Compositions and methods for selective protein expression

Abstract

To provide fusion proteins including two protein domains separated by a heterologous protease cleavage site.SOLUTION: The present invention provides a fusion protein including a first protein domain, which is a degradation domain, and a second protein domain, which is a transmembrane protein, where the first protein domain and the second protein domain are separated by a heterologous protease cleavage site, and the degradation domain is a carbonic anhydrase domain or an estrogen receptor (ER) domain.SELECTED DRAWING: None

Description

[Technical Field]

[0001] Related Applications This application claims priority to U.S. Patent Application No. 62 / 322,931, filed April 15, 2016, and U.S. Patent Application No. 62 / 481,094, filed April 3, 2017, the entire contents of each of which are incorporated herein by reference.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in ASCII format, which is incorporated herein by reference in its entirety. The ASCII copy, created on April 14, 2017, is named N2067-7128WO_SL.txt and is 2,326,027 bytes in size. [Background technology]

[0003] Various constructs have been developed to allow selective expression of a desired protein of interest. New constructs containing domains engineered to degrade in the absence of a stabilizing ligand (known in the art as "degrons") are being tested. Other constructs contain domains engineered to aggregate in the absence of a disaggregating ligand (e.g., aggregation domains). Such domains can be fused to a protein of interest to allow selective expression of such proteins only in the presence of a stabilizing or disaggregating ligand. Summary of the Invention [Problem to be solved by the invention]

[0004] Degrons and aggregation domains known in the art have certain drawbacks associated with disrupting the desired function of a protein of interest in certain circumstances due to the size and / or conformation of the fusion protein. Such drawbacks may be particularly pronounced when the protein of interest is a transmembrane protein. Therefore, there is a need for improved degron / aggregation domain technology. Furthermore, there is a need for methods of modifying T cells without permanently modifying or suppressing the immune system to treat various diseases and conditions, including, but not limited to, cancer, autoimmune disease, and alloimmunization. [Means for solving the problem]

[0005] In one aspect, the invention features a fusion protein that includes two protein domains separated by a heterologous protease cleavage site (e.g., a protease cleavage site that is cleaved by a mammalian intracellular or extracellular protease), wherein a first of the protein domains is a conditional expression domain, e.g., a degradation domain or an aggregation domain, and the second protein is a protein of interest, e.g., a transmembrane protein (e.g., a CAR).

[0006] In some embodiments, the conditional expression domain is a degradation domain, e.g., a degradation domain as described herein. Without wishing to be bound by theory, in some embodiments, the degradation domain is unstable and / or unable to fold into a stable conformation in the absence of an expression compound, e.g., a stabilizing compound. A misfolded / unfolded degradation domain, along with other domains of the fusion protein, can be degraded by intracellular degradation pathways (see, e.g., Figure 25). In the presence of the expression compound, the degradation domain can fold into a stable conformation and is less susceptible to intracellular degradation pathways, e.g., compared to a degradation domain in the absence of the expression compound. Thus, the level and / or rate of cell surface or extracellular expression of the fusion protein is enhanced, e.g., by at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, or 30-fold, in the presence of the expression compound compared to the absence of the expression compound. In some embodiments, when the degradation domain of the fusion protein adopts the appropriate conformation, a heterologous cleavage site is exposed, resulting in removal of the degradation domain and thus liberating the second protein domain.

[0007] In other embodiments, the conditional expression domain is an aggregation domain. Without wishing to be bound by theory, in some embodiments, in the absence of an expression compound, e.g., a disaggregating compound, the aggregation domain of the fusion protein associates with one or more other aggregation domains to form oligomers and aggregates (see, e.g., Figure 26). The aggregated fusion protein can be sequestered within a cellular compartment in which the fusion protein is aggregated. In the presence of an expression compound, e.g., a disaggregating compound, the aggregation domains dissociate from each other, and the fusion protein is solubilized (e.g., assumes a monomeric configuration). Thus, the level and / or rate of cell surface or extracellular expression of the fusion protein is enhanced, e.g., by at least 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 20-fold, or 30-fold, in the presence of the expression compound compared to the absence of the expression compound. In some embodiments, when the aggregation domain of the fusion protein is solubilized, the heterologous cleavage site is exposed, resulting in removal of the aggregation domain and, therefore, liberating the second protein domain.

[0008] In any of the above aspects and embodiments, the fusion protein comprises a first protein domain that is or comprises a conditional expression domain, such as a degradation domain or aggregation domain, and a second protein domain that is or comprises a target protein, such as a transmembrane protein (e.g., CAR), wherein the first and second domains of the fusion protein are separated by a heterologous protease cleavage site (e.g., a protease cleavage site that is cleaved by a mammalian intracellular or extracellular protease). In some embodiments, the conditional expression domain, such as the degradation or aggregation domain, is located N-terminal to the second protein domain. In certain embodiments, the fusion protein further comprises a signal peptide N-terminal to the degradation domain.

[0009] In one aspect, the invention relates to a fusion protein comprising two protein domains separated by a heterologous protease cleavage site, wherein a first of the protein domains is a conditional expression domain and a second of the protein domains is a transmembrane protein, wherein the conditional expression domain has a first state associated with a first level of surface and / or extracellular expression of the fusion protein and a second state associated with a second level of surface and / or extracellular expression of the fusion protein, wherein the second level is increased, e.g., by at least 2, 3, 4, 5, 10, 20, or 30-fold relative to the first level in the presence of an expression compound.

[0010] In another aspect, the present invention relates to a fusion protein comprising two protein domains separated by a heterologous protease cleavage site, wherein a first of said protein domains is a conditional expression domain and a second of said protein domains is a transmembrane protein, and wherein said heterologous protease cleavage site is a furin cleavage site, with the proviso that said furin cleavage site does not comprise the amino acid sequence SARNRQKR (SEQ ID NO:981).

[0011] In another aspect, the present invention relates to a fusion protein comprising two protein domains separated by a heterologous protease cleavage site, wherein a first of said protein domains is a conditional expression domain and a second of said protein domains is a chimeric antigen receptor (CAR).

[0012] In some embodiments, the conditional expression domain is a degradation domain.

[0013] In some embodiments, the conditional expression domain is an aggregation domain.

[0014] In some embodiments, the fusion protein comprises two protein domains separated by a heterologous protease cleavage site, wherein a first of said protein domains (also referred to herein as the first protein domain) is or comprises a degradation domain, e.g., a degradation domain as described herein, and a second of said protein domains (also referred to herein as the second protein domain) is a protein of interest. In one embodiment, the protein of interest is a transmembrane protein, e.g., a CAR.

[0015] In some embodiments, the degradation domain is selected from an estrogen receptor (ER) domain, an FKB protein (FKBP) domain, or a dihydrofolate reductase (DHFR).

[0016] In some embodiments, the degradation domain has a first state associated with a first level of surface and / or extracellular expression of the fusion protein and a second state associated with a second level of surface and / or extracellular expression of the fusion protein, the second level being increased, e.g., by at least 2, 3, 4, 5, 10, 20, or 30 fold relative to the first level in the presence of a stabilizing compound.

[0017] In certain embodiments, the degradation domain is derived from estrogen receptor.For example, the degradation domain can comprise an amino acid sequence selected from SEQ ID NO:58 or a sequence having at least 90%, 95%, 97%, 98% or 99% identity thereto, or SEQ ID NO:121 or a sequence having at least 90%, 95%, 97%, 98% or 99% identity thereto.In some embodiments, the degradation domain comprises an amino acid sequence selected from SEQ ID NO:58 or SEQ ID NO:121.When the degradation domain is derived from estrogen receptor, the stabilizing compound can be selected from bazedoxifene or 4-hydroxytamoxifen (4-OHT).In some embodiments, the stabilizing compound is bazedoxifene.Tamoxifen and bazedoxifene are FDA-approved drugs and therefore safe for human use.

[0018] In certain embodiments, the degradation domain is derived from an FKB protein (FKBP). For example, the degradation domain can comprise the amino acid sequence of SEQ ID NO: 56, or a sequence having at least 90%, 95%, 97%, 98%, or 99% identity thereto. In some embodiments, the degradation domain comprises SEQ ID NO: 56. When the degradation domain is derived from an FKBP, the stabilizing compound can be Shield-1.

[0019] In some embodiments, the degradation domain is derived from dihydrofolate reductase (DHFR). In some embodiments, the degradation domain comprises an amino acid sequence selected from SEQ ID NO: 57, or a sequence having at least 90%, 95%, 97%, 98%, or 99% identity thereto. In some embodiments, the degradation domain comprises SEQ ID NO: 57. When the degradation domain is derived from DHFR, the stabilizing compound can be trimethoprim.

[0020] In other embodiments, the degradation domain is not derived from an FKB protein or an estrogen receptor.

[0021] In some embodiments, the fusion protein comprises two protein domains separated by a heterologous protease cleavage site, wherein a first of said protein domains (also referred to herein as the first protein domain) is or comprises an aggregation domain, e.g., an aggregation domain as described herein, and a second of said protein domains (also referred to herein as the second protein domain) is a protein of interest. In one embodiment, the protein of interest is a transmembrane protein, e.g., a CAR.

[0022] In some embodiments, the fusion protein comprises two protein domains separated by a heterologous protease cleavage site, wherein a first of the protein domains is an aggregation domain and a second of the protein domains is a transmembrane protein, and wherein the aggregation domain has a first state associated with a first level of surface and / or extracellular expression of the fusion protein and a second state associated with a second level of surface and / or extracellular expression of the fusion protein, wherein the second level is increased, e.g., by at least 2, 3, 4, 5, 10, 20, or 30-fold relative to the first level in the presence of a disaggregating compound.

[0023] In some embodiments, the fusion protein comprises two protein domains separated by a heterologous protease cleavage site, wherein a first of said protein domains is an aggregation domain and a second of said protein domains is a transmembrane protein, and wherein said heterologous protease cleavage site is a furin cleavage site, with the proviso that said furin cleavage site does not comprise the amino acid sequence SARNRQKR (SEQ ID NO: 981).

[0024] In some embodiments, the fusion protein comprises two protein domains separated by a heterologous protease cleavage site, wherein a first of the protein domains is an aggregation domain and a second of the protein domains is a chimeric antigen receptor (CAR).

[0025] In some embodiments, the aggregation domain comprises 1, 2, 3, 4, 5, 6, 7, 8, or more repeats of a dimerization domain, eg, a homodimerization or heterodimerization domain.

[0026] In some embodiments, the aggregation domain is from an FKB protein (FKBP).

[0027] In some embodiments, the aggregation domain is an FKBP F36M domain.

[0028] In some embodiments, the aggregation domain is from an FKB protein (FKBP) and comprises an amino acid sequence that is at least 90, 95, 97, 98, 99, or 100% identical to either SEQ ID NO:975 or 976.

[0029] In some embodiments, the fusion protein further comprises a second, third, fourth, fifth, sixth, seventh, eighth, ninth, or tenth aggregation domain.

[0030] In some embodiments, the second, third, fourth, fifth, sixth, seventh, eighth, ninth or tenth aggregation domain is the same type of aggregation domain as the first aggregation domain.

[0031] In some embodiments, the aggregation domain forms a homodimer with an identical aggregation domain.

[0032] In some embodiments, the fusion protein comprises a plurality of aggregation domains, said plurality comprising more than one type of aggregation domain, e.g., two types, wherein a first type of aggregation domain forms a heterodimer with a second type of aggregation domain.

[0033] In some embodiments, the fusion protein comprises 2, 4, 6, 8 or 10 aggregation domains, and said fusion protein comprises an equal number of aggregation domains of the first type and aggregation domains of the second type.

[0034] In some embodiments, the aggregation domains are arranged in the fusion protein in an alternating order of first and second types, for example, first, second, first, second, or second, first, second, first.

[0035] In some embodiments, when the fusion protein comprises an aggregation domain derived from an FKB protein (FKBP), such as FKBP F36M, the disaggregating compound is selected from FK506, rapamycin, AP22542, AP21998, and Shield-1.

[0036] In some embodiments, the heterologous cleavage site is cleaved by a mammalian intracellular protease.

[0037] In some embodiments, the cleavage site is cleaved by a protease selected from the group consisting of furin, PCSK1, PCSK5, PCSK6, PCSK7, cathepsin B, granzyme B, factor XA, enterokinase, genenase, sortase, precision protease, thrombin, TEV protease, and elastase 1.

[0038] In some embodiments, the cleavage site comprises a polypeptide having a cleavage motif selected from the group consisting of an RX(K / R)R consensus motif, an RXXX[KR]R consensus motif, an RRX consensus motif, an IEPDX consensus motif (SEQ ID NO: 35), Glu / Asp-Gly-Arg, Asp-Asp-Asp-Asp-Lys (SEQ ID NO: 36), Pro-Gly-Ala-Ala-His-Tyr (SEQ ID NO: 37), an LPXTG / A consensus motif, Leu-Glu-Val-Phe-Gln-Gly-Pro (SEQ ID NO: 38), Leu-Val-Pro-Arg-Gly-Ser (SEQ ID NO: 40), ENLYFQG (SEQ ID NO: 41), and [AGSV]-x (SEQ ID NO: 42).

[0039] In some embodiments, the cleavage site is cleaved by furin.

[0040] In some embodiments, the fusion protein comprises a furin cleavage site selected from RTKR (SEQ ID NO: 123), GTGAEDPRPSRKRRSLGDVG (SEQ ID NO: 125), GTGAEDPRPSRKRR (SEQ ID NO: 127), LQWLEQQVAKRRTKR (SEQ ID NO: 129), GTGAEDPRPSRKRRSLGG (SEQ ID NO: 131), GTGAEDPRPSRKRRSLG (SEQ ID NO: 133), SLNLTESHNSRKKR (SEQ ID NO: 135), or CKINGYPKRGRKRR (SEQ ID NO: 137).

[0041] In some embodiments, the fusion protein comprises a furin cleavage site selected from GTGAEDPRPSRKRRSLGDVG (SEQ ID NO: 125), or GTGAEDPRPSRKRR (SEQ ID NO: 127).

[0042] In some embodiments, the fusion protein comprises a furin cleavage site of GTGAEDPRPSRKRRSLGDVG (SEQ ID NO: 125).

[0043] In some embodiments, the heterologous protease cleavage site is cleaved by a mammalian extracellular protease.

[0044] In some embodiments, the mammalian extracellular protease is selected from the group consisting of factor XA, enterokinase, genenase, sortase, precision protease, thrombin, TEV protease, and elastase-1.

[0045] In some embodiments, the cleavage site comprises a polypeptide having an amino acid sequence selected from the group consisting of Glu / Asp-Gly-Arg, Asp-Asp-Asp-Asp-Lys (SEQ ID NO: 36), Pro-Gly-Ala-Ala-His-Tyr (SEQ ID NO: 37), LPXTG / A consensus motif, Leu-Glu-Val-Phe-Gln-Gly-Pro (SEQ ID NO: 38), Leu-Val-Pro-Arg-Gly-Ser (SEQ ID NO: 40), ENLYFQG (SEQ ID NO: 41), and [AGSV]-x (SEQ ID NO: 42).

[0046] In any of the above aspects and embodiments, the heterologous cleavage site is cleaved by furin, PCSK1, PCSK5, PCSK6, PCSK7, cathepsin B, granzyme B, factor XA, enterokinase, genenase, sortase, precision protease, thrombin, TEV protease, or elastase 1. For example, the protease cleavage site may comprise a polypeptide having a cleavage motif selected from the RX(K / R)R consensus motif, the RXXX[KR]R consensus motif, the RRX consensus motif, the IEPDX consensus motif (SEQ ID NO: 35), Glu / Asp-Gly-Arg, Asp-Asp-Asp-Asp-Lys (SEQ ID NO: 36), Pro-Gly-Ala-Ala-His-Tyr (SEQ ID NO: 37), the LPXTG / A consensus motif, Leu-Glu-Val-Phe-Gln-Gly-Pro (SEQ ID NO: 38), Leu-Val-Pro-Arg-Gly-Ser (SEQ ID NO: 40), ENLYFQG (SEQ ID NO: 41), or [AGSV]-x (SEQ ID NO: 42). In certain embodiments, the mammalian extracellular protease is selected from Factor XA, enterokinase, genenase, sortase, precision protease, thrombin, TEV protease, or elastase 1 (e.g., the cleavage site may include a polypeptide having an amino acid sequence selected from Glu / Asp-Gly-Arg, Asp-Asp-Asp-Asp-Lys (SEQ ID NO: 36), Pro-Gly-Ala-Ala-His-Tyr (SEQ ID NO: 37), the LPXTG / A consensus motif, Leu-Glu-Val-Phe-Gln-Gly-Pro (SEQ ID NO: 38), Leu-Val-Pro-Arg-Gly-Ser (SEQ ID NO: 40), ENLYFQG (SEQ ID NO: 41), or [AGSV]-x (SEQ ID NO: 42)).

[0047] In some embodiments, the fusion proteins described herein include a furin cleavage site. In some embodiments, the fusion proteins described herein include any one of the furin cleavage sites listed in Table 20. In some embodiments, the fusion proteins described herein include a furin cleavage site selected from the group consisting of RTKR (SEQ ID NO: 123) or a sequence having at least 90%, 95%, 97%, 98%, or 99% identity thereof, GTGAEDPRPSRKRRSLGDVG (SEQ ID NO: 125) or a sequence having at least 90%, 95%, 97%, 98%, or 99% identity thereof, GTGAEDPRPSRKRR (SEQ ID NO: 127) or a sequence having at least 90%, 95%, 97%, 98%, or 99% identity thereof, LQWLEQQVAKRRTKR (SEQ ID NO: 129) or a sequence having at least 90%, 95%, 97%, 98%, or 99% identity thereof, GT and a furin cleavage site selected from: GAEDPRPSRKRRSLGG (SEQ ID NO: 131) or a sequence having at least 90%, 95%, 97%, 98% or 99% identity thereto; GTGAEDPRPSRKRRSLG (SEQ ID NO: 133) or a sequence having at least 90%, 95%, 97%, 98% or 99% identity thereto; SLNLTESHNSRKKR (SEQ ID NO: 135) or a sequence having at least 90%, 95%, 97%, 98% or 99% identity thereto; or CKINGYPKRGRKRR (SEQ ID NO: 137) or a sequence having at least 90%, 95%, 97%, 98% or 99% identity thereto. In some embodiments, the fusion proteins described herein include a furin cleavage site selected from GTGAEDPRPSRKRRSLGDVG (SEQ ID NO: 125) or a sequence having at least 90%, 95%, 97%, 98%, or 99% identity thereto, or GTGAEDPRPSRKRR (SEQ ID NO: 127) or a sequence having at least 90%, 95%, 97%, 98%, or 99% identity thereto.In some embodiments, the fusion proteins described herein include a furin cleavage site of GTGAEDPRPSRKRRSLGDVG (SEQ ID NO: 125) or a sequence having at least 90%, 95%, 97%, 98%, or 99% identity thereto.

[0048] In some embodiments, the fusion proteins described herein include a furin cleavage site selected from RTKR (SEQ ID NO: 123), GTGAEDPRPSRKRRSLGDVG (SEQ ID NO: 125), GTGAEDPRPSRKRR (SEQ ID NO: 127), LQWLEQQVAKRRTKR (SEQ ID NO: 129), GTGAEDPRPSRKRRSLGG (SEQ ID NO: 131), GTGAEDPRPSRKRRSLG (SEQ ID NO: 133), SLNLTESHNSRKKR (SEQ ID NO: 135), or CKINGYPKRGRKRR (SEQ ID NO: 137). In some embodiments, the fusion proteins described herein include a furin cleavage site selected from GTGAEDPRPSRKRRSLGDVG (SEQ ID NO: 125) or GTGAEDPRPSRKRR (SEQ ID NO: 127). In some embodiments, the fusion proteins described herein include a furin cleavage site of GTGAEDPRPSRKRRSLGDVG (SEQ ID NO: 125).

[0049] In some embodiments, the conditional expression domain, eg, an aggregation domain or a degradation domain, is located N-terminal to the second protein domain or C-terminal to the second protein domain.

[0050] In some embodiments, the fusion protein further comprises a signal peptide N-terminal to the conditional expression domain, e.g., the aggregation domain or the degradation domain. In some embodiments, the fusion protein further comprises a linker positioned between the signal peptide and the conditional expression domain, e.g., the aggregation domain or the degradation domain. In some embodiments, the linker is the linker in any of the fusion proteins listed in Tables 23 and 24.

[0051] In some embodiments, the fusion protein comprises the amino acid sequence of any fusion protein listed in Tables 22, 23, or 24.

[0052] In any of the above aspects and embodiments, the second of the protein domains is a transmembrane protein (e.g., a transmembrane receptor). In any of the above aspects, the transmembrane receptor can be, for example, a synthetic protein (e.g., a chimeric antigen receptor). A chimeric antigen receptor can include, for example, from N- to C-terminus, an antigen-binding domain, a transmembrane domain, and one or more intracellular signaling domains. The signaling domain may include one or more primary signaling domains (e.g., a CD3-zeta stimulatory domain) and, optionally, one or more costimulatory signaling domains (e.g., an intracellular domain from a costimulatory protein selected from CD27, CD28, 4-1BB (CD137), OX40, GITR, CD30, CD40, ICOS, BAFFR, HVEM, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD2, CDS, CD7, CD287, LIGHT, NKG2C, NKG2D, SLAMF7, NKp80, NKp30, NKp44, NKp46, CD160, B7-H3, or a ligand that specifically binds to CD83).

[0053] In some of the above embodiments, the antigen-binding domain is an scFv. Also, the antigen-binding domain can bind to an antigen selected from the following: CD19; CD123; CD22; CD30; CD171; CS-1; C-type lectin-like molecule-1, CD33; epidermal growth factor receptor variant III (EGFRvIII); ganglioside G2 (GD2); ganglioside GD3; TNF receptor family member B-cell mutated (BCMA); Tn antigen [(Tn Ag) or (GalNAcα-Ser / Thr)]; prostate-specific membrane antigen (PSMA); receptor tyrosine kinase-like orphan receptor 1 (ROR1); Fms-like tyrosine kinase 3 (FLT3); tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6; carcinoembryonic antigen (CEA); epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); interleukin-13 receptor subunit alpha-2; mesothelin; interleukin-11 receptor alpha (IL-11Ra); prostate stem cell antigen (PSCA); prostatic serine 21; vascular endothelial growth factor receptor 2 (VEGFR2); Lewis (Y) antigen; CD24; platelet-derived growth factor receptor beta (PDGFR-beta); stage-specific embryonic antigen-4 (SSEA-4); CD20; folate receptor alpha; receptor tyrosine protein kinase ERBB2 (Her2 / neu); cell surface association Mucin 1 (MUC1); epidermal growth factor receptor (EGFR); neural cell adhesion molecule (NCAM); prostase; prostatic acid phosphatase (PAP); elongation factor 2 mutated (ELF2M); ephrin B2; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (IGF-I receptor), carbonic anhydrase IX (CAIX); proteasome (prosome, macropain) subunit, beta, 9 (LMP2); glycoprotein 100 (gp100); oncogene fusion protein (bcr-abl) encompassing the breakpoint cluster region (BCR) and Abelson murine leukemia viral oncogene homolog 1 (Abl); tyrosinase; ephrin type A receptor 2 (EphA2); fucosyl-GM1; sialyl-Lewis adhesion molecule (sLe); ganglioside GM3; transglutaminase 5 (TGS5); high molecular weight melanoma-associated antigen (HMWMAA);o-Acetyl-GD2 ganglioside (OAcGD2); folate receptor beta; tumor endothelial marker 1 (TEM1 / CD248); tumor endothelial marker 7-related (TEM7R); claudin 6 (CLDN6); thyroid-stimulating hormone receptor (TSHR); G protein-coupled receptor class C group 5, member D (GPRC5D); X chromosome open reading frame 61 (CXORF61); CD97; CD179a; anaplastic lymphoma kinase (ALK); polysialic acid; placenta-specific 1 (PLAC1); hexasaccharide moiety of globo-H glycoceramide (GloboH); mammary differentiation antigen (NY-BR-1); uroplakin 2 (UPK2); hepatitis A virus cellular receptor 1 (HAVCR1); adrenergic receptor beta 3 (ADRB3); pannexin 3 (PANX3); G protein-coupled receptor 20 (GPR20); lymphocyte antigen 6 complex, locus K 9 (LY6K); olfactory receptor 51E2 (OR51E2); TCR gamma alternative reading frame protein (TARP); Wilms tumor protein (WT1); cancer / testis antigen 1 (NY-ESO-1); cancer / testis antigen 2 (LAGE-1a); melanoma-associated antigen 1 (MAGE-A1); ETS translocation variant gene 6 located on chromosome 12p (ETV6-AML); sperm protein 17 (SPA17); X antigen family, member 1A (XAGE1); angiopoietin-binding cell surface receptor 2 (Tie 2); melanoma cancer testis antigen-1 (MAD-CT-1); melanoma cancer testis antigen-2 (MAD-CT-2); Fos-related antigen 1; tumor protein p53 (p53); p53 mutant; prostein; survivin; telomerase; prostate cancer tumor antigen-1, melanoma antigen 1 recognized by T cells; rat sarcoma (Ras) mutant; human telomerase reverse transcriptase (hTERT); sarcoma translocation breakpoint; melanoma inhibitor of apoptosis (ML-IAP); ERG [transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene]; N-acetylglucosaminyltransferase V (NA17); paired box protein Pax-3 (PAX3); androgen receptor; cyclin B1; v-myc avian myelocytic viral oncogene neuroblastoma-derived homolog (MYCN);Ras homolog family member C (RhoC); tyrosinase-related protein 2 (TRP-2); cytochrome P450 1B1 (CYP1B1); CCCTC-binding factor (zinc finger protein)-like, squamous cell carcinoma antigen 3 recognized by T cells (SART3); paired box protein Pax-5 (PAX5); proacrosin-binding protein sp32 (OY-TES1); lymphocyte-specific protein tyrosine kinase (LCK); A-kinase anchor protein 4 (AKAP-4); synovial sarcoma, X-chromosome breakpoint 2 (SSX2); receptor for advanced glycation end products (RAGE-1); renal ubiquitous 1 (RU1); renal ubiquitous 2 (RU2); legumain; human papillomavirus E6 (HPV E6); human papillomavirus E7 (HPV E7); intestinal carboxylesterase; heat shock protein 70-2 mutant (mutated) hsp70-2); CD79a; CD79b; CD72; leukocyte-associated immunoglobulin-like receptor 1 (LAIR1); Fc fragment of IgA receptor (FCAR or CD89); leukocyte-associated immunoglobulin-like receptor subfamily A member 2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12 member A (CLEC12A); bone marrow stromal cell antigen 2 (BST2); EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2); lymphocyte antigen 75 (LY75); glypican 3 (GPC3); Fc receptor-like 5 (FCRL5); or immunoglobulin lambda-like polypeptide 1 (IGLL1).

[0054] In some embodiments, the fusion protein comprises an antigen-binding domain that binds to CD19. In some embodiments, the fusion protein comprises an antigen-binding domain comprising an amino acid sequence selected from any one of SEQ ID NOs: 356-368 or 381. In some embodiments, the fusion protein comprises a chimeric antigen receptor comprising an amino acid sequence selected from any one of SEQ ID NOs: 897, 902, 907, 912, 917, 922, 927, 932, 937, 942, 947, 952, and 956.

[0055] In some embodiments, the fusion protein comprises an antigen-binding domain that binds to CD123. In some embodiments, the fusion protein comprises an antigen-binding domain comprising an amino acid sequence selected from any one of SEQ ID NOs: 751, 756, 761, or 766. In some embodiments, the fusion protein comprises a chimeric antigen receptor comprising an amino acid sequence selected from any one of SEQ ID NOs: 750, 755, 760, or 765.

[0056] In some embodiments, the fusion protein comprises an antigen-binding domain that binds to BCMA. In some embodiments, the fusion protein comprises an antigen-binding domain comprising an amino acid sequence selected from any one of SEQ ID NOs: 382, ​​386, 390, 394, 398, 402, 406, 410, 414, 418, 422, 426, 430, 434, 438, 442, 446, 450, 454, 458, 462, 466, 470, 474, 478, 482, 486, 490, 494, 498, 502, 506, 510, 514, 518, 522, 528, 531, 534, or 537. In some embodiments, the fusion protein comprises a chimeric antigen receptor comprising an amino acid sequence selected from any one of SEQ ID NOs: 789, 791, 793, 795, 797, 799, 801, 803, 805, 807, 809, 811, 813, 815, 817, 819, 821, 823, 825, 827, 829, 831, 833, 835, 837, 839, 841, 843, 845, 847, 849, 851, 853, 855, 857, or 859.

[0057] In some embodiments, the fusion protein comprises an antigen-binding domain that binds to CD20. In some embodiments, the fusion protein comprises an antigen-binding domain comprising the amino acid sequence located at positions 470-712 or 470-939 of SEQ ID NO: 3033. In some embodiments, the fusion protein comprises a chimeric antigen receptor comprising the amino acid sequence of SEQ ID NO: 3033.

[0058] Cells, nucleic acids and methods for producing fusion proteins In another aspect, the present invention features a cell, e.g., a host cell, comprising any one of the fusion proteins described above. In some embodiments, the cell, e.g., the host cell, is an immune cell, e.g., an immune effector cell. In some embodiments, the cell is a T cell or an NK cell.

[0059] In yet another aspect, the invention features a nucleic acid (e.g., an mRNA or DNA molecule) encoding any one of the above-described fusion proteins. In another aspect, the invention features a vector (e.g., a viral vector (e.g., a lentiviral vector)) containing such a nucleic acid. The invention also features a viral particle comprising such a viral vector.

[0060] In yet another aspect, the invention features a cell, eg, a host cell (eg, a human T cell), containing any of the vectors, nucleic acids, or fusion proteins described above.

[0061] In certain embodiments, the cell further comprises a protease that can cleave heterologous protease cleavage site.In certain embodiments, the host cell can further comprise a stabilizing compound (for example, bazedoxifene, Shield1 or 1 μM 4-OHT (4-hydroxytamoxifen)), and the degradation domain adopts a conformation that allows intracellular degradation in the absence of the stabilizing compound.

[0062] In some embodiments, in the absence of an expression compound, e.g., a stabilizing compound, the fusion protein is degraded by intracellular degradation pathways, e.g., at least 50%, 60%, 70%, 80%, 90% or more of the fusion protein is degraded.

[0063] In some embodiments, in the absence of an expression compound, e.g., a disaggregating compound, the fusion protein is in an aggregated state within the cell, e.g., in the endoplasmic reticulum or cytosol, e.g., at least 50%, 60%, 70%, 80%, 90% or more aggregated state.

[0064] In some embodiments, the cells further comprise an expression compound, eg, a stabilizing compound.

[0065] In some embodiments, the conditional expression domain, e.g., a degradation domain, adopts a conformation in the presence of an expression compound, e.g., a stabilizing compound, that is more resistant to intracellular degradation compared to the conformation in the absence of the expression compound.

[0066] In some embodiments, the conformation of the fusion protein is more permissive to cleavage at the heterologous protease cleavage site in the presence of an expression compound, e.g., a stabilizing compound, compared to the conformation in the absence of the expression compound.

[0067] In some embodiments, the level of cell surface or extracellular expression of the fusion protein is higher, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, or 30 times higher, than the level of cell surface or extracellular expression of the fusion protein in cells that do not contain an expression compound, e.g., a stabilizing compound.

[0068] In some embodiments, the cells further comprise an expression compound, eg, a disaggregation compound.

[0069] In some embodiments, the conditional expression domain, e.g., the aggregation domain, adopts a conformation in the presence of an expression compound, e.g., a disaggregation compound, that is more resistant to oligomerization or aggregation compared to the conformation in the absence of the expression compound.

[0070] In some embodiments, the conformation of the fusion protein is more permissive to cleavage at the heterologous protease cleavage site in the presence of an expression compound, e.g., a disaggregating compound, compared to the conformation in the absence of the expression compound.

[0071] In some embodiments, the level of cell surface or extracellular expression of the fusion protein is higher, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, or 30 times higher, than the level of cell surface or extracellular expression of the fusion protein in cells that do not contain an expression compound, e.g., a disaggregation compound.

[0072] In yet another aspect, a method of making a fusion protein as described herein is disclosed, the method comprising placing a cell, e.g., a host cell as described herein, under conditions suitable for expression, e.g., a host cell containing any of the vectors, nucleic acids, or fusion proteins described above.

[0073] In another aspect, the invention features a method for conditionally expressing a protein of interest. In one embodiment, the protein of interest is a transmembrane protein, such as CAR.

[0074] In some embodiments, the invention also features a method for conditionally expressing a protein of interest, a transmembrane protein, or a CAR on the surface of a cell (e.g., an immune cell, e.g., a host cell), the method comprising: providing a cell, e.g., an immune cell (e.g., a host cell), that contains a fusion protein (e.g., any of the fusion proteins described herein) or that contains a nucleic acid encoding said fusion protein; contacting the fusion protein, or a cell containing said fusion protein, with an expression compound; It encompasses (a) in the presence of the expression compound, surface expression of the protein, transmembrane protein, or CAR of interest is increased compared to a reference value, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, or 30 times higher, e.g., compared to the level of surface expression of the protein, transmembrane protein, or CAR of interest in the absence of the expression compound; and (b) in the absence of the expression compound, surface expression of the protein of interest, transmembrane protein, or CAR is substantially reduced, e.g., 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 20-, or 30-fold, compared to a reference value, e.g., compared to the level of surface expression of the protein of interest, transmembrane protein, or CAR in the presence of the expression compound.

[0075] In some embodiments, the presence of the expression compound is associated with, e.g., causes, a conformational change of the conditionally expressed domain from a first folding state to a second folding state, wherein the first folding state is more susceptible to degradation, e.g., intracellular degradation, or aggregation, compared to the second folding state.

[0076] In some embodiments, the presence of the expressed compound exposes a heterologous protease cleavage site to a greater extent, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, or 30 times greater, compared to the exposure of the protease cleavage site in the absence of the expressed compound.

[0077] In some embodiments, the invention provides a method for conditionally expressing a protein of interest, a transmembrane protein, or a CAR, comprising contacting a cell, e.g., a host cell described herein, and / or a cell, with a stabilizing compound; (a) in the presence of the stabilizing compound, (i) the degradation domain adopts a conformation that is more resistant to intracellular degradation compared to its conformation in the absence of the stabilizing compound; thereby cleaving the degradation domain from the protein of interest, transmembrane protein, or CAR and resulting in expression of the protein of interest, transmembrane protein, or CAR; and (b) in the absence of the stabilizing compound, the degradation domain adopts a conformation that is more permissive for intracellular degradation compared to its conformation in the presence of the stabilizing compound, thereby resulting in degradation of the protein of interest, transmembrane protein, or CAR; The method is also featured.

[0078] In some embodiments, the cells are contacted with the stabilizing compound ex vivo.

[0079] In some embodiments, the cells are contacted with the stabilizing compound in vivo.

[0080] In some embodiments, the invention provides a method for conditionally expressing a protein of interest, a transmembrane protein, or a CAR, comprising contacting a cell, e.g., a host cell and / or a cell described herein, with a disaggregating compound; (a) in the presence of the disaggregating compound, (i) the aggregation domain adopts a conformation that is more resistant to aggregation or oligomerization compared to its conformation in the absence of the disaggregating compound; This results in cleavage of the aggregation domain from the protein of interest, transmembrane protein, or CAR, and expression of the protein of interest, transmembrane protein, or CAR; and (b) in the absence of the disaggregating compound, the aggregation domain adopts a conformation that is more permissive to aggregation or oligomerization compared to its conformation in the presence of the disaggregating compound, thereby causing the protein of interest, transmembrane protein, or CAR to aggregate; The method is also featured.

[0081] In some embodiments, the cells are contacted with the disaggregating compound ex vivo.

[0082] In some embodiments, the cells are contacted with the disaggregating compound in vivo.

[0083] In yet another aspect, the invention features a method of treating a subject having a disease associated with expression of a tumor antigen, comprising administering to the subject an effective amount of any of the host cells described above, wherein the second protein is a chimeric antigen receptor and comprises, from N- to C-terminus, an antigen-binding domain, a transmembrane domain, and one or more intracellular signaling domains, wherein the antigen-binding domain specifically binds to the tumor antigen. In yet another aspect, the invention features a method of treating an autoantibody or alloantibody disease or condition, comprising administering to the subject an effective amount of the host cells described above, wherein the second protein is a chimeric antigen receptor and comprises, from N- to C-terminus, an antigen-binding domain, a transmembrane domain, and one or more intracellular signaling domains, wherein the antigen-binding domain specifically binds to an antigen specific to the autoantibody or alloantibody disease. In such methods, the host cells may be autologous to the subject or non-autologous, e.g., allogeneic. Such methods can further comprise contacting the host cells in vivo or ex vivo with the stabilizing compound described above.

[0084] In some embodiments, the cells are contacted with an expression compound; (a) in the presence of the expression compound, (i) the conditional expression domain adopts a conformation that is more resistant to intracellular degradation or aggregation compared to its conformation in the absence of the expression compound, thereby cleaving the conditional expression domain from the chimeric antigen receptor (CAR) and expressing the CAR; and (b) in the absence of the expression compound, the conditional expression domain adopts a conformation that is more permissive for intracellular degradation or aggregation compared to its conformation in the presence of the expression compound, thereby resulting in degradation or aggregation of the fusion protein.

[0085] In some embodiments, a cell, e.g., a host cell, is contacted with a stabilizing compound; (a) in the presence of the stabilizing compound, (i) the degradation domain adopts a conformation that is more resistant to intracellular degradation compared to its conformation in the absence of the stabilizing compound; This results in cleavage of the degradation domain from the chimeric antigen receptor (CAR) and expression of the CAR; and (b) in the absence of the stabilizing compound, the degradation domain adopts a conformation that is more permissive for intracellular degradation compared to the conformation in the presence of the stabilizing compound, thereby resulting in degradation of the fusion protein.

