Novel use of oncolytic gene-modified measles virus

Abstract

To develop, as a tool for tumor therapy, gene-modified measles viruses that do not recognize SLAM.SOLUTION: The present invention provides: a pharmaceutical composition for inducing cellular immunity against tumor cells for treatment, the pharmaceutical composition containing an oncolytic gene-modified measles virus, wherein the tumor cells as medical treatment targets are tumor cells expressing PVRL4 / Nectin4, and the tumor cells are peritoneally metastasized tumor or scirrhous gastric cancer cells; and a method for inducing cellular immunity against residual tumor cells in vivo or metastatic or recurrent tumor cells that could not be eliminated by direct introduction of an oncolytic gene-modified measles virus, the method comprising directly introducing an oncolytic gene-modified measles virus into tumor cells to be treated and causing cell death (provided that methods for treating humans are excluded), wherein the tumor cells are peritoneally metastasized tumor or scirrhous gastric cancer cells.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a new use of an oncolytic gene-modified measles virus to enhance its efficacy. Specifically, the present invention relates to a new use of an oncolytic gene-modified measles virus, a pharmaceutical composition utilizing the new use, and a new method for treating tumors. This application claims priority based on Japanese Patent Application No. 2022-041183, filed on March 16, 2022, the contents of which are incorporated herein by reference. [Background technology]

[0002] Oncolytic virus therapy is considered to be a very promising new strategy for tumor treatment that can be combined with traditional therapeutic approaches. Currently, a wide range of viruses from many virus species are being evaluated as oncolytic agents, and some viruses are in clinical trials.

[0003] Measles virus (MV) is a pathogenic virus belonging to the genus Morbillivirus in the family Paramyxoviridae that infects humans as a natural host, proliferates entirely in the cytoplasm (i.e., viral sequences are not integrated into the host's chromosomal DNA), and causes immunosuppression and respiratory symptoms. It has been shown that measles virus infects tumor cells and induces tumor regression (Non-Patent Document 1), so measles virus has attracted attention as a tool for viral tumor therapy.

[0004] Taking advantage of this characteristic, the inventors' research group has created a recombinant measles virus (rMV-SLAMblind) based on the wild-type measles virus HL strain that does not recognize the signaling lymphocyte activation molecule (SLAM), which is a receptor for the pathogenicity of the wild-type measles virus (Patent Document 1, Non-Patent Document 1). In this document, the inventors demonstrated that rMV-SLAMblind can kill breast cancer cells when infected with it in vitro or in vivo, and that its antitumor activity is higher than that of conventional measles virus vaccine strains. In addition, it was confirmed that rMV-SLAMblind is completely attenuated, does not cause typical clinical symptoms of measles even when subcutaneously inoculated into monkeys, and is highly safe (Patent Document 1, Non-Patent Document 1).

[0005] The inventors' research group further created rMV-V(-)-SLAMblind as a genetically modified measles virus that does not recognize SLAM, and found that this rMV-V(-)-SLAMblind is also capable of treating breast cancer and metastatic cancer (Patent Document 2). Furthermore, they demonstrated that both genetically modified measles viruses that do not recognize SLAM (rMV-SLAMblind and rMV-V(-)-SLAMblind) have a tumor regression effect not only when administered intratumorally, but also when administered intravenously (Patent Document 2). [Prior art documents] [Patent documents]

[0006] [Patent Document 1] JP 2013-216609 A [Patent Document 2] International Publication No. 2016 / 047645 [Non-patent literature]

[0007] [Non-Patent Document 1] Sugiyama et al., Gene Therapy, 2013, vol.20, p.338-347. Summary of the Invention [Problem to be solved by the invention]

[0008] Oncolytic genetically modified measles viruses (rMV-SLAMblind and rMV-V(-)-SLAMblind) are characterized by infecting and lysing tumor cells, thereby inducing regression of tumor tissue. However, for tumor cells that cannot be directly infected by the virus, such as deep tumors and metastatic tumors that develop after treatment, it was necessary to develop a method other than direct infection. Therefore, an objective of the present invention is to develop genetically modified measles viruses that do not recognize SLAM (rMV-SLAMblind and rMV-V(-)-SLAMblind) as a tool for tumor treatment. [Means for solving the problem]

[0009] The inventors of the present invention discovered that induction of cell death in tumor cells into which an oncolytic gene-modified measles virus has been introduced can result in the induction of strong cellular immunity against tumor cells systemically, thereby demonstrating that the above-mentioned problem can be solved.

[0010] More specifically, in order to solve the above-mentioned problems, the present application provides the following inventions. [1] A pharmaceutical composition for treating tumors by inducing cellular immunity against tumor cells, comprising an oncolytic genetically modified measles virus. [2] The pharmaceutical composition according to [1] above, wherein the tumor cells to be treated are tumor cells expressing PVRL4 / Nectin4. [3] The pharmaceutical composition of [1] or [2] above, wherein the tumor to be treated is breast cancer, lung cancer, colon cancer, or pancreatic cancer. [4] The pharmaceutical composition according to any one of [1] to [3] above, wherein the tumor cells to be treated are tumor cells that cannot be eliminated by direct introduction of an oncolytic gene-modified measles virus and remain. [5] The pharmaceutical composition of [4], wherein the remaining tumor cells are selected from the group consisting of deep tumor cells, recurrent tumor cells, and metastatic tumor cells. [6] The pharmaceutical composition according to any one of [1] to [5] above, wherein the oncolytic gene-modified measles virus is rMV-SLAM-blind or rMV-V(-)-SLAM-blind. [7] The pharmaceutical composition according to any one of [1] to [6] above, wherein the oncolytic gene-modified measles virus is administered intravenously, directly into a tumor mass, or intraperitoneally. [8] The pharmaceutical composition according to any one of [1] to [7] above, wherein the oncolytic gene-modified measles virus induces cellular immunity in addition to its oncolytic effect. [9] A method for inducing cellular immunity against tumor cells remaining in the body that could not be eliminated by direct introduction of an oncolytic gene-modified measles virus, comprising directly introducing an oncolytic gene-modified measles virus into the tumor cells to be treated, thereby causing cell death.

[10] The method according to [9], wherein the remaining tumor cells are selected from the group consisting of deep tumor cells, recurrent tumor cells, and metastatic tumor cells.

[11] The method according to [9] or

[10] , wherein the oncolytic gene modified measles virus is rMV-SLAM-blind or rMV-V(-)-SLAMblind. Effect of the Invention

[0011] The oncolytic gene-modified measles viruses used in the present invention (rMV-SLAMblind and rMV-V(-)-SLAMblind) not only directly induce significant cell death in tumor cells when introduced into the tumor (direct antitumor effect), but also induce indirect cellular immunity in tumor cells that have not been directly infected with the virus (such as metastatic tumor cells and deep tumor cells that have spread to sites that cannot be directly infected by the virus), thereby having an inhibitory effect on tumor growth (secondary antitumor effect). [Brief description of the drawings]

