Generating mammalian t cell activation inducible synthetic promoters (syn+pro) to improve t cell therapy

Abstract

To provide methods of making and using inducible promoters for use in T cell therapy that exhibit a high signal to noise ratio and can be repetitively turned on.SOLUTION: Inducible promoters according to the present invention are derived from the NFAT response element inducible system and are used to improve or enhance T cell survival and proliferation.SELECTED DRAWING: None

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 507,565, filed May 17, 2017, the disclosure of which is expressly incorporated herein by reference in its entirety.

[0002] Sequence Listing Reference This application has been filed with an electronic Sequence Listing, which has been provided as a 22 kb file under filename SCRI.152WO.TXT, created on May 15, 2018. The information set forth in the electronic Sequence Listing is incorporated herein by reference in its entirety.

[0003] Methods for making and using inducible promoters for transgene expression are described. The inducible promoters of the present invention are derived from the NFAT response element inducible system and are used to improve or enhance T cell survival and proliferation. [Background technology]

[0004] A variety of inducible promoters have been used in T cell therapy. There remains a need for promoters that provide strong signals, especially those with high signal / noise ratios and that can be repeatedly turned "on". Summary of the Invention [Means for solving the problem]

[0005] In a first aspect, there is provided a method for generating an inducible synthetic promoter library, the method comprising: screening promoters that are activated by activation of chimeric antigen receptor (CAR) T cells to generate a set of screened promoters; screening transcription factor responsive elements to generate a set of screened transcription factor responsive elements; generating an inducible synthetic promoter library comprising promoters that are activated by activation of the transcription factor responsive elements by CAR T cells; and synthesizing an oligonucleotide comprising a first sequence encoding the screened transcription factor responsive element and a second sequence encoding the screened promoter.

[0006] In a second aspect, an inducible synthetic promoter is provided. The inducible synthetic promoter comprises a first sequence encoding a transcription factor response element; and a second sequence encoding a promoter sequence, optionally comprising one or more of SEQ ID NOs: 1-33. In some embodiments, the inducible synthetic promoter is inducible by activation of a chimeric antigen receptor. In some embodiments, the inducible synthetic promoter is inducible by binding of the chimeric antigen receptor to a ligand. In some embodiments, the inducible synthetic promoter is inducible by interaction with an anti-CD3 antibody / anti-CD28 antibody. In some embodiments, the inducible synthetic promoter is inducible by a chemical. In some embodiments, the chemical is PMA or lonomycin. In some embodiments, the promoter comprises an endogenous minimal IL2 promoter sequence. In some embodiments, the inducible synthetic promoter comprises a sequence as set forth in any one of SEQ ID NOs: 1-33. In some embodiments, the transcription factor response element is E2F1, EGR1, HIF1A, NFAT, LEF1, SP1, PU.1, NFKB, JUN, FOS and / or STAT4.

[0007] In a third aspect, a cell for expressing a molecule is provided, the cell comprising a vector comprising an inducible synthetic promoter according to any of the preceding embodiments; a gene encoding the molecule; and a sequence encoding a chimeric antigen receptor. The inducible synthetic promoter may comprise a first sequence encoding a transcription factor response sequence; and a second sequence encoding a promoter sequence, optionally comprising one or more of SEQ ID NOs: 1-33. In some embodiments, the inducible synthetic promoter is inducible by activation of a chimeric antigen receptor. In some embodiments, the inducible synthetic promoter is inducible by binding of the chimeric antigen receptor to a ligand. In some embodiments, the inducible synthetic promoter is inducible by interaction with an anti-CD3 antibody / anti-CD28 antibody. In some embodiments, the inducible synthetic promoter is inducible by a chemical. In some embodiments, the chemical is PMA or lonomycin. In some embodiments, the promoter comprises an endogenous minimal IL2 promoter sequence. In some embodiments, the inducible synthetic promoter comprises a sequence as set forth in any one of SEQ ID NOs: 1-33. In some embodiments, the transcription factor response element is E2F1, EGR1, HIF1A, NFAT, LEF1, SP1, PU.1, NFKB, JUN, FOS and / or STAT4. In some embodiments, the molecule is a protein, an antibody or a binding fragment thereof, a growth-promoting molecule or a molecule capable of eradicating tumors. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments, the chimeric antigen receptor is specific for CD19. In some embodiments, the cell is CD8+ or CD4+. In some embodiments, the expression of the molecule is inducible expression. In some embodiments, the chimeric antigen receptor (CAR) comprises a signaling domain. In some embodiments, the signaling domain is first generation, second generation or third generation. In some embodiments, the vector is a lentiviral vector, a transposase-based minicircle or a nanoplasmid.In some embodiments, the cells further comprise a TCR knockout system for CAR-specific activation. In some embodiments, the molecule is a chimeric cytokine receptor. In some embodiments, the chimeric cytokine receptor comprises a CCR, CASTAT5, PD1 chimera, and / or a miRNA. In some embodiments, the miRNA comprises miRNA155. In some embodiments, the CCR comprises CD122, CD127, or CD360. In some embodiments, the PD1 chimera comprises PD1:CD28, dnSHP1 / 2, and / or IL-12.

[0008] In a fourth aspect, a method of controlling expression of a gene in chimeric antigen receptor (CAR) T cell therapy is provided, comprising providing a cell according to any of the embodiments of the present invention, and introducing the cell into a subject in need of CAR T cell therapy. The cell comprises a vector comprising an inducible synthetic promoter according to any of the embodiments described herein; a gene encoding a molecule; and a sequence encoding a chimeric antigen receptor. The inducible synthetic promoter may comprise a first sequence encoding a transcription factor response sequence; and a second sequence encoding a promoter sequence, optionally comprising one or more of SEQ ID NOs: 1-33. In some embodiments, the inducible synthetic promoter is inducible by activation of a chimeric antigen receptor. In some embodiments, the inducible synthetic promoter is inducible by binding of the chimeric antigen receptor to a ligand. In some embodiments, the inducible synthetic promoter is inducible by interaction with an anti-CD3 antibody / anti-CD28 antibody. In some embodiments, the inducible synthetic promoter is inducible by a chemical. In some embodiments, the chemical is PMA or lonomycin. In some embodiments, the promoter comprises an endogenous minimal IL2 promoter sequence. In some embodiments, the inducible synthetic promoter comprises a sequence as set forth in any one of SEQ ID NOs: 1-33. In some embodiments, the transcription factor response element is E2F1, EGR1, HIF1A, NFAT, LEF1, SP1, PU.1, NFKB, JUN, FOS and / or STAT4. In some embodiments, the molecule is a protein, an antibody or a binding fragment thereof, a growth-promoting molecule or a molecule capable of eradicating a tumor. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments, the chimeric antigen receptor is specific for CD19. In some embodiments, the cell is CD8+ or CD4+. In some embodiments, the expression of the molecule is inducible expression. In some embodiments, the CAR comprises a signaling domain.In some embodiments, the signaling domain is first generation, second generation or third generation. In some embodiments, the vector is a lentiviral vector, a transposase-based minicircle or a nanoplasmid. In some embodiments, the cell further comprises a TCR knockout system for CAR-specific activation. In some embodiments, the molecule is a chimeric cytokine receptor (such as CCR (CD122, CD127 and CD360)), CASTAT5, PD1 chimera (such as PD1:CD28), dnSHP1 / 2, IL-12 and / or miRNA (such as miRNA155). In some embodiments, the method of controlling expression of a gene in a CAR T cell therapy further comprises monitoring the subject's response to the molecule expressed under the control of the inducible synthetic promoter. In some of the embodiments of the method of controlling expression of a gene in a CAR T cell therapy, the subject is further monitored for expression of the molecule expressed under the control of the inducible synthetic promoter. In some of the embodiments of the method of controlling gene expression in CAR T cell therapy, the molecule is a protein, an antibody or binding fragment thereof, a cytokine and / or an anti-cancer therapeutic. In some of the embodiments of the method of controlling gene expression in CAR T cell therapy, the method further comprises inducing expression of the molecule. In some embodiments, the inducing is performed by administration of PMA or lonomycin. In some embodiments, the inducing step is performed before administering the cells to the subject, and the cells are exposed to anti-CD3 / anti-CD28 beads before administration. In some embodiments, the subject is suffering from or diagnosed with cancer. In some embodiments, the molecule is a chimeric cytokine receptor (such as CCR (CD122, CD127 and CD360)), CASTAT5, PD1 chimera (such as PD1:CD28), dnSHP1 / 2, IL-12 and / or miRNA (such as miRNA155). In some embodiments, the molecule is a chimeric cytokine receptor.In some embodiments, the chimeric cytokine receptor comprises a CCR, CASTAT5, PD1 chimera and / or a miRNA. In some embodiments, the miRNA comprises miRNA155. In some embodiments, the CCR comprises CD122, CD127 or CD360. In some embodiments, the PD1 chimera comprises PD1:CD28, dnSHP1 / 2 and / or IL-12.

[0009] In a fifth aspect, there is provided a method of alleviating, inhibiting or treating a disease, for example cancer (e.g., any one or more of leukemia, breast cancer, gastric cancer, esophageal cancer, brain cancer, uterine cancer, prostate cancer, bone cancer, liver cancer, pancreatic cancer, ovarian cancer, lung cancer, colon cancer, kidney cancer, bladder cancer, uterine cancer or thyroid cancer) in a subject in need thereof, comprising the steps of obtaining a cell comprising an inducible synthetic promoter and a chimeric antigen receptor according to any of the embodiments described herein; administering the cell to the subject; and inducing expression of a molecule by introducing a vector into the cell. The vector comprises an inducible synthetic promoter according to any of the embodiments described herein; a gene encoding a molecule; and a sequence encoding a chimeric antigen receptor. The inducible synthetic promoter may comprise a first sequence encoding a transcription factor responsive sequence; and a second sequence encoding a promoter sequence, optionally comprising one or more of SEQ ID NOs: 1-33. In some embodiments, the inducible synthetic promoter is inducible by activation of the chimeric antigen receptor. In some embodiments, the inducible synthetic promoter is inducible by binding of the chimeric antigen receptor to a ligand. In some embodiments, the inducible synthetic promoter is inducible by interaction with an anti-CD3 antibody / anti-CD28 antibody. In some embodiments, the inducible synthetic promoter is inducible by a chemical. In some embodiments, the chemical is PMA or lonomycin. In some embodiments, the promoter comprises an endogenous minimal IL2 promoter sequence. In some embodiments, the inducible synthetic promoter comprises a sequence set forth in any one of SEQ ID NOs: 1-33. In some embodiments, the transcription factor response element is E2F1, EGR1, HIF1A, NFAT, LEF1, SP1, PU.1, NFKB, JUN, FOS, and / or STAT4. In some embodiments, the molecule is a protein, an antibody or binding fragment thereof, a growth promoting molecule, or a molecule capable of eradicating a tumor. In some embodiments, the cell is a hematopoietic stem cell.In some embodiments, the chimeric antigen receptor is specific for CD19. In some embodiments, the cell is CD8+ or CD4+. In some embodiments, the expression of the molecule is inducible expression. In some embodiments, the chimeric antigen receptor (CAR) comprises a signaling domain. In some embodiments, the signaling domain is first generation, second generation, or third generation. In some embodiments, the vector is a lentiviral vector, a transposase-based minicircle, or a nanoplasmid. In some embodiments, the cell further comprises a TCR knockout system for CAR-specific activation. In some embodiments, the molecule is CCR (CD122), CASTAT5, PD1:CD28, and / or miRNA. In some embodiments, the cell is obtained from the subject. In some of the embodiments of the method of alleviating, inhibiting, or treating a disease in a subject in need thereof, the method further comprises monitoring the response of the subject to the molecule expressed under the control of the inducible synthetic promoter. In some embodiments, the molecule is a protein, an antibody, a cytokine, or an anti-cancer therapeutic. In some embodiments, the method further comprises inducing expression of the molecule. In some embodiments, the induction is performed by administration of PMA or lonomycin. In some embodiments, the induction is performed before administering the cells to the subject, and the cells are exposed to anti-CD3 / anti-CD28 antibodies bound to beads prior to administration. In some embodiments, the subject is suffering from cancer. In some embodiments, the molecule is CCR (CD122), CASTAT5, PD1:CD28 and / or miRNA. In some embodiments, the subject is a subject selected for carrying out a cancer therapy. In some embodiments, the cancer is leukemia, breast cancer, gastric cancer, esophageal cancer, brain cancer, uterine cancer, prostate cancer, bone cancer, liver cancer, pancreatic cancer, ovarian cancer, lung cancer, colon cancer, kidney cancer, bladder cancer, uterine cancer or thyroid cancer.In some embodiments, the molecule is a chimeric cytokine receptor. In some embodiments, the chimeric cytokine receptor comprises a CCR, CASTAT5, PD1 chimera and / or a miRNA. In some embodiments, the miRNA comprises miRNA155. In some embodiments, the CCR comprises CD122, CD127 or CD360. In some embodiments, the PD1 chimera comprises PD1:CD28, dnSHP1 / 2 and / or IL-12. [Brief description of the drawings]

[0010] [Figure 1] An overview of gene expression regulation in CAR T cell therapy is provided.

[0011] [Diagram 2] 1 shows an overview of the gene expression system induced by CAR activation.

[0012] [Diagram 3] A schematic diagram illustrating the function of the inducible synthetic promoter (iSynPro) and a graph showing the activation of CAR T cells by iSynPro are shown. Upon binding of the scFv of the CAR to an antigen, the intracellular domain of the CAR induces various transcription factors, which then bind to various promoter regions to activate the gene expression corresponding to each promoter region. When various endogenous genes are expressed simultaneously, the synthetic promoter, which is composed of optimal transcription factor response elements (TREs), can utilize the activated transcription factors to initiate downstream transcription. This transcription activation by the synthetic promoter can be induced multiple times by the activation of CAR T cells. Conventional methods for constructing promoters require a great deal of rational design. The number of TREs that can be tested is limited, and the success rate is low. As shown in the figure, a synthetic promoter library has been created from hundreds of unique sequences, and the strongest inducible promoters can be identified by screening using CAR T cells.