[0086] In some embodiments, when the fusion protein comprises a degradation domain from an estrogen receptor, the stabilizing compound is selected from bazedoxifene or 4-hydroxytamoxifen (4-OHT).

[0087] In some embodiments, when the fusion protein comprises a degradation domain from an FKB protein, the stabilizing compound is Shield-1.

[0088] In some embodiments, the cells are contacted with a disaggregating compound; (a) in the presence of the disaggregating compound, (i) the aggregation domain adopts a conformation that is more resistant to aggregation or oligomerization compared to its conformation in the absence of the disaggregating compound; This results in cleavage of the aggregation domain from the chimeric antigen receptor (CAR) and expression of the CAR; and (b) in the absence of the disaggregating compound, the aggregation domain adopts a conformation that is more permissive to aggregation or oligomerization compared to the conformation in the presence of the disaggregating compound, thereby causing the fusion protein to aggregate.

[0089] In some embodiments, when the fusion protein comprises an aggregation domain derived from an FKB protein (FKBP), such as FKBP F36M, the disaggregating compound is selected from FK506, rapamycin, AP22542, and AP21998.

[0090] In some embodiments, the autoantibody disease or condition is selected from the group consisting of bullous pemphigoid; epidermolysis bullosa acquisita; p200 pemphigoid; linear IgA bullous dermatosis; other pemphigoid group diseases; dermatitis herpetiformis; celiac disease; myasthenia gravis; Goodpasture's syndrome; granulomatosis with polyangiitis and other ANCA+ vasculitides; autoimmune limbic encephalitis; anti-N-methyl-D-aspartate receptor encephalopathy; neuromyelitis optica; autoimmune hemolytic anemia; autoantibody-associated end organ damage in lupus and other connective tissue diseases (due to anti-dsDNA, anti-Ro and other autoantibodies); Graves' and Hashimoto's thyroiditis; anti-insulin antibodies in diabetes; and autoimmune hypoglycemia. The alloantibody disease or condition is selected from the group consisting of anti-insulin receptor antibodies, cryoglobulinemia, rheumatoid arthritis, multiple sclerosis, Sjogren's syndrome, dermatomyositis, anti-Fc-epsilon receptor antibodies in chronic idiopathic urticaria, anti-folate receptor antibodies, anti-endothelial receptor or anti-adrenergic receptor antibodies in pulmonary arterial hypertension, refractory hypertension, dilated cardiomyopathy, autoinflammatory syndromes, neuromyelitis optica, Goodpasture's syndrome, anti-NMDAR encephalitis: AIHA, ITP, TTP, Graves' / Hashimoto's disease, primary biliary cirrhosis, neonatal lupus, maternal autoantibodies inducing T cell destruction, pulmonary alveolar proteinosis, anti-folate receptors, chronic inflammatory demyelinating polyneuropathy, and idiopathic membranous nephropathy. In some embodiments, the alloantibody disease or condition is an immune response in response to organ transplantation, blood transfusion, pregnancy, or protein replacement therapy.

[0091] In some embodiments, the cancer is mesothelioma (e.g., malignant pleural mesothelioma), e.g., in a subject that has progressed on at least one prior standard of care therapy, lung cancer (e.g., non-small cell lung cancer, small cell lung cancer, squamous cell lung carcinoma, or large cell lung carcinoma), pancreatic cancer (e.g., pancreatic ductal adenocarcinoma or metastatic pancreatic ductal adenocarcinoma (PDA), e.g., in a subject that has progressed on at least one prior standard of care therapy), esophageal adenocarcinoma, ovarian cancer (e.g., serous epithelial ovarian cancer, e.g., in a subject that has progressed after at least one prior standard of care regimen), breast cancer, colorectal cancer, bladder cancer, or any combination thereof.

[0092] In some embodiments, the disease associated with tumor antigen expression is cancer.

[0093] In some embodiments, the disease associated with tumor antigen expression is a hematological cancer, e.g., a hematological cancer selected from leukemia or lymphoma.

[0094] In some embodiments, the cancer is chronic lymphocytic leukemia (CLL), mantle cell lymphoma (MCL), multiple myeloma, acute lymphoblastic leukemia (ALL), Hodgkin's lymphoma, B-cell acute lymphoblastic leukemia (BALL), T-cell acute lymphoblastic leukemia (TALL), small lymphocytic leukemia (SLL), B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt's lymphoma. , diffuse large B-cell lymphoma (DLBCL), DLBCL associated with chronic inflammation, chronic myeloid leukemia, myeloproliferative neoplasms, follicular lymphoma, childhood follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative conditions, MALT lymphoma (mucosa-associated lymphoid tissue-type extranodal marginal zone lymphoma), marginal zone lymphoma, myelodysplasia and myelodysplastic syndromes group, non-Hodgkin's lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom's macroglobulinemia, splenic marginal zone lymphoma, splenic lymphoma / splenic leukemia, diffuse red pulp small B-cell lymphoma, hairy cell leukemia-variant, lymphoplasmacytic lymphoma, heavy chain disease, plasma cell myeloma, isolated plasmacytoma of bone, extraskeletal plasmacytoma, nodal marginal zone lymphoma, pediatric nodal Selected from marginal zone lymphoma, primary cutaneous follicle center lymphoma, lymphomatoid granulomatosis, primary mediastinal (thymic) large B-cell lymphoma, intravascular large B-cell lymphoma, ALK+ large B-cell lymphoma, large B-cell lymphoma arising in HHV8-associated multicentric Castleman disease, primary effusion lymphoma, B-cell lymphoma, acute myeloid leukemia (AML), or unclassifiable lymphoma.

[0095] In some embodiments, the cancer is selected from MCL, CLL, ALL, Hodgkin's lymphoma, AML, or multiple myeloma.

[0096] In yet another aspect, the invention features a fusion protein, cell, nucleic acid, viral particle, or vector described herein for use as a medicament.

[0097] In yet another aspect, the invention features a fusion protein, cell, nucleic acid, vector, or method described herein for use in treating a disease that expresses a tumor antigen.

[0098] Methods and compositions for use in treating autoantibody or alloantibody diseases In one aspect, the invention features a method of treating an autoantibody or alloantibody disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a pharmaceutical composition comprising modified T cells, wherein the modified T cells comprise a suicide gene and a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an anti-B cell binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain. In another aspect, the invention features a method of treating an autoantibody or alloantibody disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a pharmaceutical composition comprising modified T cells, wherein the modified T cells comprise a nucleic acid encoding a chimeric antigen receptor (CAR) comprising a dimerization domain and an anti-B cell binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain.

[0099] In some embodiments, the suicide gene encodes an amino acid sequence selected from the group consisting of SEQ ID NOs: 3005-3007.

[0100] In some embodiments, the suicide gene further comprises a dimerization domain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 3013 and 3014.

[0101] In some embodiments, the dimerization domain comprises the amino acid sequence of SEQ ID NO:980.

[0102] In some embodiments, the dimerization domain further comprises a furin cleavage site comprising the amino acid sequence of SEQ ID NO:980.

[0103] In some embodiments, the CAR further comprises a signal peptide.

[0104] In some embodiments, the signal peptide comprises the amino acid sequence of SEQ ID NO:3035.

[0105] In some embodiments, administering an effective amount comprises activating the modified T cells to perform a cytotoxic function against B cells.

[0106] In some embodiments, the method further comprises activating a suicide gene product of the suicide gene to induce cell death of the modified T cell.

[0107] In some embodiments, activating the suicide gene product further comprises administering a dimerizing agent to promote dimerization of the suicide gene product.

[0108] In some embodiments, activating the suicide gene product occurs after the modified T cell exerts its cytotoxic function against a B cell.

[0109] In some embodiments, activating the suicide gene product occurs after the initiation of an adverse reaction to the engineered T cells in the subject.

[0110] In some embodiments, the method further comprises inhibiting activation of a suicide gene product of the suicide gene to inhibit cell death of the modified T cell.

[0111] In some embodiments, inhibiting activation of the suicide gene product further comprises administering a solubilizing agent to prevent dimerization of the suicide gene product.

[0112] In some embodiments, administration of the solubilizing agent is simultaneous with administration of the modified T cells and continues while the modified T cells exert their cytotoxic function against B cells.

[0113] In some embodiments, administering the solubilizing agent is discontinued after the onset of an adverse reaction to the engineered T cells in the subject.

[0114] In some embodiments, the anti-B cell binding domain of the CAR comprises an antibody selected from the group consisting of a monoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a single domain antibody, a single-chain variable fragment, and an antigen-binding fragment thereof.

[0115] In some embodiments, the anti-B cell binding domain of the CAR specifically binds to a B cell marker selected from the group consisting of CD19, BCMA, CD20, CD21, CD27, CD38, CD138, and any combination thereof.

[0116] In some embodiments, the anti-B cell binding domain of the CAR specifically binds to a B cell marker selected from the group consisting of CD20, CD21, CD27, CD38, CD138, any combination thereof, and at least one surface marker selectively found on pro-B cells, pre-B cells, immature B cells, mature B cells, memory B cells, and plasma cells.

[0117] In some embodiments, the intracellular domain of the CAR comprises dual signaling domains.

[0118] In some embodiments, the costimulatory domain is selected from the group consisting of CD3, CD27, CD28, CD83, CD86, CD127, 4-1BB, 4-1BBL, PD1, PD1L, a T cell receptor (TCR), any derivative or variant thereof, any synthetic sequence thereof having the same functional capability, and any combination thereof.

[0119] In some embodiments, the method further comprises administering a solubilizing agent to prevent dimerization of the CAR.

[0120] In some embodiments, administration of the solubilizing agent is simultaneous with administration of the modified T cells and continues while the modified T cells exert their cytotoxic function against B cells.

[0121] In some embodiments, administering the solubilizing agent is discontinued after the onset of an adverse reaction to the engineered T cells in the subject.

[0122] In some embodiments, the autoantibody disease or condition is selected from the group consisting of bullous pemphigoid; epidermolysis bullosa acquisita; p200 pemphigoid; linear IgA bullous dermatosis; other pemphigoid group diseases; dermatitis herpetiformis; celiac disease; myasthenia gravis; Goodpasture's syndrome; granulomatosis with polyangiitis and other ANCA+ vasculitides; autoimmune limbic encephalitis; anti-N-methyl-D-aspartate receptor encephalopathy; neuromyelitis optica; autoimmune hemolytic anemia; autoantibody-associated end organ damage (anti-dsDNA, anti-Ro and other autoantibodies); Graves' and Hashimoto's thyroiditis; anti-insulin antibodies in diabetes; anti-insulin receptor antibodies in autoimmune hypoglycemia; cryoglobulinemia; rheumatoid arthritis; multiple sclerosis; Sjogren's syndrome; dermatomyositis; anti-Fc-epsilon receptor antibodies in chronic idiopathic urticaria; anti-folate receptor antibodies, anti-endothelial receptor or anti-adrenergic receptor antibodies in pulmonary arterial hypertension; refractory hypertension; dilated cardiomyopathy; and autoinflammatory syndromes.

[0123] In some embodiments, the alloantibody disease or condition is an immune response in response to organ transplantation, blood transfusion, pregnancy, and protein replacement therapy.

[0124] In some embodiments, the modified T cells are further modified by deleting a gene selected from the group consisting of a T cell receptor (TCR) chain, a major histocompatibility complex protein, and any combination thereof.

[0125] In some embodiments, the modified T cells are further modified prior to administration to a subject in need thereof.

[0126] In some embodiments, the modified T cells are further modified by inducing a CRISPR / Cas system.

[0127] In one aspect, the invention features a pharmaceutical composition formulated for use in the methods described herein, the pharmaceutical composition comprising an engineered T cell comprising a nucleic acid encoding a suicide gene and a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an anti-B cell binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain.

[0128] In one aspect, the invention features a pharmaceutical composition formulated for use in the methods described herein, the pharmaceutical composition comprising an engineered T cell comprising a nucleic acid encoding a dimerization domain and a chimeric antigen receptor (CAR) comprising an anti-B cell binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain.

[0129] In some embodiments, the suicide gene encodes an amino acid sequence selected from the group consisting of SEQ ID NOs: 3005-3007.

[0130] In some embodiments, the suicide gene further comprises a dimerization domain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 3013 and 3014.

[0131] In some embodiments, the dimerization domain comprises the amino acid sequence of SEQ ID NO:980.

[0132] In some embodiments, the dimerization domain further comprises a furin cleavage site comprising the amino acid sequence of SEQ ID NO:980.

[0133] In some embodiments, the CAR further comprises a signal peptide.

[0134] In some embodiments, the signal peptide comprises the amino acid sequence of SEQ ID NO:3035.

[0135] In some embodiments, the composition further comprises an inducer for inducing activation of the suicide gene.

[0136] In some embodiments, the modified T cells lack at least one gene encoding a T cell receptor (TCR) chain and a major histocompatibility complex protein.

[0137] In one aspect, the invention features an isolated nucleic acid sequence comprising a nucleic acid sequence comprising: (i) a suicide gene comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 3001-3004; and (ii) a nucleic acid sequence encoding a chimeric antigen receptor (CAR) comprising an anti-B cell binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain.

[0138] In some embodiments, the isolated nucleic acid sequence comprises SEQ ID NO: 3018, 3020, 3024, 3026, 3028 or 3030.

[0139] In one aspect, the invention features an isolated polypeptide comprising: (i) an amino acid sequence encoded by a suicide gene, the amino acid sequence being selected from the group consisting of SEQ ID NOs: 3005-3007; and (ii) a chimeric antigen receptor (CAR) comprising an anti-B cell binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain.

[0140] In some embodiments, the isolated polypeptide comprises the amino acid sequence of SEQ ID NO: 3019, 3021, 3026, 3028, 3030, or 3034.

[0141] In one aspect, the invention features an isolated nucleic acid sequence comprising: (i) a nucleic acid encoding a dimerization domain; and (ii) a chimeric antigen receptor (CAR) comprising an anti-B cell binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain.

[0142] In some embodiments, the dimerization domain comprises the amino acid sequence of SEQ ID NO:980.

[0143] In some embodiments, the isolated nucleic acid sequence comprises SEQ ID NO: 977 or 3032.

[0144] In one aspect, the invention features an isolated polypeptide comprising: (i) a dimerization domain; and (ii) a chimeric antigen receptor (CAR) comprising an anti-B cell binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain.

[0145] In some embodiments, the isolated polypeptide comprises the amino acid sequence of SEQ ID NO: 978 or 3033. [Brief explanation of the drawings]

[0146] [Figure 1] Figure 1 is a graph showing the expression of PCSK (proprotein convertase) family members in primary human T cells. Expression of PCSK family members was measured by qRT-PCR. RNA was collected from normal donor T cells on days 0, 4, and 11 after stimulation with anti-CD3 / anti-CD28 activating beads. An additional group was supplemented with 100 U / mL IL-2 during culture, and RNA was collected on day 11. [Figure 2] Figure 2 is a series of graphs showing compound-dependent CAR expression in Jurkat T cells transduced with anti-CD19 scFv CAR constructs (FKBPFD, ERαFD, or DHFRFD) fused to the indicated furin degradation domains and subsequently treated with the corresponding stabilizing compounds. Transduced cells treated with Shield1 at 1 μM FKBPFD; bazedoxifene at 1 μM ERαFD; and trimethoprim (TMP) at 1 mM DHFRFD. Anti-CD19 scFv expression can be induced by the stabilizing compounds. Black = UTD (untransduced cells); gray = constructs without compound treatment; white = constructs treated with compound. [Figure 3]Figure 3 is a graph showing the kinetics of CAR expression in Jurkat cells transduced with anti-CD19 scFv CAR constructs (FKBPFD or ERαFD) fused to the indicated furin degradation domains followed by the addition of stabilizing compounds. FKBPFD-transduced cells were treated with 1 μM Shield1, and ERαFD-transduced cells were treated with 1 μM 4-OHT (4-hydroxytamoxifen) for the indicated times, and CAR expression was determined by FACS. [Figure 4] Figure 4 is a series of histograms showing that the furin degron domain ERαFD can regulate CAR19 expression in primary human T cells in a bazedoxifene-dependent manner, and that stabilization is enhanced in vitro in the presence of IL-2. Primary human T cells were transduced with the ERαFD domain fused to an anti-CD19 scFv CAR construct. 100 U / mL of IL-2 was added on day 9 after activation with anti-CD3 / CD28 stimulatory beads. Bazedoxifene was added on day 10, and CAR expression was determined by FACS on day 11. [Figure 5] Figure 5 is a pair of graphs showing the kinetics of CAR expression after compound washout in primary T cells transduced with a CAR construct fused to a furin-degrading domain. Primary human T cells were transduced with the indicated furin-degrading domain (FKBPFD or ERαFD) fused to an anti-CD19 scFv CAR construct. 100 U / mL IL-2 was added on day 9 after activation with anti-CD3 / CD28 stimulatory beads. Bazedoxifene was added on day 10, and T cells were frozen on day 11. T cells were thawed, washed extensively, and placed in culture for the indicated times, after which CAR expression was determined by FACS. [Figure 6]Figure 6 is a series of plots showing that multiple ERα-targeting drugs stabilize FurOn CART. Jurkat T cells were transduced with the ERα FD degradation domain fused to an anti-CD19 scFv CAR construct and then treated with the indicated compounds for 24 hours. The ERα-targeting drugs used were 10 μM 4-OHT, 1 μM bazedoxifene, or 1 μM lasofoxifene. [Figure 7] Figure 7 is a graph showing the dose response of ErαFD-fused CAR expression to bazedoxifene. Primary human T cells were transduced with the ERαFD degradation domain fused to an anti-CD19 scFv CAR construct or the parental CD19 CAR construct. 100 U / mL of IL-2 was added on day 9 after activation with anti-CD3 / CD28 stimulatory beads, and T cells were frozen on day 11. T cells were thawed and placed in culture with the indicated concentrations of bazedoxifene for 48 hours. CAR expression was determined by FACS. [Figure 8] Figure 8 is a pair of graphs showing compound-dependent, target-specific cell killing by ER-alpha-based FurON CARTs. Primary human T cells were transduced with the ERαFD degradation domain fused to an anti-CD19 scFv CAR construct or the parental CD19 CAR construct. On day 9 after activation with anti-CD3 / CD28 stimulator beads, 100 U / mL of IL-2 and bazedoxifene were added, and T cells were frozen on day 11. T cells were thawed and incubated with the indicated ludiferized cell line targets, K562 (CD19-) or NALM6 (CD19+), for 20 hours. Percent killing was determined by analysis of residual luciferase activity. [Figure 9]Figure 9 is a pair of graphs showing compound-dependent, target-specific cell killing by FKBP-based FurON CARTs. Primary human T cells were transduced with the FKBPFD furin degradation domain fused to an anti-CD19 scFv CAR construct or the parental CD19 CAR construct. 100 U / mL IL-2 and Shield1 were added on day 9 after activation with anti-CD3 / CD28 stimulator beads, and T cells were frozen on day 11. T cells were thawed and incubated with the indicated luminescence-treated cell line targets, K562 (CD19-) or NALM6 (CD19+), for 20 hours. Percent killing was determined by analysis of residual luciferase activity. [Figure 10] Figure 10 is a pair of graphs showing compound-dependent cytokine production of ER-alpha FurOn CART. Primary human T cells were transduced with the ERαFD furin degradation domain fused to an anti-CD19 scFv CAR construct or the parental CD19 CAR construct. On day 9 after activation with anti-CD3 / CD28 stimulatory beads, 100 U / mL of IL-2 and bazedoxifene were added, and T cells were frozen on day 11. T cells were thawed and incubated with the indicated cell line targets for 20 hours. Supernatants were collected and analyzed by cytokine bead array. [Figure 11] Figure 11 is a graph showing compound-dependent proliferation of ER-alpha FurOn CART. Primary human T cells were transduced with the ERαFD degradation domain fused to an anti-CD19 scFv CAR construct or the parental CD19 CAR construct. 100 U / mL IL-2 and bazedoxifene were added on day 9 after activation with anti-CD3 / CD28 stimulator beads, and T cells were frozen on day 11. T cells were thawed and incubated with the indicated cell line targets for 4 days. T cell FurON-CAR counts were analyzed by FACS. [Figure 12]12A-12B are representative immunoblots showing the extent of furin cleavage across various furin cleavage sites tested in the ERα-FurON CAR19 construct: #105 - LQWLEQQVAKRRTKR (SEQ ID NO: 129), #106 - GTGAEDPRPSRKRRSLGDVG (SEQ ID NO: 125), #107 - GTGAEDPRPSRKRRSLGG (SEQ ID NO: 131), #108 - GTGAEDPRPSRKRRSLG (SEQ ID NO: 133), #102 - SLNLTESHNSRKKR (SEQ ID NO: 135), #103 - GTGAEDPRPSRKRR (SEQ ID NO: 127), #104 - CKINGYPKRGRKRR (SEQ ID NO: 137), and #73 - RTKR (SEQ ID NO: 123). [Figure 13] FIG. 13 is a table showing that the furon (furin degron) domain regulates CAR19 expression in human primary T cells in a stabilizing compound-dependent manner, without affecting cell viability or proliferation. [Figure 14] Figure 14 is a series of line graphs showing that CAR19 with a furin degron domain kills CD19+ tumor cells in a stabilized compound dose-dependent manner and is non-inferior to the parental CAR construct. [Figure 15] Figure 15 is a bar graph showing that primary human T cells expressing ERαFurON CAR19 secrete IFNγ in the presence of CD19+ tumor cells in a stabilized compound dose-dependent manner and in a manner comparable to the parental CAR construct. [Figure 16] Figure 16 is a series of bar graphs showing that primary human T cells expressing ERαFurON CAR19 proliferate in the presence of CD19+ tumor cells in a manner that is stabilizing compound dependent and non-inferior to the parental CAR19 construct. [Figure 17] Figure 17 is a series of graphs showing that the tested FurON domains regulate CAR19 expression in Jurkat cells in a compound-dependent manner, regardless of the number of mutations, and that CAR surface expression is not detectable in the absence of stabilizing compounds. [Figure 18] 18 is a table showing that the FurON domain regulates CAR19 expression in human primary T cells in a stabilizing compound-dependent and IL2-dependent manner. When the FurON moiety is fused to CAR19, no surface CAR expression is detected in the absence of the stabilizing compound bazedoxifene. [Figure 19] Figures 19A-19B are line graphs showing that CART cells expressing FurON CAR19, which contains a limited number of mutations in the degron domain, kill CD19+ tumor cells in a stabilized compound- and target-dependent manner and are non-inferior to the parental CAR construct. [Figure 20] Figure 20 is a bar graph showing that CART cells expressing FurON CAR19, which contains a limited number of mutations in the degron domain, secrete cytokines in the presence of CD19+ tumor cells in a manner that is stabilizing compound-dependent and comparable to the parental CAR construct. [Figure 21] Figure 21 is a bar graph showing that CD3+ T cells containing FurON CAR19 proliferate in the presence of CD19+ tumor cells in a manner that is stabilized compound dependent and non-inferior to the parental CAR construct. [Figure 22] Figure 22 is a series of graphs showing that the FurON domain regulates CAR123 expression in a stabilizing compound-dependent manner in primary human T cells. [Figure 23] Figure 23 is a series of bar graphs showing that CART cells expressing FurON CAR123 kill CD123+ tumor cells in a stabilized compound- and target-dependent manner and are non-inferior to the parental CAR construct. [Figure 24] Figure 24 is a series of bar graphs showing that CART cells expressing FurON CAR123 secrete cytokines in the presence of CD123+ tumor cells in a manner that is stabilizing compound-dependent and comparable to the parental CAR construct. [Figure 25]FIG. 25 is a schematic diagram showing an exemplary fusion protein comprising a degradation domain (degron), a protease cleavage site, and a second protein domain (CAR), and the alteration of degradation of the fusion protein in the presence of a drug, e.g., a stabilizing compound. [Figure 26] Figure 26 is a schematic diagram showing an exemplary fusion protein comprising four copies of an aggregation domain (FKBP12F36M), a protease cleavage site (furin site), and a second protein domain (ScFv with a cytoplasmic tail), and the change in aggregation of the fusion protein in the presence of a compound, e.g., a disaggregating compound. This figure is an exemplary illustration of a regulatory on-CAR system, yet another embodiment for controlling cell surface expression and therefore CAR function, called a regulatory on-CAR system. The CAR is expressed downstream of a modified FKBP12 domain separated by a furin site. In the absence of a solubilizing compound, the CAR molecules spontaneously aggregate in the endoplasmic reticulum, reducing the number of CAR molecules that can exit to the surface of the T cell, e.g., eliminating CAR-mediated T cell function. In the presence of a solubilizing compound, the CAR aggregation domain is separated, preventing aggregation. The furin site located at the N-terminus of the scFv becomes accessible for cleavage. After removal of the aggregation domain by furin in the late Golgi, the CAR molecule is exported to the surface of the T cell, where CAR-mediated T-cell function can occur. [Figure 27] Figure 27 is a diagram of anti-CD19 or anti-CD20 chimeric antigen receptor constructs with a suicide switch (inducible caspase-9 or iCasp9 or iC9), collectively referred to as CD19 sCAR or CD20 sCAR, designed to cause complete but transient B cell depletion. CD19 / CD20 sCAR T cells exert their therapeutic effect by depleting B cells upon fusion. Subsequent treatment with a small molecule compound dimerizes caspase-9, activating caspase activity and inducing CD19 / CD20 sCAR T cell suicide, thereby allowing B cell repopulation to occur. [Figure 28] Figure 28 is a diagram of another embodiment of a caspase-9 suicide cassette, a reversible caspase-9 suicide cassette. In this CD19 / CD20 revCAR system, caspase-9 is constitutively expressed and spontaneously dimerizes, thus inducing apoptosis by default in CD19 revCAR T cells. In the presence of a small molecule compound that solubilizes the caspase-9 molecule (i.e., inhibits dimerization), caspase activity is inhibited. Thus, small molecule solubilizing agent treatment inhibits caspase-9 activity during revCAR T cell expansion and fusion, and withdrawal of the small molecule solubilizing agent results in activation of caspase-9 activity and suicide of revCAR T cells, allowing B cell repopulation to occur. [Figure 29-1] Figures 29A-29F are a series of graphs showing efficient expression of CD19 sCAR, CD19revCAR, and CD20 CAR constructs in primary human T cells. [Figure 29-2] Figures 29A-29F are a series of graphs showing efficient expression of CD19 sCAR, CD19revCAR, and CD20 CAR constructs in primary human T cells. [Figure 29-3] Figures 29A-29F are a series of graphs showing efficient expression of CD19 sCAR, CD19revCAR, and CD20 CAR constructs in primary human T cells. [Figure 30] Figure 30 is a graph showing specific killing in vitro by CD19 sCAR. Nalm6 are B cells that express CD19 (wt, wild-type). CD19 sCAR T cells killed CD19+Nalm6 cells, whereas non-transduced (NTD) T cells or T cells expressing a control sCAR (negative control) did not recognize Nalm6 wt cells. [Figure 31]Figure 31 is a graph showing the specific and robust elimination of CD19 sCAR T cells after activation of the caspase-9 suicide switch with AP20187. CAR T cells were incubated in the presence of the indicated concentrations of AP20187 for 16 hours at 37°C. Dead cells were detected with LIVE / DEAD violet dye and quantified by flow cytometry. Only T cells that expressed inducible caspases were eliminated (FMC63 iC9 or CD19 sCAR, as well as iC9 control CAR). T cells that did not express the control CAR were unaffected (non-transduced, NTD, or control CAR not expressing iC9). [Figure 32] Figure 32 is a graph showing that CD19 sCAR T cells expressing inducible caspase-9 are effective in vivo. NSG mice were injected with 1x106 CD19+Nalm6 cells. Five days later, the mice were treated with either CD19 CAR T cells expressing inducible caspase-9 or untransduced control T cells. [Figure 33] Figure 33 is a graph showing detection of CD19 sCAR T cells expressing inducible caspase-9 in the blood and spleen by flow cytometry at the end of the in vivo experiment, indicating engraftment. [Figure 34] Figure 34 is a series of graphs illustrating killing assays: CD20sCAR, 20revCAR, and CD20 onCAR. 4-hour chromium release assay to assess killing of Nalm6 cells pre-engineered to express CD20. Kwt = K562 wild-type cells (the cells are CD20 negative and serve as irrelevant targets to demonstrate specific killing). CD20sCAR, 20revCAR, and CD20 onCAR show comparable and specific killing of CD20+ target cells. On-CAR was tested in the presence of 500 nM Shield-1. [Figure 35]Figure 35 is a series of histograms demonstrating that the absence of soluble FKBP ligand (e.g., shield-1) inhibits CAR function. The percent reduction in killing in the absence of shield-1 compared to killing in the presence of 500 nM shield-1 is shown. Jeko cells express CD20. At lower E:T ratios, On-CAR function is strongly inhibited in the absence of FKBP ligand. [Figure 36] Figure 36 is a series of graphs illustrating modulation of CAR surface expression with the FKBP ligand Shield-1. CD20 on-CAR T cells were stained for CAR expression, and the mean fluorescence intensity (MFI, assessed by flow cytometry) of the CAR signal was plotted against Shield-1 concentration. Shield-1 results in a dose-dependent increase in CAR expression. The absence of Shield-1 results in an approximately 60% reduction in CD20 on-CAR expression (bottom graph). [Figure 37] Figure 37 is a series of flow cytometry graphs illustrating the potency of Shield-1 in CD19rev CARs. CD19rev CAR T cells (approximately 38% transduced) were incubated with different Shield-1 doses for 24 hours to assess dose-dependent caspase-9 activation. Remaining CAR+ cells were quantified by flow cytometry. In the CD19rev CAR system, lower doses of Shield-1 resulted in higher caspase-9 activation and increased apoptosis (smaller percentage of CAR+ cells). [Figure 38]Figure 38 is a graph illustrating the in vivo assessment of apoptosis efficiency in anti-CD19 revCAR T cells. CD19-positive Nalm6 cells (expressing click beetle luciferase) were injected (iv) into NSG mice on day 0. On day 4, mice were injected with CD19-targeted revCAR, 19sCAR, or irrelevant (untransduced) T cells. The bioluminescence signal of Nalm6 cells was quantified at the indicated time points. revCAR-treated mice were injected twice with 10 mg / kg of aquashield-1 at the indicated time points. These injections were expected to be insufficient to keep revCAR T cells alive. Therefore, the bioluminescence curves for revCAR and NTD mice are highly overlapping, indicating sufficient in vivo apoptosis of revCAR T cells. [Figure 39] Figure 39 is a series of schematic timelines and graphs showing the in vivo efficacy of CD19revCAR T cells. CD19-positive Nalm6 cells (expressing click beetle luciferase) were injected (iv) into NSG mice on day 0. On day 4, mice were implanted with osmotic infusion pumps to secrete aquashield-1 at a dose of 20 mg / kg / day. CD19rev CAR T cells were injected 4 hours after successful pump implantation (bottom graph, black arrow). The bioluminescence signal of Nalm6 cells was quantified at the indicated time points. The infusion pump secreted aquashield-1 for 7 days, after which the bioluminescence of Nalm6 cells began to increase (CD19revCAR curve). [Figure 40]Figure 40 is a series of flow cytometry graphs illustrating that suicide activation results in peripheral suicide CAR T cell depletion. Mice were injected with Nalm6 cells and treated with 19s CAR T cells 5 days later. CD19s CAR T cells were sorted based on scFV expression before injection. Flow plots show peripheral T cells (CD3+, CD45+) on days 8 and 26. CD19 sCAR T cells were depleted by injection of AP1903 (10 mg / kg) on ​​day 10. The two plots on the left for AP1903-treated mice show that T cells are barely detectable after suicide activation, while the two plots on the right for vehicle-treated mice show stable T cell percentages. [Figure 41] Figure 41 is a series of graphs demonstrating that suicide activation results in peripheral sCAR T cell depletion. T cells from several mice were quantified. Mice were treated with AP1903 on day 10 to deplete sCAR T cells. After treatment, the AP1903 group showed a drop in T cell percentage, in contrast to the vehicle-treated group. [Figure 42] Figure 42 is a series of images and graphs demonstrating that suicide activation results in sCAR T cell depletion from lymphoid organs. Top image: Mouse spleens were harvested two weeks or more after AP1903 treatment and stained for human CD3. No T cells are detected in AP1903-treated mice, in contrast to vehicle-treated mice. Bottom graph: Quantitative PCR was performed to detect sCAR T cells in the spleens of AP1903- and vehicle-treated mice, demonstrating near-complete absence of sCAR in the majority of mice. [Figure 43]Figure 43 is a series of schematic timelines and graphs showing that the use of BT (bone marrow, liver, thymus) mice as hosts requires "universal" T cells lacking TCR and MHCI expression. T cells were transduced with lentivirus encoding CD19 sCAR on day 1 after activation, electroporated with Cas9 guide RNA (10ug / 10^6 cells) on day 3, and again electroporated with guide RNAs targeting the TCR beta chain and beta-2 microglobulin on day 4. The flow plot shows sCAR19 expression in 45.2% of cells 10 days after activation, and a double knockout for TCR beta and beta-2 microglobulin in approximately 20% of cells. This schematic outlines the timeline of T cell production. [Figure 44] Figure 44 is a schematic timeline of the experimental design of the in vivo experiments of the present invention. Use of BT (bone marrow, liver, thymus) mice to assess universal sCAR function in a non-oncology mouse model. Human fetal bone marrow and thymus were transplanted into NSG mice 91 days ago. Verification of engraftment was performed by flow cytometry 27 days ago. Universal T cells expressing CD19 sCAR T cells were injected on day 0, B cell depletion was assessed on day 10, and mice were treated with AP1903 (3 daily injections with 10 mg / kg). sCAR survival was assessed by qPCR. [Figure 45] Figure 45 is a series of flow cytometry graphs illustrating that "universal" sCAR T cells deplete peripheral B cells in non-autologous BT (bone marrow, liver, and thymus) mice. Universal CAR T cells were able to deplete human B cells in a non-cancer humanized mouse model. The flow plots on days 0 and 10 demonstrate a complete absence of CD19-positive cells in the peripheral circulation. [Figure 46]Figure 46 is a graph showing that universal sCAR T cells can be depleted by AP1903 treatment. Quantitative PCR was performed to detect sCAR T cells in the peripheral blood of AP1903 and vehicle-treated mice, and the results demonstrated almost complete absence of sCAR in 2 / 3 mice. Four weeks after AP1903 treatment, qPCR was performed from peripheral blood WPRE copy number using gDNA. [Figure 47] Figure 47 is a graph showing that CD19+ NALM6 tumor growth was inhibited in mice injected with CART19 or FurON CART19 and treated with BZA, with or without co-treatment with IL-2. DETAILED DESCRIPTION OF THE INVENTION

[0147] In general, the present invention features regulated expression of recombinant fusion proteins. This regulation is characterized by expression of a fusion protein containing a protein of interest fused to a conditional expression domain, e.g., a degradation domain (often referred to in the art as a "degron") or an aggregation domain. Typically, such a degradation domain folds into a stable conformation only in the presence of a specific ligand (e.g., a soluble ligand or a ligand tethered to the fusion protein). In the absence of such a ligand, the degradation domain adopts a disordered structure, resulting in degradation of the entire fusion protein by native intracellular mechanisms. Typically, such an aggregation domain associates into oligomers and / or aggregates in the absence of a specific ligand (e.g., a soluble ligand or a ligand tethered to the fusion protein), resulting in aggregation and / or sequestration of the entire fusion protein. The present invention is based on the insight that a degradation domain or aggregation domain can be separated from a protein of interest by a cleavage site (e.g., a protease cleavage site) when expressed under stabilizing conditions (e.g., in the presence of a stabilizing compound) or disaggregating conditions (e.g., in the presence of a disaggregating compound). Thus, in the absence of the corresponding protease, a fusion protein containing a degradation domain will avoid degradation only in the presence of a stabilizing compound, and a fusion protein containing an aggregation domain will avoid aggregation only in the presence of a disaggregating compound. However, once the cleavage site is cleaved by the corresponding protease, the presence of a stabilizing compound or disaggregating compound is no longer necessary to enable degradation or avoidance of aggregation of the protein of interest, because the protein of interest is no longer associated with either the degradation or aggregation domain. Thus, upon initial expression, a fusion protein containing a degradation domain is susceptible to degradation, and a fusion protein containing an aggregation domain is susceptible to aggregation, but once cleavage has occurred, the resulting protein of interest may be indistinguishable from its non-fused protein counterpart.

[0148] Thus, the fusion proteins of the present invention have three essential elements: a conditional expression domain (e.g., a degradation domain or aggregation domain); a domain containing the protein of interest; and a cleavage domain separating the two. The specific domains within each of these elements are interchangeable and are discussed below. Of note, fusion proteins can be configured such that the conditional expression domain is located either N-terminally or C-terminally to the protein of interest. However, in certain embodiments, the conditional expression domain is N-terminally to the protein of interest. In those embodiments in which the conditional expression domain is a degradation domain, the degradation domain, when perturbed, targets the entire fusion protein for degradation prior to cleavage of the cleavage domain. In the case of a C-terminal fusion, the protease cleavage site must be directed toward a compartment where the protease resides. In the specific case of furin, the C-terminal degron must be oriented toward the lumen of the endoplasmic reticulum and Golgi.