[0012] [Figure 1] FIG. 1 shows an experimental protocol for investigating the secondary antitumor effect of an oncolytic gene-modified measles virus. [Diagram 2] Figure 2 shows a summary of the increase in tumor volume when an oncolytic virus was administered. In Figure 2, the left figure shows the tumor growth on the virus-administered side (left subcutaneous) in comparison with the MOCK-administered group (negative control), and the right figure shows the tumor growth on the non-virus-administered side (right subcutaneous) in comparison with the MOCK-administered group (negative control). [Diagram 3] FIG. 3 shows an experimental protocol for investigating the mechanism of action of the secondary antitumor effect of oncolytic gene-modified measles viruses. [Figure 4] Figure 4 shows a summary of the increase in tumor volume when an oncolytic virus was administered. In Figure 2, the left figure shows the tumor growth on the virus-administered side (left subcutaneous) in comparison with the MOCK-administered group (negative control), and the right figure shows the tumor growth on the non-virus-administered side (right subcutaneous) in comparison with the MOCK-administered group (negative control). [Diagram 5] FIG. 5 shows the results of detecting oncolytic virus genomes in tumor tissues. [Figure 6] FIG. 6 shows the numbers of tumor-infiltrating immune cells in tumor tissues on the virus-administered side and in tumor tissues on the non-virus-administered side. [Figure 7]FIG. 7 shows the number of activated T cells in tumor tissues from the virus-administered side and in tumor tissues from the non-virus-administered side. [Figure 8] FIG. 8 shows the results of measuring the number of cells highly expressing the activation marker CD44 on NK cells, NK T cells, CD4 T cells, and CD8 T cells present in lymph nodes near the tumor (draining LN). [Figure 9] FIG. 9 shows the number of immune cells in draining lymph nodes near tumor tissue on the virus-administered side and in draining lymph nodes near tumor tissue on the non-virus-administered side. [Figure 10] FIG. 10 shows the numbers of various immune cells in the spleen tissue of mice administered an oncolytic virus. [Figure 11] FIG. 11 shows the numbers of various immune cells in the spleen tissue of mice administered an oncolytic virus. [Figure 12] FIG. 12 shows the experimental protocol for investigating the secondary antitumor effect of oncolytic gene-modified measles viruses. [Figure 13] FIG. 13 shows that inoculation with an oncolytic gene-modified measles virus induces tumor antigen-specific CD8+ T cell responses. [Figure 14] FIG. 14 shows the results of examining the expression of Nectin-4 on the cell surface of scirrhous gastric cancer cell lines and non-scirrhous gastric cancer cell lines. [Figure 15] FIG. 15 shows the results of investigating the infection susceptibility of scirrhous gastric cancer cell lines and non-scirrhous gastric cancer cell lines to the oncolytic virus rMV-SLAMblind. [Figure 16] FIG. 16 shows the results of investigating the cell viability after infection with the oncolytic virus rMV-SLAMblind in scirrhous gastric cancer cell lines and non-scirrhous gastric cancer cell lines. [Figure 17] FIG. 17 shows the results of investigating the antitumor activity of the oncolytic virus rMV-SLAMblind using subcutaneous xenograft models of HSC60 cells and HSC43 cells as an example. [Figure 18] FIG. 18 shows the results of examining the oncolytic activity of oncolytic viruses in a model in which luciferase-expressing HSC-60 cells (HSC60-Luc) were metastasized to the peritoneum. [Figure 19] FIG. 19 is a diagram summarizing the change in tumor volume over time when an oncolytic virus and an antibody against each immune response cell were administered to immune-competent mice transplanted with tumor cells in Example 8. [Figure 20] FIG. 20 is a graph summarizing the change over time in survival rate when an oncolytic virus and antibodies against each immune response cell were administered to immune-competent mice transplanted with tumor cells in Example 8. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0013] Oncolytic viruses are very promising as new tumor therapeutic agents that can be used in combination with conventionally used therapeutic methods. The inventors of the present invention have found that the oncolytic gene-modified measles viruses (rMV-SLAMblind and rMV-V(-)-SLAMblind) used in the present invention not only directly induce significant cell death in tumor cells by introduction into the tumor cells (direct antitumor effect), but also induce indirect but strong cellular immunity in tumor cells that are not directly infected with the virus (metastatic tumor cells and deep tumor cells that spread to sites that cannot be directly infected with the virus, etc.), thereby suppressing tumor growth (secondary antitumor effect), and have completed the present invention.

[0014] <Pharmaceutical Composition> That is, in one aspect, the present invention provides a pharmaceutical composition for inducing cellular immunity against tumor cells, comprising an oncolytic genetically modified measles virus, for treatment. This invention provides a method for treating tumor cells that cannot be directly infected with an oncolytic genetically modified measles virus, such as deep tumor cells, metastatic tumor cells that occur after treatment, and recurrent cancer cells, by a method other than direct infection.

[0015] The "oncolytic gene-modified measles virus" used in the present invention refers to a measles virus having oncolytic activity that has been genetically modified to enhance safety or to enhance infection efficiency in tumor cells. For example, the oncolytic gene-modified measles virus used in the present invention may be a wild-type measles virus (MV HL strain) that has been found to efficiently infect various tumor cells expressing PVRL4 / Nectin4, grow in the cells, and cause efficient cell death.

[0016] The genetic modification used to create the oncolytic virus of the present invention is preferably a genetic modification that allows the virus to have infectivity to tumor cells but not to normal cells, including, for example, a genetic modification that causes the virus to lose the ability to bind to SLAM so as to lose infectivity to SLAM-positive cells. By losing the ability to bind to SLAM, the oncolytic virus of the present invention does not infect cells of the immune system that are normal target cells of the measles virus and are SLAM-positive, and SLAM-deficient viruses do not cause measles pathology in infection experiments in monkeys (Patent Document 1, Non-Patent Document 1). In addition, the loss of infectivity to immune cells can improve efficacy and safety during treatment.

[0017] Examples of oncolytic gene-modified measles viruses used in the present invention are not particularly limited, and any oncolytic gene-modified measles virus can be used as long as it has the above-mentioned characteristics as an oncolytic gene-modified measles virus. Examples of oncolytic gene-modified measles viruses include rMV-SLAM-blind and rMV-V(-)-SLAM-blind, which were previously produced by the inventors of the present invention and have actually been found to have a direct antitumor effect.

[0018] An example of the oncolytic genetically modified measles virus used in the present invention, "rMV-SLAMblind", is an oncolytic genetically modified measles virus described in Patent Documents 1 and 2. This virus strain is a genetically modified measles virus strain created as a recombinant MV that cannot selectively utilize SLAM using a reverse genetics technique. This genetically modified measles virus strain has lost infectivity to SLAM-positive cells, and does not originally infect or induce cytotoxicity in CD46-positive cells, but uses PVRL4 / Nectin4 as a receptor for infecting cells, and therefore specifically infects PVRL4-positive tumor cells and induces their cell death. Therefore, it has specific oncolytic activity against SLAM-negative tumor cells (e.g., breast cancer cells).

[0019] "rMV-V(-)-SLAMblind", another example of an oncolytic gene-modified measles virus used in the present invention, is an oncolytic gene-modified measles virus described in Patent Document 2. This virus strain is a gene-modified measles virus strain that has oncolytic activity similar to that of "rMV-SLAMblind", although it is basically the same as "rMV-SLAMblind", with an additional modification in the P gene. This gene-modified measles virus strain has characteristics similar to those of the rMV-SLAMblind strain (infection specificity, oncolytic activity), and is characterized by being attenuated by being genetically modified so as not to express the V gene involved in pathogenicity.

