shown in WO2017 / 081223 (hereby incorporated by reference), was used as a comparison compound. Compound number 1219027 is a mixed LNA / DNA oligonucleotide having a sugar motif (5' to 3') of ldldldldddddddddddll, where each "l" represents an LNA sugar moiety and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, and a sequence (5' to 3') of TTACACTTAATTATACTTCC (SEQ ID NO:2910), where each "C" is a 5-methylcytosine, and where each internucleoside linkage is a phosphorothioate internucleoside linkage. Compound no. 626_8 has cytosines at positions 4, 6, and 16, whereas compound no. 1219027 has 5-methylcytosines at these positions.

[0279] In certain embodiments, compound number 1219028, an alternative of which (compound number 639_5) is shown in WO2017 / 081223 (hereby incorporated by reference), was used as a comparison compound. Compound number 1219028 is a mixed LNA / DNA oligonucleotide having a sugar motif (5' to 3') of ldddddddddddlldlll, where each "l" represents an LNA sugar moiety and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, and a sequence (5' to 3') of GTTTCCATCTACTATTAA (SEQ ID NO: 2911), where each "C" is a 5-methylcytosine, and where each internucleoside linkage is a phosphorothioate internucleoside linkage. Compound number 639_5 has cytosines at positions 5, 6, 9 and 12, whereas compound number 1219028 has 5-methylcytosines at these positions.

[0280] In certain embodiments, compound number 1219029, an alternative of which (compound number 642_12) is shown in WO2017 / 081223 (hereby incorporated by reference), was used as a comparison compound. Compound number 1219029 is a mixed LNA / DNA oligonucleotide having a sugar motif (5' to 3') of llddlddddddddddll, where each "l" represents an LNA sugar moiety and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, and a sequence (5' to 3') of CTGTATACACCATCCCA (SEQ ID NO:2912), where each "C" is a 5-methylcytosine, and where each internucleoside linkage is a phosphorothioate internucleoside linkage. Compound No. 642_12 has cytosines at positions 8, 10, 11, 14 and 15, whereas compound No. 1219029 has 5-methylcytosines at these positions.

[0281] In certain embodiments, compound number 1219030, an alternative of which (compound number 304_6) is shown in WO2017 / 081223 (hereby incorporated by reference), was used as a comparison compound. Compound number 1219030 is a mixed LNA / DNA oligonucleotide having a sugar motif (5' to 3') of lddllddddddddllll, where each "l" represents an LNA sugar moiety and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, and a sequence (5' to 3') of AGTTCTACTATACTTTC (SEQ ID NO: 2913), where each "C" is a 5-methylcytosine. , where each internucleoside linkage is a phosphorothioate internucleoside linkage. Compound No. 304_6 has cytosines at positions 8 and 13, whereas compound No. 1219030 has 5-methylcytosines at these positions.

[0282] In certain embodiments, compound number 1219031, an alternative of which (compound number 573_8) is shown in WO2017 / 081223 (hereby incorporated by reference), was used as a comparison compound. Compound number 1219031 is a mixed LNA / DNA oligonucleotide having a sugar motif (5' to 3') of llddldldddddddddddll, where each "l" represents an LNA sugar moiety and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, and a sequence (5' to 3') of TATACCTTTCTTTAACCCTT (SEQ ID NO: 2914), where each "C" is a 5-methylcytosine, and where each internucleoside linkage is a phosphorothioate internucleoside linkage. Compound number 573_8 has cytosines at positions 6, 10, 16, 17 and 18, whereas compound number 1219031 has 5-methylcytosines at these positions.

[0283] Compound numbers 1219022-1219031 (related to compound numbers #586_9, #572_7, #591_1, #169_52, #624_5, #626_8, #639_5, #642_12, #304_6, #573_8, respectively) were selected as comparison compounds from Example 7 of WO2017 / 081223, which presented a subset of active compounds "selected for efficacy and effectiveness testing."

[0284] In certain embodiments, the compounds described herein are superior to the compounds described in WO2017 / 081223 because they exhibit one or more improved properties, such as in vivo tolerability.

[0285] For example, as described herein, specific compounds Compound No. 1263517, Compound No. 1263518, Compound No. 1263533, Compound No. 1273039, and Compound No. 1273062 produced 3 hour FOB scores of 1.0 (Table 88), 0.0 (Table 88), 1.0 (Table 88), 1.0 (Table 96), and 0.0 (Table 96) in mice, respectively, whereas comparison compounds Compound No. 1219022, Compound No. 1219024, Compound No. 1219025, Compound No. 1219028, Compound No. 1219029, Compound No. 1219030, and Compound No. 1219031, respectively, produced 3 hour FOB scores of 7.0, 5.3, 4.0, 6.0, 6.3, 5.0, and 5.3 in mice, respectively (Table 119). Thus, certain compounds described herein are better tolerated in this assay than the comparator compounds Compound No. 1219022, Compound No. 1219024, Compound No. 1219025, Compound No. 1219028, Compound No. 1219029, Compound No. 1219030, and Compound No. 1219031.

[0286] For example, as described herein, certain compounds Compound No. 1065645, Compound No. 1263517, Compound No. 1263518, Compound No. 1263533, Compound No. 1273039, and Compound No. 1273062 each resulted in a 2-week FOB score of 0.0 in mice (Example 12, Table 112), whereas Compound No. 1219023, Compound No. 1219024, Compound No. 1219025, Compound No. 1219026, Compound No. 1219028, Compound No. 1219029, Compound No. 1219030, and Compound No. 1219031 each resulted in 2-week delayed FOB scores in mice of 3.5, 6.5, 6.0, 6.0, 6.0, 6.0, 6.0, 5.0, and 6.0, respectively (Table 119). Thus, certain compounds described herein are comparable in this assay to the comparative compounds Compound No. 1219023 and Compound No. Better tolerated than 219026.

[0287] For example, as described herein, certain compounds, Compound No. 1065645, Compound No. 1263517, Compound No. 1263518, Compound No. 1263533, Compound No. 1273039, and Compound No. 1273062, do not cause significant differences in body weight compared to PBS-treated rats in an 8-week experiment, while treatment with Compound No. 1219027 results in a weight loss of more than 10% compared to PBS-treated rats (p-value<0.05, Table 120). Thus, certain compounds described herein are better tolerated in this assay than the comparative compound, Compound No. 1219027.

[0288] IX. Specific Hotspot Areas In certain embodiments, the nucleobase ranges shown below include hotspot regions of UBE3A-ATS. In certain embodiments, modified oligonucleotides complementary to hotspot regions of UBE3A-ATS achieve an average reduction of UBE3A-ATS RNA in vitro of more than 50% in standard cell assays.

[0289] 1. Nucleic acid bases 461,413 to 461,487 of SEQ ID NO:1 In certain embodiments, nucleobases 461,413-461,487 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 461,413-461,487 of SEQ ID NO:1. In certain embodiments, the modified oligonucleotide has a length of 20 nucleobases. In certain embodiments, the modified oligonucleotide has a length of 18 nucleobases. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the 5' to 3' order: sooooossssssssssss, soooooosssssssssss, sooooossssssssss, soooosssssssssss, soooosssssssssss, or sooosssssssssss.

