Modified guide rnas

Abstract

To provide modified single and dual guide RNAs having improved in vitro and in vivo activity in gene editing methods.SOLUTION: The present invention provides a single guide RNA (sgRNA) comprising a 5' end modification and one or more modification in one or more of a. the upper stem region, b. the hairpin 1 region, and c. the hairpin 2 region, wherein the 5' end modification comprises at least two phosphorothioate (PS) linkages within the first seven nucleotides at the 5' end of the 5' terminus.SELECTED DRAWING: None

Description

[Technical field]

[0001] This application contains a sequence listing that has been submitted electronically in ASCII format, the sequence listing being: The ASCII copy was dated December 12, 2017. It was created on the 7th of the month and is named 01155-0004-00PCT_SeqList.txt. It is the name and is 118,877 bytes in size.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS This application is a continuation of U.S. Provisional Patent Application No. 62 / 431,756, filed December 8, 2016. No. 60 / 239,933, filed on Oct. 23, 2003, which claims the benefit of priority to US Provisional Application No. 60 / 239,933, filed on Oct. 23, 2003, which is incorporated by reference in its entirety.

[0003] The present disclosure relates to a method for the detection and cleavage of exogenous genetic elements using CRISP, a part of a prokaryotic immune system. It relates to the field of gene editing using the CRISPR / Cas system. The system is a transcription factor-dependent transcription factor (TFR) ... Cas9 relies on a single nuclease called a guide RNA (gRNA). The guide RNA is a short RNA molecule that is directed to a specific DNA sequence. A (also known as tracrRNA) and crisprRNA (crRNA). The trRNA and crRNA are contained within a single guide RNA (sgRNA). or contained in two separate RNA molecules of dual guide RNA (dgRNA) Ca in combination with trRNA and crRNA or sgRNA may be s9 is referred to as the Cas9 ribonucleoprotein complex (RNP).

[0004] Oligonucleotides, especially RNA, are sometimes subject to endonuclease cleavage or exonuclease cleavage. It may be degraded in cells and serum by cleavage with creatine. Improved methods for inhibiting transcription of ribosomal RNA, improving gRNA stability, and enhancing gene editing efficiency Methods and compositions are particularly desirable for therapeutic applications. Summary of the Invention [Means for solving the problem]

[0005] In some embodiments, a therapeutic genome editing tool is provided comprising a modified guide RNA. The modified guide RNAs described herein include guide RNA and guide RNA / Cas9 Improve the stability of the complex and cleave the target DNA with Cas9 (e.g., SpyCas9 and the like). In some embodiments, the guide RNA is an sgRNA. In some embodiments, the guide RNA is a dgRNA. In some embodiments, the guide RNA is a crRNA. It is.

[0006] The guide RNAs described herein include at least one modified nucleotide. The decorations are 2'-O-methyl (2'-O-Me), 2'-O-(2-methoxyethyl) (2' -O-moe), 2'-fluoro (2'-F), phosphorothioate internucleotide ( PS) bonds, GC substitutions, and inverted abasic linkages between nucleotides and their equivalents. Embodiments of the present invention may include the following.

[0007] In some embodiments, the single guide RNA (sgRNA) comprises a 5' end modification as well as in one or more of the upper stem region; hairpin 1 region; and hairpin 2 region. The 5' end modification includes a 5' end modification or a 5' end modification. Contains at least two phosphorothioate linkages within the first seven nucleotides. In some instances, the modification is a 2'-O-methyl (2'-O-Me) modified nucleotide. In an embodiment, the modification is a 2'-fluoro (2'-F) modified nucleotide.

[0008] In some embodiments, the sgRNA comprises modifications in US1 to US12 and / or or H1-1 and / or H2-1. In the form, the sgRNA is located at H1-1 to H1-12 and / or H2-1 to H2-15. In some embodiments, the sgRNA comprises modifications in the upper stem region, the hairpin 1 region, In some embodiments, the hairpin 1 region includes one or more modifications in each of the hairpin 2 region and the hairpin 3 region. In this embodiment, the sgRNA contains modified nucleotides between the hairpin 1 and hairpin 2 regions. In some embodiments, the sgRNA comprises a modification in the lower stem region.

[0009] In some embodiments, the sgRNA comprises a modification at the 5' end and / or the 3' end. In some embodiments, the sgRNA comprises a 3' end modification in the 3' terminus. In embodiments, the sgRNA comprises a 3′-terminal nucleotide sequence of the last four nucleotides at the 3′ end of the 3′ terminus. In some embodiments, the sgRNA comprises a modification in at least two of the 5' end. In some embodiments, the sgRNA comprises a 5' end modification at the 5' end of the 5' terminus. In some embodiments, the nucleotide sequence includes a modification in at least two of the first four nucleotides. In this embodiment, the sgRNA comprises a 3' end modification at the 3' end and a 5' end modification at the 5' end. In some embodiments, the sgRNA comprises a terminal modification at the 3' end of the 3' terminus. in at least two of the four nucleotides and at the 5' end of the 5' terminus In some cases, the amino acid sequence includes modifications in at least two of the first four nucleotides. These modifications can be 2'-O-Me, 2'-F, 2'-O-moe, or nucleotides. In some embodiments, the sgRNA is linked to a phosphorothioate (PS) bond. At least two of the last four nucleotides at the 3' end of the 3' terminus and and / or at least two of the first four nucleotides at the 5' end of the 5' terminus In some cases, the sgRNA comprises one or more of the sequences described herein. More modifications, such as PS linkages and 5'- and 3'-terminus modifications Including the ends.

[0010] In some embodiments, the sgRNA comprises a modification in the bulge region. , 50% of the nucleotides in the bulge region are modified, the modifications being 2'-O-Me or It is 2'-F.

[0011] In some embodiments, the sgRNA comprises a modification in the nexus region. The sgRNA targets N15, N16, N17, and / or N18 in the nexus region. In some instances, the N1 6, N17, and N18 are linked by a PS bond.

[0012] In some embodiments, the sgRNA comprises at least one nucleotide sequence at the 5' end of the modified 5' terminus. The first three nucleotides at the 3' end of the Includes ochido.

[0013] In some embodiments, the sgRNA comprises a modification at the 3' end and / or the 5' end. In some cases, the first four nucleotides at the 5' end of the 5' terminus, and The last four nucleotides at the 3' end of the 3' terminus are phosphorothioate (PS). In some embodiments, the 5' and 3' modifications are linked by a 2'-O-Me bond. or 2'-O-moe. In some embodiments, the 5' and 3' modifications include 2'-F. In some embodiments, the 5' and / or 3' modifications include P In some embodiments, the 5' and / or 3' modifications include 2'-O-Me, 2'-O-moe, 2'-F, and one of the PS bonds linking the nucleotides includes plural.

[0014] In some embodiments, the sgRNA is a nucleotide sequence that is sequenced by the first four nucleotides at the 5' end of the 5' terminus. Contains modifications in the last four nucleotides at the 3' end and the 3' terminus In some cases, these modifications are at the linking PS bond (i.e., the first four nucleotides). In some embodiments, the nucleotide sequence is a PS bond linking the nucleotide sequence of ... In this case, the sgRNA is inserted between the first three nucleotides at the 5' end and the 3' end. Further comprising 2'-O-Me modifications in the last three nucleotides at the 3' end of the nothing.

[0015] In some embodiments, the sgRNA is a nucleotide sequence that is sequenced by the first four nucleotides at the 5' end of the 5' terminus. nucleotides at the 3' end and the last four nucleotides at the 3' end The modification is a PS bond linking at least four nucleotides, and further includes a 5'-terminal The first three nucleotides at the 5' end of Three nucleotides contain 2'-O-Me, 2'-O-moe, or 2'-F modifications .

[0016] In some embodiments, the sgRNA is a modified LS1, LS6, LS7, LS8, LS11 , and LS12, where the modification is 2'-O-Me or 2'-F.

[0017] In some embodiments, the sgRNA is The modification is 2'-O-Me or 2'-F.

[0018] In some embodiments, the sgRNA is The modification is 2'-O-Me or 2'-F.

[0019] In some embodiments, the sgRNA is nucleotide-matched at each of the nucleotides in the hairpin 1 region. The modification is 2'-O-Me or 2'-F.

[0020] In some embodiments, the sgRNA is nucleotide-binding at each of the nucleotides in the hairpin 2 region. The modification is 2'-O-Me or 2'-F.

[0021] In some embodiments, the following positions: a. the first three nucleotides at the 5' end of the 5' terminus; b. LS1, LS6, LS7, LS8, LS11, and / or in the lower stem region LS12 and c. B1 and / or B2 in the bulge region; d. each nucleotide in the upper stem region; e. N16, N17, and / or N18 in the nexus region; f. each nucleotide in the hairpin 1 region, g. each nucleotide in the hairpin 2 region, h. the last four nucleotides at the 3' end of the 3' terminus and e.g., sgRNAs that contain modified nucleotides are included. In some embodiments, B3-B6 are modified with 2'-O-Me. The sgRNA consists of three nucleotides that link the first four nucleotides at the 5' end of the 5' terminus. The phosphorothioate (PS) bonds at the 3' end and the last four nucleotides at the 3' end of the In some embodiments, the sgRNA further comprises three PS bonds linking the nucleotides. In some embodiments, the sgRNA comprises a 2'-F modification in LS9 and LS10. , N15, N16, N17, and N18. sgRNAs are H2-9, H2-10, H2-11, H2-12, H2-13, H2 In some embodiments, the sgRNA comprises a 2'F modification at H2-14, and at H2-15. are the penultimate, third to last, and fourth to last positions at the 3' end of the 3' terminus. It contains a 2'F modification at the second nucleotide.

[0022] In some embodiments, the following positions: a. LS9 and LS10 in the lower stem region; b. N15, N16, N17, and N18 in the nexus region; c. H2-9, H2-10, H2-11, H2-12, and H2-13 in the hairpin 2 region , H2-14, and H2-15, and sgRNs containing 2'-F modified nucleotides in A is included. In some embodiments, the sgRNA is the penultimate, third to last, or both at the 3' end. The 2'-F modified nucleotides are located at the 1st and 4th to the last nucleotide. In some embodiments, the sgRNA is comprised of the first four nucleotides at the 5' end of the 5' terminus. Three phosphorothioate (PS) bonds linking the 3′ ends of the 3′ ends of the It contains three PS bonds linking the last four nucleotides. RNA has a 2'-OM residue in the first three nucleotides at the 5' end of the e or 2'-F modified nucleotides and the last four nucleotides at the 3' end of the 3' terminus wherein three of the nucleotides contain 2'-O-Me or 2'-F modified nucleotides.

