Complex surface-bound transposome complexes

Abstract

To provide complex surface-bound transposome complexes.SOLUTION: The present disclosure relates to methods, compositions, and kits for generating a library of tagged nucleic acid fragments without using PCR amplification. In some aspects, the present disclosure relates to a transposome complex comprising: (a) a transposase; (b) a first transposon comprising a 3' transposon end sequence and a 5' adaptor sequence; (c) a second transposon comprising a 5' transposon end sequence and a 3' adaptor sequence, where the 5' transposon end sequence is complementary to the 3' transposon end sequence; and (d) an attachment polynucleotide comprising: i. an attachment adaptor sequence hybridized to one of the two adaptor sequences; and ii. a binding element.SELECTED DRAWING: None

Description

[Technical field]

[0001] (Incorporation by reference of any priority application) This application claims the benefit of priority to U.S. Provisional Patent Application No. 62 / 791,509, filed January 11, 2019, and U.S. Provisional Patent Application No. 62 / 840,610, filed April 30, 2019.

[0002] FIELD OF THEINVENTION The present disclosure relates to methods, compositions, and kits for generating libraries of tagged nucleic acid fragments without the use of PCR amplification, including methods and compositions for fragmenting and tagging nucleic acids (e.g., DNA) using transposome complexes immobilized on a solid support. [Background technology]

[0003] Current protocols for next generation sequencing (NGS) of nucleic acid samples routinely employ sample preparation processes that convert DNA or RNA into libraries of fragmented templates that can be sequenced. Sample preparation methods often require multiple steps and material transfers and expensive equipment to effect fragmentation, which can make these methods difficult, time consuming, expensive, and inefficient. Furthermore, amplification using primers introduces bias in library content and therefore in the resulting sequencing data. For example, the PCR amplification step can generate gaps that are exacerbated in GC-rich regions due to the inability of polymerization to efficiently copy GC-rich regions. These gaps generate bias in the resulting sequencing data from the library. Library preparation processes with PCR amplification steps can have significantly reduced insertion and deletion (indel) calling performance. Some regions with multiple extended repeats can be difficult to sequence accurately, and DNA with GC-rich promoters can exhibit low coverage in the genome. Furthermore, many library preparation methods are not compatible with the incorporation of sample indexes or require multiple additional steps to introduce such indexes.

[0004] There is a need for short, efficient and accurate library preparation procedures. Described herein are various methods, compositions and kits that address these issues and accommodate single and dual indexing approaches. Summary of the Invention [Means for solving the problem]

[0005] The present disclosure relates to methods, compositions, and kits for generating libraries of tagged nucleic acid fragments without using PCR amplification to incorporate fragment tags, such as primer and / or index sequences, including methods and compositions for fragmenting and tagging nucleic acids (e.g., DNA) using transposome complexes immobilized on a solid support.

[0006] Some embodiments provided herein relate to a transposome complex comprising an attachment polynucleotide. In some aspects, the present disclosure relates to a transposome complex comprising: (a) a transposase; (b) a first transposon comprising a 3' transposon end sequence and a 5' adaptor sequence; (c) a second transposon comprising a 5' transposon end sequence and a 3' adaptor sequence, where the 5' transposon end sequence is complementary to at least a portion of the 3' transposon end sequence; and (d) an attachment polynucleotide comprising: (i) an attachment adaptor sequence that hybridizes to one of the two adaptor sequences; and (ii) a binding element. Typically, the transposon end sequences are annealed together to form a double-stranded transposon end sequence that is recognized by the transposase. In some aspects, the binding element is immobilized to a solid support to provide an immobilized transposome complex.

[0007] In some aspects, the disclosure relates to an annealed transposon / attachment polynucleotide hybrid comprising a first transposon, a second transposon, and an attachment polynucleotide.

[0008] In some aspects, the disclosure relates to a method for producing an annealed transposon / attached polynucleotide hybrid comprising a transposome complex, comprising annealing a first transposon, a second transposon, and an attached polynucleotide. In some aspects, the disclosure relates to a method for producing a transposome complex, comprising treating an annealed transposon / attached polynucleotide hybrid with a transposase. In some aspects, the method provides a method for producing an immobilized transposome complex by immobilizing the transposome complex to a solid support via a binding member.

[0009] In some aspects, the present disclosure relates to a transposome comprising: (a) a transposase; (b) a first transposon comprising a 3' transposon end sequence and a 5' adaptor sequence; (c) a second transposon comprising a 5' transposon end sequence complementary to at least a portion of the 3' transposon end sequence and a 3' adaptor sequence; and (d) a binding element attached to the 5' adaptor sequence via a cleavable linker. In some aspects, the binding element is immobilized on a solid support to provide an immobilized transposome complex. In some aspects, the present disclosure relates to an annealed oligonucleotide construct comprising a first transposon, a second transposon, and a binding element.

[0010] In some aspects, the disclosure relates to a method of generating a library of tagged nucleic acid fragments, comprising contacting a target nucleic acid with a plurality of immobilized transposome complexes described herein under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and to join the 3' end of a 3' transposon end sequence to the 5' end of the target fragments to generate a plurality of 5' tagged target fragments.

[0011] Some embodiments provided herein relate to a kit for generating a library of tagged nucleic acid fragments without the use of PCR amplification. In some embodiments, the kit comprises an immobilized transposome complex as described herein.

[0012] In some aspects, the disclosure provides a method of generating a library of tagged nucleic acid fragments, comprising contacting an immobilized transposome complex with a target nucleic acid under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and to attach a 3' end of a first transposon to a 5' end of the target fragment to produce a plurality of 5'-tagged target fragments, and optionally treating the solid support to remove unbound nucleic acid by (a) heating the solid support and / or (b) washing the solid support with an enzymatic denaturant or to remove transposase from the complexes, the enzymatic denaturant optionally comprising sodium dodecyl sulfate (SDS), guanidine hydrochloride, urea, or a proteinase, and polymerizing the plurality of 5'-tagged target fragments. and selecting the fully double-stranded tagged fragments using capture beads, optionally the capture beads are magnetic beads, and further optionally, two separate selection steps are performed.

[0013] In some embodiments, the immobilized transposome complex comprises a solid support and a transposome complex immobilized to the solid support, the transposome complex comprises a transposon, a first transposon comprising a 3' transposon end sequence and an anchor sequence (Anchor), a second transposon comprising a 5' transposon end sequence and a B15' sequence, an anchor sequence complement (Anchor'), an A14' sequence, a spacer, a P5' sequence, and a binding element comprising biotin, the biotin being immobilized to the solid support. In some embodiments, the method further comprises sequencing one or more of the complete double-stranded tagged fragments.

[0014] In some embodiments, the method includes contacting the first immobilized transposome complex and the second immobilized transposome complex with the target nucleic acid under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and to attach the 3' end of each first transposon to the 5' end of the target fragment to produce a plurality of first 5'-tagged target fragments generated from the first immobilized transposome complex and a plurality of second 5'-tagged target fragments generated from the second immobilized transposome complex. In some embodiments, the first immobilized transposome complex comprises a solid support and a first transposome complex immobilized to the solid support, the first transposome complex comprising a transposase, a first transposon comprising a 3' transposon end sequence and an anchor sequence, a second transposon comprising a 5' transposon end sequence, and a first attached polynucleotide comprising (i) an anchor sequence complement, an A14' sequence, a spacer, and a P5' sequence, and (ii) a binding element comprising biotin, where the biotin is immobilized to the solid support. In some embodiments, the second immobilized transposome complex comprises a solid support and a second transposome complex immobilized to the solid support, the second transposome complex comprising a transposase, a first transposon comprising a 3' transposon end sequence and an anchor sequence, a second transposon comprising a 5' transposon end sequence, and a second attached polynucleotide comprising (i) an anchor sequence complement, a B15' sequence, a spacer, and a P7' sequence, and (ii) a binding element comprising biotin, where the biotin is immobilized to the solid support.In some embodiments, the method includes treating a plurality of 5'-tagged target fragments with a ligase to ligate each 5'-tagged target fragment to either a first indexing oligonucleotide or a second indexing oligonucleotide by contacting the 5'-tagged target fragments with a pool of first and second indexing oligonucleotides, wherein each first indexing oligonucleotide comprises an A14 sequence, an i5 sequence, and a P5 sequence and is capable of associating with a first 5'-tagged target fragment, and each second indexing oligonucleotide comprises a B15 sequence, an i7 sequence, and a P7 sequence and is capable of associating with a second 5'-tagged target fragment. , which can produce a plurality of 5'-tagged target fragments ligated to the indexing oligonucleotides; and, optionally, treating the solid support to remove the transposase from the complexes by (a) heating the solid support and / or (b) washing the solid support with an enzymatic denaturant, which optionally comprises sodium dodecyl sulfate (SDS), guanidine hydrochloride, urea, or proteinase; and treating the plurality of 5'-tagged target fragments ligated to the indexing oligonucleotides with a polymerase to extend and produce complete double-stranded tagged fragments. In some embodiments, contacting the first immobilized transposome complex and the second immobilized transposome complex and treating the plurality of 5'-tagged target fragments with a ligase are performed in a single reaction. In some embodiments, the double-stranded tagged fragments are produced in solution. [Brief description of the drawings]

[0015] [Figure 1]FIG. 1 is a flow diagram showing one embodiment of a method for generating a library of tagged nucleic acid fragments without using PCR amplification. In the first step, a transposome complex as described herein and immobilized on a solid support is provided. A target nucleic acid is applied to the solid support, and a tagmentation reaction occurs to generate tagged and fragmented nucleic acids. An index mix with index sequences is applied, and extension and ligation occur. Finally, indexing of the tagged nucleic acid fragments occurs. In some embodiments, indexing occurs simultaneously with extension and ligation, and in other embodiments, indexing occurs after extension and ligation. In other embodiments, the arrangement of the steps is different, as shown in Example 9.

[0016] [Figure 2A] 2A shows a schematic diagram and method for preparing a library of tagged nucleic acid fragments without using PCR amplification. FIG. 2A is an exemplary configuration of a transposome complex with biotin (B) attached to one transposon via a cleavable linker. In this exemplary embodiment, the transposome complex includes a transposase, a first transposon including a 3' transposon end sequence and a 5' adaptor sequence, a second transposon including a 5' transposon end sequence complementary to at least a portion of the 3' transposon end sequence and a 3' adaptor sequence, and a binding element attached to the 5' adaptor sequence via a cleavable linker (FIG. 2A). FIG. 2B shows a schematic diagram of exemplary steps of a method for preparing a library of tagged nucleic acid fragments without using PCR amplification using the exemplary transposome complex from FIG. 2A immobilized on a solid support (solid support not shown), including steps of tagmentation and washing, extension and ligation, and removal of beads. FIG. 2B shows the steps of tagmentation, in which an insert from a target nucleic acid adds a tag, extension and ligation, and cleavage by a solid support. [Figure 2B]2A shows a schematic diagram and method for preparing a library of tagged nucleic acid fragments without using PCR amplification. FIG. 2A is an exemplary configuration of a transposome complex with biotin (B) attached to one transposon via a cleavable linker. In this exemplary embodiment, the transposome complex includes a transposase, a first transposon including a 3' transposon end sequence and a 5' adaptor sequence, a second transposon including a 5' transposon end sequence complementary to at least a portion of the 3' transposon end sequence and a 3' adaptor sequence, and a binding element attached to the 5' adaptor sequence via a cleavable linker (FIG. 2A). FIG. 2B shows a schematic diagram of exemplary steps of a method for preparing a library of tagged nucleic acid fragments without using PCR amplification using the exemplary transposome complex from FIG. 2A immobilized on a solid support (solid support not shown), including steps of tagmentation and washing, extension and ligation, and removal of beads. FIG. 2B shows the steps of tagmentation, in which an insert from a target nucleic acid adds a tag, extension and ligation, and cleavage by a solid support.

[0017] [Figure 3A]Exemplary steps of a method for generating a library of tagged nucleic acid fragments without PCR amplification are shown. FIG. 3A shows a transposome complex immobilized to a solid support via an attached polynucleotide with biotin (B, solid support not shown). For simplicity, a depiction of the dimer is shown in FIG. 3A but not in FIG. 3B-C. FIG. 3B shows the tagged and fragmented nucleic acid still complexed to the transposase (top panel) and the structure after transposase removal (bottom panel). FIG. 3B shows a transposome complex with a nucleic acid fragment (insert) bound to a first transposon with the 5′ end of the insert attached to the 3′ transposon end sequence. The transposase is removed using methods described herein, for example, using an agent that removes the transposase, such as sodium dodecyl sulfate (SDS). FIG. 3C shows the structure after gap filling and extension (extension and ligation) (top panel) and after dehybridization to remove the generated fragments from the solid support (bottom panel). As shown in Figure 3C, the index is added to the solid support and hybridized to the attached polynucleotide of the second transposon. Specifically, as shown in the embodiment of Figure 3C, the i5 index having a primer sequence (P5 sequence), an index sequence (i5 sequence), and an anchor sequence hybridizes to the attached polynucleotide in a complementary sequence, such that P5 hybridizes to P5' and the anchor hybridizes to the anchor'. Similarly, in the embodiment of Figure 3C, the i7 index having a primer sequence (P7), an index sequence (i7), and an adapter sequence (B15 sequence) hybridizes to the second transposon in a complementary sequence, such that P7 hybridizes to P7', i7 hybridizes to i7', and B15 hybridizes to B15'. After contacting the solid support with the index, the fragments are extended and ligated using an extension and ligation mix (ELM). The solid support is then treated with an agent that denatures the strand sequence, such as NaOH, thereby generating tagged nucleic acid fragments.One embodiment of a transposome complex with Tn5 transposase with a first and a second transposon is shown. The first transposon comprises a 3' transposon end sequence (ME sequence) that hybridizes to the 5' transposon end sequence (ME' sequence) of the second transposon. The second transposon also comprises a 3' adaptor sequence (B15' sequence). The first transposon comprises a 5' adaptor sequence (A14 sequence) that is shown hybridized to the attachment adaptor sequence (A14' sequence) of the attachment polynucleotide. The attachment polynucleotide also comprises an anchor sequence (anchor'), a spacer region, a primer sequence (P5' sequence), and a linker attached to the binding element (B). The transposome complex is a dimer, with two transposase monomers dimerized. [Figure 3B]Exemplary steps of a method for generating a library of tagged nucleic acid fragments without PCR amplification are shown. FIG. 3A shows a transposome complex immobilized to a solid support via an attached polynucleotide with biotin (B, solid support not shown). For simplicity, a depiction of the dimer is shown in FIG. 3A but not in FIG. 3B-C. FIG. 3B shows the tagged and fragmented nucleic acid still complexed to the transposase (top panel) and the structure after transposase removal (bottom panel). FIG. 3B shows a transposome complex with a nucleic acid fragment (insert) bound to a first transposon with the 5′ end of the insert attached to the 3′ transposon end sequence. The transposase is removed using methods described herein, for example, using an agent that removes the transposase, such as sodium dodecyl sulfate (SDS). FIG. 3C shows the structure after gap filling and extension (extension and ligation) (top panel) and after dehybridization to remove the generated fragments from the solid support (bottom panel). As shown in Figure 3C, the index is added to the solid support and hybridized to the attached polynucleotide of the second transposon. Specifically, as shown in the embodiment of Figure 3C, the i5 index having a primer sequence (P5 sequence), an index sequence (i5 sequence), and an anchor sequence hybridizes to the attached polynucleotide in a complementary sequence, such that P5 hybridizes to P5' and the anchor hybridizes to the anchor'. Similarly, in the embodiment of Figure 3C, the i7 index having a primer sequence (P7), an index sequence (i7), and an adapter sequence (B15 sequence) hybridizes to the second transposon in a complementary sequence, such that P7 hybridizes to P7', i7 hybridizes to i7', and B15 hybridizes to B15'. After contacting the solid support with the index, the fragments are extended and ligated using an extension and ligation mix (ELM). The solid support is then treated with an agent that denatures the strand sequence, such as NaOH, thereby generating tagged nucleic acid fragments.One embodiment of a transposome complex with Tn5 transposase with a first and a second transposon is shown. The first transposon comprises a 3' transposon end sequence (ME sequence) that hybridizes to the 5' transposon end sequence (ME' sequence) of the second transposon. The second transposon also comprises a 3' adaptor sequence (B15' sequence). The first transposon comprises a 5' adaptor sequence (A14 sequence) that is shown hybridized to the attachment adaptor sequence (A14' sequence) of the attachment polynucleotide. The attachment polynucleotide also comprises an anchor sequence (anchor'), a spacer region, a primer sequence (P5' sequence), and a linker attached to the binding element (B). The transposome complex is a dimer, with two transposase monomers dimerized. [Figure 3C]Exemplary steps of a method for generating a library of tagged nucleic acid fragments without PCR amplification are shown. FIG. 3A shows a transposome complex immobilized to a solid support via an attached polynucleotide with biotin (B, solid support not shown). For simplicity, a depiction of the dimer is shown in FIG. 3A but not in FIG. 3B-C. FIG. 3B shows the tagged and fragmented nucleic acid still complexed to the transposase (top panel) and the structure after transposase removal (bottom panel). FIG. 3B shows a transposome complex with a nucleic acid fragment (insert) bound to a first transposon with the 5′ end of the insert attached to the 3′ transposon end sequence. The transposase is removed using methods described herein, for example, using an agent that removes the transposase, such as sodium dodecyl sulfate (SDS). FIG. 3C shows the structure after gap filling and extension (extension and ligation) (top panel) and after dehybridization to remove the generated fragments from the solid support (bottom panel). As shown in Figure 3C, the index is added to the solid support and hybridized to the attached polynucleotide of the second transposon. Specifically, as shown in the embodiment of Figure 3C, the i5 index having a primer sequence (P5 sequence), an index sequence (i5 sequence), and an anchor sequence hybridizes to the attached polynucleotide in a complementary sequence, such that P5 hybridizes to P5' and the anchor hybridizes to the anchor'. Similarly, in the embodiment of Figure 3C, the i7 index having a primer sequence (P7), an index sequence (i7), and an adapter sequence (B15 sequence) hybridizes to the second transposon in a complementary sequence, such that P7 hybridizes to P7', i7 hybridizes to i7', and B15 hybridizes to B15'. After contacting the solid support with the index, the fragments are extended and ligated using an extension and ligation mix (ELM). The solid support is then treated with an agent that denatures the strand sequence, such as NaOH, thereby generating tagged nucleic acid fragments.One embodiment of a transposome complex with Tn5 transposase with a first and a second transposon is shown. The first transposon comprises a 3' transposon end sequence (ME sequence) that hybridizes to the 5' transposon end sequence (ME' sequence) of the second transposon. The second transposon also comprises a 3' adaptor sequence (B15' sequence). The first transposon comprises a 5' adaptor sequence (A14 sequence) that is shown hybridized to the attachment adaptor sequence (A14' sequence) of the attachment polynucleotide. The attachment polynucleotide also comprises an anchor sequence (anchor'), a spacer region, a primer sequence (P5' sequence), and a linker attached to the binding element (B). The transposome complex is a dimer, with two transposase monomers dimerized.