[0149] definition As used herein, the term "conditional expression domain" refers to a domain of a fusion protein that has a first state and a second state, e.g., an aggregation state or a conformational state, e.g., a stabilized / destabilized state, or a folded / misfolded state. The first state is associated with, causes, or mediates cell surface or extracellular expression of one or more (e.g., all) portions of the fusion protein at a first rate or level, and the second state is associated with, causes, or mediates cell surface or extracellular expression of one or more (e.g., all) portions of the fusion protein at a second rate or level. When expressed in a target cell, unless an expression compound is present, most of the fusion protein containing the conditional expression domain cannot be detected on the cell surface or extracellularly. Conversely, in the presence of an expression compound, the surface and / or extracellular expression of one or more (e.g., all) domains of the fusion protein is substantially increased. Thus, a conditional expression domain can be identified by the following characteristics: (1) the conditional expression domain does not naturally occur in the context of the fusion protein; (2) surface expression and / or extracellular expression is regulated co-translationally or post-translationally; and (3) the surface expression rate and / or extracellular expression rate is substantially increased in the presence of an expression compound. In embodiments, the conditional expression domain is a degradation domain, e.g., as described herein. In other embodiments, the conditional expression domain is an aggregation domain, e.g., as described herein. In embodiments, a fusion protein comprising a conditional expression domain comprises a chimeric antigen receptor (CAR), e.g., as described herein. In embodiments, the fusion protein comprises a heterologous protease cleavage site disposed between the conditional expression domain and the second domain. In such embodiments, in the absence of an expression compound, the protease corresponding to the protease cleavage site for the majority of the fusion protein is inaccessible, and the cellular fate of the fusion protein is determined by the conditional expression domain.In the presence of the expression compound, the protease cleavage site for the majority of the fusion protein becomes accessible to the corresponding protease, the conditional expression domain is cleaved from the fusion protein, and the cellular fate of the remainder of the fusion protein proceeds as it is not interrupted by the conditional expression domain.

[0150] As used herein, the term "aggregation domain" refers to a domain of a fusion protein that causes intracellular aggregation of the fusion protein. When expressed in a target cell, unless a disaggregation compound is present, most of the fusion protein containing the aggregation domain will exist in aggregates, e.g., aggregates that are sequestered intracellularly before reaching mature expression, e.g., before being expressed on the surface of the cell or secreted extracellularly. Conversely, in the presence of a disaggregation compound, the surface and / or extracellular expression of one or more (e.g., all) domains of the fusion protein will be substantially increased. Thus, an aggregation domain can be identified by the following characteristics: (1) the aggregation domain does not naturally occur in the context of the fusion protein; (2) the surface and / or extracellular expression is regulated co-translationally or post-translationally; (3) the surface and / or extracellular expression rate will be substantially increased in the presence of a disaggregation compound. In an embodiment, the aggregation domain comprises one or more repeats of a dimerization domain, e.g., 1, 2, 3, 4, 5, 6, 7, or more repeats. In embodiments, the dimerization domain is a homodimerization domain. In other embodiments, the dimerization domain is a heterodimerization domain.

[0151] As used herein, the term "expression compound" refers to a compound that, when added to a cell expressing a fusion protein containing a conditional expression domain, binds to the conditional expression domain and results in increased surface and / or extracellular expression of one or more (e.g., all) domains of the fusion protein. Expression compounds may be naturally occurring or synthetic.

[0152] As used herein, the term "disaggregating compound" refers to a compound that, when added to a cell expressing a fusion protein containing an aggregation domain, binds to the aggregation domain and results in increased surface and / or extracellular expression of one or more (e.g., all) domains of the fusion protein. Disaggregating compounds may be naturally occurring or synthetic.

[0153] The term "degradation domain" refers to a domain of a fusion protein that adopts a stable conformation when expressed in the presence of a stabilizing compound. When expressed in a cell of interest, unless a stable conformation is present, most of the degradation domain (and typically any protein to which the degradation domain is fused) will be degraded by endogenous intracellular mechanisms. Notably, the degradation domain is not a naturally occurring domain of the protein; rather, it is engineered to be unstable unless contacted with a stabilizing compound. Thus, a degradation domain can be identified by the following characteristics: (1) the degradation domain is not naturally occurring; (2) expression of the degradation domain is co-translationally or post-translationally regulated by increasing or decreasing the degradation rate; and (3) the degradation rate is substantially reduced in the presence of a stabilizing compound. In some embodiments, the degradation domain does not result in aggregation of the fusion protein. In some embodiments, unless a stabilizing compound is present, the degradation domain or other domains of the fusion protein are substantially undetectable in or on cells.

[0154] As used herein, the terms "disaggregation" and "deagglomeration" are used interchangeably.

[0155] As used herein, a "fusion protein" or "chimeric protein" refers to a protein created by joining two or more heterologous protein domains into a single contiguous protein.

[0156] The term "heterologous" refers to a domain (e.g., a protein domain) that has a different origin than the protein domain or domains to which it is fused (i.e., it is not naturally occurring and is fused to at least one of the other domains mentioned). Furthermore, a "heterologous protease cleavage site" refers to a protease cleavage site that is not cleaved by any domains present within the fusion protein.

[0157] By "protease" is meant a protein that cleaves another protein based on the presence of a cleavage site in the protein to be cleaved.

[0158] By "intracellular protease" is meant a protease that is naturally expressed within the cells of a subject.

[0159] By "extracellular protease" is meant a protease that is naturally expressed in an organism (e.g., a mammal) and secreted or exposed outside the cell (e.g., in the blood or on the surface of the skin).

[0160] "Stabilization compound" or "stabilizing compound" means a compound that, when added to a cell expressing a degradation domain, stabilizes the degradation domain and reduces the rate at which it is subsequently degraded. Stabilization compounds or stabilizing compounds can be naturally occurring or synthetic.

[0161] The terms "a" and "an" refer to one or to more than one (i.e., at least one) of the grammatical object article. By way of example, "an element" means one element or more than one element.

[0162] The term "about," when referring to a measurable value such as an amount, temporal duration, and the like, is meant to encompass a ±20% variation, or in some cases a ±10% variation, or in some cases a ±5% variation, or in some cases a ±1% variation, or in some cases a ±0.1% variation from the stated value, since such variations are appropriate for performing the disclosed methods.

[0163] The term "chimeric antigen receptor" or alternatively "CAR" refers to a recombinant polypeptide construct comprising at least an extracellular antigen-binding domain, a transmembrane domain, and an intracytoplasmic signaling domain (also referred to herein as an "intracellular signaling domain") comprising a functional signaling domain derived from a stimulatory molecule as defined below. In some embodiments, the domains in a CAR polypeptide construct are in the same polypeptide chain, e.g., comprising a chimeric fusion protein. In some embodiments, the domains in a CAR polypeptide construct are not contiguous with each other, e.g., are in different polypeptide chains, e.g., a regulatable chimeric antigen receptor (RCAR).

[0164] In one embodiment, the stimulatory molecule is a zeta chain associated with the T cell receptor complex. In one embodiment, the cytoplasmic signaling domain comprises a primary signaling domain (e.g., the primary signaling domain of CD3-zeta). In one embodiment, the cytoplasmic signaling domain further comprises one or more functional signaling domains from at least one costimulatory molecule as defined below. In one embodiment, the costimulatory molecule is selected from 4-1BB (i.e., CD137), CD27, ICOS, and / or CD28. In one embodiment, the CAR comprises a chimeric fusion protein comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain comprising a functional signaling domain from the stimulatory molecule. In one embodiment, the CAR comprises a chimeric fusion protein comprising an extracellular antigen-recognition domain, a transmembrane domain, and an intracellular signaling domain comprising a functional signaling domain from a costimulatory molecule and a functional signaling domain from the stimulatory molecule. In one embodiment, the CAR comprises a chimeric fusion protein comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain comprising two functional signaling domains derived from one or more costimulatory molecules and a functional signaling domain derived from a stimulatory molecule. In one embodiment, the CAR comprises a chimeric fusion protein comprising an extracellular antigen-binding domain, a transmembrane domain, and an intracellular signaling domain comprising at least two functional signaling domains derived from one or more costimulatory molecules and a functional signaling domain derived from a stimulatory molecule. In one embodiment, the CAR comprises an optional leader sequence at the amino-terminus (N-ter) of the CAR fusion protein. In one embodiment, the CAR further comprises a leader sequence at the N-terminus of the extracellular antigen-binding domain, which is appropriately cleaved from the antigen recognition domain (e.g., scFv) during intracellular processing and localization of the CAR to the cell membrane.

[0165] A CAR that includes an antigen-binding domain (e.g., scFv, or TCR) that targets, e.g., binds to, a specific antigen X, such as those described herein, is also referred to as an XCAR, X-CAR, or X-targeted CAR. For example, a CAR that includes an antigen-binding domain that targets CD19 is referred to as a CD19CAR.

[0166] The term "signaling domain" refers to a functional portion of a protein that acts by transmitting intracellular information to regulate cellular activity through a defined signaling pathway by generating a second messenger or functioning as an effector in response to such a messenger. In some embodiments, the signaling domain of a CAR described herein is derived from a stimulatory molecule or costimulatory molecule described herein, or is a synthetic or engineered signaling domain.

[0167] The term "antibody," as used herein, refers to a protein or polypeptide sequence derived from an immunoglobulin molecule that specifically binds to an antigen. Antibodies may be polyclonal or monoclonal, multiple or single chain, or intact immunoglobulins, and may be derived from natural or recombinant sources. An antibody may also be a tetramer of immunoglobulin molecules.

[0168] The term "antibody fragment" refers to at least a portion of an intact antibody, or a recombinant variant thereof, and refers to the antigen-binding domain of an intact antibody, e.g., the antigenic determining variable region, sufficient to confer recognition and specific binding of the antibody fragment to a target such as an antigen. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, and Fv fragments; scFv antibody fragments; linear antibodies; single-domain antibodies, e.g., sdAb (either VL or VH); camelized VHH domains; and multispecific antibodies formed from antibody fragments, such as a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; and isolated CDRs or other epitope-binding fragments of antibodies. Antigen-binding fragments may also be incorporated into single domain antibodies, maxibodies, minibodies, nanobodies, intrabodies, diabodies, triabodies, tetrabodies, v-NARs, and bis-scFvs (see, e.g., Hollinger and Hudson, Nature Biotechnology 23:1126-1136, 2005). Antigen-binding fragments can also be grafted onto polypeptide-based scaffolds, such as fibronectin type III (Fn3) (see U.S. Pat. No. 6,703,199, which describes minibodies of fibronectin polypeptides).

[0169] The term "scFv" refers to a fusion protein comprising at least one antibody fragment comprising a light chain variable region and at least one antibody fragment comprising a heavy chain variable region, wherein the light and heavy chain variable regions are contiguously linked via a short, flexible polypeptide linker, such that the fusion protein can be expressed as a single polypeptide chain, and the scFv retains the specificity of the intact antibody from which it was derived. Unless otherwise specified, an scFv, as used herein, may have the VL and VH variable regions in either order; for example, with respect to the N- and C-terminal ends of the polypeptide, the scFv may comprise VL-linker-VH or VH-linker-VL.

[0170] The term "complementarity determining region" or "CDR" as used herein refers to the amino acid sequence in an antibody variable region that confers antigen specificity and binding affinity. For example, there are generally three CDRs (e.g., HCDR1, HCDR2, and HCDR3) in each heavy chain variable region and three CDRs (LCDR1, LCDR2, and LCDR3) in each light chain variable region. The precise amino acid sequence boundaries of a given CDR can be determined using any of a number of well-known schemes, such as those described by Kabat et al. (1991), "Sequences of Proteins of Immunological Interest," 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD ("Kabat" numbering scheme), Al-Lazikani et al., (1997) JMB 273,927-948 ("Chothia" numbering scheme), or a combination thereof. According to the Kabat numbering scheme, in some embodiments, the amino acid residues of the CDRs in the heavy chain variable domain (VH) are numbered 31-35 (HCDR1), 50-65 (HCDR2), and 95-102 (HCDR3), and the amino acid residues of the CDRs in the light chain variable domain (VL) are numbered 24-34 (LCDR1), 50-56 (LCDR2), and 89-97 (LCDR3). According to the Chothia numbering scheme, in some embodiments, the amino acid residues of the CDRs in the VH are numbered 26-32 (HCDR1), 52-56 (HCDR2), and 95-102 (HCDR3), and the amino acid residues of the CDRs in the VL are numbered 26-32 (LCDR1), 50-52 (LCDR2), and 91-96 (LCDR3). In a combined Kabat and Chothia numbering scheme, in some embodiments, the CDRs correspond to amino acid residues that are part of a Kabat CDR, a Chothia CDR, or both.For example, in some embodiments, the CDRs correspond to amino acid residues 26-35 (HCDR1), 50-65 (HCDR2), and 95-102 (HCDR3) in a VH, e.g., a mammalian VH, e.g., a human VH; and amino acid residues 24-34 (LCDR1), 50-56 (LCDR2), and 89-97 (LCDR3) in a VL, e.g., a mammalian VL, e.g., a human VL.

[0171] The portion of the CAR of the present invention comprising an antibody or antibody fragment thereof can exist in various forms in which the antigen-binding domain is expressed as part of a continuous polypeptide chain, including, for example, scFv antibody fragments, linear antibodies, single-domain antibodies such as sdAb (either VL or VH), camelized VHH domains, humanized antibodies, bispecific antibodies, and antibody conjugates (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426). In one embodiment, the antigen-binding domain of the CAR of the present invention comprises an antibody fragment. In a further embodiment, the CAR comprises an antibody fragment comprising an scFv.

[0172] As used herein, the term "binding domain" or "antibody molecule" (also referred to herein as "anti-target (e.g., CD19) binding domain") refers to a protein, e.g., an immunoglobulin chain or fragment thereof, that comprises at least one immunoglobulin variable domain sequence. The term "binding domain" or "antibody molecule" encompasses antibodies and antibody fragments. In certain embodiments, an antibody molecule is a multispecific antibody molecule, e.g., comprising a plurality of immunoglobulin variable domain sequences, wherein a first immunoglobulin variable domain sequence of the plurality has binding specificity for a first epitope and a second immunoglobulin variable domain sequence of the plurality has binding specificity for a second epitope. In one embodiment, a multispecific antibody molecule is a bispecific antibody molecule. A bispecific antibody has specificity for no more than two antigens. A bispecific antibody molecule is characterized by a first immunoglobulin variable domain sequence that has binding specificity for a first epitope and a second immunoglobulin variable domain sequence that has binding specificity for a second epitope. The term "antibody heavy chain" refers to the larger of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations, and which usually determines the class to which the antibody belongs.

[0173] The term "antibody heavy chain" refers to the larger of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations, and which usually determines the class to which the antibody belongs.

[0174] The term "antibody light chain" refers to the smaller of the two types of polypeptide chains present in antibody molecules in their naturally occurring conformations. Kappa (κ) and lambda (λ) light chains refer to the two major antibody light chain isotypes.

[0175] The term "recombinant antibody" refers to an antibody produced using recombinant DNA technology, such as, for example, an antibody expressed in a bacteriophage or yeast expression system. The term shall also be taken to mean an antibody produced by synthesis of a DNA molecule encoding the antibody (which DNA molecule expresses the antibody protein), or an amino acid sequence specifying the antibody, where the DNA or amino acid sequence is obtained using recombinant DNA or amino acid sequence technology available and well known in the art.

[0176] The term "immunoglobulin" or "Ig" as used herein is defined as a class of proteins that function as antibodies. Antibodies expressed by B cells are sometimes referred to as BCRs (B cell receptors) or antigen receptors. Five members of this class of proteins are IgA, IgG, IgM, IgD, and IgE. IgA is the primary antibody present in bodily secretions, such as saliva, tears, breast milk, gastrointestinal secretions, and respiratory and genitourinary mucus secretions. IgG is the most common circulating antibody. IgM is the major immunoglobulin generated in the primary immune response in most subjects. IgM is the immunoglobulin most effective in agglutination, complement fixation, and other antibody responses, and is important for defense against bacteria and viruses. IgD is an immunoglobulin that has no known antibody function but can serve as an antigen receptor. IgE is an immunoglobulin that mediates immediate hypersensitivity by inducing the release of mediators from mast cells and basophils upon exposure to allergens.

[0177] The term "antigen" or "Ag" refers to a molecule that elicits an immune response. This immune response can involve either antibody production or activation of specific immunocompetent cells, or both. Those skilled in the art will understand that any macromolecule, including virtually any protein or peptide, can serve as an antigen. Furthermore, antigens may be derived from recombinant or genomic DNA. Those skilled in the art will understand that any DNA containing a nucleotide sequence or partial nucleotide sequence encoding a protein that elicits an immune response will thereby encode an "antigen," as the term is used herein. Those skilled in the art will also understand that an antigen is not necessarily encoded solely by the full-length nucleotide sequence of a gene. The present disclosure encompasses, but is not limited to, the use of partial nucleotide sequences from more than one gene, and that these nucleotide sequences may be arranged in various combinations to encode a polypeptide that elicits a desired immune response. Those skilled in the art will also understand that an antigen does not necessarily have to be encoded by a "gene." It will be readily understood that an antigen can be generated or derived from a biological sample, or can be a macromolecule other than a polypeptide. Such biological samples may include, but are not limited to, tissue samples, tumor samples, and fluids containing cells or other biological components.

[0178] The term "autoantigen" in accordance with the present invention refers to any self-antigen that is recognized as foreign by the immune system. Autoantigens include, but are not limited to, cellular proteins, phosphorylated proteins, cell surface proteins, cellular lipids, nucleic acids, glycoproteins, and encompass cell surface receptors.

[0179] "Autoantibody" refers to an antibody produced by B cells specific for a self-antigen.

[0180] The term "autoantibody disease," as used herein, is defined as a disorder resulting from an autoantibody immune response. Autoantibody diseases are the result of inappropriate and excessive autoantibody production. Examples of autoantibody diseases include, but are not limited to, bullous pemphigoid; epidermolysis bullosa acquisita; p200 pemphigoid; linear IgA bullous dermatosis; other pemphigoid group diseases; dermatitis herpetiformis; celiac disease; myasthenia gravis; Goodpasture's syndrome; granulomatosis with polyangiitis and other ANCA+ vasculitides; autoimmune limbic encephalitis; anti-N-methyl-D-aspartate receptor encephalopathy; neuromyelitis optica; autoimmune hemolytic anemia; and autoantibody-related end-organ damage in lupus and other connective tissue diseases. wounds (due to anti-dsDNA, anti-Ro and other autoantibodies); Graves' and Hashimoto's thyroiditis; anti-insulin antibodies in diabetes; anti-insulin receptor antibodies in autoimmune hypoglycemia; cryoglobulinemia; rheumatoid arthritis; multiple sclerosis; Sjögren's syndrome; dermatomyositis; anti-Fc-epsilon receptor antibodies in chronic idiopathic urticaria; anti-folate receptor antibodies, anti-endothelial receptor or anti-adrenergic receptor antibodies in pulmonary arterial hypertension; refractory hypertension; dilated cardiomyopathy, as well as autoinflammatory syndromes such as IgG4-related disease.

[0181] The term "autoimmune disease," as used herein, is defined as a disorder or condition resulting from an antibody-mediated autoimmune response to a self-antigen. An autoimmune disease results in the production of inappropriately and / or excessively produced autoantibodies against a self-antigen or autoantigen.

[0182] The term "autologous" refers to any material derived from the same individual into which it is later reintroduced.

[0183] The term "anti-tumor effect" or "anti-tumor activity" refers to a biological effect that can be manifested by various means, including, but not limited to, a reduction in tumor volume, a reduction in tumor cell number, a reduction in the number of metastases, an increase in life expectancy, a reduction in tumor cell proliferation, a decrease in tumor cell viability, or an improvement in various physiological symptoms associated with a cancerous condition. An "anti-tumor effect" can also be manifested by the ability of the peptides, polynucleotides, cells, and antibodies of the present invention to prevent the development of tumors at an early stage.

[0184] The term "allogeneic" refers to any material derived from a different animal of the same species as the individual into which the material is introduced. Two or more individuals are said to be allogeneic to one another if their genes at one or more loci are not identical. In some embodiments, allogeneic material from individuals of the same species may be genetically distinct enough to interact antigenically.

[0185] The term "xenogeneic" refers to a graft derived from an animal of a different species.

[0186] The term "apheresis," as used herein, refers to an extracorporeal process in which a donor's or patient's blood is removed from the donor or patient, passed through a device that removes certain selected components, and what remains is returned to the donor's or patient's circulation, e.g., by autotransfusion. Thus, reference to an "apheresis sample" refers to a sample obtained using apheresis.

[0187] The term "cleavage" refers to the breaking of a covalent bond, for example, a covalent bond in the backbone of a nucleic acid molecule, or the hydrolysis of a peptide bond. Cleavage can be initiated by various methods, including, but not limited to, enzymatic or chemical hydrolysis of a phosphodiester bond. Both single-strand and double-strand cleavage are possible. Double-strand cleavage can occur as a result of two separate single-strand cleavage events. DNA cleavage can result in blunt ends or staggered ends. In certain embodiments, fusion proteins can be used to target cleaved double-stranded DNA.

[0188] The term "cancer" or "tumor" refers to a disease characterized by the uncontrolled growth of abnormal cells. Cancer encompasses any type of cancerous growth or oncogenic process, metastatic tissue, or malignantly transformed cells, tissues, or organs, regardless of histopathological type or invasive stage. Cancer cells can spread locally or to other parts of the body via the bloodstream and lymphatic system. Examples of various cancers are described herein and include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, and the like.

[0189] The term "CRISPR / CAS," "clustered regularly interspaced short palindromic repeats system," or "CRISPR" refers to a DNA locus that contains short repeats of a base sequence. Each repeat is followed by a short segment of spacer DNA from previous exposure to a virus. Bacteria and archaea have developed an adaptive immune defense, termed the CRISPR-CRISPR-associated (Cas) system, that uses short strands of RNA to direct the degradation of foreign nucleic acids. In bacteria, the CRISPR system confers adaptive immunity against invading foreign DNA through RNA-guided DNA cleavage.

[0190] In the type II CRISPR / CAS system, short segments of foreign DNA, termed "spacers," are integrated into the CRISPR genomic locus, transcribed, and processed into short CRISPR RNAs (crRNAs). These crRNAs anneal to transactivating crRNAs (tracrRNAs) and direct sequence-specific cleavage and silencing of pathogenic DNA by Cas proteins. Recent studies have revealed that target recognition by the Cas9 protein requires a "seed" sequence within the crRNA and a conserved dinucleotide-containing protospacer adjacent motif (PAM) sequence upstream of the crRNA-binding region.

[0191] To direct Cas9 to cleave a sequence of interest, a crRNA-tracrRA fusion transcript (hereinafter referred to as "guide RNA" or "gRNA") can be designed from the human U6 polymerase III promoter. CRISPR / CAS-mediated genome editing and regulation has highlighted its potential to transform basic science, cell engineering, and therapeutics.

[0192] The term "CRISPRi" refers to a CRISPR system for sequence-specific gene silencing or inhibition of gene expression, such as at the transcriptional level.

[0193] "Derived from," as the term is used herein, refers to the relationship between a first molecule and a second molecule. This generally refers to the structural similarity between the first molecule and the second molecule and does not imply or include a limitation on the process or source of the first molecule from which the second molecule is derived. For example, in the case of an intracellular signaling domain derived from a CD3 zeta molecule, the intracellular signaling domain retains sufficient CD3 zeta structure to have the required function, i.e., the ability to generate a signal under appropriate conditions. This does not imply or include a limitation to the particular process by which the intracellular signaling domain is produced, e.g., it does not mean that one must start with the CD3 zeta sequence and delete or mutate unnecessary sequences to provide the intracellular signaling domain.

[0194] The phrase "diseases associated with the expression of tumor antigens as described herein" includes, but is not limited to, diseases associated with the expression of tumor antigens as described herein, or conditions associated with cells expressing tumor antigens as described herein, including, for example, proliferative diseases such as cancers or malignant tumors, or precancerous conditions such as myelodysplasia, myelodysplastic syndromes, or preleukemia; or non-cancer-related indications associated with cells expressing tumor antigens as described herein. In one embodiment, the cancer associated with the expression of tumor antigens as described herein is a blood cancer. In one embodiment, the cancer associated with the expression of tumor antigens as described herein is a solid cancer. Furthermore, diseases associated with the expression of tumor antigens as described herein include, but are not limited to, for example, atypical and / or atypical cancers, malignant tumors, precancerous conditions, or proliferative diseases associated with the expression of tumor antigens as described herein. Non-cancer-related indications associated with the expression of tumor antigens as described herein include, but are not limited to, for example, autoimmune diseases (e.g., lupus), inflammatory disorders (allergies and asthma), and transplantation.

[0195] The term "conservative sequence modifications" refers to amino acid modifications that do not significantly affect or alter the binding characteristics of an antibody or antibody fragment containing that amino acid sequence. Such conservative modifications include amino acid substitutions, additions, and deletions. Modifications can be introduced into the antibodies or antibody fragments of the present invention by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. A conservative amino acid substitution is one in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families encompass amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, one or more amino acid residues within the CARs described herein can be replaced with other amino acid residues from the same side chain family, and the modified CARs can be tested using the functional assays described herein.

[0196] The term "stimulation" refers to a primary response induced by the binding of a stimulatory molecule (e.g., a TCR / CD3 complex or a CAR) with its cognate ligand (or tumor antigen in the case of a CAR), thereby mediating a signaling event, such as, but not limited to, signaling through the TCR / CD3 complex, or signaling through an appropriate NK receptor or signaling domain of the CAR. Stimulation may also mediate changes in the expression of certain molecules, e.g., downregulation of TGF-β, and / or remodeling of cytoskeletal structure, and the like.

[0197] The term "stimulatory molecule" refers to a molecule expressed by an immune effector cell (e.g., T cell, NK cell, B cell) that provides a cytoplasmic signaling sequence that regulates immune effector cell activation in a stimulatory manner, with respect to at least some aspects of an immune effector cell signaling pathway, e.g., a T cell signaling pathway. In one embodiment, the signal is a primary signal initiated, for example, by binding of the TCR / CD3 complex to a peptide-presenting MHC molecule, which results in mediation of T cell responses, including, but not limited to, proliferation, activation, differentiation, and allogeneic responses. The primary cytoplasmic signaling sequence (also referred to as a "primary signaling domain") that acts in a stimulatory manner may contain a signaling motif, known as an immunoreceptor tyrosine-based activation motif or ITAM. Examples of ITAMs containing primary cytoplasmic signaling sequences that have particular utility in the present invention include, but are not limited to, those derived from CD3 zeta, common FcR gamma (FCER1G), Fc gamma RIIa, FcR beta (Fc epsilon R1b), CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD278 (also known as "ICOS"), FcεRI, DAP10, DAP12, and CD66d. In certain CARs of the present invention, the intracellular signaling domain in any one or more CARs of the present invention comprises an intracellular signaling sequence, such as the primary signaling sequence of CD3-zeta. In certain CARs of the present invention, the primary signaling sequence of CD3-zeta is the sequence provided as SEQ ID NO: 18, or the equivalent residues from non-human species, such as mice, rodents, monkeys, apes, and the like. In certain CARs of the invention, the primary signaling sequence of CD3-zeta is the sequence provided in SEQ ID NO: 20, or the equivalent residues from a non-human species, such as mouse, rodent, monkey, ape, and the like.

[0198] The term "antigen-presenting cell" or "APC" refers to immune system cells such as accessory cells (e.g., B cells, dendritic cells, and allogeneic cells) that present foreign antigens complexed with major histocompatibility complexes (MHC) on their surface. T cells may recognize these complexes using their T cell receptors (TCRs). APCs process antigens and present them to T cells.

[0199] As used herein, the term "intracellular signaling domain" refers to the intracellular portion of a molecule. The intracellular signaling domain generates a signal that promotes the immune effector function of a CAR-expressing cell, such as a CART cell or a CAR-expressing NK cell. For example, examples of immune effector functions in a CART cell or a CAR-expressing NK cell include cytolytic activity and helper activity, such as cytokine secretion. Although the entire intracellular signaling domain may be employed, in many cases, it is not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signaling domain is used, such a truncated portion can be used in place of the intact chain as long as it transmits an effector function signal. Thus, the term intracellular signaling domain is intended to encompass any truncated portion of the intracellular signaling domain that is sufficient to transmit an effector function signal.

[0200] In some embodiments, the intracellular signaling domain may comprise a primary intracellular signaling domain. Exemplary primary intracellular signaling domains include those derived from molecules involved in primary stimulation or antigen-dependent simulation. In some embodiments, the intracellular signaling domain may comprise a costimulatory intracellular domain. Exemplary costimulatory intracellular signaling domains include those derived from molecules involved in costimulatory signals or antigen-independent stimulation. In some embodiments, the intracellular signaling domain is synthetic or engineered. For example, in the case of CAR-expressing immune effector cells, e.g., CART cells or CAR-expressing NK cells, the primary intracellular signaling domain may comprise a cytoplasmic sequence of a T cell receptor, the primary intracellular signaling domain may comprise a cytoplasmic sequence of a T cell receptor, and the costimulatory intracellular signaling domain may comprise a cytoplasmic sequence from a coreceptor or costimulatory molecule.

[0201] The primary intracellular signaling domain may contain a signaling motif known as an immunoreceptor tyrosine-based activation motif, or ITAM. Examples of ITAM-containing primary cytoplasmic signaling sequences include, but are not limited to, those derived from CD3 zeta, common FcR gamma (FCER1G), Fc gamma RIIa, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD278 ("ICOS"), FcεRICD66d, DAP10, and DAP12.

[0202] The terms "zeta" or alternatively "zeta chain," "CD3-zeta," or "TCR-zeta" are defined as the protein provided under GenBank Accession No. BAG36664.1, or equivalent residues from non-human species, e.g., mouse, rodent, monkey, ape, and the like, and "zeta stimulatory domain" or alternatively "CD3-zeta stimulatory domain" or "TCR-zeta stimulatory domain" are defined as amino acid residues from the cytoplasmic domain of the zeta chain sufficient to functionally transmit the initial signal required for T cell activation. In one embodiment, the zeta cytoplasmic domain comprises residues 52 to 164 of GenBank Accession No. BAG36664.1, or equivalent residues from non-human species that are functional orthologs thereof, e.g., mouse, rodent, monkey, ape, and the like. In one embodiment, the "zeta stimulatory domain" or "CD3-zeta stimulatory domain" is the sequence provided as SEQ ID NO: 18. In one embodiment, the "zeta stimulatory domain" or "CD3-zeta stimulatory domain" is the sequence provided as SEQ ID NO: 20. CD3 zeta domains that include one or more mutations relative to the amino acid sequence described herein, e.g., SEQ ID NO: 20, are also encompassed herein.

[0203] The term "costimulatory molecule" refers to the cognate binding partner on a T cell that specifically binds to a costimulatory ligand and thereby mediates a costimulatory response by the T cell, such as, but not limited to, proliferation. Costimulatory molecules are cell surface molecules other than antigen receptors or their ligands that are required for an efficient immune response. Costimulatory molecules include, but are not limited to, MHC class I molecules, TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocyte activation molecules (SLAM proteins), activating NK cell receptors, BTLA, Toll ligand receptors, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, LFA-1 (CD11a / CD18), and 4-1B. B (CD137), B7-H3, CDS, ICAM-1, ICOS (CD278), GITR, BAFFR, LIGHT, HVEM (LIGHTR), KIRDS2, SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8 alpha, CD8 beta, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, IT GA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2 , CD18, LFA-1, ITGB7, NKG2D, NKG2C, TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), Ligands that specifically bind to CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a, and CD83 are included.

[0204] The costimulatory intracellular signaling domain or costimulatory signaling domain can be the intracellular portion of a costimulatory molecule. The intracellular signaling domain can include the entire intracellular portion or the entire native intracellular signaling domain of the molecule from which it is derived, or a functional fragment thereof.

[0205] The term "4-1BB" refers to a member of the TNFR superfamily having the amino acid sequence provided as GenBank Accession No. AAA62478.2, or equivalent residues from non-human species, such as mouse, rodent, monkey, ape, and the like, and a "4-1BB costimulatory domain" is defined as amino acid residues 214-255 of GenBank Accession No. AAA62478.2, or equivalent residues from non-human species, such as mouse, rodent, monkey, ape, and the like. In one embodiment, the "4-1BB costimulatory domain" is the sequence provided as SEQ ID NO: 14, or equivalent residues from non-human species, such as mouse, rodent, monkey, ape, and the like.

[0206] The term "immune response," as used herein, is defined as a cellular response to an antigen that occurs when lymphocytes recognize the antigen molecule as foreign and induce the formation of antibodies and / or activate lymphocytes to eliminate the antigen.

[0207] When an "immunologically effective amount," an "autoimmune disease-inhibiting effective amount," or a "therapeutic amount" is indicated, the exact amount of the composition of the present invention to be administered can be determined by a doctor or researcher taking into account the age, weight, tumor size, degree of infection or metastasis, and individual differences in condition of the patient (subject).

[0208] "Immune effector cells," as the term is used herein, refer to cells that are involved in immune responses, for example, promoting immune effector responses. Examples of immune effector cells include T cells, such as alpha / beta T cells and gamma / delta T cells, B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, and myeloid-derived phagocytes.

[0209] "Immune effector function or immune effector response," as used herein, refers to, for example, a function or response of an immune effector cell that enhances or promotes immune attack of a target cell. For example, immune effector function or response refers to a property of a T or NK cell that promotes killing or inhibiting the growth or proliferation of a target cell. In the case of T cells, primary stimulation and costimulation are examples of immune effector functions or responses.

[0210] The term "effector function" refers to a specialized function of a cell. The effector function of a T cell can be, for example, cytolytic activity or helper activity such as cytokine secretion.

[0211] The term "encoding" refers to the inherent property of a specific sequence of nucleotides in a polynucleotide, such as a gene, cDNA, or mRNA, to serve as a template for the synthesis of other polymers and macromolecules in biological processes, having either a defined sequence of nucleotides (e.g., rRNA, tRNA, and mRNA) or a defined sequence of amino acids, and the resulting biological properties. Thus, a gene, cDNA, or RNA encodes a protein when a protein is produced in a cell or other biological system by transcription and translation of the mRNA corresponding to that gene. Both the coding strand, whose nucleotide sequence is identical to the mRNA sequence and usually shown in a sequence listing, and the non-coding strand used as a template for transcription of the gene or cDNA can be said to encode the protein or other product of that gene or cDNA.

[0212] Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Also, the phrase "nucleotide sequence encoding a protein or RNA" may include introns to the extent that the nucleotide sequence encoding the protein may contain introns in some cases.

[0213] The terms "effective amount" or "therapeutically effective amount" are used interchangeably herein and refer to an amount of a compound, formulation, material or composition as described herein that is effective to achieve a particular biological result.

[0214] The term "endogenous" refers to any material derived from or produced within an organism, cell, tissue, or system.

[0215] The term "exogenous" refers to any material introduced from outside an organism, cell, tissue or system, or produced outside thereof.

[0216] The term "expression" refers to the transcription and / or translation of a particular nucleotide sequence driven by a promoter.

[0217] The term "transfer vector" refers to a composition that contains an isolated nucleic acid and can be used to deliver the isolated nucleic acid into a cell. Numerous vectors are known in the art, including, but not limited to, linear polynucleotides, polynucleotides bound to ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term "transfer vector" encompasses autonomously replicating plasmids or viruses. This term should also be construed to include non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as polylysine compounds, liposomes, and the like. Examples of viral transfer vectors include, but are not limited to, adenoviral vectors, adeno-associated viral vectors, retroviral vectors, lentiviral vectors, and the like.

[0218] The term "expression vector" refers to a vector containing a recombinant polynucleotide comprising expression control sequences operably linked to a nucleotide sequence to be expressed. An expression vector contains sufficient cis-acting elements for expression; other elements for expression may be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., lentiviruses, retroviruses, adenoviruses, and adeno-associated viruses) incorporating the recombinant polynucleotide.

[0219] The term "lentivirus" refers to a genus of the Retroviridae family. Lentiviruses are unique among retroviruses in that they can infect non-dividing cells, and they are one of the most efficient gene delivery vectors, as they can deliver a significant amount of genetic information into the DNA of host cells. HIV, SIV, and FIV are all examples of lentiviruses.

[0220] The term "lentiviral vector" refers to a vector derived from at least a portion of a lentiviral genome, and particularly includes self-inactivating lentiviral vectors such as those described in Milone et al., Mol. Ther. 17(8): 1453-1464 (2009). Other examples of lentiviral vectors that may be used in clinical settings include, but are not limited to, Oxford BioMedica's LENTIVECTOR® gene delivery technology, Lentigen's LENTIMAX™ vector system, and the like. Non-clinical types of lentiviral vectors are also available and would be known to those skilled in the art.

[0221] The term "homology" or "identity" refers to the identity of subunit sequences between two polymers, for example, between two nucleic acid molecules, for example, between two DNA molecules or two RNA molecules, or between two polypeptide molecules. If a subunit position in both molecules is occupied by the same monomer subunit, for example, if a position in each of two DNA molecules is occupied by adenine, they are homologous or identical at that position. The homology between two sequences is a direct function of the number of matching or homologous positions; for example, if half of the positions in two sequences (e.g., 5 positions in a polymer length of 10 subunits) are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 out of 10) are matched or homologous, the two sequences are 90% homologous.

[0222] "Humanized" forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains, or antibody fragments thereof (e.g., Fv, Fab, Fab', F(ab')2, or other antigen-binding subsequences of antibodies) that contain minimal sequence derived from non-human immunoglobulin. In most cases, humanized antibodies and their antibody fragments are human immunoglobulins (recipient antibody or antibody fragment) in which residues from a complementarity-determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat, or rabbit having the desired specificity, affinity, and capacity. In some cases, Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies / antibody fragments may comprise residues found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications may further refine and optimize antibody or antibody fragment performance. Generally, a humanized antibody or antibody fragment thereof will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or a substantial portion of the FR regions are those of a human immunoglobulin sequence. The humanized antibody or antibody fragment may also comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details, see Jones et al., Nature, 321: 522-525, 1986; Reichmann et al., Nature, 332: 323-329, 1988; Presta, Curr. Op. Struct. Biol., 2: 593-596, 1992.

[0223] "Fully human" refers to an immunoglobulin, such as an antibody or antibody fragment, where the entire molecule is of human origin or consists of an amino acid sequence identical to a human form of the antibody or immunoglobulin.

[0224] The term "isolated" means altered or removed from the natural state. For example, a nucleic acid or peptide naturally present in a living animal is not "isolated," but the same nucleic acid or peptide is "isolated" if it is partially or completely separated from the coexisting materials in its natural state. An isolated nucleic acid or protein may exist in a substantially purified form, or may exist in a non-native environment, such as a host cell.