[0023] In some embodiments, a. 2'-O-Me modification in the first three nucleotides at the 5' end of the 5' terminus A decorative nucleotide, b. Optional 2'-O-Me modified nucleotides in LS1 and / or LS6 and, c. 2'-O-Me modified nucleotides in US1 to US12; d. 2'-O-Me modified nucleotides in H1-1 to H1-12 e. an optional 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2; f. 2'-O-Me modified nucleotides in H2-1 to H2-15; g. 2'-O-Me modification in the last four nucleotides at the 3' end of the 3' terminus and optionally, Three phosphorothioates link the first four nucleotides at the 5' end of the 5' terminus The 3' terminus is linked to the 3'-terminus of ... The sgRNA further comprises three PS bonds.

[0024] In some embodiments, a. 2'-O-Me modification in the first three nucleotides at the 5' end of the 5' terminus A decorative nucleotide, b. 2'-F modified nucleotides in LS1 to LS6; c. 2'-O-Me modified nucleotides in US1 to US12; d. 2'-O-Me modified nucleotides in H1-1 to H1-12; e. 2'-O-Me modified nucleotides between hairpin 1 and hairpin 2; f. 2'-O-Me modified nucleotides in H2-1 to H2-15; g. 2'-O-Me modification in the last four nucleotides at the 3' end of the 3' terminus and optionally, Three phosphorothioates link the first four nucleotides at the 5' end of the 5' terminus. P-terminal ester (PS) bond and the last four nucleotides at the 3' end of the 3' terminus The sgRNA further comprises three PS bonds that correspond to the sgRNA nucleotides.

[0025] In some embodiments, a. 2'-O-Me modified nucleosides in the first three nucleotides at the 5' end Chid and b. 2'-F modified nucleotides in LS2 to LS5; c. 2'-O-Me modified nucleotides in LS1 and LS6; d. 2'-O-Me modified nucleotides in US1 to US12; e. 2'-O-Me modified nucleotides in H1-1 to H1-12; f. 2'-O-Me modified nucleotides between hairpin 1 and hairpin 2; g. 2'-O-Me modified nucleotides in H2-1 to H2-15; h. 2'-O-Me modified nucleosides in the last four nucleotides at the 3' end and optionally, Three phosphorothioates link the first four nucleotides at the 5' end of the 5' terminus The 3' terminus is linked to the 3' end of the 3'-terminus by a polysaccharide bond (PS) The sgRNA further comprises three PS bonds.

[0026] In some embodiments, a. 2'-O-Me modified nucleosides in the first three nucleotides at the 5' end Chid and b. 2'-O-Me modified nucleotides in US1 to US12; c. 2'-O-Me modified nucleosides in LS7, LS8, LS11, and LS12 Chid and d. 2'-O-Me modified nucleotides in H1-1 to H1-12; e. 2'-O-Me modified nucleotides between hairpin 1 and hairpin 2; f. 2'-O-Me modified nucleotides in H2-1 to H2-15; g. 2'-O-Me modified nucleosides in the last four nucleotides at the 3' end Chid, and optionally, three nucleotides linking the first four nucleotides at the 5' end of the 5' terminus. The phosphorothioate (PS) bonds at the 3' end and the last four nucleotides at the 3' end of the The sgRNA further comprises three PS bonds linking the nucleotides.

[0027] In some embodiments, a. 2'-O-Me modified nucleosides in the first three nucleotides at the 5' end Chid and b. 2'-O-Me modified nucleotides in US1 to US12; c. 2'-O-Me modified nucleosides in LS7, LS8, LS11, and LS12 Chid and d. 2'-F modified nucleotides in LS9 and LS10; e. 2'-O-Me modified nucleotides in H1-1 to H1-12; f. 2'-O-Me modified nucleotides between hairpin 1 and hairpin 2; g. 2'-O-Me modified nucleotides in H2-1 to H2-15; h. 2'-O-Me modified nucleosides in the last four nucleotides at the 3' end Chid, and optionally, three nucleotides linking the first four nucleotides at the 5' end of the 5' terminus. The phosphorothioate (PS) bonds at the 3' end and the last four nucleotides at the 3' end of the The sgRNA further comprises three PS bonds linking the nucleotides.

[0028] In some embodiments, a. 2'-O-Me modified nucleosides in the first three nucleotides at the 5' end Chid and b. 2'-O-Me modified nucleotides in US1 to US12; c. 2'-O-Me modified nucleotides in LS8, LS10, and LS12; d. 2'-OF modified nucleotides in LS7, LS9, and LS11; e. 2'-O-Me modified nucleotides in H1-1 to H1-12; f. 2'-O-Me modified nucleotides between hairpin 1 and hairpin 2; g. 2'-O-Me modified nucleotides in H2-1 to H2-15; h. 2'-O-Me modified nucleosides in the last four nucleotides at the 3' end and optionally, Three phosphorothioates link the first four nucleotides at the 5' end of the 5' terminus The 3' terminus is linked to the 3' end of the 3'-terminus by a polysaccharide bond (PS) The sgRNA further comprises three PS bonds.

[0029] In some embodiments, a. 2'-O-Me modified nucleosides in the first three nucleotides at the 5' end Chid and b. 2'-O- in LS1, LS6, LS7, LS8, LS11, and LS12 Me modified nucleotides; c. 2'-O-Me modified nucleotides in US1 to US12; d. 2'-O-Me modified nucleotides in H1-1 to H1-12; e. 2'-O-Me modified nucleotides between hairpin 1 and hairpin 2; f. 2'-O-Me modified nucleotides in H2-1 to H2-15; g. 2'-O-Me modified nucleosides in the last four nucleotides at the 3' end and optionally, Three phosphorothioates link the first four nucleotides at the 5' end of the 5' terminus The 3' terminus is linked to the 3' end of the 3'-terminus by a polysaccharide bond (PS) The sgRNA further comprises three PS bonds.

[0030] In some embodiments, a. 2'-O-Me modified nucleosides in the first three nucleotides at the 5' end Chid and b. 2'-O- in LS1, LS6, LS7, LS8, LS11, and LS12 Me modified nucleotides; c. 2'-F modified nucleotides in LS9 and LS10; d. 2'-O-Me modified nucleotides in US1 to US12; e. 2'-O-Me modified nucleotides in H1-1 to H1-12; f. 2'-O-Me modified nucleotides between hairpin 1 and hairpin 2; g. 2'-O-Me modified nucleotides in H2-1 to H2-15; h. 2'-O-Me modified nucleosides in the last four nucleotides at the 3' end and optionally, Three phosphorothioates link the first four nucleotides at the 5' end of the 5' terminus The 3' terminus is linked to the 3' end of the 3'-terminus by a polysaccharide bond (PS) The sgRNA further comprises three PS bonds.

[0031] In some embodiments, a. 2'-O-Me modification in the first three nucleotides at the 5' end of the 5' terminus A decorative nucleotide, b. 2'-O-Me modified nucleotides in US1 to US12; c. 2'-O-Me modified nucleotides in H1-1 to H1-12; d. 2'-O-Me modified nucleotides between hairpin 1 and hairpin 2; e. 2'-O-Me modified nucleotides in H2-1 to H2-8; f. 2'-F modified nucleotides in H2-9 to H2-15; g. The penultimate, third penultimate, and fourth penultimate nucleotides at the 3' end 2'-F modified nucleotides in the nucleotides; h. 2'-O-Me modified nucleotide at the last nucleotide at the 3' terminus; , and optionally Three phosphorothioates link the first four nucleotides at the 5' end of the 5' terminus The 3' terminus is linked to the 3' end of the 3'-terminus by a polysaccharide bond (PS) The sgRNA further comprises three PS bonds.

[0032] In some embodiments, a. 2'-O-Me modification in the first three nucleotides at the 5' end of the 5' terminus A decorative nucleotide, b. 2'-O-Me modified nucleotides in US1 to US12; c. H1-2, H1-4, H1-6, H1-8, H1-10, and H1-12 and a 2'-O-Me modified nucleotide; d. In H1-1, H1-3, H1-5, H1-7, H1-9, and H1-11 2'-F modified nucleotides; e. a 2'-F modified nucleotide between hairpin 1 and hairpin 2; f.H2-2, H2-4, H2-6, H2-8, H2-10, H2-12; and H2 a 2'-F modified nucleotide at -14; g.H2-1, H2-3, H2-5, H2-7, H2-9, H2-11; H2-13, and a 2'-O-Me modified nucleotide in H2-15; h. the penultimate and penultimate nucleotides at the 3' terminus 2'-F modified nucleotides; i. 2 at the third to last and last nucleotide at the 3' end of the 3' terminus '-O-Me modified nucleotides, and optionally, three nucleotides linking the first four nucleotides at the 5' end of the 5' terminus. The phosphorothioate (PS) bonds at the 3' end and the last four nucleotides at the 3' end of the The sgRNA further comprises three PS bonds linking the nucleotides.

[0033] In some embodiments, a. 2'-O-Me modified nucleotides LS8, LS10, LS12, H1-2, H1- 4, H1-6, H1-8, H1-10, H1-12, H2-1, H2-3, H2-5, H 2-7, H2-9, H2-11, H2-13, and H2-15, b.LS7, LS9, LS11; H1-1, H1-3, H1-5, H1-7, H1-9 , H1-11, H1-13, H2-2, H2-4, H2-6, H2-8, H2-10, H 2-12, and 2'-F modified nucleotides at H2-14, and optionally In the choice, Three phosphorothioates link the first four nucleotides at the 5' end of the 5' terminus The 3' terminus is linked to the 3'-terminus of ... and optionally, c. 2 nucleotides at the last and penultimate nucleotides at the 3' end of the 3' terminus '-O-Me modified nucleotides; and / or d. the penultimate, fourth to last, and / or most significant position at the 3' end of the 3' terminus The sgRNA further comprises a 2'-F modified nucleotide at the subsequent nucleotide. will be done.