[0018] [Figure 4A]FIG. 4A shows a schematic comparing various configurations of transposome complexes immobilized to a solid support via an exemplary biotin (B, solid support not shown), including indexed beads and universal beads, each shown in both single and dual indexing modes, for an embodiment of a method for generating a library of tagged nucleic acid fragments without PCR amplification, in which the transposon and / or attached polynucleotide components are modified, sequenced, or changed compared to each other. FIG. 4A shows various configurations of transposome complexes attached to a solid support. FIG. 4A shows an embodiment of a transposome complex attached to a solid support via an attached polynucleotide, showing a transposase with a first and a second transposon. FIG. 4B shows various configurations after tagmentation. FIG. 4B shows a tagmentation reaction for indexed or universal beads with single or dual indexing, in which a solid support is contacted with a nucleic acid fragment (insert) that binds to the 3′ transposon end of the first transposon. FIG. 4C shows various configurations after extension and ligation. FIG. 4C shows extension and ligation for indexed or universal beads with single or dual indexing, where the solid support is contacted with an index mix that hybridizes to the transposon or attached polynucleotide, and the nucleic acid fragments are extended. FIG. 4D shows various configurations after indexing (indexed beads for single indexing are not shown because indexing has been completed for this configuration in FIG. 4C). FIG. 4D shows indexing for indexed beads with dual indexing or universal beads with single or dual indexing. As shown in FIG. 4D, in the extension-ligation step of FIG. 4C, indexed beads with single indexing have been completed. The solid support is contacted with an index mix, and the nucleic acid fragments are tagged for indexing.FIG. 4E shows exemplary results of various configurations showing normalized read frequency as a function of insert size. FIG. 4E shows normalized read frequency of tagged nucleic acid fragments from indexed or universal beads with single or dual indexing. FIG. 4A-E specifically shows embodiments of transposome complexes arranged as indexed beads for single indexing (top left), universal beads for single indexing (top right), indexed beads for dual indexing (bottom left), and universal beads for dual indexing. In the indexed bead embodiment shown in FIG. 4A-E, for both single and dual indexing (left), the attached polynucleotide is hybridized to the second transposon at the 3' adaptor sequence (B15' sequence). In the universal bead embodiment shown in FIG. 4A-E, for both single and dual indexing (right), the attached polynucleotide is hybridized to the first transposon at the 5' adaptor sequence (A14 sequence). In some embodiments, normalized libraries can be prepared from raw samples such that nucleic acids are extracted from the raw samples and directly input into the systems or methods described herein, with the self-normalized samples providing tight CVs across the range of sample types. [Figure 4B]FIG. 4A shows a schematic comparing various configurations of transposome complexes immobilized to a solid support via an exemplary biotin (B, solid support not shown), including indexed beads and universal beads, each shown in both single and dual indexing modes, for an embodiment of a method for generating a library of tagged nucleic acid fragments without PCR amplification, in which the transposon and / or attached polynucleotide components are modified, sequenced, or changed compared to each other. FIG. 4A shows various configurations of transposome complexes attached to a solid support. FIG. 4A shows an embodiment of a transposome complex attached to a solid support via an attached polynucleotide, showing a transposase with a first and a second transposon. FIG. 4B shows various configurations after tagmentation. FIG. 4B shows a tagmentation reaction for indexed or universal beads with single or dual indexing, in which a solid support is contacted with a nucleic acid fragment (insert) that binds to the 3′ transposon end of the first transposon. FIG. 4C shows various configurations after extension and ligation. FIG. 4C shows extension and ligation for indexed or universal beads with single or dual indexing, where the solid support is contacted with an index mix that hybridizes to the transposon or attached polynucleotide, and the nucleic acid fragments are extended. FIG. 4D shows various configurations after indexing (indexed beads for single indexing are not shown because indexing has been completed for this configuration in FIG. 4C). FIG. 4D shows indexing for indexed beads with dual indexing or universal beads with single or dual indexing. As shown in FIG. 4D, in the extension-ligation step of FIG. 4C, indexed beads with single indexing have been completed. The solid support is contacted with an index mix, and the nucleic acid fragments are tagged for indexing.FIG. 4E shows exemplary results of various configurations showing normalized read frequency as a function of insert size. FIG. 4E shows normalized read frequency of tagged nucleic acid fragments from indexed or universal beads with single or dual indexing. FIG. 4A-E specifically shows embodiments of transposome complexes arranged as indexed beads for single indexing (top left), universal beads for single indexing (top right), indexed beads for dual indexing (bottom left), and universal beads for dual indexing. In the indexed bead embodiment shown in FIG. 4A-E, for both single and dual indexing (left), the attached polynucleotide is hybridized to the second transposon at the 3' adaptor sequence (B15' sequence). In the universal bead embodiment shown in FIG. 4A-E, for both single and dual indexing (right), the attached polynucleotide is hybridized to the first transposon at the 5' adaptor sequence (A14 sequence). In some embodiments, normalized libraries can be prepared from raw samples such that nucleic acids are extracted from the raw samples and directly input into the systems or methods described herein, with the self-normalized samples providing tight CVs across the range of sample types. [Figure 4C]FIG. 4A shows a schematic comparing various configurations of transposome complexes immobilized to a solid support via an exemplary biotin (B, solid support not shown), including indexed beads and universal beads, each shown in both single and dual indexing modes, for an embodiment of a method for generating a library of tagged nucleic acid fragments without PCR amplification, in which the transposon and / or attached polynucleotide components are modified, sequenced, or changed compared to each other. FIG. 4A shows various configurations of transposome complexes attached to a solid support. FIG. 4A shows an embodiment of a transposome complex attached to a solid support via an attached polynucleotide, showing a transposase with a first and a second transposon. FIG. 4B shows various configurations after tagmentation. FIG. 4B shows a tagmentation reaction for indexed or universal beads with single or dual indexing, in which a solid support is contacted with a nucleic acid fragment (insert) that binds to the 3′ transposon end of the first transposon. FIG. 4C shows various configurations after extension and ligation. FIG. 4C shows extension and ligation for indexed or universal beads with single or dual indexing, where the solid support is contacted with an index mix that hybridizes to the transposon or attached polynucleotide, and the nucleic acid fragments are extended. FIG. 4D shows various configurations after indexing (indexed beads for single indexing are not shown because indexing has been completed for this configuration in FIG. 4C). FIG. 4D shows indexing for indexed beads with dual indexing or universal beads with single or dual indexing. As shown in FIG. 4D, in the extension-ligation step of FIG. 4C, indexed beads with single indexing have been completed. The solid support is contacted with an index mix, and the nucleic acid fragments are tagged for indexing.FIG. 4E shows exemplary results of various configurations showing normalized read frequency as a function of insert size. FIG. 4E shows normalized read frequency of tagged nucleic acid fragments from indexed or universal beads with single or dual indexing. FIG. 4A-E specifically shows embodiments of transposome complexes arranged as indexed beads for single indexing (top left), universal beads for single indexing (top right), indexed beads for dual indexing (bottom left), and universal beads for dual indexing. In the indexed bead embodiment shown in FIG. 4A-E, for both single and dual indexing (left), the attached polynucleotide is hybridized to the second transposon at the 3' adaptor sequence (B15' sequence). In the universal bead embodiment shown in FIG. 4A-E, for both single and dual indexing (right), the attached polynucleotide is hybridized to the first transposon at the 5' adaptor sequence (A14 sequence). In some embodiments, normalized libraries can be prepared from raw samples such that nucleic acids are extracted from the raw samples and directly input into the systems or methods described herein, with the self-normalized samples providing tight CVs across the range of sample types. [Figure 4D]FIG. 4A shows a schematic comparing various configurations of transposome complexes immobilized to a solid support via an exemplary biotin (B, solid support not shown), including indexed beads and universal beads, each shown in both single and dual indexing modes, for an embodiment of a method for generating a library of tagged nucleic acid fragments without PCR amplification, in which the transposon and / or attached polynucleotide components are modified, sequenced, or changed compared to each other. FIG. 4A shows various configurations of transposome complexes attached to a solid support. FIG. 4A shows an embodiment of a transposome complex attached to a solid support via an attached polynucleotide, showing a transposase with a first and a second transposon. FIG. 4B shows various configurations after tagmentation. FIG. 4B shows a tagmentation reaction for indexed or universal beads with single or dual indexing, in which a solid support is contacted with a nucleic acid fragment (insert) that binds to the 3′ transposon end of the first transposon. FIG. 4C shows various configurations after extension and ligation. FIG. 4C shows extension and ligation for indexed or universal beads with single or dual indexing, where the solid support is contacted with an index mix that hybridizes to the transposon or attached polynucleotide, and the nucleic acid fragments are extended. FIG. 4D shows various configurations after indexing (indexed beads for single indexing are not shown because indexing has been completed for this configuration in FIG. 4C). FIG. 4D shows indexing for indexed beads with dual indexing or universal beads with single or dual indexing. As shown in FIG. 4D, in the extension-ligation step of FIG. 4C, indexed beads with single indexing have been completed. The solid support is contacted with an index mix, and the nucleic acid fragments are tagged for indexing.FIG. 4E shows exemplary results of various configurations showing normalized read frequency as a function of insert size. FIG. 4E shows normalized read frequency of tagged nucleic acid fragments from indexed or universal beads with single or dual indexing. FIG. 4A-E specifically shows embodiments of transposome complexes arranged as indexed beads for single indexing (top left), universal beads for single indexing (top right), indexed beads for dual indexing (bottom left), and universal beads for dual indexing. In the indexed bead embodiment shown in FIG. 4A-E, for both single and dual indexing (left), the attached polynucleotide is hybridized to the second transposon at the 3' adaptor sequence (B15' sequence). In the universal bead embodiment shown in FIG. 4A-E, for both single and dual indexing (right), the attached polynucleotide is hybridized to the first transposon at the 5' adaptor sequence (A14 sequence). In some embodiments, normalized libraries can be prepared from raw samples such that nucleic acids are extracted from the raw samples and directly input into the systems or methods described herein, with the self-normalized samples providing tight CVs across the range of sample types. [Figure 4E]FIG. 4A shows a schematic comparing various configurations of transposome complexes immobilized to a solid support via an exemplary biotin (B, solid support not shown), including indexed beads and universal beads, each shown in both single and dual indexing modes, for an embodiment of a method for generating a library of tagged nucleic acid fragments without PCR amplification, in which the transposon and / or attached polynucleotide components are modified, sequenced, or changed compared to each other. FIG. 4A shows various configurations of transposome complexes attached to a solid support. FIG. 4A shows an embodiment of a transposome complex attached to a solid support via an attached polynucleotide, showing a transposase with a first and a second transposon. FIG. 4B shows various configurations after tagmentation. FIG. 4B shows a tagmentation reaction for indexed or universal beads with single or dual indexing, in which a solid support is contacted with a nucleic acid fragment (insert) that binds to the 3′ transposon end of the first transposon. FIG. 4C shows various configurations after extension and ligation. FIG. 4C shows extension and ligation for indexed or universal beads with single or dual indexing, where the solid support is contacted with an index mix that hybridizes to the transposon or attached polynucleotide, and the nucleic acid fragments are extended. FIG. 4D shows various configurations after indexing (indexed beads for single indexing are not shown because indexing has been completed for this configuration in FIG. 4C). FIG. 4D shows indexing for indexed beads with dual indexing or universal beads with single or dual indexing. As shown in FIG. 4D, in the extension-ligation step of FIG. 4C, indexed beads with single indexing have been completed. The solid support is contacted with an index mix, and the nucleic acid fragments are tagged for indexing.FIG. 4E shows exemplary results of various configurations showing normalized read frequency as a function of insert size. FIG. 4E shows normalized read frequency of tagged nucleic acid fragments from indexed or universal beads with single or dual indexing. FIG. 4A-E specifically shows embodiments of transposome complexes arranged as indexed beads for single indexing (top left), universal beads for single indexing (top right), indexed beads for dual indexing (bottom left), and universal beads for dual indexing. In the indexed bead embodiment shown in FIG. 4A-E, for both single and dual indexing (left), the attached polynucleotide is hybridized to the second transposon at the 3' adaptor sequence (B15' sequence). In the universal bead embodiment shown in FIG. 4A-E, for both single and dual indexing (right), the attached polynucleotide is hybridized to the first transposon at the 5' adaptor sequence (A14 sequence). In some embodiments, normalized libraries can be prepared from raw samples such that nucleic acids are extracted from the raw samples and directly input into the systems or methods described herein, with the self-normalized samples providing tight CVs across the range of sample types.