[0225] In the context of this disclosure, the following commonly occurring nucleobase abbreviations are used: "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.

[0226] The term "operably linked" or "transcriptional control" refers to the operably linking of a regulatory sequence with a heterologous nucleic acid sequence, resulting in the expression of the latter. For example, a first nucleic acid sequence is operably linked to a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For example, a promoter is operably linked to a coding sequence if it affects the transcription or expression of the coding sequence. Operatively linked DNA sequences can be contiguous with each other and can be in the same reading frame, for example, when necessary to combine the coding regions of two proteins.

[0227] The term "parenteral" administration of an immunogenic composition includes, for example, subcutaneous (sc), intravenous (iv), intramuscular (im) or intrasternal injection, intratumor, or infusion techniques.

[0228] The term "nucleic acid" or "polynucleotide" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and polymers thereof, in either single-stranded or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise specified, a particular nucleic acid sequence also encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences, as well as the sequence explicitly presented. Specifically, degenerate codon substitution can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with hybrid bases and / or deoxyinosine residues [Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)].

[0229] The terms "peptide," "polypeptide," and "protein" are used interchangeably and refer to compounds composed of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that may comprise a protein or peptide sequence. Polypeptides include any peptide or protein containing two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, commonly referred to in the art as peptides, oligopeptides, and oligomers, and longer chains, commonly referred to in the art as proteins, of which there are many types. "Polypeptides" include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, and fusion proteins, among others. Polypeptides include natural peptides, recombinant peptides, or combinations thereof.

[0230] The term "promoter" refers to a DNA sequence recognized by the synthetic machinery of a cell, or introduced synthetic machinery, necessary to initiate the specific transcription of a polynucleotide sequence.

[0231] The term "promoter / regulatory sequence" refers to a nucleic acid sequence required for expression of a gene product operably linked to the promoter / regulatory sequence. In some cases, this sequence may be the core promoter sequence, and in other instances, this sequence may also include enhancer sequences and other regulatory elements required for expression of the gene product. The promoter / regulatory sequence may, for example, be a promoter / regulatory sequence that expresses the gene product in a tissue-specific manner.

[0232] The term "constitutive" promoter refers to a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes a gene product to be produced in a cell under most or all physiological conditions of the cell.

[0233] The term "inducible" promoter refers to a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes the gene product to be produced in a cell substantially only when an inducer corresponding to the promoter is present in the cell.

[0234] The term "tissue-specific" promoter refers to a nucleotide sequence that, when operably linked to a polynucleotide encoding or specified by a gene, causes a gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.

[0235] The terms "cancer-associated antigen" or "tumor antigen" refer interchangeably to a molecule (typically a protein, carbohydrate, or lipid) that is expressed on the surface of cancer cells, either in whole or as fragments (e.g., MHC / peptides), and is useful for preferential targeting of pharmaceutical agents to cancer cells. In some embodiments, a tumor antigen is a marker expressed by both normal and cancer cells, such as a lineage marker, e.g., CD19 on B cells. In some embodiments, a tumor antigen is a cell surface molecule that is overexpressed in cancer cells compared to normal cells, e.g., 1-fold overexpression, 2-fold overexpression, 3-fold overexpression, or more, compared to normal cells. In some embodiments, a tumor antigen is a cell surface molecule that is inappropriately synthesized in cancer cells, e.g., a molecule that contains deletions, additions, or mutations compared to molecules expressed on normal cells. In some embodiments, a tumor antigen, either in whole or as fragments (e.g., MHC / peptides), is expressed exclusively on the cell surface of cancer cells and is not synthesized or expressed on the surface of normal cells. In some embodiments, exemplary tumor antigens include CD19; CD123; CD22; CD30; CD171; CS-1; C-type lectin-like molecule-1, CD33; epidermal growth factor receptor variant III (EGFRvIII); ganglioside G2 (GD2); ganglioside GD3; TNF receptor family member B-cell mutated (BCMA); Tn antigen [(Tn Ag) or (GalNAcα-Ser / Thr)]; prostate-specific membrane antigen (PSMA); receptor tyrosine kinase-like orphan receptor 1 (ROR1); Fms-like tyrosine kinase 3 (FLT3); tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6; carcinoembryonic antigen (CEA); epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); interleukin-13 receptor subunit alpha-2; mesothelin; interleukin-11 receptor alpha (IL-11Ra); prostate stem cell antigen (PSCA); prostatic serine 21; vascular endothelial growth factor receptor 2 (VEGFR2); Lewis (Y) antigen; CD24; platelet-derived growth factor receptor beta (PDGFR-beta); stage-specific embryonic antigen-4 (SSEA-4); CD20;Folate receptor alpha; receptor tyrosine protein kinase ERBB2 (Her2 / neu); cell surface-associated mucin 1 (MUC1); epidermal growth factor receptor (EGFR); neural cell adhesion molecule (NCAM); prostase; prostatic acid phosphatase (PAP); elongation factor 2 mutated (ELF2M); ephrin B2; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (IGF-I receptor), carbonic anhydrase IX (CAIX); proteasome (prosome, macropain) subunit, beta, 9 (LMP2); glycoprotein 100 (gp100); oncogene fusion protein consisting of the breakpoint cluster region (BCR) and Abelson murine leukemia viral oncogene homolog 1 (Abl) (bcr-abl); tyrosinase; ephrin type A receptor 2 (EphA2); fucosyl-GM1; sialyl-Lewis adhesion molecule (sLe); ganglioside GM3; transglutaminase o-acetyl-GD2 ganglioside (OAcGD2); folate receptor beta; tumor endothelial marker 1 (TEM1 / CD248); tumor endothelial marker 7-related (TEM7R); claudin 6 (CLDN6); thyroid-stimulating hormone receptor (TSHR); G protein-coupled receptor class C group 5, member D (GPRC5D); X chromosome open reading frame 61 (CXOR F61; CD97; CD179a; anaplastic lymphoma kinase (ALK); polysialic acid; placenta-specific 1 (PLAC1); hexasaccharide moiety of GloboH glycoceramide (GloboH); mammary differentiation antigen (NY-BR-1); uroplakin 2 (UPK2); hepatitis A virus cellular receptor 1 (HAVCR1); adrenergic receptor beta 3 (ADRB3); pannexin 3 (PANX3); G protein-coupled receptor 20 (GPR20); lymphocyte antigen 6 complex, locus K 9 (LY6K); olfactory receptor 51E2 (OR51E2); TCR gamma alternative reading frame protein (TARP); Wilms tumor protein (WT1); cancer / testis antigen 1 (NY-ESO-1); cancer / testis antigen 2 (LAGE-1a); melanoma-associated antigen 1 (MAGE-A1); ETS translocation mutant gene 6 located on chromosome 12p (ETV6-AML); sperm protein 17 (SPA17);X antigen family, member 1A (XAGE1); angiopoietin-binding cell surface receptor 2 (Tie 2); melanoma cancer testis antigen-1 (MAD-CT-1); melanoma cancer testis antigen-2 (MAD-CT-2); Fos-related antigen 1; tumor protein p53 (p53); p53 mutant; prostein; survivin; telomerase; prostate cancer tumor antigen-1, melanoma antigen 1 recognized by T cells; rat sarcoma (Ras) mutant; human telomerase reverse transcriptase (hTERT); sarcoma translocation breakpoint; melanoma inhibitor of apoptosis (ML-IAP); ERG [transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene]; N-acetylglucosaminyltransferase V (NA17); paired box protein Pax-3 (PAX3); androgen receptor; cyclin B1; v-myc avian myelocytic viral oncogene neuroblastoma-derived homolog (MYCN); Ras homolog family member C (RhoC); tyrosinase-related protein 2 (TRP-2); cytochrome P450 1B1 (CYP1B1); CCCTC-binding factor (zinc finger protein)-like, squamous cell carcinoma antigen 3 recognized by T cells (SART3); paired box protein Pax-5 (PAX5); proacrosin-binding protein sp32 (OY-TES1); lymphocyte-specific protein tyrosine kinase (LCK); A-kinase anchor protein 4 (AKAP-4); synovial sarcoma, X-chromosome breakpoint 2 (SSX2); receptor for advanced glycation end products (RAGE-1); renal ubiquitous 1 (RU1); renal ubiquitous 2 (RU2); legumain; human papillomavirus E6 (HPV E6); human papillomavirus E7 (HPV E7); intestinal carboxylesterase; heat shock protein 70-2 mutant (mutated) hsp70-2); CD79a; CD79b; CD72; leukocyte-associated immunoglobulin-like receptor 1 (LAIR1); Fc fragment of IgA receptor (FCAR or CD89); leukocyte-associated immunoglobulin-like receptor subfamily A member 2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12 member A (CLEC12A); bone marrow stromal cell antigen 2 (BST2); EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2);Lymphocyte antigen 75 (LY75); glypican 3 (GPC3); Fc receptor-like 5 (FCRL5); immunoglobulin lambda-like polypeptide 1 (IGLL1); TNF receptor family members; Fms-like tyrosine kinase 3 (FL-T3); CD10; CD19; CD20; CD21; CD22; CD23; CD24; CD25; CD37; CD38; CD53; CD72; CD73; CD74; CD75; CD77; CD79a; CD79b; CD80; CD81; CD82; CD83; CD84; CD85; ROR1; BCMA; CD86; CD179b; CD1a; CD1b; CD1c; CD1d; CD2; CD5; CD6; CD9; CD11a; CD11b ;CD11c;CD17;CD18;CD26;CD27;CD29;CD30;CD31;CD32a;CD32b;CD35;CD38;CD39;CD40;CD44;CD45;CD45RA;CD45RB; CD45RC;CD45RO;CD46;CD47;CD48;CD49b;CD49c;CD49d;CD50;CD52;CD54;CD55;CD58;CD60a;CD62L;CD63;CD63;CD68 CD69;CD70;CD85E;CD85I;CD85J;CD92;CD95;CD97;CD98;CD99;CD100;CD102;CD108;CD119;CD120a;CD120b;CD121b;CD122;CD124;CD125;CD126;CD13 0;CD132;CD137;CD138;CD139;CD147;CD148;CD150;CD152;CD162;CD164;CD166;CD167a;CD170;CD175;CD175s;CD180;CD184;CD185;CD192;CD196;CD 197;CD200;CD205;CD210a;CDw210b;CD212;CD213a1;CD213a2;CD215;CD217;CD218a;CD218b;CD220;CD221;CD224;CD225;CD226;CD227;CD229;CD230 ;CD232;CD252;CD253;CD257;CD258;CD261;CD262;CD263;CD264;CD267;CD268;CD269;CD270;CD272;CD274;CD275;CD277;CD279;CD283;CD289;CD290;CD295; CD298; CD300a; CD300c; CD305; CD306; CD307a; CD307b; CD307c; CD307d; CD307e; CD314; CD315; CD316; CD317; CD319; CD321; CD327; CD328; CD329; CD338; CD351; CD352; CD353; CD354; CD355; CD357; CD358; CD360; CD361; CD362; CD363; and peptides for any of these antigens presented on MHC. Particularly preferred antigens include CD19, CD20, CD22, FcRn5, FcRn2, BCMA, CS-1, CD138, CLDN6, mesothelin, EGFRvIII, CD123, CD33, and CLL-1. In some embodiments, the CAR of the present disclosure encompasses a CAR comprising an antigen-binding domain (e.g., an antibody or antibody fragment) that binds to an MHC-presented peptide. Typically, peptides derived from endogenous proteins fill the pocket of major histocompatibility complex (MHC) class I molecules and are recognized by T cell receptors (TCRs) on CD8+ T lymphocytes. MHC class I complexes are constitutively expressed by all nucleated cells. In cancer, virus-specific and / or tumor-specific peptide / MHC complexes represent a unique class of cell surface targets for immunotherapy. TCR-like antibodies targeting peptides derived from viral or tumor antigens in the context of human leukocyte antigen (HLA)-A1 or HLA-A2 have been described [e.g., Sastry et al., J Virol.2011 85(5):1935-1942; Sergeeva et al., Bood, 2011 117(16):4262-4272; Verma et al., J Immunol 2010 184(4):2156-2165; Willemsen et al., Gene Ther 2001 8(21):1601-1608; Dao et al., Sci Transl Med 2013 5(176):1763-1766;See Tassev et al., Cancer Gene Ther 2012 19(2):84-100. For example, TCR-like antibodies can be identified by screening libraries such as human scFv phage display libraries. Thus, the present disclosure provides a CAR comprising an antigen-binding domain that binds to an MHC-presented peptide of a molecule selected from the group consisting of WT1, NY-ESO-1, LAGE-1a, MAGE-A1, and RAGE-1.

[0236] The term "flexible polypeptide linker" or "linker," when used in the context of an scFv, refers to a peptide linker consisting of amino acids such as glycine and / or serine residues, used alone or in combination, to link the variable heavy and variable light chain regions together. In one embodiment, the flexible polypeptide linker is a Gly / Ser linker, having the amino acid sequence (Gly-Gly-Gly-Ser). n wherein n is a positive integer equal to or greater than 1. For example, n=1, n=2, n=3, n=4, n=5, and n=6, n=7, n=8, n=9, or n=10 (SEQ ID NO: 28). In one embodiment, flexible polypeptide linkers include, but are not limited to, (Gly4Ser)4 (SEQ ID NO: 29) or (Gly4Ser)3 (SEQ ID NO: 30). In another embodiment, the linker comprises multiple repeats of (Gly2Ser), (GlySer), or (Gly3Ser) (SEQ ID NO: 31). Linkers described in WO2012 / 138475, incorporated herein by reference, are also within the scope of the present invention.

[0237] 5' cap (RNA cap, RNA 7-methylguanosine cap or RNAm 7As used herein, a 5' cap (also referred to as a G-cap) is a modified guanine nucleotide added to the "front" or 5' end of eukaryotic messenger RNA immediately after transcription initiation. The 5' cap consists of a terminal group attached to the first transcribed nucleotide. Its presence is crucial for ribosome recognition and protection from RNases. Capping is coupled with transcription, occurring by co-transcription, each affecting the other. Shortly after transcription initiation, the 5' end of the mRNA being synthesized is bound to a cap-synthesizing complex associated with RNA polymerase. This enzymatic complex catalyzes the chemical reactions required for mRNA capping. Synthesis proceeds as a multistep biochemical reaction. The capping moiety may be modified to modulate mRNA functionality, such as its stability or translation efficiency.

[0238] "In vitro transcribed RNA," as used herein, refers to RNA, preferably mRNA, synthesized in vitro. Generally, in vitro transcribed RNA is produced from an in vitro transcription vector. The in vitro transcription vector contains a template used to produce the in vitro transcribed RNA.

[0239] As used herein, "poly(A)" is a series of adenosines attached to an mRNA by polyadenylation. In a preferred embodiment of a construct for transient expression, the poly(A) is between 50 and 5000 (SEQ ID NO: 32), preferably greater than 64, more preferably greater than 100, and most preferably greater than 300 or 400. The poly(A) sequence may be chemically or enzymatically modified to modulate mRNA functionality such as localization, stability, or translation efficiency.

[0240] "Polyadenylation," as used herein, refers to the covalent linkage of a polyadenylyl moiety or its modified variants to a messenger RNA molecule. In eukaryotes, most messenger RNA (mRNA) molecules are polyadenylated at their 3' ends. The 3' poly(A) tail is a long sequence (often several hundred) of adenine nucleotides added to pre-mRNA via the action of the enzyme polyadenylate polymerase. In higher eukaryotes, the poly(A) tail is added to transcripts containing a specific polyadenylation signal. The poly(A) tail and its associated proteins help protect mRNA from exonuclease degradation. Polyadenylation is also important for transcription termination, mRNA export outside the cell nucleus, and translation. Polyadenylation occurs in the cell nucleus immediately after DNA transcription into RNA, but can also occur later in the cytoplasm. After transcription is terminated, the mRNA strand is cleaved through the action of an endonuclease complex associated with RNA polymerase. The cleavage site is usually characterized by the presence of the base sequence AAUAAA near the cleavage site. After the mRNA is cleaved, an adenosine residue is added to the free 3' end at the cleavage site.

[0241] "Transient," as used herein, refers to expression of an unintegrated transgene for a period of hours, days, or weeks, where the period of expression is shorter than the period of expression of the gene when integrated into the genome or contained within a stable plasmid replicon in the host cell.

[0242] As used herein, the terms "treat," "treatment," and "treating" refer to a reduction or amelioration of the progression, severity, and / or duration of a proliferative disorder, or an amelioration of one or more symptoms (preferably one or more discernible symptoms) of a proliferative disorder, resulting from the administration of one or more therapies (e.g., one or more therapeutic agents, e.g., a CAR of the invention). In certain embodiments, the terms "treat," "treatment," and "treating" refer to an amelioration of at least one measurable physical parameter of a proliferative disorder, such as tumor growth, which may not necessarily be discernible by the patient. In other embodiments, the terms "treat," "treatment," and "treating" refer to inhibiting the progression of a proliferative disorder, either physically, e.g., by stabilization of a discernible symptom, physiologically, e.g., by stabilization of a physical parameter, or both. In other embodiments, the terms "treat," "treatment," and "treating" refer to a reduction or stabilization of tumor size or cancer cell number.

[0243] The term "signal transduction pathway" refers to the biochemical relationships between various signaling molecules that play a role in transmitting a signal from one part of a cell to another part of the cell. The phrase "cell surface receptor" encompasses molecules and molecular complexes that can receive a signal and transmit the signal across the cell membrane.

[0244] The term "subject" is intended to include organisms (e.g., mammals, humans) in which an immune response can be elicited. A "subject" or "patient," as used herein, may be a human or a non-human mammal. Non-human mammals include, for example, livestock and pets, such as sheep, cows, pigs, dogs, cats, and murine mammals. Preferably, the subject is a human.

[0245] The term "substantially purified" cells refers to cells that are essentially free of other cell types. Substantially purified cells also refer to cells that have been separated from other cell types that normally coexist with them in their naturally occurring context. In some cases, a population of substantially purified cells refers to a homogenous population of cells. In other instances, the term simply refers to cells that have been separated from the cells that naturally coexist with them in their native state. In some embodiments, such cells are cultured in vitro. In other embodiments, such cells are not cultured in vitro.

[0246] The term "suicide gene," as used herein, refers to a suicide or apoptosis-inducing gene operably linked to a promoter that may be constitutive or inducible. Examples of suicide genes include, but are not limited to, herpes simplex virus thymidine kinase (HSV-TK), the cytoplasmic domain of Fas, caspases such as caspase-8 or caspase-9, cytosine deaminase, E1A, FHIT, and other known suicide or apoptosis-inducing genes.

[0247] The term "suicide gene product" or "suicide domain" as used herein refers to the expression product of a suicide gene.

[0248] The term "therapeutic" as used herein means treatment. A therapeutic effect is achieved by reducing, suppressing, ameliorating, or eliminating a disease condition.

[0249] The term "tolerance" or "immune tolerance," as used herein, refers to a state in which a subject's immune response to a specific antigen or group of antigens to which the subject normally responds is reduced or absent. Tolerance is achieved under conditions that suppress the immune response, and is not simply the absence of an immune response. In certain embodiments, tolerance in a subject may be characterized by one or more of the following: a reduced level of a specific immunological response (e.g., one mediated by antigen-specific effector T lymphocytes, B lymphocytes, or antibodies) compared to an untreated subject; a delayed initiation or progression of a specific immunological response; or a reduced risk of initiation or progression of a specific immunological response.

[0250] The term "prophylaxis" as used herein means the prevention or prophylactic treatment of a disease or condition.

[0251] The terms "transfection" or "transformation" or "transduction" refer to the process of transferring or introducing exogenous nucleic acid into a host cell. A "transfected" or "transformed" or "transduced" cell is one that has been transfected, transformed, or transduced with exogenous nucleic acid. The cell includes the primary subject cell and its progeny.

[0252] The term "specifically binds" refers to an antibody or ligand that recognizes and binds to its cognate binding partner (e.g., a stimulatory and / or costimulatory molecule present on a T cell) protein present in a sample, but does not substantially recognize or bind to other molecules in the sample.

[0253] "Refractory," as used herein, refers to a disease, e.g., a cancer, that does not respond to treatment. In embodiments, a refractory cancer may be resistant to treatment before or at the start of treatment. In other embodiments, a refractory cancer may become resistant during treatment. A refractory cancer is also referred to as a resistant cancer.

[0254] "Relapsed" or "recurrence," as used herein, refers to the return or reappearance of a disease (e.g., cancer) or signs and symptoms of a disease, such as cancer, after a period of improvement or responsiveness, e.g., after a previous treatment, e.g., a cancer treatment. The initial responsive period can include a decrease in the level of cancer cells below a certain threshold, e.g., below 20%, 1%, 10%, 5%, 4%, 3%, 2%, or 1%. Reappearance can include a rise in the level of cancer cells above a certain threshold, e.g., above 20%, 1%, 10%, 5%, 4%, 3%, 2%, or 1%. For example, in the context of B-ALL, reappearance can include the reappearance of blasts in the blood, bone marrow (>5%), or any extramedullary site, e.g., after a complete response. A complete response in this context can include <5% BM blasts. More generally, in certain embodiments, a response (e.g., a complete or partial response) can include the absence of detectable MRD (minimal residual disease). In certain embodiments, the initial response period lasts for at least 1, 2, 3, 4, 5, or 6 days, at least 1, 2, 3, or 4 weeks, at least 1, 2, 3, 4, 6, 8, 10, or 12 months, or at least 1, 2, 3, 4, or 5 years.

[0255] Ranges: Throughout this disclosure, various aspects of the invention may be presented in range format. It will be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range shall be considered to have specifically disclosed all possible subranges, as well as individual numerical values ​​within that range. For example, the description of a range such as 1 to 6 would be considered to have specifically disclosed subranges, such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numerical values ​​within that range, e.g., 1, 2, 2.7, 3, 4, 5, 5.3, and 6. As another example, a range such as 95-99% identity includes something with 95%, 96%, 97%, 98% or 99% identity, and also includes subranges such as 96-99%, 96-98%, 96-97%, 97-99%, 97-98% and 98-99% identity, regardless of the breadth of the range.

[0256] Fusion proteins Provided herein are fusion proteins comprising two protein domains separated by a heterologous protease cleavage site (e.g., a protease cleavage site cleaved by a mammalian intracellular or extracellular protease), wherein the first of the protein domains is a conditional expression domain, e.g., a degradation domain or an aggregation domain. In some embodiments, the fusion proteins described herein contain three essential elements: a conditional expression domain, e.g., a degradation domain or an aggregation domain; a domain containing the protein of interest; and a protease cleavage domain separating the two. These elements can be positioned so that the conditional expression domain, e.g., the degradation domain or the aggregation domain, is located either N-terminally or C-terminally to the protein of interest.

[0257] In some embodiments, the fusion proteins described herein include a furin cleavage site. In some embodiments, the fusion proteins described herein include any one of the furin cleavage sites listed in Table 20. In some embodiments, the fusion proteins described herein include any one of the furin cleavage sites listed in Table 20. In some embodiments, the fusion proteins described herein include any one of the furin cleavage sites listed in Table 20. In some embodiments, the fusion proteins described herein include any one of the furin cleavage sites listed in Table 20. a sequence having at least 90%, 95%, 97%, 98% or 99% identity thereto; GTGAEDPRPSRKRRSLGG (SEQ ID NO: 131) or a sequence having at least 90%, 95%, 97%, 98% or 99% identity thereto; GTGAEDPRPSRKRRSLG (SEQ ID NO: 133) or a sequence having at least 90%, 95%, 97%, 98% or 99% identity thereto; SLNLTESHNSRKKR (SEQ ID NO: 135) or a sequence having at least 90%, 95%, 97%, 98% or 99% identity thereto; 95%, 97%, 98%, or 99% identity thereto; or CKINGYPKRGRKRR (SEQ ID NO: 137) or a sequence having at least 90%, 95%, 97%, 98%, or 99% identity thereto. In some embodiments, the fusion proteins described herein include a furin cleavage site selected from GTGAEDPRPSRKRRSLGDVG (SEQ ID NO: 125) or a sequence having at least 90%, 95%, 97%, 98%, or 99% identity thereto, or GTGAEDPRPSRKRR (SEQ ID NO: 127) or a sequence having at least 90%, 95%, 97%, 98%, or 99% identity thereto. In some embodiments, the fusion proteins described herein include a furin cleavage site selected from GTGAEDPRPSRKRRSLGDVG (SEQ ID NO: 125) or a sequence having at least 90%, 95%, 97%, 98%, or 99% identity thereto.

[0258] In some embodiments, the fusion proteins described herein comprise a furin cleavage site selected from RTKR (SEQ ID NO: 123), GTGAEDPRPSRKRRSLGDVG (SEQ ID NO: 125), GTGAEDPRPSRKRR (SEQ ID NO: 127), LQWLEQQVAKRRTKR (SEQ ID NO: 129), GTGAEDPRPSRKRRSLGG (SEQ ID NO: 131), GTGAEDPRPSRKRRSLG (SEQ ID NO: 133), SLNLTESHNSRKKR (SEQ ID NO: 135), or CKINGYPKRGRKRR (SEQ ID NO: 137). In some embodiments, the fusion proteins described herein encompass a furin cleavage site selected from GTGAEDPRPSRKRRSLGDVG (SEQ ID NO: 125) or GTGAEDPRPSRKRR (SEQ ID NO: 127). In some embodiments, the fusion proteins described herein encompass a furin cleavage site of GTGAEDPRPSRKRRSLGDVG (SEQ ID NO: 125).

[0259] In some embodiments, the fusion proteins described herein include a furin degron (FurON) domain, which contains two components: a degron or degradation domain, a mutated protein domain that cannot acquire the proper conformation in the absence of a small molecule ligand, and a furin cleavage site. The furin degron domain may be fused to a protein of interest expressed in the endoplasmic reticulum. The N-terminus and / or C-terminus of the protein of interest can be used as the fusion site, provided that the furin degron domain faces the lumen of the endoplasmic reticulum. The protein of interest may be a membrane protein (with any number of transmembrane domains) or a soluble protein. The orientation of the furin cleavage site relative to the degron domain should be such that cleavage results in separation of the furin degron domain and the protein of interest. In the absence of a small molecule ligand or stabilizing compound, the furin degron domain destabilizes or degrades the entire fusion protein. In the presence of a small molecule ligand or stabilizing compound, the furin protein is resistant to degradation. The furin degron domain is mutated to eliminate affinity for its natural endogenous ligand, to preserve affinity for small molecule ligands or stabilizing compounds, and to confer protein instability in the absence of the small molecule.

[0260] In some embodiments, the degron or degradation domain is derived from a protein listed in Table 21. In some embodiments, the degron or degradation domain is derived from an estrogen receptor. In some embodiments, the degron or degradation domain comprises an amino acid sequence selected from SEQ ID NO:58 or a sequence having at least 90%, 95%, 97%, 98%, or 99% identity thereto, or SEQ ID NO:121 or a sequence having at least 90%, 95%, 97%, 98%, or 99% identity thereto. In some embodiments, the degron or degradation domain comprises an amino acid sequence selected from SEQ ID NO:58 or SEQ ID NO:121.

[0261] In some embodiments, the degron or degradation domain is derived from an FKB protein (FKBP). In some embodiments, the degradation domain comprises the amino acid sequence of SEQ ID NO: 56, or a sequence having at least 90%, 95%, 97%, 98%, or 99% identity thereto. In some embodiments, the degradation domain comprises the amino acid sequence of SEQ ID NO: 56.

[0262] In some embodiments, the degron or degradation domain is derived from dihydrofolate reductase (DHFR). In some embodiments, the degradation domain comprises an amino acid sequence selected from SEQ ID NO: 57, or a sequence having at least 90%, 95%, 97%, 98%, or 99% identity thereto. In some embodiments, the degradation domain comprises an amino acid sequence selected from SEQ ID NO: 57. In some embodiments, the degron or degradation domain is not derived from an FKB protein, an estrogen receptor, or DHFR.

[0263] Protein of interest The fusion proteins of the present invention can encompass virtually any protein of interest. In certain preferred embodiments, the protein of interest may be a transmembrane protein (e.g., a transmembrane receptor). The fusion protein format of the present invention is particularly useful for such transmembrane proteins, because including an intact conditional expression domain, such as a degradation domain or, for example, an aggregation domain, at the N-terminus of a transmembrane receptor may result in the activity of the protein of interest being disrupted, while including it at the C-terminus may result in the protein of interest being dysregulated (because, for example, membrane integration may result in sufficient stabilization of the protein or degradation domain to avoid degradation and / or aggregation). One example of a class of proteins of interest is a chimeric antigen T-cell receptor, as described in the following section.

[0264] Chimeric Antigen Receptor In some embodiments, the protein of interest is a chimeric antigen receptor (CAR) comprising an antigen-binding domain (e.g., an antibody or antibody fragment, a TCR or TCR fragment) that binds to a tumor antigen as described herein, a transmembrane domain (e.g., a transmembrane domain described herein), and an intracellular signaling domain (e.g., an intracellular signaling domain described herein) (e.g., an intracellular signaling domain comprising a costimulatory domain (e.g., a costimulatory domain described herein) and / or a primary signaling domain (e.g., a primary signaling domain described herein). The CAR nucleic acid constructs, encoded proteins, containing vectors, host cells, pharmaceutical compositions, and administration and treatment methods related to the present disclosure are disclosed in detail in International Patent Application Publication No. WO2015142675, which is incorporated by reference in its entirety.

[0265] In some embodiments, the protein of interest is a chimeric antigen receptor (CAR) comprising an antigen-binding domain (e.g., an antibody or antibody fragment, a TCR or a TCR fragment) that binds to a tumor-supporting antigen (e.g., a tumor-supporting antigen as described herein), a transmembrane domain (e.g., a transmembrane domain described herein), and an intracellular signaling domain (e.g., an intracellular signaling domain described herein) (e.g., an intracellular signaling domain comprising a costimulatory domain (e.g., a costimulatory domain described herein) and / or a primary signaling domain (e.g., a primary signaling domain described herein). In some embodiments, the tumor-supporting antigen is an antigen present on stromal cells or myeloid-derived suppressor cells (MDSCs). In other aspects, the invention features polypeptides encoded by such nucleic acids, as well as host cells containing such nucleic acids and / or polypeptides.

[0266] In some embodiments, the CAR molecule comprises at least one intracellular signaling domain selected from a CD137 (4-1BB) signaling domain, a CD28 signaling domain, a CD27 signaling domain, an ICOS signaling domain, a CD3 zeta signal domain, or any combination thereof. In some embodiments, the CAR molecule comprises at least one intracellular signaling domain selected from one or more costimulatory molecules selected from CD137 (4-1BB), CD28, CD27, or ICOS.

[0267] In some embodiments, the present invention also encompasses methods of modifying T cells using a chimeric antigen receptor (CAR) and a suicide gene. Thus, the present invention encompasses a nucleic acid encoding a CAR or a modified T cell comprising a CAR, wherein the CAR comprises an antigen-binding domain, a transmembrane domain, and an intracellular domain.

[0268] Examples of CARs are described in U.S. Patent Nos. 8,911,993, 8,906,682, 8,975,071, 8,916,381, 9,102,760, 9,101,584, and 9,102,761, all of which are incorporated by reference in their entirety.

[0269] Non-limiting example sequences of various components that can be part of a CAR molecule are listed in Table 2, where "aa" represents an amino acid and "na" represents a nucleic acid that encodes the corresponding peptide.

[0270] [Table 1] [Table 2] [Table 3] [Table 4] [Table 5] [Table 6]

[0271] In certain embodiments, the CAR construct comprises an scFv domain, where the scFv may be preceded by an optional leader sequence, such as that provided in SEQ ID NO:2, followed by an optional hinge sequence, such as that provided in SEQ ID NO:4 or SEQ ID NO:6 or SEQ ID NO:8 or SEQ ID NO:10, a transmembrane region, such as that provided in SEQ ID NO:12, an intracellular signaling domain comprising any one of SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:120 or SEQ ID NO:124, and a CD3 zeta sequence comprising SEQ ID NO:18 or SEQ ID NO:20, e.g., said domains are contiguous and in the same reading frame to form a single fusion protein.

[0272] In one embodiment, an exemplary CAR construct comprises an optional leader sequence (e.g., a leader sequence described herein), an extracellular antigen binding domain (e.g., an antigen binding domain described herein), a hinge (e.g., a hinge region described herein), a transmembrane domain (e.g., a transmembrane domain described herein), and an intracellular stimulatory domain (e.g., an intracellular stimulatory domain described herein). In one embodiment, an exemplary CAR construct comprises an optional leader sequence (e.g., a leader sequence described herein), an extracellular antigen binding domain (e.g., an antigen binding domain described herein), a hinge (e.g., a hinge region described herein), a transmembrane domain (e.g., a transmembrane domain described herein), an intracellular costimulatory signaling domain (e.g., a costimulatory signaling domain described herein), and / or an intracellular primary signaling domain (e.g., a primary signaling domain described herein).

[0273] An exemplary leader sequence is provided as SEQ ID NO: 2. An exemplary hinge / spacer sequence is provided as SEQ ID NO: 4 or SEQ ID NO: 6 or SEQ ID NO: 8 or SEQ ID NO: 10. An exemplary transmembrane domain sequence is provided as SEQ ID NO: 12. An exemplary sequence of the intracellular signaling domain of 4-1BB protein is provided as SEQ ID NO: 14. An exemplary sequence of the intracellular signaling domain of CD27 is provided as SEQ ID NO: 16. An exemplary sequence of the intracellular signaling domain of ICOS is provided as SEQ ID NO: 120. An exemplary sequence of the intracellular signaling domain of CD28 is provided as SEQ ID NO: 124. An exemplary CD3 zeta domain sequence is provided as SEQ ID NO: 18 or SEQ ID NO: 20.

[0274] Nucleic acid sequences encoding the desired molecules can be obtained using recombinant methods known in the art, such as by screening libraries from cells which express the nucleic acid molecule, by extracting the nucleic acid molecule from a vector known to contain it, or by direct isolation using standard techniques from cells and tissues containing the gene, etc. Alternatively, the nucleic acid of interest can be produced synthetically rather than cloned.

[0275] antigen-binding domain In one embodiment, a chimeric antigen receptor (CAR) comprises a target-specific binding element, otherwise referred to as an antigen-binding domain. The selection of the portion depends on the type and number of ligands that define the target cell surface. For example, the antigen-binding domain can be selected or engineered to recognize a ligand that acts as a cell surface marker on target cells associated with a particular disease state, such as a tumor antigen associated with a particular cancer (e.g., an antigen-binding domain that binds to a tumor antigen). In other embodiments, the antigen-binding domain is selected or engineered to recognize normal B cells or a subpopulation of B cells to deplete normal B cells or a target B cell population (e.g., an antigen-binding domain that binds to a B cell antigen).

[0276] The antigen-binding domain can be any domain that binds to antibodies, including but not limited to monoclonal antibodies, polyclonal antibodies, recombinant antibodies, bispecific antibodies, conjugated antibodies, human antibodies, humanized antibodies, and functional fragments thereof (including but not limited to single-domain antibodies, such as camelid-derived nanobodies, heavy chain variable domains (VH), light chain variable domains (VL), and variable domains (VHH)), and alternative scaffolds known in the art to function as antigen-binding domains, such as recombinant fibronectin domains, T cell receptors (TCR), affinity-enhanced recombinant TCRs, or fragments thereof, such as single-chain TCRs, and the like. In some cases, it is beneficial for the antigen-binding domain to be derived from the same species as the CAR is expected to ultimately be used. For example, when used in humans, it may be beneficial for the antigen-binding domain of the CAR to contain human or humanized residues in the antigen-binding domain of an antibody or antibody fragment.

[0277] In some embodiments, the antigen binding domain of the encoded CAR molecule comprises an antibody, antibody fragment, scFv, Fv, Fab, (Fab')2, single domain antibody (SDAB), VH or VL domain, camelid VHH domain, or bifunctional (e.g., bispecific) hybrid antibody [e.g., Lanzavecchia et al., Eur. J. Immunol. 17, 105 (1987)].

[0278] In some embodiments, the antigen-binding domain of the encoded CAR molecule comprises an scFv. In some cases, scFv can be prepared according to methods known in the art (see, for example, Bird et al., (1988) Science 242:423-426 and Huston et al., (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883). scFv molecules can be produced by linking VH and VL regions together using a flexible polypeptide linker.

[0279] In one embodiment, the antigen binding domain of the CAR is an scFv antibody fragment that is humanized relative to the murine sequence of the scFv from which it is derived.

[0280] In one embodiment, the antigen-binding domain (e.g., scFv) of the CAR of the present invention is encoded by a nucleic acid molecule whose sequence has been codon-optimized for expression in mammalian cells. In one embodiment, the entire CAR construct of the present invention is encoded by a nucleic acid molecule whose entire sequence has been codon-optimized for expression in mammalian cells. Codon optimization refers to the discovery that the frequency of synonymous codons (i.e., codons that encode the same amino acid) in coding DNA is biased across different species. This codon degeneracy allows identical polypeptides to be encoded by various nucleotide sequences. Various codon optimization methods are known in the art, including, for example, the methods disclosed in at least U.S. Patent Nos. 5,786,464 and 6,114,148. In one embodiment, the CAR comprises an antigen-binding domain that binds to B cells. A cell surface marker selectively found on B cells can serve as an antigen that binds to the antigen-binding domain of the CAR. The anti-B cell antigen-binding domain can include any domain that binds to B cells, including, but not limited to, monoclonal antibodies, polyclonal antibodies, synthetic antibodies, human antibodies, humanized antibodies, non-human antibodies, and any fragments thereof. Thus, in one embodiment, the antigen-binding domain portion comprises a mammalian antibody or a fragment thereof, such as a short-chain variable fragment (scFv). The antigen-binding domain can bind to one or more antigens, including, but not limited to, any surface marker selectively found on B cells, such as pro-B cells, pre-B cells, immature B cells, mature B cells, memory B cells, and plasma cells. In one embodiment, the antigen-binding domain binds to at least one antigen, such as CD19, BCMA, and any combination thereof. In another embodiment, the antigen-binding domain binds to at least one antigen, such as CD20, CD21, CD27, CD38, CD138, and any combination thereof. In some cases, it is beneficial for the species from which the antigen-binding domain is derived to be the same species as the species in which the CAR will ultimately be used.For example, for human use, it may be beneficial for the antigen-binding domain of the CAR to comprise a human antibody, a humanized antibody as described elsewhere herein, or a fragment thereof.