[0013] [Figure 4] 1 is a graph showing functionality of the NFAT promoter in CD8+ cells. As can be seen, only weak induction is obtained using the NFAT-regulated promoter in CD8+ cells.

[0014] [Diagram 5] FIG. 1 shows an overview of a method for designing a synthetic promoter library to screen for promoters that are activated upon CAR T cell activation.

[0015] [Figure 6] Figure 1 shows an overview of how a synthetic promoter library building block can be constructed using various databases. As shown in the Venn diagram, the protein library may include E2F1, EGR1, FOS, 1IF1A, JUN, JFAT, LEF1, NFKB, SP1, PU.1 and / or STAT4.

[0016] [Figure 7] 1 is an overview of steps and methods for constructing an inducible iSynPro library.

[0017] [Figure 8] Sanger sequencing of colonies from the iSynPRo plasmid library is shown. Sequencing results are mapped in a schematic diagram. Transcription factor response elements (TREs) are mapped to the sequences as indicated. Sequencing results for selected clones are summarized in two bar graphs. The left panel shows the frequency of TREs measured in 10 clones. The right panel shows the number of TREs measured per clone.

[0018] [Figure 9] 1 shows the results of a series of FACS assays evaluating Jurkat cells transfected with the iSynPro library by comparison with promoters under NFAT and NFkB control.

[0019] [Figure 10] This is an example of screening a promoter library in CD8 primary T cells. As shown in the figure, first, a nucleic acid having an iSynPro-IL2mp promoter for inducing GFP expression and a nucleic acid expressing an EGFRt marker protein and CD19 are simultaneously transduced into CD8 primary T cells. Next, the cells are activated with anti-CD3 / anti-CD28 beads, and then the beads are removed. Next, the EGFRt+GFP- population is sorted from the cells. Next, the cells isolated by sorting are stimulated by co-culture with CD19+ cells, and GFP-positive cells are sorted on the first, second, and third days and the day after restimulation.

[0020] [Figure 11] Bar graph showing next-generation MiSeq sequencing of iSynPro libraries in sorted cells, with expression of unique contigs observed in cells on days 1, 2, 3, and the day after restimulation, as shown.

[0021] [Figure 12] Summary of the validation protocol of iSynPro in CD8 T cells from two donors. Three nucleic acids are shown: a) a nucleic acid expressing iSynPro promoter-IL2mp to induce expression of GFP; b) a nucleic acid expressing CD19 with EGFRt marker; and c) a nucleic acid expressing CD19+ with DHFRdm promoter, a drug-inducible promoter, and EGFRt marker. Cells are transduced with nucleic acid a) and nucleic acid b) or nucleic acid c). Cells are stimulated with anti-CD3 / anti-CD28 beads as shown and transduced 24 hours later. Beads are removed and selected with MTX (methotrexate). On day 13, cells are co-cultured with irradiated Tm-LCL cells. On days 30 and 46, cells are co-cultured again with irradiated Tm-LCL cells.

[0022] [Figure 13]Using the method shown in Figure 14, we show the results of validating iSynPro in CD8 T cells from two different donors. After activating CD8 T cells with anti-CD3 / anti-CD28 beads, CD19CAR and iSynPro library are transduced into CD8 T cells simultaneously. Six days after the beads are removed, irradiated Tm-LCL cells and CD8 T cells are co-cultured, and a portion of CD8 T cells is collected after 24 and 72 hours for flow cytometry analysis. The remaining cells are cultured for two weeks, then restimulated with Tm-LCL cells, and then stimulated again. The top 28 selected iSynPros are first validated in CD8+ T cells from donor no. 1. Upon stimulation with anti-CD3 / anti-CD28 beads, GFP signal is turned on to various degrees via endogenous TCR, and returns to baseline upon removal of beads. This rise and fall of signal is repeatedly observed for at least three cycles by contacting irradiated Tm-LCL cells with CD19CAR-positive T cells. Overall, upon induction of activation, 27 of the 28 iSynPros show higher GFP positivity and MFI than the 6xNFAT promoter, half of them show higher GFP positivity than the 7xNFkB, and 10 show higher MFI than the 7xNFkB. We then repeat the experiment in cells from donor no. 2 using 9 of the 28 iSynPros. In this experiment, we incorporate the drug selection marker DHFRdm into the CD19CAR construct to allow for the selection of an even purer population. We obtain very similar results to the previous experiment.

[0023] [Figure 14] An overlay graph of iSynPro-regulated GFP expression observed in cells from the two donors is shown. GFP (%) and MFI results were very similar between cells from the two donors, implying that iSynPro induction is consistent and robust.

[0024] [Figure 15]Transcription factor pull-down assays are shown. Methods: iSynPro and control sequences are amplified by PCR using biotin-labeled primers. Nuclear extracts are isolated from PMA / ionomycin-treated Jurkat cells, incubated with biotin-labeled double-stranded iSynPro DNA (three iSynPro sequences were tested in this experiment), and pulled down with streptavidin-conjugated magnetic beads. Transcription factors pulled down with promoter DNA are denatured, loaded onto SDS-PAGE gels, and immunoblotted with antibodies targeting the predicted transcription factors. It has been shown that at least two of the three iSynPro sequences tested here contained TREs corresponding to these transcription factors.

[0025] [Figure 16] Figure 1 shows that iSynPro can be activated through the interaction of CD19CAR with various CD19+ cells. From left to right, GFP expression is shown after stimulation with Tm-LCL cells, K562 / CD19 cells, Raji cells, DHL-4 cells, SupB15 cells, Be2 / CD19 cells, K562 cells, or Be2 cells.

[0026] [Figure 17]A series of bar graphs showing activation of iSynPro S1-61-GFP:ffluc and 7×NFkB-GFP:ffluc in CD19CAR T cells by various target cell lines expressing the T cell costimulators (CD28 receptors), CD80 and CD86. From left to right, K562 cells, K562 / OKT3 cells, K562 / CD19 cells, K562 / CD80 / CD86 / CD19 cells, K562 / CD80 / CD86 cells, Raji cells, Raji / CD19- cells, and Tm-LCL cells are shown. K562 parental cells do not express CD19, CD80, or CD86 on the cell surface. K562 / OKT3 cells were used as a positive control to demonstrate TCR-activated cytotoxic activity. Exogenously expressed CD80 / CD86 alone on K562 cells was unable to activate iSynPro or 7×NFkB. The synergistic activation effect of CD80 / CD86 and CD19 was observed only in cells transfected with 7×NFkB (right graph), and GFP expression was enhanced in K562 / CD80 / CD86 / CD19 cells compared to K562 / CD19 cells, but such a synergistic activation effect was not observed in cells transfected with S1-61 (left graph). Raji cells and Tm-LCL cells express CD19 and CD80 / CD86, but at different levels. Raji cells and Tm-LCL cells activated S-61 and 7×NFkB, with 7×NFkB showing a stronger signal, possibly related to the synergistic effect of CD19 and CD80 / CD86. Knockdown of the CD19 gene with CRISPR rapidly reduced GFP expression to near baseline levels for both promoters, supporting the results observed in K562 cells with the CD19 gene knocked in. Previous experimental data suggest that T cell costimulators do not induce S1-61 and 7×NFkB, and that activation of S1-61 is more specific to CAR–antigen interaction than 7×NFkB.To demonstrate that induction of S1-61 or 7×NFkB coexists with CD19CAR function, that induction of S1-61 or 7×NFkB correlates with CD19CAR function, and that the effect of S1-61 or 7×NFkB is not a random effect, cytokine release assays and chromium release assays shown in Figures 20 and 21 below were performed simultaneously.

[0027] [Figure 18] This shows that CD80 / CD86 costimulatory factors alone did not induce cytokine release from the cells. From left to right, Mock cells, CD19CAR cells, CD19CAR+S1-61-GFP:ffluc cells, and CD19CAR+NFkB-GFP:ffluc cells are shown. The cytokines analyzed were IL-2, IFNγ, and TNFα.

[0028] [Figure 19] Results of chromium release assay are shown, demonstrating that cells expressing CD80 / CD86 costimulators but not CD19 were not killed by CD19CAR T cells. K562 parental cells do not express CD19, CD80, or CD86 on the cell surface. The experimental data showed that K562 cells exogenously expressing CD19 were killed by CD19CAR T cells, but K562 cells exogenously expressing CD80 / CD86 were not killed by CD19CAR T cells. Methods: CD19CAR target cells were labeled with Cr51, and effector cells (CD19CAR T cells) were serially diluted and co-cultured with target cells at various effector:target ratios (30:1, 10:1, 3:1, or 1:1). Additionally, labeled target cells were cultured with 2% SDS as a positive control, and labeled target cells were cultured in RPMI medium as a negative control. After 4 hours of incubation, supernatants were collected and transferred to LUMA 96-well plates. Plates were allowed to dry overnight and counted in a TopCount microplate scintillation counter.

[0029] [Figure 20] A pilot study of iSynPro in vivo using a Be2 / CD19 subcutaneous implantation model is shown. The protocol timeline is shown in the figure. 15 NSG mice were divided into three groups of 5 mice each. Mice in group A were implanted subcutaneously with 3 million Be2 cells in both flanks. Mice in group B were implanted with 3 million Be2 cells in the left flank and 3 million Be2 / CD19 cells in the right flank. Mice in group C were implanted with 3 million Be2 / CD19 cells in both flanks. Five days after tumor implantation, mice in each group were intravenously injected with 2.5 million CD8 T cells expressing CD19CAR / S1-61-GFP:ffluc. Luminescence images were taken the day after CAR T cell injection and continuously over several days to track luciferase expression in implanted T cells.

[0030] [Figure 21]The results of the in vivo experiment are shown below. A strong luciferase signal was observed in mice from group B that were transplanted with both Be2 and Be2 / CD19 cells the day after CAR T cell injection. An even stronger signal was observed in mice from group C that were transplanted with Be2 / CD19 cells in both flanks. In mice from group A that were transplanted with only Be2 cells, almost no signal was observed. The luciferase signal was suggested to be specific to the CD19 antigen, and was presumed to be due to the activation of CD19CAR, as seen in the previous in vitro experiment. The CAR T cells were not localized in the flank area, but were diffused throughout the body, especially in the lungs, indicating that the day after the CAR T cells encountered the tumor cells, the CAR T cells did not remain at the tumor site. Three days after CAR T cell injection, one mouse from group B showed a luciferase signal localized to the tumor (only in the right flank). The same phenomenon was observed in another mouse from group B about 7 days after CAR T cell injection. In the first mouse, the localized luciferase signal increased over time and then decreased, and the second mouse seemed to follow the same trend. Luciferase appeared to correlate with tumor volume. Of the five mice in group B, these two mice showed the largest tumor volume when the localized luciferase signal of CAR T cells reached a high value (data not shown). This is an initial pilot experiment, and further experiments are needed to draw conclusions.

[0031] [Figure 22] Shown is the result of injecting CD8 / CD19CAR / S1-61-GFP:ffluc EGFRt sorted cells into mice.

[0032] [Figure 23]Overview of sample processing for DNA targeted sequencing. As shown in the figure, step 1 involves amplifying the region of interest by PCR. Step 2 involves adding Illumina indexes and sequencing adapters and performing a second round of PCR. Step 3 involves purification of the PCR products, analysis by TapeStation and DNA MiSEQ.

[0033] [Figure 24] Two graphs showing the promoter length distribution obtained as a result of MiSeq are shown.

[0034] [Diagram 25] A summary of the DNA sequencing results is shown. The total number of unique contigs identified by sequencing is shown in the outlined area of ​​the graph.

[0035] [Figure 26] 1 shows an analysis of the iSynPro promoter.

[0036] [Figure 27] An example of a schedule for testing Syn-iPro in CD8+ CAR T cells. As shown in the figure, first, CD8 T cells are stimulated with CD3 / CD28 beads. After 24 hours, the cells are transduced with the viral vector. On day 7, the beads are removed. Then, on day 11, the cells are co-cultured with irradiated Tm-LCL cells. This procedure is repeated on days 27 and 41.

[0037] [Figure 28]The results of flow cytometry analysis of mock cells, cells expressing CD19CAR, cells expressing CD19+CAR (without promoter), cells expressing IL2mp and CD19CAR+, cells expressing 6×NFAT-IL2mp and CD19CAR+, and cells expressing 7×NFkB-IL2mp and CD19CAR+ are shown. EGFRt and GFP were measured in all cells. As shown in the figure, the expression levels of EGFRt and GFP were low in cells expressing the 6×NFAT-IL2mp promoter.

[0038] [Figure 29] Although there was no unique expression pattern, two graphs are shown that demonstrate that protein expression could be re-induced.

[0039] [Diagram 30] The MFI of GFP is shown before and after activation of CAR T cells with target cells, with the left side showing the pre-activation state and the right side showing the post-activation state.

[0040] [Diagram 31] Shown are EGFRt+ populations represented in a series of FACS assays. The top row shows cells before stimulation, and the bottom row shows cells after stimulation (CD19CAR+6xNFAT-IL2mp, CD19CAR+7xNFkB, and CD19CAR+S1-61-IL2mp). As shown, cells containing the 7xNFkB promoter or the S1-61-IL2mp promoter expressed EGFRt after stimulation.

[0041] [Diagram 32] Shown are the expression of EGFRt and GFP in cells after stimulation with CD3 / CD28 or LCL cells. CD19CAR only cells, CD19CAR+promoterless cells, CD19CAR+IL2mp only cells, CD19CAR+6×NFAT-IL2mp cells, and CD19CAR+S1-61-IL2mp cells were used. As shown, cells with S1-61-IL2mp had the highest expression of EGFRt and GFP after stimulation. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0042] The term "conditionally induced" or "inducible" as used herein has its general and ordinary meaning in the context of the present specification, including, but not limited to, a nucleic acid construct such as a promoter that causes expression of a gene in the presence of an inducer, but does not substantially cause expression of the gene in the absence of the inducer. Inducible promoters for mammalian expression constructs include, but are not limited to, promoters inducible by tetracycline, ecdysone, streptogramin antibiotics, macrolide antibiotics, or doxycycline. Inducible promoters for bacterial expression constructs include, but are not limited to, T7 promoter, lac promoter, trc promoter, tac promoter, tetA promoter, araBAD promoter, and rhaPBAD promoter. Insect-derived promoters include, but are not limited to, pB2 promoter and polyhedrin promoter. In some embodiments of the present invention, an inducible promoter for mammalian protein expression is provided. In some embodiments, the promoter is an inducible synthetic promoter. In some embodiments, the promoter is selected to be a promoter that is activated by the activation of CAR T cells.