[0019] [Figure 5A]Schematic diagrams of exemplary transposome complexes for non-indexing are shown, depicting an attached polynucleotide hybridizing to either a P7 sequence-containing transposon (FIG. 5A) or a P5 sequence-containing transposon (FIG. 5B). Specifically, FIGS. 5A and 5B depict a primer sequence (P5 sequence) bound to a 5' adaptor sequence (A14 sequence) on a first transposon, and a primer sequence (P7' sequence) bound to a 3' adaptor sequence (B15' sequence) on a second transposon, thereby providing a non-indexing transposome complex. The attached polynucleotide can be hybridized to either a second transposon using a 5' binding element (B) (FIG. 5A) or a first transposon using a 3' binding element (B) (FIG. 5B). [Figure 5B] Schematic diagrams of exemplary transposome complexes for non-indexing are shown, depicting an attached polynucleotide hybridizing to either a P7 sequence-containing transposon (FIG. 5A) or a P5 sequence-containing transposon (FIG. 5B). Specifically, FIGS. 5A and 5B depict a primer sequence (P5 sequence) bound to a 5' adaptor sequence (A14 sequence) on a first transposon, and a primer sequence (P7' sequence) bound to a 3' adaptor sequence (B15' sequence) on a second transposon, thereby providing a non-indexing transposome complex. The attached polynucleotide can be hybridized to either a second transposon using a 5' binding element (B) (FIG. 5A) or a first transposon using a 3' binding element (B) (FIG. 5B).

[0020] [Figure 6A]A schematic diagram of an exemplary transposome complex containing an i5 indexing sequence is shown. Figure 6A shows a complex in which an attachment polynucleotide containing a nitro sequence and an anchor sequence can hybridize to an indexing oligonucleotide and then ligate to the 5' end of a first transposon. In Figure 6A, the transposome complex includes a first transposon containing a 3' transposon end sequence (ME) and a 5' adaptor sequence (A14), a second transposon containing a 5' transposon end sequence (ME') and a 3' adaptor sequence (B15'), an attachment polynucleotide containing an attachment adaptor sequence (A14') that hybridizes to A14 in the first transposon, and a binding element (biotin). In this case, the attachment polynucleotide further includes a nitroindole sequence (a universal sequence that binds to any i5 index region) and a primer sequence (P5'). The B15' region of the second transposon is capable of hybridizing to a polynucleotide containing the complement (B15), index region, and P7 primer sequence, which itself is annealed to the P7'-i7' index molecule. Ligation of the 5' end of the i7' index region to the 3' end of the 3' adapter sequence serves to generate a complete double-stranded region.

[0021] [Figure 6B]6B shows a schematic diagram of an exemplary transposome complex containing an i5 indexing sequence. An attached polynucleotide is shown that contains an anchor sequence and a spacer region that can hybridize to an indexing oligonucleotide that can be ligated to the 5' end of a first transposon. In FIG. 6B, the first transposon contains a 3' transposon end sequence (ME) and a 5' adaptor sequence (A14), and the second transposon contains a 5' transposon end sequence (ME') and a 3' adaptor sequence (B15') as in FIG. 6A. However, in this case, the attached polynucleotide contains an adaptor complement (A14'), an anchor sequence, a 2xsp18 spacer region, a primer complement (P5'), and a biotin binding element. The i5 index contains an anchor sequence (complementary to anchor'), an i5 index region, and a primer sequence (P5). The i5 index hybridizes to the complementary anchor and primer sequences on the attached polynucleotide across the spacer.

[0022] [Figure 6C]6C shows a schematic diagram of an exemplary transposome complex containing an i5 indexing sequence. An attachment polynucleotide containing a spacer and an A14' sequence that can hybridize to the indexing oligonucleotide and then ligate to sequence X at the 5' end of the first transposon is shown. In FIG. 6C, the first transposon contains a 3' transposon end sequence (ME) and a 5' adaptor sequence X, and the second transposon contains a 5' transposon end sequence (ME') and a 3' adaptor sequence (B15'). The attachment polynucleotide contains a 5' adaptor sequence (X'), a second adaptor sequence (A14'), a spacer region (2xsp18), a primer complement (P5'), and a complement to a biotin binding element. The 5' adaptor sequence (X') hybridizes to the first transposon 5' adaptor sequence (X). The i5 index comprises a complement to the second adaptor sequence (A14), a 2xsp18 spacer region, and a primer sequence (P5). The i5 index hybridizes across the spacer region to the second adaptor sequence and the primer complement on the attached polynucleotide, and the 3' end of the complement to the second adaptor sequence is ligated to sequence X. In addition, an i7 index comprising a 5' primer sequence (P7), an i7 index region, and a complement to the 3' adaptor sequence (B15) is annealed, and the 3' end of the 3' adaptor sequence is extended to produce a double-stranded region.

[0023] [Figure 6D]6D shows a schematic diagram of an exemplary transposome complex containing an i5 indexing sequence. An attached polynucleotide containing a spacer and an A14' sequence that can hybridize to the indexing oligonucleotide and then ligate to sequence X at the 5' end of the first transposon is shown. In this case, the indexing oligonucleotide contains a double-stranded primer region. In FIG. 6D, the first transposon, the second transposon, and the attached polynucleotide are as in FIG. 6C. The i7 index contains a double-stranded primer (P7 / P7'), an i7 index region, and a complement to the 3' adaptor sequence (B15). The double-stranded region in the i7 index can be generated (annealed) during the extension ligation reaction, e.g., it is not necessary to anneal the i7 index prior to the reaction itself. The P7' oligo can be included in the reaction mixture. The i7 index is annealed via the B15 region, and extension and ligation from the second transposon generates a double-stranded region. An example of this method is provided in Example 5.

[0024] [Figure 7A]Exemplary results are shown for performing the method of generating libraries of tagged nucleic acid fragments with and without PCR amplification, including results for improved indel accuracy and reproducibility (FIG. 7A) and improved coverage in GC-rich promoters (FIG. 7B). Four methods were used to generate these data, two of which used PCR (TruSeq™ Nano and Nextera™ DNA Flex) and two of which did not involve PCR (our method and TruSeq™ PCR-Free). There were two replicates per method, generating a total of eight libraries. After sequencing, the data was downsampled 25X. FIG. 7A shows a high percentage of indel accuracy and reproducibility for the PCR-free method described herein. From left to right, the samples include (in duplicate) TruSeq™ Nano (black), Nextera™ DNA Flex (white), the PCR-free method of the present invention described herein (hatched pattern), and TruSeq™ PCR-Free (checkered pattern). FIG. 7B shows improved coverage in GC-rich promoters for the PCR-free methods described herein compared to other methods, including Nextera™ DNA Flex (top left), TruSeq™ Nano (top right), the PCR-free methods described herein (bottom left), and TruSeq™ PCR-Free (bottom right). [Figure 7B]Exemplary results are shown for performing the method of generating libraries of tagged nucleic acid fragments with and without PCR amplification, including results for improved indel accuracy and reproducibility (FIG. 7A) and improved coverage in GC-rich promoters (FIG. 7B). Four methods were used to generate these data, two of which used PCR (TruSeq™ Nano and Nextera™ DNA Flex) and two of which did not involve PCR (our method and TruSeq™ PCR-Free). There were two replicates per method, generating a total of eight libraries. After sequencing, the data was downsampled 25X. FIG. 7A shows a high percentage of indel accuracy and reproducibility for the PCR-free method described herein. From left to right, the samples include (in duplicate) TruSeq™ Nano (black), Nextera™ DNA Flex (white), the PCR-free method of the present invention described herein (hatched pattern), and TruSeq™ PCR-Free (checkered pattern). FIG. 7B shows improved coverage in GC-rich promoters for the PCR-free methods described herein compared to other methods, including Nextera™ DNA Flex (top left), TruSeq™ Nano (top right), the PCR-free methods described herein (bottom left), and TruSeq™ PCR-Free (bottom right).

[0025] [Figure 8] FIG. 1 shows the results of sequencing libraries from samples containing a known 100% GC repeat expansion (FMR1) prepared using the Nextera™ DNA Flex or TruSeq™ DNA PCR-Free Library Prep Kit as described in Example 3, compared to the methods described herein (four replicate samples 1-4).

[0026] [Figure 9A]Shown are %CV results for libraries prepared using eight index pairs with systems 6C (data in Figure 9A) and 6D (data for two reaction conditions in Figures 9B and 9C), as described in Example 5. [Figure 9B] Shown are %CV results for libraries prepared using eight index pairs with systems 6C (data in Figure 9A) and 6D (data for two reaction conditions in Figures 9B and 9C), as described in Example 5. [Figure 9C] Shown are %CV results for libraries prepared using eight index pairs with systems 6C (data in Figure 9A) and 6D (data for two reaction conditions in Figures 9B and 9C), as described in Example 5.

[0027] [Figure 10] 1 shows a graphical representation of sequencing coverage with gaps within the region of gene RNPEPL1 for PCR library preparation methods (Nextera Flex or tube-based Nextera), but with fewer gaps using the PCR-free method described herein (two lower panels). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0028] Libraries of fragmented nucleic acids are often generated from genomic nucleic acids for use in next generation sequencing (NGS) applications. The present disclosure provides methods, compositions, and kits for generating libraries of fragmented nucleic acids that add the sequences required to perform sequencing operations, including indexes, without using PCR to add sequences by amplification (also referred to herein as PCR-free library generation or PCR-free library preparation). This PCR-free transposomal library preparation method can reduce and / or eliminate the bias caused by PCR in current tagmentation approaches for library preparation.

[0029] Tagmentation refers to the use of transposase to fragment and tag nucleic acid. Tagmentation involves modification of DNA with a transposome complex that contains a transposase enzyme complexed with an adaptor that contains a transposon end sequence (referred to herein as a transposon). Tagmentation results in simultaneous fragmentation of DNA and ligation of adaptors to the 5'-ends of both strands of a duplex fragment. Typically, following a purification step to remove the transposase enzyme, additional sequences are added to the ends of the adapted fragments by PCR.

[0030] The methods, compositions, systems, and kits described herein relate to complex hybridized oligonucleotides and transposome complexes comprising these hybrids, including complexes immobilized on a surface, and the use of transposome complexes for PCR-free library generation. As described herein, the transposome complexes comprise a transposase and an associated transposon that fragments and tags a target DNA molecule. In some embodiments, the complex hybridized oligonucleotides are cleavable and comprise a binding element, while in other embodiments, the complex hybridized oligonucleotides comprise an attachment polynucleotide having a binding element. In some embodiments, the attachment polynucleotide is a nucleic acid sequence that hybridizes to a transposon in the transposome complex and is immobilized on a solid support, such as a slide, flow cell, or bead. Hybridization of the attachment polynucleotide to the transposon allows the transposome complex to be immobilized on the solid support indirectly through the attachment polynucleotide. The attachment polynucleotide is attached to the solid support through a binding element on the attachment polynucleotide. The target nucleic acid is captured by the transposome complex, and the nucleic acid is then fragmented and tagged ("tagmentation"). The oligonucleotide system is designed to allow the incorporation of any tags required for indexing and sequencing through tagmentation, extension, and / or ligation steps without PCR amplification. Thus, in some embodiments, the tagged fragments may be extended, ligated, and indexed without amplification to generate a library of nucleic acid fragments without the use of PCR amplification.

[0031] Solution-based tagmentation has drawbacks and requires several laborious steps. Additionally, bias can be introduced during the PCR amplification step used to introduce tag sequences. For example, reduced indels can be the result of PCR due to polymerase slippage. Furthermore, PCR polymerases have difficulties in some regions, such as high GC regions or AT or sequence repeat regions, resulting in gaps or false structural variation calls in the genome or missing repeat extensions.

[0032] The methods, compositions, systems, and kits presented herein overcome these shortcomings and allow for unbiased sample preparation and sequencing with minimal sample manipulation or transfer requirements. The methods, compositions, systems, and kits described herein relate to generating libraries without the use of PCR amplification. PCR-free approaches reduce and / or eliminate bias caused by PCR, including reducing the number and frequency of gaps, especially in difficult-to-PCR GC-rich regions, improving indel calling performance, including improving indel reproducibility and indel accuracy, improving calling of repeat expansions, and improving coverage in GC-rich promoters. The present application discloses various transposome complex designs for performing PCR-free tagmentation to improve the generation of nucleic acid libraries.

[0033] Additionally, the methods, compositions, systems, and kits described herein may be performed in a shorter time period than nucleic acid sample preparation and analysis using other methods, such as PCR-based methods. Thus, in some embodiments, the methods of generating a library of tagged nucleic acid fragments described herein may be performed in a time period of less than about 5 hours, e.g., less than 5 hours, less than 4 hours, less than 3 hours, or less than 2 hours. In some embodiments, the methods of generating a library of tagged nucleic acid fragments described herein may be performed for a time period ranging from about 90 minutes to about 300 minutes, e.g., 90, 105, 120, 135, 150, 165, 180, 195, 210, 225, 240, 255, 270, 285, or 300 minutes, or within a range defined by any two of the foregoing values.

[0034] Furthermore, in some embodiments, use of the methods, compositions, systems, and kits described herein results in nucleic acid fragmentation that is not time-dependent, transposome immobilization results in consistent insert sizes, and saturation allows for integrated extraction and quantification-free library preparation.

[0035] Additional advantages of the methods, compositions, systems, and kits described herein relate to the immobilization of transposome complexes on solid surfaces, including, for example, reducing hands-on and overall library preparation time, costs, and reagent requirements, and reducing sample input requirements, allowing the use of unpurified or degraded samples as the starting point for library preparation. In addition, the transposome complexes described herein also produce libraries with more consistent insert sizes relative to solution-phase methods, even when various sample input concentrations are used.

[0036] In some embodiments, the nucleic acid library obtained by the methods disclosed herein can be used to determine the nucleic acid sequence of the target sequence using any suitable nucleic acid sequencing platform. In some aspects, the sequence of interest is correlated or associated with one or more congenital or genetic diseases, pathogenicity, antibiotic resistance, or genetic modifications. Sequencing can be used to determine the nucleic acid sequence of short tandem repeats, single nucleotide polymorphisms, genes, exons, coding regions, exomes, or portions thereof. Thus, the methods and compositions described herein relate to creating sequenceable libraries useful in cancer and disease diagnosis, prognosis and therapy, DNA fingerprinting applications (e.g., DNA data banking, criminal casework), metagenomic research and discovery, aglaigenomic applications, and pathogen identification and monitoring.

[0037] In some embodiments, the attachment adaptor sequence hybridizes to at least a portion of the 5' adapter sequence and the binding element is at the 3' end of the attachment polynucleotide. In some embodiments, the attachment adaptor sequence hybridizes to at least a portion of the 3' adapter sequence and the binding element is at the 5' end of the attachment oligonucleotide.

[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. All patents, applications, published applications, and other publications referenced herein are incorporated by reference in their entirety unless otherwise indicated. In the event that there are multiple definitions for a term in this specification, the definitions in this section prevail unless otherwise indicated. As used in this specification and the appended claims, the singular forms "a", "an", and "the" include multiple referents unless the context clearly dictates otherwise. Conventional methods of mass spectrometry, NMR, HPLC, protein chemistry, biochemistry, recombinant DNA techniques, and pharmacology are employed unless otherwise indicated. The use of "or" or "and" means "and / or" unless otherwise indicated. Additionally, the use of the term "including" as well as other forms such as "include", "includes", and "included" are not limiting. As used herein, in a transition phrase or in the body of a claim, the terms "comprise(s)" and "comprising" should be interpreted as having an open-ended meaning. That is, these terms should be interpreted as synonymous with the phrases "at least" or "comprising at least." When used in the context of a process, the term "comprising" means that the process includes at least the recited steps, but may include additional steps. When used in the context of a compound, composition, or device, the term "comprising" means that the compound, composition, or device includes at least the recited features or components, but may also include additional features or components.

[0039] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. Transposome complex

[0040] Some embodiments provided herein relate to a composition for generating a library of tagged nucleic acid fragments without PCR amplification. In some embodiments, the composition comprises a solid support and a transposome complex immobilized to the solid support. In some embodiments, the transposome complex comprises a transposon, a first transposon, an attachment polynucleotide, and a second transposon. In some embodiments, the first transposon comprises a 3' transposon end sequence and a 5' adaptor sequence. In some embodiments, the attachment polynucleotide comprises a 5' adaptor sequence and an attachment adaptor sequence that hybridizes to the binding element. In some embodiments, the second transposon comprises a 5' transposon end sequence and a 3' adaptor sequence. In some embodiments, the transposome complex is immobilized to the solid support via the attachment polynucleotide. In some embodiments, the attachment polynucleotide further comprises a primer sequence.

