Norovirus-binding peptide

Abstract

To provide a peptide that specifically binds to norovirus, which is useful for detection and infection control of norovirus.SOLUTION: A norovirus-binding peptide consists of a specific amino acid sequence.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a norovirus-binding peptide having affinity for norovirus. [Background technology]

[0002] Noroviruses have traditionally been classified as small round structured virus (SRSV). rus (small spherical virus) and NLV (Norwalk-like The virus is also known as the Norwalk associated virus, and its genotype It is divided into five groups, GI (genogroup I) to GV (genogroup V), based on the Of these, GI, GII, and GIV are the viruses that infect humans. It grows in the intestinal cells of the body and causes food poisoning accompanied by symptoms such as diarrhea, vomiting, abdominal pain, nausea, and fever. The main source of infection is food, with raw oysters often being a problem. In recent years, there has been an increase in human-to-human infections through the feces of virus carriers.

[0003] Currently, methods for detecting norovirus include observation with an electron microscope, the use of antibodies, and the There are methods to measure the amount of viral RNA amplified products. A polypeptide consisting of 18 amino acids that has affinity for norovirus and is useful for detecting norovirus Although antibodies against norovirus have been found, their binding strength is not as strong as that of previously reported norovirus antibodies. It has been reported that the efficacy is low (Non-Patent Document 1).

[0004] However, the method for detecting RNA requires reverse transcription and amplification steps, and the operation is complicated. It takes time and money. In addition, antibodies may have low specificity, and the animals and culture media may be Problems of unstable quality and high cost due to the use of cultivated cells for production exists. Therefore, a more effective and simple method for specific detection of norovirus and a method for detecting norovirus infection are required. There is a need to develop methods to prevent and treat infection. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Hye Jin Hwang et al. Biosensors and Bioelectronics 87(2017)164-170 Summary of the Invention [Problem to be solved by the invention]

[0006] The present invention relates to a method for the specific detection and control of norovirus infection using ... The present invention relates to providing peptides that bind to [Means for solving the problem]

[0007] The inventor of the present invention 14 Create a cDNA library containing cDNA of any order Using the cDNA display method, we will now identify peptides that specifically bind to norovirus. Thus, the present invention has been completed.

[0008] That is, the present invention relates to the following 1) to 4). 1) A norovirus consisting of any amino acid sequence selected from SEQ ID NOs: 1 to 269. Binding peptide. 2) Any of the N-terminus and C-terminus of an amino acid sequence selected from SEQ ID NOs: 1 to 269 A norovirus-binding peptide consisting of an amino acid sequence in which a cysteine ​​residue has been added to either or both of the amino acid sequences. Petite. 3) A method for detecting norovirus using the norovirus-binding peptide according to 1) or 2) above. 4) A norovirus detection kit containing the norovirus-binding peptide described above in 1) or 2). . Effect of the Invention

[0009] According to the present invention, a norovirus-binding peptide having high affinity for norovirus is provided. The peptide of the present invention can specifically and highly sensitively detect norovirus. It is believed that this will be able to control norovirus infection in humans. [Brief description of the drawings]

[0010] [Figure 1] Schematic diagram showing the production flow of VLPs. [Diagram 2] Schematic diagram showing an outline of screening for norovirus-binding peptides. [Diagram 3] Schematic diagram showing mRNA-linker conjugates (A: for selection, B: for analysis). [Figure 4] Results of interaction evaluation by ELISA. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0011] The norovirus-binding peptide of the present invention is any one of peptides selected from SEQ ID NOs: 1 to 269. It is a peptide consisting of six amino acids, consisting of an amino acid sequence (Table 16). The peptide is 10 14 cDNA library containing cDNA of order Using the NA display method, we screened norovirus as a target molecule by in vitro selection. It has been screened and has the ability to specifically bind to norovirus. The peptide is a peptide aptamer for binding. The peptide is composed of 34.4% hydrophobic amino acids and 10% hydrophilic amino acids. The six amino acids are composed of a library sequence consisting of 65.6% cyclic amino acids. The norovirus-binding peptide was screened by in vitro selection to detect norovirus as a target molecule. Among the screened norovirus-binding peptides, those with high occurrence frequency (see Example 6 or more occurrences), and more frequently occurring, SEQ ID NOs: 1 to 101 (occurrence frequency 8 times A norovirus-binding peptide having any one of the amino acid sequences selected from the above is preferred. or from any amino acid sequence selected from SEQ ID NOs: 1 to 52 (occurrence frequency 10 or more). More preferred are norovirus-binding peptides having sequences of SEQ ID NOs: 1 to 28 (occurrence frequency of 12 or more), A norovirus-binding peptide having any one of the amino acid sequences selected from the following is further preferred: In addition, any one selected from SEQ ID NOs: 1 to 12, 14 to 17, 19, 21, and 28. More preferably, the norovirus-binding peptide has the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 4, Norovirus having any one of the amino acid sequences selected from 14, 15, 17, 21 and 28 Even more preferred are rus-binding peptides.

[0012] In one embodiment, the peptide of the present invention includes any one of the peptides selected from SEQ ID NOs: 1 to 269. An amino acid sequence having a cysteine ​​residue added to either or both of the N-terminus and C-terminus. The peptide having cysteine ​​residues at both ends is The cysteine ​​residues can form disulfide bonds to form a cyclic peptide.

[0013] In another embodiment, the peptide of the present invention has a specific binding ability to norovirus. As long as it is retained, any one of the amino acid sequences selected from SEQ ID NOs: 1 to 269 above. or a cysteine ​​residue is added to either or both of the N-terminus and C-terminus of the amino acid sequence. The peptide further comprises a peptide having an amino acid sequence comprising the amino acid sequence The amino acid sequence includes those consisting of an amino acid sequence to which any 1 to 20 amino acid residues have been added.

[0014] Currently, the noroviruses that infect humans are classified into Genogroup I (G I), Genogroup II (GII), and Genogroup IV (GIV) More than 90% of reported cases of infection are of the GII group. It is believed that each genotype corresponds to a serotype. The norovirus genome structure includes viruses belonging to the norovirus family. When the protein domain is inserted into a baculovirus and expressed in insect cells, the virus particles It is possible to produce hollow virus particles (VLPs) that closely resemble the structure of norovirus. It has the same antigenicity as the virus particle, but does not have genomic RNA inside. Therefore, in the present invention, noroviruses also include such VLPs. Included. The VLPs were derived from the GII.4 Saga1 strain (Genbank No. AB4474 56), GII.4 Sydney strain (Genbank No. JX459908.1) , GII.3 TCH strain (Genbank No. KF006265), GII.2 E hime strain (Genbank No. LC145808), GII.17 Kawasa ki strain (Genbank No. AB983218), GII.17 Saitama strain Prepared using norovirus genomes such as (Genbank No. KJ196286.1) Examples of VLPs include