[0290] The nucleobase sequences of SEQ ID NOs: 1053, 1329, 1501, 1576, 1873, 1949, 2025, 2096, 2245, 2512, 2591, 2680 to 2682, and 2844 are complementary to a portion of nucleobases 461413 to 461487 of SEQ ID NO:1.

[0291] The nucleobase sequences of compound numbers 749901 to 749904, 1065641 to 1065646, 1165562 to 1165563, 1165857 to 1165858, and 1273001 are complementary to a portion of nucleobases 461,413 to 461,487 of SEQ ID NO:1.

[0292] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 461,413-461,487 of SEQ ID NO:1 provide at least a 36% reduction in UBE3A-ATS RNA in vitro in a standard cell assay. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 461,413-461,487 of SEQ ID NO:1 provide an average of a 60% reduction in UBE3A-ATS RNA in vitro in a standard cell assay.

[0293] 1. Nucleic acid bases 468,968 to 469,013 of SEQ ID NO:1 In certain embodiments, nucleobases 468,968 to 469,013 of SEQ ID NO: 1 comprise a hotspot region. It is complementary to a portion of bases 468,968 to 469,013. In certain embodiments, the modified oligonucleotide has a length of 20 nucleobases. In certain embodiments, the modified oligonucleotide has a length of 18 nucleobases. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the 5' to 3' order: sooooossssssssssss, soooooosssssssssss, sooooossssssssss, soooosssssssssss, soooosssssssssss, or sooosssssssssss.

[0294] The nucleobase sequences of SEQ ID NOs: 376, 377, 2751 to 2756, 2773 to 2776, 2872, 2873, and 2876 to 2878 are complementary to a portion of nucleobases 468,968 to 469,013 of SEQ ID NO:1.

[0295] The nucleobase sequences of compound numbers 750031 to 750032, 1263408 to 1263411, 1263426, 1263441, 1263460 to 1263465, 1263486 to 1263492, 1263517 to 1263523, 1273061, 1273062, and 1273065 to 1273067 are complementary to a portion of nucleobases 468,968 to 469,013 of SEQ ID NO:1.

[0296] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 468,968-469,013 of SEQ ID NO:1 achieve at least a 75% reduction in UBE3A-ATS RNA in a standard cell assay in vitro. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 468,968-469,013 of SEQ ID NO:1 achieve an average of 78% reduction in UBE3A-ATS RNA in a standard cell assay in vitro. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 468,968-469,013 of SEQ ID NO:1 achieve an average of 410% upregulation of UBE3A-ATS RNA in vitro at 6.7 μM in cell culture.

[0297] 3. Nucleic acid bases 483,965 to 484,003 of SEQ ID NO: 1 In certain embodiments, nucleobases 483,965-484,003 of SEQ ID NO:1 comprise a hotspot region. In certain embodiments, the modified oligonucleotide is complementary to a portion of nucleobases 483,965-484,003 of SEQ ID NO:1. In certain embodiments, the modified oligonucleotide has a length of 20 nucleobases. In certain embodiments, the modified oligonucleotide has a length of 18 nucleobases. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the gapmer is a MOE gapmer. In certain embodiments, the internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages. In certain embodiments, the phosphodiester ("o") and phosphorothioate ("s") internucleoside linkages are arranged in the 5' to 3' order: sooooossssssssssss, soooooosssssssssss, sooooossssssssss, soooosssssssssss, soooosssssssssss, or sooosssssssssss.

[0298] The nucleobase sequences of SEQ ID NOs: 172, 764 to 770, 995, 1445, 1668, 1743, 2255, 2595, and 2762 to 2767 are complementary to a portion of nucleobases 483,965 to 484,003 of SEQ ID NO:1.

[0299] The nucleobase sequences of compound numbers 617557, 699781, 750138 to 750144, 1065918 to 1065921, 1165621, 1165878, and 1263532 to 1263557 are complementary to a portion of nucleobases 483,965 to 484,003 of SEQ ID NO:1.

[0300] In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 483,965-484,003 of SEQ ID NO:1 achieve at least a 24% reduction in UBE3A-ATS RNA in a standard cell assay in vitro. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 483,965-484,003 of SEQ ID NO:1 achieve an average of 65% reduction in UBE3A-ATS RNA in a standard cell assay in vitro. In certain embodiments, modified oligonucleotides complementary to a portion of nucleobases 468,968-469,013 of SEQ ID NO:1 achieve an average of 330% upregulation of UBE3A-ATS RNA in vitro at 6.7 μM in cell culture.

[0301] 4. Further hotspot areas In certain embodiments, the ranges set forth in the table below include hotspot regions. Each hotspot region begins with a nucleobase of SEQ ID NO:1 identified in the "Start Site SEQ ID NO:1" column and ends with a nucleobase of SEQ ID NO:1 identified in the "Stop Site SEQ ID NO:1" column. In certain embodiments, the modified oligonucleotide is complementary within any of the hotspot regions 1-61 as defined in the table below. In certain embodiments, the modified oligonucleotide has a length of 18 nucleobases. In certain embodiments, the modified oligonucleotide has a length of 20 nucleobases. In certain embodiments, the modified oligonucleotide is a gapmer. In certain embodiments, the modified oligonucleotide is a 4-8-6, 6-8-4, 5-8-5, 4-10-6, 6-10-4, or 5-10-5 MOE gapmer.

[0302] The nucleobase sequences of the compounds listed in the "Compound Number Within Range" column of the table below are complementary to SEQ ID NO: 1 within the designated hotspot regions. The nucleobase sequences of the oligonucleotides listed in the "SEQ ID NO: Within Range" column of the table below are complementary to the target sequence SEQ ID NO: 1 within the designated hotspot regions.

[0303] In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot regions provide at least a "minimum percent reduction" (minimum percent reduction relative to untreated control cells) of UBE3A-ATS RNA in vitro in a standard cell assay as shown in the table below. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot regions provide an average "average percent reduction" (average percent reduction relative to untreated control cells) of UBE3A-ATS RNA in vitro in a standard cell assay as shown in the table below. In certain embodiments, modified oligonucleotides complementary to nucleobases within the hotspot regions provide the greatest "maximum percent reduction" (maximum percent reduction relative to untreated control cells) of UBE3A-ATS RNA in vitro in a standard cell assay as shown in the table below.

[0304] Table 1 UBE3A-ATS Hotspot [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] #The oligonucleotides described in this section are complementary to this hotspot region at multiple sites, which are detailed in Table 4b herein below (Example 1).

[0305] Non-limiting disclosure and incorporation by reference Each of the literature and patent publications cited herein is hereby incorporated by reference in its entirety.

[0306] While the specific compounds, compositions and methods described herein have been described in detail based on specific embodiments, the following examples are intended to merely illustrate the compounds described herein and are not intended to be limiting thereof.

[0307] Each of the references, GenBank accession numbers, etc. mentioned in this application are hereby incorporated by reference in their entirety.

[0308] Although the sequence listing accompanying this application identifies each sequence as either "RNA" or "DNA" where appropriate, in fact these sequences may be modified by any combination of chemical modifications.