[0020] Specifically, rMV-SLAMblind has the 533rd amino acid residue in the amino acid sequence of the H protein of a measles virus strain substituted with alanine instead of the arginine in the wild-type strain, etc. On the other hand, rMVV(-)-SLAMblind has the 533rd amino acid residue in the amino acid sequence of the H protein substituted with alanine, and furthermore, the 687th and 690th bases in the P gene have been substituted with U to C and C to U, respectively. rMV-SLAMblind can be prepared, for example, by using a plasmid pMV-HL(7+) encoding the full-length antigenome cDNA of the measles virus HL wild-type strain to prepare a vector (pMV-SLAMblind) in which the 533rd amino acid residue of the H protein is substituted with alanine for arginine, and using this vector by a reverse genetics technique. The full-length antigenome cDNA of the measles virus HL wild-type strain in which the 533rd amino acid residue of arginine is substituted with alanine is used herein contains the nucleotide sequence shown in SEQ ID NO: 1, and among the proteins encoded by this nucleotide sequence, the N protein consists of the amino acid sequence shown in SEQ ID NO: 2, the P protein consists of the amino acid sequence shown in SEQ ID NO: 3, the M protein consists of the amino acid sequence shown in SEQ ID NO: 4, the F protein consists of the amino acid sequence shown in SEQ ID NO: 5, the H protein consists of the amino acid sequence shown in SEQ ID NO: 6, and the L protein consists of the amino acid sequence shown in SEQ ID NO: 7. The virus is composed of these proteins. On the other hand, rMV-V(-)-SLAMblind can be prepared by reverse genetics using, for example, a vector (pMV-SLAMblind) in which the arginine at amino acid residue 533 of the H protein is substituted with alanine, using the plasmid pMV-HL(7+) encoding the full-length antigenome cDNA of the measles virus HL wild-type strain, and two further mutations (U at residue 687 to C and C at residue 690 to U) are added to the P gene of the vector (pMV-V(-)SLAMblind). The amino acid sequence of the protein encoded by pMV-V(-)SLAMblind is exactly the same as that of rMV-SLAMblind. The original virus strain for producing MV-SLAMblind or rMV-V(-)-SLAMblind may be a strain other than the wild-type MV-HL strain. Thus, rMV-SLAMblind or rMV-V(-)-SLAMblind used as an oncolytic gene-modified measles virus in the present invention is not limited to those using the above-mentioned pMV-SLAMblind vector or pMV-V(-)SLAMblind.

[0021] The tumor cells to be treated with the pharmaceutical composition of the present invention are characterized by being tumor cells expressing PVRL4 / Nectin4, and are preferably tumor cells that highly express PVRL4 / Nectin4. Examples of tumor cells that highly express PVRL4 / Nectin4 include epithelial cancer cells such as breast cancer, lung cancer, and colon cancer such as colorectal cancer, and ovarian cancer, but are not limited thereto as long as they are tumor cells that highly express PVRL4 / Nectin4.

[0022] In the present invention, it is particularly preferable that the oncolytic gene-modified measles virus used in the present invention is one that efficiently infects various tumor cells that express PVRL4 / Nectin4, and therefore tumor cells that express PVRL4 / Nectin4 (cells of breast cancer, lung cancer, colon cancer such as colorectal cancer, pancreatic cancer, etc.) are preferred as treatment targets for the pharmaceutical composition of the present invention.

[0023] The oncolytic gene-modified measles virus used in the present invention has the effect of significantly suppressing the growth of tumor masses formed by tumor cells when directly introduced into the tumor cells. Such a reaction in which the oncolytic gene-modified measles virus used in the present invention is directly introduced to the tumor cells to cause cell death is called the "direct antitumor effect."

[0024] It has been pointed out that when tumors are treated with oncolytic gene-modified measles viruses, there is a possibility that some tumor cells (deep-seated tumor cells, recurrent tumor cells, metastatic tumor cells, etc.) remain in the body because they cannot be eliminated by the direct antitumor effect. There has been a demand for the development of a method that is effective in treating such remaining tumor cells or tumors.

[0025] The present invention has demonstrated that directly introducing an oncolytic gene-modified measles virus into a target tumor or tumor cells not only induces cell death in the tumor cells (direct antitumor effect), but also induces cellular immunity against the tumor cells in the body through the action of the body's cellular immune system as a result. This cellular immunity can eliminate tumor cells that cannot be killed by the direct antitumor effect and remain in the body among the tumor cells to be treated. In the present invention, the effect of eliminating such tumor cells remaining in the body by cellular immunity is referred to as a "secondary antitumor effect."

[0026] Based on such an action, the present invention provides a pharmaceutical composition for inducing cellular immunity against tumors for treatment. That is, the treatment target of the pharmaceutical composition of the present invention includes, but is not limited to, tumor cells (including deep tumor cells, recurrent tumor cells, metastatic tumor cells, etc.) that remain even after treatment with an antitumor agent that has a direct antitumor effect in the primary tumor focus. Although many treatment methods for tumors have been developed and various antitumor agents exist, there are still many intractable tumors, and metastatic tumors in particular are highly malignant and there is a high demand for treatment.

[0027] By directly introducing the oncolytic gene-modified measles virus used in the present invention into a target tumor or tumor cells, it is possible to not only induce cell death in the tumor cells (direct antitumor effect) but also induce cellular immunity against the tumor cells in vivo. To achieve this purpose, the oncolytic gene-modified measles virus used in the present invention is administered to a subject in a manner that can produce a direct antitumor effect. The oncolytic gene-modified measles virus used in the present invention can be administered intravenously, directly into a tumor mass, intraperitoneally, or the like.

[0028] The pharmaceutical composition of the present invention may contain only the active ingredient, an oncolytic genetically modified measles virus (e.g., rMV-SLAMblind or rMV-V(-)-SLAMblind), or it may be used in combination with one or more other active ingredients.

[0029] The dosage form of the pharmaceutical composition may be any form used in the art, as long as it is suitable for administering an oncolytic virus, and may be, for example, a liquid formulation.

[0030] In addition, when the pharmaceutical composition of the present invention is administered, it may contain various unit doses. The unit dose refers to the content of a predetermined amount of the recombinant measles virus of the present invention, and this unit dose may be administered as a single injection or may include continuous injections over a set period of time. The specific unit dose may be a unit dose that has already been investigated for a direct antitumor effect (Patent Document 2).

[0031] <Method for inducing cellular immunity against tumor cells> In another aspect, the present invention also provides a method for inducing cellular immunity against tumor cells remaining in the body that cannot be eliminated by direct introduction of an oncolytic genetically modified measles virus (secondary antitumor effect), which includes directly introducing an oncolytic genetically modified measles virus into tumor cells to be treated to cause cell death (direct antitumor effect).

[0032] In general, cellular immunity against tumor cells (secondary antitumor effect) is Antigens derived from tumor cells are taken up by antigen-presenting cells (APCs; macrophages and dendritic cells), where they are broken down into small peptides. The degraded antigen fragments bind to MHC class II molecules in the endosomes and are transferred to the surface of antigen-presenting cells, where they bind to the T cell receptor (TCR) of helper T cells, presenting the antigen determinant. As a result, helper T cells are activated, and cytotoxic T cells are activated by IL-2 and interferon gamma (IFN-γ) produced by Th1 cells. - Cytotoxic T cells recognize antigen peptides complexed with MHC class I presented by tumor cells, perceive them as foreign bodies, and become activated. As a result, cytotoxic T cells secrete a protein called perforin against the tumor cells they recognize, creating holes in the target tumor cells and injecting an enzyme called granzyme to induce apoptosis or destroy the tumor cells via the Fas-Fas ligand system. In addition, macrophages are also activated by stimulation from helper T cells and have stronger phagocytosis, phagocytosing tumor cells attacked by killer T cells. It is believed to occur through the following mechanism.

[0033] In the method of the present invention, although it has not been directly confirmed, it is considered necessary that the antigen derived from the tumor cell is presented to the antigen-presenting cell (APC; macrophage or dendritic cell) (i.e., to produce a direct antitumor effect). In the method of the present invention, the oncolytic gene-modified measles virus used in the present invention is directly introduced into the tumor cell to be treated to cause cell death, and the antigen derived from the tumor cell that has caused cell death is taken up by the antigen-presenting cell, and accompanied by activation of effector cells such as macrophages, cytotoxic T cells (CTL, killer T cells), and natural killer cells (NK cells), it is considered that cellular immunity against the tumor cell to which the oncolytic gene-modified measles virus used in the present invention has not been directly introduced can be produced. In particular, activated killer T cells play an important role in the secondary antitumor effect of the oncolytic gene-modified measles virus used in the present invention.

[0034] Cellular immunity induced in the body is enabled by two types of memory T cells, central memory (CM) T cells and effector memory (EM) T cells, which survive for long periods of time, enabling a rapid immune response to be mounted even if the same antigen (such as a pathogen) reappears.