[0043] The term "promoter" has its usual meaning in the context of this specification, including, but not limited to, a nucleotide sequence that induces transcription of a structural gene. In some embodiments, a promoter is present in the non-coding region at the 5' end of a gene and is located near the transcription start site of the structural gene. The elements of a promoter sequence that initiate transcription are often characterized by consensus nucleotide sequences. A promoter is a DNA region that initiates transcription of a particular gene. A promoter is located upstream (towards the 5' region of the sense strand) in the same DNA strand near the gene transcription start site. The length of a promoter is about 100 base pairs, about 200 base pairs, about 300 base pairs, about 400 base pairs, about 500 base pairs, about 600 base pairs, about 700 base pairs, about 800 base pairs, or about 1000 base pairs, or within a range defined by any two of these lengths. As used herein, a promoter may be a constitutively active promoter, a repressible promoter, or an inducible promoter. If the promoter is an inducible promoter, the transcription rate increases in response to an inducer. In some embodiments, the promoter is a synthetic promoter.

[0044] The term "nucleic acid" or "nucleic acid molecule" as used herein has its common and ordinary meaning in the context of this specification, including, but not limited to, polynucleotides or oligonucleotides, such as deoxyribonucleic acid (DNA), ribonucleic acid (RNA), oligonucleotides, fragments obtained by polymerase chain reaction (PCR), fragments obtained by ligation, cleavage, endonuclease action, exonuclease action, and synthesis. Nucleic acid molecules may be composed of naturally occurring nucleotide monomers (e.g., DNA, RNA), or monomers consisting of analogs of naturally occurring nucleotides (e.g., enantiomers of naturally occurring nucleotides), or combinations thereof. Modified nucleotides may have modifications in the sugar moiety and / or the pyrimidine or purine base moiety. Modifications in the sugar moiety include, for example, replacement of one or more hydroxyl groups with halogens, alkyl groups, amines, or azide groups, and the sugar moiety may be etherified or esterified. Additionally, the entire sugar moiety may be replaced with conformationally or electronically similar structures, such as, for example, azasugars and carbocyclic sugar analogs. Modified base moieties include alkylated purines, alkylated pyrimidines, acylated purines, acylated pyrimidines, and other known heterocyclic substituents. Nucleic acid monomers can be linked by phosphodiester bonds or similar bonds. Linkages similar to phosphodiester bonds include phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, or phosphoroamidate bonds. "Nucleic acid molecule" also includes so-called "peptide nucleic acids," which contain natural or modified nucleobases attached to a polyamide backbone. Nucleic acids can be single-stranded or double-stranded. Nucleic acids can also be called "oligonucleotides."

[0045] The term "transcription factor response element" as used herein has its general and usual meaning in the context of the present specification, including but not limited to, a short DNA sequence in a gene promoter region that can bind to a specific transcription factor and control the transcription of the gene. Under stress conditions, transcription activator proteins bind to the transcription factor response element and stimulate transcription. Transcription factor response elements are short DNA regions (50-1500 bp) to which proteins (activators) can bind, and can increase, promote, or enhance the likelihood or amount of transcription of a specific gene by binding to the transcription factor response element. Such activator proteins are usually called transcription factors. Enhancers are usually cis-acting, located up to 1 Mbp (1,000,000 bp) away from the target gene, upstream or downstream of the transcription start site, and in forward or reverse orientation. Enhancers may be located upstream or downstream of the gene to be controlled. In some embodiments, multiple enhancer regions may be used to increase the amount of transcription, for example, multimerized activation binding domains may be used to further enhance or increase the amount of transcription. Furthermore, enhancers do not need to be located near the transcription start site to affect transcription, as some researchers have found that enhancers are located hundreds of thousands of base pairs upstream or downstream from the transcription start site. Enhancers do not act on the promoter region itself, but bind to activator proteins. The activator proteins interact with the mediator complex, recruiting polymerase II and basic transcription factors to initiate transcription of the gene. Enhancers may be present within an intron. The orientation of the enhancer may be reversed, and the function is not affected by the reverse orientation. Furthermore, enhancers may be truncated or inserted at any location in the chromosome, and such treatments can still affect the transcription of the gene. An example of an enhancer binding region is the TCR alpha enhancer. In some embodiments, the enhancer region in the embodiments described herein is the TCR alpha enhancer.

[0046] The term "transcriptional activator region" or "transcriptional activation region" as used herein has its common and ordinary meaning in the context of this specification, including, but not limited to, specific DNA sequences to which transcription factors can bind, which can control the rate of transcription of genetic information from DNA to messenger RNA. Specific examples of transcription factors include, but are not limited to, SP1, AP1, C / EBP, heat shock factor, ATF / CREB, c-Myc, Oct-1 and / or NF-1.

[0047] The "chimeric antigen receptor (CAR)" as described herein is also known as a chimeric T cell receptor, which term has its general and ordinary meaning in the context of the present specification, including, but not limited to, an artificial T cell receptor or a genetically engineered receptor that can be grafted with a desired specificity onto an effector immune cell. A CAR may be a synthetically engineered receptor that includes a ligand binding domain of an antibody sequence or other protein sequence that binds to a molecule associated with the disease or disorder, and the ligand binding domain is linked via a spacer domain to one or more intracellular signaling domains (e.g., costimulatory domains) derived from a T cell receptor or other receptor. In some embodiments, a cell (e.g., a mammalian cell) is generated that includes a chimeric antigen receptor. The chimeric antigen receptor can be used to graft, for example, the specificity of a monoclonal antibody or binding portion thereof onto a T cell. In some embodiments of the present invention, the genetically engineered cell further includes a sequence encoding a chimeric antigen receptor. In some embodiments, the chimeric antigen receptor is specific for a molecule on a tumor cell. A genetically engineered cell expressing a T cell receptor or a chimeric antigen receptor can be used to target a specific tissue.

[0048] A "ligand" as used herein refers to a substance capable of forming a complex with a biomolecule. Examples of ligands include, but are not limited to, substrates, proteins, small molecules, inhibitors, activators, nucleic acids, and neurotransmitters. Ligands bind by intermolecular forces, such as ionic bonds, hydrogen bonds, and van der Waals interactions. Binding of a ligand to a receptor protein causes a change in the three-dimensional structure, which allows the ligand to exert its function. The binding strength of a ligand, also referred to as binding affinity, is determined by direct interaction and dissociation effects. A ligand may be bound by a "ligand binding domain." A "ligand binding domain" may refer to, for example, a conserved sequence found in a structure that can bind a particular ligand or a particular epitope on a protein. A ligand binding domain or ligand binding portion may include an antibody or binding fragment thereof or scFv, a ligand or variant thereof for a receptor, a peptide, and / or a polypeptide affinity molecule or polypeptide binding partner. A ligand binding domain may be, but is not limited to, a particular protein domain or epitope on a protein that is specific for one or more ligands.

[0049] "PMA" or "phorbol 12-myristate 13-acetate" is a diester of phorbol and is a potent tumor promoter that is often used in biomedical research to activate the signaling enzyme protein kinase C (PKC). In the embodiments described herein, PMA is used to induce an inducible synthetic promoter.

[0050] Lonomycin is an ionophore produced by the bacterium Streptomyces conglobatus. 2+ It has been used in research to increase intracellular concentrations of Ca across biological membranes. 2+It is also used as a research tool to understand the delivery of cytokines. Lonomycin is also commonly used in combination with PMA to stimulate intracellular production of cytokines (interferon, perforin, IL-2 and / or IL-4). In an embodiment of the invention, lonomycin is used to induce an inducible synthetic promoter.

[0051] "Minimal promoters" are used to keep the amount of transcription of target genes low. Minimal promoters have the critical sequences that specify the transcription start site, but do not strongly recruit RNA polymerase or transcription factors, and therefore induce only weak transcription activation. In an embodiment of the present invention, the minimal promoter sequence is the minimal IL2 promoter sequence, which is a TATA box-containing fragment of the IL2 promoter (-70 to +47). Prior to construction and use of the minimal IL-2 promoter, a commercially available minimal promoter was tested in an inducible gene expression construct. This commercially available minimal promoter was shown to function in cell lines but not in primary T cells.

[0052] A "protein" is a macromolecule that includes one or more polypeptide chains. A protein may further include non-peptide components, such as a carbohydrate group. The addition of a carbohydrate or other non-peptide substituent to a protein may be performed by the cell that produces the protein, and depends on the type of cell. In the present specification, a protein is defined by the structure of its amino acid backbone, and substituents such as a carbohydrate group are not specifically defined, but such substituents may be included in the protein. In some embodiments, a cell is provided that includes a vector that includes a gene encoding a protein, an antibody or a binding fragment thereof, a growth-promoting molecule, or a molecule capable of eradicating a tumor.

[0053] As used herein, "antibody" refers to a large Y-shaped protein produced by plasma cells that functions in the immune system to identify and neutralize foreign substances such as bacteria and viruses. An antibody protein may contain four polypeptide chains, i.e., two identical heavy chains and two identical light chains linked by disulfide bonds. Each heavy and light chain is composed of structural domains called immunoglobulin domains. These domains can contain approximately 70-110 amino acids and are classified into various categories based on their size and function.

[0054] As used herein, "growth-promoting molecules" refer to chimeric cytokine receptors, such as CCR(CD122), CCR(CD127), CCR(CD360); caSTAT5; miRNAs, such as miRNA155; dnSHP1; dnSHP2; PD1 chimeras, such as PD1:MyD88 and PD1:CD28; and CD200:CD28. In some embodiments of the invention, synthesis of the growth-promoting molecules is induced by an inducible synthetic promoter.

[0055] The term "inducible synthetic promoter library" as used herein has its common and ordinary meaning in the context of the present specification, including, but not limited to, a promoter library inducible by CAR activation, a promoter library inducible by T cell exhaustion, a promoter library inducible by the tumor microenvironment, and a promoter library inducible by hypoxia.

[0056] The term "inducible synthetic promoter (iSynPro)" as used herein has its common and ordinary meaning in the context of the present specification, including, but not limited to, a promoter library inducible by CAR activation, a promoter library inducible by T cell exhaustion, a promoter library inducible by the tumor microenvironment, and a promoter library inducible by hypoxia.

[0057] As used herein, "T cell precursor" refers to a lymphoid precursor cell that can migrate to the thymus and become a T cell precursor, which does not express a T cell receptor. All T cells originate from hematopoietic stem cells in the bone marrow. Hematopoietic stem cell-derived hematopoietic precursor cells (lymphoid precursor cells) colonize the thymus and proliferate by cell division, generating a large population of immature thymocytes. The earliest thymocytes express neither CD4 nor CD8 and are therefore double negative (CD4 - CD8 - ) cells. As development progresses, these are classified as double positive thymocytes (CD4 + CD8 + ) and finally became single positive (CD4 + CD8 - or CD4 - CD8 + ) They mature into thymocytes and are then released from the thymus into peripheral tissues.

[0058] The term "CD19" as used herein has a general and ordinary meaning in the context of the present specification, including, but not limited to, a protein present on the surface of leukocytes that can associate with the antigen receptor of B lymphocytes to lower the threshold of antigen receptor-dependent stimulation. CD19 is expressed on follicular dendritic cells and B cells. CD19 is found from the earliest stage of B lineage cells in the process of developing into B lymphoblasts, but is lost when maturing into plasma cells. CD19 mainly acts as a B cell co-receptor together with CD21 and CD81. When CD19 is activated, its intracellular tail is phosphorylated, and Src family kinases bind to the phosphorylated CD19 and recruit PI-3 kinase. As in the case of T cells, several B cell surface molecules form antigen receptors and form a complex on B lymphocytes.

[0059] Mutations in CD19 are associated with severe immunodeficiency syndromes characterized by reduced antibody production. For example, aberrant expression of CD19 is a monocytic marker in acute myeloid leukemia. Because CD19 is a hallmark of B cells, this protein can be used to diagnose cancers arising from B cells, especially B cell lymphomas. Since 2011, clinical trials of CD19-targeted therapies have been initiated. Most experimental anti-CD19 drugs currently in development work by exploiting the presence of CD19 to specifically target therapies to B cell cancers. Meanwhile, CD19 has increasingly been found to play an active role in promoting the growth of B cell cancers by stabilizing the concentration of the MYC oncoprotein. Therefore, CD19 and its downstream signaling appear to be promising therapeutic targets.

[0060] A "subject" or "patient" as used herein refers to any organism to which the embodiments described herein may be used or administered, e.g., for experimental, diagnostic, prophylactic and / or therapeutic purposes. A subject or patient may include, for example, an animal. In some embodiments, the subject is a mouse, a rat, a rabbit, a non-human primate and / or a human. In some embodiments, the subject is a cow, a sheep, a pig, a horse, a dog, a cat, a primate or a human.

[0061] As used herein, "cytokine" refers to small proteins (5-25 kDa) that play an important role in cell signaling. Cytokines are released by cells and affect the behavior of other cells and sometimes the behavior of the cell that released them (e.g., T cells). Cytokines include, for example, chemokines, interferons, interleukins, lymphokines, and / or tumor necrosis factors. Cytokines are produced by a variety of cells, including, for example, immune cells such as macrophages, B lymphocytes, T lymphocytes, and / or mast cells, as well as endothelial cells, fibroblasts, and / or various stromal cells.