[0309] Those skilled in the art will appreciate that designations such as "RNA" or "DNA" to describe modified oligonucleotides are not intended to be limiting. It will be readily understood that certain examples are optional. For example, an oligonucleotide containing a nucleoside containing a 2'-OH sugar moiety and a thymine base can be described as a DNA with a modified sugar (2'-OH instead of a single 2'-H in DNA) or an RNA with a modified base (thymine (methylated uracil) instead of uracil in RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those in the Sequence Listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to those nucleic acids with modified nucleobases. As a further example, and without limitation, an oligomeric compound having the nucleobase sequence "ATCGATCG", whether modified or unmodified, can also be described as such compounds containing RNA bases such as having the sequence "AUCGAUCG", and those having some DNA bases and some RNA bases such as "AUCGATCG", and those having some RNA bases such as "ATCGATCG". m CGAUCG" (However, m The invention encompasses any oligomeric compound having such a nucleobase sequence, including, but not limited to, oligomeric compounds having other modified nucleobases such as cytosine base having a methyl group at the 5-position.

[0310] Certain compounds (e.g., oligonucleotides) described herein contain one or more asymmetric centers and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined with respect to absolute stereochemistry as (R) or (S), as α or β in the case of, e.g., sugar anomers, or as (D) or (L) in the case of, e.g., amino acids. Compounds provided herein depicted or described as having a particular stereoisomeric configuration include only the compound shown. Compounds provided herein depicted or described with undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms, unless otherwise specified. Similarly, tautomers of the compounds herein are also included unless otherwise specified. Unless otherwise specified, the compounds described herein are intended to include the corresponding salts.

[0311] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds described herein that contain hydrogen atoms include 1 Isotopic substitutions encompassed by the compounds herein include, but are not limited to, all possible deuterium substitutions for each H hydrogen atom. 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S, 34 S, 35 S, or 36In certain embodiments, non-radioactive isotope substitution can provide oligomeric compounds with new properties that are beneficial for use as therapeutic or research tools. In certain embodiments, radioactive isotope substitution can make the compounds suitable for research or diagnostic purposes, such as imaging.

[0312] Working Example The following examples are illustrative of certain embodiments of the present disclosure, but are not limiting. Moreover, where specific embodiments are provided, the inventors contemplate the general application of those specific embodiments. For example, the disclosure of an oligonucleotide having a particular motif provides rational support for additional oligonucleotides having that motif or a similar motif. Similarly, for example, where a particular high affinity modification is found at a particular position, If so, other high affinity modifications at the same positions are also considered appropriate unless otherwise indicated.

[0313] Example 1: In vitro effects of 5-10-5 MOE gapmer modified oligonucleotides on human UBE3A-ATS RNA, single dose Modified oligonucleotides complementary to human UBE3A-ATS nucleic acid were tested for their effect on UBE3A-ATS RNA levels in vitro.

[0314] The modified oligonucleotides in the table below are 5-10-5 MOE gapmers. Gapmers are 20 nucleosides in length with a central gap segment consisting of 10 2'-β-D-deoxynucleosides and the 5' and 3' wing segments each consisting of 5 2'-MOE nucleosides. The sugar motif of the gapmer is (5' to 3') eeeeeddddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety.

[0315] Each internucleoside linkage in compound numbers 617441-617596 (Tables 2 and 3) is a phosphorothioate internucleoside linkage. All other compounds (Tables 4-33) have the internucleoside linkage motif sooooosssssssssss (5' to 3'), where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0316] All cytosine residues are 5-methylcytosines.

[0317] "Start Site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the human gene sequence. "End Site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide set forth in the table below is 100% complementary to SEQ ID NO:1 (GENBANK Accession No. NC_000015.10 truncated to nucleotides 24821647-25441028). Selected compounds in the table below are complementary to the target nucleic acid sequence at three or more specific sites. For these compounds, the "Start Site" and "End Site" values ​​in the table below are indicated with a hashtag (#) to indicate only the first site to which the compound is complementary. Additional sites to which these compounds are complementary are set forth in Table 4b below.

[0318] iCell GABANeurons (Cellular Dynamics), derived from human IPSC cells, were cultured at 20,000–60,000 cells per well (indicated in the table heading) according to the manufacturer's instructions and treated with 5,000–10,000 nM of modified oligonucleotides (indicated in the table heading) ad libitum. After a treatment period of approximately 6 days, total RNA was isolated from the cells and UBE3A-ATS RNA levels were measured by quantitative real-time RT PCR. RNA levels were measured using human UBE3A-ATS primer probe set RTS4796 (forward sequence CTCCCCCAGTTCTGGAATGA, shown herein as SEQ ID NO:2; reverse sequence TACACAGGGATTTGAGCCTGCTA, shown herein as SEQ ID NO:3; probe sequence CCCACAGATCAAGCATTCCCCAAAGA, shown herein as SEQ ID NO:4). UBE3A-ATS RNA levels were normalized to total RNA content measured with RIBOGREEN®. The reduction in UBE3A-ATS RNA is shown in the following table as a percentage of UBE3A-ATS RNA amount relative to untreated control (UTC) cells. Each table represents the results of an individual assay plate. Values ​​marked with an asterisk (*) indicate that the modified oligonucleotide is complementary to the amplicon region of the primer-probe set. Additional assays can be used to measure the potency and efficacy of modified oligonucleotides complementary to the amplicon region. "ND" indicates that the value was not determined in this experiment due to experimental error. However, the values ​​may be different from those defined in Example 1. The activity of selected modified oligonucleotides, including those that have not been modified, has been successfully demonstrated in dose-response experiments herein below.

[0319] Table 2 In vitro reduction of UBE3A-ATS RNA by 7,000 nM of 5-10-5 MOE gapmer containing PS internucleoside linkages (60,000 cells / well) [Table 2-1] [Table 2-2] [Table 2-3]

[0320] Table 3 In vitro reduction of UBE3A-ATS RNA by 7,000 nM of 5-10-5 MOE gapmer containing PS internucleoside linkages (60,000 cells / well) [Table 3-1] [Table 3-2] [Table 3-3]

[0321] Table 4 In vitro reduction of UBE3A-ATS RNA by 5,000 nM of 5-10-5 MOE gapmer containing mixed PO / PS internucleoside linkages (35,000 cells / well) [Table 4-1] [Table 4-2] [Table 4-3]

[0322] Table 4b SEQ ID NO: 1 Start site of modified oligonucleotide complementary to the repeat region [Table 4-4] [Table 4-5] [Table 4-6] [Table 4-7]

[0323] Table 5 5-10-5 MOE gap of 7,000 nM containing mixed PO / PS internucleoside linkages In vitro reduction of UBE3A-ATS RNA by Mer (35,000 cells / well) [Table 5-1] [Table 5-2]

[0324] Table 6 In vitro reduction of UBE3A-ATS RNA by 8,000 nM of 5-10-5 MOE gapmer containing mixed PO / PS internucleoside linkages (40,000 cells / well) L) [Table 6-1] [Table 6-2]

[0325] Table 7 In vitro reduction of UBE3A-ATS RNA by 8,000 nM of 5-10-5 MOE gapmers containing mixed PO / PS internucleoside linkages (40,000 cells / well) [Table 7-1] [Table 7-2]