[0035] It has been clarified that the direct antitumor effect produced by the method of the present invention establishes a memory of cellular immunity in the body, so that even if recurrent tumor cells begin to grow in the future, cellular immunity against the tumor cells can be induced again in the body without administering the oncolytic gene-modified measles virus used in the present invention. A feature of the measles virus is that it induces strong cellular immunity, which is known to last so long that it can be considered lifelong immunity, so this immune effect is expected to have a long-term and sustained suppressive effect against metastatic cancer and re-cancer.

[0036] <Tumor treatment method via cellular immunity against tumor cells> In another aspect of the present invention utilizing the above-mentioned method of inducing cellular immunity against tumor cells, the present invention also provides a method for treating tumors via cellular immunity against tumor cells remaining in the body that could not be eliminated even by direct introduction of an oncolytic gene-modified measles virus, which includes directly introducing an oncolytic gene-modified measles virus into the tumor cells to be treated to cause cell death (direct anti-tumor effect).

[0037] The therapeutic method of the present invention can treat tumor cells remaining in the body that cannot be eliminated by the direct antitumor effect (deep tumor cells, recurrent tumor cells, metastatic tumor cells, etc.) by exerting a secondary antitumor effect on tumor cells remaining in the body that cannot be eliminated by the direct antitumor effect.

[0038] This method has a secondary antitumor effect on tumor cells remaining in the body that could not be eliminated by cellular immunity generated in the body as a result of the direct antitumor effect, and therefore can treat tumor cells (deep tumor cells, recurrent tumor cells, metastatic tumor cells, etc.) remaining in the body that cannot be eliminated by the direct antitumor effect. Because such a therapeutic effect can be obtained, the treatment method of the present invention is suitable as a treatment method for advanced tumors in stages 2 to 4 and recurrent tumors.

[0039] The therapeutic method of the present invention may be applied to a tumor patient after other cancer therapies such as drug therapy, radiation therapy, and surgery have been administered, or to a tumor patient before other cancer therapies have been administered. For example, the therapeutic method of the present invention is suitable as a first-choice therapeutic method in cancer treatment. EXAMPLES

[0040] The present invention will be described in more detail below with reference to examples, which are not intended to limit the present invention in any way.

[0041] [Example 1] Examination of the antitumor effect of oncolytic gene-modified measles virus In this example, in order to investigate the antitumor effect of the oncolytic gene-modified measles virus used in the present invention, immune mice transplanted with mouse lymphoma-derived tumor cells were used to examine the growth of tumor cells in the virus-administered side and the non-virus-administered side when the oncolytic gene-modified measles virus used in the present invention was administered.

[0042] The experimental protocol is as shown in Figure 1. Specifically, C57BL / 6J mice (n=5) were inoculated with 3 × 10 6 EG-7 cells (T cell lymphoma cell line, ova-expressing tumor, obtained from ATCC) or B16 / cells (melanoma cell line, obtained from ATCC) were subcutaneously transplanted (the day of transplantation is designated as D0). Thereafter, while being kept in a clean environment, 1 × 10 cells were transplanted only into the right transplantation site on each of the following days: 3 days (D3), 4 days (D4), 5 days (D5), 6 days (D6), 7 days (D7), 8 days (D8), 10 days (D10), and 12 days (D12) after transplantation. 6 TCID 50 rMV-SLAMblind carrying the EGFP gene (rMV-EGFP-SLAMblind) or saline as a negative control was administered, and nothing was administered to the right transplant site. rMV-EGFP-SLAMblind was prepared by a previously reported method (Patent Document 1). The tumor size was measured by calipers up to D14, and the long and short diameters were calculated.

[0043] The increase in tumor volume is summarized in Figure 2. In Figure 2, the left figure shows the tumor growth on the virus-administered side (left subcutaneous) in comparison with the MOCK-administered group (negative control), and the right figure shows the tumor growth on the non-virus-administered side (right subcutaneous) in comparison with the MOCK-administered group (negative control).

[0044] It was shown that the tumor volume on the virus-administered side was significantly suppressed by the inherent action of the oncolytic virus (direct antitumor effect, Figure 2, left). In contrast, it was shown that the increase in tumor volume on the non-virus-administered side was suppressed, even though the oncolytic virus was not administered into the tumor (Figure 2, right). The oncolytic virus used in this example (rMV-SLAMblind) is not thought to enter the blood circulation in the body, and it was thought that the increase in tumor volume on the non-virus-administered side was suppressed via a mechanism other than the direct administration of the oncolytic virus.

[0045] [Example 2] Mechanism of antitumor effect of oncolytic gene-modified measles virus in non-virus-administered tumor tissue (1) This example was carried out for the purpose of investigating the mechanism of action of the antitumor effect of the oncolytic gene-modified measles virus used in the present invention in non-virus-administered tumor tissue, which was revealed in Example 1.

[0046] The experimental protocol is as shown in Figure 3. Specifically, C57BL / 6J mice (n=5) were inoculated with 1.4 × 10 6 EG-7 cells (T cell lymphoma cell line, ova-expressing tumor, obtained from ATCC) were subcutaneously transplanted (the day of transplantation was designated as D0). Thereafter, while being raised in a clean environment, 1 × 10 cells were transplanted only into the right transplantation site on each of the 5th (D5), 6th (D6), 7th (D7), 8th (D8), and 9th (D9) days after transplantation. 6 TCID 50 rMV-SLAMblind carrying the EGFP gene (rMV-EGFP-SLAMblind) was administered to the right transplant site, and nothing was administered to the right transplant site. rMV-EGFP-SLAMblind was prepared by a method already reported (Patent Document 1). The tumor size was measured by calipers for the long and short diameters until D15, and the test was terminated on D16, when the mice were euthanized and the transplanted tumor tissue was collected.

[0047] The increase in tumor volume during this experiment is summarized in Figure 4. As in Example 1, it was shown that the tumor volume on the virus-administered side was significantly suppressed by the inherent action of the oncolytic virus (direct antitumor effect, Figure 4, left), and that the increase in tumor volume on the non-virus-administered side was suppressed despite the fact that the oncolytic virus was not administered into the tumor (Figure 4, right).

[0048] To clarify the mechanism of action of the antitumor effect in non-virus-administered tumor tissues, we attempted to detect the viral genome in tumor tissues collected on D16. RT-PCR was performed on 2μg of total RNA, and after the reaction was completed, the solution was diluted 4-fold and 4μL of the template was subjected to real-time PCR using Thunderbird SYBR qPCR mix with a primer set for the MV genome. After the reaction, the presence or absence of the viral genome was analyzed by electrophoresis. The primer set used was the RT-1 primer (ACCAAACAAAGT) for cDNA synthesis, the MV-genome-F1 primer (5'-CAATCAATGATCATATTCTAGTACAC-3') for PCR, and the MV genome-R1 primer (5'-TATAATAATGTGTTTGATTCCTCTG-3') for PCR.

[0049] As a result, a sequence derived from the measles virus genome was detected in the tumor tissue on the virus-injected side (Fig. 5, left), but no sequence derived from the measles virus genome was detected in the tumor tissue on the non-virus-injected side (Fig. 5, right). In Fig. 5, the * marks in lane 3 of the rMV-injected tumor and in lanes 4 and 5 of the rMV-non-injected tumor indicate that the above primers formed a dimer. This result indicates that the suppression of tumor volume in the non-virus-injected tumor tissue shown in Fig. 4, right, occurs through a mechanism different from the direct antitumor effect of virus infection (secondary antitumor effect).

[0050] [Example 3] Examination of the mechanism of secondary antitumor effect of oncolytic gene-modified measles virus (2) In this example, the composition of tumor-infiltrating immune cells in tumor tissue collected as a result of the experiment in Example 2 was confirmed in order to investigate the mechanism of action of the antitumor effect of the oncolytic gene-modified measles virus used in the present invention in non-virus-administered tumor tissue, which was revealed in Examples 1 and 2.