[0015] The peptide of the present invention targets norovirus (empty virus particles; VLPs). In vitro evolution methods known in the art, such as cDNA display methods (Nucleic Acid Acid Research, vol37, No.16, e108(2009) That is, a cDNA library (peptide library) containing cDNA can be prepared. A library of linker-mRNA / cDNA conjugates was prepared, and the resulting library was then combined with the cDNA It can be prepared by in vitro selection using the spray method. Specifically, it can be produced by the following steps a) to c) (see FIG. 2). a) A DNA fragment (construct) encoding a desired random peptide library Preparation process b) Using the construct prepared in the above step, a cDNA display method is used. cDNA display to generate peptide-linker-mRNA / cDNA in vitro Fabrication process c) Mixing the cDNA display obtained in the above step with VLPs and binding to the VLPs The cDNA display was collected and the VLPs-bound cDNA display was screened. Selection process for

[0016] a. Construct preparation process The construct for producing the norovirus-binding peptide was A primer region, a promoter region, a non-translated region, a random region, and a tag region. A DNA fragment encoding the desired random peptide library is constructed. The DNA sequences used as primer regions are commercially available. In addition, T7, SP6, etc. can be used as the promoter region. As the untranslated region, the Ω sequence or the like can be used.

[0017] The random region consists of alanine, valine, leucine, isoleucine, methionine, and proline. , phenylalanine, tryptophan, 34.4% of the hydrophobic amino acids, glycine, A polar amino acid consisting of serine, threonine, asparagine, glutamine, tyrosine, and cysteine. Amino acids make up 31.3% of the protein, while basic amino acids consisting of lysine, arginine, and histidine make up 15. DN 6%, and acidic amino acids consisting of aspartic acid and glutamic acid 6.3%. A is constructed.

[0018] b. cDNA display production process The production of cDNA display is as shown in Figure 2, which consists of (b1) mRNA preparation step; b2) a linker-mRNA conjugate formation step; and (b3) a peptide-linker-mRNA conjugate formation step. (b4) a particle binding step; and (b5) a cDNA display formation step; (b6) a peptide cross-linking step; and (b7) a cDNA display release step.

[0019] (b1) In the mRNA preparation step, mRNA is prepared by transcription from the construct. Then, (b2) the mRNA obtained in the above-mentioned mRNA preparation step is subjected to puromycin. The mRNA is then bound to the linked linker to form a linker-mRNA conjugate. Next, (b3) extracting an amino acid sequence corresponding to the mRNA sequence translated by the cell-free translation system. Peptide with a linker is conjugated to puromycin and the peptide-linker-mRNA ligation is performed. Forms the body. Next, in the (b4) particle binding step, the peptide-linker obtained as described above is The -mRNA conjugate is bound to magnetic particles. Next, (b5) the mRNA of the peptide-linker-mRNA conjugate bound to the magnetic particle is The NA is reverse transcribed to form cDNA, and peptide-linker-mRNA / cDNA is obtained. ("cDNA display"). Next, (b6) randomly identifiying the peptides in the cDNA display obtained in the above step. The domain is cross-linked by a cross-linking reaction with cysteines at the N-terminus and C-terminus. Next, in the (b7) complex releasing step, the cDNA display obtained in the previous step is It is released from the magnetic particles and optionally purified.

[0020] c. Selection process of VLPs-bound cDNA display Selection of VLPs-bound cDNA display includes (c1) a solution addition step and (c2) a separation step. and (c3) a recovery step. (c1) In the solution addition step, a cDNA display-containing solution is added to the VLPs solution. Subsequently, in the separation step (c2), the mixture of VLPs and the cDNA display solution is The VLPs can be precipitated by centrifugation at, for example, 130,000 x g for 5 minutes. The cDNA display that did not bind to V is separated. Then, in the (c3) recovery step, The cDNA display bound to the LPs is recovered together with the VLPs.

[0021] The peptide of the present invention can be selected in vitro from a given DNA library as described above. It is Noh. The peptide of the present invention can be synthesized by a liquid phase method, a solid phase method, or a hybrid method combining the liquid phase method and the solid phase method. The peptides are produced by known methods for producing peptides, such as chemical synthesis methods, gene recombination methods, etc. It is possible.

[0022] Since the peptide of the present invention specifically binds to norovirus, it is called norovirus. by contacting the sample with a sample that contains or may contain It can confirm the presence or absence of norovirus in the juice. That is, for example, instead of anti-norovirus antibodies in immunoassays such as ELISA, In addition, the peptides of the present invention can be used to detect norovirus in a sample. When used as a detection agent, the peptides of the present invention can be detectably labeled. Labels include, for example, enzymes such as peroxidase and alkaline phosphatase, as well as radioactive substances. In addition, nanoparticles such as gold colloids and quantum dots are used. In addition, in immunoassays, the peptides of the present invention can be labeled with biotin. Alternatively, detection can be performed by binding avidin or streptavidin labeled with an enzyme or the like. .

[0023] Among immunoassays, the ELISA method using enzyme labeling is a simple and rapid method for measuring antigens. The peptide of the present invention is preferably used to detect norovirus by ELISA. When detecting a virus, for example, the norovirus is immobilized on a solid phase carrier and then a bio After washing, the avidin-modified enzyme is bound to the biotin. The norovirus is detected by reacting it with an enzyme substrate, developing color, and measuring the absorbance. Alternatively, the peptide of the present invention can be immobilized and the norovirus can be bound thereto. After washing, enzyme-labeled anti-norovirus antibody or anti-norovirus antibody and enzyme-labeled After binding the secondary antibody, it reacts with the enzyme substrate to develop color, and the absorbance is measured. , and can detect norovirus. For the enzyme substrate, p-nitrophenyl phosphate ( NPP) can be used, and in the case of peroxidase, 3,3',5,5'-tetrahydrofuran can be used. The solid phase carrier may be polystyrene, Polycarbonate, polyvinyl toluene, polypropylene, polyethylene, polyvinyl chloride nylon, polymethacrylate, latex, gelatin, agarose, cellulose, Beads made of materials such as Sepharose, glass, metal, ceramics, or magnetic materials, Insoluble carriers in the form of plates, test tubes, sticks, test strips, etc. can be used. The peptide of the present invention can be immobilized on the solid phase carrier by a physical adsorption method, a chemical binding method, or a combination thereof. The binding can be carried out according to a known method, such as a method of using these in combination.

[0024] The peptide of the present invention can be a component of a kit for detecting norovirus. In addition to the peptide of the present invention, the present invention also includes reagents and instruments necessary for detection, such as antibodies, solid phase carriers, buffers, etc. The kit may include a reagent solution, an enzyme reaction stopping solution, a microplate reader, etc. The sample to be detected by the detection kit is, for example, a sample containing or not containing norovirus. Anything that can be used to treat the disease is not particularly limited, but examples include feces and vomit collected from patients. Examples of the virus include clinical specimens such as swine fever, isolated virus culture fluids, foods such as oysters, and water and sewerage water. It can be done.