[0326] Table 8 In vitro reduction of UBE3A-ATS RNA by 8,000 nM of 5-10-5 MOE gapmers containing mixed PO / PS internucleoside linkages (35,000 cells / well) [Table 8-1] [Table 8-2]

[0327] Table 9 In vitro reduction of UBE3A-ATS RNA by 8,000 nM of 5-10-5 MOE gapmers containing mixed PO / PS internucleoside linkages (35,000 cells / well) [Table 9-1] [Table 9-2]

[0328] Table 10 In vitro reduction of UBE3A-ATS RNA by 10,000 nM of 5-10-5 MOE gapmers containing mixed PO / PS internucleoside linkages (40,000 cells / well) [Table 10-1] [Table 10-2]

[0329] Table 11 In vitro reduction of UBE3A-ATS RNA by 8,000 nM of 5-10-5 MOE gapmers containing mixed PO / PS internucleoside linkages (40,000 cells / well) [Table 11-1] [Table 11-2] [Table 11-3]

[0330] Table 12 In vitro reduction of UBE3A-ATS RNA by 8,000 nM of 5-10-5 MOE gapmers containing mixed PO / PS internucleoside linkages (40,000 cells / well) [Table 12-1] [Table 12-2]

[0331] Table 13 In vitro reduction of UBE3A-ATS RNA by 8,000 nM of 5-10-5 MOE gapmers containing mixed PO / PS internucleoside linkages (40,000 cells / well) [Table 13-1] [Table 13-2]

[0332] Table 14 In vitro reduction of UBE3A-ATS RNA by 7,000 nM of 5-10-5 MOE gapmers containing mixed PO / PS internucleoside linkages (37,000 cells / well) [Table 14-1] [Table 14-2]

[0333] Table 15 In vitro reduction of UBE3A-ATS RNA by 7,000 nM of 5-10-5 MOE gapmers containing mixed PO / PS internucleoside linkages (37,000 cells / well) [Table 15-1] [Table 15-2]

[0334] Table 16 In vitro reduction of UBE3A-ATS RNA by 7,000 nM of 5-10-5 MOE gapmers containing mixed PO / PS internucleoside linkages (37,000 cells / well) [Table 16-1] [Table 16-2]

[0335] Table 17 In vitro reduction of UBE3A-ATS RNA by 7,000 nM of 5-10-5 MOE gapmers containing mixed PO / PS internucleoside linkages (37,000 cells / well) [Table 17-1] [Table 17-2]

[0336] Table 18 5-10-5 MOE gap of 7,000 nM containing mixed PO / PS internucleoside linkages In vitro reduction of UBE3A-ATS RNA by Mer (37,000 cells / well) [Table 18-1] [Table 18-2]

[0337] Table 19 In vitro reduction of UBE3A-ATS RNA by 7,000 nM of 5-10-5 MOE gapmer containing mixed PO / PS internucleoside linkages (37,000 cells / well) L) [Table 19-1] [Table 19-2]

[0338] Table 20 In vitro reduction of UBE3A-ATS RNA by 7,000 nM of 5-10-5 MOE gapmers containing mixed PO / PS internucleoside linkages (37,000 cells / well) [Table 20-1] [Table 20-2]

[0339] Table 21 In vitro reduction of UBE3A-ATS RNA by 7,000 nM of 5-10-5 MOE gapmer containing mixed PO / PS internucleoside linkages (37,000 cells / well) L) [Table 21-1] [Table 21-2]

[0340] Table 22 In vitro reduction of UBE3A-ATS RNA by 7,000 nM of 5-10-5 MOE gapmer containing mixed PO / PS internucleoside linkages (37,000 cells / well) L) [Table 22-1] [Table 22-2]

[0341] Table 23 In vitro reduction of UBE3A-ATS RNA by 7,000 nM of 5-10-5 MOE gapmer containing mixed PO / PS internucleoside linkages (37,000 cells / well) L) [Table 23-1] [Table 23-2]

[0342] Table 24 In vitro reduction of UBE3A-ATS RNA by 7,000 nM of 5-10-5 MOE gapmer containing mixed PO / PS internucleoside linkages (37,000 cells / well) L) [Table 24-1] [Table 24-2]

[0343] Table 25 5-10-5 MOE gap of 7,000 nM containing mixed PO / PS internucleoside linkages In vitro reduction of UBE3A-ATS RNA by Mer (37,000 cells / well) [Table 25-1] [Table 25-2]

[0344] Table 26 In vitro reduction of UBE3A-ATS RNA by 7,000 nM of 5-10-5 MOE gapmer containing mixed PO / PS internucleoside linkages (37,000 cells / well) L) [Table 26-1] [Table 26-2]

[0345] Table 27 In vitro reduction of UBE3A-ATS RNA by 7,000 nM of 5-10-5 MOE gapmer containing mixed PO / PS internucleoside linkages (37,000 cells / well) L) [Table 27-1] [Table 27-2]

[0346] Table 28 In vitro reduction of UBE3A-ATS RNA by 7,000 nM of 5-10-5 MOE gapmers containing mixed PO / PS internucleoside linkages (37,000 cells / well) [Table 28-1] [Table 28-2]

[0347] Table 29 In vitro reduction of UBE3A-ATS RNA by 7,000 nM of 5-10-5 MOE gapmer containing mixed PO / PS internucleoside linkages (37,000 cells / well) L) [Table 29-1] [Table 29-2]

[0348] Table 30 In vitro reduction of UBE3A-ATS RNA by 8,000 nM of 5-10-5 MOE gapmer containing mixed PO / PS internucleoside linkages (20,000 cells / well) L) [Table 30-1] [Table 30-2]

[0349] Table 31 In vitro reduction of UBE3A-ATS RNA by 8,000 nM of 5-10-5 MOE gapmer containing mixed PO / PS internucleoside linkages (20,000 cells / well) L) [Table 31-1] [Table 31-2]

[0350] Table 32 In vitro reduction of UBE3A-ATS RNA by 8,000 nM of 5-10-5 MOE gapmers containing mixed PO / PS internucleoside linkages (20,000 cells / well) [Table 32-1] [Table 32-2]

[0351] Table 33 5-10-5 MOE gap of 8,000 nM containing mixed PO / PS internucleoside linkages In vitro reduction of UBE3A-ATS RNA by Mer (20,000 cells / well) [Table 33-1] [Table 33-2] [Table 33-3]

[0352] Example 2: In vitro effects of 5-10-5 MOE gapmer modified oligonucleotides on human UBE3A-ATS RNA, single dose Modified oligonucleotides complementary to human UBE3A-ATS nucleic acid were tested for their effect on UBE3A-ATS RNA levels in vitro.

[0353] The modified oligonucleotides in the table below are 5-10-5 gapmers. The gapmers are 20 nucleosides in length with a central gap segment consisting of 10 2'-β-D-deoxynucleosides and the 5' and 3' wing segments each consisting of 5 2'-MOE nucleosides. The sugar motif of the gapmer is (5' to 3') eeeeeddddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety.

[0354] Each internucleoside linkage in compound numbers 617456, 617457, 617460, 617461, and 617557 is a phosphorothioate internucleoside linkage. All other compounds have the internucleoside linkage motif sooooosssssssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0355] All cytosine residues are 5-methylcytosines.