[0051] To clarify the mechanism of action of the antitumor effect in non-virus-treated tumor tissue, we detected various immune cells in lymph nodes near the tumor tissue collected on D16. The method was to stain the immune cells with antibodies against the surface antigens of each immune cell, and then analyze them using BD FACSVerse flow cytometry.

[0052] Infiltrating immune cells were collected from the tumor tissue on the side where the virus was administered, and the number of NK cells (NK1.1 positive cells), NKT cells (NK1.1 positive and CD3 positive), CD3 positive T cells, CD4 positive T cells, and CD8 positive T cells was analyzed by flow cytometry after staining for cell surface antigens. CD44 was used as an activation marker for NK cells and T cells, and CD62L was used as a memory T cell marker, and CD44hiCD62L positive T cells were analyzed as central memory cells and CD44hiCD62L negative T cells as effector / effector memory cells. In addition, the numbers of activated NK cells and activated T cells were analyzed by staining for the cytokines Granzyme-B and IFN-γ, which are indicators of NK cell and T cell activation. Meanwhile, the number of immune cells in the tumor tissue on the side where the virus was not administered was also analyzed in the same way.

[0053] When we compared the numbers of NKT cells, CD4+ T cells, CD8+ T cells, and NK cells in the tumor tissue on the virus-administered side and the tumor tissue on the non-virus-administered side, we found that only CD4+ T cells showed significant cellular infiltration in the virus-administered group, but there was a tendency for there to be more infiltrating immune cells in the tumor tissue on both sides of the virus-administered group (Figure 6).

[0054] Next, we analyzed the number of activated T cells in the same way, and found that the numbers of CD69+CD4+ T cells and IFN-γ+CD4 T cells were significantly higher in the tumor tissues on the virus-treated side of the virus-treated group. A tendency for these cells to be higher was also observed in the tumor tissues on the non-treated side (Figure 7).

[0055] The status of these various immune cells suggested that CD4+ T cells, CD8+ T cells, and NK cells were activated as a result of virus-induced cell death of tumor cells in the tumor tissue of the virus-injected side, and that these cells also migrated to the tumor tissue of the non-virus-injected side, inducing tumor-lytic virus-independent proliferation inhibition or cell death in the tumor tissue of the non-virus-injected side.

[0056] [Example 4] Examination of the mechanism of secondary antitumor effect of oncolytic gene-modified measles virus (3) In this example, the composition of immune cells in the draining lymph nodes near the tumor tissue collected as a result of the experiment in Example 2 was confirmed in order to investigate the mechanism of action of the antitumor effect of the oncolytic gene-modified measles virus used in the present invention in non-virus-administered tumor tissue, which was revealed in Example 1.

[0057] To clarify the mechanism of action of the antitumor effect in non-virus-administered tumor tissue, we detected various immune cells in the draining lymph nodes near the tumor tissue collected on D16. The method was the same as above, and analysis was performed by immunostaining followed by flow cytometry.

[0058] First, we measured the number of cells highly expressing the activation marker CD44 on NK cells, NK T cells, CD4 T cells, and CD8 T cells present in the tumor-draining lymph nodes (LNs).

[0059] The results are shown in Figure 8. In the lymph nodes near the tumor on the virus-administered side, a significant increase in the numbers of activated NK cells, NK T cells, CD4 T cells, and CD8 T cells highly expressing CD44 was observed. On the other hand, in the draining lymph nodes on the non-virus-administered side, although there was a tendency for each cell to increase, no significant difference was observed.

[0060] Next, we analyzed the activation of T cells in lymph nodes draining the vicinity of the tumor using the expression of IFN-γ and GrB as indicators, and found a significant increase in the number of IFN-γ-positive CD4 T cells and GrB-positive CD8 T cells in the lymph nodes draining the side of the virus administration (Figure 9, upper, center and right graphs). This indicates that the number of activated CD4 T cells and CD8 T cells is increased.

[0061] On the other hand, in the draining lymph nodes on the non-administered side, the number of IFN-γ-positive CD4 T cells was increased, but the increase was not significant (p=0.102) (Fig. 9, lower, center). However, the proportion of IFN-γ-positive cells in CD4 T cells was increased with a significant difference (Fig. 9, lower, left), which revealed that the proportion of activated T cells was increased. In addition, the number of GrB-positive CD8 T cells (activated CD8 T cells) on the non-administered side was significantly increased (Fig. 9, lower, right), which revealed that activated CD4 cells and CD8 cells were accumulated in the lymph nodes near the tumor on the non-administered side.

[0062] [Example 5] Response of immune cells to oncolytic gene-modified measles virus (1) In this example, the composition of immune cells in the spleen tissue collected as a result of the experiment in Example 2 was confirmed in order to investigate the mechanism of action of the antitumor effect of the oncolytic gene-modified measles virus used in the present invention in non-virus-administered tumor tissue, which was revealed in Example 1.

[0063] To confirm the systemic immune cell response, various immune cells were detected in the spleen tissue collected on day 16. In this experiment, NK1.1+CD3+ cells were stained as NKT cells, NK1.1+CD3- cells as NK cells, NK1.1-CD4+ cells as CD4+T cells, and NK1.1-CD8+ cells as CD8+T cells, and the cell numbers were calculated.

[0064] As shown in Figure 10, a significant increase in the number of CD8 T cells and NK cells was observed. In other words, it was revealed that activated CD8+ T cells and activated NK cells proliferated and circulated throughout the body.

[0065] In addition, phenotypic analysis was performed by comparing the numbers of effector memory (EM) CD4+ T cells, central memory (CM) CD4+ T cells, GrB+ CD8+ T cells, and IFN-γ+ CD8+ T cells in splenic tissue.

[0066] In general, central memory T cells express the chemokine receptor CCR7 and the adhesion factor CD62L, and are present mainly in the T cell area of ​​secondary lymphoid tissues such as lymph nodes and spleens. When exposed to an antigen to which they have been previously exposed again, they have the ability to produce IL-2 and rapidly proliferate. On the other hand, effector memory T cells generally have reduced expression of adhesion factors such as CCR7 and CD62L, and are present mainly in the local area of ​​inflammation (e.g., lungs, liver, intestinal tract, etc.), and have the ability to produce large amounts of cytokines such as IL-4, IFN-γ, and IL-5 when stimulated by an antigen to which they have been previously exposed. The long-term survival of these two types of memory T cells enables them to mount a rapid immune response even when the same antigen (e.g., a pathogen) reappears.

[0067] As a result, compared with the spleen tissue of the MOCK-administered group (negative control), Analysis of GrB and IFN-γ revealed a significant increase in the numbers of GrB+CD8 T cells and IFN-γ+CD8 T cells (both activated CD8 T cells), which are T cells that express GrB and IFN-γ, indicators of activation (Figure 11, top and bottom right graphs). Furthermore, analysis of central memory cells (CM; CD62L+CD44hi T cells), which are necessary for exerting strong immunity against cancer cells, revealed a significant increase in both CMCD4 T cells and CMCD8 T cells (Figure 11, bottom, left and center). However, there was an increase in the number of CD8 T cells with effector / effector memory cell phenotypes, but not in the number of CD4 T cells.

[0068] [Example 6] Response of immune cells to oncolytic gene-modified measles virus (2) rMV-SLAMblind treatment was shown to rapidly and significantly induce IFN-γ-producing type 1 CD4+ T cells (Th1). Th1 cells play a crucial role in establishing antitumor responses by supporting CTL function and differentiation of memory CD8+ T cells. Therefore, in this example, we analyzed whether tumor antigen-specific CD8+ T cells were induced by rMV-SLAMblind treatment.

[0069] EG-7 cells were implanted into B6 mice followed by MOCK or rMV-SLAMblind treatment on days 3 and 5 after tumor implantation (n=5 / group). Mice were euthanized on day 13 and TDLN of those animals were harvested.