[0041] In some embodiments, the binding member comprises or is an optionally substituted biotin. In some embodiments, the binding member is linked to the attachment polynucleotide via a linker. In some embodiments, the binding member comprises or is a biotin linker. In some embodiments, the binding member comprises or is a 3', 5', or internal biotin.

[0042] In some embodiments, the 3' transposon end sequence comprises a mosaic end (ME) sequence and the 5' transposon end sequence comprises an ME' sequence. In some embodiments, the 5' adaptor sequence comprises an A14 sequence and the attachment adaptor sequence comprises an A14' sequence. In some embodiments, the 3' adaptor sequence comprises a B15' sequence. In some embodiments, the 3' adaptor sequence is complementary to at least a portion of an index adaptor sequence. In some embodiments, the index adaptor sequence comprises a B15 sequence. In some embodiments, the portion of the attachment polynucleotide comprises a primer sequence, such as a P5' primer sequence. In some embodiments, the primer sequence of the attachment polynucleotide is complementary to at least a portion of an indexing oligonucleotide sequence, such as a P5 primer sequence.

[0043] In some embodiments, the transposome complexes are immobilized on a solid support via a binding member (and optional linker) as described herein. In some embodiments, the solid support is a bead, a paramagnetic bead, a flow cell, a surface of a microfluidic device, a tube, a well of a plate, a slide, a patterned surface, or a microparticle. In some embodiments, the solid support comprises or is a bead. In one embodiment, the bead is a paramagnetic bead. In some embodiments, the solid support comprises a plurality of solid supports. In some embodiments, the transposome complexes are immobilized on a plurality of solid supports. In some embodiments, the plurality of solid supports comprises a plurality of beads. In some embodiments, the plurality of transposome complexes is greater than 1 mm. 2 At least 10 per 3 , 10 4 , 10 5 , 10 6 In some embodiments, the solid support is a bead or a paramagnetic bead and there are more than 10,000, 20,000, 30,000, 40,000, 50,000, or 60,000 transposome complexes bound to each bead.

[0044] Transposon-based technologies can be utilized to fragment DNA, for example, as exemplified in the workflow of the NEXTERA™ FLEX DNA Sample Preparation Kit (Illumina, Inc.), where target nucleic acids such as genomic DNA are treated with a transposome complex that simultaneously fragments and tags ("tagmentes") the target, thereby generating a population of fragmented nucleic acid molecules tagged with unique adapter sequences at the ends of the fragments.

[0045] A transposition reaction is a reaction in which one or more transposons are inserted into a target nucleic acid at random or near-random sites. The components of a transposition reaction include a transposase (or other enzymes capable of fragmenting and labeling nucleic acids (e.g., integrase) as described herein), a transposon element comprising a double-stranded transposon end sequence that binds to the transposase (or other enzymes described herein), and an adapter sequence attached to one of the two transposon end sequences. One strand of the double-stranded transposon end sequence is transcribed into one strand of the target nucleic acid, and the complementary transposon end sequence strand is not (non-transcribed transposon sequence). The adapter sequence may include one or more functional sequences or components (e.g., primer sequences, anchor sequences, universal sequences, spacer regions, or index tag sequences) as necessary or desired.

[0046] A "transposome complex" is composed of at least one transposase (or other enzymes described herein) and a transposon recognition sequence. In some such systems, the transposase binds to the transposon recognition sequence to form a functional complex capable of catalyzing a transposition reaction. In some embodiments, the transposon recognition sequence is a double-stranded transposon end sequence. The transposase binds to a transposase recognition site in a target nucleic acid and inserts the transposon recognition sequence into the target nucleic acid. In some such insertion events, one strand of the transposon recognition sequence (or end sequence) is transcribed into the target nucleic acid and a cleavage event occurs. Exemplary transposition procedures and systems can be readily adapted for use with transposases.

[0047] Exemplary transposases that may be used with certain embodiments provided herein include Tn5 transposase, Sleeping Beauty (SB) transposase, Vibrio harveyi transposase, MuA transposase including R1 and R2 end sequences, and the like. Examples include transposases and Mu transposase recognition sites, Staphylococcus aureus Tn552, Ty1, Tn7 transposase, TN / O and IS10, Mariner transposase, Tc1, P Element, Tn3, bacterial insertion sequences, retroviruses, and yeast retrotransposons. More examples include IS5, Tn10, Tn903, IS911, and engineered versions of transposase family enzymes. The methods described herein also include combinations of transposases, and not just single transposases.

[0048] In some embodiments, the transposase is a Tn5, Tn7, MuA, or Vibrio harveyi transposase, or an active variant thereof. In other embodiments, the transposase is a Tn5 transposase or a variant thereof. In other embodiments, the transposase is a Tn5 transposase or a variant thereof. In other embodiments, the transposase is a Tn5 transposase or an active variant thereof. In some embodiments, the Tn5 transposase is a hyperactive Tn5 transposase or an active variant thereof. In some aspects, the Tn5 transposase is a Tn5 transposase described in PCT International Application No. WO2015 / 160895, which is incorporated herein by reference. In some aspects, the Tn5 transposase is a hyperactive Tn5 having mutations at positions 54, 56, 372, 212, 214, 251, and 338 relative to wild-type Tn5 transposase. In some aspects, the Tn5 transposase is a hyperactive Tn5 having the following mutations relative to wild-type Tn5 transposase: E54K, M56A, L372P, K212R, P214R, G251R, and A338V. In some embodiments, the Tn5 transposase is a fusion protein. In some embodiments, the Tn5 transposase fusion protein comprises a fusion elongation factor Ts (Tsf) tag. In some embodiments, the Tn5 transposase is a hyperactive Tn5 transposase comprising mutations at amino acids 54, 56, and 372 relative to the wild-type sequence. In some embodiments, the hyperactive Tn5 transposase is a fusion protein, and optionally, the fusion protein has an elongation factor Ts (Tsf). In some embodiments, the recognition site is a Tn5-type transposase recognition site (Goryshin and Reznikoff, J. Biol. Chem., 273:7367, 1998). In one embodiment, a transposase recognition site that forms a complex with a hyperactive Tn5 transposase is used (e.g., EZ Tn5™ Transposase, Epicentre Biotechnologies, Madison, Wis.).In some embodiments, the Tn5 transposase is a wild-type Tn5 transposase.

[0049] In some embodiments, the transposome complex comprises a dimer of two molecules of transposase. In some embodiments, the transposome complex is a homodimer, where the two molecules of transposase are each bound to a first and a second transposon of the same type (e.g., the sequences of the two transposons bound to each monomer are the same, forming a "homodimer"). In some embodiments, the compositions and methods described herein employ two populations of transposome complexes. In some embodiments, the transposons in each population are the same. In some embodiments, the transposome complexes in each population are homodimers, where the first population has a first adaptor sequence in each monomer and the second population has a different adaptor sequence in each monomer.

[0050] In some embodiments, the transposase complex comprises a transposase (e.g., Tn5 transposase) dimer comprising a first and a second monomer. In some aspects, each monomer comprises a first transposon, a second transposon, and an attachment polynucleotide, wherein the first transposon comprises a transposon end sequence at its 3' end (also referred to as a 3' transposon end sequence) and an adaptor sequence at its 5' end (also referred to as a 5' adaptor sequence), the second transposon comprises a transposon end sequence at its 5' end (also referred to as a 5' transposon end sequence) and an adaptor sequence at its 3' end (also referred to as a 3' adaptor sequence), and the attachment polynucleotide comprises an attachment adaptor sequence that hybridizes to the 5' adaptor sequence, primer sequence, and linker of the first transposon. In some embodiments, the 5' transposon end sequence of the second transposon is at least partially complementary to the 3' transposon end sequence of the first transposon. In some embodiments, the attachment adaptor sequence of the attachment polynucleotide is at least partially complementary to the 5' adaptor sequence of the first transposon. In some embodiments, the linker of the attachment polynucleotide comprises a binding element. Terminal sequence

[0051] In any of the embodiments of the methods described herein, the first transposon comprises a 3' transposon end sequence and the second transposon comprises a 5' transposon end sequence. In some embodiments, the 5' transposon end sequence is at least partially complementary to the 3' transposon end sequence. In some embodiments, the complementary transposon end sequence hybridizes to form a double-stranded transposon end sequence that binds to a transposase (or other enzymes described herein). In some embodiments, the transposon end sequence is a mosaic end (ME) sequence. Thus, in some embodiments, the 3' transposon end sequence is a ME sequence and the 5' transposon end sequence is a ME' sequence. Adapter Array

[0052] In any embodiment of the methods described herein, the first transposon comprises a 5' adaptor sequence and the second transposon comprises a 3' adaptor sequence. The adaptor sequence may comprise one or more functional sequences or components selected from the group consisting of a primer sequence, an anchor sequence, a universal sequence, a spacer region, an index sequence, a capture sequence, a barcode sequence, a cleavage sequence, a sequencing-related sequence, and combinations thereof. In some embodiments, the adaptor sequence comprises a primer sequence. In other embodiments, the adaptor sequence comprises a primer sequence and an index or barcode sequence. The primer sequence may also be a universal sequence. The present disclosure is not limited to the types of adaptor sequences that can be used, and one of skill in the art will recognize additional sequences that can be used in library preparation and next-generation sequencing. A universal sequence is a region of nucleotide sequence that is common to two or more nucleic acid fragments. Optionally, the two or more nucleic acid fragments also have regions of sequence differences. A universal sequence that may be present in different members of a plurality of nucleic acid fragments can allow for the duplication or amplification of a plurality of different sequences using a single universal primer that is complementary to the universal sequence.

[0053] In some embodiments, the attachment polynucleotide comprises an attachment adaptor sequence that hybridizes to the 5' adapter sequence. In some embodiments, the attachment adaptor sequence is at least partially complementary to the 5' adapter sequence. In some embodiments, the adapter sequence is an A14 sequence or a B15 sequence. Thus, in some embodiments, the 5' adapter sequence is an A14 sequence and the attachment adaptor sequence is an A14' sequence. In some embodiments, the 3' adapter sequence is a B15' sequence. In some embodiments, the adapter sequence is any sequence for hybridization (referred to herein as sequence X). In some embodiments, sequence X comprises 16-20 nucleotides. In some embodiments, sequence X has a melting temperature (Tm) similar to the adapter sequence. In some embodiments, sequencing results are improved when the Tm of sequence X has a melting temperature similar to the adapter sequence. In some embodiments, sequence X has a melting temperature similar to the A14 sequence or the B15 sequence. In some embodiments, the Tm of sequence X is 53°-56°. In some embodiments, the adapter sequence is transcribed onto the 5' end of the nucleic acid fragment by a tagmentation reaction.

[0054] In any embodiment, adapter sequences or transposon end sequences including A14-ME, ME, B15-ME, ME', A14, B15, and ME are provided below: A14-ME: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 1) B15-ME: 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 2) ME': 5'-phoS-CTGTCTCTTATACACATCT-3' (SEQ ID NO: 3) A14: 5'-TCGTCGGCAGCGTC-3' (SEQ ID NO: 4) B15: 5'-GTCTCGTGGGCTCGG-3' (SEQ ID NO: 5) ME: AGATGTGTATAAGAGACAG (SEQ ID NO: 6) Attached polynucleotide

[0055] The embodiments of the transposome complex described herein include an attachment polynucleotide. As used herein, an attachment polynucleotide is a polynucleotide that hybridizes to a transposon on one end and binds to a surface on a second end. Thus, the transposome complex described herein is immobilized to a solid support via an attachment polynucleotide. In some embodiments, the attachment polynucleotide includes an attachment adapter sequence that hybridizes to the adapter sequence of the first transposon or the adapter sequence of the second transposon, a primer sequence, and a linker. In some embodiments, the linker includes a binding element.

[0056] As described herein, the attachment adaptor sequence may be at least partially complementary to the adapter sequence of the first or second transposon. In some embodiments, the attachment adaptor sequence hybridizes to the 5' adapter sequence. In embodiments where the attachment adaptor sequence hybridizes to the 5' adapter sequence, the 5' adapter sequence is an A14 sequence, and the attachment adaptor sequence is an A14' sequence. In some embodiments, the adapter sequence is sequence X. In some embodiments, the attachment adaptor sequence hybridizes to the 3' adapter sequence. In embodiments where the attachment adaptor sequence hybridizes to the 3' adapter sequence, the 3' adapter sequence is a B15' sequence, and the attachment adaptor sequence is a B15 sequence. In any of these embodiments, the attachment adaptor sequence may be fully complementary to the adapter sequence of the first or second transposon, or may be partially complementary to the adapter sequence of the first or second transposon.

[0057] In some embodiments, the attached polynucleotide comprises a primer sequence. In some embodiments, the primer sequence is a P5 primer sequence or a P7 primer sequence or its complement (e.g., P5' or P7'). P5 and P7 primers are used on the surface of commercially available flow cells sold by Illumina, Inc. for sequencing on various Illumina platforms. Primer sequences are described in U.S. Patent Application Publication No. 2011 / 0059865, which is incorporated herein by reference in its entirety. Examples of P5 and P7 primers that may be alkyne-terminated at the 5' end include the following: P5: AATGATACGGGCGACCACCGAGAUCTACAC (SEQ ID NO: 7) P7: CAAGCAGAAGACGGCATACGAG * AT (SEQ ID NO: 8) and derivatives thereof. In some embodiments, the P7 sequence is G * In other examples, the modified guanine at position 14 is 8-oxo-guanine. * is G * and the adjacent 3'A is a phosphorothioate bond. In some examples, the P5 and / or P7 primers include a non-natural linker. Optionally, one or both of the P5 and P7 primers may include a poly-T tail. The poly-T tail is generally located at the 5' end of the above sequence, e.g., between the 5' base and the terminal alkyne unit, but may be located at the 3' end in some cases. The poly-T sequence may include any number of T nucleotides, e.g., 2-20. Although P5 and P7 primers are given as examples, it is understood that any suitable primer may be used in the examples presented herein. An index sequence having a primer sequence that includes the P5 and P7 primer sequences serves to add P5 and P7 to activate the library for sequencing. Although P5 and P7 primers are given as examples, it is understood that any suitable amplification primer may be used in the examples presented herein.

[0058] As used herein, an example of a linker is a moiety that covalently attaches a binding element to the end of a nucleotide portion of an attached polynucleotide, and may be used to immobilize the attached polynucleotide to a solid support. The linker may be a cleavable linker, for example, a linker that can be cleaved to remove the attached polynucleotide, and thus the transposome complex or tagmentation product, from the solid support. As used herein, a cleavable linker is a linker that can be cleaved by chemical or physical means, such as, for example, photolysis, chemical cleavage, thermal cleavage, or enzymatic cleavage. In some embodiments, cleavage may be by biochemical, chemical, enzymatic, nucleophilic, reduction-sensitive agent, or other means. The cleavable linker may comprise a moiety selected from the group including a restriction endonuclease site, at least one ribonucleotide cleavable by an RNAse, a nucleotide analogue cleavable in the presence of a particular chemical agent(s), a photocleavable linker unit, a diol bond cleavable by treatment with (for example) periodate, a disulfide group cleavable by a chemical reducing agent, a cleavable moiety capable of photochemical cleavage, and a peptide cleavable by a peptidase enzyme or other suitable means. Cleavage may be mediated enzymatically by incorporating a cleavable nucleotide or nucleobase into the cleavable linker, such as uracil or 8 oxo-guanine.

[0059] In some embodiments, the linkers described herein may be covalently and directly attached to the attached nucleotide, for example forming an -O- linkage, or may be covalently attached via another group, such as a phosphate or ester. Alternatively, the linkers described herein may be covalently attached to a phosphate group of the attached polynucleotide, for example covalently attached via a phosphate group to the 3' hydroxyl, thus forming an -OP(O)3- linkage.

[0060] As used herein, a binding element is a moiety that can be used to covalently or non-covalently bind to a binding partner. In some aspects, the binding element is on a transposome complex and the binding partner is on a solid support. In some embodiments, the binding element can bind or non-covalently bind to a binding partner on a solid support, thereby non-covalently attaching the transposome complex to the solid support. In some embodiments, the binding element can bind (covalently or non-covalently) to a binding partner on a solid support. In some aspects, the binding element is bound (covalently or non-covalently) to a binding partner on a solid support, resulting in an immobilized transposome complex.