[0062] Cytokines can act through receptors. They are important for the immune system because they can regulate the balance between humoral and cellular immune responses, as well as the maturation, proliferation, and responsiveness of specific cell populations. Some cytokines enhance or inhibit the action of other cytokines in complex ways. Examples of cytokines include acylated stimulatory proteins, adipokines, albinterferon, CCL1, CCL11, CCL12, CCL13, CCL14, CCL15, CCL16, CCL17, CCL18, CCL19, CCL2, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CCL27, CCL28, CCL3, CCL5, CCL6, CCL7, CCL8, CCL9, chemokines, colony stimulating factors, and inflammatory cytokines. CX3CL1, CX3CR1, CXCL1, CXCL10, CXCL11, CXCL13, CXCL14, CXCL15, CXCL16, CXCL17, CXCL2, CXCL3, CXCL5, CXCL6, CXCL7, CXCL9, erythropoietin, Gc-MAF, granulocyte colony-stimulating factor, granulocyte-macrophage colony-stimulating factor, hepatocyte growth factor, IL10 cytokine family, IL17 cytokine family, IL1A, IL1B, inflammasome Interferome, Interferon, Interferon beta 1a, Interferon beta 1b, Interferon gamma, Type I interferon, Type II interferon, Type III interferon, Interleukin, Interleukin 1 family, Interleukin 1 receptor antagonist, Interleukin 10, Interleukin 12, Interleukin 12 beta subunit, Interleukin 13, Interleukin 15, Interleukin 16, Interleukin 2, Interleukin 23, Interleukin 23 alpha subunit, Interleukin 34, Interleukin 35, Interleukin 6, Interleukin 7, Interleukin 8, Interleukin 36, Leukemia inhibitory factor, Leukocyte promoting factor, Lymphokine, Lymphotoxin, Lymphotoxin alpha, Lymphotoxin beta, Macrophage colony stimulating factor, Macrophage inflammatory protein, Macrophage activating factor, Monokine, Myokine,These may include, but are not limited to, myonectin, nicotinamide phosphoribosyltransferase, oncostatin M, oprelvekin, platelet factor 4, proinflammatory cytokines, promegapoietin, RANKL, stromal cell-derived factor 1, talimogene laherparepvec, tumor necrosis factor alpha, tumor necrosis factor, XCL1, XCL2, GM-CSF, and / or XCR1.

[0063] As used herein, "interleukins" or ILs are cytokines that play a major role in the immune system. Interleukins that can be used in the present invention include, for example, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8 / CXCL8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, IL-34, IL-35, and / or IL-36. Contacting T cells with an interleukin may have the effect of promoting, supporting, inducing, or improving the transplant compatibility of T cells. IL-1 can function, for example, in T cell maturation and proliferation. IL-2 can stimulate, for example, proliferation and differentiation of T cell responses. IL-3 can promote, for example, differentiation and proliferation of myeloid progenitor cells. IL-4 can promote, for example, proliferation and differentiation. IL-7 can promote, for example, differentiation and / or proliferation of lymphoid progenitor cells involved in the survival, development and / or homeostasis of B cells, T cells and NK cells. IL-15 can induce, for example, the development of natural killer cells. IL-21 can, for example, costimulate the activation and / or proliferation of CD8+ T cells, enhance the cytotoxicity of NK cells, enhance the proliferation, differentiation and / or isotype switching of B cells by induction of CD40, and / or promote the differentiation of Th17 cells.

[0064] A "vector", "expression vector" or "construct" is a nucleic acid used to introduce heterologous nucleic acid into a cell, and contains various regulatory elements, allowing the expression of the heterologous nucleic acid in the cell. Vectors include, but are not limited to, plasmids, minicircles, yeast and / or viral genomes. In some embodiments, the vector is a plasmid, minicircle, yeast or viral genome. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is a lentivirus. In some embodiments, the vector is a vector for protein expression in bacterial systems such as E. coli. In some embodiments, the vector is a lentiviral vector. In some embodiments, the vector is a foamy virus vector, an adenovirus vector, a retrovirus vector, or a lentivirus vector. In some embodiments, the vector is a vector for protein expression in bacterial systems such as E. coli. In some embodiments, the vector is a lentiviral vector, a transposase-based minicircle or a nanoplasmid.

[0065] As used herein, "combination therapy" refers to the use of two or more drugs or therapies to treat a disease. Combination therapy can also refer to the use of multiple therapies, for example, to treat a single disease, and multiple pharmaceutical preparations are often used together for this purpose. Combination therapy can also include the administration of two or more active ingredients by formulating and administering separate drugs. In some embodiments, a combination therapy is provided. In some embodiments, the combination therapy further includes administering CAR-expressing T cells to a subject (e.g., a human) in need thereof.

[0066] A "chemotherapeutic agent" is a class of anti-cancer medicines that may be used, such as chemicals (e.g., anti-cancer drugs (chemotherapeutic agents)) that can be administered as part of a standardized chemotherapy regimen. Chemotherapy agents may be administered with a curative intent or with the intent of prolonging survival or alleviating symptoms (palliative chemotherapy). Chemotherapy may further include hormonal therapy and targeted therapy, which are one of the major categories of medical oncology (cancer chemotherapy). These chemotherapy agents are often combined with other cancer therapies, such as radiation therapy, surgery, and / or hyperthermia. In a small number of cases, surgery has been known to cause cancer to spread. In some embodiments, genetically modified immune cells are administered to the tumor site before or after the surgical procedure.

[0067] Some of the recently developed anti-cancer drugs (e.g., various monoclonal antibodies, their humanized antibodies, and / or their binding fragments) are not indiscriminately cytotoxic but target proteins that are aberrantly expressed in cancer cells and essential for their proliferation. Such treatments are often called targeted therapies (as distinct from classical chemotherapy) and are often combined with conventional chemotherapeutic agents in anti-tumor protocols. In some embodiments, the method of the present invention may further include administering one or more of such targeted anti-cancer therapies (e.g., various monoclonal antibodies, their humanized antibodies, and / or their binding fragments).

[0068] In chemotherapy, a chemotherapeutic agent is administered, and one type of agent may be used in one chemotherapy (single agent chemotherapy) or multiple types of agents may be used simultaneously (combination chemotherapy or polychemotherapy). Chemotherapy combined with radiation therapy is called chemoradiotherapy. Chemotherapy using agents that are converted into substances that exert cytotoxic activity when exposed to light is called photochemotherapy or photodynamic therapy. In some embodiments of the method comprising administering the cells described herein, the method can further comprise administering the cells to a subject having cancer, followed by administering the cells to the subject with photochemotherapy or photodynamic therapy.

[0069] Chemotherapeutic agents include, but are not limited to, antibody-drug conjugates (e.g., an antibody or binding fragment thereof attached to a drug by a linker), nanoparticles (which may be, for example, 1-1000 nm particles that promote tumor selectivity and aid in the delivery of low solubility drugs), electrochemotherapy, alkylating agents, antimetabolites (e.g., 5-fluorouracil (5-FU), 6-mercaptopurine (6-MP), capecitabine (Xeloda®), cladribine, clofarabine, cytarabine (Ara-C®), floxuridine, fludarabine, gemcitabine (Gemzar®), hydroxyurea, methotrexate, pemetrexed (Alimta®), pentostatin and / or thioguanine), antitumor antibiotics, topoisomerase inhibitors, mitotic inhibitors, corticosteroids, DNA intercalators, and checkpoint inhibitors (e.g., checkpoint kinases CHK1 or CHK2). In some embodiments of the methods described herein, the genetically modified immune cells, or compositions comprising the genetically modified immune cells, are administered in combination with one or more anti-cancer agents, such as one or more of the compounds or therapies described above. In some embodiments, the one or more anti-cancer agents co-administered or administered in combination with the genetically modified immune cells include antibody-drug conjugates, nanoparticles, electrochemotherapy, alkylating agents, antimetabolites, antitumor antibiotics, topoisomerase inhibitors, mitotic inhibitors, corticosteroids, DNA intercalators, or checkpoint inhibitors. In some embodiments, the antimetabolite comprises 5-fluorouracil (5-FU), 6-mercaptopurine (6-MP), capecitabine (Xeloda®), cladribine, clofarabine, cytarabine (Ara-C®), floxuridine, fludarabine, gemcitabine (Gemzar®), hydroxyurea, methotrexate, pemetrexed (Alimta®), pentostatin, or thioguanine.

[0070] "Cancer" as referred to herein may refer to a malignant tumor or neoplasm involving the proliferation of abnormal cells that may invade or spread to other sites in the body. In some embodiments, a method of treating, ameliorating or inhibiting a disease or infection in a subject is provided, comprising delivering to the subject cells produced according to any of the embodiments described herein. In some embodiments, the subject is afflicted with cancer. In some embodiments, the subject is a subject selected for administration of cancer therapy. In some embodiments, the cancer comprises adrenal gland cancer, bile duct cancer, bladder cancer, bone cancer, brain cancer, breast cancer, Castleman's disease, cervical cancer, colon cancer, endometrial cancer, esophageal cancer, Ewing's sarcoma family tumors, eye cancer, gallbladder cancer, gastrointestinal carcinoid tumors, Hodgkin's disease, Kaposi's sarcoma, kidney cancer, laryngeal and hypopharyngeal cancer, leukemia, liver cancer, lung cancer, lymphoma, multiple myeloma, malignant mesothelioma, myelodysplastic syndrome, nasopharyngeal cancer, osteosarcoma, ovarian cancer, pancreatic cancer, pituitary tumor, prostate cancer, retinoblastoma, skin cancer, small intestine cancer, gastric cancer, testicular cancer, thymic cancer, thyroid cancer, or uterine sarcoma.

[0071] A synthetic promoter library was created by randomly ligating multiple transcription factor response elements (TREs) constructed upstream of a known minimal IL2 promoter (IL2mp), and the synthetic promoters were screened by reporter gene expression upon CAR activation in chimeric antigen receptor (CAR) gene-modified T cells. The method of constructing a library for this assay is illustrated in FIG. 5. In this figure, a method of screening promoters that are activated by CAR T cell activation is shown. The function of an inducible synthetic promoter (iSynPro) is shown in FIG. 3. DNA was extracted from the sorted cells and sequenced. The top candidates of the obtained promoter sequences were then synthesized and verified in the same system as described above. The identified or selected promoter (also referred to as Syn-i-Pro in this disclosure) was found to be inducible by CAR activation, inducible by CD3 / CD28, or inducible by chemicals (e.g., PMA / lonomycin). For example, the promoter is inducible by beads containing CD3, beads containing CD28, or beads containing both CD3 and CD28 (FIG. 27). The gene expression under the control of Syn-i-Pro did not decrease significantly even after multiple (at least four) rounds of stimulation. This promoter is useful in CAR T cell therapy, for example, when it is necessary to selectively express a desired molecule in CAR T cells while avoiding side effects seen when using constitutive expression.

[0072] Traditionally, inducible NFAT promoters have been used in T cell therapy, but the inducible promoters (Syn-i-Pro promoters) constructed by the methods described herein showed stronger reporter signals than the endogenous and unmodified NFAT promoters. In some embodiments, the inducible NFAT promoters constructed by the methods described herein showed a significantly higher signal-to-noise ratio than the endogenous and unmodified NFAT promoters, and some of the promoters constructed using the methods described herein could be repeatedly turned on. As shown in FIG. 4, only weak induction was obtained using the NFAT promoter in CD8 cells. The Syn-i-Pro promoters constructed using the methods described herein can be used in CAR T cells to control the expression of molecules that may cause side effects when constitutively expressed, as well as to limit or prevent the expression of molecules before the CAR T cells interact with the desired antigen.

[0073] In some embodiments, the Syn-i-Pro promoter constructed using the methods described herein may have a relatively high basal level of expression. A Syn-i-Pro promoter with a low basal level of expression can be created by constructing a minimal promoter sequence or by using a transposase-based minicircle or nanoplasmid instead of a lentivirus-based expression system. One advantage of activating the gene expression of the Syn-i-Pro promoter described herein with CAR is that it does not require the use of drugs and does not cause side effects because it utilizes CAR activation. The methodology used and further embodiments are described in the following further embodiments.

[0074] Further embodiments In some embodiments, a method of making an inducible synthetic promoter library is provided, the method comprising: screening a promoter that is activated by activation of chimeric antigen receptor (CAR) T cells to generate a screened promoter; screening a transcription factor responsive element to generate a screened transcription factor responsive element; generating an inducible synthetic promoter library comprising a promoter that is activated by activation of the transcription factor responsive element by the CAR T cells; and synthesizing an oligonucleotide comprising a first sequence encoding the screened transcription factor responsive element and a second sequence encoding the screened promoter.

[0075] In some embodiments, an inducible synthetic promoter is provided, the inducible synthetic promoter comprising: a first sequence encoding a transcription factor response element; and a second sequence encoding a promoter sequence, optionally comprising one or more of SEQ ID NOs: 1-39. In some embodiments, the inducible synthetic promoter is inducible by activation of a chimeric antigen receptor. In some embodiments, the inducible synthetic promoter is inducible by binding of the chimeric antigen receptor to a ligand. In some embodiments, the inducible synthetic promoter is inducible by interaction with CD3 / CD28. In some embodiments, the CD3 / CD28 is bound to a bead. In some embodiments, the inducible synthetic promoter is inducible by a chemical. In some embodiments, the chemical is PMA or lonomycin. In some embodiments, the promoter comprises an endogenous minimal IL2 promoter sequence. In some embodiments, the inducible synthetic promoter comprises a sequence as set forth in any one of SEQ ID NOs: 1-39. In some embodiments, the inducible synthetic promoter comprises a sequence having 80%, 85%, 90%, or 90% sequence identity, or a range of sequence identity between any two of these percentages, to any one of SEQ ID NOs: 1-39. In some embodiments, the transcription factor responsive element is E2F1, EGR1, HIF1A, NFAT, LEF1, SP1, PU.1, NFKB, JUN, FOS, and / or STAT4.