[0034] In some embodiments, the nucleic acid of any of SEQ ID NOs: 228-353, including modifications of Table 4, In some embodiments, the sgRNA includes an sgRNA having a nucleotide sequence similar to that of SEQ ID NO:2, which includes the modifications in Table 4. In some embodiments, the sgRNA includes any of the sgRNAs listed in any of the following: SEQ ID NOs: 235-240, 265-285, and 309-329 containing the modifications in Table 4 In some embodiments, the sgRNA comprises any of SEQ ID NO: 240. In some embodiments, the sgRNA includes the sgRNA of SEQ ID NO: 240, which includes the modifications in Table 4. In some embodiments, the sgRNA comprises SEQ ID NO: 242. In some embodiments, the sgRNA includes SEQ ID NO: 358. In additional embodiments, SEQ ID NOs: 235-240, 265-285, and 309-3 At least 99, 98, 97, 96, 95, 9 Nucleic acids having 4, 93, 92, 91, 90, 85, 80, 75, or 70% identity to Each nucleotide of the sgRNA corresponds to a nucleotide of the reference sequence identifier in Table 4. The modifications in the sequence are the same or equivalent to those shown in the reference sequence identifiers in Table 4. The gRNA optionally ligates the first four nucleotides at the 5' end of the 5' terminus Three phosphorothioate (PS) bonds at the 3' end and the last four at the 3' end of the In some embodiments, the sgR further comprises three PS bonds linking the nucleotides. NA further comprises at least three PS bonds linking the nucleotides in the hairpin 1 region. In some embodiments, the sgRNA ligates nucleotides in the hairpin 2 region. In some embodiments, the sgRNA further comprises at least three PS bonds. In some embodiments, the nucleic acid further comprises at least three PS bonds linking the nucleotides in the nucleic acid region. In its morphology, sgRNA binds to the Cas9 and ribonucleoprotein of S. pyogenes. Form a matrix complex. [Brief description of the drawings]

[0035] [Figure 1] FIG. 1 shows percent editing measured by next generation sequencing (NGS) of the mouse transthyretin (TTR) gene following transfection of Neuro2A cells with modified crRNA together with Cas9 mRNA and unmodified trRNA (TR000002). [Diagram 2] FIG. 2 shows percent editing measured by NGS of the mouse TTR gene following transfection of Neuro2A cells with unmodified crRNA (CR000686) and modified trRNA together with Cas9 mRNA. [Diagram 3] FIG. 3 shows percent editing measured by NGS of the mouse TTR gene following transfection of Neuro2A cells with Cas9 mRNA and crRNA and trRNA with GC pairing not found in the parental sequence. [Figure 4] Figure 4 shows the percentage editing measured by NGS of the mouse TTR gene after transfection of Neuro2A cells with modified crRNA and trRNA together with Cas9 mRNA. Standard deviations are shown after the values. [Diagram 5] FIG. 5 shows percent editing measured by NGS of the mouse TTR gene following transfection of Neuro2A cells with modified sgRNA along with Cas9 mRNA. [Figure 6] Figure 6 shows the percentage editing measured by NGS of mouse TTR gene after transfection of Neuro2A cells with modified crRNA and unmodified trRNA (TR000002) together with Cas9 mRNA. The star represents the dual guide that did not show activity in this experiment due to technical reasons. This dual guide was tested again in the experiment shown in Figure 9, and showed editing activity in this test. [Figure 7] FIG. 7 shows percent editing measured by NGS of the mouse TTR gene following transfection of Neuro2A cells with unmodified crRNA (CR000686) and modified trRNA together with Cas9 mRNA. [Figure 8] FIG. 8 shows percent editing measured by NGS of the mouse TTR gene after transfection of Neuro2A cells with Cas9 mRNA and crRNA and trRNA pairings with GC pairings or GU mismatches not found in the parental sequence. [Figure 9] Figure 9 shows the percentage editing measured by NGS of the mouse TTR gene after transfection of Neuro2A cells with modified crRNA and modified trRNA together with Cas9 mRNA. Standard deviations are shown after the values. [Figure 10] FIG. 10 shows percent editing measured by NGS of the mouse TTR gene following transfection of Neuro2A cells with modified sgRNA along with Cas9 mRNA. [Figure 11] FIG. 11 shows percent editing measured by NGS of the mouse Factor VII (FVII) gene following transfection of Neuro2A cells with modified sgRNA along with Cas9 mRNA. [Figure 12A] FIG. 12A shows percent editing measured by NGS of mouse TTR following transfection of Neuro2A cells with modified crRNA and unmodified trRNA along with Cas9 mRNA. [Figure 12B] FIG. 12B shows the percent editing measured by NGS of FVII after transfection of Neuro2A cells with modified crRNA and unmodified trRNA together with Cas9 mRNA. [Figure 13A] FIG. 13A shows percent editing measured by NGS of mouse TTR following transfection of Neuro2A cells with modified trRNA and unmodified crRNA along with Cas9 mRNA. [Figure 13B] FIG. 13B shows percent editing measured by NGS of FVII following transfection of Neuro2A cells with modified trRNA and unmodified crRNA together with Cas9 mRNA. [Figure 14A]FIG. 14A shows interferon alpha (IFN-alpha) levels in serum following in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 14B] FIG. 14B shows interleukin 6 (IL-6) levels in serum following in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 14C] Figure 14C shows monocyte chemotactic protein 1 (MCP-1) levels in serum following in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 14D] FIG. 14D shows tumor necrosis factor alpha (TNF-alpha) levels in serum following in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 15A] Figure 15A shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 15A shows the total editing percentage in the liver. [Figure 15B] Figure 15B shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 15B shows serum TTR levels. [Figure 15C] Figure 15C shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 15C shows the mean and standard deviation of the results in Figure 15A. [Figure 15D] Figure 15D summarizes the modifications to the G000209 sgRNA (SEQ ID NO: 228). Nucleotides in bold are 2'-O-Me modified. [Figure 15E] Figure 15E summarizes the modifications to the G000267 sgRNA (SEQ ID NO: 234). Nucleotides in bold are 2'-O-Me modified. [Figure 16A] FIG. 16A shows interferon alpha (IFN-alpha) levels in serum following in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 16B]Figure 16B shows tumor necrosis factor alpha (TNF-alpha) levels in serum following in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 16C] Figure 16C shows interleukin 6 (IL-6) levels in serum after in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 16D] Figure 16D shows monocyte chemotactic protein 1 (MCP-1) levels in serum following in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 17A] Figure 17A shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 17A shows the total editing percentage in the liver. [Figure 17B] Figure 17B shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 17B shows the mean and standard deviation of the results of Figure 17A. [Figure 17C] Figure 17C shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 17C shows serum TTR levels. [Figure 17D] Figure 17D shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 17D shows the mean and standard deviation of the results in Figure 17B. [Figure 18A] Figure 18A shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 18A shows the percentage of total editing in the liver. MPK = milligrams per kilogram; BLOD = below the level of detection. [Figure 18B] Figure 18B shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 18B summarizes the liver editing data. MPK = milligrams per kilogram; BLOD = below the level of detection. [Figure 18C]Figure 18C shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 18C shows serum TTR levels. MPK = milligrams per kilogram; BLOD = below detection level. [Figure 19A] FIG. 19A shows interferon alpha (IFN-alpha) levels in serum following in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 19B] Figure 19B shows monocyte chemotactic protein 1 (MCP-1) levels in serum following in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 19C] Figure 19C shows interleukin 6 (IL-6) levels in serum after in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 19D] Figure 19D shows tumor necrosis factor alpha (TNF-alpha) levels in serum following in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 20A] FIG. 20A shows liver editing of the FVII locus following in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 20B] FIG. 20B shows editing in the liver of the TTR locus following in vivo administration of LNPs containing Cas9 mRNA and sgRNA. [Figure 21A] Figure 21A shows a diagram of the annotated sgRNA (SEQ ID NO: 341). [Figure 21B] FIG. 21B shows a schematic of unannotated dgRNAs CR000686 (SEQ ID NO: 1) and TR000002 (SEQ ID NO: 188). [Figure 21C] Figure 21C shows a schematic of the annotated dgRNAs CR000686 (SEQ ID NO: 1) and TR000002 (SEQ ID NO: 188). [Figure 22A] Figure 22A shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 22A shows the percentage of total editing of the TTR locus in the liver. [Figure 22B] Figure 22B shows in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 22B summarizes the liver editing data. [Figure 22C] Figure 22C shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 22C shows serum TTR levels. [Figure 23A] Figure 23A shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 23A shows the percentage of total editing of the TTR locus in the liver. [Figure 23B] Figure 23B shows in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 23B summarizes the liver editing data. [Figure 23C] Figure 23C shows the in vivo results after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 23C shows serum TTR levels. [Figure 24A] Figure 24A shows editing in primary mouse hepatocytes after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 24A shows the editing percentage of total editing at the TTR locus. [Figure 24B] Figure 24B shows editing in primary mouse hepatocytes after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 24B shows the normalized conversion of editing percentage as a function of mRNA dose used to calculate EC50. [Figure 24C] Figure 24C shows editing in primary mouse hepatocytes after administration of LNPs containing Cas9 mRNA and sgRNA. Figure 24C shows EC50 values ​​for the LNPs tested. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0036] Dual-guide RNAs and single-guide RNAs for use in gene editing methods Modified guide RNAs comprising NAs are provided herein. Modified guides are similar to their unmodified counterparts. It is more stable and has improved in vitro efficacy and in vivo efficacy compared to the corresponding The sequences of the engineered and tested guide RNAs are shown in Table 4. [Table 1] JPEG2024178237000002.jpg255157JPEG2024178237000003.jpg255156JPEG2024178237000004.jpg255157JPE G2024178237000005.jpg255156JPEG2024178237000006.jpg255156JPEG2024178237000007.jpg255157JPEG202 4178237000008.jpg255157JPEG2024178237000009.jpg255157JPEG2024178237000010.jpg255157JPEG2024178 237000011.jpg255157JPEG2024178237000012.jpg255157JPEG2024178237000013.jpg255157JPEG20241782370 00014.jpg255156JPEG2024178237000015.jpg255156JPEG2024178237000016.jpg255156JPEG20241782370000 17.jpg255148JPEG2024178237000018.jpg255148JPEG2024178237000019.jpg255153JPEG2024178237000020.j pg255153JPEG2024178237000021.jpg255153JPEG2024178237000022.jpg255153JPEG2024178237000023.jpg25 5153JPEG2024178237000024.jpg255153JPEG2024178237000025.jpg255152JPEG2024178237000026.jpg255139

[0037] "Guide RNA" and "gRNA" are collectively referred to as sgRNA, trRNA (tracRNA), rRNA (also known as rRNA), or crRNA (also known as CRISPR RNA). crRNA and trRNA are used interchangeably herein to refer to either They may be assembled on a single RNA molecule (single guide RNA [sgRNA]), and may be in two separate RNA molecules (dual guide RNA [dgRNA]). "Guide RNA" or "gRNA" refers to each type.

[0038] The trRNA sequence may be naturally occurring, or the trRNA sequence may be naturally occurring. It may contain modifications or variations compared to existing sequences.

[0039] As used herein, "editing efficiency" or "editing percentage" or "editing percentage" refers to a “Count” is the percentage of sequence reads to the target region of interest relative to the total number of sequence reads after cleavage by Cas RNP. The total number of sequence reads that have nucleotide insertions or deletions.