[0025] In addition, the peptide of the present invention specifically binds to the capsid protein of norovirus, It is believed that the peptide of the present invention inhibits the binding of the virus to the cell. , as an anti-norovirus preparation, and as a medicine for preventing or treating norovirus. It is also possible to do so. When the peptide of the present invention is used as a medicine, it may be administered orally or parenterally. These may be used in combination with well-known pharma- ceutically acceptable non-toxic carriers and diluents, if appropriate. Parenteral administration can be typically achieved by injection, but it can also be achieved by inhalation together with aerosols, etc. Administration by oral administration is also possible.

[0026] With respect to the above-described embodiment, the present invention discloses the following aspects. <1> Norovirus comprising any one of the amino acid sequences selected from SEQ ID NOs: 1 to 269 Binding peptide. <2> The N-terminus and C-terminus of any one of the amino acid sequences selected from SEQ ID NOs: 1 to 269 Norovirus-binding domain consisting of an amino acid sequence with a cysteine ​​residue bound to either or both ends peptide. <3> At the N-terminus and C-terminus of any amino acid sequence selected from SEQ ID NOs: 1 to 269 A cysteine ​​residue is attached. <2> Norovirus-binding peptide. <4> N of a peptide consisting of any one of amino acid sequences selected from SEQ ID NOs: 1 to 269 A norovirus-binding peptide <3> in which cysteine ​​residues bound to the terminal and C-terminal end form a ring via disulfide bonds. <5> <1> ~ <4> At either or both of the N-terminus and C-terminus of any of the peptides A norovirus-binding peptide consisting of an amino acid sequence of 1 to 20 amino acids. <6> <1> ~ <5> Norovirus using any of the norovirus-binding peptides Detection methods. <7> <1> ~ <5> Norovirus containing any one of the norovirus-binding peptides Detection kit. <8> Any of the amino acid sequences selected from SEQ ID NOs: 1 to 269 is selected from SEQ ID NOs: 1 to 10 Any amino acid sequence selected from 1 <1> ~ <6> Any of the noroviruses a binding peptide, or <7> Norovirus detection kit. <9> Any of the amino acid sequences selected from SEQ ID NOs: 1 to 269 is selected from SEQ ID NOs: 1 to 52 Any amino acid sequence selected from <1> ~ <6> Norovirus infection Peptide combination, or <7> Norovirus detection kit. <10> Any amino acid sequence selected from SEQ ID NOs: 1 to 269 is selected from 1 to 28 Any of the amino acid sequences known <1> ~ <6> Norovirus-binding peptides Chid, or <7> Norovirus detection kit. <11> Any of the amino acid sequences selected from SEQ ID NOs: 1 to 269 is SEQ ID NO: 1 2, 14 to 17, 19, 21, and 28. <1> ~ <6> or <7> Norovirus detection kit . <12> Any of the amino acid sequences selected from SEQ ID NOs: 1 to 269 is SEQ ID NO: 1, 4 , 14, 15, 17, 21, and 28. <1> ~ <6> or <7> Norovirus detection kit. EXAMPLES

[0027] The present invention will be described more specifically below with reference to examples. Reference example: Preparation of VLPs (1) Introduction of VP1 and VP2 genes into pDEST8 Norovirus (hereinafter sometimes abbreviated as NoV) GII.4 Saga1 strain (Ge nbank No:AB447456), GII.3 TCH strain (Genbank No .KF006265), GII.17 Saitama strain (Genbank No.KJ DNA encoding the structural protein regions VP1 and VP2 of 196286.1 The artificial synthesis of pUCFa plasmid lac was outsourced to FASMAC Co., Ltd. The Zα region is 5'-CAGACGTGTGCTCTTCCGATCTGAT / ATCA GATCGGAAGAGCGTCGTTAAG-3' (SEQ ID NO: 270) The target gene was introduced as a cloning site. Using Saga1 (Figure 1) DNA as a template, primer 1 (5'-CATCACAAGTTT GTACAAAAAAGCAGGCTGTGA-3': SEQ ID NO: 271) and primers 2(5'-TATCACCACTTTGTACAAGAAAGCTGGGTT-3': PCR was performed using the GII.3 fragment (Figure 1-A). The synthesized pUC-TCH DNA was used as a template, and primer 3 (5'-ATCACA AGTTTGTACTGGGAGGGCGATCGCA-3': SEQ ID NO: 273) and Reimer 4(5'-CTATCACCACTTTGTTCGCTACCTCGCGAA- 3': SEQ ID NO: 274) was used in a PCR reaction to obtain a fragment (FIG. 1-A). The DEST8 plasmid (Invitrogen) was used as a template, and primer 5 (5'-A CAAGTGGTGATAGCTTGTCGAGAAGTA-3': SEQ ID NO: 275) and and primer 6 (5'-GTACAAACTTGTGATGATCCGCGCCCGAT PCR was carried out using the nucleotide sequence (nucleotide 3': SEQ ID NO: 276) to obtain a fragment (Figure 1-B). The PCR fragments A and B were mixed and incubated with the InFusion HD Cloning Kit (Clontech), and 1 ng of the resulting DNA (Figure 1-C) was used. Competent Quick DH5α (TOYOBO) was transformed with Selection was performed on LB agar plates containing 1 μg / mL ampicillin, and the resulting colonies were - was cultured in LB liquid medium containing 100 μg / mL ampicillin, and the resulting cells were cultured to obtain QI The plasmid was purified using the Aprep Spin Miniprep Kit (Qiagen). The NoV gene-introduced plasmid was then analyzed using a DNA sequencer. The sequence was determined to confirm that the desired sequence had been inserted. For GII.17, the attL1 sequence (5 '-ccccaaataatgattttattttgactgatagtgacctg ttcgttgcaacaaattgatgagcaatgctttttataatg ccaactttgtacaaaaaagcaggct-3': SEQ ID NO: 277) 55 bases downstream of the termination codon of the VP2 region, there is a polyadenine sequence of 30 bases, followed by att L2 sequence (5'-agcttacccagctttcttgtacaaagttggca ttataagaaagcattgcttatcaatttgttgcaacgaaca ggtcactatcagtcaaaataaaatcattatttg-3': sequence number pUC-Saitama and pDES were artificially synthesized by introducing the sequence of pUC-Saitama. T8 was mixed in equal amounts, and the mixture was mixed as shown in Table 1 and reacted at 25°C for 1 hour. Roteinase K (Takara Bio) was added and reacted at 37°C for 10 minutes. Reaction solution 1 Competent Quick DH5α (TOYOBO) was transformed with ng. The resulting colonies were transformed with 100 μg / mL ampicillin-containing LB agar plates. Ronni was cultured in LB liquid medium containing 100 μg / mL ampicillin, and the resulting cells were Purification using QIAprep Spin Miniprep Kit (Qiagen) This resulted in pDEST8 encoding GII.17.