[0076] In some embodiments, a cell for expressing a molecule is provided, the cell comprising a vector comprising an inducible synthetic promoter according to any of the embodiments of the present invention; a gene encoding the molecule; and a sequence encoding a chimeric antigen receptor. The inducible synthetic promoter comprises a first sequence encoding a transcription factor response sequence; and a second sequence encoding a promoter sequence, optionally comprising one or more of SEQ ID NOs: 1-39. In some embodiments, the inducible synthetic promoter is inducible by activation of a chimeric antigen receptor. In some embodiments, the inducible synthetic promoter is inducible by binding of the chimeric antigen receptor to a ligand. In some embodiments, the inducible synthetic promoter is inducible by interaction with anti-CD3 / anti-CD28. In some embodiments, the anti-CD3 / anti-CD28 is bound to beads. In some embodiments, the inducible synthetic promoter is inducible by a chemical. In some embodiments, the chemical is PMA or lonomycin. In some embodiments, the promoter comprises an endogenous minimal IL2 promoter sequence. In some embodiments, the inducible synthetic promoter comprises a sequence as set forth in any one of SEQ ID NOs: 1-39. In some embodiments, the inducible synthetic promoter comprises a sequence having 80%, 85%, 90% or 90% sequence identity with any one of SEQ ID NOs: 1-39, or a sequence identity within a range between any two of these percentages. In some embodiments, the transcription factor response element is E2F1, EGR1, HIF1A, NFAT, LEF1, SP1, PU.1, NFKB, JUN, FOS and / or STAT4. In some embodiments, the molecule is a protein, an antibody or binding fragment thereof, a growth promoting molecule or a molecule capable of eradicating a tumor. In some embodiments, the cell is a hematopoietic stem cell. In some embodiments, the chimeric antigen receptor is specific for CD19. In some embodiments, the cell is CD8+ or CD4+. In some embodiments, the expression of the molecule is inducible expression.In some embodiments, the chimeric antigen receptor (CAR) comprises a signaling domain. In some embodiments, the CAR comprises a spacer. In the chimeric antigen receptor, the spacer may comprise, for example, any of 20 amino acids in any order to form a polypeptide chain of desired length, including arginine, histidine, lysine, aspartic acid, glutamic acid, serine, threonine, asparagine, glutamine, cysteine, glycine, proline, alanine, valine, isoleucine, methionine, phenylalanine, tyrosine, and / or tryptophan. The spacer sequence may be a linker connecting the scFV and the transmembrane domain in the chimeric antigen receptor. In some embodiments, the signaling domain is first generation, second generation, or third generation. In some embodiments, the vector is a lentiviral vector, a transposase-based minicircle, or a nanoplasmid. In some embodiments, the cell further comprises a TCR knockout system for CAR-specific activation. In some embodiments, the molecule is CCR (CD122), CASTAT5, PD1:CD28 and / or miRNA. In some embodiments, the molecule is a chimeric cytokine receptor. In some embodiments, the chimeric cytokine receptor comprises CCR, CASTAT5, PD1 chimera and / or miRNA. In some embodiments, the miRNA comprises miRNA155. In some embodiments, the CCR comprises CD122, CD127 or CD360. In some embodiments, the PD1 chimera comprises PD1:CD28, dnSHP1 / 2 and / or IL-12.

[0077] In some embodiments, a method of controlling gene expression in chimeric antigen receptor (CAR) T cell therapy is provided, comprising providing a cell according to any of the embodiments of the present invention, and introducing the cell into a subject in need of CAR T cell therapy. The cell comprises a vector comprising an inducible synthetic promoter according to any of the embodiments of the present invention; a gene encoding a molecule; and a sequence encoding a chimeric antigen receptor. The inducible synthetic promoter comprises a first sequence encoding a transcription factor response sequence; and a second sequence encoding a promoter sequence, optionally comprising one or more of SEQ ID NOs: 1-39. In some embodiments, the inducible synthetic promoter is inducible by activation of a chimeric antigen receptor. In some embodiments, the inducible synthetic promoter is inducible by binding of the chimeric antigen receptor to a ligand. In some embodiments, the inducible synthetic promoter is inducible by interaction with anti-CD3 / anti-CD28. In some embodiments, the anti-CD3 / anti-CD28 is bound to beads. In some embodiments, the inducible synthetic promoter is inducible by a chemical. In some embodiments, the chemical is PMA or lonomycin. In some embodiments, the promoter comprises an endogenous minimal IL2 promoter sequence. In some embodiments, the inducible synthetic promoter comprises a sequence set forth in any one of SEQ ID NOs: 1-39. In some embodiments, the inducible synthetic promoter comprises a sequence having 80%, 85%, 90% or 90% sequence identity or a range of sequence identity between any two of these percentages to a sequence set forth in any one of SEQ ID NOs: 1-39. In some embodiments, the transcription factor response element is E2F1, EGR1, HIF1A, NFAT, LEF1, SP1, PU.1, NFKB, JUN, FOS and / or STAT4. In some embodiments, the molecule is a protein, an antibody or binding fragment thereof, a growth promoting molecule or a molecule capable of eradicating a tumor. In some embodiments, the cell is a hematopoietic stem cell.In some embodiments, the chimeric antigen receptor is specific for CD19. In some embodiments, the cell is CD8+ or CD4+. In some embodiments, the expression of the molecule is inducible. In some embodiments, the CAR comprises a signaling domain. In some embodiments, the CAR comprises a spacer. In the chimeric antigen receptor, the spacer may comprise, for example, any of 20 amino acids in any order to form a polypeptide chain of a desired length, including arginine, histidine, lysine, aspartic acid, glutamic acid, serine, threonine, asparagine, glutamine, cysteine, glycine, proline, alanine, valine, isoleucine, methionine, phenylalanine, tyrosine, and / or tryptophan. The spacer sequence may be a linker connecting the scFV and the transmembrane domain in the chimeric antigen receptor. In some embodiments, the signaling domain is first generation, second generation, or third generation. In some embodiments, the vector is a lentiviral vector, a transposase-based minicircle, or a nanoplasmid. In some embodiments, the cells further comprise a TCR knockout system for CAR-specific activation. In some embodiments, the molecule is CCR (CD122), CASTAT5, PD1:CD28, and / or miRNA. In some embodiments, the method further comprises monitoring the subject's response to the molecule expressed under the control of the inducible synthetic promoter. In some embodiments, the subject is further monitored for expression of the molecule expressed under the control of the inducible synthetic promoter. In some embodiments, the molecule is a protein, an antibody or binding fragment thereof, a cytokine, or an anti-cancer therapeutic. In some embodiments, the method further comprises inducing expression of the molecule. In some embodiments, the induction is by administration of PMA or lonomycin.In some embodiments, the induction step is performed prior to administering the cells to the subject, and the cells are exposed to anti-CD3 / anti-CD28 beads prior to administration. In some embodiments, the subject is suffering from or diagnosed with cancer. In some embodiments, the molecule is CCR (CD122), CASTAT5, PD1:CD28 and / or miRNA. In some embodiments, the molecule is a chimeric cytokine receptor. In some embodiments, the chimeric cytokine receptor comprises CCR, CASTAT5, PD1 chimera and / or miRNA. In some embodiments, the miRNA comprises miRNA155. In some embodiments, the CCR comprises CD122, CD127 or CD360. In some embodiments, the PD1 chimera comprises PD1:CD28, dnSHP1 / 2 and / or IL-12.

[0078] In some embodiments, a method of alleviating, suppressing or treating a disease (e.g., any one or more of leukemia, breast cancer, gastric cancer, esophageal cancer, brain cancer, uterine cancer, prostate cancer, bone cancer, liver cancer, pancreatic cancer, ovarian cancer, lung cancer, colon cancer, kidney cancer, bladder cancer, uterine cancer or thyroid cancer) in a subject in need thereof is provided, comprising the steps of obtaining a cell comprising an inducible synthetic promoter and a chimeric antigen receptor according to any of the embodiments of the present invention by introducing a vector into the cell; administering the cell to the subject; and inducing expression of a molecule. The inducible synthetic promoter comprises a first sequence encoding a transcription factor responsive element; and a second sequence encoding a promoter sequence, optionally comprising one or more of SEQ ID NOs: 1-39. In some embodiments, the inducible synthetic promoter is inducible by activation of a chimeric antigen receptor. In some embodiments, the inducible synthetic promoter is inducible by binding of the chimeric antigen receptor to a ligand. In some embodiments, the inducible synthetic promoter is inducible by interaction with anti-CD3 / anti-CD28. In some embodiments, the anti-CD3 / anti-CD28 is bound to beads. In some embodiments, the inducible synthetic promoter is inducible by a chemical. In some embodiments, the chemical is PMA or lonomycin. In some embodiments, the promoter comprises an endogenous minimal IL2 promoter sequence. In some embodiments, the inducible synthetic promoter comprises a sequence set forth in any one of SEQ ID NOs: 1-39. In some embodiments, the inducible synthetic promoter comprises a sequence having 80%, 85%, 90% or 90% sequence identity or a range of sequence identity between any two of these percentages to a sequence set forth in any one of SEQ ID NOs: 1-39. In some embodiments, the transcription factor response element is E2F1, EGR1, HIF1A, NFAT, LEF1, SP1, PU.1, NFKB, JUN, FOS and / or STAT4. In some embodiments, the cells are obtained from the subject.In some embodiments, the method further comprises monitoring the subject's response to the molecule expressed under the control of the inducible synthetic promoter. In some embodiments, the molecule is a protein, an antibody or binding fragment thereof, a cytokine, or an anti-cancer therapeutic. In some embodiments, the method further comprises inducing expression of the molecule. In some embodiments, the inducing is performed by administration of PMA or lonomycin. In some embodiments, the inducing step is performed prior to administering the cells to the subject, and the cells are exposed to anti-CD3 / anti-CD28 beads prior to administration. In some embodiments, the subject is afflicted with cancer. In some embodiments, the molecule is a chimeric cytokine receptor (such as CCR (CD122, CD127, and CD360)), CASTAT5, PD1 chimera (such as PD1:CD28), dnSHP1 / 2, IL-12, and / or miRNA (such as miRNA155). In some embodiments, the subject is a subject selected for administration of a cancer therapy. In some embodiments, the cancer is leukemia, breast cancer, gastric cancer, esophageal cancer, brain cancer, uterine cancer, prostate cancer, bone cancer, liver cancer, pancreatic cancer, ovarian cancer, lung cancer, colon cancer, kidney cancer, bladder cancer, uterine cancer, or thyroid cancer. In some embodiments, the subject is a subject selected for performing combination therapy. In some embodiments, the molecule is a chimeric cytokine receptor. In some embodiments, the chimeric cytokine receptor comprises CCR, CASTAT5, PD1 chimera, and / or miRNA. In some embodiments, the miRNA comprises miRNA155. In some embodiments, the CCR comprises CD122, CD127, or CD360. In some embodiments, the PD1 chimera comprises PD1:CD28, dnSHP1 / 2, and / or IL-12.

[0079] Embodiment 1. Only weak induction is obtained using the NFAT promoter in CD8 cells To obtain a promoter useful for controlling gene expression in CAR T cell therapy, we attempted to create a synthetic promoter. As shown in Figure 1, by using drugs, the expression of the transgene (such as the expression of CAR or TCR in T cells) can be controlled on and off, or activation can be turned on.

[0080] It is also contemplated that synthetic promoter libraries can be designed for screening to isolate promoters that are activated upon CAR T cell activation (Figure 5). Genes and transcription factors that are upregulated upon T cell activation can be identified by mRNA analysis and identified as transcription response elements (TREs) (Figure 6).

[0081] A global relative gene expression profile of CD8 T cells activated through TCR was previously reported by Blair et al. (Best, Blair et al. 2013; incorporated herein by reference in its entirety). By searching the TRED and TRANSFAC databases, 11 transcription factors were selected that were confirmed to regulate genes related to CD8 T cell activation. The selected genes were E2F1, EGR1, FOS, HIF1a, JUN, NFAT, LEF1, NFkB, SP1, PU.1 and STAT4. The corresponding TRE sequences were obtained from the JASPAR database and synthesized.

[0082] The genes encoding each TRE may be ligated into a vector together with a promoter to induce expression of the CAR or TCR (Figure 7). As shown in Figure 8, depending on the type of promoter, several TREs may be expressed depending on the frequency of the TREs.

[0083] As shown in Figure 6, the global relative gene expression profile of CD8 T cells activated through TCR has been reported previously (Best, Blair et al., 2013). Genes that were significantly upregulated by CD8 T cell activation were selected. Eleven transcription factors that were confirmed to regulate these genes were selected by searching the TRED and TRANSFAC databases. The selected genes were E2F1, EGR1, FOS, HIF1a, JUN, NFAT, LEF1, NFkB, SP1, PU.1 and STAT4. The corresponding TRE sequences were obtained from the JASPAR database and synthesized.

[0084] According to previous reports, a synthetic promoter library was created by annealing the sense and antisense oligonucleotides of each TRE, and randomly ligating the resulting double strands of each TRE as "building blocks" (Brown A., 2014; this document is incorporated by reference in its entirety) (Figure 7). The CARs used in clinical trials were mainly second-generation 4-1BB-CD3ζ CARs. NFkB is known to be a transcription factor downstream of 4-1BB, and since 4-1BB was used as the intracellular signaling domain, a relatively large amount of NFkB was recruited as a building block. Two cloning units containing restriction enzyme cleavage sites were also introduced into the library, which allowed cloning into a plasmid vector and adjusted the size of the ligation product. Thus, the pool of reactions by random ligation contained a 2-fold ratio of each TRE unit (but not the TRE of NFkB), a 6-fold ratio of NFkB units, and a 1-fold ratio of cloning units. When the dsDNA ligation library was digested with restriction enzymes, smears ranging from about 75 bp to about 500 bp were observed on an agarose gel, as expected, indicating that it was a diverse library.