[0040] As used herein, a "hairpin" refers to a nucleic acid strand that folds over to separate segments of the same strand. A hairpin is a loop or U-shaped nucleic acid that is created when a nucleic acid molecule forms a base pair with another molecule. In some embodiments, the hairpin may form a structure that includes an RNA loop. Hairpins can be used to fold the molecules together in a single nucleic acid molecule. The formation of two complementary sequences, together with a ring or wrinkle In some embodiments, the hairpin comprises a stem or stem loop structure.

[0041] As used herein, a "region" refers to a conserved group of nucleic acids. A region is also referred to as a "module." A region of a gRNA may be called a “gRNA domain” or a “gRNA tag.” For example, Briner AE et al., Molecular Cell 56: 333-339 (2014) The gRNA region is shown in Tables 1 to 3. It will be described.

[0042] As used herein, a "ribonucleoprotein" (RNP) or "RNP complex" refers to, e.g., For example, it represents a gRNA coupled to a nuclease, such as a Cas protein. In this form, the RNP comprises Cas9 and gRNA.

[0043] As used herein, a "stem loop" refers to a nucleic acid sequence that terminates in a loop of unpaired nucleic acid. The secondary structure of nucleotides that form a base-paired "stem." The stem is made up of the same nucleus. When the sequences of two regions of a nucleic acid strand are at least partially complementary when read in opposite directions As used herein, a "loop" may be formed to cap a stem. The term "base pair" refers to a region of non-base-paired (i.e., non-complementary) nucleotides that match each other. "Tetraloop" refers to a loop of four nucleotides. The upper stem of the gRNA may contain a tetraloop.

[0044] In certain embodiments involving dgRNAs, the "stem" region as used herein comprises: A specific region of the crRNA and a specific region of the trRNA (e.g., the lower part of each RNA) The two nucleotides that form the base-paired region between the stem region and the upper stem region The "stem" region of a dgRNA represents a "flagpole" region in the art. " area.

[0045] As used herein, "treatment" refers to any administration or administration of a therapeutic agent for a disease in a subject. It also includes the application of a therapeutic agent that inhibits the disease, prevents its progression, or alleviates one or more symptoms of the disease. The present invention relates to a method for treating a disease, including alleviating, curing, or preventing the recurrence of one or more symptoms of a disease. nothing.

[0046] 1. Types of Modifications A. 2'-O-Methyl Modification The modified sugars improve the oligonucleotide binding affinity for the complementary strand, duplex formation, The sugar ring of a nucleotide is a physical property that affects its structure and interaction with nucleases. Substitutions on the sugar ring are therefore thought to control the puckering of these sugars. The confirmation and puckering of the 2'-O-methyl (2' -O-Me) modifications increase the binding affinity and nuclease stability of oligonucleotides However, as shown in the examples, The effect of any modifications in will need to be determined empirically.

[0047] The terms "mA", "mC", "mU", or "mG" are modified with 2'-O-Me The term may be used to represent a nucleotide that is

[0048] The modification of ribonucleotides as 2'-O-methylribonucleotides is depicted below: Can be copied: [ka]

[0049] B. 2'-O-(2-Methoxyethyl) Modification In some embodiments, the modification is 2'-O-(2-methoxyethyl) (2'-O-moe). The modification of the ribonucleotide as a 2'-O-moe ribonucleotide may be It can be depicted as follows: [ka]

[0050] The terms "moeA," "moeC," "moeU," or "moeG" refer to the 2' It may be used to represent a nucleotide modified with -O-moe.

[0051] C. 2'-Fluoro Modification Another chemical modification that has been shown to affect the sugar ring of nucleotides is halogen substitution. For example, 2'-fluoro (2'-F) substitutions on the sugar ring of a nucleotide can The binding affinity and nuclease stability of the leutidine can be increased.

[0052] In this application, the terms "fA", "fC", "fU", or "fG" refer to 2' Sometimes used to represent a nucleotide substituted with -F.

[0053] The 2'-F substitution can be depicted as follows: [ka]

[0054] D. Phosphorothioate Modification Phosphorothioate (PS) linkages or bonds are used to link phosphodiester bonds, e.g., nucleic acids. This refers to a bond between the leucine bases in which a sulfur replaces one non-bridging phosphate oxygen. When phosphorothioates are used to generate the oligonucleotides, the modified oligonucleotides Nucleotides are sometimes referred to as S-oligos.

[0055] "*" may be used to denote PS modifications. In this application, A*, C The terms *, U*, or G* refer to a nucleotide linked to the next (e.g., 3') nucleotide by a PS bond. The term may be used to refer to a linked nucleotide.

[0056] In this application, the terms "mA*", "mC*", "mU*", or "mG*" are used to refer to: substituted with 2'-O-Me and linked to the next (e.g., 3') nucleotide by a PS bond Similarly, "fA*", "fC*" may be used to represent nucleotides that have been The terms "fU*" or "fG*" refer to a 2'-F substituted, It is sometimes used to represent a nucleotide linked to a nucleotide in the formula (1) by a PS bond. The equivalent of a PS linkage or bond is encompassed by the embodiments described herein.

[0057] The diagram below shows the S-linked cleavage sites that form PS bonds instead of phosphodiester bonds. Showing substitutions on bridging phosphate oxygen: [ka]

[0058] EG-C substitution In some embodiments, the gRNA is modified by sequence substitutions that do not include chemical modifications. In some embodiments, the modified gRNA is not found in the parent gRNA sequence (e.g. GC pairing in the lower stem region and / or upper stem region In some embodiments, the modified gRNA is not found in the parent gRNA sequence. Operated by GU mismatch ("GU wobble" or mismatch pairing) do.

[0059] F. Inverted abasic modifications An abasic nucleotide is a nucleotide that lacks a nitrogenous base. 1 depicts an oligonucleotide with an abasic (also known as apurine) site: [ka]

[0060] Inverted bases are linkages that are reversed (i.e., 5' to 5') from the normal 5' to 3' linkage. linkage or 3' to 3' linkage), for example: [ka]

[0061] Abasic nucleotides can be linked by inverted linkage. The nucleotide is attached to the 5' nucleotide at the end via a 5' to 5' linkage. Alternatively, the abasic nucleotide can be linked to the terminal 3' nucleotide via a 3' to 3' linkage. The nucleotide at either the 5' or 3' end of the The inverted abasic nucleotide in this case is also sometimes called an inverted abasic end cap. In the application, the term "invd" refers to an inverted abasic nucleotide linkage.

[0062] Such modifications and their equivalents are included within the scope of the embodiments described herein. do.

[0063] 2. Guide RNA Composition Compositions comprising a guide RNA are included. In some embodiments, the guide RNA is a trR In some embodiments, the guide RNA comprises a crRNA. In some embodiments, the guide RNA comprises a crRNA and a trRNA. NA contains crRNA and trRNA on one RNA molecule as sgRNA. In some embodiments, the guide RNA is a crRNA on two RNA molecules as a dgRNA. and trRNA. In dgRNA, two RNA molecules are linked together through base pairing. You may meet.

[0064] In some embodiments, the guide RNA comprises a 5' terminal region. In some embodiments, the 5' terminal region of the sgRNA does not include a 5' terminal region. (However, this specification is applicable to all guide RNAs) Briner AE et al., Molecular Cell 56: 333-339 (2014). In some embodiments, the 5' terminal region comprises a 5' end modification. The 5'-terminal region does not include crRNA, trRNA, sgRNA, and / or dgRNA. The spacer region may be associated with the RNA. Also referred to by others as a "guide region," "guide domain," or "targeting domain." As used herein, a "target sequence" refers to a sequence that is nucleated at a position where a guide region / domain is located for cleavage. In some embodiments, spyCas9 refers to a nucleic acid sequence to which the spyCas9 enzyme is directed. The protein is directed to the target sequence of the target nucleic acid molecule by the nucleotides present in the spacer region. In some embodiments, the guide region / domain may be oriented toward the target site. A does not include the spacer region.

[0065] In some embodiments, the guide RNA described herein has a sequence similar to that shown in Table 4. However, the sequence may contain or consist of any of the guide / spacer regions. It is recognized that when a region is indicated, the composition may or may not include this region. In addition, the sequences shown in Table 4 and identified by sequence numbers in Table 4 are The present invention includes guide RNAs that contain any modification of the sequences set forth above. The peptides may be the same or different, but the modification patterns shown are The modification pattern may be the same as or similar to the guide sequence in Table 4. The modification pattern can be determined by the relative position and identity of the modification on the gRNA or on a region of the gRNA (e.g., 5' end region, lower stem region, bulge region, upper stem region, nexus region, hairpin In some embodiments, the modification pattern comprises a 3′-terminal region, a 4′-terminal region, a 5′-terminal region, and a 6′-terminal region. or a modification of any one of the sequences shown in the sequence column of Table 4, or At least 50%, 55%, 60%, 70%, 75%, 80% of modifications across multiple regions %, 85%, 90%, 95%, 96%, 97%, 98%, and 99%. In this embodiment, the modification pattern is any one of the sequences shown in the sequence column of Table 4. At least 50%, 55%, 60%, 70%, 75%, 80%, 8 5%, 90%, 95%, 96%, 97%, 98%, and 99% identical. In some embodiments, the modification pattern is in one or more regions of the sequences shown in Table 4, e.g., the 5' Terminal region, lower stem region, bulge region, upper stem region, nexus region, hairpin 1 region at least 50%, 55% across the 3′-terminal region, hairpin 2 region, and / or 3′-terminal region , 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% , and 99% identical. For example, in some embodiments, the modification pattern is Modification patterns of sequences spanning at least 50%, 55%, 60%, 70%, 75% %, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% identical In some embodiments, the guide RNA includes a guide RNA having a modification pattern that extends across the lower stem. At least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95% %, 96%, 97%, 98%, and 99% identical guide RNAs are included. In some embodiments, the modification pattern is at least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 9 In some embodiments, guide RNAs that are 9% identical to the top strip are included. At least 50%, 55%, 60%, 70%, 75%, 80%, 85%, Includes guide RNAs that are 90%, 95%, 96%, 97%, 98%, and 99% identical In some embodiments, the modification pattern is at least 50%, 50%, or 50% across the nexus. 5%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 9 In some embodiments, modified guide RNAs are included that are 8% and 99% identical. The turns must be at least 50%, 55%, 60%, 70%, 75%, 8% across the hairpin 1. Guys that are 0%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% identical In some embodiments, the modification pattern is at least one across hairpin 2. At least 50%, 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 9 Guide RNAs that are 6%, 97%, 98%, and 99% identical are included. In the form, the modification pattern is at least 50%, 55%, 60%, 70%, or 80% across the 3' end. %, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, and 99% In some embodiments, the modification pattern is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, a sequence of Table 4 in one, two, three, four, five, or six nucleotides; or Such regions of the sequence (e.g., the 5' end, the lower stem, the bulge, the upper stem, the nexus , hairpin 1, hairpin 2, 3' end). In the present invention, the gRNA can be modified by 0, 1, 2, 3, 4, 5, or 6 nucleotides. In some embodiments, the gRNA comprises 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, A region of a sequence in Table 4 of 1, 2, 3, 4, 5, or 6 nucleotides (e.g. For example, 5' end, lower stem, bulge, upper stem, nexus, hairpin 1, hairpin 2 , 3'-terminus) includes modifications different from those at the 3'-terminus.