[0356] "Start site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. "End site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the tables below is 100% complementary to SEQ ID NO:1. The start and end sites of compound 750519 are indicated by a hashtag (#) in some of the tables below. A complete list of start sites for compound 750519 is provided in Table 4b.

[0357] Human iPSC-derived ReproNeuro™ Neurons (ReproCELL) were cultured at 40,000 cells per well according to the manufacturer's instructions and treated with 8,000 nM of ad libitum modified oligonucleotides. After a treatment period of approximately 5 days, total RNA was isolated from the cells and UBE3A-ATS RNA levels were analyzed by quantitative real-time RT-PCR. Measured by PCR. RNA levels were measured using human UBE3A-ATS primer probe set RTS4796 (described in Example 1 herein). UBE3A-ATS RNA levels were normalized to total RNA content measured with RIBOGREEN®. Reduction of UBE3A-ATS is shown in the table below as a percentage of UBE3A-ATS RNA amount relative to untreated control (UTC) cells. Each table represents the results of an individual assay plate. Values ​​marked with an asterisk (*) indicate the presence of modified oligonucleotides. The nucleotides are shown to be complementary to the amplicon region of the primer-probe set. Additional assays can be used to measure the potency and efficacy of modified oligonucleotides complementary to the amplicon region.

[0358] Table 34 In vitro reduction of UBE3A-ATS RNA by 8,000 nM of 5-10-5 MOE gapmer containing mixed PO / PS internucleoside linkages [Table 34-1] [Table 34-2]

[0359] Table 35 In vitro reduction of UBE3A-ATS RNA by 8,000 nM of 5-10-5 MOE gapmer containing mixed PO / PS internucleoside linkages [Table 35-1] [Table 35-2]

[0360] Table 36 In vitro reduction of UBE3A-ATS RNA by 8,000 nM of 5-10-5 MOE gapmer containing mixed PO / PS internucleoside linkages [Table 36-1] [Table 36-2]

[0361] Table 37 5-10-5 MOE gap of 8,000 nM containing mixed PO / PS internucleoside linkages In vitro reduction of UBE3A-ATS RNA by Mer [Table 37-1] [Table 37-2] [Table 37-3]

[0362] Example 3: In vitro effects of 5-10-5 MOE gapmer modified oligonucleotides on human UBE3A-ATS RNA, single dose Modified oligonucleotides complementary to human UBE3A-ATS nucleic acids were tested for their effect on UBE3A-ATS RNA levels in vitro essentially as described in Example 1, except that RNA levels were measured using human UBE3A-ATS primer probe set LTS01075 (forward sequence GCCCGAAGTGCCTATTCCTT, shown herein as SEQ ID NO:5; reverse sequence TGGTCAGGAGAACATAGGCATAAA, shown herein as SEQ ID NO:6; probe sequence ACTCCCAGGGTTGATGGGCTACATCC, shown herein as SEQ ID NO:7).

[0363] The modified oligonucleotides in the table below are 5-10-5 gapmers. The gapmers are 20 nucleosides in length with a central gap segment consisting of 10 2'-β-D-deoxynucleosides and the 3' and 5' wing segments each consisting of 5 2'-MOE nucleosides. The sugar motif of the gapmer is (5' to 3') eeeeeddddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. Each internucleoside linkage in compound numbers 617456, 617457, 617460, 617461, and 617557 is a phosphorothioate internucleoside linkage. All other compounds have the internucleoside linkage motif sooooosssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0364] All cytosine residues are 5-methylcytosines.

[0365] "Start site" indicates the 5'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid. "End site" indicates the 3'-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO:1.

[0366] The reduction in UBE3A-ATS RNA is shown in the table below as a percentage of the amount of UBE3A-ATS RNA compared to untreated control (UTC) cells. Asterisks (*) A value of 0 indicates that the modified oligonucleotide is complementary to the amplicon region of the primer-probe set. Additional assays can be used to measure the potency and effectiveness of modified oligonucleotides complementary to the amplicon region.

[0367] Table 38 In vitro reduction of UBE3A-ATS RNA by 7,000 nM of 5-10-5 MOE gapmer containing PS internucleoside linkages (35,000 cells / well) [Table 38-1] [Table 38-2]

[0368] Example 4: In vitro effects of modified oligonucleotides on human UBE3A-ATS RNA, multiple administrations Modified oligonucleotides selected from the above examples were tested at different doses in human iPS-derived iCell GABANeurons (Cellular Dynamics). Cells were plated at a density of 35,000–60,000 cells per well and incubated at 4°C for 1 h. The cells were maintained according to the manufacturer's instructions and treated with the modified oligonucleotides by free incorporation at different concentrations as shown in the table below. After a treatment period of about 6 days, total RNA was isolated from the cells and UBE3A-ATS RNA levels were measured by quantitative real-time PCR. RNA levels were measured using the human UBE3A-ATS primer probe set RTS4796 described above. UBE3A-ATS RNA levels were normalized based on the total RNA content measured with RIBOGREEN®. UBE3A-ATS The RNA reduction is shown in the table below as a percentage of the UBE3A-ATS RNA amount relative to untreated control (UTC) cells.

[0369] When possible, the half maximal inhibitory concentration (IC 50 ) were calculated using linear regression on log / linear plots of the data in Excel. In some cases, the IC 50 could not be calculated with a high degree of confidence and the data points are indicated as "NC." Values ​​indicated as "ND" indicate that the value was not determined in this experiment.

[0370] [Table 39] [Table 40] [Table 41] [Table 42] [Table 43] [Table 44] [Table 45] [Table 46] [Table 47]

[0371] [Table 48] [Table 49] [Table 50] [Table 51] [Table 52] [Table 53]

[0372] Example 5: In vitro effects of modified oligonucleotides on human UBE3A-ATS RNA, multiple administrations Modified oligonucleotides selected from the above examples were tested at different doses in human IPS-derived ReproNeuro™ Neurons (ReproCELL). Cells were plated at a density of 20,000 cells per well, maintained according to the manufacturer's instructions, and treated with modified oligonucleotides by free uptake at different concentrations as shown in the table below. After a treatment period of about 5 days, total RNA was isolated from the cells and UBE3A-ATS RNA levels were measured by quantitative real-time PCR. RNA levels were measured using the human UBE3A-ATS primer probe set RTS4796 described above. UBE3A-ATS RNA levels were normalized based on total RNA content measured with RIBOGREEN®. The reduction of UBE3A-ATS RNA is shown in the table below as a percentage of UBE3A-ATS RNA amount relative to untreated control (UTC) cells.

[0373] The half-maximal inhibitory concentration (IC 50 ) was calculated using linear regression on a log / linear plot of the data in Excel. IC 50 If it is not possible to calculate IC 50 is indicated as NC (Not Calculated).