[0061] In such embodiments, the binding element includes or is, for example, biotin, and the binding partner includes or is avidin or streptavidin. In other embodiments, the binding element / binding partner combination includes or is FITC / anti-FITC, dioxygenin / dioxygenin antibody, or hapten / antibody. Further suitable binding pairs include, but are not limited to, dithiobiotin-avidin, iminobiotin-avidin, biotin-avidin, dithiobiotin-succinylated avidin, iminobiotin-succinylated avidin, biotin-streptavidin, and biotin-succinylated avidin. In some embodiments, the binding element is biotin and the binding partner is streptavidin.

[0062] In some embodiments, the binding element can be linked to the binding partner via chemical reaction or is covalently linked by reaction with a binding partner on the solid support, thereby covalently attaching the transposome complex to the solid support. In some aspects, the binding element / binding partner combination comprises or is an amine / carboxylic acid (e.g., linked by standard peptide coupling reactions under conditions known to those skilled in the art, such as EDC or NHS-mediated coupling). Reaction of the two components links the binding element and the binding partner through an amide bond. Alternatively, the binding element and the binding partner can be two click chemistry partners (e.g., an azide / alkyne reacting to form a triazole bond).

[0063] In some embodiments, the attached polynucleotide further comprises additional sequences or components, such as a universal sequence, a spacer region, an anchor sequence, or an index tag sequence, or a combination thereof. A universal sequence is a region of nucleotide sequence that is common to two or more nucleic acid fragments. Optionally, the two or more nucleic acid fragments also have a region of sequence difference. A universal sequence that may be present in different members of a plurality of nucleic acid fragments can allow the replication or amplification of a plurality of different sequences using a single universal primer that is complementary to the universal sequence.

[0064] In some embodiments, the first transposon further comprises a primer sequence 5' of the 5' adaptor sequence, and the attached polynucleotide comprises (i) a portion that is complementary to and hybridizes to the 5' adaptor sequence, and (ii) a complementary primer sequence (see, e.g., FIG. 4A, single index, universal bead). Such a structure is useful as a universal bead for single indexing applications, since there is no index tag sequence used.

[0065] In some embodiments, the first transposon further comprises a primer sequence 5' of the 5' adapter sequence, and the attached polynucleotide comprises an index tag sequence and a primer sequence (see, e.g., Figure 4A, single indexing, indexed beads).

[0066] In some embodiments, the first transposon comprises a 5' adaptor sequence and the attachment polynucleotide comprises (i) a portion that is complementary to and hybridizes to the 5' adaptor sequence, (ii) a spacer region, and (iii) a primer sequence (e.g., FIG. 4A, universal beads, dual indexing).

[0067] In some embodiments, the second transposon comprises a 3' adaptor sequence and the attachment polynucleotide comprises (i) a portion that is complementary to and hybridizes to the 3' adaptor sequence, (ii) an index tag sequence, and (iii) a primer sequence (see, e.g., FIG. 4A, dual indexing, indexed beads).

[0068] In some embodiments, the attached polynucleotide comprises a spacer region (see, e.g., FIG. 4A) or a spacer region and an anchor region (see, e.g., FIG. 3). As used herein, a spacer region refers to a nucleic acid sequence that does not carry any structural or classification information for a known gene function. The spacer region on the attached polynucleotide can be aligned with indexing oligonucleotides having various sequences (e.g., having a range of i5 sequences). In some embodiments, the spacer region is a universal sequence. In some embodiments, the spacer region is a non-DNA spacer. In some embodiments, the spacer region comprises a universal base, such as inosine or nitroindole. In some embodiments, the spacer comprises an sp18 linker. As used herein, an sp18 linker is a standard modified linker with a C18 spacer (18 atom hexa-ethylene glycol spacer), which is equal to 4 base pairs in length. Thus, a 2×sp18 linker is equal to 8 base pairs in length. In some embodiments, the spacer region comprises a 2×sp18 synthetic linker. In some embodiments, the spacer region comprises one or more C18 spacers, such as 1, 2, 3, 4, 5, 6 or more C18 spacers. In some embodiments, the spacer region comprises two C18 spacers (equivalent in length to 8 nucleotides). In some embodiments, the spacer is a C9 spacer equivalent in length to 2 base pairs. In some embodiments, the spacer region comprises one or more C9 spacers (triethylene glycol spacers), such as 1, 2, 3, 4, 5, 6 or more C9 spacers. In some embodiments, the spacer is a conventional spacer used with existing indexes, such as a 10 base pair spacer. In some embodiments, the spacer region is a combination of spacers, for example, a combination of one or more C18 spacers and one or more C9 spacers, or any combination of any spacer described herein. In some embodiments, the spacer region is equivalent in length to 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, or 30 base pairs. In some embodiments, the spacer region is approximately equivalent in length to 8 or 10 base pairs or nucleotides.In some embodiments, the spacer region is specifically selected to be the same length as the index region. In some embodiments, the index region is 8 nucleotides long and the spacer region comprises two C18 spacers. In some embodiments, the index region is 10 nucleotides long and the spacer region comprises two C18 spacers and one C9 spacer.

[0069] In some aspects, the attached polynucleotide comprises an anchor sequence. In some embodiments, the anchor sequence is GGATATGCTCGG (SEQ ID NO:22). In some embodiments, the anchor sequence is the A14 sequence (SEQ ID NO:4). As used herein, anchor region refers to a DNA sequence that is complementary to an anchor complement region in an indexing oligonucleotide and allows hybridization of the two components (see, e.g., FIG. 3B). In some aspects, the anchor region is complementary to a portion of the anchor complement region of an indexing oligonucleotide, and the indexing oligonucleotide comprises an anchor region complement and an index tag sequence (--anchor'-index tag sequence-). In some embodiments, the anchor sequence is complementary to an anchor complement region that is common to a plurality of indexing oligonucleotides. In some embodiments, each index tag sequence in a plurality of indexing oligonucleotides is the same (non-indexing) or different (indexing). In some embodiments, the index tag sequence is an i5 sequence. The attached polynucleotide may further comprise additional sequence elements or components to improve the efficiency and functionality of the attached polynucleotide to bind to the index, including, for example, primer sequences, anchor sequences, universal sequences, spacer regions, index sequences, capture sequences, barcode sequences, cleavage sequences, sequencing-related sequences, and combinations thereof. In some embodiments, the attached polynucleotide comprises an A14' sequence.

[0070] Variations of the transposome complex, including the transposase, transposon, and attached polynucleotide, can be realized. For example, variations in the composition, design, hybridization, structural elements, and overall arrangement of the transposome complex can be realized. While the disclosure and figures provided herein provide some variations, it is understood that further variations within the scope of this disclosure can be readily realized. solid support

[0071] The terms "solid surface", "solid support" and other grammatical equivalents refer to any material that is suitable or can be modified to be suitable for attachment of transposome complexes. As is understood in the art, the number of possible substrates is large. Possible substrates include glass and modified or functionalized glass, plastics (acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, Teflon, etc.), polysaccharides, polyhedral organosilsesquioxane (POSS) materials, nylon or nitrocellulose, ceramics, resins, silica, or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glass, plastics, fiber optic bundles, beads, paramagnetic beads, and various other polymers.

[0072] Suitable bead compositions include plastics, ceramics, glass, polystyrene, methylstyrene, acrylic polymers, paramagnetic materials, thoria sol, carbon black. Examples of suitable solid supports include, but are not limited to, lead, titanium dioxide, latex, or cross-linked dextran such as sepharose, cellulose, nylon, cross-linked micelles, and Teflon, as well as any other material outlined herein for solid supports. In certain embodiments, the microspheres are magnetic microspheres or beads, e.g., paramagnetic particles, spheres, or beads. The beads need not be spherical, and irregular particles may be used. Alternatively or additionally, the beads may be porous. Bead sizes range from nanometers, e.g., 100 nm to millimeters, e.g., 1 mm, with beads of about 0.2 microns to about 200 microns being preferred, and about 0.5 to about 5 microns being particularly preferred, although smaller or larger beads may be used in some embodiments. The beads may be coated with a binding partner, e.g., the beads may be coated with streptavidin. In some embodiments, the beads are streptavidin-coated paramagnetic beads, such as Dynabeads MyOne Streptavidin C1 Beads (Thermo Scientific Catalog No. 65601), Streptavidin MagneSphere Paramagnetic Particles (Promega Catalog No. Z5481), Streptavidin Magnetic Beads (NEB Catalog No. S1420S), and MaxBead Streptavidin (Abnova Catalog No. U0087). The solid support may also be a slide, such as a flow cell or other slide, modified so that transposome complexes can be immobilized thereon.

[0073] In some embodiments, the binding partners are present on the solid support or beads at a density of from about 1000 to about 6000 pmol / mg, or from about 2000 to about 5000 pmol / mg, or from about 3000 to about 5000 pmol / mg, or from about 3500 to about 4500 pmol / mg.

[0074] In one embodiment, the solid surface is the inner surface of a sample tube. In another embodiment, the solid surface is a capture membrane. In one example, the capture membrane is a biotin capture membrane (e.g., available from Promega Corporation). In another example, the capture membrane is filter paper. In some embodiments of the present disclosure, a solid support consisting of an inert substrate or matrix (e.g., glass slides, polymer beads, etc.) is functionalized by application of a layer or coating of an intermediate material that contains reactive groups that allow for covalent attachment to molecules such as polynucleotides. Examples of such supports include, but are not limited to, polyacrylamide hydrogels supported on an inert substrate such as glass, particularly the polyacrylamide hydrogels described in WO 2005 / 065814 and US 2008 / 0280773, the contents of which are incorporated herein by reference in their entirety. Methods for tagmenting (fragmenting and tagging) DNA on solid surfaces for the construction of tagmented DNA libraries are described in International Publication No. WO 2016 / 189331 and US Patent Application Publication No. 2014 / 0093916(A1), which are incorporated herein by reference in their entireties. In some embodiments, the transposome complexes described herein are immobilized to a solid support via a binding member. In some such embodiments, the solid support comprises streptavidin as a binding partner and the binding member is biotin.

[0075] In some embodiments, transposome complexes are immobilized on a solid support, such as beads, at a specific density or density range. In some embodiments, the density of the complexes on the solid support refers to the concentration of the transposome complexes in solution during the immobilization reaction. The complex density assumes that the immobilization reaction is quantitative. Once the complexes are formed at a specific density, the density remains constant for a batch of surface-bound transposome complexes. The resulting beads can be diluted, and the resulting concentration of the complexes in the diluted solution is the preparation density of the beads divided by the dilution factor. The diluted bead stocks retain the complex density from their preparation, but the complexes are present at a lower concentration in the diluted solution. The dilution step does not change the density of the complexes on the beads, and therefore affects the yield of the library, but not the size of the inserts (fragments). In some embodiments, the density is about 5 nM to about 1000 nM, or about 5 to 150 nM, or about 10 nM to 800 nM. In other embodiments, the density is about 10 nM, or about 25 nM, or about 50 nM, or about 100 nM, or about 200 nM, or about 300 nM, or about 400 nM, or about 500 nM, or about 600 nM, or about 700 nM, or about 800 nM, or about 900 nM, or about 1000 nM. In some embodiments, the density is about 100 nM. In some embodiments, the density is about 300 nM. In some embodiments, the density is about 600 nM. In some embodiments, the density is about 800 nM. In some embodiments, the density is about 100 nM. In some embodiments, the density is about 1000 nM.

[0076] Some embodiments provided herein relate to a kit comprising a transposome complex as described herein, and an index mix comprising an index sequence. Some embodiments provided herein relate to a kit comprising a composition comprising a solid support having a transposome complex immobilized thereon as described herein, and an index mix comprising an index sequence. In some embodiments, the index mix comprises an i5 index sequence and an i7 index sequence, wherein the i5 index sequence is complementary to and hybridizes to the attachment polynucleotide, and the i7 index sequence is complementary to and hybridizes to the 3' adaptor sequence. Immobilized transposome complexes / methods for generating tagged nucleic acid fragments

[0077] The present disclosure further provides a method for preparing the immobilized transposome complexes described herein. Some embodiments provided herein relate to a method for generating a library of tagged nucleic acid fragments. In some embodiments, the method includes providing a solid support with transposome complexes immobilized thereon, applying a target nucleic acid to the solid support under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and to attach a 3' end of a first transposon to a 5' end of the target fragment to generate a plurality of 5' tagged target fragments, and applying an index mix comprising index sequences to activate the library for sequencing. In some embodiments, the transposome complex includes a transposon attached to a first and a second transposon, a first transposon comprising a 3' transposon end sequence and a 5' adaptor sequence, an attachment polynucleotide comprising an attachment adaptor sequence and a binding element, and a second transposon comprising a 5' transposon end sequence and a 3' adaptor sequence.

[0078] In some embodiments, the method includes generating a library of tagged nucleic acid sequences comprising contacting an immobilized transposome complex with the target nucleic acid under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and to bind a 3' end of a first transposon to a 5' end of the target fragment to generate a plurality of 5'-tagged target fragments.

[0079] In some aspects, the methods further comprise treating the solid support to remove unbound nucleic acid or, optionally, treating the solid support to remove the transposase from the complex by (a) heating the solid support and / or (b) washing the solid support with an enzymatic denaturant, which optionally comprises sodium dodecyl sulfate (SDS), guanidine hydrochloride, urea, or a proteinase.

[0080] In some embodiments, the contacting comprises adding a biological sample to the transposome complex, in some embodiments, the biological sample comprises a cell lysate or whole cells, or is selected from blood, plasma, serum, lymph, mucus, sputum, urine, semen, cerebrospinal fluid, bronchial aspirate, feces, macerated tissue, and fixed tissue FFPE.

[0081] In some aspects, the contacting further comprises hybridizing a plurality of indexing oligonucleotides to the attached polynucleotide, wherein the plurality of indexing oligonucleotides comprises the same or different index sequences.

[0082] In some aspects, the method further comprises treating the plurality of 5'-tagged target fragments with a polymerase and a ligase to extend and ligate the strands to produce a complete double-stranded tagged fragment. In some aspects, the treating with the polymerase and the ligase is performed in the presence of a DNA secondary structure disrupting agent, optionally DMSO. In some aspects, the treating with the polymerase and the ligase is performed in the presence of an oligonucleotide that is a complement of a primer sequence, the oligonucleotide is a P7' oligonucleotide, and the primer sequence is a P7 sequence. In some embodiments, the polymerase comprises a T4 DNA polymerase mutant lacking exonuclease activity.

[0083] In some embodiments, the method further comprises removing the fully double-stranded tagged fragment from the solid support, hi some embodiments, removing comprises applying heat and / or a denaturing agent sufficient to cleave the fully double-stranded tagged fragment from the solid support.

[0084] In some embodiments, the method further comprises sequencing one or more of the 5' tagged target fragments or the fully double-stranded tagged fragments. In some embodiments, the fragments are not quantified by PCR after contacting and before sequencing. In some embodiments, the nucleic acid is DNA or RNA. In some embodiments, the 3' adaptor sequence is complementary to at least a portion of the index adaptor sequence. In some embodiments, the primer sequence of the attachment polynucleotide is complementary to at least a portion of the index primer sequence. In some embodiments, the primer sequence of the attachment polynucleotide is complementary to the index primer sequence of the indexing polynucleotide.