[0281] tumor antigens In some embodiments, the antigen-binding domain of the CAR specifically targets a tumor antigen. There are two classes of tumor antigens (tumor antigens, TAs) that can be targeted by CARs: (1) tumor antigens that are expressed on the surface of cancer cells; and (2) tumor antigens that are themselves intracellular, but fragments (peptides) of such antigens are presented on the surface of cancer cells by MHC (major histocompatibility complex).

[0282] In one embodiment, the tumor antigen is expressed on both normal cells and cancer cells, but at a lower level on normal cells. In one embodiment, the method further includes selecting a CAR that binds to the tumor antigen with an affinity that allows the engineered cells to bind to and kill cancer cells that express the tumor antigen, but does not kill more than 30%, 25%, 20%, 15%, 10%, 5% or more of normal cells that express the tumor antigen, as determined, for example, by an assay described herein. For example, a killing assay such as flow cytometry based on Cr51 CTL can be used. In one embodiment, the selected CAR has a 10% affinity for the target antigen. -4 M~10 -8 M, e.g., 10 -5 M~10 -7 M, e.g., 10 -6 M or 10 -7 Binding affinity K of M D In one embodiment, the selected antigen-binding domain has a binding affinity that is at least 5, 10, 20, 30, 50, 100, or 1000 fold lower than that of a reference antibody, e.g., an antibody described herein.

[0283] Thus, cells can be engineered to express a CAR that includes an antigen binding domain capable of targeting, e.g., binding, any one of the following exemplary tumor antigens: CD123, CD30, CD171, CS-1, CLL-1 (CLECL1), CD33, EGFRvIII, GD2, GD3, Tn Ag, sTn Ag, Tn-O-glycopeptide, Stn-O-glycopeptide, PSMA, FLT3, FAP, TAG72, CD44v6, CEA, EPCAM, B7H3, KIT, IL-13Ra2, mesothelin, IL-11Ra, PSCA, VEGFR2, Lewis Y, PDGFR-beta, PRSS21, SSEA-4, folate receptor alpha, ERBB2 (Her2 / neu), MUC1, EGFR, NCAM, Prostase, PAP, ELF2M, ephrin B2, IGF-I receptor, CAIX, LMP2, gp100, bcr-abl, tyrosinase, EphA2, fucosyl GM1, sLe, GM3, TGS5, HMWMAA, o-acetyl-GD2, folate receptor beta, TEM1 / CD248, TEM7R, CLDN6, TSHR, GPRC5D, CXORF61, CD97, CD179a, ALK, polysialic acid acid), PLAC1, GloboH, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, GPR20, LY6K, OR51E2, TARP, WT1, NY-ESO-1, LAGE-1a, legumain, HPV E6, E7, MAGE-A1, MAGE A1, ETV6-AML, sperm protein 17, XAGE1, Tie 2, MAD-CT-1, MAD-CT-2, Fos-related antigen 1, p53, p53 mutants, prostein, survivin and telomerase, PCTA-1 / galectin 8, MelanA / MART1, Ras mutants, hTERT, sarcoma translocation breakpoints, ML-IAP, ERG (TMPRSS2) ETS fusion gene), NA17, PAX3, androgen receptor, cyclin B1, MYCN, RhoC, TRP-2, CYP1B1, BORIS, SART3, PAX5, OY-TES1, LCK, AKAP-4, SSX2, RAGE-1, human telomerase reverse transcriptase, RU1, RU2, intestinal carboxylesterase, muthsp70-2, LAIR1, FCAR, LILRA2, CD300LF, CLEC12A, BST2, EMR2, LY75, GPC3, FCRL5, IGLL1, CD10, CD19, CD20, CD21, CD22, CD23, CD24, CD 25, CD37, CD38, CD53, CD72, CD73, CD74, CD75, CD77, CD79a, CD79b, CD80, CD81, CD82, CD83, CD84, CD85, ROR1, BCMA, CD86, and CD179b. Other B cell antigens that can be targeted by the CARs described herein include: CD1a, CD1b, CD1c, CD1d, CD2, CD5, CD6, CD9, CD11a, CD11b, CD11c, CD17, CD18, CD26, CD27, CD29, CD30, CD31, CD32a, CD32b, CD35, CD38, CD39, CD40, CD44, CD45, CD45RA, CD45RB, CD45RC, CD45RO, CD46, CD47, CD48, CD49b, CD49c, CD49d, CD50, CD52, CD54, CD55, CD58, CD60a, CD62L, CD63, CD68CD69, CD70, CD85E, CD85I, CD85J, CD92, CD95, CD97, CD98, CD99, CD100, CD102, CD108, CD119, CD120a, CD120b, CD121b, CD122, CD124, CD125, CD126, CD130, CD132, CD137, CD138, CD139, CD147, CD148, CD150, CD152, CD162, CD164, CD166, CD167a, CD170, CD175, CD175s, CD180, CD184, CD185, CD192, CD196, CD197, CD200, CD205, CD210 a, CDw210b, CD212, CD213a1, CD213a2, CD215, CD217, CD218a, CD218b, CD220, CD221, CD224, CD225, CD226, CD2 27, CD229, CD230, CD232, CD252, CD253, CD257, CD258, CD261, CD262, CD263, CD264, CD267, CD268, CD269, CD27 0, CD272, CD274, CD275, CD277, CD279, CD283, CD289, CD290, CD295, CD298, CD300a, CD300c, CD305, CD306, CD3 07a, CD307b, CD307c, CD307d, CD307e, CD314, CD315, CD316, CD317, CD319, CD321, CD327, CD328, CD329, CD338, CD351, CD352, CD353, CD354, CD355, CD357, CD358, CD360, CD361, CD362, CD363, and peptides of these antigens presented on MHC.

[0284] In some embodiments, the antigen binding domain of the CAR targets a tumor antigen associated with a solid tumor, e.g., expressed by a solid tumor cell, referred to herein as a solid tumor-associated antigen, e.g., an antigen associated with mesothelioma (e.g., malignant pleural mesothelioma), lung cancer (e.g., non-small cell lung cancer, small cell lung cancer, squamous cell lung cancer, or large cell lung cancer), pancreatic cancer (e.g., pancreatic ductal adenocarcinoma), esophageal adenocarcinoma, ovarian cancer, breast cancer, colorectal cancer, and bladder cancer, or any combination thereof. In one embodiment, the disease is pancreatic cancer, e.g., metastatic pancreatic ductal adenocarcinoma (PDA), e.g., in a subject that has progressed on at least one previous standard of care. In one embodiment, the disease is mesothelioma (e.g., malignant pleural mesothelioma), e.g., in a subject that has progressed on at least one previous standard of care. In one embodiment, the disease is ovarian cancer, e.g., serous epithelial ovarian cancer, e.g., in a subject that has progressed after at least one previous standard of care regimen.

[0285] Examples of tumor-associated antigens (e.g., solid tumor antigens) include, but are not limited to, EGFRvIII, mesothelin, GD2, Tn antigen, sTn antigen, Tn-O-glycopeptide, sTn-O-glycopeptide, PSMA, CD97, TAG72, CD44v6, CEA, EPCAM, KIT, IL-13Ra2, leguman, GD3, CD171, IL-11Ra, PSCA , MAD-CT-1, MAD-CT-2, VEGFR2, Lewis Y, CD24, PDGFR-beta, SSEA-4, folate receptor alpha, ERBB (e.g., ERBB2), Her2 / neu, MUC1, EGFR, NCAM, ephrin B2, CAIX, LMP2, sLe, HMWMAA, o-acetyl-GD2, folate receptor beta, TEM1 / CD248, TEM7R, FAP, legumain, HPV E6 or E7, ML-IAP, CLDN6, TSHR, GPRC5D, ALK, polysialic acid, Fos-related antigen, neutrophil elastase, TRP-2, CYP1B1, sperm protein 17, beta-human chorionic gonadotropin, AFP, thyroglobulin, PLAC1, globoH, RAGE1, MN-CA IX, human telomerase reverse transcriptase, intestinal carboxylesterase, mut hsp 70-2, NA-17, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, NY-ESO-1, GPR20, Ly6k, OR51E2, TARP, GFRα4, and peptides for any of these antigens presented on MHC.

[0286] In one embodiment, the antigen-binding domain of the CAR binds to human mesothelin. In one embodiment, the antigen-binding domain is a mouse scFv domain that binds to human mesothelin, such as SS1 shown in Table 3. In one embodiment, the antigen-binding domain is a humanized antibody or antibody fragment, such as an scFv domain derived from mouse SS1 scFv. In one embodiment, the antigen-binding domain is a human antibody or antibody fragment that binds to human mesothelin. Exemplary human scFv domains (and their sequences) that bind to mesothelin and mouse SS1 scFv are provided in Table 3. CDR sequences are underlined. The scFv domain sequences provided in Table 3 include a light chain variable region (VL) and a heavy chain variable region (VH). The VL and VH are attached by a linker comprising the sequence GGGGSGGGGSGGGGS (SEQ ID NO: 30) (e.g., as shown in the SS1 scFv domain) or GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 29) (e.g., as shown in the M1, M2, M3, M4, M5, M6, M7, M8, M9, M10, M11, M12, M13, M14, M15, M16, M17, M18, M19, M20, M21, M22, M23, or M24 scFv domains). The scFv domains listed in Table 3 are in the following orientation: VL-linker-VH.

[0287] [Table 7] [Table 8] [Table 9] [Table 10] [Table 11]

[0288] The CDR sequences of the scFv domains of the mesothelin antigen binding domains provided in Table 3 are shown in Table 4 for the heavy chain variable domain and in Table 5 for the light chain variable domain.

[0289] [Table 12] [Table 13]

[0290] [Table 14] [Table 15]

[0291] Any known anti-mesothelin binding domain, e.g., from a known antibody, bispecific molecule, or CAR, can be suitable for use in the CARs of the present invention. For example, the antigen-binding domain for mesothelin can be or be derived from the antigen binding, e.g., CDRs or VH and VL, of an antibody, antigen-binding fragment, or CAR, as described, e.g., in PCT Publication WO2015 / 090230. In embodiments, the antigen-binding domain against mesothelin is or is derived from an antigen-binding portion of an antibody, antigen-binding fragment, or CAR, e.g., CDRs or VH and VL, e.g., as described in PCT Publications WO1997 / 025068, WO1999 / 028471, WO2005 / 014652, WO2006 / 099141, WO2009 / 045957, WO2009 / 068204, WO2013 / 142034, WO2013 / 040557, or WO2013 / 063419.

[0292] In one embodiment, the mesothelin binding domain comprises one or more (e.g., all three) light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of a mesothelin binding domain described herein, e.g., provided in Table 3 or 5, and / or one or more (e.g., all three) heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) of a mesothelin binding domain described herein, e.g., provided in Table 3 or 4. In one embodiment, the mesothelin binding domain comprises one, two, or all of the LC CDR1, LC CDR2, and LC CDR3 of any of the amino acid sequences provided in Table 5, and one, two, or all of the HC CDR1, HC CDR2, and HC CDR3 of any of the amino acid sequences provided in Table 4.

[0293] In one embodiment, the mesothelin-binding domain comprises a light chain variable region described herein (e.g., in Table 3) and / or a heavy chain variable region described herein (e.g., in Table 3). In one embodiment, the mesothelin-binding domain is an scFv comprising light and heavy chains of the amino acid sequences listed in Table 3. In one embodiment, the mesothelin-binding domain (e.g., scFv) comprises a light chain variable region comprising an amino acid sequence having at least one, two, or three alterations (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 alterations (e.g., substitutions, e.g., conservative substitutions) of the amino acid sequence of a light chain variable region provided in Table 3, or a sequence with 95-99% identity to an amino acid sequence provided in Table 3; and / or a heavy chain variable region comprising an amino acid sequence having at least one, two, or three alterations (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 alterations (e.g., substitutions, e.g., conservative substitutions) of the amino acid sequence of a heavy chain variable region provided in Table 3, or a sequence with 95-99% identity to an amino acid sequence provided in Table 3.

[0294] In one embodiment, the mesothelin-binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 201-225; or an amino acid sequence having at least one, two, or three alterations (e.g., substitutions, e.g., conservative substitutions) relative to any of the foregoing sequences, but no more than 30, 20, or 10 alterations (e.g., substitutions, e.g., conservative substitutions); or a sequence having 95-99% identity to any of the foregoing sequences. In one embodiment, the mesothelin-binding domain is an scFv, in which a light chain variable region comprising an amino acid sequence described herein, e.g., in Table 3, is attached via a linker, e.g., a linker described herein, to a heavy chain variable region comprising an amino acid sequence described herein, e.g., in Table 3. In one embodiment, the mesothelin-binding domain comprises a (Gly4-Ser)n linker, where n is 1, 2, 3, 4, 5, or 6, preferably 4 (SEQ ID NO: 967). The light chain variable region and heavy chain variable region of the scFv may be, for example, in any of the following orientations: light chain variable region-linker-heavy chain variable region or heavy chain variable region-linker-light chain variable region.

[0295] In some embodiments, the antigen-binding domain of a CAR, e.g., a CAR expressed by a cell of the present invention, binds to human EGFRvIII. In some embodiments, the antigen-binding domain is a mouse scFv domain, e.g., mu310C, that binds to human EGFRvIII. In some embodiments, the antigen-binding domain is a humanized antibody or antibody fragment, e.g., an scFv domain, derived from mouse mu310C scFv. Exemplary humanized scFv domains (and their sequences) that bind to EGFRvIII and mouse SS1 scFv are provided in Table 6.

[0296] In one embodiment, the antigen-binding domain of the CAR binds to human claudin 6 (CLDN6). In one embodiment, the antigen-binding domain is a mouse scFv domain that binds to human CLDN6. In one embodiment, the antigen-binding domain is a humanized antibody or antibody fragment. Exemplary scFv domains (and their sequences) that bind to CLDN6 are provided in Table 6. The scFv domain sequences provided in Table 6 include a light chain variable region (VL) and a heavy chain variable region (VH). The VL and VH are attached by a linker comprising the sequence GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 29), for example, in the following orientation: VL-linker-VH.

[0297] [Table 16] [Table 17]

[0298] In one embodiment, the EGFRvIII binding domain comprises one or more (e.g., all three) light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of an EGFRvIII binding domain described herein, e.g., provided in Table 6, and / or one or more (e.g., all three) heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) of an EGFRvIII binding domain described herein, e.g., provided in Table 6.

[0299] In one embodiment, the EGFRvIII binding domain comprises a light chain variable region described herein (e.g., in Table 6) and / or a heavy chain variable region described herein (e.g., in Table 6). In one embodiment, the EGFRvIII binding domain is an scFv comprising light and heavy chains of the amino acid sequences listed in Table 6. In one embodiment, the EGFRvIII binding domain (e.g., scFv) comprises a light chain variable region comprising an amino acid sequence having at least one, two, or three alterations (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 alterations (e.g., substitutions, e.g., conservative substitutions) of the amino acid sequence of a light chain variable region provided in Table 6, or a sequence with 95-99% identity to an amino acid sequence provided in Table 6, and / or a heavy chain variable region comprising an amino acid sequence having at least one, two, or three alterations (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 alterations (e.g., substitutions, e.g., conservative substitutions) of the amino acid sequence of a heavy chain variable region provided in Table 6, or a sequence with 95-99% identity to an amino acid sequence provided in Table 6.

[0300] In one embodiment, the EGFRvIII binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 344-352; or an amino acid sequence having at least one, two, or three alterations (e.g., substitutions, e.g., conservative substitutions) relative to any of the foregoing sequences, but no more than 30, 20, or 10 alterations (e.g., substitutions, e.g., conservative substitutions); or a sequence having 95-99% identity to any of the foregoing sequences. In one embodiment, the EGFRvIII binding domain is an scFv, in which a light chain variable region comprising an amino acid sequence described herein, e.g., in Table 6, is attached via a linker, e.g., a linker described herein, to a heavy chain variable region comprising an amino acid sequence described herein, e.g., in Table 6. In one embodiment, the EGFRvIII binding domain comprises a (Gly4-Ser)n linker, where n is 1, 2, 3, 4, 5, or 6, preferably 4 (SEQ ID NO: 967). The light chain variable region and heavy chain variable region of the scFv may be, for example, in any of the following orientations: light chain variable region-linker-heavy chain variable region or heavy chain variable region-linker-light chain variable region.

[0301] In one embodiment, the claudin 6 binding domain comprises one or more (e.g., all three) light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of a claudin 6 binding domain described herein, e.g., provided in Table 6, and / or one or more (e.g., all three) heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) of a claudin 6 binding domain described herein, e.g., provided in Table 6.

[0302] In one embodiment, the claudin-6 binding domain comprises a light chain variable region described herein (e.g., in Table 6) and / or a heavy chain variable region described herein (e.g., in Table 6). In one embodiment, the claudin-6 binding domain is an scFv comprising light and heavy chains of the amino acid sequences listed in Table 6. In one embodiment, the claudin-6 binding domain (e.g., scFv) comprises a light chain variable region comprising an amino acid sequence having at least one, two, or three alterations (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 alterations (e.g., substitutions, e.g., conservative substitutions) of the amino acid sequence of a light chain variable region provided in Table 6, or a sequence having 95 to 99% identity to an amino acid sequence provided in Table 6, and / or a heavy chain variable region comprising an amino acid sequence having at least one, two, or three alterations (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 alterations (e.g., substitutions, e.g., conservative substitutions) of the amino acid sequence of a heavy chain variable region provided in Table 6, or a sequence having 95 to 99% identity to an amino acid sequence provided in Table 6.

[0303] In one embodiment, the claudin-6 binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 353-355; or an amino acid sequence having at least one, two, or three alterations (e.g., substitutions, e.g., conservative substitutions) relative to any of the foregoing sequences, but no more than 30, 20, or 10 alterations (e.g., substitutions, e.g., conservative substitutions); or a sequence having 95-99% identity to any of the foregoing sequences. In one embodiment, the claudin-6 binding domain is an scFv, in which a light chain variable region comprising an amino acid sequence described herein, e.g., in Table 6, is attached via a linker, e.g., a linker described herein, to a heavy chain variable region comprising an amino acid sequence described herein, e.g., in Table 6. In one embodiment, the claudin-6 binding domain comprises a (Gly4-Ser)n linker, where n is 1, 2, 3, 4, 5, or 6, preferably 4 (SEQ ID NO: 967). The light chain variable region and heavy chain variable region of the scFv may be, for example, in any of the following orientations: light chain variable region-linker-heavy chain variable region or heavy chain variable region-linker-light chain variable region.

[0304] In one embodiment, an antigen-binding domain against GD2 is an antigen-binding portion, e.g., CDR, of an antibody described in, e.g., Mujoo et al., Cancer Res. 47(4):1098-1104 (1987); Cheung et al., Cancer Res 45(6):2642-2649 (1985); Cheung et al., J Clin Oncol 5(9):1430-1440 (1987); Cheung et al., J Clin Oncol 16(9):3053-3060 (1998); Handgretinger et al., Cancer Immunol Immunother 35(3):199-204 (1992). In some embodiments, the antigen-binding domain against GD2 is an antigen-binding portion of an antibody selected from mAb 14.18, 14G2a, ch14.18, hu14.18, 3F8, hu3F8, 3G6, 8B6, 60C3, 10B8, ME36.1, and 8H9. See, for example, WO2012033885, WO2013040371, WO2013192294, WO2013061273, WO2013123061, WO2013074916, and WO201385552. In some embodiments, the antigen-binding domain against GD2 is an antigen-binding portion of an antibody described in U.S. Patent Application Publication No. 20100150910 or PCT Publication No. WO2011160119.

[0305] In one embodiment, the antigen-binding domain for a Tn antigen, sTn antigen, Tn-O-glycopeptide antigen, or sTn-O-glycopeptide antigen is an antigen-binding portion, e.g., a CDR, of an antibody described in, for example, U.S. Patent Application Publication No. 2014 / 0178365, U.S. Patent No. 8,440,798, EP 2083868 A2, Brooks et al., PNAS 107(22):10056-10061 (2010), and Stone et al., OncoImmunology 1(6):863-873(2012).

[0306] In one embodiment, the antigen-binding domain against PSMA is the antigen-binding portion, e.g., CDRs, of an antibody described, e.g., in Parker et al., Protein Expr Purif 89(2):136-145 (2013), e.g., the antibody described in US Patent Application Publication No. 20110268656 (J591 ScFv), e.g., the antibody described, e.g., in Frigerio et al., European J Cancer 49(9):2223-2232 (2013) (scFvD2B), e.g., the antibodies described in WO2006125481 (mAbs 3 / A12, 3 / E7, and 3 / F11), and short-chain antibody fragments (scFv A5 and D7).

[0307] In one embodiment, an antigen binding domain against CD97 is an antigen binding portion, e.g., CDRs, of an antibody described in, e.g., U.S. Pat. No. 6,846,911, such as the antibody described in de Groot et al., J Immunol 183(6):4127-4134 (2009), or antibody MAB3734 from R&D.

[0308] In one embodiment, an antigen binding domain against TAG72 is an antigen binding portion, e.g., CDRs, of an antibody described in, e.g., Hombach et al., Gastroenterology 113(4):1163-1170 (1997), and Abcam ab691.

[0309] In one embodiment, an antigen binding domain against CD44v6 is an antigen binding portion, e.g., CDRs, of an antibody described in, e.g., Casucci et al., Blood 122(20):3461-3472 (2013).

[0310] In one embodiment, an antigen binding domain against CEA is an antigen binding portion, e.g., CDRs, of an antibody described in, e.g., Chmielewski et al., Gastoenterology 143(4):1095-1107 (2012).

[0311] In one embodiment, the antigen-binding domain against EPCAM is an antigen-binding portion, e.g., CDR, of an antibody selected from MT110, an EpCAM-CD3 bispecific Ab (see, e.g., clinicaltrials.gov / ct2 / show / NCT00635596); edrecolomab; 3622W94; ING-1; and adecatumumab (MT201).

[0312] In one embodiment, an antigen binding domain against KIT is an antigen binding portion, e.g., a CDR, of an antibody described in, e.g., U.S. Pat. No. 7,915,391, U.S. Patent Application Publication No. 20120288506, and several commercial catalog antibodies.

[0313] In one embodiment, the antigen binding domain against IL-13Ra2 is an antigen binding portion, e.g., a CDR, of an antibody described, e.g., in WO2008 / 146911, an antibody described, e.g., in WO2004087758, some commercial catalog antibodies, and an antibody described, e.g., in WO2004087758.

[0314] In one embodiment, an antigen binding domain against CD171 is an antigen binding portion, e.g., CDRs, of an antibody described in, e.g., Hong et al., J Immunother 37(2):93-104 (2014).

[0315] In one embodiment, the antigen-binding domain against PSCA is an antigen-binding portion, e.g., a CDR, of an antibody described, e.g., in Morgenroth et al., Prostate 67(10):1121-1131 (2007) (scFv 7F5), an antibody described, e.g., in Nejatollahi et al., J of Oncology 2013(2013), article ID 839831 (scFv C5-II), and an antibody described, e.g., in U.S. Patent Application Publication No. 20090311181.

[0316] In one embodiment, an antigen binding domain against MAD-CT-2 is an antigen binding portion, eg, CDRs, of an antibody described in, eg, PMID:2450952, US Pat. No. 7,635,753.

[0317] In one embodiment, an antigen binding domain against folate receptor alpha is an antigen binding portion, e.g., CDRs, of the antibody IMGN853, or the antibodies described in US Patent Application Publication No. 20120009181, the antibodies described in US Patent No. 4,851,332, or LK26: the antibody described in US Patent No. 5,952,484.

[0318] In one embodiment, an antigen binding domain against ERBB2 (Her2 / neu) is an antigen binding portion, eg, CDRs, of the antibody trastuzumab or pertuzumab.

[0319] In one embodiment, an antigen binding domain against MUC1 is an antigen binding portion, e.g., CDRs, of the antibody SAR566658.

[0320] In one embodiment, the antigen binding domain against EGFR is an antigen binding portion, e.g., CDRs, of the antibody cetuximab, panitumumab, zalutumumab, nimotuzumab, or matuzumab.

[0321] In one embodiment, the antigen-binding domain against NCAM is the antigen-binding portion, e.g., CDRs, of the antibody clone 2-2B:MAB5324 (EMD Millipore).

[0322] In one embodiment, the antigen binding domain against CAIX is the antigen binding portion, eg, CDRs, of antibody clone 303123 (R&D Systems).

[0323] In one embodiment, an antigen-binding domain against Fos-related antigen 1 is an antigen-binding portion, e.g., CDRs, of antibody 12F9 (Novus Biologicals).

[0324] In one embodiment, an antigen binding domain against SSEA-4 is an antigen binding portion, eg, CDRs, of the antibody MC813 (Cell Signaling) or other commercially available antibodies.

[0325] In one embodiment, an antigen binding domain against PDGFR-beta is an antigen binding portion, eg, CDRs, of the antibody Abeam ab32570.

[0326] In one embodiment, an antigen binding domain against ALK is an antigen binding portion, e.g., CDRs, of an antibody described in, e.g., Mino-Kenudson et al., Clin Cancer Res 16(5):1561-1571 (2010).

[0327] In one embodiment, the antigen-binding domain against polysialic acid is an antigen-binding portion, e.g., a CDR, of an antibody described, for example, in Nagae et al., J Biol Chem 288(47):33784-33796 (2013).

[0328] In one embodiment, an antigen binding domain against PLAC1 is an antigen binding portion, e.g., CDRs, of an antibody described in, e.g., Ghods et al., Biotechnol Appl Biochem 2013 doi:10.1002 / bab.1177.

[0329] In one embodiment, an antigen-binding domain against GloboH is an antigen-binding portion, e.g., CDRs, of the antibody VK9, or an antibody described, for example, in Kudryashov V et al, Glycoconj J.15(3):243-9 (1998), for example, an antibody described in Lou et al., Proc Natl Acad Sci USA 111(7):2482-2487 (2014), or an antibody MBr1 described, for example, in Bremer EG et al. J Biol Chem 259:14773-14777 (1984).

[0330] In one embodiment, an antigen binding domain against NY-BR-1 is an antigen binding portion, e.g., CDRs, of an antibody described in, e.g., Jager et al., Appl Immunohistochem Mol Morphol 15(1):77-83 (2007).

[0331] In one embodiment, the antigen binding domain against sperm protein 17 is an antigen binding portion, e.g., a CDR, of an antibody described in, for example, Song et al., Target Oncol 2013 Aug 14 (PMID: 23943313); Song et al., Med Oncol 29(4):2923-2931 (2012).

[0332] In one embodiment, an antigen binding domain against TRP-2 is an antigen binding portion, e.g., CDRs, of an antibody described in, e.g., Wang et al., J Exp Med. 184(6):2207-16 (1996).

[0333] In one embodiment, an antigen binding domain against CYP1B1 is an antigen binding portion, e.g., CDRs, of an antibody described in, e.g., Maecker et al., Blood 102 (9): 3287-3294 (2003).

[0334] In one embodiment, the antigen binding domain against RAGE-1 is the antigen binding portion, eg, CDRs, of the antibody MAB5328 (EMD Millipore).

[0335] In one embodiment, the antigen binding domain against human telomerase reverse transcriptase is the antigen binding portion, e.g., CDRs, of antibody catalog number LS-B95-100 (Lifespan Biosciences).

[0336] In one embodiment, an antigen binding domain against intestinal carboxylesterase is an antigen binding portion, e.g., CDRs, of the antibody 4F12: catalog number LS-B6190-50 (Lifespan Biosciences).

[0337] In one embodiment, an antigen binding domain against hsp70-2 is an antigen binding portion, eg, CDRs, of the antibody Lifespan Biosciences: Monoclonal: Catalog No. LS-C133261-100 (Lifespan Biosciences).

[0338] In one embodiment, an antigen-binding domain against MAD-CT-2 is an antigen-binding portion, e.g., CDRs, of an antibody described in, e.g., PMID: 2450952; US Pat. No. 7,635,753.

[0339] In one embodiment, the antigen-binding domain comprises one, two, three (e.g., all three) heavy chain CDRs, HC CDR1, HC CDR2, and HC CDR3, from an antibody listed above, and / or one, two, three (e.g., all three) light chain CDRs, LC CDR1, LC CDR2, and LC CDR3, from an antibody listed above. In one embodiment, the antigen-binding domain comprises the heavy chain variable region and / or the light chain variable region of an antibody listed above.

[0340] In some embodiments, the antigen binding domain of the CAR targets a tumor antigen that is an antigen expressed on a myeloid tumor (either a surface antigen or an MHC-presented antigen), and cells containing such a CAR recognize the myeloid tumor antigen.

[0341] In certain embodiments, the myeloid tumor antigen is an antigen that is preferentially or specifically expressed on the surface of myeloid tumor cells.

[0342] In one embodiment, the antigen binding domain of the CAR can be selected to target a myeloid tumor population. Alternatively, if targeting to more than one type of myeloid tumor is desired, antigen binding domains can be selected that target more than one myeloid tumor antigen, for example, an antigen that targets an antigen expressed by all myeloid tumors.

[0343] The CAR can target the following additional tumor antigens: CD123, CD34, Flt3, CD33, and CLL-1. In embodiments, the tumor antigen is selected from CD123, CD33, and CLL-1. In some embodiments, the tumor antigen is CD123. In some embodiments, the tumor antigen is CD33. In some embodiments, the tumor antigen is CD34. In some embodiments, the tumor antigen is Flt3. In embodiments, the tumor antigen is CLL-1. In embodiments, the antigen-binding domain targets a human antigen.

[0344] In one embodiment, the antigen binding domain of CAR binds to CD123, for example, human CD123. Any known CD123 binding domain can be used in the present invention. In one embodiment, the antigen binding domain for CD123 is an antibody, an antigen binding fragment, or an antigen binding portion of CAR, for example, CDR or VH and VL, as described, for example, in PCT publication WO2014 / 130635. In one embodiment, the antigen binding domain for CD123 is an antibody, an antigen binding fragment, or an antigen binding portion of CAR, for example, CDR or VH and VL, as described, for example, in PCT publication WO2016 / 028896. In one embodiment, the antigen-binding domain against CD123 is an antigen-binding portion, e.g., CDR, of an antibody, antigen-binding fragment, or CAR, e.g., as described in the following patent documents: International Publication WO 1997 / 024373, WO 2008 / 127735 (e.g., the CD123-binding domains of 26292, 32701, 37716, or 32703), WO 2014 / 138805 (e.g., the CD123-binding domains of CSL362), binding domain), WO2014 / 138819, WO2013 / 173820, WO2014 / 144622, WO2001 / 66139, WO2010 / 126066 (e.g., CD123 binding domain for any of Old4, Old5, Old17, Old19, New102, or Old6), WO2014 / 144622, WO2016 / 028896, or U.S. Patent Application Publication No. 2009 / 0252742. In embodiments, the antigen-binding domain is or is derived from a mouse anti-human CD123 binding domain. In embodiments, the antigen-binding domain is a humanized antibody or antibody fragment, e.g., an scFv domain. In certain embodiments, the antigen-binding domain is a human antibody or antibody fragment that binds to human CD123. In embodiments, the antigen domain sequence is an scFv domain, which includes a light chain variable region (VL) and a heavy chain variable region (VH).The VL and VH may be attached by a linker described herein, for example, including the sequence GGGGSGGGGSGGGGS (SEQ ID NO: 30), and may be in any orientation, for example, VL-linker-VH, or VH-linker-VL.

[0345] In some embodiments, the antigen-binding domain that binds to CD123 is an scFv domain. In some embodiments, the antigen-binding domain that binds to CD123 is a mouse scFv domain. In certain embodiments, the antigen-binding domain that binds to CD123 is a human or humanized scFv domain. Exemplary scFv domains (and their sequences) that bind to CLDN6 are provided in Table 19. The scFv domain sequences provided in Table 19 include a light chain variable region (VL) and a heavy chain variable region (VH). The VL and VH are attached by a linker comprising the sequence GGGGSGGGGSGGGGSGGGGS (SEQ ID NO: 29), for example, in the following orientation: VL-linker-VH. In one embodiment, the CD123 binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 751, 756, 761 or 766; or an amino acid sequence having at least one, two or three alterations (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20 or 10 alterations (e.g., substitutions, e.g., conservative substitutions) relative to any of the foregoing sequences; or a sequence having 95-99% identity to an amino acid sequence selected from any one of SEQ ID NOs: 751, 756, 761 or 766.

[0346] In one aspect, the antigen binding domain of CAR binds to CD33, for example, human CD33. Any known CD33 binding domain can be used in the present invention. In one embodiment, the antigen binding domain for CD33 is an antibody, antigen binding fragment, or antigen binding portion of CAR, for example, CDR or VH and VL, as described in, for example, PCT Publication WO2016 / 014576 or US Patent Application Publication No. 2016 / 0096892 A1, the contents of which are incorporated herein in their entirety. In one embodiment, the antigen-binding domain against CD33 is an antigen-binding portion of or derived therefrom (e.g., comprising an antigen-binding domain comprising one or more heavy chain variable domains, e.g., one, two, or three CDRs, or one or more light chain variable domains, e.g., one, two, or three CDRs, or VH or VL, of the scFv sequence of gemtuzumab ozogamicin) (formerly sold as Mylotarg), e.g., Bross et al., Clin Cancer Res 7(6):1490-1496 (2001) (gemtuzumab ozogamicin, hP67.6). In one embodiment, the antigen-binding domain against CD33 is an antigen-binding portion of or derived from the scFv sequence encoded by GenBank reference number AM402974.1 (e.g., comprising one or more heavy chain variable domains, e.g., one, two or three CDRs, and / or one or more light chain variable domains, e.g., one, two or three CDRs, or a VH or VL, or an antigen-binding domain comprising an scFv sequence) (see, e.g., Wang et al., Mol. Ther., vol. 23:1, pp. 184-191 (2015)), incorporated herein by reference).In one embodiment, the antigen binding domain against CD33 is selected from the group consisting of antibodies described in, for example, Caron et al., Cancer Res 52(24):6761-6767 (1992) (Lintuzumab, HuM195), for example, the antibody described in Lapusan et al., Invest New Drugs 30(3):1121-1131 (2012) (AVE9633), for example, the antibody described in Aigner et al., Leukemia 27(5): 1107-1115 (2013) (AMG330, CD33 BiTE), for example, the antibody described in Dutour et al., Adv hematol 2012:683065 (2012), and for example, the antibody described in Pizzitola et al., Leukemia doi:10.1038 / Lue.2014.62 (2014). In an embodiment, the antigen-binding domain is an antigen-binding portion, e.g., CDR, of an antibody described in [Illegible Text] (2014). In an embodiment, the antigen-binding domain is a mouse anti-human CD33 binding domain or is derived therefrom. In an embodiment, the antigen-binding domain is a humanized antibody or antibody fragment, e.g., an scFv domain. In some embodiments, the antigen-binding domain is a human antibody or antibody fragment that binds to human CD33. In an embodiment, the antigen-binding domain is an scFv domain comprising a light chain variable region (VL) and a heavy chain variable region (VH). The VL and VH may be attached by a linker described herein, for example, comprising the sequence GGGGSGGGGSGGGGS (SEQ ID NO: 30), and may be in any orientation, e.g., VL-linker-VH, or VH-linker-VL.

[0347] In one embodiment, the antigen-binding domain of the CAR binds to CLL-1, for example, human CLL-1. Any known CLL-1 binding domain may be used in the present invention. In one embodiment, the antigen-binding domain against CLL-1 is an antigen-binding portion, for example, CDR or VH and VL, of an antibody, antigen-binding fragment, or CAR described in, for example, PCT Publication WO2016 / 014535 or US Patent Application Publication No. 2016 / 0051651 A1, the contents of which are incorporated herein in their entirety. In one embodiment, the antigen-binding domain against CLL-1 is an antigen-binding portion, for example, CDR, of an antibody available from R&D, Ebiosciences, Abcam, for example, PE-CLL1-hu Catalog No. 353604 (BioLegend); and PE-CLL1 (CLEC12A) Catalog No. 562566 (BD). In embodiments, the antigen-binding domain is or is derived from a mouse anti-human CLL-1 binding domain. In embodiments, the antigen-binding domain is a humanized antibody or antibody fragment, such as an scFv domain. In some embodiments, the antigen-binding domain is a human antibody or antibody fragment that binds to human CLL-1. In embodiments, the antigen-binding domain is an scFv domain comprising a light chain variable region (VL) and a heavy chain variable region (VH). The VL and VH may be attached by a linker described herein, for example, comprising the sequence GGGGSGGGGSGGGGS (SEQ ID NO: 30), and may be in any orientation, for example, VL-linker-VH or VH-linker-VL.

[0348] In some embodiments, the antigen binding domain of the CAR targets a B cell antigen. In certain embodiments, the B antigen is an antigen that is preferentially or specifically expressed on the surface of B cells. The antigen can be expressed on the surface of any one of the following types of B cells: precursor B cells (e.g., pre-B or pro-B cells), early pro-B cells, late pro-B cells, large pre-B cells, small pre-B cells, immature B cells, such as naive B cells, mature B cells, plasma B cells, plasmablasts, memory B cells, B-1 cells, B-2 cells, marginal zone B cells, follicular B cells, germinal center B cells, or regulatory B cells (Bregs).