[0374] [Table 54]

[0375] Example 6: In vitro effects of human UBE3A-ATS RNA and modified oligonucleotides on UBE3A-ATS RNA, multiple administrations Modified oligonucleotides selected from the above examples were tested at different doses in 10-week differentiated human neural cells derived from IPS cells from Angelman syndrome patients (protocol and cells are described in Chamberlain SJ., et al., Induced pluripotent stem cell models of the genomic imprinting disorders Angelman and Prader-Willi syndromes.PNAS, 2010. 41: 17668-17673). At the end of the 10-week differentiation period, cells were treated with modified oligonucleotides by free uptake at different concentrations as shown in the table below. After a treatment period of about 6 days, total RNA was isolated from the cells. Both UBE3A-ATS RNA and UBE3A RNA levels were measured by quantitative real-time PCR. Human UBE3A-ATS primer probe set RTS4796 was used to measure UBE3A-ATS RNA levels as described above. Human UBE3A primer probe set RTS35984 (forward sequence CACCCTGATGTCACCGAATG, shown herein as SEQ ID NO: 8; reverse sequence GCGTTCTATTAGAGATGCTTTGCAG, shown herein as SEQ ID NO: 9; probe sequence ACTGAGGTTCTCCTGATCTTTTACAAGCTG, shown herein as SEQ ID NO: 10) was used to measure UBE3A RNA levels. RNA levels were adjusted based on total RNA content measured with RIBOGREEN®. UBE3A- The reduction of ATS RNA or induction of UBE3A RNA is shown in the table below as a percentage of the amount of UBE3A-ATS RNA or the percentage of UBE3A RNA relative to untreated control (UTC) cells. Values ​​shown as "ND" indicate that the value was not determined in this experiment.

[0376] Several modified oligonucleotides were found to reduce UBE3A-ATS RNA with a concomitant increase in UBE3A RNA in IPS cell-derived neurons of Angelman patients.

[0377] [Table 55]

[0378] [Table 56] [Table 57] [Table 58] [Table 59] [Table 60] [Table 61]

[0379] Example 7: Design and synthesis of modified oligonucleotides complementary to human UBE3A-ATS nucleic acids Modified oligonucleotides were synthesized as shown in the table below.

[0380] Each compound in Table 62 is a 4-10-6 MOE gapmer. The gapmer is 20 nucleosides in length with a central gap segment consisting of 10 2'-β-D-deoxynucleosides, a 5' wing segment consisting of four 2'-MOE nucleosides, and a 3' wing segment consisting of six 2'-MOE nucleosides. The sugar motif of the gapmer is (5' to 3') eeeeddddddddddeeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. The gapmer has (5' to 3') the internucleoside linkage motif sooossssssssssoooss, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines.

[0381] Table 62 A 4-10-6 MOE gapmer with mixed PO / PS internucleoside linkages complementary to human UBE3A-ATS [Table 62-1] [Table 62-2]

[0382] The compounds in Table 63 are 5-10-5 MOE gapmers. The gapmers are 20 nucleosides in length with a central gap segment consisting of 10 2'-β-D-deoxynucleosides and the 5' and 3' wing segments consisting of 5 2'-MOE nucleosides each. The sugar motif of the gapmer is (5' to 3') eeeeeddddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. The gapmer has (5' to 3') the internucleoside linkage motif sooooosssssssssss, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5 methylcytosines.

[0383] Table 63 A 5-10-5 MOE gapmer with mixed PO / PS internucleoside linkages complementary to human UBE3A-ATS [Table 63-1] [Table 63-2] [Table 63-3] [Table 63-4]

[0384] The compounds in Table 64 are 6-10-4 MOE gapmers. The gapmers are 20 nucleosides in length with a central gap segment consisting of 10 2'-β-D-deoxynucleosides, a 5' wing segment consisting of six 2'-MOE nucleosides, and a 3' wing segment consisting of four 2'-MOE nucleosides. The sugar motif of the gapmer is (5' to 3') eeeeeeddddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. The gapmer has (5' to 3') the internucleoside linkage motif soooooosssssssssss, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5-methylcytosines.

[0385] Table 64 A 6-10-4 MOE gapmer with mixed PO / PS internucleoside linkages complementary to human UBE3A-ATS [Table 64-1] [Table 64-2] Each compound in Table 65 is a 4-8-6MOE gapmer. The gapmer is 18 nucleosides in length with a central gap segment consisting of eight 2'-β-D-deoxynucleosides, a 5' segment consisting of four 2'-MOE nucleosides, and a 3' wing segment consisting of six 2'-MOE nucleosides. The sugar motif of the gapmer is (5' to 3') eeeeddddddddeeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. The gapmer has (5' to 3') the internucleoside linkage motif soossssssssssoooss, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5 methylcytosines.

[0386] Table 65 A 4-8-6MOE gapmer with mixed PO / PS internucleoside linkages complementary to human UBE3A-ATS [Table 65]

[0387] The compounds in Table 66 are 5-8-5MOE gapmers. The gapmers are 18 nucleosides in length with a central gap segment consisting of eight 2'-β-D-deoxynucleosides and the 5' and 3' wing segments consisting of five 2'-MOE nucleosides each. The sugar motif of the gapmer is (5' to 3') eeeeeddddddddeeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. The gapmer has (5' to 3') the internucleoside linkage motif sooosssssssssooss, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5 methylcytosines.

[0388] Table 66 5-8- with mixed PO / PS internucleoside linkages complementary to human UBE3A-ATS 5MOE Gapmar [Table 66]

[0389] The compounds in Table 67 are 6-8-4MOE gapmers. The gapmers are 18 nucleosides in length with a central gap segment consisting of eight 2'-β-D-deoxynucleosides, a 5' wing segment consisting of six 2'-MOE nucleosides, and a 3' wing segment consisting of four 2'-MOE nucleosides. The sugar motif of the gapmer is (5' to 3') eeeeeeddddddddeeee, where "d" represents a 2'-β-D-deoxyribosyl sugar moiety and "e" represents a 2'-MOE sugar moiety. The gapmer has (5' to 3') the internucleoside linkage motif sooooosssssssssoss, where "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues are 5 methylcytosines.

[0390] Table 67 6-8- with mixed PO / PS internucleoside linkages complementary to human UBE3A-ATS 4MOE Gapmar [Table 67]

[0391] Example 8: In vitro effects of modified oligonucleotides on human UBE3A-ATS RNA, multiple administrations Modified oligonucleotides selected from the above examples were tested at different doses in human IPS-derived iCell GABANeurons (Cellular Dynamics) as described in Example 4. The reduction in UBE3A-ATS RNA is shown in the table below as a percentage of the amount of UBE3A-ATS RNA relative to untreated control (UTC) cells. Where possible, the half maximal inhibitory concentration (IC) of each modified oligonucleotide is reported. 50 ) were calculated using linear regression on log / linear plots of the data in Excel. In some cases, the IC 50could not be calculated with a high degree of confidence and the data points are indicated as "NC." Values ​​indicated as "ND" indicate that the value was not determined in this experiment.

[0392] [Table 68] [Table 69] [Table 70] [Table 71] [Table 72] [Table 73]

[0393] Example 9: In vitro effects of human UBE3A-ATS RNA and modified oligonucleotides on UBE3A-ATS RNA, multiple administrations Modified oligonucleotides selected from the above examples were tested at different doses in 10 week differentiated human neuronal cells derived from Angelman syndrome patient-derived IPS cells as described above in Example 6. Reduction of UBE3A-ATS RNA or UBE3A The induction of RNA is shown in the table below as a percentage of UBE3A-ATS RNA content or UBE3A RNA content relative to untreated control (UTC) cells. Values ​​shown as "ND" indicate that the value was not determined in this experiment.