[0085] In some embodiments, the method further comprises washing the solid support to remove unbound nucleic acid. In some embodiments, the method further comprises treating the solid support to remove transposase. In some embodiments, treating the solid support comprises washing the solid support with an enzymatic denaturant. In some embodiments, the enzymatic denaturant comprises acetic acid, dimethylsulfoxide (DMSO), dithiothreitol, ethanol, formaldehyde, formamide, glutaraldehyde, guanidine hydrochloride, lithium perchlorate, mercaptoethanol, propylene glycol, proteinase, sodium bicarbonate, sodium dodecyl sulfate (SDS), sodium salicylate, sulfosalicylic acid, trichloroacetic acid, tris(2-carboxyethyl)phosphine) (TCEP), or urea. In some embodiments, treating the solid support comprises heating the solid support to remove transposase. In some embodiments, applying the target nucleic acid comprises mixing the biological sample with the transposome complex. The nucleic acids need not be completely purified or purified at all, but may be part of a biological sample or a mixture with proteins, other nucleic acid species, other cellular components, and / or any other contaminants. In some embodiments, the biological sample comprises a cell lysate. In some embodiments, the biological sample comprises whole cells. In some embodiments, the biological sample is selected from bodily fluids, blood, plasma, serum, lymph, mucus, sputum, urine, semen, cerebrospinal fluid, bronchial aspirate, feces, macerated tissue, and fixed tissue formalin-fixed paraffin-embedded tissue (FFPE).

[0086] In some embodiments, applying the index mix comprises hybridizing the index sequence to the attached polynucleotide and the second transposon. In some embodiments, the index mix comprises an extension ligation mix (ELM). In some embodiments, the ELM comprises a polymerase and a ligase. In some embodiments, the ELM is a split ELM for separate ligation of the index. In some embodiments, the polymerase comprises T4 DNA polymerase or a variant thereof (such as a T4 DNA polymerase lacking exonuclease activity, or a mutant T4 DNA polymerase, or a mutant T4 DNA polymerase lacking exonuclease activity). In some embodiments, the ligase comprises E. coli DNA ligase. In some embodiments, the extension ligation reaction is performed in the presence of a DNA secondary structure disrupting agent, such as DMSO. In some embodiments, the method further comprises denaturing the plurality of 5'-tagged target fragments from the solid support. In some embodiments, denaturation can be achieved by applying heat and / or a denaturing agent sufficient to cleave the 5'-tagged target fragments from the solid support. In some embodiments, the method further comprises sequencing one or more of the 5' tagged target fragments or ligation products thereof. In some embodiments, the nucleic acid is DNA or RNA.

[0087] In some embodiments, such methods include contacting a first transposon and a second transposon with an attached polynucleotide bound to a surface under conditions suitable for hybridizing the attached polynucleotide to the first or second transposon. In some embodiments, a method for preparing a solid support-bound transposome complex includes incubating a transposome complex as described herein with a solid support containing a binding partner under conditions sufficient for the binding element to bind (covalently or non-covalently) to the binding partner. The immobilized hybridized polynucleotide comprising the attached polynucleotide and the first and second transposons is then contacted with a transposase under conditions suitable for forming a transposome complex.

[0088] In some embodiments, the first and second transposons described herein are annealed to each other, and the first transposon is annealed to the attached polynucleotide.The annealed polynucleotide is then loaded onto a transposase, such as Tn5 transposase, thereby forming a transposome complex, and then contacted with and bound to a solid support, such as beads.In some embodiments, the annealed transposon is bound to a solid support, such as beads, and then the transposase is complexed with the transposon, thereby generating a transposome that is bound to the solid support.

[0089] In some aspects, a method for preparing fragments from a target nucleic acid is provided, the method comprising providing a solid support comprising a transposome complex immobilized thereon as described herein, and applying the target nucleic acid to the solid support under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and to attach the 3' end of a first transposon to the 5' end of the target fragments to generate a plurality of 5'-tagged target fragments. In some aspects, the method further comprises applying an index mix comprising index sequences. In some embodiments, the sequence conditions are suitable for tagmentation by using a transposome complex to fragment and tag the target nucleic acid.

[0090] In some embodiments of the methods described herein, after fragmentation and labeling, the method further comprises washing the solid support to remove unbound nucleic acids. In some embodiments of the methods described herein, following fragmentation and tagging, the method further comprises removing the transposase. Removal of the transposase can be accomplished under chemical conditions, such as washing the solid support with an agent to remove the transposase. In some embodiments, the agent is sodium dodecyl sulfate (SDS).

[0091] In some embodiments, the method further comprises contacting the solid support with an index mix. Contacting with the index mix serves to tag the fragments with a specific index and activate the library for sequencing. In some embodiments, the index mix comprises oligonucleotides that hybridize to the transposon or attached polynucleotide to tag or index the nucleic acid fragments. Thus, for example, the oligonucleotides comprising the index and other regions of the oligonucleotide are complementary to and hybridize to the transposon or attached polynucleotide. As an example, in one embodiment, an i5 index having a primer sequence (P5 sequence), an index sequence (i5 sequence), and an anchor sequence hybridizes to the attached polynucleotide in a complementary sequence such that P5 hybridizes to P5' and the anchor hybridizes to the anchor'. In some embodiments, the i5 sequence binds to the nitroindole (nitro) sequence of the attached polynucleotide. In some embodiments, the nitroindole sequence is complementary to and hybridizes to any i5 index sequence. In one embodiment, the i7 index, which has a primer sequence (P7), an index sequence (i7), and an adapter sequence (B15 sequence), hybridizes to a second transposon with a complementary sequence, such that P7 hybridizes to P7', i7 hybridizes to i7', and B15 hybridizes to B15'. In some embodiments, the index mix includes a double-stranded index. After contacting the solid support with the index mix, the fragments are ligated and extended using an extension and ligation mix (ELM). The ELM can include, for example, T4 DNA polymerase and E. coli DNA ligase. Exemplary polymerases include, but are not limited to, Bst DNA polymerase I, E. coli DNA polymerase I (Klenow fragment), Klenow fragment (3'-5' exo), T4 DNA polymerase, T7 DNA polymerase, and Deep VentR.(Exo)DNA polymerase, Deep VentR DNA polymerase, Therminator II DNA polymerase, AmpliTherm DNA polymerase, SP6 DNA polymerase, or Taq polymerase, or a mutant, analog, or derivative of any of the foregoing polymerases. Exemplary ligases include T4 DNA ligase, T4. Examples of suitable ligases include, but are not limited to, RNA ligase, Taq DNA ligase, E. coli DNA ligase, Pfu DNA ligase, and Tth DNA ligase. In some embodiments, the ELM is a split ELM reaction that allows index ligation and index extension of differential indexes, for example, to allow separate i5 ligation and i7 extension. The solid support is then treated with an agent that denatures strand sequences, such as NaOH, thereby generating tagged nucleic acid fragments.

[0092] In some embodiments, the fragments are deposited on a flow cell. In some embodiments, the fragments are hybridized to complementary primers grafted to a flow cell or surface. In some embodiments, the sequences of the sequencing fragments are detected by next generation sequencing methods such as array sequencing or sequencing while synthesis.

[0093] Table 1 shows exemplary sequences used in transposome complexes to generate a library of tagged nucleic acid fragments. [Table 1]

[0094] In some embodiments, a method of generating a library of tagged nucleic acid fragments includes contacting an immobilized transposome complex with a target nucleic acid under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and to attach a 3' end of a first transposon to a 5' end of the target fragment to produce a plurality of 5'-tagged target fragments, and optionally treating the solid support to remove unbound nucleic acid by (a) heating the solid support and / or (b) washing the solid support with an enzymatic denaturant or treating the solid support to remove the transposase from the complex, wherein the enzymatic denaturant optionally includes sodium dodecyl sulfate (SDS), guanidine hydrochloride, urea, or a proteinase. treating the plurality of 5'-tagged target fragments with a polymerase and a ligase to extend and ligate the 5'-tagged target fragments to produce fully double-stranded tagged fragments, optionally wherein the treatment with the polymerase and ligase is in the presence of a DNA secondary structure disrupting agent, which optionally is DMSO; removing the fully double-stranded tagged fragments from the solid support, optionally wherein the removing comprises applying heat and / or a denaturing agent sufficient to cleave the fully double-stranded tagged fragments from the solid support, optionally wherein the denaturing agent is NaOH; and selecting the fully double-stranded tagged fragments using capture beads, optionally wherein the capture beads are magnetic beads, and further optionally wherein two separate selection steps are performed.

[0095] In some embodiments, the immobilized transposome complex comprises a solid support and a transposome complex immobilized to the solid support, the transposome complex comprises a transposon, a first transposon comprising a 3' transposon end sequence and an anchor sequence (Anchor), a second transposon comprising a 5' transposon end sequence and a B15' sequence, an anchor sequence complement (Anchor'), an A14' sequence, a spacer, a P5' sequence, and a binding element comprising biotin, the biotin being immobilized to the solid support. In some embodiments, the method further comprises sequencing one or more of the complete double-stranded tagged fragments. Methods for generating tagged nucleic acid sequences via combined tagmentation and indexing

[0096] In some embodiments, dual-indexed paired-end libraries can be prepared from DNA samples using a combined tagmentation and indexing process. By avoiding separate tagmentation and indexing steps, this protocol has the advantages of ease of use and shorter duration. Furthermore, this protocol can avoid a denaturation step and produce double-stranded libraries without the need for a separate step of producing double-stranded samples from denatured single-stranded samples. This protocol can also avoid specific washing steps, further shortening the time required for workflow.

[0097] In this method, a first immobilized transposon complex and a second immobilized transposon complex are used. In the first immobilized transposon complex, the sequence X in the first transposon is an anchor sequence, and the sequence X' in the attachment polynucleotide is an anchor sequence complement. In the second immobilized transposon complex, the sequence X in the first transposon is an anchor sequence, and the sequence X' in the attachment polynucleotide is an anchor sequence complement. The anchor sequences of the first and second immobilized transposon complexes may be non-complementary to avoid cross-hybridization. The first transposon complex may include an exemplary first attachment polynucleotide that includes (i) an anchor sequence complement, an A14' sequence, a spacer, and a P5' sequence, and (ii) a binding element that includes biotin, and the second transposon complex may include an exemplary second attachment polynucleotide that includes (i) an anchor sequence complement, a B15' sequence, a spacer, and a P7' sequence, and (ii) a binding element that includes biotin.

[0098] In combined tagmentation and indexing, a suspension of solid support bound transposomes (BLT, i.e., immobilized transposon complexes) containing the first and second transposome complexes may be added to each well. The indexing step may then be performed in a single reaction solution with index 1 (i7) adaptors, index 2 (i5) adaptors, and sequences required to determine cluster generation ligated in the same reaction solution as tagmentation. The first indexing oligonucleotide may include A14, i5, and P5 sequences, and the second indexing oligonucleotide may include B15, i7, and P7 sequences. Conditions for the tagmentation / ligation step include tagmentation buffer and E. coli DNA ligase added to a mixture of the target DNA, the first and second transposome complexes, and the first and second indexing oligonucleotides. This combined tagmentation and indexing step may proceed for various times, such as at least 1 minute to at least 15 minutes, or at least 5 minutes to at least 15 minutes.

[0099] Tagmentation and indexing can then be stopped using a variety of methods, including heating the solid support and / or washing the solid support with an enzyme denaturant, optionally using sodium dodecyl sulfate (SDS), guanidine hydrochloride, urea, or proteinase. The time to stop the reaction can vary from at least 1 minute to at least 5 minutes by heating and / or through the washing steps.

[0100] The 5' tagged target fragments linked to indexing oligonucleotides can be treated with a polymerase to produce complete double-stranded tagged fragments. The extension reaction can proceed for various times, such as from at least 1 minute to at least 10 minutes, or from at least 2 minutes to at least 10 minutes.

[0101] Furthermore, library preparation involving combined tagmentation and indexing may also avoid a qPCR step since the final product is a double-stranded DNA library in solution.

[0102] In some embodiments, contacting the first immobilized transposome complex with the second immobilized transposome complex and treating the multiple 5'-tagged target fragments with the ligase are performed in a single reaction.

[0103] In some embodiments, the double-stranded tagged fragments are produced in solution.

[0104] Some embodiments further include selecting the fully double-stranded tagged fragments using capture beads, optionally the capture beads are magnetic beads, and further optionally, two separate selection steps are performed.

[0105] In some embodiments, the method further comprises sequencing one or more of the complete double-stranded tagged fragments. target nucleic acid

[0106] The target nucleic acid may be of any type, including DNA, RNA, cDNA, etc. For example, the target nucleic acid may be in various states of purification, including purified nucleic acid. In some embodiments, the biological sample comprises a mixture of nucleic acids (such as DNA), proteins, other nucleic acid species, other cellular components, and / or any other contaminants present in approximately the same proportions as found in vivo. For example, in some embodiments, the components are found in the same proportions as found in intact cells. Because the methods provided herein allow the nucleic acids or DNA to bind to the solid support via the tagmentation process, other contaminants can be removed by washing the solid support after tagmentation has occurred. The biological sample may include, for example, crude cell lysates or whole cells. For example, the crude cell lysates applied to the solid support in the methods described herein do not need to be subjected to one or more of the separation steps traditionally used to isolate nucleic acids from other cellular components.

[0107] Thus, in some embodiments, biological samples can include, for example, blood, plasma, serum, lymph, mucus, sputum, urine, semen, cerebrospinal fluid, bronchial aspirate, feces, and macerated tissues thereof, as well as purified nucleic acids from any source, or any other biological specimens that contain nucleic acid or DNA material. Target nucleic acids can be obtained from tissue samples, tumor samples, cancer cells, or biopsy samples. Target nucleic acids can also be cell-free DNA (cfDNA).

[0108] The target nucleic acid may be from any species from a mixture of species. For example, the target nucleic acid may be from a mammal (such as human, dog, cat, cow, pig, sheep, or other livestock), or other species such as fish, bacteria, viruses, fungi, or archaea. The nucleic acid may be from an environmental sample such as soil or water.

[0109] In some embodiments, the target nucleic acid is DNA. In one such embodiment, the DNA is double-stranded. In some further embodiments, the double-stranded DNA comprises genomic DNA. In some other embodiments, the target nucleic acid is RNA or a derivative thereof, or cDNA. In some embodiments, the target nucleic acid is the product of an upstream reaction, such as an amplification or replication event, e.g., an amplicon. In some embodiments, the target nucleic acid is bisulfite-treated DNA.

[0110] In some embodiments, the biological sample (raw sample or extract) is processed to purify the target nucleic acid prior to the tagmentation method described herein. In some embodiments, the biological sample is a raw sample or a raw sample lysate (e.g., blood, saliva, single or multiple cells). In some embodiments, the processing method includes providing a raw sample, a raw sample lysate, or a pre-treated sample (e.g., a blood or saliva sample), mixing the sample with a lysis buffer and proteinase K, and incubating the mixture to lyse cells in the sample and release DNA from the cells, thereby providing the target nucleic acid(s) for the tagmentation method described herein. The amount of the biological sample is not particularly required, as long as the biological sample contains sufficient nucleic acid for analysis. Thus, the amount of biological sample may include from about 1 μL to about 500 μL, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, or 500 μL, or an amount within a range defined by any two of the foregoing values.

[0111] Components in a raw sample or a raw sample lysate, or additives in a pretreated sample such as saliva collected in an Oragene collection tube (stabilizers in the collection tube) may inhibit the tagmentation reaction. Thus, methods are provided herein for processing a raw sample, a raw sample lysate, or a pretreated sample to overcome this problem. In some embodiments, the method includes providing a raw sample, a raw sample lysate, or a pretreated sample (e.g., a blood or saliva sample), mixing the sample with a lysis buffer, proteinase K, and DNA capture or purification beads (e.g., SPRI beads, beads containing carboxyl groups, where the beads are optionally magnetic beads), incubating the mixture to lyse cells in the sample and release DNA from the cells, thereby capturing DNA on the DNA purification beads or SPRI beads, and separating the beads containing the captured DNA from the mixture. The separation serves to remove potential tagmentation inhibitors present in the supernatant. The method optionally further includes washing the beads containing the captured DNA and eluting the DNA from the beads to provide the target nucleic acid(s).