[0349] The present disclosure provides CARs that can target the following antigens: CD19; CD123; CD22; CD30; CD171; CS-1; C-type lectin-like molecule-1; CD33; epidermal growth factor receptor variant III (EGFRvIII); ganglioside G2 (GD2); ganglioside GD3; TNF receptor family member B cell maturation (BCMA); Tn antigen (Tn Ag) or (GalNAcα-Ser / Thr)); prostate-specific membrane antigen (PSMA); receptor tyrosine kinase-like orphan receptor 1 (ROR1); Fms-like tyrosine kinase 3 (FLT3); tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6; carcinoembryonic antigen (CEA); epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); interleukin-13 receptor subunit alpha 2; mesothelin; interleukin-11 receptor alpha (IL-11Ra); prostate stem cell antigen (PSCA); protease serine 21; vascular endothelial growth factor receptor 2 (VEGFR2); Lewis (Y) antigen; CD24 ; platelet-derived growth factor receptor beta (PDGFR-beta); stage-specific embryonic antigen 4 (SSEA-4); CD20; folate receptor alpha; receptor tyrosine protein kinase ERBB2 (Her2 / neu); cell surface-associated mucin 1 (MUC1); epidermal growth factor receptor (EGFR); neural cell adhesion molecule (NCAM); prostase; prostatic acid phosphatase (PAP); elongation factor 2 mutated (ELF2M); ephrin B2; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (IGF-I receptor), carbonic anhydrase IX (CAIX); proteasome (prosome, macropain) subunit, beta,9 (LMP2); glycoprotein 100 (gp100); oncogene fusion protein (bcr-abl) consisting of the breakpoint cluster region (BCR) and Abelson murine leukemia viral oncogene homolog 1 (Abl); tyrosinase; ephrin type A receptor 2 (EphA2); fucosyl GM1; sialyl Lewis adhesion molecule (sLe); ganglioside GM3; transglutaminase 5 (TGS5); high molecular weight melanoma-associated antigen (HMWMAA); o-acetyl-GD2 ganglioside (OAcGD2); folate receptor beta; tumor endothelial marker 1 (TEM1 / CD248); tumor endothelial marker 7-related (TEM7R); claudin 6 (CLDN6) ); thyroid-stimulating hormone receptor (TSHR); G protein-coupled receptor class C group 5, member D (GPRC5D); X chromosome open reading frame 61 (CXORF61); CD97; CD179a; anaplastic lymphoma kinase (ALK); polysialic acid; placenta-specific 1 (PLAC1); hexasaccharide moiety of globoH glycoceramide (GloboH); mammary differentiation antigen (NY-BR-1); uroplakin 2 (UPK2); hepatitis A virus cellular receptor 1 (HAVCR1); adrenergic receptor beta 3 (ADRB3); pannexin 3 (PANX3); G protein-coupled receptor 20 (GPR20); lymphocyte antigen 6 complex, locus K 9 (LY6K); olfactory receptor 51E2 (OR51E2); TCR gamma alternate reading frame protein (TARP); Wilms tumor protein (WT1); cancer / testis antigen 1 (NY-ESO-1); cancer / testis antigen 2 (LAGE-1a); melanoma-associated antigen 1 (MAGE-A1); ETS translocation mutant gene 6 located on chromosome 12p (ETV6-AML); sperm protein 17 (SPA17); X antigen family, member 1A (XAGE1); angiopoietin-binding cell surface receptor 2 (Tie 2); melanoma cancer testis antigen 1 (MAD-CT-1); melanoma cancer testis antigen 2 (MAD-CT-2); Fos-related antigen 1; tumor protein p53 (p53); p53 mutant; prostein; survivin; telomerase; prostate cancer tumor antigen 1.Melanoma antigen 1 recognized by T cells; rat sarcoma (Ras) mutant; human telomerase reverse transcriptase (hTERT); sarcoma translocation breakpoint; melanoma-derived inhibitor of apoptosis (ML-IAP); ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene); N-acetylglucosaminyltransferase V (NA17); paired box protein Pax-3 (PAX3); androgen receptor; cyclin B1; v-myc avian myelocytic viral oncogene neuroblastoma-derived homolog (MYCN); Ras homolog family member C (RhoC); tyrosinase-related protein 2 (TRP-2); cytochrome P450 1B1 (CYP1B1); CCCTC-binding factor (zinc finger protein)-like, squamous cell carcinoma antigen 3 recognized by T cells (SART3); paired box protein Pax-5 (PAX5); proacrosin-binding protein sp32 (OY-TES1); lymphocyte-specific protein tyrosine kinase (LCK); A-kinase anchor protein 4 (AKAP-4); synovial sarcoma, X-chromosome breakpoint 2 (SSX2); receptor for advanced glycation end products (RAGE-1); renal ubiquitous 1 (RU1); renal ubiquitous 2 (RU2); legumain; human papillomavirus E6 (HPV E6); human papillomavirus E7 (HPV E7); intestinal carboxylesterase; heat shock protein 70-2 mutant (mutated) hsp70-2); CD79a; CD79b; CD72; leukocyte-associated immunoglobulin-like receptor 1 (LAIR1); Fc fragment of IgA receptor (FCAR or CD89); leukocyte-associated immunoglobulin-like receptor subfamily A member 2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12 member A (CLEC12A); bone marrow stromal cell antigen 2 (BST2); EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2); lymphocyte antigen 75 (LY75); glypican 3 (GPC3); Fc receptor-like 5 (FCRL5); immunoglobulin lambda-like polypeptide 1 (IGLL1); TNF receptor family members; Fms-like tyrosine kinase 3 (FLT3); CD10, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD37,CD38, CD53, CD72, CD73, CD74, CD75, CD77, CD79a, CD79b, CD80, CD81, CD82, CD83, CD84, CD85, ROR1, BCMA, CD86 and CD179b. Other B cell antigens that can be targeted by the CARs described herein include: CD1a, CD1b, CD1c, CD1d, CD2, CD5, CD6, CD9, CD11a, CD11b, CD11c, CD17, CD18, CD26, CD27, CD29, CD30, CD31, CD32a, CD32b, CD35, CD38, CD39, CD40, CD44, CD45, CD45RA, CD45RB, CD45RC, CD45RO, CD46, CD47, CD48, CD49b, CD49c, CD49d, CD50, CD52, CD54, CD55, CD58, CD60a, CD62L, CD63, CD68 CD69, CD70, CD85E, CD85I, CD85J, CD92, CD95, CD97, CD98, CD99, CD100, CD102, CD108, CD119 , CD120a, CD120b, CD121b, CD122, CD124, CD125, CD126, CD130, CD132, CD137, CD138, CD139, CD147, CD148, CD150, CD152, CD162, CD164, CD166, CD167a, CD170, CD175, CD175s, CD180, CD 184, CD185, CD192, CD196, CD197, CD200, CD205, CD210a, CDw210b, CD212, CD213a1, CD213a2 , CD215, CD217, CD218a, CD218b, CD220, CD221, CD224, CD225, CD226, CD227, CD229, CD230, C D232, CD252, CD253, CD257, CD258, CD261, CD262, CD263, CD264, CD267, CD268, CD269, CD270 , CD272, CD274, CD275, CD277, CD279, CD283, CD289, CD290, CD295, CD298, CD300a, CD300c, C D305, CD306, CD307a, CD307b, CD307c, CD307d, CD307e, CD314, CD315, CD316, CD317, CD319,CD321, CD327, CD328, CD329, CD338, CD351, CD352, CD353, CD354, CD355, CD357, CD358, CD360, CD361, CD362, and CD363.

[0350] In another embodiment, the antigen targeted by the CAR is selected from CD19, BCMA, CD20, CD22, FcRn5, FcRn2, CS-1, and CD138. In one embodiment, the antigen targeted by the CAR is CD19. In one embodiment, the antigen targeted by the CAR is CD20. In one embodiment, the antigen targeted by the CAR is CD22. In one embodiment, the antigen targeted by the CAR is BCMA. In one embodiment, the antigen targeted by the CAR is FcRn5. In one embodiment, the antigen targeted by the CAR is FcRn2. In one embodiment, the antigen targeted by the CAR is CS-1. In one embodiment, the antigen targeted by the CAR is CD138.

[0351] In one embodiment, the antigen binding domain of a CAR, e.g., a CAR expressed by a cell of the present invention (e.g., a cell that also expresses a CAR), can be selected to target a preferred B cell population. For example, in an embodiment where targeting to regulatory B cells is desired, an antigen binding domain is selected that targets an antigen expressed on regulatory B cells but not on other B cell populations, such as plasma B cells and memory B cells. Cell surface markers expressed on regulatory B cells include CD19, CD24, CD25, CD38, or CD86, or the markers described in He et al., 2014, J Immunology Research, Article ID 215471. If targeting to more than one type of B cell is desired, an antigen binding domain can be selected that targets an antigen expressed by all of the B cells to be targeted.

[0352] In one embodiment, the antigen-binding domain of a CAR, e.g., a CAR expressed by a cell of the invention, binds to CD19. CD19 is found on B cells throughout lineage differentiation from the pro / pre-B cell stage to the terminally differentiated plasma cell stage. In one embodiment, the antigen-binding domain is a mouse scFv domain that binds to human CD19, e.g., CTL019 (e.g., SEQ ID NO: 356). In one embodiment, the antigen-binding domain is a humanized antibody or antibody fragment, e.g., an scFv domain, derived from the mouse CTL019 scFv. In one embodiment, the antigen-binding domain is a human antibody or antibody fragment that binds to human CD19. Exemplary scFv domains that bind to CD19 (and their sequences, e.g., CDRs, VL, and VH sequences) are provided in Table 7 and Table 15A. The scFv domain sequences provided in Table 7 include a light chain variable region (VL) and a heavy chain variable region (VH). The VL and VH are attached by a linker comprising the sequence GGGGSGGGSGGGGS (SEQ ID NO: 30), for example in the following orientation: VL-linker-VH.

[0353] [Table 18] [Table 19] [Table 20]

[0354] The CDR sequences of the scFv domains of the CD19 antigen binding domains provided in Table 7 are shown in Tables 8 and 15B for the heavy chain variable domain and in Tables 9 and 15C for the light chain variable domain. "ID" represents the respective SEQ ID NO of each CDR.

[0355] [Table 21]

[0356] [Table 22]

[0357] In some embodiments, the antigen-binding domain comprises an anti-CD19 antibody or a fragment thereof, such as an scFv. For example, the antigen-binding domain comprises a variable heavy chain and a variable light chain listed in Table 10. The linker sequence joining the variable heavy chain and variable light chain may be any of the linker sequences described herein or, alternatively, may be GSTSGSGKPGSGEGSTKG (SEQ ID NO: 378). The light chain variable region and heavy chain variable region of the scFv may be, for example, in any of the following orientations: light chain variable region-linker-heavy chain variable region or heavy chain variable region-linker-light chain variable region.

[0358] [Table 23]

[0359] In one embodiment, the CD19 binding domain comprises one or more (e.g., all three) light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2), and light chain complementarity determining region 3 (LC CDR3) of a CD19 binding domain described herein, e.g., provided in Table 7 or 9, and / or one or more (e.g., all three) heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2), and heavy chain complementarity determining region 3 (HC CDR3) of a CD19 binding domain described herein, e.g., provided in Table 7 or 8. In one embodiment, the CD19 binding domain comprises one, two or all of the LC CDR1, LC CDR2 and LC CDR3 of any of the amino acid sequences provided in Table 9, which is incorporated herein by reference, and one, two or all of the HC CDR1, HC CDR2 and HC CDR3 of any of the amino acid sequences provided in Table 8.

[0360] In one embodiment, the CD19 binding domain comprises a light chain variable region described herein (e.g., in Table 7 or 10) and / or a heavy chain variable region described herein (e.g., in Table 7 or 10). In one embodiment, the CD19 binding domain is an scFv comprising light and heavy chains of amino acid sequences listed in Table 7 or 10. In one embodiment, the CD19 binding domain (e.g., scFv) comprises a light chain variable region comprising an amino acid sequence having at least one, two, or three alterations (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 alterations (e.g., substitutions, e.g., conservative substitutions) of the amino acid sequence of a light chain variable region provided in Table 7 or 10, or a sequence with 95-99% identity to an amino acid sequence provided in Table 7 or 10, and / or a heavy chain variable region comprising an amino acid sequence having at least one, two, or three alterations (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 alterations (e.g., substitutions, e.g., conservative substitutions) of the amino acid sequence of a heavy chain variable region provided in Table 7 or 10, or a sequence with 95-99% identity to an amino acid sequence provided in Table 7 or 10.

[0361] In one embodiment, the CD19-binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 356-368 and 381; or an amino acid sequence having at least one, two, or three alterations (e.g., substitutions, e.g., conservative substitutions) relative to any of the foregoing sequences, but no more than 30, 20, or 10 alterations (e.g., substitutions, e.g., conservative substitutions); or a sequence having 95-99% identity to any of the foregoing sequences. In one embodiment, the CD19-binding domain is an scFv, wherein a light chain variable region comprising an amino acid sequence described herein, e.g., in Table 7 or 10, is attached via a linker, e.g., a linker described herein, to a heavy chain variable region comprising an amino acid sequence described herein, e.g., in Table 7 or 10. In one embodiment, the CD19-binding domain comprises a (Gly4-Ser)n linker, where n is 1, 2, 3, 4, 5, or 6, preferably 4 (SEQ ID NO: 967). The light chain variable region and heavy chain variable region of the scFv may be, for example, in any of the following orientations: light chain variable region-linker-heavy chain variable region or heavy chain variable region-linker-light chain variable region.

[0362] Any known CAR in the art, for example, the CD19 antigen binding domain of any known CAR, can be used in accordance with the present invention to construct a CAR. For example, LG-740; U.S. Patent No. 8,399,645; U.S. Patent No. 7,446,190; Xu et al., Leuk Lymphoma. 2013 54(2):255-260(2012); Cruz et al., Blood 122(17):2965-2973 (2013); Brentjens et al., Blood, 118(18):4817-4828 (2011); Kochenderfer et al., Blood 116(20):4099-102 (2010); Kochenderfer et al., Blood 122 (25):4129-39(2013); and CARs described in 16th Annu Meet Am Soc Gen Cell Ther (ASGCT) (May 15-18, Salt Lake City) 2013, Abst 10. In one embodiment, the antigen binding domain against CD19 is a CAR, an antigen binding portion, e.g., a CDR, of an antibody or antigen-binding fragment thereof described in, e.g., PCT Publication WO2012 / 079000; PCT Publication WO2014 / 153270; Kochenderfer, JN et al., J. Immunother. 32 (7), 689-702 (2009); Kochenderfer, JN, et al., Blood, 116 (20), 4099-4102 (2010); PCT Publication WO2014 / 031687; Bejcek, Cancer Research, 55, 2346-2351, 1995; or U.S. Patent No. 7,446,190.

[0363] In some embodiments, the antigen-binding domain of a CAR, e.g., a CAR expressed by a cell of the invention, binds to BCMA. BCMA is found to be preferentially expressed in mature B lymphocytes. In some embodiments, the antigen-binding domain is a mouse scFv domain that binds to human BCMA. In some embodiments, the antigen-binding domain is a humanized antibody or antibody fragment, e.g., an scFv domain, that binds to human BCMA. In some embodiments, the antigen-binding domain is a human antibody or antibody fragment that binds to human BCMA. Exemplary scFv domains that bind to BCMA (and their sequences, e.g., CDRs, VL and VH sequences) are provided in Tables 11, 12, 13, and 14. The scFv domain sequences provided in Tables 11 and 12 include a light chain variable region (VL) and a heavy chain variable region (VH). The VL and VH are attached by a linker, e.g., in the following orientation: VH-linker-VL.

[0364] [Table 24] [Table 25] [Table 26] [Table 27] [Table 28] [Table 29] [Table 30] [Table 31] [Table 32] [Table 33] Table 34 Table 35 Table 36 Table 37 Table 38 Table 39 Table 40 Table 41 Table 42 Table 43 Table 44 Table 45 Table 46 Table 47 Table 48 Table 49

[0365] In some embodiments, additional exemplary CAR constructs are generated using VH and VL sequences from PCT Publication WO2012 / 0163805 (the contents of which are incorporated herein by reference in their entirety). In some embodiments, additional exemplary CAR constructs are generated using VH and VL sequences from PCT Publication WO2016 / 014565 (the contents of which are incorporated herein by reference in their entirety). In some embodiments, additional exemplary CAR constructs are generated using VH and VL sequences from PCT Publication WO2014 / 122144 (the contents of which are incorporated herein by reference in their entirety). In some embodiments, additional exemplary CAR constructs are generated using CAR molecules and / or VH and VL sequences from PCT Publication WO2016 / 014789 (the contents of which are incorporated herein by reference in their entirety). In some embodiments, additional exemplary CAR constructs are generated using CAR molecules and / or VH and VL sequences from PCT Publication WO2014 / 089335, the contents of which are incorporated herein by reference in their entirety. In some embodiments, additional exemplary CAR constructs are generated using CAR molecules and / or VH and VL sequences from PCT Publication WO2014 / 140248, the contents of which are incorporated herein by reference in their entirety.

[0366] In some embodiments, additional exemplary CAR constructs can also be generated using the VH and VL sequences found in Table 12. The amino acid sequences of exemplary scFv domains, including the VH and VL domains and linker sequences, and full-length CARs are also found in Table 12.

[0367] [Table 50] [Table 51]

[0368] The human CDR sequences of the scFv domains are shown in Table 13 for the heavy chain variable domain and in Table 14 for the light chain variable domain. "ID" represents the respective SEQ ID NO of each CDR. The CDRs are shown according to the Kabat definition, although CDRs under other definitions, such as the Chothia definition or the combined Kabat / Chothia definition, can be easily deduced based on the VH and VL sequences above.

[0369] [Table 52] [Table 53] [Table 54]

[0370] [Table 55] [Table 56]

[0371] In one embodiment, the BCMA binding domain comprises light chain complementarity determining region 1 (LC CDR1), light chain complementarity determining region 2 (LC CDR2) and light chain complementarity determining region 3 (LC CDR3) of one or more (e.g. all three) of the BCMA binding domains described herein, for example, as provided in Tables 11, 12 or 14, and / or heavy chain complementarity determining region 1 (HC CDR1), heavy chain complementarity determining region 2 (HC CDR2) and heavy chain complementarity determining region 3 (HC CDR3) of one or more (e.g. all three) of the BCMA binding domains described herein, for example, as provided in Tables 11, 12 or 13. In one embodiment, the BCMA binding domain comprises one, two or all of the LC CDR1, LC CDR2 and LC CDR3 of any of the amino acid sequences provided in Table 11, which is incorporated herein by reference, and one, two or all of the HC CDR1, HC CDR2 and HC CDR3 of any of the amino acid sequences provided in Table 11.

[0372] In one embodiment, the BCMA binding domain comprises a light chain variable region described herein (e.g., in Table 11 or 12), and / or a heavy chain variable region described herein (e.g., in Table 11 or 12). In one embodiment, the BCMA binding domain is an scFv comprising light and heavy chains of amino acid sequences listed in Table 11 or 12. In one embodiment, the BCMA binding domain (e.g., scFv) comprises a light chain variable region comprising an amino acid sequence having at least one, two, or three alterations (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 alterations (e.g., substitutions, e.g., conservative substitutions) of the amino acid sequence of a light chain variable region provided in Table 11 or 12, or a sequence with 95-99% identity to an amino acid sequence provided in Table 11 or 12, and / or a heavy chain variable region comprising an amino acid sequence having at least one, two, or three alterations (e.g., substitutions, e.g., conservative substitutions) but no more than 30, 20, or 10 alterations (e.g., substitutions, e.g., conservative substitutions) of the amino acid sequence of a heavy chain variable region provided in Table 11 or 12, or a sequence with 95-99% identity to an amino acid sequence provided in Table 11 or 12.

[0373] In one embodiment, the BCMA binding domain comprises an amino acid sequence selected from any one of SEQ ID NOs: 382, ​​386, 390, 394, 398, 402, 406, 410, 414, 418, 422, 426, 430, 434, 438, 442, 446, 450, 454, 458, 462, 466, 470, 474, 478, 482, 486, 490, 494, 498, 502, 506, 510, 514, 518, 522, 528, 531, 534, or 537; or an amino acid sequence having at least one, two, or three alterations (e.g., substitutions, e.g., conservative substitutions) but not more than 30, 20, or 10 alterations (e.g., substitutions, e.g., conservative substitutions) relative to any of the foregoing sequences; or a sequence having 95-99% identity to any of the foregoing sequences. In one embodiment, the BCMA binding domain is an scFv, wherein a light chain variable region comprising an amino acid sequence described herein, e.g., in Table 11 or 12, is attached via a linker, e.g., a linker described herein, to a heavy chain variable region comprising an amino acid sequence described herein, e.g., in Table 11 or 12. In one embodiment, the BCMA binding domain comprises a (Gly4-Ser)n linker, where n is 1, 2, 3, 4, 5 or 6, preferably 4 (SEQ ID NO: 967). The light chain variable region and heavy chain variable region of the scFv may, for example, be in any of the following orientations: light chain variable region-linker-heavy chain variable region or heavy chain variable region-linker-light chain variable region.

[0374] Any known CAR in the art, for example, the BCMA antigen binding domain of any known CAR, can be used in accordance with the present invention to construct a CAR, for example, those described herein.

[0375] In one embodiment, an antigen binding domain against ROR1 is an antigen binding portion, e.g., CDRs, of an antibody described in, e.g., Hudecek et al., Clin Cancer Res 19(12):3153-3164 (2013); WO2011159847; and U.S. Patent Application Publication No. 20130101607.

[0376] In one embodiment, an antigen binding domain against CD22 is an antigen binding portion, e.g., CDRs, of an antibody described in, e.g., Haso et al., Blood, 121(7): 1165-1174 (2013); Wayne et al., Clin Cancer Res 16(6): 1894-1903 (2010); Kato et al., Leuk Res 37(1):83-88 (2013); Creative BioMart (creativebiomart.net): MOM-18047-S(P).

[0377] In one embodiment, the antigen-binding domain against CD20 is an antigen-binding portion, e.g., a CDR, of the antibody rituximab, ofatumumab, ocrelizumab, veltuzumab, or GA101, or a derivative thereof. In one embodiment, the antigen-binding domain against CD20 is an antigen-binding portion described in WO2016 / 164731, the entire contents of which are incorporated herein by reference.

[0378] In one embodiment, the antigen-binding domain comprises one, two, three (e.g., all three) heavy chain CDRs, HC CDR1, HC CDR2, and HC CDR3, from an antibody listed above, and / or one, two, three (e.g., all three) light chain CDRs, LC CDR1, LC CDR2, and LC CDR3, from an antibody that binds to a tumor antigen listed above. In one embodiment, the antigen-binding domain comprises the heavy chain variable region and / or the light chain variable region of an antibody that binds to a tumor antigen listed above.

[0379] In one embodiment, the antigen-binding domain of the CAR described herein is an scFv antibody fragment. In one aspect, such antibody fragments are functional in that they retain equivalent binding affinity, e.g., they bind to the same antigen with equal potency as the IgG antibody from which they are derived. In other embodiments, the antibody fragment has a lower binding affinity than the antibody from which it is derived, e.g., binds to the same antigen with lower binding affinity, but is functional in providing the biological response described herein. In one embodiment, the CAR molecule binds to a target antigen with a binding affinity of 10 or more. -4 M~10 -8 M, e.g., 10 -5 M~10 -7 M, e.g., 10 -6 M or 10 -7 Binding affinity K of M D In one embodiment, the antibody fragment has a binding affinity that is at least 5-fold, 10-fold, 20-fold, 30-fold, 50-fold, 100-fold, or 1000-fold less than that of a reference antibody, e.g., an antibody described herein.

[0380] In one embodiment, the antigen-binding domain comprises a non-human antibody or antibody fragment, for example, a murine antibody or antibody fragment.

[0381] In another embodiment, the antigen-binding domain comprises a humanized antibody or antibody fragment. In some aspects, a non-humanized antibody is humanized, in which specific sequences or regions of the antibody are modified to increase similarity to antibodies or fragments thereof naturally produced in humans. In one aspect, the antigen-binding domain is humanized compared to the mouse sequence of the antibody or antibody fragment, e.g., scFv, from which it is derived.

[0382] Humanized antibodies can be produced using a variety of techniques known in the art, such as CDR grafting (see, e.g., European Patent No. 239,400, International Publication No. WO 91 / 09967, and U.S. Patent Nos. 5,225,539, 5,530,101, and 5,585,089, each of which is incorporated herein by reference in its entirety), veneering, or resurfacing (see, e.g., European Patent Nos. 592,106 and 519,596; Padlan, 1991, Molecular Immunology, 28(4 / 5):489-498; Studnicka et al., 1994, Protein Engineering, 7(6):805-814; and Roguska et al., 1994, PNAS, 91:969-973, each of which references is incorporated herein by reference in its entirety), chain shuffling (see, e.g., U.S. Pat. No. 5,565,332, which reference is incorporated herein by reference in its entirety), as well as other techniques described in, e.g., U.S. Patent Application Publication No. 2005 / 0042664, U.S. Patent Application Publication No. 2005 / 0048617, U.S. Pat. No. 6,407,213, U.S. Pat. No. 5,766,886, International Publication No. WO9317105; Tan et al., J. Immunol., 169:1119-25 (2002); Caldas et al., Protein Eng., 13(5):353-60 (2000); Morea et al., Methods, 20(3):267-79 (2000); Baca et al., J. Biol. Chem., 272(16):10678-84 (1997);Roguska et al., Protein Eng., 9(10):895-904 (1996);Couto et al., Cancer Res., 55 (23 Supp):5973s-5977s (1995);Couto et al., Cancer Res., 55(8):1717-22 (1995); Sandhu JS, Gene, 150(2):409-10 (1994); and Pedersen et al., J. Mol. Biol., 235(3):959-73 (1994) (each of these references is incorporated herein by reference in its entirety). Often, framework residues in the framework regions will be substituted with corresponding residues from the CDR donor antibody to alter, e.g., improve, antigen binding. These framework substitutions are identified by methods well known in the art, for example, by modeling the interactions of CDR and framework residues to identify framework residues important for antigen binding, and by sequence comparison to identify unusual framework residues at particular positions. (See, e.g., Queen et al., U.S. Pat. No. 5,585,089, and Riechmann et al., 1988, Nature, 332:323, which references are incorporated herein by reference in their entireties.)

[0383] A humanized antibody or antibody fragment retains one or more amino acid residues from a non-human source. These non-human amino acid residues are often referred to as "import" residues, and these residues are usually obtained from an "import" variable domain. As provided herein, a humanized antibody or antibody fragment comprises one or more CDRs and framework regions from a non-human immunoglobulin molecule, wherein the amino acid residues comprising the framework are derived entirely or primarily from human germline. Several humanization techniques for antibodies or antibody fragments are known in the art, essentially including the method of Winter and coworkers [Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1989)]. (1988)] by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody, i.e., CDR grafting (European Patent No. 239,400, PCT Publication No. WO 91 / 09967, and U.S. Patent Nos. 4,816,567, 6,331,415, 5,225,539, 5,530,101, 5,585,089, and 6,548,640, the contents of which are incorporated herein by reference in their entireties). In such humanized antibodies and antibody fragments, substantially less of the variable domain than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. Humanized antibodies are often human antibodies in which some CDR residues and possibly some framework (FR) residues are substituted by residues from analogous sites in rodent antibodies.Humanization of antibodies and antibody fragments can also be achieved by veneering or resurfacing (EP 592,106; EP 519,596; Padlan, 1991, Molecular Immunology, 28(4 / 5):489-498; Studnicka et al., Protein Engineering, 7(6):805-814 (1994); and Roguska et al., PNAS, 91:969-973 (1994)) or chain shuffling (U.S. Pat. No. 5,565,332), the contents of which are incorporated herein by reference in their entireties.

[0384] The selection of human variable domains, both light and heavy, to be used in the production of humanized antibodies is aimed at reducing antigenicity. According to the so-called "best-fit" method, the sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable domain sequences. The human sequence that is closest to that of the rodent is then accepted as the human framework (FR) for the humanized antibody (Sims et al., J. Immunol., 151:2296 (1993); Chothia et al., J. Mol. Biol., 196:901 (1987) (the contents of the above references are incorporated herein by reference in their entirety). Another method uses a specific framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same framework may be used for several different humanized antibodies (see, e.g., Nicholson et al. Mol. Immun. 34 (16-17): 1157-1165 (1997); Carter et al., Proc. Natl. Acad. Sci. USA, 89:4285 (1992); Presta et al., J. Immunol., 151:2623 (1993), the contents of which are incorporated herein by reference in their entireties). In some embodiments, the framework regions of the heavy chain variable region, e.g., all four framework regions, are derived from the VH4_4-59 germline sequence. In one embodiment, the framework regions may contain one, two, three, four, or five modifications, e.g., substitutions, from amino acids in the corresponding murine sequence. In one embodiment, the framework regions of the light chain variable region, e.g., all four framework regions, are derived from the VK3_1.25 germline sequence. In one embodiment, the framework regions may contain, for example, 1, 2, 3, 4 or 5 modifications, eg, substitutions, from amino acids in the corresponding murine sequence.

[0385] In some embodiments, the antibody fragment of the CAR is humanized while retaining high affinity for the target antigen and other favorable biological properties. According to one aspect of the present invention, humanized antibodies and antibody fragments are prepared by a process of analyzing the parental sequences and various conceptual humanized products using three-dimensional models of the parental and humanized sequences. Three-dimensional immunoglobulin models are generally available and known to those skilled in the art. Computer programs are available that illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Examination of these displays allows for analysis of the likely role of residues in the function of the candidate immunoglobulin sequence, for example, analysis of residues that affect the candidate immunoglobulin's ability to bind to the target antigen. In this way, FR residues can be selected and combined from the recipient and import sequences to achieve desired antibody or antibody fragment properties, such as increased affinity for the target antigen. In general, CDR residues are directly and most significantly involved in influencing antigen binding.

[0386] A humanized antibody or antibody fragment can retain the same antigen specificity as the original antibody, e.g., in the present disclosure, the ability to bind to a human tumor antigen as described herein. In some embodiments, a humanized antibody or antibody fragment can have improved affinity and / or specificity of binding to a tumor antigen as described herein. In some embodiments, a humanized antibody or antibody fragment can have lower affinity and / or specificity for a tumor antigen as described herein or a B cell antigen as described herein.

[0387] In one embodiment, the antigen-binding domain of the present invention is characterized by a particular functional feature or property of an antibody or antibody fragment. For example, in one embodiment, the portion of the CAR of the present invention comprising the antigen-binding domain specifically binds to a tumor antigen as described herein.

[0388] In one embodiment, the antigen-binding domain is a fragment, such as a single-chain variable fragment (scFv). In one embodiment, the binding domain of an anti-tumor antigen as described herein is an Fv, Fab, (Fab')2, or a bifunctional (e.g., bispecific) hybrid antibody (e.g., Lanzavecchia et al., Eur. J. Immunol. 17, 105 (1987)). In one embodiment, the antibodies and fragments thereof of the present invention bind to the tumor antigens described herein with wild-type or enhanced affinity.

[0389] In some cases, scFvs can be prepared according to methods known in the art (see, for example, Bird et al., (1988) Science 242:423-426 and Huston et al., (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883). scFv molecules can be produced by linking the VH and VL domains together using a flexible polypeptide linker. scFv molecules contain linkers optimized for length and / or amino acid composition (e.g., Ser-Gly linkers). Linker length can significantly affect how the variable regions of an scFv fold and interact. Indeed, when short polypeptide linkers are employed (e.g., between 5 and 10 amino acids), intrachain folding is prevented. Interchain folding is also required to bridge the two variable regions together and form a functional epitope-binding site. For examples of linker orientations and sizes, see, e.g., Hollinger et al. 1993 Proc Natl Acad. Sci. USA 90:6444-6448, U.S. Patent Application Publication Nos. 2005 / 0100543, 2005 / 0175606, 2007 / 0014794, and PCT Publication Nos. WO2006 / 020258 and WO2007 / 024715, which are incorporated herein by reference.

[0390] An scFv may include a linker of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, or more amino acid residues between its VL and VH regions. The linker sequence may include any naturally occurring amino acid. In some embodiments, the linker sequence includes the amino acids glycine and serine. In another embodiment, the linker sequence includes a series of glycine and serine repeats, such as (Gly4Ser)n, where n is a positive integer equal to or greater than 1 (SEQ ID NO: 22). In one embodiment, the linker may be (Gly4Ser)4 (SEQ ID NO: 29) or (Gly4Ser)3 (SEQ ID NO: 30). Varying the length of the linker can maintain or enhance activity, resulting in superior efficacy in activity studies.

[0391] In another embodiment, the antigen-binding domain is a T cell receptor ("TCR"), an engineered TCR, or a fragment thereof, such as a single-chain TCR (scTCR). Methods for producing such TCRs are known in the art. See, for example, Willemsen RA et al., Gene Therapy 7: 1369-1377 (2000); Zhang T et al., Cancer Gene Ther 11: 487-496 (2004); Aggen et al., Gene Ther. 19(4): 365-74 (2012) (references are incorporated herein by reference in their entirety). For example, a scTCR can be engineered containing Vα and Vβ genes from a T cell clone linked by a linker (e.g., a flexible peptide). This approach is highly useful for cancer-associated targets that are themselves intracellular, but in which fragments of such antigens (peptides) are presented on the surface of cancer cells by MHC.

[0392] In one embodiment, the antigen binding domain of the CAR comprises an amino acid sequence that is homologous to an antigen binding domain amino acid sequence described herein, wherein said antigen binding domain retains the desired functional properties of the antigen binding domain described herein.

[0393] In one specific embodiment, the antigen-binding domain of the CAR comprises an antibody fragment. In a further embodiment, the antibody fragment comprises an scFv. In a further embodiment, the antibody fragment comprises only the variable heavy chain (VH).

[0394] In various embodiments, the antigen-binding domain of the CAR is engineered by modifying one or more amino acids within one or both variable regions (e.g., VH and / or VL), e.g., within one or more CDR regions and / or within one or more framework regions. In one specific embodiment, the CAR composition of the invention comprises an antibody fragment. In a further embodiment, the antibody fragment comprises an scFv.

[0395] Those skilled in the art will understand that antibodies or antibody fragments of the present invention can be further modified to differ in amino acid sequence (e.g., from wild-type) but not in desired activity. For example, additional nucleotide substitutions can be made to the protein, leading to amino acid substitutions of "non-essential" amino acid residues. For example, a non-essential amino acid residue in the molecule can be replaced with another amino acid residue from the same side chain family. In another embodiment, a string of amino acids can be replaced with a structurally similar string that differs in the order and / or composition of side chain family members, e.g., conservative substitutions can be made in which an amino acid residue is replaced with an amino acid residue having a similar side chain.

[0396] Families of amino acid residues having similar side chains have been defined in the art, and include basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).

[0397] With respect to two or more nucleic acid or polypeptide sequences, percent identity refers to two or more sequences that are the same. Two sequences are "substantially identical" if they have a specified percentage of amino acid residues or nucleotides that are the same (e.g., 60% identity, or, as appropriate, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity over a specified region, or, when not specified, over the entire sequence), when compared over a comparison window, or designated region, and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below or by manual alignment and visual inspection. Suitably, identity exists over a region that is at least about 50 nucleotides (or 10 amino acids) in length, or more preferably over a region that is 100 to 500 or 1000 or more nucleotides (or 20, 50, 200 or more amino acids) in length.

[0398] For sequence comparison, usually one sequence serves as the reference sequence to compare test sequence.When using sequence comparison algorithm, test and reference sequences are input into computer, partial sequence coordinates are designated as necessary, and sequence algorithm program parameters are designated.Default program parameters can be used, or alternative parameters can be designated.Then, sequence comparison algorithm calculates the percent sequence identity of test sequence to reference sequence based on program parameters.The method of sequence alignment for comparison is well known in the art. Optimal sequence alignment for comparison can be performed, for example, by the local homology algorithm of Smith and Waterman, (1970) Adv. Appl. Math. 2:482c, by the homology alignment algorithm of Needleman and Wunsch, (1970) J. Mol. Biol. 48:443, by the similarity search method of Pearson and Lipman, (1988) Proc. Nat'l. Acad. Sci. USA 85:2444, by computer implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by manual alignment and visual inspection (see, e.g., Brent et al., (2003) Current Protocols in Molecular Biology).

[0399] Two examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., (1977) Nuc. Acids Res. 25:3389-3402, and Altschul et al., (1990) J. Mol. Biol. 215:403-410, respectively. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.

[0400] The percent identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller, (1988) Comput. Appl. Biosci. 4:11-17, which has been incorporated into the ALIGN program (version 2.0), using a PAM120 residue mass table, a gap length penalty of 12, and a gap penalty of 4. Additionally, the percent identity between two amino acid sequences can be determined using the algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:444-453, which has been incorporated into the GAP program in the GCG software package (available at www.gcg.com), using either a Blossom 62 matrix or a PAM250 matrix, and gap weights of 16, 14, 12, 10, 8, 6, or 4 and length weights of 1, 2, 3, 4, 5, or 6.

[0401] In one embodiment, the present disclosure contemplates modifying the amino acid sequence of a starting antibody or fragment (e.g., scFv) to generate a functionally equivalent molecule. For example, the VH or VL of an antigen-binding domain, e.g., scFv, against a tumor antigen described herein contained in a CAR can be modified such that at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity of the starting VH or VL framework region of the antigen-binding domain, e.g., scFv, against a tumor antigen described herein is retained. The present disclosure contemplates modifications of the entire CAR construct, for example, modifications in one or more amino acid sequences of various domains of the CAR construct, to generate functionally equivalent molecules. The CAR construct can be modified to retain at least about 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity of the starting CAR construct.