[0028] [Table 1]

[0029] (2) VP1, VP2, and VP3 were cloned into bMON14272 Bacmid (Invitrogen). 2. Gene Introduction The resulting plasmid was introduced into Bacmid in the following manner according to the protocol provided with the product. was carried out (Figure 1-D). The obtained NoV gene introduction plasmid and MAX Efficiency DH10Ba c NoV VP was expressed using competent cells (Invitrogen). 1. VP2 region was introduced into bMON14272 bacmid (Invitrogen) The presence or absence of gene introduction into the bacmid was examined by incubating the bacmid with 40 μg / mL IPTG ( sopropyl β-D-1-thiogalactopyranoside: Wa ko), 100 μg / mL X-Gal (5-bromo-4-chloro-3 -indolyl β-D-galactopyranoside: manufactured by Wako), 50 μg / mL kanamycin, 7 μg / mL gentamicin, 10 μg / mL tetracycline Selection was performed on LB medium containing kanamycin (bMON14272 contains the kanamycin resistance gene, DH1 The helper plasmid present in the 0Bac Competent Cells contains tetracycline. The gentamicin resistance gene was inserted into the region of the pDEST bacmid. Each gene is encoded by a different gene), and the fragment is inserted into the target site by color selection. The white colonies obtained were incubated with 50 μg / mL kanamycin and 7 μg / mL genotype. The cells were cultured in LB liquid medium containing 10 μg / mL tacrolimus and 10 μg / mL tetracycline. The cells were purified using the QIAprep Spin Miniprep Kit (Qiagen). The concentration of the extracted DNA solution was adjusted using NanoDrop (Thermo Fisher Scientific). This was confirmed using mofisher scientific equipment.

[0030] (3) Recombination by transfection of NoV VP1 and VP2-introduced Bacmid Production of baculovirus (rBV) The bacmid containing the NoV VP1 and VP2 genes was then transformed with Lipofectamine. ne LTX Reagent & Plus Reagent(Invitrogen The transfection was performed on Sf9 cells (Invitrogen) according to the attached protocol. The transfected cells were transfected with Sf900III( The cells were cultured at 27°C for one week using Invitrogen medium. After the culture, the medium was centrifuged. The supernatant was collected to obtain recombinant baculovirus (rBV) carrying the NoV gene.

[0031] (4) Production of NoV VLPs by rBV infection High Five cells (Invitrogen) 1.0 x 10 7 cells / For flask, we set the MOI to 2 by 1.0×10 7 Add pfu / mL of rBV The cells were infected with Express five (Invitrogen) medium for 27 h. After 7 days from infection, the culture supernatant was collected by centrifugation and then further collected. The supernatant was centrifuged at 10,000xg for 1 hour to pellet down the baculovirus. The supernatant containing NoV VLPs was then separated by a SW32Ti rotor ( Beckman Coulter) at 32,000 rpm for 2 hours. The VLPs were pelleted down. The supernatant was removed and the pellet was washed with 1.9 mg of CsCl (density SW55Ti ( Separation was performed by centrifugation at 40,000 rpm for 20 hours using a Bechman Coulter Purification was performed, and the fractions that were visually confirmed by irradiating white light were collected. The collected fractions were then washed again with SW Centrifuge at 32,000 rpm in a 32Ti rotor to pellet down, remove the supernatant, and The VLPs were suspended in 500 μL of xpress five medium. The VLP concentration was determined by the Bradford method. The standard protein used was BSA (manufactured by WAKO).

[0032] Example 1: Preparation of norovirus-binding peptide (see FIG. 2) (1) Preparation of DNA library The peptide library was designed to be 10 amino acids in length. I checked in. (DNA library sequence) 5'-GATCCCGCGAAATTAATACGACTCACTATAGGGGAAG TATTTTTACAACAATTACCAAACAACAACAAACAACAA CAACATTACATTTTACATTCTACAACTACAAGCCACCATG GGCAGCGGCGGCAGCTGCNNKNNKNNKNNKNNKNNKTGCG GGGGAGGCAGCCATCATCATCATCATCACGGCGGAAGCAG GACGGGGGGCGGCGTGGAAA-3' (SEQ ID NO: 279)

[0033] [Table 2]

[0034] The DNA library contains the T7-PRO-Ω region (SEQ ID NO: 280), a random region ( The three DNA sequences are: The fragments were then ligated by extension PCR. The random region, His-Y, is designed so that cysteines appear at the N-terminus and C-terminus of the The tag region and the T7-PRO-Ω region were provided by Tsukuba Oligo Service Co., Ltd. A was synthesized and obtained from the manufacturer. Using these, the following extension PCR was performed to obtain the above DNA library. A braille was created.

[0035] [Sequence number 280] 5'GATCCCGCGAAATTAATACGACTCACTATAGGGGAAG TATTTTTACAACAATTACCAAACAACAACAAACAACAA CAACATTACATTTTACATTCTACAACTACAAGCCACCATG 3'

[0036] [SEQ ID NO:281] 5'-ACAACTACAAGCCACCATGGGCAGCGGCGGCAGCTGC NNKNNKNNKNNKNNKNNKTGCGGGGGGAGGCAGCCATCATC A-3'

[0037] The frequency of occurrence of bases other than ATCG in the above sequence (A:T:G:C) is as follows: It is. N: A=0.25, T=0.25, G=0.25, C=0.25 K: A=0,T=0.5,G=0.5,C=0

[0038] [SEQ ID NO:282] 5' TTTCCACGCCGCCCCCCGTCCTGCTTCCGCCGTGATG ATGATGATGATGGCTGCCTCCCCC 3'

[0039] For the first synthesis step, extension PCR, prepare the reaction solution with the composition shown in Table 3 below with ultrapure water to 50 μL. The DNA fragment with the random region and the His-Y tag region was then amplified using the following PCR program. The PCR program was (a) 96°C (2 min), (b) 94°C (20 s). (c) 69°C (5 seconds), (d) 72°C (20 seconds), and (e) 72°C (2 minutes). Steps (b) to (d) were repeated for five cycles.

[0040] [Table 3]

[0041] For the second-stage extension PCR, prepare a reaction solution with the composition shown in Table 4 below with ultrapure water to 50 μL. The PCR program below extends the T7-PRO-SD region, allowing the DNA library to be The PCR program was: (a) 96°C (2 min), (b) 94°C (20 sec), (c) 59°C (5 seconds), (d) 72°C (30 seconds), and (e) 72°C (2 minutes). The steps (b) to (d) were repeated 15 times. Then, Poly Acrylamide G The DNA library was purified by polyacrylamide gel electrophoresis (PAGE). .