[0070] To evaluate tumor antigen-specific T cells, immature bone marrow-derived dendritic cells (BMDCs) were prepared from bone marrow cells of C57BL / 6J mice. Briefly, bone marrow cells from the femurs of adult mice were cultured in cRPMI supplemented with 20 ng / mL GM-CSF (PeproTech). After 3 days, the culture medium was supplemented with fresh cRPMI and GM-CSF and cultured for an additional 3 days.

[0071] On day 6, immature BMDCs were harvested and stimulated as follows: To stimulate immature DCs with tumor antigens, heat shocked tumor cell lysates were prepared as follows: Briefly, EG-7 cells were incubated at 42°C for 1 h, then incubated at 37°C for 2 h. After incubation, cells were washed with PBS and 1.5 × 10 7 Cells were resuspended in PBS at a density of 100 / mL, the cell suspension was lysed by three cycles of freeze-thawing and centrifugation at 20,400 g for 10 min, and the supernatant was stored at -30°C until use.

[0072] Immature BMDCs were stimulated overnight with heat-shocked tumor cell lysates (tumor antigen-pulsed DCs) at a ratio of 4:1 (tumor cells:DCs) in the presence of 20 ng / mL GM-CSF. They were mixed with lymphocytes from rMV-SLAMblind-treated EG-7-bearing mice or MOCK-treated EG-7-bearing mice. After overnight coculture, IFN-γ and GrB expression in CD8+ T cells from these animals was analyzed by flow cytometry (Figure 12).

[0073] The maturation state of DCs was monitored by expression of CD11c (CD11c-FITC, clone; HL3 (BD ​​Biosciences)), IA / IE (IA / IE Pacific Blue, clone; M5 / 114.15.2 (BioLegend)), CD80 (CD80-PerCP-Cy5.5, clone; 16-10A1 (BioLegend)), and CD86 (CD86-APC, clone; GL1 (BD Biosciences)) by flow cytometry (data not shown).

[0074] After stimulation, DCs were treated with 50 μg / mL mitomycin C (WAKO) for 1 h and then washed twice with cRPMI. In addition, lymphocytes were prepared from tumor-draining lymph nodes (TDLN) of EG-7 tumor-bearing mice treated with MOCK or EG-7 tumor-bearing mice treated with rMV-SLAMblind, and then labeled with efluor450 (eBioscience) to distinguish the cells from the DC mixture. Lymphocytes and DCs were then mixed at a ratio of 5:1 (lymphocytes:DCs). After overnight co-culture, cells were stimulated with PMA and ionomycin in the presence of brefeldin A for 4 h, followed by staining and flow cytometry.

[0075] A higher percentage of CD8+ T cells from rMV-SLAMblind-treated mice expressed IFN-γ and GrB in response to tumor antigen-pulsed DCs compared with the percentage of CD8+ T cells from MOCK-treated mice (Figure 13A, % IFN-γ among CD8+, p<0.05 and Figure 13C, % GrB among CD8+, p=0.103). Furthermore, expression of IFN-γ and GrB was significantly higher in CD8+ T cells from rMV-SLAMblind-treated mice than in MOCK-treated mice (Figures 13B and 13D, IFN-γ, p<0.05, GrB, p<0.05).

[0076] These results demonstrated that rMV-SLAMblind treatment induced tumor antigen-specific CD8+ T cell responses.

[0077] [Example 7] Functional analysis of oncolytic viruses using gastric cancer cells Materials and Methods

[0078] ·cell OCUM-1, NUGC-4, and KatoIII cells were purchased from the Japanese Cancer Research Resources Bank (Tokyo, Japan) and grown in Dulbecco's modified Eagle's medium (DMEM; Sigma, St Louis, MO) containing 0.5 mM sodium pyruvate (Life Technologies, Carlsbad, CA), 10% fetal bovine serum (FBS; SAFC Biosciences, Lenexa, KS), streptomycin (100 mg / mL), and penicillin (100 U / mL). GCIY cells were obtained from the RIKEN Bioresource Center (Ibaraki, Japan) and cultured in minimum essential medium (Sigma) containing 15% FBS and antibiotics. HSC-60, HSC-43, HSC-44PE, HSC-64, MKN28, TMK-1, HSC-39, NKPS, 58As1, 58As9, and HSC-59 were previously established from gastric cancer tissue (refs) and cultured in RPMI 1640 medium (Sigma) containing 10% FBS and antibiotics. Vero cells expressing human Nectin-4 (Vero / N4 cells) were grown in DMEM containing 10% FBS and antibiotics. All cells were cultured at 37°C, 5% CO2.

[0079] Virus preparation rMV-EGFP-SLAMblind was propagated in Vero / N4 cells. The titer of each virus was calculated as TCID 50 It was decided as follows.

[0080] Flow cytometry Cells were washed with PBS and detached with 0.025% trypsin / 0.24 mM EDTA. After centrifugation at 3,300 × g for 1 min, cells were resuspended in 100 μl of PBS containing 2% FBS and incubated with 0.5 μg of anti-human Nectin-4 monoclonal antibody (R&D Systems, Minneapolis, MN) or anti-human SLAM antibody (BioLegend, San Diego, CA) on ice for 30 min.

[0081] Cells were then washed once and stained with 0.1 μg of Alexa 488-conjugated anti-mouse IgG (Molecular Probes, Eugene, OR) for an additional 30 min on ice. Finally, cells were washed twice with PBS containing 2% FBS and resuspended in PBS containing 7-aminoactinomycin D (Beckman Coulter Immunotech, Massielle, France). Fluorescence intensity was measured with a FACSCalibur (BD Biosciences, San Jose, CA, USA) and data were analyzed using FlowJo software ver. 9.7.5 (TreeStar, San Carlos, CA).

[0082] Viral infection of gastric cancer cell lines Cells were cultured in 12-well plates and infected with rMV-EGFP-SLAMblind at an MOI of 0.1. Viral infection was observed 5 days postinfection (5 dpi) under an all-in-one fluorescence microscope (BZ-710; Keyence, Osaka, Japan).

[0083] Cell proliferation assay Cells were infected with rMV-EGFP-SLAMblind at an MOI of 1. Cells were then cultured at 5 × 10 cells per well in 200 μL medium. Cells were seeded at a density of 3x100 in 96-well plates and cultured at 37°C. Cell viability was measured at 1, 3, 5, and 7 dpi using a WST-1 cell proliferation kit (Takara BIO INC., Otsu, Shiga, Japan) according to the manufacturer's protocol. The viability of virus-infected cells was calculated as the mean absorbance value divided by the mean absorbance value of uninfected cells and expressed as a percentage.

[0084] Xenograft model Animal experiments were approved by the Animal Care and Experimental Committee of the University of Tokyo. HSC-60 cells (5 × 10 6 ) or HSC-43 cells (3 × 10 6 ) were suspended in 50 μL of Hank's balanced salt solution (HBSS; Thermo Fisher Scientific, Wilmington, DE) containing 2% FBS, and the suspension was mixed with 50 μL of Matrigel (BD Biosciences). The cell suspension was injected into the flanks of 7-week-old male NSG (NOD-scidIL2rγnull) mice for HSC-60 and into the flanks of 6-week-old male SCID mice (CB-17 / Icrscid / scidJc1) for HSC-43 (mice were purchased from Clea Japan, Tokyo, Japan).

[0085] Mouse, 10 6 TCID 50 rMV-EGFP-SLAMblind (n = 5) or HBSS (n = 5) was administered intratumorally three times at weekly intervals. Tumor diameters were measured with a caliper every 3 to 4 days for 28 days after the first administration. Tumor volumes were calculated based on the formula (width × width × length) / 2. All mice were euthanized 28 days after the first virus administration, and tumor samples were collected. EGFP fluorescence in isolated tumors was observed by a fluorescence microscope (MVX10; Olympus, Tokyo, Japan).