[0085] To screen the library in primary T cells, the digested ligation library was inserted into an HIV7 transfer plasmid containing a fusion reporter gene of GFP and firefly luciferase (GFP:ffluc) and a minimal promoter of IL2 (IL2mp). The GFP:ffluc reporter gene has been used in our laboratory for both in vitro and in vivo assays. IL2mp has been reported to be used in several laboratories (Durand, Shaw et al., 1988; Fiering, Northrop, 1990; which are incorporated herein by reference in their entireties) and has been previously tested in our laboratory. As negative control constructs, a construct without a promoter and a construct containing only IL2mp were prepared, and as positive control constructs, a construct containing 6×NFAT-IL2mp and a construct containing 7×NFkB-IL2mp were prepared and used in the following screening. Before proceeding with virus packaging and screening, we analyzed the library to confirm that it was constructed as expected. A small amount of transformed E. coli cells was spread onto an agarose plate, and 10 colonies were picked, purified by mini-prep, and Sanger sequenced. The test results showed that 9 out of 10 clones contained promoters and 6 to 20 TREs integrated by random ligation. Each TRE was represented in at least one clone, with NFkB being the most frequent. This result was consistent with the mixing ratio of TREs in the ligation pool (Figure 8).

[0086] Cells expressing TCR under the control of the Syn-iPro synthetic promoter were analyzed by FACS to examine the expression of CD69 and GFP after contact with PMA / lonomycin or anti-CD3 / anti-CD28. As shown, the use of the Syn-iPro synthetic promoter induces the expression of CD69 and GFP under the control of the chemicals PMA / lonomycin (Figure 9).

[0087] The library of Syn-iPro synthetic promoters was screened in primary CD8 T cells (Figure 10). The second generation CD19CAR-T2A-EGFRt used in clinical trials was studied in detail and showed promising results. In light of this, the expression of the iSynPro library was triggered by co-transducing the second generation CD19CAR-T2A-EGFRt with the iSynPro library. To avoid selection of false positive sequences due to piggybacking effect, the library had to be transduced at a low MOI so that a single cell contained at most one iSynPro sequence. We also needed a cell line that contained a "resting" or "off" phase and a CAR-activated or "on" phase. To avoid sorting GFP-positive cells in the absence of constitutively active promoters or CAR, we used a flow cytometer / sorter to isolate only EGFRt-positive GFP-negative cells in the "resting" phase (7 days after removal of anti-CD3 / anti-CD28 beads). The isolated cells were then co-cultured with irradiated Tm-LCL (CD19+) cells to activate CD19CAR. After 24, 48, and 72 hours, GFP-positive cells that expressed GFP due to iSynPro activation were selected by gating on cells with moderate GFP expression and cells with high GFP expression. The remaining cells were cultured for another week and then co-cultured with Tm-LCL cells again. After 24 hours, GFP-positive cells were sorted.

[0088] As shown in Figure 11, cells were screened to determine the number of unique contigs expressed on days 1, 2, and 3, and after restimulation with PMA / lonomycin. Sample processing for DNA targeted sequencing is shown in Figure 23. Regions of interest were amplified by PCR and purified as shown. Illumina indexes and sequencing adapters were then added to the purified DNA sequences and a second round of PCR was performed. DNA MiSeq sequencing was then performed (Figure 24). Sequences were then analyzed to determine the total number of unique contigs per time point (Figure 11). The total number of unique contigs on days 1, 2, and 3, post-stimulation, and the day after restimulation are shown from left to right. The top 28 contigs for each pattern were used to analyze the unique expression patterns in the clones and evaluate the induction of expression by T cells bearing specific CARs.

[0089] CD8+ cells were also transfected with a first vector containing the Syn-iPro synthetic promoter linked to a minimal promoter (IL2mp) for expressing GFP. The cells were then co-transfected with a) a vector containing a nucleic acid expressing CD19 with EGFRt marker; or b) a vector containing a drug-inducible promoter, DHFRdm promoter, and a nucleic acid expressing CD19+ with EGFRt marker (Figure 12). Analysis of Syn-Pro expression can be performed by the method outlined in Figure 27. Cells were then harvested and protein expression was analyzed using a pull-down assay.

[0090] As shown in Figures 16 and 17, iSynPro may be activated through the interaction of CD19CAR with various CD19+ cells. From left to right, GFP expression is induced by interaction with Tm-LCL cells, K562 / CD19 cells, Raji cells, DHL-4 cells, SupB15 cells, Be2 / CD19 cells, K562 cells, or Be2 cells.

[0091] Additionally, cells were analyzed for expression of cytokines (IL-2, IFNγ and TNFα). As shown, CD80 / CD86 costimulatory factors alone did not induce cytokine release from cells. However, cells containing nucleic acid encoding Syn-iPro promoter were activated or stimulated by CD19+CAR T cells (Figure 18). As shown in Figure 19, cells expressing CD80 / CD86 costimulatory factors were not killed by CD19CAR T cells (top right panel, left middle panel and bottom left panel).

[0092] Next, a pilot study of iSynPro in vivo was performed using a Be2 / CD19 subcutaneous implantation model. Be2 cells were injected subcutaneously into the tail of mice as shown in Figure 20. On day 5, CD8 T cells were injected into the site where Be2 cells were injected. Mice were photographed on days 6, 7, 8, 9, and 12 (Figures 21 and 22).

[0093] Syn-iPro was tested in CD8 CAR T cells by co-transfecting cells with a) Syn-Pro-IL2mp-GFP vector and b) EF1a-CD19scFv-EGFRt vector (Figure 27). First, CD8 T cells were stimulated with CD3 / CD28 beads and transfected with virus. Then, irradiated Tm-LCL cells were co-cultured with CD8 CAR T cells on days 12, 13, 15, 26, 27, 28, 29, 41, 42 and 43. Then, cells were analyzed by FACS assay. As shown in Figure 28, Tm-LCL cells were stimulated with CD19CAR expressing cells. Also, as shown in Figure 28, cells stimulated with CD19 CAR only had the highest expression of EGFRt. Cells containing Syn iPro synthetic promoter S1-61-IL2mp had the highest expression of GFP after stimulation (Figure 31).

[0094] EMBODIMENT 2 Next-generation sequencing (NGS) analysis of DNA from sorted GFP+ cells yields over 200,000 unique promoter reads. Approximately 30 unique promoter read sequences from the top sequences (ranked by number of reads) were selected and tested in CAR T cells, and the majority of these were inducible promoters and performed better than the 6×NFAT promoter. The pool of sequences that were not tested is expected to contain additional functional sequences.

[0095] Throughout the promoter screening process, technical limitations and biases exist, limiting the diversity of the library at each step. For example, the number of library samples is reduced at each step, for example, during cloning of the library obtained by random ligation into the GFP:ffluc_HIV 7 plasmid, during packaging of the plasmid into lentivirus, and during recovery of DNA extracted from sorted cells for PCR amplification. On the other hand, sequence redundancy occurs at several steps where amplification occurs, for example, during transformation of E. coli cells with the GFP:ffluc_HIV7 plasmid, during lentivirus production in 293T cells, and during PCR for targeted sequencing. Only if the library is sequenced at each step (raw data from ligation, plasmid, and virus), can biases be known and removed from the sequencing results of sorted cells. In this way, the ranking of sorted cells becomes more meaningful. Unfortunately, however, sequencing of all libraries has not yet been completed. On the other hand, it is known that PCR favors short sequences, and long sequences are usually not amplified as efficiently as short sequences. Longer sequences may be ranked lower by the number of reads due to the two rounds of PCR amplification. Therefore, among the sequences analyzed by NGS Miseq from DNA from sorted cells that have not been tested, only patentable long promoter sequences (similar or longer than the currently most preferred promoter S-61) can be selected simply because they are not favorable for PCR amplification. Among the longer sequences, sequences that were observed at least at three or four time points were further selected. Here, the cutoff threshold for the number of reads is 100 (SEQ ID NOs. 34-39).

[0096] In some embodiments, a method for making an inducible synthetic promoter library is provided, comprising the steps of: sequencing the DNA of a cell containing a marker gene; screening a putative promoter; screening a transcription factor response element to produce a screened transcription factor response element; producing an inducible synthetic promoter library containing the putative promoter; and synthesizing an oligonucleotide comprising a first sequence encoding the screened transcription factor response element and a second sequence encoding the promoter. In some embodiments, the method is performed by next generation sequencing. In some embodiments, the promoter is tested in CAR T cells to evaluate CAR binding and CAR T signaling activation. In some embodiments, the screening comprises performing an assay to evaluate transcription or translation of a marker gene. In some embodiments, the promoter is sequenced after confirming the upregulation of a marker gene, and tested for activation in response to CAR T cells interacting with a ligand. In some embodiments, the CAR T cell interaction upregulates the transcription factor response element.