[0112] In some embodiments, the target nucleic acid is present in an amount sufficient to generate a library for sequencing. In some embodiments, the amount of target nucleic acid is an amount of 10-500 ng of gDNA, such as 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, or 500 ng, or an amount within a range defined by any two of the aforementioned values. In some embodiments, the target nucleic acid is gDNA present in an amount of 50 ng. Sequencing methods

[0113] Some of the methods provided herein include a method of analyzing nucleic acids. Such methods include preparing a library of template nucleic acids of a target nucleic acid, obtaining sequence data from the library of template nucleic acids, and optionally assembling a sequence representation of the target nucleic acid. The DNA fragments produced by transposome-mediated tagmentation can be sequenced according to any suitable sequencing methodology, such as direct sequencing or next-generation sequencing, including sequencing by synthesis, sequencing by ligation, sequencing by hybridization, sequencing based on detection of released protons, which may use electrical detectors and related technologies available from Ion Torrent (Guilford, CT, a subsidiary of Life Technologies), nanopore sequencing, and the like. In some embodiments, the DNA fragments are sequenced on a solid support, such as a flow cell. Exemplary SBS procedures, fluidics systems, and detection platforms that can be readily adapted for use with the nucleic acid libraries produced by the methods of the present disclosure are described, for example, in Bentley et al., Nature 456:53-59 (2008), WO 04 / 018497, U.S. Pat. No. 7,057,026, WO 91 / 06678, WO 07 / 123744, U.S. Pat. Nos. 7,329,492, 7,211,414, 7,315,019, 7,405,281, and 2008 / 0108082, each of which is incorporated herein by reference.

[0114] The methods described herein are not limited to any particular type of sequencing instrumentation system used. EXAMPLES

[0115] The following examples serve to illustrate, but not limit, the disclosure provided herein. Example 1: No attached oligonucleotide with user cleavable linker

[0116] Experiments were performed to compare PCR-free sequencing data with PCR sequencing data. Libraries were prepared using TruSeq PCR-free, TruSeq Nano (+PCR), Nextera Flex (+PCR), and our method, and then sequenced to 25X coverage. There were two replicates for each method, for a total of eight libraries. Figure 7A shows that the PCR-free method (striped and checked bars representing our method and TruSeq PCR-free, respectively) has improved indel accuracy and reproducibility compared to the method with PCR (black and white bars representing TruSeq Nano and Nextera Flex, respectively). Figure 7B shows that coverage of GC-rich promoter regions is also improved in the PCR-free method (lower two panels, our method in the lower left panel and TruSeq PCR-free in the lower right panel). Example 2: Generation of a library of tagged nucleic acid fragments without PCR amplification

[0117] Step A1. Formation of Immobilized Transposome Complexes - Indexed Beads. A mixture consisting of (1) a first transposon having a 3' mosaic end (ME) sequence (SEQ ID NO:6), a first tag sequence (A14), and a 5' primer sequence (P5') (final concentration 25 μM), (2) a second transposon having a 5' complementary mosaic end sequence (ME'; SEQ ID NO:3) and a second tag sequence (B15') (final concentration 37.5 μM), and (3) an attached polynucleotide comprising a 3' sequence complementary to the second tag sequence (B15), an index sequence (i701 in this case, Table 1), and a 5' primer sequence (P7) with biotin at the 5' end (final concentration 25 μM) was dissolved in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, and 25 mM EDTA. The transposon / attached polynucleotides were annealed by treating with NaCl, heating at 95°C for 10 min, and then cooling to 10°C over approximately 15 min. The annealed transposon / attached polynucleotides (2 μM final concentration based on the attached polynucleotide) were then mixed with transposase enzyme (6.1 μM final concentration) and incubated overnight at 37°C to form solution-phase transposome complexes (Figure 4A, diagram of indexed beads). The solution-phase transposome complexes were then immobilized on a solid support by mixing with streptavidin-coated beads. In some examples, immobilization can be performed in the presence of HT1 buffer (Illumina), a high salt buffer that aids in the formation of biotin-streptavidin bonds. After rotating in HT1 for 1 h, the beads were pelleted and washed once in a mixture of HT1 buffer and 50% glycerol standard storage buffer (Illumina) (9:1). The beads were then resuspended in 360 μL of buffer containing 50 mM Tris pH 7.5, 30 mM NaCl, and 0.1% Tween 20. 40 μL of EPX2 (Illumina) was added and the beads were rotated for an additional 10 minutes at room temperature. The beads were pelleted again and then resuspended in 396 μL of the same buffer and treated with 4 μL of single-stranded binding protein (5 mg / mL) and rotated again for 10 minutes.The beads were pelleted again, washed once in a 9:1 mixture of HT1 buffer:standard storage buffer, and resuspended in 15% glycerol standard storage buffer (Illumina). The resulting indexed beads were used in single-indexing and dual-indexing tagmentation protocols.

[0118] Step A2. Formation of immobilized transposome complex-universal beads. Annealed transposons were prepared as described in step A1, except that the attached polynucleotide contained a 5' sequence complementary to the first tag sequence (A14') and a 3' primer sequence (P5') with a biotin at the 3' end and, optionally, an intervening universal nitroindole sequence (for dual indexing). Transposome complexes were prepared from the annealed transposons and immobilized on a solid support as described in step A1. The resulting universal beads were used in single-indexing and dual-indexing tagmentation protocols as indicated.

[0119] Step B. Tagmentation. DNA (e.g., about 50 pg to 5 μg) was mixed with transposome complexes and 50 μL of tagmentation buffer (10 mM Tris acetate (pH 7.6), 5 mM magnesium acetate, and 10% dimethylformamide), as described in U.S. Patent Nos. 9,080,211, 9,085,801, and 9,115,396, each of which is incorporated by reference, and the resulting mixture was incubated at 55° C. for 5 minutes. A library of tagged DNA fragments immobilized on the beads was generated. The tagmentation reaction mixture was treated with 10 μL of stop buffer containing 5% SDS, 100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween 20, and the resulting mixture was incubated at 37° C. for 5 minutes to denature the transposase enzyme from the transposome complexes. The beads with immobilized DNA fragments were then pelleted on a magnet and washed three times in wash buffer (100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween) to remove residual SDS. The beads were separated from the supernatant by magnetic capture and further washed using 100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween 20. The tagmented fragments obtained for all four approaches are shown in FIG. 4B.

[0120] Step C. Extension, Ligation, and Indexing. Extension and ligation were performed by contacting with an extension and ligation mix (ELM) containing T4 DNA polymerase (exonuclease-minus) and E. coli DNA ligase, and incubating at 30° C. for 15 min, followed by 16° C. for 15 min, thereby filling the gap in the DNA fragment between the 3′ end of the fragment and the 5′ end of the ME′ sequence, and extending the single-stranded region to generate a fully double-stranded product by incorporating the remaining sequence from the attached polynucleotide (FIG. 4C). In certain cases, an index was also added during this step. As shown in the top right diagram of FIG. 4D, an index was added to the universal bead / single index construct by adding an oligonucleotide with a double-stranded primer sequence (P7 / P7′), a double-stranded index sequence (in this case, i701 / i701′), and a single-stranded overhang region with a 3′ sequence complementary to the second tag sequence (B15). For the indexed bead / dual indexing approach (Figure 4D, bottom left diagram), the indexing reagent contained a double-stranded primer sequence (P5 / P5'), a double-stranded index sequence (in this case, i501 / i501'), and a single-stranded overhang region with a 5' sequence complementary to the first sequence tag (A14'). For the universal bead / dual indexing approach (Figure 4D, bottom right diagram), the indexing reagent was the same as for the universal bead / single index, but an additional second indexing reagent containing a complementary primer sequence (P5) and index sequence (i5) was hybridized and ligated to the 5' end of the A14 sequence.

[0121] The reaction mixture was treated with 10 μL of stop buffer containing 5% SDS, 100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween20, and the resulting mixture was incubated at 37° C. for 5 min to denature the transposase enzyme from the transposome complex. The beads with immobilized DNA fragments were then pelleted on a magnet and washed three times in wash buffer (100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween) to remove residual SDS. The beads were separated from the supernatant by magnetic capture and further washed using 100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween20.

[0122] Step D. Release of tagged fragments. After the third wash, the beads were resuspended in 100 μL of 0.2 N NaOH to denature the library fragments and release them from the beads. The library was purified according to the standard SPRI purification protocol by adding 100 μL of the supernatant directly to 180 μL of SPRI beads and eluting with 15 μL of Illumina resuspension buffer. The library was quantified by qPCR and then prepared for sequencing on the MiSeq® by diluting to 5 μL of approximately 3200 pM and denaturing with 5 μL of 0.2 N NaOH for 5 min at room temperature. Chilled Illumina HT1 buffer (990 μL) was added and 1 mL of the complete mixture was loaded into the MiSeq® cartridge.

[0123] The results are shown in FIG. 4E and summarized in Table 2 below for indexed beads or universal beads with single or dual indexing. [Table 2]

[0124] Using the method described herein, the bias in sequencing data that is typically introduced by PCR is overcome.For example, using the PCR-free method described herein, the library of nucleic acid fragments obtained is sequenced, and the sequence does not have significant gaps in GC-rich regions, as typically observed when PCR is used. Example 3: Sequencing comparison of test libraries

[0125] In this example, two comparison libraries from samples containing a known 100% GC repeat expansion (FMR1) were prepared using Nextera™ DNA Flex (including PCR) and TruSeq™ PCR-Free Library Prep Kits, and four test libraries were prepared as described herein using the universal bead / dual indexing method, as shown in FIG. 4D. As shown in FIG. 8, there were no repeats called in the sequencing data from the library prepared using Nextera™ DNA Flex (first column, no bars shown as results being 0). Using the methods described herein, repeats were called using TruSeq™ PCR-Free (column 2) and the four test libraries (samples 1-4, columns 3-6). Thus, the present method shows improved calling of repeat expansion samples with 100% GC regions. Example 4: Bifurcated oligonucleotides with cleavable linkers

[0126] Step 1. Formation of the transposome complex. A 5' biotin, three T residues, then three U residues, P5, A14, and ME with the sequence: / 5Biosg / TTUUUAATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACA (SEQ ID NO: 20); an oligonucleotide comprising ME'_B15'_P7' (75 μM) having the sequence: CTGTCTCTTATACACATCTCCGAGCCCACGAGACATCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO: 21); and a biotinylated oligonucleotide (50 μM) comprising The annealed transposons were then mixed with transposase enzyme such that the final concentration of biotinylated oligos was 2 μM and the concentration of transposase was 4 μM. The mixture was incubated overnight at 37°C to form solution-phase transpososome complexes. The solution-phase transpososome complexes were then immobilized on the solid support by mixing with streptavidin-coated beads and HT1 buffer (Illumina) and rotating at room temperature for 1 h. The beads were then washed three times in HT1 buffer before being resuspended in 15% glycerol standard storage buffer (Illumina) (Figure 2A).

[0127] Step 2. Tagmentation. DNA (e.g., about 50 pg to 5 μg) was mixed with transposome complexes and 50 μL of tagmentation buffer (10 mM Tris acetate (pH 7.6), 5 mM magnesium acetate, and 10% dimethylformamide), as described in U.S. Patent Nos. 9,080,211, 9,085,801, and 9,115,396, each of which is incorporated by reference, and the resulting mixture was incubated at 55° C. for 5 minutes. A library of tagged DNA fragments immobilized on the beads was generated. The tagmentation reaction mixture was treated with 10 μL of stop buffer containing 5% SDS, 100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween 20, and the resulting mixture was incubated at 37° C. for 5 minutes to denature the transposase enzyme from the transposome complexes. The beads with immobilized DNA fragments were then pelleted on a magnet and washed three times in wash buffer (100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween) to remove residual SDS. The beads were separated from the supernatant by magnetic capture and further washed using 100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween 20.

[0128] Step 3. Extension and Ligation. Extension and ligation were performed by contacting the beads with an Extension and Ligation Mix (ELM) containing T4 DNA polymerase (exonuclease minus) and E. coli DNA ligase and incubating at 30° C. for 15 min followed by 16° C. for 15 min, thereby filling the gap in the DNA fragment between the 3′ end of the fragment and the 5′ end of the ME′ sequence. The reaction mixture was diluted with 5% SDS, 100 mM The beads were treated with 10 μL of wash buffer containing Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween20, and the resulting mixture was incubated at 37° C. for 5 min to denature the transposase enzyme from the transposome complex. The beads with immobilized DNA fragments were then pelleted on a magnet and washed three times in wash buffer (100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween) to remove residual SDS. The beads were separated from the supernatant by magnetic capture and further washed using 100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween20.

[0129] Step 4. Release of tagged fragments. After the third wash, the beads were resuspended in a buffer containing 50 mM potassium acetate, 20 mM Tris acetate, 10 mM magnesium acetate, and 100 µg / mL BSA. 5 µL of an enzyme mix containing uracil DNA glycosylation enzyme and endonuclease VIII was added, and the library was incubated at 37 °C for 30 min. The enzymes act together to cleave U within the attached oligonucleotides, releasing the library fragments into solution. Following a standard size selection SPRI purification protocol (0.5x right and 0.7-0.8x left), the library was purified by adding 100 µL of the supernatant directly to the SPRI beads and eluting with 15 µL of Illumina resuspension buffer. The resulting library was quantified by qPCR (Figure 2B). Example 5: Modified extension-ligation protocol

[0130] An alternative protocol for indexed variable extension-ligation reaction (Example 2C) may be used. In some cases, the extension of the i7 index is inefficient due to secondary structures in certain index sequences. Therefore, for the structure in Figure 6C, eight different index pairs were investigated. As shown in Figure 9A, the %CV of the index pool was 76%. It was discovered that adding a P7' oligonucleotide during the extension-indexing reaction enhances the performance of certain index pairs, possibly due to hybridization to the P7 sequence, which may interfere with or prevent the formation of secondary structures. In this example, the extension-indexing reaction also includes ligation. During the extension-ligation-indexing reaction, P7' (containing a 5' phosphate for ligation) is added at 2.5 μM. For the structure shown in Figure 6D, Figure 9B shows the %CV for the eight index pairs of less than 30%.

[0131] Addition of DMSO to the P7' oligo extension-ligation-indexing reaction further improves the %CV. In this example, DMSO is added to the extension-ligation-indexing reaction at 5% for the structure in Figure 6D. The extension-ligation reaction contains all of the necessary enzymes and components for extension and ligation. The reaction is incubated at 37°C for 30 minutes, after which the workflow proceeds as normal. As shown in Figure 9C, the %CV for the eight different index pairs was less than 20%. This result allows the system to be used to tune mutations for indexing performance without quantifying the DNA output from the library for each sample. Example 6: PCR-free immobilized transposomes in a tube

[0132] This example shows a method and system for immobilizing transposome complexes in a tube, such as a PCR tube, for PCR-free whole genome sequencing. The method is carried out similarly to the method described in Example 2, and the entire preparation may be carried out in the same tube.

[0133] Formation of immobilized trans-spome complex in tube. A mixture consisting of (1) a first transposon having a 3' mosaic end (ME) sequence (SEQ ID NO:6), a first tag sequence (A14), and a 5' primer sequence (P5) (final concentration 25 μM), (2) a second transposon having a 5' complementary mosaic end sequence (ME'; SEQ ID NO:3) and a second tag sequence (B15') (final concentration 37.5 μM), and (3) an attached polynucleotide containing a 3' sequence complementary to the second tag sequence (B15), an index sequence, and a 5' primer sequence (P7) having biotin at the 5' end (final concentration 25 μM) was treated with 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, and 25 mM NaCl, and annealed by heating to 95°C for 10 min and then cooling to 10°C over approximately 15 min. The attached polynucleotide contained a 5' sequence complementary to the first tag sequence (A14') and a 3' primer sequence (P5') with a biotin at the 3' end (for single indexing). In some embodiments, the attached polynucleotide contains an intervening universal nitroindole sequence (for dual indexing). The annealed transposon / attached polynucleotide (2 μM final concentration based on the attached polynucleotide) was then mixed with transposase enzyme (6.1 μM final concentration) and incubated overnight at 37° C. to form a solution-phase transposome complex. The solution-phase transposome complex was then immobilized on the surface of a PCR tube by mixing the complex (with biotin) in a PCR tube with a streptavidin-coated surface. In some examples, immobilization can be performed in the presence of HT1 buffer (Illumina, San Diego, CA), a high salt buffer that supports the formation of biotin-streptavidin bonds. After 1 h of incubation, the PCR tubes were washed in a mixture of TWB buffer (Illumina, San Diego, CA). The resulting tubes with transposomes immobilized thereon were used in the single dual tagging and dual indexing tagmentation protocols.