[0042] [Table 4]

[0043] (2) Transcription of DNA library DNA library transcription using RiboMAX Large Scale RNA Pro duction Systems -T7 (by Promega) and the included The reaction was carried out according to the protocol. The reaction scale was 20 μL using 1 μg of DNA library. The mRNA obtained by the transcription reaction was purified using After Tri-Reagent R. Purification was performed using the NA Clean-Up Kit (Favogen).

[0044] Next, the obtained mRNA was ligated with a puromycin linker as described below. This was carried out as follows (Figure 3(A)). First, the puromycin linker and mRN 20 pmol of A, 4 μL of 0.25 M Tris-HCl (pH 7.5), 1 M N The reaction mixture was mixed with 4 μL of aCl and diluted to 20 μL with ultrapure water. Incubate at 70°C for 1 minute, then cool to 4°C and anneal at 25°C for 1 hour. Then, the CL-1000 Ultraviolet Crosslinker was Using ultraviolet light with a wavelength of 365 nm, the output was 405 mJ / cm 2 Puromycin was irradiated under the conditions Cross-linking was performed with a .alpha.-linker.

[0045] <Puromycin linker DNA> Puromycin linker DNA1 (Figure 3(A)) consists of two segments (puromycin The isine segment (PS) and the short biotin segment (SBS) were combined with EMCS (N-(6 Chemical cross-linking was performed using (-maleimidocaproyloxy)succinimide (manufactured by Dojin Chemical Industries, Ltd.) The linker was synthesized as described in the literature (Mochizuki Y., Suzuki T., Fujim oto K., Nemoto N.. (2015) A versatile puromy cin-linker using cnvK for high-throughput in vitro selection by cDNA display. J Biotec The method described in (Honol. 212, 174-80.) was used.

[0046] The sequence structure of the puromycin segment (PS) is shown below. 5'-(S)-TCTCTC(F)-(PEG)(PEG)-CC-(Puro)-3' Here, (S) is 5'-thiol modifier C6 (compound name: S-Trityl -6-mercaptohexyl-1-[(2-cyanoethyl)-(N,N- diisopropyl)]-phosphoramidite, Glen resea (F) stands for fluorescein-dT. (Puro) stands for puromycin. Thin CPG(5'-Dimethoxytrityl-N-trifluoroacet yl-puromycin,2'-succinoyl-long chain alky lamino-CPG, manufactured by Glen Research).

[0047] Next, the sequence structure of the short biotin segment (SBS) is shown below. 5'(B)-AA-(rG)-AATTTCCA(K)GCCGCCCCCG(Y) CCT-3' (SEQ ID NO: 283) where (Y) is the amino modifier C6 deoxythymine (5'-Dimeth oxytrityl-5-[N-(trifluoroacetylaminohexy l)-3-acrylimido]-2'-deoxyUridine,3'-[(2- cyanoethyl)-(N,N-diisopropyl)]-phosphora midite, manufactured by Glen Research), and (K) stands for 3-Cyanovin (B) represents Biotin-Trieth ylene glycol (TEG), manufactured by Glen Research), and (rG ) stands for riboguanine (Glen Research). PS and SBS are from Tsukuba University. The synthesis was outsourced to Rigo and was carried out according to standard methods.

[0048] The 5' thiol group of the PS was dissolved in 100 μL of 50 mM phosphate buffer (pH 7. 0) at room temperature for 6 hours. Reduction with tetrachloroethylene (TCEP: Thermofisher Scientific) After that, the solution was desalted as needed using a NAP-5 column (GE Healthcare). Biotin loop and 2 μmol EMCS in 100 μL of 0.2 M sodium phosphate The mixture was then incubated at 37° C. for 30 minutes. The mixture was then subjected to ethanol precipitation at 4°C to remove excess EMCS.

[0049] The precipitate was washed twice with 500 μL of 70% ethanol that had been pre-cooled in an ice bath, and then dissolved in 10 μL of pre-cooled 0.2 M sodium phosphate buffer (pH 7.0). Reduced PS was added immediately, and the mixture was stirred overnight at 4°C. The reaction was stopped by adding 4 mM TCEP and incubating at 37°C for 15 minutes. Subsequently, ethanol precipitation was performed to remove excess PS at room temperature. To remove the biotin loop and uncrosslinked biotin-EMCS complex, the precipitate was dissolved in 0.1 M TEAA (Triethylamine Acetate: manufactured by Glen research) or phosphate buffer and purified using a C18 HPLC column under the following conditions. Column: AR-300, 4.6 x 250 mm (manufactured by Nacalai Tesque) Solvent: Solvent A: 0. 1 M TEAA; Solvent B: acetonitrile / water (80:20, v / v) Gradient: B / A (15 - 35%, 33 minutes) Flow rate: 0.5 mL / min Detection wavelength: absorbance at 254 nm and 490 nm Fractions corresponding to the peak at absorbance 254 nm (corresponding to a single peak at absorbance 490 nm) from the final peak were collected. After drying, the sample was resuspended in DEPC-treated water and stored. In this way, puromycin-linker DNA1 could be obtained.

[0050] <Binding of mRNA and puromycin-linker DNA1> For every 20 pmol of mRNA obtained by transcription, 20 pmol of puromycin-linker DNA1, 4 μL of 0.25 M Tris-HCl (pH 7.5), 1 M NaCl

[0051]

[0052] <mRNA and puromycin linker DNA1 binding> Per 20 pmol of mRNA obtained by transcription, 20 pmol of puromycin linker DNA1, 4 μL of 0.25 M Tris-HCl (pH 7.5), 1 M NaCl ​​​​​​​Add 4 μL and add nuclease-free water to make a total of 20 μL. The mixture was prepared as shown in Table 5. After incubation at 90°C for 1 min, it was incubated at 70°C for 1 min. The temperature was then lowered to 25°C at a rate of 0.04°C / s. The mRNA was then covalently linked to cnvK and uracil in the mRNA. -linker conjugates were obtained. The required amount was synthesized in each round.

[0053] [Table 5]

[0054] <Translation> The above mRNA-linker conjugate was translated in a cell-free translation system as follows. The reaction mixture shown in 6 was prepared in 50 μL with ultrapure water and reacted at 37°C for 15 minutes. To this reaction mixture, 24 μL of 3M KCl and 6 μL of 1M MgCl2 were added. After that, the solution was further reacted at 37°C for 20 minutes to separate the C-terminus and puromycin of the translated peptide. By binding ribozyme, an mRNA-peptide conjugate was obtained.