[0097] array Syn-iPro Array Sequence number, sequence name, sequence SEQ ID NO:1 S1-17 CTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATCGAGGAGGAAAAACTCGATGTGACTCATTCGAAGATCAAAGGGTCGAGGAAAGTCCCTCGACCCTTTGATCTTCGAATGACATCATCTTTCGAGG AAAGTCCCCTCGAGGGGACTTTCCTCGAGGGGACTTTCCTCGAATGAGTCACATCGATCTCCGCCCCCTCTTCGAGCGCCAAATCGAGGACGTGATCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT கார்க்கை S1-37 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGAGGGGCGGGGTCGATCTCCGCCCCCTTCTGAGTTTTTCCTCCTCGAGGGGACTTTCCTCGAATGACATCATCTTTCGACCCTTTGATCTTGAAGGAAGTTCGATCACGTCCTCGATTTGGCGCTCGAGGGGACTTTCCTCGAAGATCAAAGGGTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT அக்க்கியுக்க்கு3 S1-4 CTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATCGATTTCCAAGAAATCGAGAAAGTCCCCTCGACCCTTTGATCTTCGAGGAGAAAAACTCGAATGAGTCACATCGACCCTTTGAATCTTCGAAGAGGGGGCGGAGATCGATCTCCGCCCCCTTCTGAGGAAAGTCCCCTCGACCCTTTGATCTTCGACCCCGCCCCTCCGAGGAAAGTCCCCTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 4 S1-1 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGATCTCCGCCCCCTTCTGAAGATCAAAGGGTCGAGGGGACTTTCCTCGATTTCTTGGAAATCGAATGACATCATCTTTCGATTTGGCGCTCGAATGACATCATCTTTCGACCCTTTGATCTTCGATGTGACTCATTCGAGGGACTTTCCTCGAAGATCAAAGGGTCGAGGGGACTTTCCTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 5 S1-3 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGAGGGGACTTTCCTCGAGGGGGCGGGGTCGATTTGGCGCTCGATCTCCGCCCCCTCTTCGAATGAGTCACATCGAGGAAAGTCCCCTCGAGGAAAAACTCGATGTGACTCATTCGATTTCCAAGAAATCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT அக்க்கை S1-42 CTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATCGATTTCCAAGAAATCGATCTCCGCCCCCTTCTCGAATGACATCATCTTTCGAATGACATCATCTTTTCGAGGAGAAAAACTCGACCCCGCCCCCTCGATTTCTTGGAAATCGAGGAAAGTCCCCTCGAGCGCCAAATCGAAGGAAGTTCGAATGACATCATCTTTCGAATGAGTCACATCGAGGAAAGCCCTCGAGGAAAAACTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence no. 7 S1-61 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGAATGAGTCACATCGATCTCCGCCCCCTTCTCGAGGGGGCGGGGTCGAGGAGGAAAACTCGAATGAGTCACATCGACCCTTTGATCTTCGAGGGGACTTTCCGGGGTGGAGCAAGCGTGACAAGTCCACGTATGACCCGACCGACGATATCGAAGCC TACGCGCTGAACGCCAGCCCGATCGACCCCGCCCCTCGATTTCCAAGAAATCGAATGACATCATCTTTCGAATGACATCATCTTTCGAGGGGACTTTCCTCGAACTTCCTTCGAGGGGACTTTCCTCGAGGGGACTTTCCTCGAGGAGGAAAAACTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 8 S1-62 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGATTTCCAAGAAATCGAGTTTTTCCTCCTCGAGGGGGCGGGGTCGAGGGGACTTTCCTCGACCCTTTGATCTTCGAGGAAAGTCCCCTCGAGCGCCAAATCGATCTCCGCCCCCTCTTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 9 S1-15 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGAAGATCAAAGGGTCGATTTCTTGGAAATCGATGTGACTCATTCGATCACGTCCTCGAGGAGAAAAACTCGAGGAAAGTCCCCTCGAACTTCCTTCGAGGGGGCGGGGTCGAATGAGTCACATCGAGGAAAGTCCCCTCGAGGGGACTTTCCTCGATTTCTTGGAAATCGAAGAGGGGGCGAGATCGAGTTTTCCTCCTCGAGGAAAGTCCCTCGATCGACTCTACATTTTGACACCCCCAT sequence number 10 S1-2 CTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATCGAATGAGTCACATCGAAGATCAAAGGGTCGACCCTTTGATCTTCGATTTGGCGCTCGATGTGACTCATTCGACCCCGCCCCTCGAGGAAAGTCCCTCGAGGAAAGTCCCCTGAGGAAAGTCCCCTGAGAAGTACCCCTCGAGTTTTTCCTCCTCGAAGGGGGCGGAGATCGATTTGGCGCTCGAGGACGTGATCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 11 S1-27 CTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATCGATTTCCAAGAAATCGAGTTTTTCCTCCTCGATTTCCAAGAAATCGAGGGGACTTTCCTCGAGGGGACTTTCCTCGAATGACATCATCTTTCGATGTGACTCATTCGAAGATCAAAGGGTCGAAGGAAGTTCGAATGAGTCACATCGAATGAGTCACATCGACCCTTGATCTTCGAGGAAAAAACTCGATTTGGCCTCGATTTGGCCTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 12 S1-8 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGATTTCTTGGAAATCGATTTGGCGCTCGAAGGAAGTTCGAGGGGGCGGGGTCGATTTCCAAGAAATCGAGTTTTTCCTCCTCGAGCGCCAAATCGACCCTTTGATCTTCGATCACGTCCTCGAGCGCCAAATCGAGGACGTGATCGAATGAGTCACATCGA ATGAGTCACATCGAATGAGTCACATCGATTTGGCGCTCGATCGGGGGGCGGGGTCGAGGAAAGTCCCTCGAGGAAAGTCCCCTCGATTTCCAAGAAATCGATTTGGCGCTCGATCTCCGCCCCCTTCTGATCTCCGCCCCCTCTTCGAGTTTTTCCTCCTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 13 S1-30 CTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGAATCGAATGACATCATCTTTCGAGGAAAGTCCCCTCGACCCTTTGATCTTCGACCCCGCCCCCTCGAGTTTTTCCTCCTCGAGGAAAGTCCCCTGACCCTTTGATCTTCGAGGGGACTTTCCTCGAGGGGGCGGGGTCGAGGACGTGATCGAGGAAAGTCCCCTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 14 S1-33 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGAAGATCAAAGGGTCGAGGAGGAAAACTCGAGGGGACTTTCCTCGACCCTTTGATCTTCGAATGAGTCACATCGATTTCTTGGAAATCGAAGGAAGTTCGAGGGGACTTTCCTCGAGTTTTTCCTCCT GAACTTCCTTCGAGGAAAGTCCCCTCGAAGATCAAAGGGTCGAAGGAAGTTCGAAAGATGATGCATTCGATTTCTTGGAAATCGAAGATCAAAGGGTCGAAGAGGGGGCGGAGATCGATTTCCAAGAAATCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 15 S1-41 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGAATGAGTCACATCGAGGCCAAATCGAGGGACTTTCCTCGAGGGGGCGGGGTCGAGTTTTTCCTCCTCGATTTCCAAGAAATCGAGGGGACTTTCCTCGAGGGGACTTTCCTCGAGGGGACTTTCCTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 16 S1-59 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGAGTTTTTCCTCCTCGAGGGGACTTTCCTCGAAAGATGATGTCATTCGATCTCCGCCCCCTTCGAGGGGACTTTCCTCGAGGAAAGTCCCCTGAGGAAAGTCCCTCGAAGATCAAAGGGTCGAATGAGTCACATCGACCCTTTGATCTTCGACCCTTTGATCTTCGATTTCCAAGAAATCGAGGAAAGTCCCTCGAGGAAGTCCCCTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 17 S1-66 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGAGGGGACTTTCCTCGAGGAAAGTCCCCTCGATTTCTTGGAAATCGATTTGGCGCTCGAGGAGAAAAACTCGATGTGACTCATTCGACCCTTTGATCTTCGAGGGGACTTTCCTCGAGGGGACTTTCCTCGAGCGCCAAATCGAGGAAAAAACTGAGGGGACTTTCCTCGATTTCTTGGAAATCGAAAGATGTCATTCGACCCTTTGATCTTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 18 S1-71 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGAGAAGTCCCCTCGAGGAAAGTCCCCTCGATTTCTTGGAAATCGAATGACATCATCTTTTCGATCACGTCCTCGAGGAAAGTCCCCTCGAGTTTTTCCTCCTCGAGGGGACTTTCCTCGATTTCCAAGAAATCGATTTCTTGGAAATCGACCCTTTGATCTTCGAGGAGGAAAACTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 19 S1-56 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGATGTGACTCATTCGAGGAAAGTCCCCTCGATTTGGCGCTCGATGGACTCATTCGATTTGGCGCTCGAGGGGACTTTCCTCGATTTCCAAGAAATCGAGGGGACTTTCCTCGAGGAAAGTCCCCTGAGTTTTCCTCCTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 20 S1-6 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGATGTGACTCATTCGAGCGCCAAATCGATTTCCAAGAAATCGAATGAGTCACATCGAATGACATCATCTTTCGATGTGACTCATTCGAGGAAAGTCCCCTCGATTTCTTGGAAATCGAGGAAGTACCCCTCGAGTTTTTCCTCCTCGAAGGGGGCGGAGATCGAATGACATCATCTTTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 21 S1-60 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGAGGGGACTTTCCTCGATCTCCGCCCCCTTCTGAGGAAAGTCCCCTCGAAGGAAGTTCGAACTTCCTTCGAGGGGACTTTCCTCGAAGGAAGTTCGAGCGCCAAATCGAATGAGTCACATCGATTTCCAAGAAATCGAT CTCCGCCCCCTCTTCGAGGAGAAAAAACTGAGGGGACTTTCCTCGATTTCCAAGAAATCGAGGGGACTTTCCTCGATCACGTCCTCGAGGACGTGATCGAATGAGTCACATCGATGTGACTCATTCGACCCTTTGATCTTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence no. 22 S1-86 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGATTTCCAAGAAATCGAGGGGGCGGGGTCGAGGGGACTTTCCTCGAGGGGACTTTCCTCGAGGAAAGTCCCCTCGATCTCCGCCCCCTCTTCGAGGAAAGTCCCCTCGAACTTCCTTCGAGGAAAGTCCCCCTCGAATGAGTCACATCGATTTGGCGCTCGAGGAAAGTCCCCTGAGGGGACTTTCCTCGAGGAAGTCCCCTCGAGGGGCGGGTCGAACTTCCTTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 23 S1-32 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGAATGAGTCACATCGATCTCCGCCCCCTCTTCGATTTGGCGCTCGAGGGGACTTTCCTCGACCCTTTGATCTTCGAGGGGACTTTCCTCGAGGAAAGTCCCCTCGAGGAAAGTCCCCTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 24 S1-10 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGATTTGGCGCTCGATGTGACTCATTCGAGGAAAGTCCCCTCGAGGGGACTTTCCTCGAAGATCAAAGGGTCGAAAGATGATGTCATTCGAGGAAAGTCCCTCGACCCCGCCCCTCGATTTCTTGGAAATCGAATGAGTCACATCGATTTCTTGGAAATCGATGTGACTCATTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence no. 25 S1-18 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGAGGGGACTTTCCTCGATGGACTCATTCGATTTCTTGGAAATCGATTTCCAAGAAATCGACCCCGCCCCCTCGAGGAGGAAAAAACTCGATTTCCAAGAATCGAATGACATCATCTTTCGAGGGGACTTTCCT CGAAGATCAAAGGGTCGAAGATCAAAGGGTCGAGGAGGAAAAACTCGATTTCCAAGAAATCGAATGAGTCACATCGAGTTTTTCCTCCTCGATTTCTTGGAAATCGAAGAGGGGGCGAGATCGATTTGGCGCTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 26 S1-14 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGAAAGATGATGTCATTCGAATGAGTCACATCGATTTGGCGCTCGAGGGGGCGGGGTCGATTTGGCGCTCGAAAGATGATGTCATTCGAGTTTTCCTCCTCGACCCTTTGATCTTCGAAGAGGGGGCGAGATCGAAAGATGATGTCATTCGAATGAGTCACATCGATTTCCAAGAAATCGATTTCCAAGAATCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 27 S1-16 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGAGGAGGAAAACTCGATTTCTTGGAAATCGAGGGGGACTTTCCTCGAAAGATGATGTCATTCGAAGATCAAAGGGTCGATGTGACTCATTCGAGGGGACTTTCCTCGAGGGGGCGGGGTCGAATGACATCATCTTTCGAGGGGACTTTCCTCGAGGGGACTTTCCTCGAATGACATCATCTTTCGATTTCTTGGAAATCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence no. 28 S1-19 CTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATCGATCTCCGCCCCCTTCGAGTTTTTCCTCCTCGATTTCTTGGAAATCGAAGAATCAAAGGGTCGATTTCTTGGAAATCGAGGGACTTTCCTCGAGGAAAGTCCCCTGAGGGGACTTTCCTCGAGGAGGAAAAACTCGATTTGGCGCTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 29 S1-26 CTGCTTAGGGTTAGGCGTTTGCGCTGCTTCGCGATCGAAAGATGATGTCATTCGAGTTTTTCCTCCTCGAAGGAAGTTCGAGGACGTGATCGAAGGGGGCGGAGATCGAATGAGTCACATCGAAGGAAGTTCGAGGAAAGTCCCCTCGAGGAAAGTGCCCTGAAGATCAAAGGGTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 30 S1-65 CTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATCGACCCCGCCCCCTCGAGCGCCAAATCGAGGGGACTTTCCTCGAGGGGACTTTCCTCGAGGGGACTTTCCTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT Sequence number 31 S2-n1 CTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATCGAGGGGGCGGGGTCGAATGACATCATCTTTCGAGGAAAGTCCCCTCGAGGAAAGTCCCCTCGAGGAAAGTCCCCTCGATTTCCAAGAAATCGACCCTTTGATCTTCGAAGATCAAAGGGTCGATGTGACTCATTCGAAGATCAAAGGGTCGATTTGGCGCTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT Sequence number 32 S4-n1 CTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATCGAGGAAAGTCCCCTCGAGTTTTTCCTCCTCGAAGAGGGGGCGGAGATCGATTTCCAAAAAACTCGAATGACATCATCTTTCGAAGATCAAGGGGTCGAAGATCAAAGGGTCGATTTCCAAGAAATCGATTTCTTGGAAATCGAGGAAAGTCCCCTCGACCCTTTGATCTTCGATCTCCGCCCCCTCTTCGAAGATCAAAGGGTCGAAGAGGGGGCGGAGATCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT Sequence number 33 S6-n1 CTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATCGATTTCCAAGAAATCGATTTCTTGGAAATCGAATGACATCATCTTTCGAGTTTTTCCTCCTCGAAGAGGGGGCGGAGATCGAGAAAGTCCCCTCGATTTCCAAGAAATCGAACTTCCTTCGAAGGAAGTTCGAGGAAAAAACTGAGGGCGGGGTCGAGTTTTCCTCCTCGAGGGGACTTTCCTCGACCCCGCCCTCGACCCTTTGATCTTCGATTTCCAAGAAATCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCAT sequence number 34 S1-325 TCGAAGATCAAAGGGTCGATTTCCAAGAAATCGATGTGACTCATTCGATTTGGCGCTCGACCCCGCCCCCTCGAAGGGGGCGGAGATCGAATGAGTCACATCGAGGAAAGTCCCCTCGATTTCTTGGAAATCGAGGAAAGTCCCCTCGAGGGGACTTTCCTCGAGGAGGAAAAACTCGAATGACATCATCTTTCGAATGAGTCACATCGATTTCT TGGAAATCGAGGGGACTTTCCTCGACCCCGCCCCCTCGAGGTGACTTTCCTCGAGGGGACTTTCCTCGATGTGACTCATTCGAGGGGACTTTCCTCGAGGGGACTTTCCTCGACCCTTTGATCTTCGATTTGGCGCTCGAGGGGACTTTCCTCGAGGGGACTTTCCTCGAGGGGACTTTCCTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCA sequence no. 35 S1-60 TCGAATGAGTCACATCGATCTCCGCCCCCTCTTCGAGGGGGCGGGGTCGAGGAGGAAAAACTCGAATGAGTCACATCGACCCTTTGATCTTCGAGGGGACTTTCCGGGGTGGAGCAAGCGTGACAAGTCCACGTATGACCCGACCGACGATATCGAAGCCTACGCGCTGAACGCCAGCCCCGATCGACCCCGCCCCCTCGATTTCCAAGAAATCGAATGACATCATCTTTCGAATGACATCATCTTTCGAGGGGACTTTCCTCGAACTTCCTTCGAGGGGACTTTCCTCGAGGGGACTTTCCTCGAGGGGACTTTCCTCGAGGAGGAAAAACTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCA Sequence number 36 S2-274 TCGAATGAGTCACATCGATCTCCGCCCCCTCTTCGAGGGGGCGGGGTCGAGGAGGAAAAACTCGAATGAGTCACATCGACCCTTTGATCTTCGAGGGGACTTTCCGGGGTGGAGCAAGCGTGACAAGTCCACGTATGACCCGACCGACGATATCGAAGCCTACGCGCTGAACGCCAGCCCCGATCGACCCCGCCCCCTCGATTTCCAAGAAATCGAATGACATCATCTTTCGAATGACATCATCTTTCGAGGGGACTTTCCTCGAACTTCCTTCGAGGGGACTTTCCTCGAGGGGACTTTCCTCGAGGGGACTTTCCTCGAGGAGGAAAAACTCGAAAGATGATGTCATTCGAGTTTTTCCTCCTCGAGGAGGAAAAACTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCA Sequence number 37 S2-310 TCGAATGAGTCACATCGATCTCCGCCCCCTCTTCGAGGGGGCGGGGTCGAGGAGGAAAACTCGAATGAGTCACATCGACCCTTTGATCTTCGAGGGGACTTTCCGGGGTGGAGCAAGCGTGACAAGTCCACGTATGACCCGACGACGATATCGAAGCCTACGCGCTGAACGCCAGCCCCGAT CGACCCCGCCCCCTCGATTTCCAAGAAATCGAATGACATCATCTTTCGAATGACATCATCTTTCGAGGGGACTTTCCTCGAACTTCCTTCGAGGGGACTTTCCTCGAGGGGACTTTCCTCGAGGGGACTTTCCTCGAGGAGGAAAAACTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCA sequence number 38 S1-367 TCGATTTCCAAGAAATCGACCCCGCCCCCTCGAACTTCCTTCGATTTCTTGGAAATCGAGGAAAGTCCCCTCGATTTCTTGGAAATCGATTTCTTGGAAATCGAATGACATCATCTTTCGATTTCTTGGAAATCGACCCTTTGATCTTCGAGGAGGAAAACTCGAATGACATCATCTTTCGATCACGTCCTCGAAGATCAAAGGGTCG AGTTTTTCCTCCTCGAGGAAAGTCCCCTCGATGTGACTCATTCGATTTCTTGGAAATCGAGGGACTTTCCTCGAGGGGACTTTCCTCGAGTTTTTCCTCCTCGAGGAGAAAAACTCGATTTCCAAGAAATCGAGGGGACTTTCCTCGACCCTTTGATCTTCGAGCGCCAAATCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCA sequence number 39 S1-7 TCGATTTCTTGGAAATCGATTTGGCGCTCGAAGGAAGTTCGAGGGGGCGGGGTCGATTTCCAAGAAATCGAGTTTTTCCTCCTCGAGCGCCAAATCGACCCTTTGATCTTCGATCACGTCCTCGAGCGCCAAATCGAGGACGTGATCGAATGAGTCACATCGAATGAGTCACATCGAATG AGTCACATCGATTTGGCGCTCGATCGGGGGCGGGGTCGAGGAAAGTCCCCTCGAGGAAAGTCCCCTCGATTTCCAAGAAATCGATTTGGCGCTCGATCTCCGCCCCCTCTTCGATCTCCGCCCCCTCTTCGAGTTTTTCCTCCTCGAGTAGAGTCTAGACTCTACATTTTGACACCCCCA

[0098] The present invention includes the following inventions. [1] A method for producing an inducible synthetic promoter library, the method comprising: screening a promoter that is activated by activation of chimeric antigen receptor (CAR) T cells to produce a screened promoter; screening a transcription factor response element to produce a screened transcription factor response element; producing an inducible synthetic promoter library comprising a promoter that is activated by activation of the transcription factor response element by CAR T cells; and synthesizing an oligonucleotide comprising a first sequence encoding the screened transcription factor response element and a second sequence encoding the screened promoter. [2] An inducible synthetic promoter comprising: a first sequence encoding a transcription factor responsive sequence; and a second sequence encoding a promoter sequence, optionally comprising one or more of SEQ ID NOs: 1-33. [3] The inducible synthetic promoter according to [2], which is inducible by activation of a chimeric antigen receptor. [4] The inducible synthetic promoter according to [3], which is inducible by binding of the chimeric antigen receptor to a ligand. [5] The inducible synthetic promoter according to any one of [2] to [4], which is inducible by interaction with anti-CD3 / anti-CD28. [6] The inducible synthetic promoter according to any one of [2] to [5], which is inducible by a chemical substance. [7] The inducible synthetic promoter described in [6], wherein the chemical is PMA or lonomycin. [8] An inducible synthetic promoter according to any one of [2] to [8], which comprises an endogenous minimal IL2 promoter sequence. [9] An inducible synthetic promoter according to any one of [2] to [8], comprising any one of the sequences shown in SEQ ID NOs: 1 to 33.