[0394] Several modified oligonucleotides were found to reduce UBE3A-ATS RNA with a concomitant increase in UBE3A RNA in IPS cell-derived neurons of Angelman patients.

[0395] [Table 74] [Table 75] [Table 76] [Table 77]

[0396] Example 10: Tolerance of modified oligonucleotides complementary to human UBE3A-ATS in wild type mice, 3 hour study The modified oligonucleotides described above were tested in wild type female C57 / Bl6 mice to assess the tolerability of the oligonucleotides. Each wild type female C57 / Bl6 mouse received a single ICV dose of 700 μg of the modified oligonucleotides described in the table below. Each treatment group consisted of four mice. One group of four mice received PBS as a negative control for each experiment (identified in a separate table below). Mice were evaluated according to seven different criteria 3 hours after injection. The criteria were: (1) Mice were active, alert, and responsive; (2) Mice reared or hunched without stimulation; (3) Mice showed any movement without stimulation; (4) Mice showed forward movement when lifted; (5) Mice showed any movement when lifted; (6) Mice responded to tail pinching; (7) Regular breathing. For each of the seven criteria, a subscore of 0 was given if the criterion was met and a subscore of 1 was given if the criterion was not met (Functional Observation Bulk Score or FOB). After all seven criteria were assessed, the scores were summed for each mouse and averaged within each treatment group. The results are shown in the table below.

[0397] [Table 78] [Table 79]

Table 80

Table 81

Table 82

Table 83

Table 84-1

Table 84-2

Table 85

Table 86

Table 87-1

Table 87-2

Table 88

Table 89

Table 90

Table 91

Table 92

Table 93

Table 94

Table 95

[0398] Example 11: Tolerance of modified oligonucleotides complementary to human UBE3A-ATS in rats, 3 hour study The modified oligonucleotides described above were tested in rats to assess the tolerability of the oligonucleotides. Each Sprague Dawley rat was given a single intrathecal (IT) dose of 3 mg of the oligonucleotides described in the table below. Each treatment group consisted of 4 rats, with one group of 4 rats receiving PBS as a negative control. Three hours after injection, movement of 7 different body parts was assessed for each rat. The 7 body parts were: (1) the rat's tail, (2) the rat's back, (3) the rat's hind legs, (4) the rat's hind paws, (5) the rat's front paws, (6) the rat's front dorsum, and (7) the rat's head. For each of the 7 different body parts, each rat was given a subscore of 0 if the body part was moving and a subscore of 1 if the body part was paralyzed (Function Observation Total Score or FOB). After each of the 7 body parts was assessed, the subscores were summed for each rat and then averaged for each group. For example, if a rat's tail, head, and all other assessed body parts were moving 3 hours after an IT dose of 3 mg, the rat receives a total score of 0. If another rat did not move its tail but all other assessed body parts were moving 3 hours after an IT dose of 3 mg, the rat receives a score of 1. Results are presented as the average score for each treatment group.

[0399] [Table 99] [Table 100] [Table 101] [Table 102] [Table 103] [Table 104] [Table 105] *One of the four rats in this group died during surgery and is therefore excluded from this value.

[0400] [Table 106] [Table 107] [Table 108] [Table 109] [Table 110] [Table 111]

[0401] Example 12: Tolerance of modified oligonucleotides complementary to human UBE3A-ATS in wild-type mice, 2-week study The modified oligonucleotides described above were tested in wild type female C57 / Bl6 mice to assess the tolerability of the oligonucleotides. Each wild type female C57 / Bl6 mouse received a single ICV dose of 700 μg of the modified oligonucleotides described in the table below. Each treatment group consisted of four mice. One group of four mice received PBS as a negative control for each experiment (identified in a separate table below). Two weeks after injection, the mice were evaluated according to seven different criteria. The criteria were: (1) the mouse was active, alert, and responsive; (2) the mouse reared or hunched without stimulation; (3) the mouse showed any movement without stimulation; (4) the mouse showed forward movement when lifted; (5) the mouse showed any movement when lifted; (6) the mouse responded to pinching of the tail; and (7) regular breathing. For each of the seven criteria, a subscore of 0 was given if the criterion was met and a subscore of 1 was given if the criterion was not met (Functional Observation Bulk Score or FOB). After all seven criteria were assessed, the scores were summed for each mouse and averaged within each treatment group. The results are shown in the table below.

[0402] [Table 112]

[0403] Example 13: Activity of modified oligonucleotides complementary to human UBE3A-ATS in transgenic mice The modified oligonucleotides described above were tested in the UBE3A-ATS BAC transgenic mouse model. The transgenic mouse model was developed at the University of Michigan Bacterial Artificial Chromosome Recombineering Core and contains the region 25163935-25348867 of human chromosome 15 (GRCh38 / hg38 assembly) (from BAC clone RP11-664B13). Expression of UBE3A-ATS is driven by the ENO2 promoter and terminated by the BGH poly(A) signal. The gene fragment was introduced into fertilized eggs of C57BL / 6 mice by pronuclear injection to generate the line RP11-748, which will be used in the experiments described below.

[0404] treatment UBE3A-ATS transgenic mice were divided into groups of 2–4 mice per group. Each mouse received a single dose of 350 μg of modified oligonucleotide via ICV bolus. One group of 4 mice received PBS as a negative control.

[0405] RNA analysis After 2 weeks, mice were sacrificed and RNA was extracted from cortical brain tissue, hippocampal brain tissue, and spinal cord for real-time PCR analysis of UBE3A-ATS RNA expression using primer probe set RTS4796 (described herein above) and / or primer probe set RTS40595 (forward sequence TCCTTCCCTACCTTAGTCTTGA, shown herein as SEQ ID NO: 14; reverse sequence CCCTCTTGAACCAGGAAACA, shown herein as SEQ ID NO: 15; probe sequence AGATGGCAGCCCACATTTCTACTGT, shown herein as SEQ ID NO: 16). Primer probe set RTS4796 is less reliable when oligonucleotides bind to sites distant from the primer probe binding site. Results are expressed as % change in RNA relative to PBS control normalized to mouse GAPDH. Mouse GAPDH was assayed using primer probe set RTS108 (forward sequence GGCAAATTCAACGGCACAGT, shown herein as SEQ ID NO:11; reverse sequence GGGTCTCGCTCCTGGAAGAT, shown herein as SEQ ID NO:12; probe sequence AAGGCCGGAATGGGAAGC, shown herein as SEQ ID NO:13). TTGTCATC). In some cases, RTPCR values ​​were not defined for a particular sample and are shown as ND (not defined).

[0406] As shown in the table below, treatment with modified oligonucleotides reduced UBE3A-ATS RNA compared to the PBS control.

[0407] Table 113 Reduction of human UBE3A-ATS RNA in transgenic mice [Table 113-1] [Table 113-2]

[0408] Table 114 Reduction of human UBE3A-ATS RNA in transgenic mice [Table 114] Table 115 Reduction of human UBE3A-ATS RNA in transgenic mice [Table 115-1] [Table 115-2] Table 116 Reduction of human UBE3A-ATS RNA in transgenic mice [Table 116-1] [Table 116-2] Table 117 Reduction of human UBE3A-ATS RNA in transgenic mice [Table 117-1] [Table 117-2]

[0409] Example 14: Activity of modified oligonucleotides complementary to human UBE3A-ATS in transgenic mice, multiple administrations The modified oligonucleotides described above were tested in the UBE3A-ATS BAC transgenic mouse model RP11-748 line.