[0402] Bispecific CAR In one embodiment, a multispecific antibody molecule is a bispecific antibody molecule. A bispecific antibody has specificity for no more than two antigens. A bispecific antibody molecule is characterized by a variable domain sequence of a first immunoglobulin having binding specificity for a first epitope and a variable domain sequence of a second immunoglobulin having binding specificity for a second epitope. In one embodiment, the first and second epitopes are on the same antigen, e.g., the same protein (or subunit of a multimeric protein). In one embodiment, the first and second epitopes overlap. In one embodiment, the first and second epitopes do not overlap. In one embodiment, the first and second epitopes are on different antigens, e.g., different proteins (or subunits of different multimeric proteins). In one embodiment, a bispecific antibody molecule comprises heavy and light chain variable domain sequences having binding specificity for a first epitope, and heavy and light chain variable domain sequences having binding specificity for a second epitope. In one embodiment, a bispecific antibody molecule comprises a half antibody having binding specificity for a first epitope and a half antibody having binding specificity for a second epitope. In one embodiment, a bispecific antibody molecule comprises a half antibody, or fragment thereof, having binding specificity for a first epitope and a half antibody, or fragment thereof, having binding specificity for a second epitope. In one embodiment, a bispecific antibody molecule comprises an scFv, or fragment thereof, having binding specificity for a first epitope and an scFv, or fragment thereof, having binding specificity for a second epitope.

[0403] In certain embodiments, the antibody molecule is a multispecific (e.g., bispecific or trispecific) antibody molecule. Protocols for generating bispecific or heterodimeric antibody molecules are known in the art and include, but are not limited to, the "knob-in-hole" approach, e.g., as described in U.S. Pat. No. 5,731,168; electrostatic steering Fc pairing, e.g., as described in WO09 / 089004, WO06 / 106905, and WO2010 / 129304; strand exchange engineered domains, e.g., as described in WO07 / 110205; Domain) (SEED) heterodimerization; Fab arm exchange, as described, for example, in WO08 / 119353, WO2011 / 131746, and WO2013 / 060867; biantibody conjugates, for example, by antibody crosslinking to generate bispecific structures using heterobifunctional reagents having an amine-reactive group and a sulfhydryl-reactive group, as described, for example, in U.S. Pat. No. 4,433,059; bispecific antibody determinants generated by recombining half-antibodies (heavy chain-light chain pairs or Fab) from different antibodies by cycling the reduction and oxidation of the interchain disulfide bond, as described, for example, in U.S. Pat. No. 4,444,878; trifunctional antibodies, as described, for example, in U.S. Pat. No. 5,273,743, Biosynthetic binding proteins, e.g., scFv pairs cross-linked by their C-terminal tails, preferably cross-linked by disulfide or amine reactive chemical bridges, as described, e.g., in U.S. Pat. No. 5,534,254; bifunctional antibodies, e.g., Fab fragments with different binding specificities dimerized with leucine zippers (e.g., c-fos and c-jun) replacing the constant domains, as described, e.g., in U.S. Pat. No. 5,582,996; bispecific and oligospecific monovalent and oligovalent receptors, e.g., as described, e.g., in U.S. Pat. No. 5,591,828;The VH-CH1 regions of two antibodies (two Fab fragments) in which the CH1 region of one antibody and the VH region of the other antibody that is normally associated with the light chain are linked by a polypeptide spacer; bispecific DNA-antibody conjugates, e.g., cross-linking of antibodies or Fab fragments with a double-stranded piece of DNA, as described, for example, in U.S. Pat. No. 5,635,602; bispecific fusion proteins, e.g., containing two scFvs and having a region between them and the complete construct, as described, for example, in U.S. Pat. No. 5,637,481. expression constructs in which a hydrophilic helical peptide linker is present between the VL and VH chains; multivalent and multispecific binding proteins, commonly referred to as diabodies, e.g., dimers of polypeptides having a first domain containing an Ig heavy chain variable region binding region and a second domain containing an Ig light chain variable region binding region (including higher order structures resulting in bispecific, trispecific, or tetraspecific molecules), as described, e.g., in U.S. Pat. No. 5,837,242; minibody constructs in which the VH and VL domains are linked in either orientation by a short peptide linker (e.g., 5 or 10 amino acids) or no linker at all, which can dimerize to form bispecific diabodies; trimers and tetramers, for example, as described in U.S. Pat. No. 5,844,094; strings of VH domains (or VL domains of family members) with cross-linking groups connected at the C-terminus by peptide bonds that further associate with the VL domains to form a series of FVs (or scFvs), for example, as described in U.S. Pat. No. 5,864,019; and single-chain binding polypeptides having both VH and VL domains linked by peptide linkers that are combined into multivalent structures by non-covalent or chemical cross-linking, for example, as described in U.S. Pat. No. 5,869,620.Both scFV or diabody type formats are used to form homobivalent, heterobivalent, trivalent and tetravalent structures. Additional exemplary multispecific and bispecific molecules and methods of making them are described in, for example, U.S. Patent Nos. 5,910,573, 5,932,448, 5,959,083, 5,989,830, 6,005,079, 6,239,259, 6,294,353, 6,333,396, 6,476,198, 6,511,663, 6,670,453, 6,743,896, 6,809,185, and 683,344. 1, U.S. Patent No. 7,129,330, U.S. Patent No. 7,183,076, U.S. Patent No. 7,521,056, U.S. Patent No. 7,527,787, U.S. Patent No. 7,534,866, U.S. Patent No. 7,612,181, U.S. Patent Application Publication No. 2002004587 A1, U.S. Patent Application Publication No. 2002076406 A1, U.S. Patent Application Publication No. 2002103345 A1, U.S. Patent Application Publication No. 2003207346 A1, U.S. Patent Application Publication No. 2003211078 A1, U.S. Patent Application Publication No. 2004219643 A1, U.S. Patent Application Publication No. 2004219643 A1, U.S. Patent Application Publication No. 2004211078 ... 04220388 A1, U.S. Patent Application Publication No. 2004242847 A1, U.S. Patent Application Publication No. 2005003403 A1, U.S. Patent Application Publication No. 2005004352 A1, U.S. Patent Application Publication No. 2005069552 A1, U.S. Patent Application Publication No. 2005079170 A1, U.S. Patent Application Publication No. 2005100543 A1, U.S. Patent Application Publication No. 2005136049 A1, U.S. Patent Application Publication No. 2005136051 A1, U.S. Patent Application Publication No. 2005163782 A1, U.S. Patent Application Publication No. 20052664 25 A1, U.S. Patent Application Publication No. 2006083747 A1, U.S. Patent Application Publication No. 2006120960 A1, U.S. Patent Application Publication No. 2006204493 A1, U.S. Patent Application Publication No. 2006263367 A1, U.S. Patent Application Publication No. 2007004909 A1, U.S. Patent Application Publication No. 2007087381 A1, U.S. Patent Application Publication No. 2007128150 A1, U.S. Patent Application Publication No. 2007141049 A1, U.S. Patent Application Publication No. 2007154901 A1, U.S. Patent Application Publication No. 2007274985 A1,U.S. Patent Application Publication No. 2008050370 A1, U.S. Patent Application Publication No. 2008069820 A1, U.S. Patent Application Publication No. 2008152645 A1, U.S. Patent Application Publication No. 2008171855 A1, U.S. Patent Application Publication No. 2008241884 A1, U.S. Patent Application Publication No. 2008254512 A1, U.S. Patent Application Publication No. 2008260738 A1, U.S. Patent Publication No. 2009130106 A1, U.S. Patent Application Publication No. 2009148905 A1, U.S. Patent Application Publication No. 2009155275 A1, U.S. Patent Application Publication No. 2009162359 A1, U.S. Patent Application Publication No. 2009162360 A1, U.S. Patent Application Publication No. 2009175851 A1, U.S. Patent Application Publication No. 2009175867 A1, U.S. Patent Application Publication No. 2009232811A1, U.S. Patent Application Publication No. 2009234105A1, U.S. Patent Application Publication No. 2009263392A1, U.S. Patent Application Publication No. 2009274649A1, European Patent No. 346087A2, WO0006605A2, WO02072635A2, WO04081051A1, WO06020258A2, WO2007044887A2, WO No. 2007095338A2, WO2007137760A2, WO2008119353A1, WO2009021754A2, WO2009068630A1, WO9103493A1, WO9323537A1, WO9409131A1, WO9412625A2, WO9509917A1, WO9637621A2, WO9964460A1, the contents of the above-referenced applications are incorporated herein by reference in their entireties.

[0404] Within each antibody or antibody fragment (e.g., scFv) of a bispecific antibody molecule, the VH may be upstream or downstream of the VL. In some embodiments, the upstream antibody or antibody fragment (e.g., scFv) is arranged such that its VH (VH1) is upstream of its VL (VL1), and the downstream antibody or antibody fragment (e.g., scFv) is arranged such that its VL (VL2) is upstream of its VH (VH2), such that the bispecific antibody molecule as a whole has the configuration VH1-VL1-VL2-VH2. In other embodiments, the upstream antibody or antibody fragment (e.g., scFv) is arranged such that its VL (VL1) is upstream of its VH (VH1), and the downstream antibody or antibody fragment (e.g., scFv) is arranged such that its VH (VH2) is upstream of its VL (VL2), such that the overall bispecific antibody molecule has the following configuration: VL1-VH1-VH2-VL2. Optionally, a linker is placed between the two antibodies or antibody fragments (e.g., scFvs), e.g., between VL1 and VL2 when the construct is arranged as VH1-VL1-VL2-VH2, or between VH1 and VH2 when the construct is arranged as VL1-VH1-VH2-VL2. The linker may be a linker as described herein, for example, a (Gly4-Ser)n linker, where n is 1, 2, 3, 4, 5, or 6, preferably 4 (SEQ ID NO: 967). Generally, the linker between two scFvs should be long enough to avoid mispairing between the domains of the two scFvs. The linker may be disposed between the VL and VH of the first scFv. The linker may be disposed between the VL and VH of the second scFv. In the case of constructs with multiple linkers, any two or more of the linkers may be the same or different. Thus, in some embodiments, the bispecific CAR comprises a VL, a VH, and optionally one or more linkers, in an arrangement as described herein.

[0405] In one aspect, the chimeric antigen receptor comprises a bispecific antigen-binding domain, a transmembrane domain (e.g., as described herein), and an intracellular signaling domain (e.g., as described herein). In an embodiment, the bispecific antigen-binding domain comprises a first immunoglobulin variable domain sequence that binds to an antigen, e.g., an antigen as described herein, e.g., a CD19-binding domain or a BCMA-binding domain (described herein, e.g., in Table 6 or Table 12), e.g., comprises an scFv (or comprises light chain CDRs and / or heavy chain CDRs from an scFv described herein), and a second immunoglobulin variable domain sequence that has binding specificity for one or more antigens described herein, e.g., comprises an scFv (or comprises light chain CDRs and / or heavy chain CDRs from an scFv described herein), e.g., comprises an scFv as described herein, e.g., comprises a mesothelin-binding domain or an EGFRvIII-binding domain (e.g., as described in Table 2 or Table 5). In embodiments, the bispecific antigen-binding domain comprises a CD19-binding domain described herein and a mesothelin-binding domain described herein. In embodiments, the bispecific antigen-binding domain comprises a BCMA-binding domain described herein and a mesothelin-binding domain described herein. In embodiments, the bispecific antigen-binding domain comprises a CD19-binding domain described herein and an EGFRvIII-binding domain described herein. In embodiments, the bispecific antigen-binding domain comprises a BCMA-binding domain described herein and an EGFRvIII-binding domain described herein. In another aspect, the invention provides a cell (e.g., a population of cells), e.g., immune effector cells, e.g., T cells or NK cells, e.g., as described herein, that has been engineered to express (e.g., comprise) a bispecific CAR as described herein, e.g., a bispecific CAR comprising two antigen-binding domains described herein.Without being bound by any theory, it is believed that cells expressing such bispecific CARs (e.g., those comprising two antigen-binding domains, e.g., as described herein) are useful in the methods and compositions described herein.

[0406] Chimeric TCR In one embodiment, antigen-binding domains described herein, e.g., antibodies and antibody fragments, e.g., those provided in the Tables herein, can be grafted onto one or more constant domains of a T cell receptor ("TCR") chain, e.g., a TCR alpha or TCR beta chain, to create a chimeric TCR that specifically binds to a tumor antigen described herein. Without being bound by theory, it is believed that the chimeric TCR signals via the TCR complex upon binding to an antigen. For example, a mesothelin or CD19 scFv, or a fragment thereof, e.g., a VL domain or a VH domain, as disclosed herein, can be grafted onto a constant domain, e.g., at least a portion of the extracellular constant domain, the transmembrane domain, and the cytoplasmic domain, of a TCR chain, e.g., a TCR alpha chain and / or a TCR beta chain. As another example, the CDRs of an antibody or antibody fragment, e.g., the CDRs of any antibody or antibody fragment as described in the Tables provided herein, can be grafted onto the TCR alpha and / or TCR beta chain to create a chimeric TCR that specifically binds to a tumor antigen described herein. For example, an LCDR disclosed herein may be grafted onto the variable domain of a TCR alpha chain, or an HCDR disclosed herein may be grafted onto the variable domain of a TCR beta chain, or vice versa. Such chimeric TCRs can be produced by methods known in the art (e.g., Willemsen RA et al., Gene Therapy 2000;7:1369-1377; Zhang T et al., Cancer Gene Ther 2004;11:487-496; Aggen et al., Gene Ther. 2012 Apr;19(4):365-74).

[0407] Transmembrane domain With regard to the transmembrane domain, in various embodiments, the CAR can be designed to include a transmembrane domain attached to the extracellular domain of the CAR, e.g., the antigen-binding domain. The transmembrane domain can include one or more additional amino acids adjacent to the transmembrane region, e.g., one or more amino acids associated with the extracellular region of the protein from which the transmembrane was derived (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 to up to 15 amino acids of the extracellular region), and / or one or more additional amino acids associated with the intracellular region of the protein from which the transmembrane protein was derived (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 to up to 15 amino acids of the intracellular region). In one embodiment, the transmembrane domain is associated with one of the other domains of the CAR, e.g., the transmembrane domain is from the same protein as the intracellular signaling domain, e.g., the costimulatory domain. In some cases, the transmembrane domain may be selected or modified by amino acid substitution so that it does not bind to the transmembrane domain of the same or different surface membrane protein, for example, to minimize interaction with other members of the receptor complex. In one embodiment, the transmembrane domain can homodimerize with another CAR on the surface of the cell that expresses the CAR. In another embodiment, the amino acid sequence of the transmembrane domain may be modified or substituted to minimize interaction with the binding domain of the natural binding partner present in the same CAR-expressing cell.

[0408] The transmembrane domain can be obtained from natural or recombinant sources.When the source is natural, the domain can be derived from any membrane-bound or transmembrane protein.In one embodiment, the transmembrane domain can transmit signals to the intracellular domain whenever CAR binds to the target.The transmembrane domain that has particular use in the present invention can include at least the transmembrane region of, for example, the alpha, beta or zeta chain of T cell receptor, CD28, CD27, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154. In some embodiments, the transmembrane domain comprises at least a transmembrane region, e.g., KIRDS2, OX40, CD2, CD27, LFA-1 (CD11a / CD18), ICOS (CD278), 4-1BB (CD137), GITR, CD40, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD160, CD19, IL2R beta, IL2R gamma, IL7R alpha, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1 , ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​PAG / Cbp, NKG2D, or NKG2C.

[0409] In some cases, the transmembrane domain may be attached to the extracellular region of the CAR, e.g., the antigen-binding domain of the CAR, via a hinge, e.g., a hinge derived from a human protein. For example, in one embodiment, the hinge may be a human Ig (immunoglobulin) hinge, e.g., an IgG4 hinge, or a CD8a hinge. In one embodiment, the hinge or spacer comprises (e.g., consists of) the amino acid sequence of SEQ ID NO: 4. In one aspect, the transmembrane domain comprises (e.g., consists of) the transmembrane domain of SEQ ID NO: 12.

[0410] In one embodiment, the hinge or spacer comprises an IgG4 hinge. For example, in one embodiment, the hinge or spacer comprises a hinge of the amino acid sequence (SEQ ID NO: 6). In some embodiments, the hinge or spacer comprises a hinge encoded by the nucleotide sequence of SEQ ID NO: 7. In one embodiment, the hinge or spacer comprises an IgD hinge. For example, in one embodiment, the hinge or spacer comprises a hinge of the amino acid sequence (SEQ ID NO: 8). In some embodiments, the hinge or spacer comprises a hinge encoded by the nucleotide sequence of SEQ ID NO: 9.

[0411] In one embodiment, the transmembrane domain may be recombinant, in which case it is expected to contain primarily hydrophobic residues such as leucine and valine, hi one embodiment, a triplet of phenylalanine, tryptophan and valine may be found at each end of the recombinant transmembrane domain.

[0412] A short oligo- or polypeptide linker between the transmembrane domain and the cytoplasmic region of the CAR may be used to link the CAR. A glycine-serine duo provides a particularly suitable linker. For example, in one embodiment, the linker comprises the amino acid sequence GGGGSGGGGS (SEQ ID NO: 10). In some embodiments, the linker is encoded by the nucleotide sequence GGTGGCGGAGGTTCTGGAGGTGGAGGTTCC (SEQ ID NO: 11).

[0413] In one embodiment, the hinge or spacer comprises a KIR2DS2 hinge.

[0414] Cytoplasmic domain The cytoplasmic domain or region of a CAR encompasses the intracellular signaling domain. The intracellular signaling domain is generally involved in activating at least one of the normal effector functions of the immune cell into which the CAR is introduced. The term "effector function" refers to the specialized function of a cell. The effector function of a T cell can be, for example, cytolytic activity or helper activity, including cytokine secretion. Thus, the term "intracellular signaling domain" refers to the portion of a protein that transmits an effector function signal and instructs the cell to perform a specialized function. While the entire intracellular signaling domain can usually be utilized, it is often not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signaling domain is used, such a truncated portion can be used in place of the intact chain as long as it transmits the effector function signal. Thus, the term intracellular signaling domain is intended to encompass any truncated portion of the intracellular signaling domain sufficient to transmit the effector function signal.

[0415] Examples of intracellular signaling domains for use in the CARs of the invention include the cytoplasmic sequences of the T cell receptor (TCR) and of co-receptors that act cooperatively to initiate signal transduction following antigen receptor engagement, as well as any derivatives or variants of these sequences and any recombinant sequences that have the same functional capacity.

[0416] It is known that signals generated by the TCR alone are insufficient to fully activate T cells; secondary and / or costimulatory signals are also required. Thus, T cell activation can be said to be mediated by two distinct classes of intracytoplasmic signaling sequences: those that initiate antigen-dependent primary activation via the TCR (primary intracellular signaling domains) and those that act in an antigen-independent manner to provide secondary or costimulatory signals (secondary cytoplasmic domains, e.g., costimulatory domains).

[0417] The primary signaling domain regulates the primary activation of the TCR complex in either a stimulatory or inhibitory manner. Primary intracellular signaling domains that act in a stimulatory manner may contain signaling motifs known as immunoreceptor tyrosine-based activation motifs, or ITAMs.

[0418] Examples of ITAM-containing primary intracellular signaling domains that are particularly useful in the present invention include those of TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD278 (also known as "ICOS") FcεRI, DAP10, DAP12, and CD66d. In one embodiment, a CAR of the present invention comprises an intracellular signaling domain, such as a primary signaling domain of CD3-zeta, e.g., a CD3-zeta sequence described herein.

[0419] In one embodiment, the primary signaling domain comprises a modified ITAM domain, e.g., a mutated ITAM domain that has altered (e.g., increased or decreased) activity compared to the native ITAM domain. In one embodiment, the primary signaling domain comprises a modified ITAM-containing primary intracellular signaling domain, e.g., a primary intracellular signaling domain that contains an optimized and / or truncated ITAM. In certain embodiments, the primary signaling domain comprises one, two, three, four, or more ITAM motifs.

[0420] The intracellular signaling domain of the CAR may comprise the CD3 zeta signaling domain itself, or may be combined with any other desired intracellular signaling domain useful in the context of the CAR of the present invention. For example, the intracellular signaling domain of the CAR may comprise a portion of the CD3 zeta chain and a costimulatory signaling domain. The costimulatory signaling domain refers to the portion of the CAR that comprises the intracellular domain of a costimulatory molecule. Costimulatory molecules are cell surface molecules other than antigen receptors or their ligands that are required for the efficient response of lymphocytes to antigens. Examples of such molecules include CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83, and the like. For example, CD27 costimulation has been demonstrated to enhance the expansion, effector function, and survival of human CART cells in vitro and to increase the persistence and antitumor activity of human T cells in vivo [Song et al. Blood. 2012; 119(3):696-706].Further examples of such costimulatory molecules include MHC class I molecules, TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocyte activation molecules (SLAM proteins), activating NK cell receptors, BTLA, Toll ligand receptors, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, LFA-1 (CD11a / CD18), and 4-1BB. (CD137), B7-H3, CDS, ICAM-1, ICOS (CD278), GITR, BAFFR, LIGHT, HVEM (LIGHTR), KIRDS2, SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD19, CD4, CD8 alpha, CD8 beta, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITG A6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, NKG2C, TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), Ligands that specifically bind to CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a, and CD83 are included.

[0421] The intracellular signaling sequences in the cytoplasmic portion of the CAR of the present invention may be linked to each other in a random order or a specific order. For example, a short oligo- or polypeptide linker between 2 to 10 amino acids in length (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids) may form the link between the intracellular signaling sequences. In one embodiment, a suitable linker may be a glycine-serine duo. In one embodiment, a suitable linker may be a single amino acid, such as alanine or glycine.

[0422] In one aspect, the intracellular signaling domain is designed to include two or more, e.g., two, three, four, five, or more, costimulatory signaling domains. In some embodiments, the two or more, e.g., two, three, four, five, or more, costimulatory signaling domains are separated by a linker molecule, e.g., a linker molecule described herein. In one embodiment, the intracellular signaling domain comprises two costimulatory signaling domains. In some embodiments, the linker molecule is a glycine residue. In some embodiments, the linker is an alanine residue.

[0423] In one embodiment, the intracellular signaling domain is designed to comprise the signaling domain of CD3-zeta and the signaling domain of CD28. In one embodiment, the intracellular signaling domain is designed to comprise the signaling domain of CD3-zeta and the signaling domain of 4-1BB. In one embodiment, the signaling domain of 4-1BB is the signaling domain of SEQ ID NO: 14. In one embodiment, the signaling domain of CD3-zeta is the signaling domain of SEQ ID NO: 18.

[0424] In one embodiment, the intracellular signaling domain is designed to include the signaling domain of CD3-zeta and the signaling domain of CD27. In one embodiment, the signaling domain of CD27 comprises the amino acid sequence of SEQ ID NO: 16. In one embodiment, the signaling domain of CD27 is encoded by the nucleic acid sequence of SEQ ID NO: 17.

[0425] In one embodiment, the intracellular entity is designed to comprise the signaling domain of CD3-zeta and the signaling domain of CD28. In one embodiment, the signaling domain of CD28 comprises the amino acid sequence of SEQ ID NO: 124. In one embodiment, the signaling domain of CD28 is encoded by the nucleic acid sequence of SEQ ID NO: 1113.

[0426] In one embodiment, the intracellular entity is designed to include the signaling domain of CD3-zeta and the signaling domain of ICOS. In one embodiment, the signaling domain of ICOS includes the amino acid sequence of SEQ ID NO: 120. In one embodiment, the signaling domain of ICOS is encoded by the nucleic acid sequence of SEQ ID NO: 1111.

[0427] In one aspect, a cell of the invention, e.g., as described herein, e.g., a cell expressing two different CARs, comprises CARs each comprising an antigen-binding domain that binds to a target antigen described herein, a transmembrane domain, a primary signaling domain, and a costimulatory signaling domain. In embodiments of the above aspect, the costimulatory domains of the two different CARs may be the same or different. In embodiments, one or more of the two different CARs comprises more than one costimulatory signaling domain. In another aspect, a cell of the invention, e.g., as described herein, e.g., a cell expressing two different CARs, comprises a first CAR that comprises an antigen-binding domain that binds to a target antigen described herein, a transmembrane domain, and a primary signaling domain, but does not comprise a costimulatory signaling domain, and a second CAR that comprises an antigen-binding domain that binds to a target antigen described herein, a transmembrane domain, and a costimulatory signaling domain, but does not comprise a primary signaling domain.

[0428] In one aspect, a CAR-expressing cell described herein, e.g., a cell expressing two different CARs, can further comprise another, e.g., a third CAR, e.g., another CAR, including a different antigen-binding domain, for the same target or a different target (e.g., a target other than a tumor antigen described herein, or a different tumor antigen described herein). For example, in embodiments where a cell of the invention expresses a third CAR including an antigen-binding domain that binds to a second target tumor antigen, the third CAR includes an antigen-binding domain for a target expressed on the same cancer cell type as the tumor antigen targeted by the first or second CAR. In one embodiment, the CAR-expressing cell comprises a first CAR that targets a first tumor antigen, the first CAR including an intracellular signaling domain with a costimulatory signaling domain but without a primary signaling domain, and a third CAR that targets a second, different tumor antigen, the third CAR including an intracellular signaling domain with a primary signaling domain but without a costimulatory signaling domain. Without wishing to be bound by theory, placing a costimulatory signaling domain, such as 4-1BB, CD28, CD27, or OX-40, on a first CAR and a primary signaling domain, such as CD3 zeta, on a third CAR can limit CAR activity to cells in which both targets are expressed. In one embodiment, the cells of the invention comprise a first CAR that includes an antigen-binding domain, a transmembrane domain, and a costimulatory domain that binds to a target antigen described herein, and a second CAR that targets a different target antigen (e.g., an antigen expressed on the same cancer cell type as the first target antigen) and includes an antigen-binding domain, a transmembrane domain, and a primary signaling domain. In another embodiment, the cells of the invention comprise (i.e., are genetically engineered to express) a first CAR that includes an antigen-binding domain, a transmembrane domain, and a primary signaling domain that binds to a target antigen described herein, and a second CAR that targets a tumor antigen other than the first target antigen (e.g., an antigen expressed on the same cancer cell type as the first target antigen) and includes an antigen-binding domain, a transmembrane domain, and a costimulatory signaling domain for the antigen.In another embodiment, the cells of the present invention comprise (i.e., are genetically engineered to express) a first CAR that includes an antigen-binding domain that binds to a target antigen described herein, a transmembrane domain, a costimulatory domain, and a primary signaling domain, and a second CAR that targets a tumor antigen other than the first target antigen (e.g., an antigen expressed on the same cancer cell type as the first target antigen) and includes an antigen-binding domain for the antigen, a transmembrane domain, a costimulatory signaling domain, and a primary signaling domain. In embodiments in which both the first and second CARs include costimulatory signaling domains, the costimulatory signaling domains of the first CAR and the second CAR may be derived from the same protein, e.g., a costimulatory protein described herein, e.g., 4-1BB, CD28, or ICOS. In other embodiments, the costimulatory signaling domains of the first CAR and the second CAR may be derived from different proteins, e.g., the first CAR includes a costimulatory signaling domain described herein, e.g., of 4-1BB, and the second CAR includes a different costimulatory signaling domain described herein, e.g., of CD28.

[0429] In one embodiment, the CAR-expressing cells include a CAR comprising an antigen-binding domain that binds to a target antigen described herein, and an inhibitory CAR. In one embodiment, the inhibitory CAR comprises an antigen-binding domain that binds to an antigen that can be found not on cancer cells but on normal cells, for example, normal cells that also express the tumor antigen targeted by the CAR comprising the antigen-binding domain that binds to the target antigen. In one embodiment, the inhibitory CAR comprises the antigen-binding domain, transmembrane domain, and intracellular domain of an inhibitory molecule. For example, the intracellular domain of the inhibitory CAR may be the intracellular domain of PD1, PD-L1, CTLA4, TIM3, LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD270), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, or TGFR beta.

[0430] In one embodiment, the antigen-binding domains of different CARs may be such that they do not interact with each other. For example, a cell expressing a first and a second CAR may have an antigen-binding domain of the first CAR, e.g., as a fragment, e.g., an scFv, that does not associate with the antigen-binding domain of the second CAR, e.g., the antigen-binding domain of the second CAR is a VHH.

[0431] In some embodiments, the antigen-binding domain includes a single-domain antigen-binding (SDAB) molecule, which encompasses molecules whose complementarity-determining regions are part of a single-domain polypeptide. Examples include, but are not limited to, heavy chain variable domains, binding molecules that naturally lack light chains, single domains derived from conventional four-chain antibodies, engineered domains other than those derived from antibodies, and single-domain scaffolds. The SDAB molecule may be any single-domain molecule in the art or any future single-domain molecule. The SDAB molecule may be derived from any species, including, but not limited to, mouse, human, camel, llama, lamprey, fish, shark, goat, rabbit, and cow. The term also encompasses naturally occurring single-domain antibody molecules from species other than camelids and sharks.

[0432] In one embodiment, SDAB molecules can be derived from the variable regions of immunoglobulins found in fish, such as those derived from the immunoglobulin isotype known as novel antigen receptors (NARs) found in shark serum. Methods for generating single domain molecules ("IgNARs") derived from the variable regions of NARs are described in WO 03 / 014161 and Streltsov (2005) Protein Sci. 14:2901-2909.

[0433] In another embodiment, the SDAB molecule is a naturally occurring single-domain antigen-binding molecule known as a heavy chain devoid of light chains.Such single-domain molecules are disclosed, for example, in WO9404678 and Hamers-Casterman, C. et al.(1993) Nature 363:446-448.For clarity, this variable domain derived from a heavy chain molecule naturally devoid of light chains is referred to herein as a VHH or nanobody to distinguish it from the conventional VH of four-chain immunoglobulins.Such VHH molecules can be obtained from Camelidae species, for example, camel, llama, dromedary, alpaca and guanaco.Other species other than Camelidae may also produce heavy chain molecules naturally devoid of light chains, and such VHHs are within the scope of the present invention.

[0434] SDAB molecules can be recombinant, CDR-grafted, humanized, camelized, deimmunized, and / or produced in vitro (e.g., selected by phage display).

[0435] It has also been discovered that cells having multiple chimeric membrane-embedded receptors comprising antigen-binding domains, where interactions between the antigen-binding domains of the receptors may be undesirable, for example, because they inhibit the ability of the antigen-binding domains to bind to one or more of their cognate antigens.Therefore, disclosed herein are cells having first and second non-naturally occurring chimeric membrane-embedded receptors comprising antigen-binding domains that minimize such interactions.Also disclosed herein are nucleic acids encoding first and second non-naturally occurring chimeric membrane-embedded receptors comprising antigen-binding domains that minimize such interactions, as well as methods for producing and using such cells and nucleic acids.In some embodiments, one antigen-binding domain of the first and second non-naturally occurring chimeric membrane-embedded receptors comprises an scFv, and the other comprises a single VH domain, for example, a camelid, shark, or lamprey single VH domain, or a single VH domain derived from a human or mouse sequence.

[0436] In another aspect, the CAR-expressing cells described herein can further express another agent, for example, an agent that enhances the activity of the CAR-expressing cell. For example, in one embodiment, the agent may be an agent that inhibits an inhibitory molecule. In some embodiments, an inhibitory molecule, such as PD1, can reduce the ability of a CAR-expressing cell to initiate an immune effector response. Examples of inhibitory molecules include PD1, PD-L1, CTLA4, TIM3, CEACAM (e.g., CEACAM-1, CEACAM-3, and / or CEACAM-5), LAG3, VISTA, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD270), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGFR beta.

[0437] In one embodiment, the agent that inhibits an inhibitory molecule is, e.g., a molecule described herein, e.g., an agent comprising a first polypeptide, e.g., an inhibitory molecule, associated with a second polypeptide that provides a positive signal to the cell, e.g., an intracellular signaling domain described herein. In one embodiment, the agent inhibits an inhibitory molecule, e.g., PD1, PD-L1, CTLA4, TIM3,...

Claims

1. 1. A fusion protein comprising two protein domains separated by a heterologous protease cleavage site, a first of said protein domains being a conditionally expressed domain and a second of said protein domains being a transmembrane protein, said conditionally expressed domain having a first state associated with a first level of surface and / or extracellular expression of said fusion protein and a second state associated with a second level of surface and / or extracellular expression of said fusion protein, said second level being increased, e.g., by at least 2, 3, 4, 5, 10, 20 or 30 fold relative to said first level in the presence of an expression compound.

2. A fusion protein comprising two protein domains separated by a heterologous protease cleavage site, wherein a first of said protein domains is a conditional expression domain and a second of said protein domains is a transmembrane protein, and said heterologous protease cleavage site is a furin cleavage site, with the proviso that said furin cleavage site does not comprise the amino acid sequence SARNRQKR (SEQ ID NO:981).

3. 1. A fusion protein comprising two protein domains separated by a heterologous protease cleavage site, a first of said protein domains being a conditional expression domain and a second of said protein domains being a chimeric antigen receptor (CAR).

4. The fusion protein according to any one of claims 1 to 3, wherein the conditional expression domain is a degradation domain.

5. The fusion protein according to any one of claims 1 to 3, wherein the conditional expression domain is an aggregation domain.

6. A fusion protein comprising two protein domains separated by a heterologous protease cleavage site, a first of said protein domains being a degradation domain and a second of said protein domains being a protein of interest.

7. A fusion protein comprising two protein domains separated by a heterologous protease cleavage site, a first of said protein domains being a degradation domain and a second of said protein domains being a transmembrane protein.

8. 1. A fusion protein comprising two protein domains separated by a heterologous protease cleavage site, a first of said protein domains being a degradation domain and a second of said protein domains being a chimeric antigen receptor (CAR).

9. The fusion protein according to any one of claims 6 to 8, wherein the degradation domain is selected from an estrogen receptor (ER) domain, an FKBP protein (FKBP) domain or a dihydrofolate reductase (DHFR) domain.

10. The fusion protein of any one of claims 4 or 6 to 9, wherein the degradation domain is from the estrogen receptor (ER).

11. 11. The fusion protein of any one of claims 4 or 6-10, wherein the degradation domain is from the estrogen receptor (ER) and comprises an amino acid sequence that is at least 90, 95, 97, 98, 99, or 100% identical to any of SEQ ID NOs: 58 or 121.

12. The fusion protein of any one of claims 4 or 6 to 9, wherein the degradation domain is from the FKB protein (FKBP).

13. 13. The fusion protein of any one of claims 4, 6-9, or 12, wherein the degradation domain is from FKB protein (FKBP) and comprises an amino acid sequence that is at least 90, 95, 97, 98, 99, or 100% identical to SEQ ID NO:

56.

14. The fusion protein of any one of claims 4 or 6 to 9, wherein the degradation domain is from dihydrofolate reductase (DHFR).

15. 15. The fusion protein of any one of claims 4, 6-9, or 14, wherein the degradation domain is from dihydrofolate reductase (DHFR) and comprises an amino acid sequence that is at least 90, 95, 97, 98, 99, or 100% identical to SEQ ID NO:

57.

16. 16. The fusion protein of any one of claims 4 or 6-15, wherein the degradation domain has a first state associated with a first level of surface and / or extracellular expression of the fusion protein and a second state associated with a second level of surface and / or extracellular expression of the fusion protein, the second level being increased, e.g., by at least 2, 3, 4, 5, 10, 20 or 30 fold compared to the first level in the presence of a stabilizing compound.

17. 17. The fusion protein of claim 16, wherein the stabilizing compound is selected from bazedoxifene or 4-hydroxytamoxifen (4-OHT), when the fusion protein comprises a degradation domain from an estrogen receptor.

18. The fusion protein of claim 16, wherein the stabilizing compound is Shield-1 when the fusion protein comprises a degradation domain derived from an FKB protein.

19. A fusion protein comprising two protein domains separated by a heterologous protease cleavage site, a first of said protein domains being an aggregation domain and a second of said protein domains being a transmembrane protein, said aggregation domain having a first state associated with a first level of surface and / or extracellular expression of said fusion protein and a second state associated with a second level of surface and / or extracellular expression of said fusion protein, said second level being increased, e.g., by at least 2, 3, 4, 5, 10, 20 or 30 fold compared to said first level in the presence of a disaggregating compound.

20. A fusion protein comprising two protein domains separated by a heterologous protease cleavage site, wherein a first of said protein domains is an aggregation domain and a second of said protein domains is a transmembrane protein, and wherein said heterologous protease cleavage site is a furin cleavage site, with the proviso that said furin cleavage site does not comprise the amino acid sequence SARNRQKR (SEQ ID NO:981).

21. A fusion protein comprising two protein domains separated by a heterologous protease cleavage site, a first of said protein domains being an aggregation domain and a second of said protein domains being a chimeric antigen receptor (CAR).

22. The fusion protein according to any one of claims 19 to 21, wherein the aggregation domain comprises 1, 2, 3, 4, 5, 6, 7, 8 or more repeats of a dimerization domain, such as a homodimerization or heterodimerization domain.

23. The fusion protein according to any one of claims 19 to 22, wherein the aggregation domain is from the FKB protein (FKBP).

24. The fusion protein according to any one of claims 19 to 22, wherein the aggregation domain is the FKBP F36M domain.

25. 23. The fusion protein of any one of claims 19 to 22, wherein the aggregation domain is from the FKB protein (FKBP) and comprises an amino acid sequence that is at least 90, 95, 97, 98, 99, or 100% identical to any of SEQ ID NOs: 975 or 976.

26. The fusion protein of any one of claims 19 to 25, further comprising a second, third, fourth, fifth, sixth, seventh, eighth, ninth or tenth aggregation domain.

27. 27. The fusion protein of claim 26, wherein the second, third, fourth, fifth, sixth, seventh, eighth, ninth or tenth aggregation domain is the same type of aggregation domain as the first aggregation domain.

28. The fusion protein according to any one of claims 19 to 25, wherein the aggregation domain forms a homodimer with the same aggregation domain.

29. The fusion protein according to any one of claims 19 to 25, comprising a plurality of aggregation domains, said plurality comprising more than one type, e.g. two types of aggregation domains, wherein a first type of aggregation domain forms a heterodimer with a second type of aggregation domain.

30. 30. The fusion protein of claim 29, comprising 2, 4, 6, 8 or 10 aggregation domains and comprising an equal number of first type aggregation domains and second type aggregation domains.

31. 31. The fusion protein of claim 30, wherein the aggregation domains are arranged in the fusion protein in an alternating order of first and second types, such as first, second, first, second, or second, first, second, first.