[0086] Retroviral transduction A plasmid expressing firefly luciferase was generated as follows: the coding region of firefly luciferase was amplified with Phusion High-Fidelity DNA Polymerase (New England Biolabs, Ipswich, MA) using primers specific for firefly luciferase (5'-aaa ccg gtg cca cca tgg aag acg cca aaa aca t -3' and 5'-ttg gat cct tac acg gcg atc ttt ccg c -3').

[0087] The PCR product was cloned between the AgeI and BamHI sites of the pQCXIH vector (Clontech Laboratories, Palo Alto, CA) and named pQCXIH-luc. PlatA cells were transfected with pQCXIH-luc using polyethylenimine "Max" (Mw 40,000)-high titer linear PEI (Polysciences, Inc. Warrington, PA) according to the manufacturer's instructions.

[0088] After 2 days, the supernatant was collected and filtered using a 0.45 μm Acrodisc syringe filter (Pall Corporation, Port Washington, NY). Virus was incubated with HSC-60 cells in the presence of 8 μg / mL polybrene (Sigma). Transduced cells were cultured for 2 weeks in medium containing 200–400 μg / mL hygromycin B (Thermo Fisher Scientific).

[0089] -In vivo visualization of antitumor activity in a peritoneal metastasis model HSC60-Luc cells (3 × 10 6 ) was suspended in 300 μL of HBSS containing 2% FBS and intraperitoneally inoculated into 7-week-old male NSG mice. Five days after inoculation, the mice were 6 TCID 50rMV-EGFP-SLAMblind was administered intraperitoneally. Bioluminescence analysis was performed at the indicated dpi.

[0090] Mice were infected intraperitoneally with 2 mg of D-luciferin (Gold Biotechnology, St. Louis, MO, USA) diluted in 200 μL of PBS. Images were acquired using a Xenogen IVIS 100 system (Xenogen, Alameda, CA, USA). Luciferase activity was measured as total photons / s / cm using Living Image software ver. 2.5 (Xenogen). 2 Quantified as / sr.

[0091] ·Statistical analysis Statistical analysis of in vivo experiments was performed using Welch's t test with MacTokei-Kaiseki ver. 1.5 software (Esumi, Tokyo, Japan). P < 0.05 was considered statistically significant.

[0092] <Expression of Nectin-4 in scirrhous and non-scirrhous gastric cancer cell lines> To investigate whether Nectin-4, a receptor for rMV-SLAMblind, is expressed on the cell surface of gastric cancer cells, 13 SGC and 2 non-SGC cell lines were stained with anti-human Nectin-4 monoclonal antibody (blue histogram) or control IgG (red histogram) and incubated with Alexa-Fluor-488-conjugated anti-mouse antibody to analyze the expression of Nectin-4 by flow cytometry. According to the expression level of Nectin-4, the cells were classified into three groups: high expression group (represented as "High" in Figures 14-16), low expression group (represented as "Low" in Figures 14-16), and no expression group (represented as "Negative" in Figures 14-16) (Figure 14). Data were analyzed using FlowJo software.

[0093] Nectin-4 was detected in nine SGC (69%) and two non-SGC (100%) cell lines, but not in four SGC cell lines. Among the Nectin-4-expressing cell lines, high expression was observed in three SGC cell lines (HSC-60, HSC-43, and HSC-44PE) and two non-SGC cell lines (HSC-64 and MKN28). The expression levels of Nectin-4 in the other six SGC cell lines (OCUM-1, TMK-1, HSC-39, KATOIII, NUGC-4, and NKPS) were low.

[0094] These results suggest that Nectin-4 is highly expressed in SGC cells, but that the expression levels vary among cell lines.

[0095] <Infectivity of rMV-SLAMblind in scirrhous and non-scirrhous gastric cancer cell lines> To examine the sensitivity to rMV-SLAMblind, scirrhous gastric cancer and non-scirrhous gastric cancer cell lines were infected with rMV-SLAMblind expressing EGFP (rMV-EGFP-SLAMblind) at an MOI of 0.1 (Figure 15). EGFP fluorescence was observed under a fluorescent microscope at 5 dpi, and representative data are shown. Magnification, ×100.

[0096] The virus-derived EGFP signal was detected in most Nectin-4 positive cell lines, but was hardly detected in Nectin-4 negative cell lines. In particular, four of the five cell lines expressing high levels of Nectin-4 (HSC-60, HSC-43, HSC-64, and MKN28) showed strong signals ("High" in Figure 15).

[0097] Next, to measure cytotoxicity, cells were infected with rMV-SLAMblind at an MOI of 1, and then cell viability assays were performed at 1, 3, 5, and 7 dpi using a water-soluble tetrazolium salt (WST) assay system (Figure 16). Error bars indicate SD of three independent experiments.

[0098] By 7 days postinfection (7 dpi), rMV-SLAMblind killed over 75% of HSC-60, HSC-43, HSC-64, and MKN28 cells, and approximately 50% of OCUM-1 cells. No reduction in cell viability was observed in HSC-44PE, despite high levels of Nectin-4 expression. Viability was not reduced in cell lines expressing low or no levels of Nectin-4, except for OCUM-1.

[0099] These results suggest that rMV-SLAMblind exhibits cytotoxicity against scirrhous and non-scirrhous gastric cancer cells in vitro, and that this is roughly correlated with the expression level of Nectin-4.

[0100] <Antitumor activity of rMV-SLAMblind in a subcutaneous xenograft model> To investigate the antitumor activity of rMV-SLAMblind in vivo, human xenograft models of HSC60 and HSC43 cells were generated by subcutaneous implantation into NOD-scid IL2rγnull (NSG) and severe combined immunodeficiency (SCID) mice, respectively. Tumors were established and reached 90 mm 3 After reaching 10 6 TCID 50 rMV-EGFP-SLAMblind or HBSS as a control was administered intratumorally at a dose of 100 mg / kg / day for 3 weeks at weekly intervals, i.e., 7 and 14 days after the first inoculation. The two groups were compared using Welch's t-test. Error bars represent SD. *P<0.05 was considered statistically significant. *P<0.05, **P<0.01. Administration of rMV-EGFP-SLAMblind showed significant antitumor activity in both HSC-60 and HSC-43 cell transplantation models (Figure 17A).

[0101] 28 days after the first administration, each mouse was euthanized and autopsy was performed to collect tumor samples. The weight of the collected tumor was measured on the 28th day. Error bars represent SD. P value was expressed by Welch's t-test. The tumor size of the HSC-60 xenograft model in the virus-treated group was obviously smaller, and the tumor weight was also lower than that of the control group (Figure 17B, Figure 17C). In Figure 17C, the upper sample is the tumor of the control group, and the lower sample is the tumor of the virus-inoculated group.

[0102] The HSC-43 model showed a similar trend. That is, at 28 dpi, isolated tumors from mice treated with HBSS (left panel) or rMV-SLAMblind (right panel) were observed by immunofluorescence microscopy. Furthermore, EGFP fluorescence, which indicates viral growth, was only detected in tumors treated with rMV-EGFP-SLAMblind (Figure 17D).

[0103] These results suggested that rMV-SLAMblind has antitumor activity in vivo.

[0104] <Tumor lytic activity in peritoneal metastasis model> SGC was characterized by progressive invasion and frequent metastasis to the peritoneum. To examine whether rMV-SLAMblind could exhibit oncolytic activity against peritoneal dissemination, we used 3 × 10 luciferase-expressing 6 A peritoneal seeding xenograft model was established by intraperitoneally injecting HSC-60 cells (HSC60-Luc) into NSG mice. Five days later, the luciferase activity in the peritoneal cavity increased after 2 × 10 6 TCID 50 rMV-SLAMblind or HBSS was administered intraperitoneally three times, 0, 2, and 8 days after the first administration (Figure 18A).