[10] The inducible synthetic promoter according to any one of [2] to [9], wherein the transcription factor response element is E2F1, EGR1, HIF1A, NFAT, LEF1, SP1, PU.1, NFKB, JUN, FOS and / or STAT4.

[11] A cell for expressing a molecule, comprising a vector comprising the inducible synthetic promoter according to any one of [2] to [9]; a gene encoding the molecule; and a sequence encoding a chimeric antigen receptor.

[12] The cell according to

[11] , wherein the molecule is a protein, an antibody, a growth-promoting molecule or a molecule capable of eradicating a tumor.

[13] The cell described in

[11] or

[12] , which is a hematopoietic stem cell.

[14] The cell according to any one of

[11] to

[13] , wherein the chimeric antigen receptor is specific to CD19.

[15] A cell according to any one of

[11] to

[14] , which is CD8+ or CD4+.

[16] The cell according to any one of

[11] to

[15] , wherein the expression of the molecule is inducible.

[17] The cell according to any one of

[11] to

[16] , wherein the chimeric antigen receptor comprises a signal transduction domain.

[18] The cell described in

[17] , wherein the signaling domain is first generation, second generation or third generation.

[19] The cell according to any one of [2] to

[18] , wherein the vector is a lentiviral vector, a minicircle using a transposase, or a nanoplasmid.

[20] A cell described in any one of

[11] to

[19] , further comprising a TCR knockout system for chimeric antigen receptor (CAR)-specific activation.

[21] The cell according to any one of

[11] to

[19] , wherein the molecule is CCR (CD122), CASTAT5, PD1:CD28 and / or miRNA.

[22] The cell described in any one of

[11] to

[20] , wherein the molecule is a chimeric cytokine receptor.

[23] The cell described in

[22] , wherein the chimeric cytokine receptor is a CCR, a PD1 chimera and / or an miRNA.

[24] The cell described in

[23] , wherein the CCR comprises CD122, CD127 or CD360.

[25] The cell described in

[23] , wherein the PD1 chimera includes PD1:CD28, dnSHP1 / 2 or IL-12.

[26] The cell described in

[23] , wherein the miRNA includes miRNA155.

[27] A method for controlling gene expression in chimeric antigen receptor (CAR) T-cell therapy, comprising the steps of providing a cell according to any one of

[11] to

[26] ; and introducing the cell into a subject in need of CAR T-cell therapy.

[28] The method of

[27] , further comprising the step of monitoring the subject's response to the molecule expressed under the control of the inducible synthetic promoter.

[29] The method of

[28] , further comprising monitoring the subject for expression of the molecule expressed under the control of the inducible synthetic promoter.

[30] The method according to

[29] , wherein the molecule is a protein, an antibody or a binding fragment thereof, a cytokine or an anti-cancer therapeutic agent.

[31] The method according to any one of

[27] to

[30] , further comprising a step of inducing expression of the molecule.

[32] The method according to

[31] , wherein the induction is carried out by administration of PMA or lonomycin.

[33] The method of

[31] , wherein the induction step is performed prior to administration of the cells to the subject, and the cells are exposed to anti-CD3 / anti-CD28 beads prior to administration.

[34] The method according to any one of

[27] to

[33] , wherein the subject is suffering from or has been diagnosed with cancer.

[35] The method according to any one of

[27] to

[34] , wherein the molecule is CCR (CD122), CASTAT5, PD1:CD28 and / or miRNA.

[36] A method for alleviating, suppressing or treating a disease (e.g., one or more of leukemia, breast cancer, gastric cancer, esophageal cancer, brain tumor, uterine cancer, prostate cancer, bone cancer, liver cancer, pancreatic cancer, ovarian cancer, lung cancer, colorectal cancer, kidney cancer, bladder cancer, uterine cancer or thyroid cancer) in a subject in need of such a disease, the method comprising the steps of obtaining a cell comprising an inducible synthetic promoter and a chimeric antigen receptor described in any one of [2] to

[10] by introducing a vector into the cell; administering the cell to the subject; and inducing expression of a molecule.

[37] The method according to

[36] , wherein the cells are obtained from the subject.

[38] The method of

[36] or

[37] , further comprising the step of monitoring the response of the subject to the molecule expressed under the control of the inducible synthetic promoter.

[39] The method according to

[38] , wherein the molecule is a protein, an antibody or a binding fragment thereof, a cytokine or an anti-cancer therapeutic agent.

[40] The method according to any one of

[36] to

[39] , further comprising a step of inducing expression of the molecule.

[41] The method according to

[40] , wherein the induction is carried out by administration of PMA or lonomycin.

[42] The method of

[40] , wherein the induction step is performed prior to administration of the cells to the subject, and the cells are exposed to anti-CD3 / anti-CD28 beads prior to administration.

[43] The method according to any one of

[36] to

[42] , wherein the subject is suffering from cancer.

[44] The method according to any one of

[36] to

[43] , wherein the molecule is CCR (CD122), CASTAT5, PD1:CD28 and / or miRNA.

[45] The method according to any one of

[36] to

[44] , wherein the subject is a subject selected for treatment with cancer therapy.

[46] The method according to any one of

[36] to

[45] , wherein the cancer is leukemia, breast cancer, gastric cancer, esophageal cancer, brain tumor, uterine cancer, prostate cancer, bone cancer, liver cancer, pancreatic cancer, ovarian cancer, lung cancer, colorectal cancer, kidney cancer, bladder cancer, uterine cancer or thyroid cancer.

Claims

1. A synthetic nucleic acid comprising: a first sequence comprising at least three transcription factor response elements (TREs) for a transcription factor selected from E2F1, EGR1, HIF1A, NFAT, LEF1, SP1, PU.1, NFKB, JUN, FOS and STAT4; and a second sequence comprising a promoter.

2. 2. The synthetic nucleic acid of claim 1, wherein the first sequence comprises a TRE for NFAT, LEF1, NFKB and STAT4.

3. The synthetic nucleic acid of claim 2, wherein the first sequence further comprises a TRE for EGR1, HIF1A, SP1, PU.1, JUN or FOS.

4. 2. The synthetic nucleic acid of claim 1, wherein the first sequence comprises at least two copies of a TRE for NFAT, SP1, NFKB, JUN, FOS or STAT4.

5. The synthetic nucleic acid of claim 4, wherein the at least two copies are adjacent to each other.

6. 2. The synthetic nucleic acid of claim 1, wherein the first sequence comprises a TRE for a transcription factor selected from the group consisting of (a), (b) and (c): (a) EGR1, NFAT, LEF1, SP1, PU.1, NFKB, JUN, FOS, and STAT4; (b) HIF1A, NFAT, LEF1, NFKB, JUN and STAT4; or (c) EGR1, HIF1A, NFAT, LEF1, SP1, PU.1, NFKB, FOS and STAT4

7. 3. The synthetic nucleic acid of claim 2, wherein the first sequence comprises at least two copies of a TRE for NFAT and at least two copies of a TRE for NFKB.

8. The synthetic nucleic acid of claim 7, wherein the first sequence comprises at least four copies of a TRE for NFKB.

9. 2. The synthetic nucleic acid of claim 1, wherein the first sequence has the following: (A), (B) or (C). (A) one copy of the TREs for EGR1, LEF1, STAT4 and PU.1, and at least two copies of the TREs for FOS, NFAT, NFKB, SP1 and JUN; (B) one copy of a TRE for JUN, HIF1A, and LEF1, and at least two copies of a TRE for NFKB, STAT4, and NFAT; or (C) One copy of the TREs for LEF1, HIF1A, PU.1, SP1, and EGR1, and at least two copies of the TREs for STAT4, FOS, NFAT, and NFKB.

10. The synthetic nucleic acid of claim 1, wherein the first sequence comprises, in the 5'→3' order, a TRE for a transcription factor of the following (D), (E) or (F): (D) FOS, EGR1, SP1, NFAT, FOS, LEF1, NFKB, SP1, STAT4, JUN, JUN, NFKB, PU.1, NFKB, NFKB, and NFAT; (E) NFKB, NFKB, STAT4, JUN, HIF1A, NFKB, NFAT, NFKB, STAT4, STAT4, LEF1 and NFAT; or (F) LEF1, STAT4, FOS, HIF1A, NFAT, NFKB, PU.1, SP1, FOS, NFKB, NFKB, STAT4, EGR1, NFAT and NFKB

11. 2. The synthetic nucleic acid of claim 1, wherein the first sequence has at least 80% sequence identity with the sequence of SEQ ID NO:7 or SEQ ID NO:

9.

12. 2. The synthetic nucleic acid of claim 1, wherein the first sequence has at least 85% sequence identity with the sequence of SEQ ID NO:

7.

13. The synthetic nucleic acid of claim 1 , operably linked to a sequence encoding a payload.

14. The synthetic nucleic acid of claim 13, wherein the payload comprises a chimeric antigen receptor or a chimeric cytokine receptor.

15. 13. A method of genetically modifying a cell to contain the synthetic nucleic acid of claim 1 operably linked to a sequence encoding a payload.

16. The method of claim 15, wherein the first sequence comprises a TRE for NFAT, LEF1, NFKB and STAT4.

17. The method of claim 16, wherein the first sequence further comprises a TRE for EGR1, HIF1A, SP1, PU.1, JUN or FOS.

18. The method of claim 15, wherein the first sequence comprises at least two copies of a TRE for NFAT, SP1, NFKB, JUN, FOS or STAT4.

19. 20. The method of claim 18, wherein the at least two copies are adjacent to one another.

20. The method of claim 15, wherein the first sequence comprises a TRE for a transcription factor selected from the group consisting of (a), (b) and (c): (a) EGR1, NFAT, LEF1, SP1, PU.1, NFKB, JUN, FOS, and STAT4; (b) HIF1A, NFAT, LEF1, NFKB, JUN and STAT4; or (c) EGR1, HIF1A, NFAT, LEF1, SP1, PU.1, NFKB, FOS and STAT4

21. The method of claim 15, wherein the first sequence comprises at least two copies of a TRE for NFAT and at least two copies of a TRE for NFKB.

22. The method of claim 21 , wherein the first sequence comprises at least four copies of the TRE for NFKB.

23. 16. The method of claim 15, wherein the first sequence has the following: (A), (B) or (C): (A) one copy of the TREs for EGR1, LEF1, STAT4 and PU.1, and at least two copies of the TREs for FOS, NFAT, NFKB, SP1 and JUN; (B) one copy of a TRE for JUN, HIF1A, and LEF1, and at least two copies of a TRE for NFKB, STAT4, and NFAT; or (C) One copy of the TREs for LEF1, HIF1A, PU.1, SP1, and EGR1, and at least two copies of the TREs for STAT4, FOS, NFAT, and NFKB.

24. The method of claim 15, wherein the first sequence comprises, in 5'→3' order, a TRE for a transcription factor selected from the group consisting of (D), (E) and (F). (D) FOS, EGR1, SP1, NFAT, FOS, LEF1, NFKB, SP1, STAT4, JUN, JUN, NFKB, PU.1, NFKB, NFKB, and NFAT; (E) NFKB, NFKB, STAT4, JUN, HIF1A, NFKB, NFAT, NFKB, STAT4, STAT4, LEF1 and NFAT; or (F) LEF1, STAT4, FOS, HIF1A, NFAT, NFKB, PU.1, SP1, FOS, NFKB, NFKB, STAT4, EGR1, NFAT and NFKB

25. 16. The method of claim 15, wherein the first sequence has at least 80% sequence identity with the sequence of SEQ ID NO:7 or SEQ ID NO:

9.

26. 16. The method of claim 15, wherein the first sequence has at least 85% sequence identity with the sequence of SEQ ID NO:

7.

27. The method of claim 15, wherein the cell is an immune cell or a hematopoietic stem cell.

28. 28. The method of claim 27, wherein the immune cell is a CD4+ T cell or a CD8+ T cell.

29. 16. The method of claim 15, wherein the cells are genetically modified to express a chimeric antigen receptor (CAR).

30. An immune cell modified by the method of claim 15.

31. A composition comprising the immune cell of claim 30.

Images