32. 20. The fusion protein of claim 19, wherein when the fusion protein comprises an aggregation domain derived from an FKB protein (FKBP), such as FKBP F36M, the disaggregation compound is selected from FK506, rapamycin, AP22542, AP21998 and Shield-1.

33. The fusion protein of any one of claims 1 to 32, wherein the heterologous cleavage site is cleaved by a mammalian intracellular protease.

34. 34. The fusion protein of claim 33, wherein the cleavage site is cleaved by a protease selected from the group consisting of furin, PCSK1, PCSK5, PCSK6, PCSK7, cathepsin B, granzyme B, factor XA, enterokinase, genenase, sortase, precision protease, thrombin, TEV protease and elastase 1.

35. 35. The fusion protein of any one of claims 1 to 34, wherein the cleavage site comprises a polypeptide having a cleavage motif selected from the group consisting of: RX(K / R)R consensus motif, RXXX[KR]R consensus motif, RRX consensus motif, I-E-P-D-X consensus motif (SEQ ID NO:35), Glu / Asp-Gly-Arg, Asp-Asp-Asp-Asp-Lys (SEQ ID NO:36), Pro-Gly-Ala-Ala-His-Tyr (SEQ ID NO:37), LPXTG / A consensus motif, Leu-Glu-Val-Phe-Gln-Gly-Pro (SEQ ID NO:38), Leu-Val-Pro-Arg-Gly-Ser (SEQ ID NO:40), E-N-L-Y-F-Q-G (SEQ ID NO:41) and [AGSV]-x (SEQ ID NO:42).

36. The fusion protein of claim 34 or 35, wherein the cleavage site is cleaved by furin.

37. 37. The fusion protein of claim 36, comprising a furin cleavage site selected from: GTGAEDPRPSRKRRSLGDVG (SEQ ID NO: 125), GTGAEDPRPSRKRR (SEQ ID NO: 127), LQWLEQQVAKRRTKR (SEQ ID NO: 129), GTGAEDPRPSRKRRSLGG (SEQ ID NO: 131), GTGAEDPRPSRKRRSLG (SEQ ID NO: 133), SLNLTESHNSRKKR (SEQ ID NO: 135), or CKINGYPKRGRKRR (SEQ ID NO: 137).

38. 37. The fusion protein of claim 36, comprising a furin cleavage site of GTGAEDPRPSRKRRSLGDVG (sequence number 125).

39. The fusion protein of any one of claims 1 to 32, wherein the heterologous protease cleavage site is cleaved by a mammalian extracellular protease.

40. 40. The fusion protein of claim 39, wherein the mammalian extracellular protease is selected from the group consisting of factor XA, enterokinase, genenase, sortase, precision protease, thrombin, TEV protease and elastase 1.

41. 40. The fusion protein of claim 39, wherein the cleavage site comprises a polypeptide having an amino acid sequence selected from the group consisting of Glu / Asp-Gly-Arg, Asp-Asp-Asp-Asp-Lys (SEQ ID NO:36), Pro-Gly-Ala-Ala-His-Tyr (SEQ ID NO:37), a LPXTG / A consensus motif, Leu-Glu-Val-Phe-Gln-Gly-Pro (SEQ ID NO:38), Leu-Val-Pro-Arg-Gly-Ser (SEQ ID NO:40), E-N-L-Y-F-Q-G (SEQ ID NO:41), and [AGSV]-x (SEQ ID NO:42).

42. The fusion protein of any one of claims 1 to 41, wherein the second protein domain is a chimeric antigen receptor (CAR).

43. The fusion protein of claim 42, wherein the chimeric antigen receptor (CAR) comprises, from N-terminal to C-terminal, an antigen binding domain, a transmembrane domain, and one or more intracellular signaling domains.

44. 44. The fusion protein of Claim 43, wherein the intracellular signaling domain comprises one or more primary signaling domains.

45. 45. The fusion protein of claim 43 or 44, wherein the intracellular signaling domain comprises one or more costimulatory signaling domains.

46. The fusion protein of claim 44, wherein one of the one or more primary signaling domains comprises a CD3-zeta costimulatory domain.

47. 46. ​​The fusion protein of claim 45, wherein one or more of the costimulatory signaling domains are an intracellular domain from a costimulatory protein selected from the group consisting of CD27, CD28, 4-1BB (CD137), OX40, GITR, CD30, CD40, ICOS, BAFFR, HVEM, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD2, CDS, CD7, CD287, LIGHT, NKG2C, NKG2D, SLAMF7, NKp80, NKp30, NKp44, NKp46, CD160, B7-H3, and a ligand that specifically binds CD83.

48. The fusion protein of claim 47, wherein one or more of the costimulatory signaling domains comprises a 4-1BB costimulatory domain.

49. 48. The fusion protein of claim 47, wherein one or more of the costimulatory domains comprises a CD28 costimulatory domain.

50. The fusion protein of any one of claims 43 to 49, wherein the antigen-binding domain is an scFv.

51. The antigen binding domain is selected from the group consisting of CD19, CD123, CD22, CD30, CD171, CS-1, C-type lectin-like molecule-1, CD33, epidermal growth factor receptor variant III (EGFRvIII), ganglioside G2 (GD2), ganglioside GD3, TNF receptor family member B-cell mutated (BCMA), Tn antigen [(Tn Ag) or (GalNAcα-Ser / Thr)]; prostate-specific membrane antigen (PSMA); receptor tyrosine kinase-like orphan receptor 1 (ROR1); Fms-like tyrosine kinase 3 (FLT3); tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6; carcinoembryonic antigen (CEA); epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); interleukin-13 receptor subunit alpha-2; mesothelin; interleukin-13 receptor subunit alpha-2; mesothelin; Ikin-11 receptor alpha (IL-11Ra); Prostate stem cell antigen (PSCA); Prostatic serine 21; Vascular endothelial growth factor receptor 2 (VEGFR2); Lewis (Y) antigen; CD24; Platelet-derived growth factor receptor beta (PDGFR-beta); Stage-specific embryonic antigen-4 (SSEA-4); CD20; Folate receptor alpha; Receptor tyrosine protein kinase ERBB2 (Her2 / neu); Cell surface-associated mucin 1 (MUC1); Epidermal growth factor receptor (EGFR) ; neural cell adhesion molecule (NCAM); prostase; prostatic acid phosphatase (PAP); elongation factor 2 mutated (ELF2M); ephrinB2; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (IGF-I receptor), carbonic anhydrase IX (CAIX); proteasome (prosome, macropain) subunit, beta, 9 (LMP2); glycoprotein 100 (gp100); breakpoint cluster region (BCR) and Abelson oncogene fusion protein (bcr-abl) consisting of murine leukemia viral oncogene homolog 1 (Abl); tyrosinase; ephrin type A receptor 2 (EphA2); fucosyl GM1; sialyl Lewis adhesion molecule (sLe); ganglioside GM3; transglutaminase 5 (TGS5); high molecular weight melanoma-associated antigen (HMWMAA); o-acetyl-GD2 ganglioside (OAcGD2); folate receptor beta; tumor endothelial marker 1 (TEM1 / CD248);Tumor endothelial marker 7-related (TEM7R); Claudin 6 (CLDN6); Thyroid-stimulating hormone receptor (TSHR); G protein-coupled receptor class C group 5, member D (GPRC5D); X chromosome open reading frame 61 (CXORF61); CD97; CD179a; Anaplastic lymphoma kinase (ALK); Polysialic acid; Placenta specific 1 (PLAC1); Hexasaccharide portion of Globo H glycoceramide (GloboH); Mammary differentiation antigen (NY-BR-1); Uroplakin 2 (UPK2); Hepatitis A virus cell receptor 1 (HAVCR1); Adrenergic receptor beta 3 (ADRB3); Pannexin 3 (PANX3); G protein-coupled receptor 20 (GPR20); Lymphocyte antigen 6 complex, locus K 9 (LY6K); olfactory receptor 51E2 (OR51E2); TCR gamma alternative reading frame protein (TARP); Wilms tumor protein (WT1); cancer / testis antigen 1 (NY-ESO-1); cancer / testis antigen 2 (LAGE-1a); melanoma-associated antigen 1 (MAGE-A1); ETS translocation variant gene 6 located on chromosome 12p (ETV6-AML); sperm protein 17 (SPA17); X-antigen family, member 1A (XAGE1); angiopoietin-binding cell surface receptor 2 (Tie 2); melanoma cancer testis antigen-1 (MAD-CT-1); melanoma cancer testis antigen-2 (MAD-CT-2); Fos-related antigen 1; tumor protein p53 (p53); p53 mutant; prostein; survivin; telomerase; prostate cancer tumor antigen-1, melanoma antigen 1 recognized by T cells; rat sarcoma (Ras) mutant; plasminogen activator; human telomerase reverse transcriptase (hTERT); sarcoma translocation breakpoints; inhibitor of apoptosis in melanoma (ML-IAP); ERG [transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene]; N-acetylglucosaminyl-transferase V (NA17); paired box protein Pax-3 (PAX3); androgen receptor; cyclin B1; v-myc avian myelocytosis viral oncogene neuroblastoma-derived homolog (MYCN); Ras homolog family member C (RhoC); tyrosinase-related protein 2 (TRP-2); cytochrome P450 1B1 (CYP1B1); CCCTC-binding factor (zinc finger protein)-like, squamous cell carcinoma antigen 3 recognized by T cells (SART3); paired box protein Pax-5 (PAX5); proacrosin-binding protein sp32 (OY-TES1); lymphocyte-specific protein tyrosine kinase (LCK); A-kinase anchor protein 4 (AKAP-4); synovial sarcoma, X-chromosome breakpoint 2 (SSX2); receptor for advanced glycation end products (RAGE-1); renal ubiquitous 1 (RU1); renal ubiquitous 2 (RU2); legumain; human papillomavirus E6 (HPV E6); human papillomavirus E7 (HPV E7); intestinal carboxylesterase; heat shock protein 70-2 mutant (mutated) 50. The fusion protein of any one of claims 43 to 49, which binds to an antigen selected from the group consisting of hsp70-2; CD79a; CD79b; CD72; leukocyte-associated immunoglobulin-like receptor 1 (LAIR1); Fc fragment of the IgA receptor (FCAR or CD89); leukocyte-associated immunoglobulin-like receptor subfamily A member 2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12 member A (CLEC12A); bone marrow stromal cell antigen 2 (BST2); EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2); lymphocyte antigen 75 (LY75); glypican 3 (GPC3); Fc receptor-like 5 (FCRL5); and immunoglobulin lambda-like polypeptide 1 (IGLL1).

52. 52. The fusion protein of claim 51 , wherein the antigen is CD19.

53. 53. The fusion protein of claim 52, comprising an antigen-binding domain comprising an amino acid sequence selected from any one of SEQ ID NOs: 356-368 or 381.

54. 53. The fusion protein of claim 52, comprising a chimeric antigen receptor comprising an amino acid sequence selected from any one of SEQ ID NOs: 897, 902, 907, 912, 917, 922, 927, 932, 937, 942, 947, 952, 956.

55. 52. The fusion protein of claim 51 , wherein the antigen is CD123.

56. 56. The fusion protein of claim 55, comprising an antigen-binding domain comprising an amino acid sequence selected from any one of SEQ ID NOs: 751, 756, 761 or 766.

57. 56. The fusion protein of claim 55, comprising a chimeric antigen receptor comprising an amino acid sequence selected from any one of SEQ ID NOs: 750, 755, 760 or 765.

58. 52. The fusion protein of claim 51, wherein the antigen is BCMA.

59. 59. The fusion protein of claim 58, comprising an antigen binding domain comprising an amino acid sequence selected from any one of SEQ ID NOs: 382, ​​386, 390, 394, 398, 402, 406, 410, 414, 418, 422, 426, 430, 434, 438, 442, 446, 450, 454, 458, 462, 466, 470, 474, 478, 482, 486, 490, 494, 498, 502, 506, 510, 514, 518, 522, 528, 531, 534 or 537.

60. 59. The fusion protein of claim 58, comprising a chimeric antigen receptor comprising an amino acid sequence selected from any one of SEQ ID NOs: 789, 791, 793, 795, 797, 799, 801, 803, 805, 807, 809, 811, 813, 815, 817, 819, 821, 823, 825, 827, 829, 831, 833, 835, 837, 839, 841, 843, 845, 847, 849, 851, 853, 855, 857, or 859.

61. 52. The fusion protein of claim 51 , wherein the antigen is CD20.

62. The fusion protein of claim 61, comprising an antigen-binding domain comprising an amino acid sequence located at positions 470-712 or 470-939 of SEQ ID NO:3033.

63. 62. The fusion protein of claim 61 , comprising a chimeric antigen receptor comprising the amino acid sequence of SEQ ID NO: 3033.

64. The conditional expression domain, e.g., an aggregation domain or a degradation domain, a) the N-terminus of said second protein domain, or b) the C-terminus of the second protein domain The fusion protein according to any one of claims 1 to 63, which is located in

65. 65. The fusion protein of any one of claims 1 to 64, further comprising a signal peptide, for example comprising a signal peptide N-terminal to the conditional expression domain, for example the aggregation domain or the degradation domain.

66. 66. The fusion protein of claim 65, further comprising a linker located between the signal peptide and another domain of the fusion protein, e.g., located between the signal peptide and the conditional expression domain, e.g., an aggregation domain or a degradation domain.

67. 67. The fusion protein of claim 66, wherein the linker is a linker in any of the fusion proteins listed in Tables 23 and 24.

68. A fusion protein comprising the amino acid sequence of any of the fusion proteins listed in Tables 22, 23, and 24.

69. A nucleic acid encoding a fusion protein according to any one of claims 1 to 68.

70. 70. A vector comprising the nucleic acid of claim 69.

71. The vector of claim 70 which is a viral vector.

72. 71. The vector of claim 70 which is a lentiviral vector.

73. A viral particle comprising the vector according to any one of claims 70 to 72.

74. A cell, such as a host cell, comprising a fusion protein according to any one of claims 1 to 68, a nucleic acid according to claim 69 or a vector according to any one of claims 70 to 72.

75. 75. The cell, e.g., a host cell, of claim 74, which is a human effector cell, e.g., a human T cell or a human NK cell.

76. 76. A cell, e.g. a host cell, according to either of claims 74 or 75, further comprising a protease capable of cleaving the heterologous protease cleavage site.

77. 77. The cell of any one of claims 74 to 76, wherein in the absence of an expression compound, such as a stabilizing compound, the fusion protein is degraded by an intracellular degradation pathway, such as at least 50%, 60%, 70%, 80%, 90% or more of the fusion protein is degraded.

78. 77. The cell of any one of claims 74 to 76, wherein in the absence of an expression compound, such as a disaggregating compound, the fusion protein is in an aggregated state within the cell, such as in the endoplasmic reticulum or cytosol, such as at least 50%, 60%, 70%, 80%, 90% or more in an aggregated state.

79. The cell of any one of claims 74 to 78, further comprising an expression compound, such as a stabilizing compound.

80. The cell of claim 79, wherein the conditional expression domain, e.g., a degradation domain, adopts a conformation in the presence of the expression compound, e.g., a stabilizing compound, that is more resistant to intracellular degradation compared to a conformation in the absence of the expression compound.

81. 81. The cell of either claim 79 or 80, wherein the conformation of the fusion protein is more permissive for cleavage at a heterologous protease cleavage site in the presence of the expression compound, e.g., a stabilizing compound, compared to the conformation in the absence of the expression compound.

82. 81. The cell of claim 79 or 80, wherein the level of cell surface or extracellular expression of the fusion protein is higher, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20 or 30 times higher, than the level of cell surface or extracellular expression of the fusion protein in a cell that does not contain an expression compound, e.g., a stabilizing compound.

83. The cell of any one of claims 74 to 78, further comprising an expression compound, such as a disaggregation compound.

84. 84. The cell of claim 83, wherein the conditional expression domain, e.g., aggregation domain, adopts a conformation that is more resistant to oligomerization or aggregation in the presence of the expression compound, e.g., a disaggregation compound, compared to the conformation in the absence of the expression compound.

85. 85. The cell of either claim 83 or 84, wherein the conformation of the fusion protein is more permissive for cleavage at a heterologous protease cleavage site in the presence of the expression compound, e.g., a disaggregation compound, compared to the conformation in the absence of the expression compound.

86. 85. The cell of claim 83 or 84, wherein the level of cell surface or extracellular expression of the fusion protein is higher, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20 or 30 times higher, than the level of cell surface or extracellular expression of the fusion protein in a cell that does not contain an expression compound, e.g., a disaggregation compound.

87. 1. A method for conditionally expressing a protein of interest, a transmembrane protein or a CAR at the surface of a cell, comprising contacting a fusion protein according to any one of claims 1 to 68, or a cell comprising said fusion protein (e.g. a cell according to any one of claims 74 to 86), with an expression compound, (a) in the presence of the expression compound, surface expression of the protein, transmembrane protein, or CAR of the subject is increased, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, or 30 times higher, compared to the level of surface expression of the protein, transmembrane protein, or CAR of the subject in the absence of the expression compound; and (b) in the absence of the expression compound, surface expression of the protein, transmembrane protein, or CAR of interest is substantially reduced, e.g., 2-, 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 20-, or 30-fold, compared to the level of surface expression of the protein, transmembrane protein, or CAR of interest in the presence of the expression compound; method.

88. 88. The method of claim 87, wherein the presence of the expression compound is associated with, e.g., causes, a conformational change of the conditionally expressed domain from a first folding state to a second folding state, the first folding state being more susceptible to degradation, e.g., intracellular degradation, or aggregation, compared to the second folding state.

89. 89. The method of claim 87 or 88, wherein the presence of the expressed compound exposes the protease cleavage site to a greater extent compared to the exposure of the protease cleavage site in the absence of the expressed compound, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 20 or 30 times greater.

90. A method for conditionally expressing a protein of interest, a transmembrane protein or a CAR, comprising contacting a cell, such as a cell according to any one of claims 74 to 86, with an expression compound, such as a stabilising or disaggregating compound, (a) in the presence of the expression compound, the conditionally expressed domain adopts a conformation that is more permissive for cleavage of the heterologous protease cleavage site compared to a conformation in the absence of the expression compound; whereby said conditional expression domain is cleaved from the protein of interest, transmembrane protein, or CAR, resulting in expression of said protein of interest, transmembrane protein, or CAR; and (b) in the absence of the expression compound, the conditionally expressed domain adopts a conformation that is more resistant to cleavage of the heterologous protease cleavage site compared to its conformation in the presence of the expression compound, thereby resulting in degradation or aggregation of the protein of interest, transmembrane protein, or CAR. method.

91. 91. The method of claim 90, wherein the cell is contacted with the expressed compound ex vivo.

92. 91. The method of claim 90, wherein the cell is contacted with the expressed compound in vivo.

93. A method for conditionally expressing a protein of interest, a transmembrane protein or a CAR, comprising contacting a cell, such as a cell according to any one of claims 74 to 86, with a stabilising compound, (a) in the presence of the stabilizing compound, (i) the degradation domain adopts a conformation that is more resistant to intracellular degradation compared to its conformation in the absence of the stabilizing compound; whereby the degradation domain is cleaved from the protein of interest, transmembrane protein, or CAR, resulting in expression of the protein of interest, transmembrane protein, or CAR; and (b) in the absence of the stabilizing compound, the degradation domain adopts a conformation that is more permissive for intracellular degradation compared to its conformation in the presence of a stabilizing compound, thereby resulting in degradation of the protein of interest, transmembrane protein, or CAR. method.

94. 94. The method of claim 93, wherein the cell is contacted with the stabilizing compound ex vivo.

95. 94. The method of claim 93, wherein the cell is contacted with the stabilizing compound in vivo.

96. A method for conditionally expressing a protein of interest, a transmembrane protein or a CAR, comprising contacting a cell, such as a cell according to any one of claims 74 to 86, with a disaggregating compound, (a) in the presence of the disaggregating compound, (i) the aggregation domain adopts a conformation that is more resistant to aggregation or oligomerization compared to its conformation in the absence of the disaggregating compound; This results in cleavage of the aggregation domain from the protein, transmembrane protein, or CAR of interest and expression of the protein, transmembrane protein, or CAR of interest; and (b) in the absence of the disaggregating compound, the aggregation domain adopts a conformation that is more permissive for aggregation or oligomerization compared to the conformation in the presence of the disaggregating compound, thereby causing the protein of interest, transmembrane protein, or CAR to aggregate; method.

97. 97. The method of claim 96, wherein the cells are contacted with the disaggregating compound ex vivo.

98. 97. The method of claim 96, wherein the cells are contacted with the disaggregating compound in vivo.

99. 11. A method of treating a subject having a disease associated with expression of a tumor antigen, comprising administering to the subject an effective amount of a cell, such as an effective amount of a cell according to any one of claims 74 to 86, wherein the second protein is a chimeric antigen receptor and comprises, from N-terminal to C-terminal, an antigen-binding domain, a transmembrane domain, and one or more intracellular signalling domains, and wherein the antigen-binding domain specifically binds to the tumor antigen.

100. 10. A method of treating an autoantibody or alloantibody disease or condition, comprising administering to the subject an effective amount of a cell, such as an effective amount of a cell according to any one of claims 74 to 86, wherein the second protein is a chimeric antigen receptor and comprises, from N-terminal to C-terminal, an antigen binding domain, a transmembrane domain and one or more intracellular signalling domains, and wherein the antigen binding domain specifically binds to an antigen specific to the autoantibody or alloantibody disease.

101. 101. The method of claim 99 or 100, wherein the cells are autologous to the subject.

102. 101. The method of claim 99 or 100, wherein the cells are allogeneic to the subject.

103. contacting the cell with an expressed compound; (a) in the presence of the expression compound, (i) the conditional expression domain adopts a conformation that is more resistant to intracellular degradation or aggregation compared to its conformation in the absence of the expression compound, thereby cleaving the conditional expression domain from the chimeric antigen receptor (CAR) and resulting in expression of the CAR; and (b) in the absence of the expression compound, the conditional expression domain adopts a conformation that is more permissive for intracellular degradation or aggregation compared to its conformation in the presence of the expression compound, thereby causing the fusion protein to be degraded or aggregated; 103. The method according to any one of claims 99 to 102.

104. contacting the cell, e.g., a host cell, with a stabilizing compound; (a) in the presence of the stabilizing compound, (i) the degradation domain adopts a conformation that is more resistant to intracellular degradation compared to its conformation in the absence of the stabilizing compound; This results in cleavage of the degradation domain from the chimeric antigen receptor (CAR) and expression of the CAR; and (b) in the absence of the stabilizing compound, the degradation domain adopts a conformation that is more permissive for intracellular degradation compared to its conformation in the presence of the stabilizing compound, thereby resulting in degradation of the fusion protein.

103. The method according to any one of claims 99 to 102.

105. 105. The method of any one of claims 90-98 and 104, wherein when the fusion protein comprises a degradation domain from an estrogen receptor, the stabilizing compound is selected from bazedoxifene or 4-hydroxytamoxifen (4-OHT).

106. 105. The method of any one of claims 90-98 or 104, wherein when the fusion protein comprises a degradation domain from an FKB protein, the stabilizing compound is Shield-1.

107. contacting the cells with a disaggregating compound; (a) in the presence of the disaggregating compound, (i) the aggregation domain adopts a conformation that is more resistant to aggregation or oligomerization compared to its conformation in the absence of a disaggregating compound; This results in cleavage of the aggregation domain from the chimeric antigen receptor (CAR) and expression of the CAR; and (b) in the absence of the disaggregating compound, the aggregation domain adopts a conformation that is more permissive for aggregation or oligomerization compared to the conformation in the presence of the disaggregating compound, thereby causing the fusion protein to aggregate; 103. The method according to any one of claims 99 to 102.

108. 108. The method of any one of claims 90 to 98 and 107, wherein when the fusion protein comprises an aggregation domain derived from an FKB protein (FKBP), such as FKBP F36M, the disaggregating compound is selected from FK506, rapamycin, AP22542 and AP21998.

109. The autoantibody disease or condition is selected from the group consisting of bullous pemphigoid; epidermolysis bullosa acquisita; p200 pemphigoid; linear IgA bullous dermatosis; other pemphigoid group diseases; dermatitis herpetiformis; celiac disease; myasthenia gravis; Goodpasture's syndrome; granulomatous disease with polyangiitis and other ANCA+ vasculitis; autoimmune limbic encephalitis; anti-N-methyl-D-aspartate receptor encephalopathy; neuromyelitis optica; autoimmune hemolytic anemia; autoantibody-associated end organ damage in lupus and other connective tissue diseases (caused by anti-dsDNA, anti-Ro and other autoantibodies) ), Graves' and Hashimoto's thyroiditis, anti-insulin antibodies in diabetes, anti-insulin receptor antibodies in autoimmune hypoglycemia, cryoglobulinemia, rheumatoid arthritis, multiple sclerosis, Sjogren's syndrome, dermatomyositis, anti-Fc-epsilon receptor antibodies in chronic idiopathic urticaria, anti-folate receptor antibodies, anti-endothelial receptor or anti-adrenergic receptor antibodies in pulmonary arterial hypertension, refractory hypertension, dilated cardiomyopathy, and autoinflammatory syndromes.

110. 109. The method of any one of claims 100-108, wherein the alloantibody disease or condition is an immune response in response to organ transplantation, blood transfusion, pregnancy, or protein replacement therapy.

111. The method according to any one of claims 99 to 108, wherein the disease associated with expression of a tumor antigen is cancer.

112. The method of claim 111, wherein the cancer is mesothelioma (e.g., malignant pleural mesothelioma), e.g., in a subject that has progressed on at least one prior standard of care therapy, lung cancer (e.g., non-small cell lung cancer, small cell lung cancer, squamous cell lung carcinoma, or large cell lung carcinoma), pancreatic cancer (e.g., pancreatic ductal adenocarcinoma or metastatic pancreatic ductal adenocarcinoma (PDA), e.g., in a subject that has progressed on at least one prior standard of care therapy); esophageal adenocarcinoma, ovarian cancer (e.g., serous epithelial ovarian cancer, e.g., in a subject that has progressed after at least one prior standard of care regimen), breast cancer, colorectal cancer, bladder cancer, or any combination thereof.

113. The method according to any one of claims 99 to 111, wherein the disease associated with expression of a tumor antigen is a blood cancer, such as a blood cancer selected from leukemia or lymphoma.

114. The cancer is selected from the group consisting of chronic lymphocytic leukemia (CLL), mantle cell lymphoma (MCL), multiple myeloma, acute lymphocytic leukemia (ALL), Hodgkin's lymphoma, B-cell acute lymphocytic leukemia (BALL), T-cell acute lymphocytic leukemia (TALL), small lymphocytic leukemia (SLL), B-cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt's lymphoma, diffuse large B cell type DLBCL, DLBCL associated with chronic inflammation, chronic myeloid leukemia, myeloproliferative neoplasms, follicular lymphoma, childhood follicular lymphoma, hairy cell leukemia, small cell or large cell follicular lymphoma, malignant lymphoproliferative conditions, MALT lymphoma (extranodal marginal zone lymphoma of mucosa-associated lymphoid tissue), marginal zone lymphoma, myelodysplasia, myelodysplastic syndromes, non-Hodgkin's lymphoma, Plasmablastic lymphoma, Plasmacytoid dendritic cell neoplasm, Waldenstrom macroglobulinemia, Splenic marginal zone lymphoma, Splenic lymphoma / splenic leukemia, Diffuse red pulp small B-cell lymphoma, Hairy cell leukemia-variant, Lymphoplasmacytic lymphoma, Heavy chain disease, Plasma cell myeloma, Isolated plasmacytoma of bone, Extraosseous plasmacytoma, Nodal marginal zone lymphoma, Childhood nodal marginal zone lymphoma, Primary cutaneous The method of claim 111, wherein the tumor is selected from follicular center lymphoma, lymphomatoid granulomatosis, primary mediastinal (thymic) large B-cell lymphoma, intravascular large B-cell lymphoma, ALK+ large B-cell lymphoma, large B-cell lymphoma arising in HHV8-associated multicentric Castleman disease, primary effusion lymphoma, B-cell lymphoma, acute myeloid leukemia (AML), or unclassifiable lymphoma.

115. 112. The method of claim 111, wherein the cancer is selected from MCL, CLL, ALL, Hodgkin's lymphoma, AML, or multiple myeloma.

116. A fusion protein, a nucleic acid, a vector, a viral particle or a cell according to any one of claims 1 to 115 for use as a medicament.

117. A fusion protein, nucleic acid, vector, cell, composition or method according to any one of claims 1 to 116 for use in the treatment of a disease associated with expression of a tumor antigen, such as cancer.

118. 1. A method of treating an autoantibody or alloantibody disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a pharmaceutical composition comprising a modified T cell, wherein the modified T cell comprises a suicide gene and a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an anti-B cell binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain.

119. 1. A method of treating an autoantibody or alloantibody disease or condition in a subject in need thereof, comprising administering to the subject an effective amount of a pharmaceutical composition comprising a modified T cell, wherein the modified T cell comprises a nucleic acid encoding a chimeric antigen receptor (CAR) comprising a dimerization domain, an anti-B cell binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain.

120. 119. The method of claim 118, wherein the suicide gene encodes an amino acid sequence selected from the group consisting of SEQ ID NOs: 3005-3007.

121. 119. The method of claim 118, wherein the suicide gene further comprises a dimerization domain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 3013 and 3014.

122. 120. The method of claim 119, wherein the dimerization domain comprises the amino acid sequence of SEQ ID NO:

980.

123. 122. The method of claim 121, wherein the dimerization domain further comprises a furin cleavage site comprising the amino acid sequence of SEQ ID NO:

980.

124. 120. The method of claim 119, wherein the CAR further comprises a signal peptide.

125. 125. The method of claim 124, wherein the signal peptide comprises the amino acid sequence of SEQ ID NO: 3035.

126. 120. The method of any one of claims 118 or 119, wherein administering the effective amount comprises activating the modified T cells to perform a cytotoxic function against B cells.

127. The method of Claim 118, further comprising activating a suicide gene product of said suicide gene to induce cell death of said modified T cell.

128. 128. The method of claim 127, wherein activating the suicide gene product further comprises administering a dimerizing agent to promote dimerization of the suicide gene product.

129. The method of claim 127, wherein activating the suicide gene product occurs after the modified T cell exerts a cytotoxic function against a B cell.

130. The method of claim 127, wherein activating the suicide gene product occurs after initiation of an adverse reaction to the modified T cell in the subject.

131. The method of claim 118, further comprising inhibiting activation of a suicide gene product of the suicide gene to inhibit cell death of the modified T cell.

132. 132. The method of claim 131, wherein inhibiting activation of the suicide gene product further comprises administering a solubilizing agent to prevent dimerization of the suicide gene product.

133. 133. The method of claim 132, wherein administering the solubilizing agent is performed simultaneously with administration of the modified T cells and continues while the modified T cells are exerting cytotoxic function against B cells.

134. The method of claim 133, wherein administering the solubilizing agent is discontinued following initiation of an adverse reaction to the modified T cells in the subject.

135. 120. The method of any one of claims 118 or 119, wherein the anti-B cell binding domain of the CAR comprises an antibody selected from the group consisting of a monoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a single domain antibody, a single chain variable fragment, and an antigen-binding fragment thereof.

136. 120. The method of any one of claims 118 or 119, wherein the anti-B cell binding domain of the CAR specifically binds to a B cell marker selected from the group consisting of CD19, BCMA, CD20, CD21, CD27, CD38, CD138, and any combination thereof.

137. 120. The method of any one of claims 118 or 119, wherein the anti-B cell binding domain of the CAR specifically binds to a B cell marker selected from the group consisting of CD20, CD21, CD27, CD38, CD138, any combination thereof, and at least one surface marker selectively found on pro-B cells, pre-B cells, immature B cells, mature B cells, memory B cells, and plasma cells.

138. 120. The method of any one of claims 118 or 119, wherein the intracellular domain of the CAR comprises a dual signaling domain.

139. 120. The method of any one of claims 118 or 119, wherein the costimulatory domain is selected from the group consisting of CD3, CD27, CD28, CD83, CD86, CD127, 4-1BB, 4-1BBL, PD1, PD1L, T cell receptor (TCR), any derivative or variant thereof, any synthetic sequence thereof having the same functional capability, and any combination thereof.

140. 140. The method of any one of claims 119 or 139, further comprising administering a solubilizing agent to prevent dimerization of the CAR.

141. 141. The method of claim 140, wherein administering the solubilizing agent is performed simultaneously with administration of the modified T cells and continues while the modified T cells are exerting cytotoxic function against B cells.

142. The method of claim 138, wherein administering the solubilizing agent is discontinued following initiation of an adverse reaction to the modified T cells in the subject.

143. The autoantibody disease or condition may be selected from the group consisting of bullous pemphigoid; epidermolysis bullosa acquisita; p200 pemphigoid; linear IgA bullous dermatosis; other pemphigoid group diseases; dermatitis herpetiformis; celiac disease; myasthenia gravis; Goodpasture's syndrome; granulomatous disease with polyangiitis and other ANCA+ vasculitis; autoimmune limbic encephalitis; anti-N-methyl-D-aspartate receptor encephalopathy; neuromyelitis optica; autoimmune hemolytic anemia; autoantibody-associated end organ damage in lupus and other connective tissue diseases (due to anti-dsDNA, anti-Ro and other autoantibodies); Graves' and Hashimoto's thyroiditis; anti-insulin antibodies in diabetes; anti-insulin receptor antibodies in autoimmune hypoglycemia; cryoglobulinemia; The method of any one of claims 118 or 119, wherein the therapeutic agent is selected from the group consisting of: phosphatemia; rheumatoid arthritis; multiple sclerosis; Sjogren's syndrome; dermatomyositis; anti-Fc-epsilon receptor antibodies in chronic idiopathic urticaria; anti-folate receptor antibodies, anti-endothelial receptor or anti-adrenergic receptor antibodies in pulmonary arterial hypertension; refractory hypertension; dilated cardiomyopathy; autoinflammatory syndromes; neuromyelitis optica; Goodpasture's syndrome; anti-NMDAR encephalitis: AIHA; ITP; TTP; Graves / Hashimoto's disease; primary biliary cirrhosis; neonatal lupus; maternal autoantibodies inducing T cell destruction; pulmonary alveolar proteinosis; anti-folate receptors; chronic inflammatory demyelinating polyneuropathy; and idiopathic membranous nephropathy.

144. 120. The method of any one of claims 118 or 119, wherein the alloantibody disease or condition is an immune response in response to organ transplantation, blood transfusion, pregnancy, or protein replacement therapy.

145. 120. The method of any one of claims 118 or 119, wherein the modified T cell is further modified by deleting a gene selected from the group consisting of a T cell receptor (TCR) chain, a major histocompatibility complex protein, and any combination thereof.

146. 146. The method of claim 145, wherein the modified T cells are further modified prior to administration to a subject in need thereof.

147. The method of claim 145, wherein the modified T cell is further modified by inducing a CRISPR / Cas system.

148. 119. A pharmaceutical composition formulated for use in the method of claim 118, comprising an engineered T cell comprising a nucleic acid encoding a suicide gene and a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an anti-B cell binding domain, a transmembrane domain, a costimulatory domain and an intracellular signaling domain.

149. 120. A pharmaceutical composition formulated for use in the method of claim 119 comprising an engineered T cell comprising a nucleic acid encoding a dimerization domain and a chimeric antigen receptor (CAR) comprising an anti-B cell binding domain, a transmembrane domain, a costimulatory domain and an intracellular signaling domain.

150. The composition of claim 148, wherein the suicide gene encodes an amino acid sequence selected from the group consisting of SEQ ID NOs: 3005-3007.

151. The composition of claim 148, wherein the suicide gene further comprises a dimerization domain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 3013 and 3014.

152. The composition of claim 148, wherein the dimerization domain comprises the amino acid sequence of SEQ ID NO:

980.

153. The composition of claim 149, wherein the dimerization domain further comprises a furin cleavage site comprising the amino acid sequence of SEQ ID NO:

980.

154. The composition of claim 149, wherein the CAR further comprises a signal peptide.

155. The composition of claim 154, wherein the signal peptide comprises the amino acid sequence of SEQ ID NO: 3035.

156. 149. The composition of claim 148, further comprising an inducer for inducing activation of the suicide gene.

157. The composition of any one of claims 148 or 149, wherein the modified T cell lacks at least one gene encoding a T cell receptor (TCR) chain and a major histocompatibility complex protein.

158. 1. An isolated nucleic acid sequence comprising: (i) a nucleic acid sequence comprising a suicide gene comprising a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 3001-3004; and (ii) a nucleic acid sequence encoding a chimeric antigen receptor (CAR) comprising an anti-B cell binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain.

159. 159. The isolated nucleic acid sequence of claim 158, comprising SEQ ID NO: 3018, 3020, 3024, 3026, 3028 or 3030.

160. (i) an amino acid sequence encoded by a suicide gene, the amino acid sequence being selected from the group consisting of SEQ ID NOs: 3005-3007; and (ii) a chimeric antigen receptor (CAR) comprising an anti-B cell binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain.

161. 161. The isolated polypeptide of claim 160, comprising the amino acid sequence of SEQ ID NO: 3019, 3021, 3026, 3028, 3030 or 3034.

162. 1. An isolated nucleic acid sequence comprising: (i) a nucleic acid encoding a dimerization domain; and (ii) a chimeric antigen receptor (CAR) comprising an anti-B cell binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain.

163. 163. The isolated nucleic acid sequence of claim 162, wherein the dimerization domain comprises the amino acid sequence of SEQ ID NO:

980.

164. 163. The isolated nucleic acid sequence of claim 162, comprising SEQ ID NO: 977 or 3032.

165. 1. An isolated polypeptide comprising: (i) a dimerization domain; and (ii) a chimeric antigen receptor (CAR) comprising an anti-B cell binding domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain.

166. 166. The isolated polypeptide of claim 165, comprising the amino acid sequence of SEQ ID NO: 978 or 3033.

Images