[0066] In some embodiments, the gRNA comprises 2'-O-methyl (2'-O-Me) modified nucleotides. In some embodiments, the gRNA comprises a 2'-O-(2-methoxyethyl) (2'- In some embodiments, the gRNA comprises 2'-fluoro (O-moe) modified nucleotides. In some embodiments, the gRNA comprises an internucleotide It contains phosphorothioate (PS) bonds.

[0067] In some embodiments, the gRNA is 5'-end modified, 3'-end modified, or 5'-end modified. and 3' end modifications. In some embodiments, the 5' end modification is an internucleotide host. In some embodiments, the 5'-end modification comprises a 2'-O- Methyl (2'-O-Me), 2'-O-(2-methoxyethyl) (2'-O-moe), and / or 2'-fluoro (2'-F) modified nucleotides. The 5'-end modification is at least one phosphorothioate (PS) bond and a 2'-O- Methyl (2'-O-Me), 2'-O-(2-methoxyethyl) (2'-O-moe), and / or one or more of 2'-fluoro (2'-F) modified nucleotides End modifications include phosphorothioate (PS), 2'-O-methyl (2'-OM e), 2'-O-(2-methoxyethyl) (2'-O-moe), and / or 2'- It may also contain a fluoro (2'-F) modification. Equivalent terminal modifications are also described herein. In some embodiments, the gRNA is one or more of the gRNAs. Combinations of region modifications include terminal modifications.

[0068] A. Composition of sgRNA In some embodiments, the compositions and methods of the invention target a nuclease, such as Cas9. The gRNA contains crRNA and trRNA that direct it to a target DNA sequence. In embodiments, the gRNAs described herein are comprised of one RNA molecule (single guide RNA). or sgRNA).

[0069] In some embodiments, the present invention relates to any one of the sequences set forth in SEQ ID NOs: 228-332. The present invention includes an sgRNA that comprises or consists of any one of the above.

[0070] In some embodiments, SEQ ID NOs: 235-240, 265-285, and 309-32 In some embodiments, an sgRNA is provided that comprises any one of the nine modified sequences. , modified sequences of SEQ ID NOs: 235 to 240, 265 to 285, and 309 to 329 A sgRNA comprising any one of the above, which is complementary to a target sequence and binds Cas9 to the target sequence. Further comprises a 5' "spacer" sequence ("guide sequence") that directs the target for cleavage. In some cases, the present invention includes sgRNAs. At least 99, 98, or 100% of any one of the nucleic acids in the range from 285 to 309 to 329 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% The nucleic acid includes a nucleic acid having an identity, and the modification pattern is the same as the modification pattern shown in the reference sequence identifier. The sgRNA is a single sgRNA.

[0071] 1. sgRNA domain Briner AE et al., Molecular Cell 56: 333-339 (2014) describes the “stimuli involved in targeting.” The "pacer" domain, the "lower stem", the "bulge" and the "upper stem" (including the tetraloop) (may include the "nexus" and "hairpin 1" and "hairpin 2" domains) A functional domain of the sgRNA, such as a domain (referred to herein as a "domain"). ) is described in Briner et al., see page 334, Figure 1A.

[0072] Table 1 and Figure 21A provide a description of the domains of the sgRNAs used herein. In Table 1, "n" between regions represents a variable number of nucleotides, e.g., from 0 to 1, 2, 3, , 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, In some embodiments, n is 0 or 19, 20, or more nucleotides. In some embodiments, n is equal to 1. [Table 2]

[0073] a) 5’ end edge area In some embodiments, the sgRNA comprises a nucleotide sequence at the 5' end as shown in Table 1. In some embodiments, the 5' end of the sgRNA comprises a nucleic acid sequence that targets a Cas protein. It contains a spacer or guide region that functions to direct the nucleotide sequence. In some embodiments, the 5' end does not include a spacer or guide region. The 5' end functions to direct the Cas protein to the target nucleotide region. The nucleotide sequence includes spacers and additional nucleotides that are not included in the nucleotide sequence.

[0074] In some embodiments, the guide region is the first 1 to 10 amino acids at the 5' end of the sgRNA. , 11, 12, 13, 14, 15, 16, 17, 18, 19, or In some embodiments, the guide region comprises 20 nucleotides. In some embodiments, the guide regions are 5, 6, 7, 8, 9, 10, 11, pieces, 12 pieces, 13 pieces, 14 pieces, 15 pieces, 16 pieces, 17 pieces, 18 pieces, 19 pieces, 20 pieces, 21 pieces 22, 23, 24, or 25 or more nucleotides In some embodiments, the guide region may comprise 17 nucleotides. In some embodiments, the guide region may comprise 18 nucleotides. In the above, the guide region may comprise 19 nucleotides.

[0075] In some embodiments, the selection of the guide region is based on a target sequence within the gene of interest for editing. For example, in some embodiments, the sgRNA is a target of the gene of interest. It contains a guide region complementary to the sequence.

[0076] In some embodiments, the target sequence in the gene of interest is complementary to the guide region of the sgRNA. In some embodiments, the guide region of the sgRNA and its counterpart in the gene of interest may The degree of complementarity or identity with the corresponding target sequence is about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, In some embodiments, the guide region and target region of the sgRNA may be 100% or 100%. The target region of the elephant gene may be 100% complementary or identical. The guide region of the sgRNA and the target region of the gene of interest contain at least one mismatch. For example, the guide region of the sgRNA and the target sequence of the gene of interest may be The total length of the target sequence is at least about 17, 18, 19, 20 or more bases. If in pairs, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 In some embodiments, the guide region of the sgRNA and the target region may contain mismatches. The target region of the gene is a sequence that contains at least about 17, 18, 19, 20 or If it contains more nucleotides, it may contain 1 to 6 mismatches. In one embodiment, the guide region of the sgRNA and the target region of the gene of interest are If the sequence contains about 20 nucleotides, it can contain 1, 2, 3, 4, 5, or 6 amino acids. The 5' end is not considered a guide region (i.e., the Cas 9) nucleotides which do not function to direct the protein to the target nucleic acid.

[0077] b) Lower stem In some embodiments, the sgRNA is located in the bulge and upper stem region when viewed linearly. It contains a more separated lower stem (LS) region (see Table 1).

[0078] In some embodiments, the lower stem region comprises 1-12 nucleotides, e.g., In one embodiment, the lower stem region comprises LS1-LS12. The stem region contains fewer nucleotides than shown in Table 1 and FIG. In embodiments, the lower stem region contains more nucleotides than shown in Table 1 and FIG. The lower stem region contains less or less than shown in Table 1 and the schematic in FIG. When a sequence contains more nucleotides, the modification pattern should be maintained as will be apparent to those skilled in the art. be.

[0079] In some embodiments, the lower stem region is a region in which the nucleic acid sequences are complementary when read in opposite directions. In some embodiments, the complementarity in the nucleic acid sequence of the lower stem is This leads to secondary structure in the stem of the sgRNA (e.g., when the regions are base-paired with each other). In some embodiments, the lower stem regions are completely aligned relative to one another when read in opposite directions. It is not necessary that the sigma sigma be complementary to the sigma ....

[0080] c) Bulge In some embodiments, the sgRNA comprises a bulge region comprising six nucleotides B1 to B6. When viewed linearly, the bulge region is separated into two regions. See Table 1. In some embodiments, the bulge region comprises six nucleotides, and the first two nucleotides The dot is followed by an upper stem region that contains the last four nucleotides of the bulge. In some embodiments, the bulge region may have a smaller number of bulges than those shown in Table 1 and FIG. In some embodiments, the bulge region comprises a sequence similar to that described in Table 1 and FIG. It contains more nucleotides than shown. The bulge region is shown in Table 1 and the diagram in Figure 21A. If the nucleic acid sequence contains fewer or more nucleotides than those listed, the modification may be performed as will be apparent to one of skill in the art. The pattern should be maintained.

[0081] In some embodiments, the presence of a bulge indicates that the sgRNA is a sgRNA with an upper stem module and a lower stem module. This results in a directional kink between the system module.

[0082] d) Upper stem In some embodiments, the sgRNA comprises an upper stem region comprising 12 nucleotides. In some embodiments, the upper stem region comprises a loop sequence. is a tetraloop (a loop of four nucleotides).

[0083] In some embodiments, the upper stem region is less than that shown in Table 1 and FIG. 21A. In some embodiments, the upper stem region comprises a nucleotide sequence similar to that shown in Table 1 and FIG. The upper stem region contains more nucleotides than are shown in Table 1 and the diagram in Figure 21A. If the sequence contains fewer or more nucleotides than shown, modifications will be apparent to those of skill in the art. The decorative pattern should be maintained.

[0084] In some embodiments, the upper stem region is a region in which the nucleic acid sequences are complementary when read in opposite directions. In some embodiments, the complementarity in the nucleic acid sequence of the upper stem is This leads to secondary structure in the stem of the sgRNA (e.g., when the regions are base-paired with each other). In some embodiments, the upper stem regions are completely aligned relative to one another when read in opposite directions. It is not necessary that the sigma-based ...

[0085] e) Nexus In some embodiments, the sgRNA is located between the lower stem region and the hairpin 1 region. In some embodiments, the nexus comprises 18 nucleotides. In some embodiments, the nexus region comprises a nucleoside analog as shown in Table 1 and FIG. Includes chids N1 to N18.

[0086] In some embodiments, the nexus region has fewer nuclei than those shown in Table 1 and FIG. In some embodiments, the nexus region comprises a nucleotide sequence as shown in Table 1 and FIG. The nexus region is shown in Table 1 and diagrammatically in Figure 21A. If the nucleic acid sequence contains fewer or more nucleotides than The policy should be maintained.

[0087] In some embodiments, a nexus region is a region in which the nucleic acid sequences are complementary when read in opposite directions. In some embodiments, the complementarity in the nucleic acid sequence is Connected to stem and / or stem-loop secondary structures (e.g., certain Certain nucleotides may base pair with each other. The sequence regions need not be perfectly complementary to each other when read in opposite directions.