[0055] [Table 6]

[0056] (3) Purification using magnetic beads Streptavidin (SA) magnetic particles (Dynabeads MyOne Streptavidin tavidin C1 (Invitrogen) was washed according to the manufacturer's instructions and the peptides were Take the amount of the linker-mRNA complex required for immobilization into an Eppendorf tube. The mixture was placed on a magnetic stand for 1 minute. The supernatant was then removed, and solution A (100 mM Na The cells were resuspended in 100 mM NaCl (50 mM OH, 50 mM NaCl). After tapping for 1-2 minutes, the cells were placed on a magnetic The plate was left on the stand for 1 minute. After that, the same procedure was repeated once more with solution A, and then with solution B ( The same procedure was carried out once using 100 mM NaCl.

[0057] The peptide-linker-mRNA conjugate was added to 2× binding buffer (20 mM Tr is-HCl (pH8.0), 2mM EDTA, 2M NaCl, 0.2% Twe Add an equal amount of 200 mM EDTA (500 mM EDTA) to the above streptavidin (SA) magnetic The particles were incubated at room temperature for 30 minutes. The Eppendorf tube was placed on the magnetic stand for 1 After leaving the mixture to stand for 1 min, the supernatant was removed. 200 μL of 1× binding buffer was added and the mixture was stirred by tapping. After this was performed for 1 to 2 minutes, the mixture was placed on a magnetic stand for 1 minute and the supernatant was removed. Repeat two more times to obtain peptide-ligand immobilized on streptavidin (SA) magnetic particles. An anchor-mRNA conjugate was obtained.

[0058] (4) Synthesis of cDNA by reverse transcription The immobilized peptide-linker-mRNA conjugate was used in the reaction mixture ratios shown in Table 7 below. Add the same volume of streptavidin (SA) magnetic particles to the inkjet printer and incubate at 42 degrees for 30 minutes. The DNA was incubated with 500 mM NaCl and reverse transcribed, and the DNA was immobilized on streptavidin (SA) magnetic particles. cDNA display was prepared as is.

[0059] [Table 7]

[0060] (5) Cross-linking reaction of peptides The cDNA display immobilized on the streptavidin (SA) magnetic beads was crosslinked. Bridge buffer (100 mM sodium phosphate (pH 7.4), 0.15 M NaCl, After washing once with 10 mM EDTA, 0.025% Tween-20, mM Tris(2-carboxyethyl)phosphine hydrochloride (TCEP: The rmofisher Scientific) and 4 mM bismaleimideethane (B Crosslinking buffer 1 containing MOE (Thermofisher Scientific) Add 25 μL of the DNA fragment to the N-terminus and C-terminus of the random region and incubate at 25°C for 1 hour. A cross-linking reaction was carried out on cysteine.

[0061] (6) Elution from magnetic bead purification The cDNA display immobilized on the streptavidin (SA) magnetic beads is 1x His-tag washing buffer (10-30mM sodium phosphate (pH 7.4), 0.25-0.75M NaCl, 5-30mM imidazole, 0.025-0.1% After washing once with Tween-20, 10 U of RNase T1 (Ambio Add 30 μL of 1×His-tag washing buffer containing 1×His-tag (manufactured by Nichia Chemical Industries, Ltd.) and incubate at 37°C for 15 minutes. The cleavage site (ribonucleotide) in the linker was cleaved from the streptavidin (SA) magnetic beads. G) The cleaved cDNA display was eluted.

[0062] (7) Purification with Ni-NTA Ni-NTA magnetic beads (His Mag Sepharose Ni: GE Healthcare 10 μL of the solution (manufactured by China) was placed in an Eppendorf tube and placed on a magnetic stand for 1 minute. After that, the supernatant was removed and the cells were resuspended in 1x His-tag washing buffer. After 1 min, the plate was placed on a magnetic stand and then the same procedure was repeated. .

[0063] The cDNA display was incubated with the Ni-NTA magnetic beads at room temperature for 30 minutes. The Eppendorf tube was placed on a magnetic stand for 1 minute, and the supernatant was removed. 200 μL of 1×His-tag washing buffer was added and tapping was performed for 1 to 2 minutes. After that, the mixture was placed on a magnetic stand for 1 minute and the supernatant was removed. , His-tag elution buffer (10-30 mM sodium phosphate (pH 7.4), 0.25-0.75M NaCl, 250-500mM imidazole, 0.025-0 Add 10 μL of 1% Tween-20 and incubate at room temperature for 15 minutes. The cDNA display was purified by

[0064] (8) In vitro selection cycle The cDNA display and VLPs were mixed according to Table 8 below, and the selection buffer (1 0-30mM Tris-HCl (pH 7.4), containing 0.1-0.3M NaCl) The mixture was adjusted to 1 mL with 50 ml of water and then incubated at 25° C. for 30 minutes.

[0065] [Table 8]

[0066] <Isolation of VLP-cDNA display complexes by centrifugation> The mixture was added to a centrifuge tube and centrifuged at 4°C for approximately Centrifuge at 130,000 x g for 2 hours. Remove the supernatant and add 1 mL of selection buffer. The walls were washed with 100 μL of RNase-free water, and the supernatant was removed. was redissolved.

[0067] <Isolation of VLP-cDNA display complexes by dialysis> The cDNA display and VLPs produced were selected for dialysis to the concentrations shown in Table 9 below. Buffer (20 mM HEPES (pH 7.4), 150 mM NaCl, 0.05% The mixture was incubated in 100 μL of tween 20 at 25°C for 30 minutes. Fill to 1mL with the selected buffer and place in a Float-A-Lyzer G2 Dialyzer. sis Device CE, 1000 kD MWCO (Spectrum Laboratories The mixture was dialyzed at 25°C with 1 L of dialysis buffer (manufactured by Zeiss). The external solution was replaced three times and the fourth dialysis was performed overnight (8 hours). 14,000× using Ultra 100K (Merck Millipore) g, 5 min.

[0068] (9) Selection of GII.3 and GII.17 VLPs Immunoplate (C-BOTTOM, CLEAR, MICROLON (registered trademark), H GII.3 or GII.IGH BINDING, Greiner) at 3 μg / mL 17. 100 μL of VLP solution was added and immobilized at 4℃ ON. Then, the solution was discarded. Add 200 μL of blocking reagent (EMD Millipore TM Blok TM NSB Blocking Reagents,Thermo Fisher Scient The mixture was then gently stirred at room temperature for 2 hours to effect blocking. Wells without VLPs were also blocked in the same way for use in preselection. We conducted a survey. Discard the solution from the wells and add 200 μL of wash buffer (10 mM Hep ES (pH 7.4), 150 mM NaCl, 0.05% Tween 20) three times After washing, 100 μL of cDNA display (1.5 pmol of mRNA-Link er) into wells where VLPs are not immobilized, and gently mix at room temperature for 30 minutes. Then, the cDNA that did not bind to the blocking agent was The supernatant containing isplay was added to the wells containing immobilized VLPs and incubated at room temperature for 30 minutes. The mixture was stirred at 37°C for 10 min to allow binding to the VLPs. After discarding the supernatant, 100 μL of wash buffer was added. After washing four times with fer, 100 μL of 5% SDS solution was added and incubated at 50°C for 15 minutes. The bound cDNA display was eluted by incubation with 100% ethanol.