[0410] treatment UBE3A-ATS transgenic mice were divided into groups of three mice each. Each mouse received a single ICV bolus dose of 10, 30, 100, 300, or 700 μg of modified oligonucleotide and was sacrificed two weeks later. One group of eight mice received PBS as a negative control.

[0411] RNA analysis After 2 weeks, mice were sacrificed and RNA was extracted from cortical and hippocampal brain tissues and spinal cord for real-time PCR analysis measuring RNA expression of UBE3A-ATS using primer probe set RTS40595 (forward sequence TCCTTCCCTACCTTAGTCTTGA, shown herein as SEQ ID NO: 14; reverse sequence CCCTCTTGAACCAGGAAACA, shown herein as SEQ ID NO: 15; probe sequence AGATGGCAGCCCACATTTCTACTGT, shown herein as SEQ ID NO: 16). Results are expressed as % change in RNA relative to PBS control, normalized to mouse GAPDH (measured with primer-probe set RTS108).

[0412] As shown in the table below, treatment with the modified oligonucleotides resulted in a dose-dependent reduction in UBE3A-ATS RNA compared to the PBS control.

[0413] Table 118 Dose-dependent decrease (%) of human UBE3A-ATS RNA in transgenic mice [Table 118-1] [Table 118-2] [Table 118-3]

[0414] Example 15: Tolerance of modified oligonucleotides complementary to human UBE3A-ATS in wild-type mice, 3 hour and 2 week studies Modified oligonucleotides closely matching the LNA / DNA oligonucleotides described in WO2017 / 081223 were tested in female wild type C57 / B16 mice to assess the tolerability of the oligonucleotides. See "Specific Comparative Compounds" above. Wild type female C57 / B16 mice were each given a single ICV dose of 700 μg of the modified oligonucleotides described in the table below. Each treatment group consisted of 4 mice. To conduct the experiment, one group of 4 mice was given PBS as a negative control. Mice were evaluated according to 7 different criteria 3 hours after injection and 2 weeks after injection. The criteria were: (1) Mice were active, alert and responsive. (2) Mice stood up or hunched without stimulation. (3) Mice showed any movement without stimulation. (4) Mice showed forward movement when lifted. (5) Mice showed any movement when lifted. (6) Mice responded to tail pinching. (7) Regular breathing. For each of the seven criteria, a subscore of 0 was given if the criterion was met and a subscore of 1 if it was not met (Functional Observation Bulk Score or FOB). After all seven criteria were assessed, the scores were summed for each mouse and averaged within each treatment group. The results are shown in the table below.

[0415] [Table 119] The subscript "l" indicates a 4'-2' LNA modified sugar moiety, the subscript "d" indicates a 2'-β-D-deoxyribosyl sugar moiety, the subscript "s" indicates a phosphorothioate internucleoside linkage, and the superscript "m" before the C indicates a 5-methylcytosine.

[0416] nd means not tested.

[0417] Example 16: Tolerance of modified oligonucleotides complementary to human UBE3A-ATS in rats, 8 week study The modified oligonucleotides described above were tested in rats to assess the tolerability of the oligonucleotides. Groups of 6-8 week old male Sprague Dawley rats were given a single intrathecal (IT) dose of 3 mg of the oligonucleotides listed in the table below. Each treatment group consisted of four rats that were roughly matched for starting body weight. One group of four rats was given PBS as a negative control. Rats were weighed before dosing and again 8 weeks after dosing. Rats are expected to gain weight over the course of the experiment due to growth, and too little weight gain is a sign of compound toxicity. The absolute values ​​of the weight changes were normalized to the weight change observed in the PBS-treated group, and the weight change in the PBS group was set to 100% to allow comparisons to be made between two experiments in which the rats had different mean starting body weights. The statistical significance (p-values) of the weight changes compared to the PBS-treated group were calculated by a two-tailed Welch T-test (two samples, unequal variances) in Excel. A p-value less than 0.05 indicates that there is less than a 5% chance that the observed difference is due to random sampling error.

[0418] [Table 120]

Claims

1. Modified oligonucleotides based on the following chemical structure: 【Chemistry 1】 (SEQ ID NO: 2752), or a salt thereof.

2. The modified oligonucleotide of claim 1 , which is a sodium or potassium salt.

3. Modified oligonucleotides based on the following chemical structure: 【Chemistry 2】 (Sequence number 2752).

4. A pharmaceutical composition comprising the modified oligonucleotide of claim 1 and a pharma- ceutically acceptable diluent.

5. 5. The pharmaceutical composition of claim 4, wherein the pharma- cerebrospinal fluid is an artificial cerebrospinal fluid.

6. The pharmaceutical composition of claim 5 consisting essentially of the modified oligonucleotide and artificial cerebrospinal fluid.

7. A pharmaceutical composition comprising the modified oligonucleotide of claim 3 and a pharma- ceutically acceptable diluent.

8. 8. The pharmaceutical composition of claim 7, wherein the pharma- cerebrospinal fluid is an artificial cerebrospinal fluid.

9. The pharmaceutical composition of claim 8 consisting essentially of the modified oligonucleotide and artificial cerebrospinal fluid.

10. The following chemical notations: ｅｓ T ｅｏ ｍ C ｅｏ A ｅｏ ｍ C ｅｏ ｍ C ｅｏ A ｄｓ T ｄｓ T ｄｓ T ｄｓ T ｄｓ G ｄｓ A ｄｓ ｍ C ｄｓ ｍ C ｄｓ T ｄｓ T ｅｏ ｍ C ｅｓ T ｅｓ T ｅ A modified oligonucleotide based on (SEQ ID NO: 2752), provided that: A is an adenine nucleobase, mC is a 5-methylcytosine nucleobase; G is a guanine nucleobase; T is a thymine nucleobase; e is 2'-O(CH ２ ) ２ OCH ３ β-D-ribosyl sugar moiety, d is a 2'-β-D-deoxyribosyl sugar moiety; s is a phosphorothioate internucleoside linkage; o is a phosphodiester internucleoside linkage A compound comprising the modified oligonucleotide.

11. 11. A pharmaceutical composition comprising a compound of claim 10 and a pharma- ceutically acceptable diluent.

12. 12. The pharmaceutical composition of claim 11, wherein the pharma- cerebrospinal fluid is an artificial cerebrospinal fluid.

13. The pharmaceutical composition of claim 12, consisting essentially of the modified oligonucleotide and artificial cerebrospinal fluid.

14. The compound of claim 10 comprising the modified oligonucleotide covalently attached to a conjugate group.

15. 15. A pharmaceutical composition comprising a compound of claim 14 and a pharma- ceutically acceptable diluent.

16. 16. The pharmaceutical composition of claim 15, wherein the pharma- cerebrospinal fluid is an artificial cerebrospinal fluid.

17. 17. The pharmaceutical composition of claim 16, consisting essentially of the modified oligonucleotide and artificial cerebrospinal fluid.

Images