[0088] f) hairpin In some embodiments, the sgRNA comprises one or more hairpin regions. In some embodiments, the hairpin region is downstream (e.g., 3') of the nexus region. So, the region of nucleotides immediately downstream of the nexus region is called "hairpin 1" or "H1". In some embodiments, the region of nucleotides 3' to hairpin 1 is referred to as "hairpin 2". In some embodiments, the hairpin region is referred to as hairpin 1 and hairpin H2. In some embodiments, the sgRNA comprises only hairpin 1 or hairpin 2. include.

[0089] In some embodiments, the hairpin 1 region includes 12 nucleic acids immediately downstream of the nexus region. In some embodiments, the hairpin 1 region comprises a nucleic acid sequence similar to that shown in Table 1 and FIG. Contains nucleotides H1-1 to H1-12.

[0090] In some embodiments, the hairpin 2 region comprises 15 nucleic acids downstream of the hairpin 1 region. In some embodiments, the hairpin 2 region comprises a nucleic acid sequence as shown in Table 1 and FIG. Includes reotides H2-1 to H2-15.

[0091] In some embodiments, one or more nucleotides in the hairpin 1 region and the hairpin 2 region One or more nucleotides between the hairpin 1 and hairpin 2 regions. The otides may be modified or unmodified. In some embodiments, Hairpin 1 and hairpin 2 are separated by one nucleotide. In some embodiments, the hairpin region may contain fewer nucleotides than those shown in Table 1 and FIG. 21A. In some embodiments, the hairpin region comprises more than the sequences shown in Table 1 and FIG. The hairpin region contains fewer nucleotides than shown in Table 1 and the diagram in FIG. As will be appreciated by those skilled in the art, when the nucleic acid sequence contains fewer or more nucleotides, the modification pattern is maintained. It should be.

[0092] In some embodiments, the hairpin region is a region in which the nucleic acid sequences are complementary when read in opposite directions. In some embodiments, the hairpin region has alternate nucleotides when read in opposite directions. It is not necessary for the pair to be completely complementary (e.g., the top or loop of the hairpin may be partially or completely complementary). (including unsubstituted nucleotides).

[0093] In some embodiments, the sgRNA comprises a substitution of hairpin 1 at nucleotide "n". , where "n" is between 1 and 50, 40, 30, 20, 15, 10, 5, 4, 3, and 2. In some embodiments, the hairpin 1 region of the sgRNA is an integer of 2 nucleotides. is replaced.

[0094] g) 3’ end edge area In some embodiments, the sgRNA comprises nucleotides after the hairpin region(s). In some embodiments, the 3' terminal region is a 1' terminal region that is not associated with the secondary structure of the hairpin, for example. pcs, 2 pcs, 3 pcs, 4 pcs, 5 pcs, 6 pcs, 7 pcs, 8 pcs, 9 pcs, 10 pcs, 15 pcs or 20 pcs In some embodiments, the 3' terminal region comprises a hair Contains 1, 2, 3, or 4 nucleotides that are not associated with the secondary structure of the pin. In one embodiment, the 3' terminal region is a region of 4 nucleotides that are not associated with the secondary structure of the hairpin. In some embodiments, the 3' terminal region comprises one that is not associated with the secondary structure of the hairpin, It contains 2 or 3 nucleotides.

[0095] 2. sgRNA Modification In some embodiments, the present invention provides a method for the preparation of a nucleic acid sequence comprising the steps of: stem region; bulge region; upper stem region; nexus region; hairpin 1 region; hairpin 2 region and one or more within one or more of the nucleotides at the 3' terminus The sgRNA includes a modification of the above.

[0096] In some embodiments, the modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide. In some embodiments, the modification includes 2'-O-(2-methoxyethyl) (2'-O-mo e) modified nucleotides. In some embodiments, the modification is 2'-fluoro (2'-F) In some embodiments, the modification is an internucleotide phosphorothioate. Contains polystyrene (PS) bonds.

[0097] In some embodiments, the sgRNA is In some embodiments, the 5' The first 3 or 4 nucleotides at the terminus and the last 3 at the 3' terminus Or 4 nucleotides are modified. The first four nucleotides and the last four nucleotides at the 3' end are phosphorothioate. In some embodiments, the modification is a 2'-O-Me In some embodiments, the modification comprises 2'-F. In some embodiments, the modification comprises 2' -Contains O-moe.

[0098] In some embodiments, the sgRNA is a nucleotide sequence consisting of the first four nucleotides at the 5' end. In some embodiments, the sgRN A is one, two, three, or four of the first four nucleotides at the 3' end In some embodiments, the first four nucleotides at the 5' end are modified. The nucleotides at the end and the last four nucleotides at the 3' end are linked by PS bonds. and the first three nucleotides at the 5' end and the last three nucleotides at the 3' end The nucleotides contain a 2'-O-Me or a 2'-O-moe modification.

[0099] In some embodiments, the first four nucleotides at the 5' end and the second four nucleotides at the 3' end The last four nucleotides in the 5′-terminus are linked by PS bonds, and The first three nucleotides and the last three nucleotides at the 3' end are 2'-F Includes modifications.

[0100] In some embodiments, LS1, LS6, LS7, LS8, LS11, and LS12 are In some embodiments, sgRNAs are provided that are 2'-O-Me modified. Each of the nucleotides in the bulge region of NA is modified with 2'-O-Me. In one embodiment, each of the nucleotides in the upper stem region of the sgRNA is 2'-O- In some embodiments, the nexus region of the sgRNA is modified with N16, N In some embodiments, N17, and N18 are modified with 2'-O-Me. Each of the nucleotides in the hairpin 1 region of A is modified with 2'-O-Me. In some embodiments, each of the nucleotides in the hairpin 2 region of the sgRNA is 2'-O -Me modified.

[0101] In some embodiments, the sgRNA comprises the following nucleotides: the first 3 at the 5' end nucleotides; LS1, LS6, LS7, LS8, LS11, and LS12; B1 and B2 in the diregion; each of the nucleotides in the upper stem region of the sgRNA; N16, N17, and N18 in the nexus region; each of the nucleotides in the hairpin 2 region; and the last four at the 3' end. At least one nucleotide is a 2'-O-Me modified nucleotide.

[0102] In some embodiments, the sgRNA comprises a sequence that spans the first four nucleotides at the 5' end. The three phosphorothioate (PS) bonds at the 3' end and the last four nucleotides at the 3' end In some embodiments, the sgRNA further comprises three PS bonds linking the nucleotides. 2'-O-Me or 2'-F modifications in the first three nucleotides at the 5' end Nucleic acid, and 2'-O-Me or In some embodiments, LS9 and LS10 further comprise a 2'-F modified nucleic acid. In some embodiments, N15, N16, N17, and N18 are modified with 2' In some embodiments, H2-9, H2-10, H2-11, H2 -12, H2-13, HS-14, and H2-15 are modified with 2'-F. In the embodiment, the penultimate, third penultimate, and fourth penultimate positions at the 3' end The third nucleotide is modified with 2'-F.

[0103] In some embodiments, the following nucleotides: LS9 and LS10 in the lower stem region N15, N16, N17, and N18 in the nexus region; and in the hairpin 2 region H2-9, H2-10, H2-11, H2-12, H2-13, HS-14, and H 2-15 provides a single guide RNA (sgRNA) containing a 2'-F modified nucleic acid. In some embodiments, the sgRNA is the penultimate, penultimate, or penultimate 3' end. Add 2'-F modified nucleotides at the third and penultimate nucleotides. In some embodiments, the sgRNA comprises the first four nucleotides at the 5' end. Three phosphorothioate (PS) bonds linking the amides and the last four at the 3' end In some embodiments, the sgRN further comprises three PS bonds linking the nucleotides of A is 2'-O-Me or 2'- in the first three nucleotides at the 5' end Further comprising an F modified nucleic acid, and three of the last four nucleotides at the 3' end The present invention further includes 2'-O-Me or 2'-F modified nucleic acids in the formula:

[0104] In some embodiments, the 2'-O- Me-modified nucleotides and 2'-O-Me-modified nucleotides in LS1 and LS6 and 2'-O-Me modified nucleotides in US1 to US12 and H1-1 to H1-1 2'-O-Me modified nucleotide at 2 and the 2'- between hairpin 1 and hairpin 2 O-Me modified nucleotides and 2'-O-Me modified nucleotides in H2-1 to H2-15 and 2'-O-Me modified nucleotides in the last four nucleotides at the 3' end. In some embodiments, a single guide RNA (sgRNA) is provided, comprising: In this form, the sgRNA consists of three nucleotides linking the first four nucleotides at the 5' end. Phosphorothioate (PS) linkages and the last four nucleotides at the 3' end are linked together It further contains three PS bonds connecting the two.

[0105] In some embodiments, the 2'-O- Me-modified nucleotides, 2'-F-modified nucleotides in LS1 to LS6, and US1 ~US12 with 2'-O-Me modified nucleotides and H1-1~H1-12 with 2'-O-Me modified nucleotide and 2 at "n" between hairpin 1 and hairpin 2 '-O-Me modified nucleotides and 2'-O-Me modified nucleotides in H2-1 to H2-15 nucleotide and 2'-O-Me modification of the last four nucleotides at the 3' end A single guide RNA (sgRNA) is provided comprising: In embodiments, the sgRNA comprises a 3′ nucleotide sequence linking the first four nucleotides at the 5′ end. phosphorothioate (PS) linkages and the last four nucleotides at the 3' end It further comprises three PS bonds linking the

[0106] In some embodiments, the 2'-O- Me-modified nucleotides, 2'-F-modified nucleotides in LS2 to LS5, and LS1 and 2'-O-Me modified nucleotides in LS6 and 2'-O-Me modified nucleotides in US1 to US12. '-O-Me modified nucleotides and 2'-O-Me modified nucleotides in H1-1 to H1-12 nucleotide and a 2'-O-Me modified nucleotide at "n" between hairpin 1 and hairpin 2 nucleotides, 2'-O-Me modified nucleotides in H2-1 to H2-15, and 3'-terminus and 2'-O-Me modified nucleotides in the last four nucleotides at the termini. In some embodiments, a single guide RNA (sgRNA) is provided. NA is a nucleotide sequence consisting of three phosphorothioates linking the first four nucleotides at the 5' end. A PS bond and three PS bonds linking the last four nucleotides at the 3' end It further comprises a bond.