[0069] After this, the VLP-cDNA display complex obtained above was diluted to 100 μL for dialysis. After diluting with the buffer of your choice, add the coprecipitant (Quick-Precip Plus So Add 10 μL of 100% ethanol (10 μL of 100% ethanol) and The mixture was centrifuged at 20,000×g for 5 minutes. The supernatant was then discarded and 1 mL of 70% ethanol was added. The tube was dried for 10 minutes and then dissolved in 20 μL of RNase-free water. and GATCCGCGAAATTAATACGACTC as the forward primer. ACTATAGGGGAAGTATTTTTACAACAATTACCAACA (sequence number No. 284), and TTTCCACGCCGCCCCCCGTCCT as the reverse primer. PCR reaction was carried out using (SEQ ID NO: 285). The PCR program was (a) 98°C for 2 minutes (b) 95°C for 20 seconds, (c) 69°C for 20 seconds, (d) 72°C for 20 seconds (25 cycles of b to d) (e) 72°C for 1 min.

[0070] [Table 9]

[0071] The resulting PCR products were used as library DNA for the next cycle, and the PCR products were purified as described in (2). The same procedure was carried out starting from transcription of the library, and the selection cycle was repeated.

[0072] <Analysis of gene sequence information> The above in vitro selection cycle (7 cycles for GII.4 and GII.4 dialysis method) Based on the 7-cycle library obtained by After 5 cycles, prepare a sequence library as follows and obtain sequence information. The sequence library was prepared and sequenced by 16S Metagenome. Microsequencing Library Preparation Protocol The procedure was carried out according to the method described in the Illumina manual.

[0073] 1) Amplicon PCR The reagents in Table 10 were mixed and PCR was performed according to the following program. 95°C for 3 minutes 23 cycles of the following reaction -95°C for 30 seconds -55°C for 30 seconds -72°C for 30 seconds 72°C for 5 minutes Hold at 4℃

[0074] [Table 10]

[0075] 2) Clean up Amplicon PCR products were analyzed using AMPure XP beads (Beckman Chemical The PCR products were purified using AMPure XP beads (manufactured by Ilter). Add 20 μL of the solution, gently pipette 10 times with a micropipette, and then leave to stand at room temperature for 5 minutes. The plate was placed on a magnetic stand and left to stand for 2 minutes, after which the supernatant was discarded. While the plates are still on the magnetic stand, add 200 μL of 80% ethanol to each well. After leaving it for 30 seconds, the supernatant was discarded. This was repeated twice. After air drying, remove the plate from the magnetic stand and place in 10 mM Tris pH 8. 52.5 μL of solution 5 was added to each well and left to stand at room temperature for 2 minutes. Place the plate on the hot stand and let it stand for another 2 minutes, then transfer the plates to the corresponding wells of a new 96-well PCR plate. 50 μL was transferred to each well.

[0076] 3) Index PCR The purified Amplicon PCR products were ligated with an adapter and an Ind A PCR reaction was carried out to add the x sequence. The reagents in Table 11 were mixed and PCR was performed according to the following program. 95°C for 3 minutes - 8 cycles of the following reaction -95°C for 30 seconds -55°C for 30 seconds -72°C for 30 seconds 72°C for 5 minutes Hold at 4℃

[0077] [Table 11]

[0078] The set of index primers used is shown in Table 12 below.

[0079] [Table 12]

[0080] 4) Clean up 2 Index PCR products were analyzed using AMPure XP beads (Beckman Coulte The PCR products were purified using AMPure XP beads (manufactured by Sigma-Aldrich Co., Ltd.). After gently pipetting 10 times with a micropipette, the mixture was allowed to stand at room temperature for 5 minutes. The plate was placed on a magnetic stand and left to stand for 2 minutes, after which the supernatant was discarded. Add 200 μL of 80% ethanol to each well while still on the net stand. After standing for 0 seconds, the supernatant was discarded. This was repeated twice. The mixture was left to stand for 10 minutes to air-dry the ethanol. Then, remove the plate from the magnetic stand and add 10 mM Tris pH 8.5 solution. 25 μL of each solution was added to each well and left to stand at room temperature for 2 minutes. Place the plates on the plates and let them stand for 2 minutes, then transfer the plates to the corresponding wells of a new 96-well PCR plate. 0 μL each was transferred. The purified Index PCR products were analyzed using Bioanalyzer DNA 1000 ch Validation was performed using ip (Agilent Technologies). .

[0081] 5) qPCR The purified index PCR products were analyzed using Kapa Library Quantification qPCR was performed using a cation kit (Nihon Genetics). Kapa SYBR FAST qPCR Mas pre-added with Primer Mix ter Mix 12μL, UltraPure Water 4μL, Index 4 μL of the 100-fold diluted PCR product was mixed and subjected to qPCR. Std1 to 6 included in the kit were used. PCR was carried out according to the following program. 95°C for 5 minutes The following reaction was repeated for 35 cycles. 95°C for 30 seconds 60°C for 45 seconds A calibration curve was drawn from the Ct values ​​of Std1 to 6, and the sample concentrations were calculated.

[0082] 6)Preparing DNA Libraries for Sequencing Miseq Reagent Kit V3 150 cycles(Illumina Thaw the Reagent Cartridge (manufactured by Eppendorf) in a water bath and add the included HT1 buffer. The mixture was thawed at room temperature and then cooled on ice. Index PCR products of known concentrations were analyzed by qPCR using UltraPure Water. The sample was diluted to 4 nM using 0.2 N NaO H (10N NaOH solution (Wako) using UltraPure Water The mixture was mixed with 5 μL of 0.2N diluted solution and left at room temperature for 5 minutes. Then, the mixture was cooled on ice. 990 μL of HT1 buffer was added to give 1 mL of 20 pM denatured library. Mix 180 μL of denatured 20 pM library with 420 μL of ice-cold HT1 buffer. The 6 pM library was obtained in an amount of 600 μL. Mix 30 μL of X DNA with 10 μL of ice-cold HT1 buffer and add 15 pM denatured DNA. PhiX was obtained by denaturing the library. Mix 70 μL of the “Lo” reagent cartridge that has been thawed in a water bath. The total volume of 600 μL was added to the "Ad Samples" (No. 17).

[0083] 7) Starting the Run Maintenance Wash with 0.5% Tween 20 The Fleq (Illumina) was washed with MilliQ water and 99.5% ethanol. The PR2 bottle and the cartridge with the reagent applied are placed in the row cell. was set and sequencing was performed.