[0105] Tumor growth was monitored by the Xenogen IVIS100 system until day 27. As shown in Figure 18B, tumor cells in the control group were widely spread in the peritoneal cavity, whereas tumor cells in the virus-treated group were largely restricted. Representative data of luciferase activity 27 days after the initial virus inoculation is shown.

[0106] Additionally, the values ​​of luciferase activity at each time point are shown. Two groups were compared using Welch's t-test. Error bars represent SD. *P<0.05 was considered statistically significant. The values ​​of luciferase activity were significantly lower in the virus-treated group than in the control group (Figure 18C).

[0107] All mice in the virus-treated group survived until 43 days after the first injection, but half died 34 days after the first injection and were euthanized 41 days after the first injection due to abnormal tumor growth. When surviving mice were sacrificed and analyzed 43 days after the first injection, control mice developed hemorrhagic ascites, whereas virus-treated mice did not (data not shown).

[0108] These results suggested that intraperitoneal administration of rMV-SLAMblind may exert antitumor activity against peritoneal dissemination.

[0109] [Example 8] Mechanism of secondary antitumor effect of oncolytic gene-modified measles virus (4) In this example, the purpose of the present invention is to investigate the mechanism of action of the antitumor effect of the oncolytic gene-modified measles virus used in the present invention in non-virus-administered tumor tissue, as revealed in Examples 1 and 2, and the effect of various immune response cells, the activation of which was induced by administration of the oncolytic gene-modified measles virus, on anticancer therapy was examined.

[0110] Administration of oncolytic gene-modified measles virus induces activation of NK cells, CD4+ T cells, and tumor antigen-specific CD8+ T cells. To investigate whether these induced immune responses influence the efficacy of cancer therapy, we performed in vivo cell-specific depletion studies.

[0111] Specifically, B16F10 / N4 cells were first transplanted into B6 mice (the day of transplantation was designated D0). Then, while rearing the mice in a clean environment, rat IgG2B (isotype control), anti-CD8 antibody, anti-CD4 antibody, and anti-NK1.1 antibody were injected on each of the days 3 (D3), 6 (D6), 10 (D10), and 14 (D14) after transplantation to deplete specific immune cell populations (n=8 per antibody administration group). In addition, rMV-SLAMblind was administered on each of the days 4 (D4), 5 (D5), 6 (D6), 8 (D8), and 10 (D10) after transplantation. In addition, for each mouse, the tumor volume was measured over time from 5 days after transplantation onwards, and tumor growth was analyzed. Depletion of immune cell subsets was confirmed 2 days after the second antibody injection.

[0112] The results of measuring the tumor volume (mean ± SEM) of each group over time are shown in Figure 19, and the results of measuring the survival rate of each group over time are shown in Figure 20. Statistical significance was analyzed by Kruskal-Wallis-Test, and P values ​​were calculated by Steele test (in the figures, * = p < 0.05, ** = p < 0.01). As shown in Figure 19, the tumor volume 14 days after implantation (D14) was significantly suppressed in the rMV-SLAMblind + isotype control treated mice (rMV + isotype) group compared with the MOCK + isotype control treated mice (MOCK + isotype) group (D6-D14, P < 0.01). The tumor volume was also significantly suppressed in the rMV-SLAMblind + anti-CD4 antibody treated mice (rMV + anti-CD4) group, although it was slightly larger than that in the rMV + isotype group. In contrast, the tumor volumes of the rMV-SLAMblind+anti-CD8 antibody-treated mice (rMV+anti-CD8) and rMV-SLAMblind+anti-NK1.1 antibody-treated mice (rMV+anti-NK1.1) groups 14 days after transplantation (D14) were smaller than those of the MOCK+isotype group, but there was no statistically significant difference. As shown in Figure 20, the survival rate of the rMV+anti-CD4 group was similar to that of the rMV+isotype group, whereas the survival rates of the rMV+anti-CD8 and rMV+anti-NK1.1 groups were lower than that of the rMV+isotype group. Specifically, the median survival time (MST) of the rMV+anti-CD8 group was shortened to 19.5 days, and that of the rMV+anti-NK1.1 group was shortened to 22 days. These results indicate that depletion of CD8+ T cells and NK cells significantly reduces the tumor-suppressing function of rMV-SLAMblind administration, in other words, CD8+ T cells and NK cells are required for the tumor-suppressing and cancer therapeutic effects of rMV-SLAMblind administration. In particular, it was found that activated killer T cells (CD8+ T cells) play the most important role in the secondary antitumor effect of rMV-SLAMblind, among the immune cells activated by rMV-SLAMblind administration. [Industrial Applicability]

[0113] The oncolytic gene-modified measles viruses used in the present invention (rMV-SLAMblind and rMV-V(-)-SLAMblind) not only induced significant cell death in tumor cells when administered intratumorally (direct antitumor effect), but also induced strong cellular immunity against tumor cells that were not directly infected with the virus (such as metastatic tumor cells and deep-seated tumor cells that have spread to sites that cannot be directly infected by the virus) (secondary antitumor effect). [Sequence List Free Text]

[0114] SEQ ID NO: 8: RT-1 primer for cDNA synthesis: ACCAAACAAAGT SEQ ID NO: 9: MV-genome-F1 primer for PCR: CAATCAATGATCATATTCTAGTACAC SEQ ID NO: 10: MV genome-R1 primer for PCR: TATAATAATGTGTTTGATTCCTCTG SEQ ID NO: 11: Primer specific for firefly luciferase: aaa ccg gtg cca cca tgg aag acg cca aaa aca t SEQ ID NO: 12: Primer specific for firefly luciferase: ttg gat cct tac acg gcg atc ttt ccg c

Claims

1. A pharmaceutical composition for treating a tumor by inducing cellular immunity against tumor cells, comprising an oncolytic genetically modified measles virus, The tumor cells to be treated are tumor cells expressing PVRL4 / Nectin4, A pharmaceutical composition, wherein the tumor is a peritoneally disseminated tumor or gastric carcinoma.

2. The pharmaceutical composition of claim 1 , wherein the oncolytic genetically modified measles virus is rMV-SLAM-blind or rMV-V(-)-SLAM-blind.

3. The pharmaceutical composition according to claim 1 or 2, wherein the oncolytic genetically modified measles virus is a wild-type measles virus that has been genetically modified.

4. The pharmaceutical composition according to claim 1 or 2, which induces cellular immunity against tumor cells to which the oncolytic genetically modified measles virus has not been directly administered.

5. The pharmaceutical composition according to claim 1 or 2, which is administered to a tumor patient after undergoing drug therapy, radiation therapy, or surgical therapy.

6. The pharmaceutical composition according to claim 1 or 2, wherein the oncolytic genetically modified measles virus is administered directly to a tumor mass.

7. The pharmaceutical composition according to claim 5, wherein the oncolytic genetically modified measles virus is administered intraperitoneally.

8. A method for inducing cellular immunity against tumor cells remaining in a living body or against metastatic or recurrent tumor cells that could not be eliminated by the direct introduction of an oncolytic gene-modified measles virus, which includes directly introducing an oncolytic gene-modified measles virus into tumor cells to be treated, thereby causing cell death (excluding methods for treating humans), The method, wherein the tumor cells are cells of a peritoneally disseminated tumor or gastric scirrhous cancer.

9. The method of claim 8, wherein the oncolytic genetically modified measles virus is directly introduced into the tumor cells by intraperitoneal administration.

10. The method of claim 8 or 9, wherein the oncolytic genetically modified measles virus is rMV-SLAM-blind or rMV-V(-)-SLAM-blind.

11. The method according to claim 8 or 9, wherein the oncolytic genetically modified measles virus is a virus that has been genetically modified from a wild-type measles virus.

12. The method of claim 8 or 9, wherein the oncolytic genetically modified measles virus induces cellular immunity against tumor cells to which the virus has not been directly administered.

Images