[0107] In some embodiments, the 2'-O- Me-modified nucleotides and 2'-O-Me-modified nucleotides in US1 to US12 , LS7, LS8, LS11, and LS12 with 2'-O-Me modified nucleotides and 2'-O-Me modified nucleotides in H1-1 to H1-12 and hairpin 1 and hairpin 2'-O-Me modified nucleotide at "n" between Apin2 and H2-1 to H2- 15 and the last four nucleotides at the 3' end. and a 2'-O-Me modified nucleotide at the nucleotide site, In some embodiments, the sgRNA comprises a first sgRNA at the 5' end. Three phosphorothioate (PS) bonds linking the four nucleotides at the 3' end It further contains three PS bonds linking the last four nucleotides in

[0108] In some embodiments, the 2'-O- Me-modified nucleotides and 2'-O-Me-modified nucleotides in US1 to US12 , LS8, LS10, and LS12, and 2'-O-Me modified nucleotides in LS 2'-OF modified nucleotides in LS7, LS9, and LS11, and H1-1 to H1 -12 and the 2'-O-Me modified nucleotide at -12 between hairpin 1 and hairpin 2 '-O-Me modified nucleotides and 2'-O-Me modified nucleotides in H2-1 to H2-15 nucleotide and 2'-O-Me modification of the last four nucleotides at the 3' end A single guide RNA (sgRNA) is provided comprising: In embodiments, the sgRNA comprises a 3′ nucleotide sequence linking the first four nucleotides at the 5′ end. phosphorothioate (PS) linkages and the last four nucleotides at the 3' end It further comprises three PS bonds linking the

[0109] In some embodiments, the 2'-O- Me-modified nucleotides and LS1, LS6, LS7, LS8, LS11, and LS12 and 2'-O-Me modified nucleotides in US1 to US12. Modified nucleotides and 2'-O-Me modified nucleotides in H1-1 to H1-12 , 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2, and H2-1 to H2 2'-O-Me modified nucleotide at -15 and the last four nucleotides at the 3' terminus and a 2'-O-Me modified nucleotide in the nucleotide sequence. In some embodiments, the sgRNA is provided as a nucleotide sequence encoding a nucleotide sequence similar to that of the nucleotide sequence of the 5′ end of the target gene. Three phosphorothioate (PS) bonds link the first four nucleotides and the 3' terminus It further contains three PS bonds linking the last four nucleotides at its ends.

[0110] In some embodiments, the 2'-O- Me-modified nucleotides and LS1, LS6, LS7, LS8, LS11, and LS12 2'-O-Me modified nucleotides in LS9 and LS10, and 2'-F modified nucleotides in LS11 and LS12. 2'-O-Me modified nucleotides in US1 to US12 and H1 2'-O-Me modified nucleotides in -1 to H1-12 and hairpin 1 and hairpin 2 2'-O-Me modified nucleotides between H2-1 and H2-15, and 2'-O- Me modified nucleotides and 2'-O in the last four nucleotides at the 3' terminus and a -Me modified nucleotide, In some embodiments, the sgRNA has the first four nucleotides at the 5' end. Three phosphorothioate (PS) bonds link the 3′-terminus and the last four nucleotides at the 3′-terminus. It further contains three PS bonds linking the nucleotides.

[0111] In some embodiments, the 2'-O- Me-modified nucleotides and 2'-O-Me-modified nucleotides in US1 to US12 , 2'-O-Me modified nucleotides in H1-1 to H1-12, and hairpin 1 and hairpin 2'-O-Me modified nucleotides between pin 2 and 2'- in H2-1 to H2-8 O-Me modified nucleotides and 2'-F modified nucleotides in H2-9 to H2-15 and the penultimate, third penultimate, and fourth penultimate nucleotides at the 3' terminus. 2'-F modified nucleotide at the nucleotide end and the last nucleotide at the 3' end and a 2'-O-Me modified nucleotide in the single guide RNA (sgRNA). In some embodiments, the sgRNA comprises the first four nucleotides at the 5' end. Three phosphorothioate (PS) bonds link the nucleotides and the most It further contains three PS bonds linking the subsequent four nucleotides.

[0112] In some embodiments, the 2'-O- Me-modified nucleotides and 2'-O-Me-modified nucleotides in US1 to US12 , H1-2, H1-4, H1-6, H1-8, H1-10, and H1-12 '-O-Me modified nucleotides and H1-1, H1-3, H1-5, H1-7, H1-9 , and 2'-F modified nucleotides in H1-11 and hairpin 1 and hairpin 2 2'-F modified nucleotides between H2-2, H2-4, H2-6, H2-8, and H2-1 2'-F modified nucleotides in H2-1, H2-2, and H2-3; 2-3, H2-5, H2-7, H2-9, H2-11, H2-13, and H2-15 2'-O-Me modified nucleotides at the 3' terminus and the penultimate and final The 2'-F modified nucleotide at the fourth nucleotide from the end and the 2'-O-Me modified nucleotides at the third to last and last nucleotide; In some embodiments, a single guide RNA (sgRNA) is provided comprising: The gRNA contains three phosphorothioate residues linking the first four nucleotides at the 5' end. The three nucleotides linking the 3′-terminus and the last four nucleotides at the 3′-terminus It further contains a PS bond.

[0113] In some embodiments, nucleotides LS8, LS10, LS12, H1-2, H1-4 , H1-6, H1-8, H1-10, H1-12, H2-1, H2-3, H2-5, H2 2'-O-Me modified in H2-7, H2-9, H2-11, H2-13, and H2-15 Includes decorations, and LS7, LS9, LS11; H1-1, H1-3, H1-5, H1-7, H1-9, H1-11, H1-13, H2-2, H2-4, H2-6, H2-8, H2- Single guide RNAs containing 2'-F modifications in H2-10, H2-12, and H2-14 Disclosed herein are sgRNAs. In some embodiments, the sgRNA comprises a 5' end Three phosphorothioate (PS) bonds link the first four nucleotides in and three PS bonds linking the last four nucleotides at the 3' end. In some embodiments, the sgRNA comprises the last and penultimate nucleotides at the 3' end. The nucleotide further comprises a 2'-O-Me modified nucleotide at the 3' terminus. The penultimate and third-to-last nucleotides are modified with 2'-F. It further includes

[0114] In some embodiments, the nucleic acid sequence of any one of SEQ ID NOs: 228-232 is In some embodiments, the RNA is SEQ ID NO: 235-240, 265 The present invention relates to an sgRNA comprising any one of the nucleic acids of ~285, and 309 to 329. In some embodiments, the sequences of SEQ ID NOs: 235-240, 265-285, and and 309 to 329, 6, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity wherein the modification pattern is identical to the modification pattern set forth in the reference sequence identifier. In some embodiments, the sgRNA comprises at the 5' end Three phosphorothioate (PS) bonds link the first four nucleotides in It further contains three PS bonds linking the last four nucleotides at the 3' end and the 4 nucleotides at the 5' end.

[0115] In some embodiments, the 5' end modification and the upper stem region; the hairpin 1 region; and the hairpin 2 region are and one or more modifications in one or more of the Pin2 regions. wherein the 5' end modifications are at least two within the first seven nucleotides of the 5' terminus The nucleotide sequence includes phosphorothioate linkages.

[0116] In some embodiments, the 5' end modification and the upper stem region; the hairpin 1 region; and the hairpin 2 region are and one or more modifications in one or more of the Pin2 regions. wherein the 5' end modification comprises one or more phosphorothioates at the 5' end of the RNA. In some embodiments, the nucleotide sequence includes one or more phosphorothioate linkages (PhT linkages). orphorothioate bonds link the 5'-terminal nucleotides.

[0117] In some embodiments, the 5' end modification and the upper stem region; the hairpin 1 region; and the hairpin 2 region are and one or more modifications in one or more of the Pin2 regions. The 5' end modification is the incorporation of one or more phospho- Contains a holothioate linkage.

[0118] In some embodiments, any of the modified sgRNA sequences of SEQ ID NOs: 228-332. sgRNAs comprising one are provided.

[0119] In some embodiments, SEQ ID NOs: 235-240, 265-285, and 309-32 The present invention provides an sgRNA that includes or consists of any one of the nine modified sgRNA sequences. It will be offered.

[0120] In some embodiments, the present invention relates to SEQ ID NOs: 235-240, 265-285, and 3 The sgRNA includes any one of the modified sequences of 09 to 329, A method for cleaving Cas9 at its target that is at least partially complementary to the target sequence and It further comprises a 5' spacer sequence which directs the

[0121] In some embodiments, the present invention relates to SEQ ID NOs: 235-240, 265-285, and 3 At least 99, 98, or 97 for any one of the nucleotides 09 to 329 , 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identical and the modification pattern is indicated in the reference sequence identifier. i.e., the nucleotides A, U, C, and G are identical to the sequence 99, 98, 97, 96, 95, 94, 93, 92, 91, compared to those shown in columns It may differ by 90, 85, 80, 75, or 70%, but the modification remains unchanged. be.

[0122] In some embodiments, the present invention provides a method for the preparation of a nucleic acid sequence comprising the steps of: stem region; bulge region; upper stem region; nexus region; hairpin 1 region; hairpin 2 region and one or more within one or more of the nucleotides at the 3' terminus Included are sgRNAs that contain modifications.

[0123] In some embodiments, the modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide. In some embodiments, the modifications include 2'-fluoro (2'-F) modified nucleotides. In some embodiments, the modification comprises an internucleotide phosphorothioate (PS) bond. In some embodiments, the modification comprises an inverted abasic nucleotide.

[0124] In some embodiments, the first three nucleotides in the 5' end and the LS in the lower stem 1, LS6, LS7, LS8, LS11, and LS12, and B1 and B2, each of the nucleotides in the upper stem region, and N16, N1 7, and N18, each of the nucleotides in the hairpin 1 region, and each of the nucleotides in the hairpin 1 and hairpin one nucleotide between hairpin 2 and each of the nucleotides in the hairpin 2 region; The last four nucleotides at the 3' end and the 2'-O-Me modified nucleotides at In one embodiment, the sgRNA comprises a 5′ end of the sgRNA. There are three PS bonds between the first four nucleotides and the last four at the 3' end. It further contains three PS bonds between the nucleotides.

[0125] In some embodiments, the first three nucleotides in the 5' end and the LS in the lower stem 1, LS6, LS7, LS8, LS11, and LS12, and B1-B6 in the bulge region. and each of the nucleotides in the upper stem region and N16, N17, and N18, each of the nucleotides in the hairpin 1 region, and each of the nucleotides in the hairpin 1 and hairpin 2, each of the nucleotides in the hairpin 2 region, and 3' The last four nucleotides at the terminus and 2'-O-Me modified nucleotides at In one embodiment, the sgRNA comprises a 5′ end of the sgRNA. Three PS bonds between the first four nucleotides and the last four nucleotides at the 3' end It further contains three PS bonds between the leucine residues.