[0084] 8) Analysis of genetic information The obtained sequence Fastq file was converted to a Fasta file and run on the software. Using MEGA software, the 115th initiation codon of the library sequence (SEQ ID NO: 279) was The obtained sequence was from the beginning of the codon (ATG) to the end of the 156th cysteine ​​codon (TGC). After translation, the terminal sequences were filtered using the filter function of Excel. The amino acids seven residues upstream from the stearate were filtered with cysteine ​​to generate peptide aptamers. -4357 sequences were obtained.

[0085] 9) Sequence Selection The 7069 peptide aptamer sequences obtained were analyzed for frequency of occurrence, and the frequency of occurrence was 6 The peptides shown in SEQ ID NOs: 1 to 269 specifically bind to norovirus. The 269 sequences selected as peptides are shown in Table 16. Example 2 Interaction with VLPs

[0086] <Peptide synthesis> Using an automatic peptide synthesizer Liberty Blue (CEM Japan), The peptide was synthesized by Fmoc solid-phase synthesis under nitrogen atmosphere. ys(Mtt)-Wang resin (Merck Millipore) or F moc-Cys(Trt)-Wang Resin (Peptide Institute, Inc.) was used. N,N-dimethylformamide (DMF) (Wako Pure Chemical Industries, Ltd.) was used as the deprotection agent. The coupling reaction was accelerated by diluting the amine (manufactured by Wako Pure Chemical Industries, Ltd.) with DMF to the specified concentration. As the photoactivator and optical activity control agent, diisopropylcarbodiimide (Tokyo Chemical Industry Co., Ltd.) and E thyl cyanoglyoxylate-2-oxime:Oxyma (Watanabe Chemical Industry) The synthesis reaction was carried out according to the synthesis program provided with the equipment. I followed the instructions.

[0087] <Introduction of biotin by manual synthesis> The synthesis reaction was carried out using a manual peptide synthesizer Petisyzer (manufactured by HiPep Laboratories). The mixture (Table 13) prepared in the following ratio was stirred at room temperature for 1 hour to obtain tryptophan. Biotin was introduced to the C-terminus of the peptide. After the reaction, the peptide was washed with DMF and diethyl ether.

[0088] [Table 13]

[0089] <Cleavage of peptide with spacer sequence from resin> The resin to which the peptide with the spacer sequence was bound was dissolved in diethyl ether (Wako Pure Chemical Industries, Ltd. The resin was washed and dried using a solvent mixture (manufactured by Yaku Kogyo Co., Ltd.). The 5:2.5 mixture was allowed to react at room temperature for 1 hour, and the peptide was cleaved from the resin. The resin and the solution were separated. Five times the volume of ice-cold diethyl ether was added to the solution, and the mixture was inverted and stirred to cause precipitation. The resulting precipitate was centrifuged at 13,000 rpm, 20 °C for 3 minutes, and the precipitate was washed again with diethyl ether and centrifuged under the same conditions. The precipitate was dried in a draft, and the obtained powder was stored at 4 °C.

[0090] <Evaluation of Interaction by ELISA> The peptide was dispersed in a 10% aqueous DMF solution. The concentration was calculated using an absorptiometer and adjusted to 50 μM with a 10% aqueous DMF solution. This was added to Pierce TM Streptavi din Coated Plates, Clear, 96-Well (manufactured by Thermo Fisher Scientific) at 100 μL / well and left standing at room temperature for 1 hour. The supernatant was removed, and after washing three times with 200 μL of PBS-T (containing 0.05% Tween 20 in PBS), it was diluted to 100 ng / mL with PBS-T. GII.3, GII. 4, GII.17 VLP solutions were added at 100 μL, and the mixture was left standing at room temperature for 50 minutes. The supernatant was removed, and after washing three times with 200 μL of PBS-T, a polyclonal antibody against norovirus VLP derived from rabbits (prepared by submitting a mixture of GII.3 and GII.17 VLP as an antigen to Eurofins Genomics K.K. and requesting production) diluted to 1 μg / mL with a blocking agent was added at 100 μL, and the mixture was left standing at room temperature for 50 minutes. The supernatant was removed, and after washing three times with 200 μL of PBS-T, an anti-rabbit IgG antibody labeled with HRP (manufactured by Cell Signalin g Technology) diluted 1000-fold with a blocking solution was added at 100 μ L, and the mixture was left standing at room temperature for 50 minutes. The supernatant was removed, and after washing three times with 200 μL of PBS-T, 3, 3’, 5, 5’-Tetramethylbenzidine (manufactured by Abcam) was added at 100 μL, and the mixture was left standing at room temperature for 15 minutes. 100 μL of 0.5 M sulfuric acid was added as a reaction stop solution, and the absorbance at 450 nm was measured using a multiplate reader (manufactured by Molecular Device). The results are shown in Figure 4.

[0091] <Calculation of KD value by Bio-Layer Interferometry: BLI method> The apparatus used was BLItz TM (manufactured by ForteBio). After the tip of the SA chip (manufactured by ForteBio) was contacted with purified water for 1 minute for hydration, it was then contacted with a 1% BSA aqueous solution for 1 hour for blocking. The blocked SA chip was set in the measurement section of the BLItzTM main body, and the measurement was carried out according to the program in Table 14. Peptides with SEQ ID NOs: 1, 21, and 28 were used, and the concentration was adjusted to 100 μM. The concentration of GII.3 VLP was adjusted to 1, 0. 1 mg / mL. The measurement data was analyzed using the attached software, and the KD value was calculated based on the Ka and Kd values. The results are shown in Table 15.

[0092] [Table 14]

[0093] [Table 15]

[0094] [Table 16] ​​​​

Claims

1. A norovirus-binding peptide consisting of any amino acid sequence selected from SEQ ID NOs: 28, 21 and 14.

2. A norovirus-binding peptide consisting of an amino acid sequence in which a cysteine ​​residue has been added to either or both of the N-terminus and C-terminus of any of the amino acid sequences selected from SEQ ID NOs: 28, 21 and 14 of claim 1.

3. The norovirus-binding peptide according to claim 2, which has cysteine ​​residues added to the N-terminus and C-terminus of any amino acid sequence selected from SEQ ID NOs: 28, 21 and 14.

4. The norovirus-binding peptide according to claim 3, wherein cysteine ​​residues added to the N-terminus and C-terminus of a peptide consisting of any one of the amino acid sequences selected from SEQ ID NOs: 28, 21 and 14 form a ring via disulfide bonds.

5. A norovirus-binding peptide consisting of an amino acid sequence in which 1 to 20 amino acids have been added to either or both of the N-terminus and C-terminus of the peptide according to any one of claims 1 to 4.

6. A method for detecting a norovirus, which uses the norovirus-binding peptide according to any one of claims 1 to 5.

7. A norovirus detection kit comprising the norovirus-binding peptide according to any one of claims 1 to 5.

Images