[0134] The library preparation workflow, including tagmentation, extension, ligation, and indexing steps, was carried out as outlined in Example 2. After completion of the steps outlined in Example 2, the library fragments immobilized on the surface of the tube were generated. The tube was rinsed with 50 μL of 0.2N NaOH to denature the library fragments and release them from the surface of the tube. The library was quantified by qPCR and then prepared for sequencing on the MiSeq® by diluting to 5 μL of approximately 3200 pM and denaturing with 5 μL of 0.2N NaOH at room temperature for 5 minutes. Chilled Illumina HT1 buffer (990 μL) was added and 1 mL of the complete mixture was loaded into the MiSeq® cartridge.

[0135] The results of the sequencing are shown in Figure 10, which shows the coverage in a region of the genome (gene RNPEPL1) that is known to be difficult to sequence. The two library prep methods using PCR (Nextera Flex and tube-based Nextera) show gaps in the sequence where the region of the gene is not covered, indicated by rectangular bounding boxes. The two PCR-free methods were found to have good coverage in this region, as shown by the sections shown in Figure 10 as "PCR-free Flex" and PCR-free tube-based Nextera. Example 7: Preparation of PCR-free without cleavable linkers

[0136] The following example shows a method and system for immobilizing transposome complexes in tubes, such as PCR tubes, for PCR-free whole genome sequencing. The method is carried out similarly to the method described in Example 2, but does not include a step of cleaving the linker or the attached nucleotides that contain a cleavable linker. The method employs three separate oligonucleotides. Additional components of the method include a Tn5 transposon, SDS, an extension-ligation mixture (ELM), and a streptavidin-coated surface (such as a bead or plate).

[0137] A mixture of (1) a first transposon with an ME sequence, a first tag sequence (A14), an i5 sequence, and a 5' primer sequence (P5), (2) a second transposon with a 5' complementary mosaic end sequence (ME'), a second tag (B15'), an i7' sequence, and a 3' primer sequence (P7'), and (3) an attachment polynucleotide comprising the P7 sequence and a binding element (such as biotin) can be prepared and attached to a surface (such as a streptavidin-coated plate or beads). Transposomes can be assembled and attached to a surface in a single step in the presence of template nucleic acid in tagmentation buffer.

[0138] Tagmentation is performed at 55°C for 5 minutes, and PEG may be included in the tagmentation reaction. The mixture is treated with SDS to remove the Tn5 transposase. ELM is performed and the supernatant is removed. In this method, SPRI capture beads are not required, and therefore there is no need to adjust the insert size by bead packing density. Fragments can be eluted in NaOH for sequencing preparation. Example 8: PCR-free preparation of 96-well libraries

[0139] The following example shows a method and system for preparing up to 96 dual indexed paired end libraries from a DNA sample. The method is performed similarly to the method described in Example 2, but uses two steps of incubation with capture beads to allow preparation without a final qPCR step. As qPCR can be time consuming (up to 2 hours), this protocol has the advantage of ease of use and shorter duration. The method was compatible with DNA inputs of 25-1000 ng. For human DNA samples and other large complex genomes, the DNA input can be more than 200 ng. For DNA inputs of 200-1000 ng, quantification and normalization of the initial DNA sample is not mandatory. For DNA inputs of 25-200 ng, the library is quantified and normalized prior to sequencing.

[0140] This method uses a first transposon as shown in Figure 6D, where the sequence X in the first transposon is ATCTGACTATCCCCTGCG (SEQ ID NO: 23) and the sequence X' in the attachment polynucleotide is CGCAGGGGATAGTCAGAT (SEQ ID NO: 24). The anchor sequence is A14 and the spacer region is composed of 2C18 and 1C9 carbon spacers (non-DNA sequences).

[0141] Tagmentation.Add DNA in 10 mM Tris-HCl (approximately 2-30 µL) to each well of a 96-well PCR plate such that the total input amount (ng) is in the desired range. If the DNA volume is less than 30 µL, add nuclease-free water to the DNA sample to bring the total volume to 30 µL. Add a suspension of bead-bound transposomes (BLT) (10 µL) to each well, followed by 10 µL of taurine buffer. BLT is loaded onto the beads at a concentration of approximately 50-1000 nM. They are prepared in 15% glycerol, 100 mM NaCl, 50 mM Tris HCl (pH 7.5), 0.1 mM The beads are resuspended in 15% glycerol standard storage buffer consisting of EDTA, 1 mM DTT, 0.1% triton X-100. The samples are mixed with a pipette until the beads are completely resuspended, the plate is sealed and placed on a thermal cycler for 5 minutes at 41°C, followed by a hold at 10°C. Tagmentation times of 15, 30, 45, 60, 75, 90, 105, 120, and 300 seconds resulted in similar yields, with a shift to longer insert lengths for shorter incubation times (e.g., 15 seconds produced longer insert sizes than 60, 120, or 300 seconds). In some examples, the tagmentation time is reduced to 1 minute.

[0142] Add 10 μL of Stop Tagmentation Buffer containing SDS to each well, pipette the resulting mixture until the beads are completely resuspended, and incubate the mixture for 1-5 min. Place the plate on the magnetic stand for 2-5 min, remove and discard the supernatant. Remove the plate from the magnet and add 150 μL of Tagmentation Wash Buffer directly to the beads in each well. Mix the samples with a pipette and place the plate on the magnetic stand until the solution is clear (approximately 2-5 min). This step removes the SDS from the samples.

[0143] Extension / Ligation. Index 1 (i7) adaptors, index 2 (i5) adaptors, and sequences required for sequencing cluster generation are added by extension / ligation. While the plate is still on the magnetic stand, the supernatant is removed and discarded. The plate is removed from the magnetic stand and 45 µL of the extension-ligation mix is ​​added to each well, followed by resuspending the beads with a pipette. The appropriate index adaptor (5 µL) is then added to each sample, the plate is sealed and placed on a thermal cycler for 5 min at 37 °C and 50 °C for 5 min, then held at 10 °C. Incubation periods at 37 °C and 50 °C can be performed for 1, 3, or 5 min, respectively, with all mutations producing similar library yields. Shorter incubation periods produce libraries with increased fragment sizes, while longer incubations result in higher concentrations of ligation products. The plate is then placed on the magnetic stand for 2-5 min, and then the supernatant is removed.

[0144] To the wells, add 75 μL of Taurine Wash Buffer and pipette the mixture to resuspend the tagmentation beads. Discard the supernatant, spin down the plate, and place on the magnet for 2-5 minutes. To each well, add 45 μL of 0.2 N NaOH to denature the fragments. To each well, pipette the mixture to resuspend the tagmentation beads and incubate the plate at room temperature for 1-5 minutes.

[0145] Library Cleanup. To each well, add 36 μL of capture beads (such as Ampure XP beads), mix well contents to resuspend beads, then incubate for 1, 3, or 5 minutes. Place plate on magnetic stand for approximately 1-5 minutes until supernatant is clear.

[0146] To each well of the second 96-well plate, add 42 μL of capture beads. Then, add 76 μL of supernatant from each well of the first 96-well plate to the second 96-well plate with capture beads. Mix the samples with a pipette and incubate for 1, 3, or 5 minutes, then place on a magnetic stand until the supernatant is clear (approximately 1-5 minutes). In some examples, the second capture bead step is omitted.

[0147] Single or dual capture bead cleaning protocols, and 1, 3, or 5 minute incubations for each bead cleaning step are suitable.

[0148] After capture bead purification, discard the supernatant and wash the capture beads twice with 180 μL fresh 80% ethanol without mixing, incubate at room temperature, and discard the supernatant. Remove residual ethanol with a pipette and air dry the plate and remove from the magnetic stand.

[0149] To each well, add 15 µL-22 µL of resuspension buffer and mix the well contents with a pipette to resuspend the beads. Incubate the plate at room temperature for 2 minutes, then place on the magnetic stand until the supernatant is clear (approximately 2 minutes). Transfer a total of 14 µL-20 µL of supernatant from each well to a third 96-well PCR plate. This plate is the final DNA library and will be prepared for sequencing as described above.

[0150] In this protocol, two purification steps using capture beads are employed and no qPCR step is used, allowing for completion of library preparation in a shorter time, for example, samples are prepared using these methods in less than 30 minutes with a short magnet incubation step of 20 minutes total.

[0151] The protocol can be carried out in other containers, such as microcentrifuge tubes.

[0152] In some embodiments, equal library volumes are pooled to achieve optimal cluster density, and the pool is quantified prior to transsequencing. When using DNA inputs between 200 and 1000 ng, in some cases, libraries are combined by pooling equal volumes from each library in a 1.7 mL microcentrifuge tube, vortexing to mix, and then centrifugation. The library pool is quantified using the ssDNA Qubit kit to determine the concentration of the pool. When using DNA inputs between 25 and 200 ng, in some examples, each library is quantified individually using the ssDNA Quibit kit.

[0153] In some embodiments, sequencing is performed on a NovaSeq6000 cartridge. Example 9: Library preparation with combined tagmentation and indexing

[0154] In the following examples, a method and system for preparing a dual-indexed paired-end library from a DNA sample using a combined tagmentation and indexing step is shown. The method was carried out similarly to the method described in Example 2, but tagmentation and indexing were combined in one step. By avoiding separate tagmentation and indexing steps, this protocol has the advantages of ease of use and shorter duration. Furthermore, this protocol avoids the denaturation step and can produce a double-stranded library without the need for a separate step of producing a double-stranded sample from a denatured single-stranded sample. This protocol can also avoid certain washing steps, further shortening the time required for the workflow.

[0155] To demonstrate that these libraries can be prepared using reactions given either long, medium, or short periods to proceed, three sets of samples can be processed at normal workflow speeds, fast workflow speeds, and ultrafast workflow speeds, respectively.

[0156] In this method, a first immobilized transposon complex and a second immobilized transposon complex are used. In the first immobilized transposon complex, the sequence X in the first transposon is an anchor sequence, and the sequence X' in the attachment polynucleotide is an anchor sequence complement. In the second immobilized transposon complex, the sequence X in the first transposon is an anchor sequence, and the sequence X' in the attachment polynucleotide is an anchor sequence complement. The anchor sequences contained in the first and second immobilized transposon complexes may be non-complementary to avoid cross-hybridization. The first transposon complex may include an exemplary first attachment polynucleotide including (i) an anchor sequence complement, an A14' sequence, a spacer, and a P5' sequence, and (ii) a binding element including biotin, and the second transposon complex may include an exemplary second attachment polynucleotide including (i) an anchor sequence complement, a B15' sequence, a spacer, and a P7' sequence, and (ii) a binding element including biotin.

[0157] Tagmentation and indexing. DNA in 10 mM Tris-HCl (approximately 2-30 μL) is added to each well of a 96-well PCR plate such that the total input amount (ng) is in the desired range. A suspension of bead-bound transposomes (BLTs, i.e., immobilized transposon complexes) containing the first and second transposome complexes is added to each well. The indexing step is performed in a single reaction solution, with the index 1 (i7) adaptors, index 2 (i5) adaptors, and sequences required for sequencing the cluster products ligated in the same reaction solution as tagmentation. In this example, the first indexing oligonucleotide contains the A14 sequence, the i5 sequence, and the P5 sequence, and the second indexing oligonucleotide contains the B15 sequence, the i7 sequence, and the P7 sequence. The conditions for the tagmentation / ligation step include tagmentation buffer and E. coli DNA ligase added to a mixture of target DNA, first and second transposome complexes, and first and second indexing oligonucleotides in a total volume of 20 μL. The tagmentation and indexing reactions are carried out at a temperature of 41° C. for three different time intervals (for three different samples), for 15 minutes (normal workflow), 5 minutes (fast workflow), and 1 minute (ultrafast workflow).

[0158] Following the combined tagmentation and indexing reaction, the taurine reaction is stopped by adding 5 μL of 0.6% SDS to each well, incubating at 37° C., and washing with SDS to denature the transposase. The stopping step was performed for three different time intervals (for three different samples): 5 min (normal workflow), 5 min (fast workflow), and 1 min (ultrafast workflow). Although the stopping step is performed for the same time period in the case of normal workflow and fast workflow, the overall time of the fast workflow is still shorter due to the time difference in other steps.

[0159] Extension. To each well, 75 μL of extension mix (DNA polymerase, dNTPs, and buffer) is added and the extension reaction proceeds at <68°C in a reaction volume of 100 μL. The extension step is performed for three different time intervals (for three different samples), for 10 min (normal workflow), 2 min (fast workflow), and 1 min (super fast workflow). This extension step can generate a double-stranded DNA library in solution. Library cleanup may be performed using capture beads.

[0160] Overall, the library yields of the normal and fast workflows are comparable to methods with separate tagmentation and indexing steps, but the library yields of the ultra-constrained workflow are likely to be sufficient for many uses, especially considering the added convenience of the faster workflow. Methods using combined tagmentation and indexing can allow the transposase to associate with DNA samples (i.e., side-stranded products) that did not fragment well. Furthermore, combined tagmentation and indexing can generate library products with P5 / P5 or P7 / P7 sequences at both ends, and library products with these homozygous ends may not sequence properly. However, for many applications, the amount of starting DNA sample is sufficient to allow parallel determination results, even if some by-products are generated.

[0161] Although several embodiments have been described, it will be understood that various modifications may be made. Accordingly, other embodiments are within the scope of the following claims. Sequence Listing SEQ ID NO:1-A14-ME TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG SEQ ID NO:2-B15-ME GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG SEQ ID NO:3-ME' phos-CTGTCTCTTATACACATCT SEQ ID NO:4-A14 TCGTCGGCAGCGTC SEQ ID NO:5-B15 GTCTCGTGGGCTCGG SEQ ID NO:6-ME AGATGTGTATAAGAGACAG SEQ ID NO:7-P5 AATGATACGGCGACCACCGAGAUCTACAC SEQ ID NO:8-P7 CAAGCAGAAGACGGCATACGAG * A Sequence number: 9-P5_A14_ME AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG SEQ ID NO: 10-P_ME'_B15 5Phos / CTGTCTCTTATACACATCTCCGAGCCCACGAGAC SEQ ID NO:11-Bio_P7_i701_B1_5_ddC 5Biosg / CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGG / 3ddC / SEQ ID NO:12-A14'_P5'_bio GACGCTGCCGACGAGTGTAGATCTCGGTGGTCGCCGTATCATT / 3Bio / Sequence number: 13-P_A14_ME 5Phos / TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG SEQ ID NO:14-A14'_nitro_P5'_bio GACGCTGCCGACGACCC / i5NitInd / / i5NitInd / / i5NitInd / / i5NitInd / / i5NitInd / / i5NitInd / / i5NitInd / / i5NitInd / GTGTAGATCTCGGTGGTCGCCGTATCATT / 3Bio / SEQ ID NO: 15-A14'_12anc'_2sp_P5'_bio GACGCTGCCGACGACCGAGCATATCC / iSp18 / / iSp18 / GTGTAGATCTCGGTGGTCGCCGTATCATT / 3BioTEG / SEQ ID NO:16-P5_i501 AATGATACGGCGACCACCGAGATCTACACTAGATCGC SEQ ID NO:17-P_i701'_P7_ddC 5Phos / TAAGGCGAATCTCGTATGCCGTCTTCTGCTTG / 3ddC / SEQ ID NO:18-P7_i701_B15_ddC CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGG / 3ddC / SEQ ID NO:19-P5_i501_12anc AATGATACGGCGACCACCGAGATCTACACTAGATCGCGGATATGCTGG SEQ ID NO:20 - Biotinylated oligonucleotide / 5Biosg / TTUUUAATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACA SEQ ID NO:21-ME'_B15'_P7' CTGTCTCTTATACACATCTCCGAGCCCACGAGACATCTCGTATGCCGTCTTCTGCTTG SEQ ID NO:22 - Exemplary anchor sequence GGATATGCTCGG SEQ ID NO:23: Exemplary sequence X ATCTGACTATCCCCTGCG SEQ ID NO:24: Exemplary sequence X' CGCAGGGGATAGTCAGAT

Claims

[Claim 1] The invention described in the specification.

Images