[0126] In some embodiments, LS9 and LS10 in the lower stem and 15 in the nexus region. ~N18, H2-9~HS-15 in the hairpin 2 region, and the penultimate 2 in the 3'-terminal region. 2'-F modification at the 1st, 3rd, and 4th nucleotides Including the nucleotides, an sgRNA is provided.

[0127] In some embodiments, each nucleotide in the lower stem and nucleotides 15 to N1 in the nexus region are 8, H2-9 to HS-15 in the hairpin 2 region, and the penultimate one in the 3'-terminal region, The third and fourth nucleotides from the end of the sequence are 2'-F modified. The sgRNA is provided comprising the nucleotide sequence.

[0128] In some embodiments, LS8, LS10, LS12, H1-2, H1-4, H1-6, H1-8, H1-10, H1-12, H2-1, H2-3, H2-5, H2-7, H2- 9, H2-11, H2-13, H2-15, and the last and penultimate ones at the 3' terminus nucleotide, and 2'-O-Me modified nucleotide in LS7, L S9, LS11, H1-1, H1-3, H1-5, H1-7, H1-9, H1-11, H 1-13, H2-2, H2-4, H2-6, H2-8, H2-10, H2-12, H2- 14, the penultimate and fourth-to-last nucleotides at the 3' terminus, A single guide RNA (sgRNA) is provided comprising a 2'-F modification.

[0129] Each of the following embodiments is encompassed: Embodiment 01. A single guide RNA (sgRNA) comprising the following region: a. 5' terminus; b. a lower stem region; C. a bulge region; d. an upper stem region; e. Nexus areas; f. hairpin 1 region; g. hairpin 2 region; h. 3' terminus and one or more modifications at one or more of: RNA. Embodiment 02. 2'-O-methyl (2'-O-Me) modified nucleotides according to embodiment 1. gRNA. Embodiment 03. 2. The sgRNA of embodiment 1, wherein the modification comprises 2'-fluoro (2'-F) modified nucleotides. . Embodiment 04. 2. The sgR of embodiment 1, wherein the modification comprises an internucleotide phosphorothioate (PS) bond. N.A. Embodiment 05. The first 3 or 4 nucleotides at the 5' end and the last at the 3' end s according to any one of embodiments 1 to 3, in which three or four nucleotides of gRNA. Embodiment 06. The first four nucleotides at the 5' end and the last four nucleotides at the 3' end 6. The method of claim 1, wherein the nucleotides are linked by phosphorothioate (PS) bonds. Any one of the sgRNAs. Embodiment 07. The sgRNA of embodiment 5, wherein the modification comprises 2'-O-Me. EMBODIMENT 08. The sgRNA of embodiment 5, wherein the modification comprises a 2'-F. EMBODIMENT 09. The first four nucleotides at the 5' end and the last four nucleotides at the 3' end The nucleotides are linked by PS bonds, and the first three nucleotides at the 5' end are The nucleotide sequence and the last three nucleotides at the 3' end contain 2'-O-Me modifications. The sgRNA of any one of embodiments 1 to 7. Embodiment 10. The first four nucleotides at the 5' end and the last four nucleotides at the 3' end The nucleotides are linked by PS bonds, and the first three nucleotides at the 5' end are In an embodiment, the nucleotide sequence of ... One sgRNA from 1 to 8. Embodiment 11. LS1, LS6, LS7, LS8, LS11, and LS12 are modified with 2'-O-Me 11. The sgRNA of any one of embodiments 1 to 10, Embodiment 12.

[0023] Embodiments in which each of the nucleotides in the bulge region is modified with 2'-O-Me One sgRNA from 1 to 11. Embodiment 13. Each of the nucleotides in the upper stem region is modified with 2'-O-Me. sgRNA of any one of forms 1 to 12. Embodiment 14. N16, N17, and N18 in the nexus region are modified with 2'-O-Me; The sgRNA of any one of embodiments 1 to 13. EMBODIMENT 15. Each of the nucleotides in the hairpin 1 region is modified with 2'-O-Me. sgRNA of any one of forms 1 to 14. EMBODIMENT 16. Each of the nucleotides in the hairpin 2 region is modified with 2'-O-Me. sgRNA of any one of forms 1 to 15. EMBODIMENT 17. A single guide RNA (sgRNA) comprising the following nucleotides: a. the first three nucleotides at the 5' end; b. LS1, LS6, LS7, LS8, LS11, and LS12 in the lower stem region A region, c. B1 and B2 in the bulge region; d. each nucleotide in the upper stem region; e. N16, N17, and N18 in the nexus region; f. each nucleotide in the hairpin 1 region, g. each nucleotide in the hairpin 2 region, h. the last four nucleotides at the 3' end and a 2'-O-Me modified nucleic acid at , sgRNA. Embodiment 18. The sgRNA of embodiment 17, wherein B3 to B6 are modified with 2'-O-Me. EMBODIMENT 19. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end The sgRNA of embodiment 17, further comprising: EMBODIMENT 20. Any one of embodiments 1 to 10, wherein LS9 and LS10 are modified with 2'-F. sgRNA. EMBODIMENT 21. In embodiments 1 to 1, N15, N16, N17, and N18 are modified with 2'-F. 0 and 20 either one sgRNA. EMBODIMENT 22. H2-9, H2-10, H2-11, H2-12, H2-13, H2-14, and H Any one of embodiments 1 to 10 and 20 to 21, wherein 2-15 is modified with 2'-F. One sgRNA. EMBODIMENT 23. The penultimate, third penultimate, and fourth penultimate nucleotides at the 3' end 23. Any one of embodiments 1 to 10 and 21 to 22, wherein the tide is modified with 2'-F. sgRNA. EMBODIMENT 24. A single guide RNA (sgRNA) comprising: a. LS9 and LS10 in the lower stem region; b. N15, N16, N17, and N18 in the nexus region; c. H2-9, H2-10, H2-11, H2-12, and H2-13 in the hairpin 2 region , H2-14, and H2-15, and a 2'-F modified nucleotide in guide RNA (sgRNA). EMBODIMENT 25. The penultimate, third penultimate, and fourth penultimate nucleotides at the 3' end 25. The sgRNA of embodiment 24, further comprising 2'-F modified nucleotides at the nucleotide positions. 26. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end 26. The sgRNA of any one of embodiments 24 or 25, further comprising: EMBODIMENT 27. 2'-O-Me or 2'-F modification in the first three nucleotides at the 5' end further comprising a nucleotide sequence similar to that of the 3' end of the nucleotide sequence ... 2'-O-Me or 2'-F modified nucleotides. 6 any one sgRNA. 28. A single guide RNA (sgRNA), a. 2'-O-Me modified nucleosides in the first three nucleotides at the 5' end Chid and b. 2'-O-Me modified nucleotides in LS1 and LS6; c. 2'-O-Me modified nucleotides in US1 to US12; d. 2'-O-Me modified nucleotides in H1-1 to H1-12; e. 2'-O-Me modified nucleotides between hairpin 1 and hairpin 2; f. 2'-O-Me modified nucleotides in H2-1 to H2-15; g. 2'-O-Me modified nucleosides in the last four nucleotides at the 3' end A sgRNA comprising: 29. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end The sgRNA of embodiment 28, further comprising: EMBODIMENT 30. A single guide RNA (sgRNA), a. 2'-O-Me modified nucleosides in the first three nucleotides at the 5' end Chid and b. 2'-F modified nucleotides in LS1 to LS6; c. 2'-O-Me modified nucleotides in US1 to US12; d. 2'-O-Me modified nucleotides in H1-1 to H1-12; e. 2'-O-Me modified nucleotides between hairpin 1 and hairpin 2; f. 2'-O-Me modified nucleotides in H2-1 to H2-15; g. 2'-O-Me modified nucleosides in the last four nucleotides at the 3' end A sgRNA comprising: EMBODIMENT 31. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end The sgRNA of embodiment 30, further comprising: EMBODIMENT 32. A single guide RNA (sgRNA), a. 2'-O-Me modified nucleosides in the first three nucleotides at the 5' end Chid and b. 2'-F modified nucleotides in LS2 to LS5; c. 2'-O-Me modified nucleotides in LS1 and LS6; d. 2'-O-Me modified nucleotides in US1 to US12; e. 2'-O-Me modified nucleotides in H1-1 to H1-12; f. 2'-O-Me modified nucleotides between hairpin 1 and hairpin 2; g. 2'-O-Me modified nucleotides in H2-1 to H2-15; h. 2'-O-Me modified nucleosides in the last four nucleotides at the 3' end A single guide RNA (sgRNA) comprising: EMBODIMENT 33. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end The sgRNA of embodiment 32, further comprising: EMBODIMENT 34. A single guide RNA (sgRNA), a. 2'-O-Me modified nucleosides in the first three nucleotides at the 5' end Chid and b. 2'-O-Me modified nucleotides in US1 to US12; c. 2'-O-Me modified nucleosides in LS7, LS8, LS11, and LS12 Chid and d. 2'-O-Me modified nucleotides in H1-1 to H1-12; e. 2'-O-Me modified nucleotides between hairpin 1 and hairpin 2; f. 2'-O-Me modified nucleotides in H2-1 to H2-15; g. 2'-O-Me modified nucleosides in the last four nucleotides at the 3' end A sgRNA comprising: EMBODIMENT 35. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end The sgRNA of embodiment 34, further comprising: EMBODIMENT 36. A single guide RNA (sgRNA), a. 2'-O-Me modified nucleosides in the first three nucleotides at the 5' end Chid and b. 2'-O-Me modified nucleotides in US1 to US12; c. 2'-O-Me modified nucleosides in LS7, LS8, LS11, and LS12 Chid and d. 2'-F modified nucleotides in LS9 and LS10; e. 2'-O-Me modified nucleotides in H1-1 to H1-12; f. 2'-O-Me modified nucleotides between hairpin 1 and hairpin 2; g. 2'-O-Me modified nucleotides in H2-1 to H2-15; h. 2'-O-Me modified nucleosides in the last four nucleotides at the 3' end A sgRNA comprising: 37. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end The sgRNA of embodiment 36, further comprising: 38. A single guide RNA (sgRNA), a. 2'-O-Me modified nucleosides in the first three nucleotides at the 5' end Chid and b. 2'-O-Me modified nucleotides in US1 to US12; c. 2'-O-Me modified nucleotides in LS8, LS10, and LS12; d. 2'-OF modified nucleotides in LS7, LS9, and LS11; e. 2'-O-Me modified nucleotides in H1-1 to H1-12; f. 2'-O-Me modified nucleotides between hairpin 1 and hairpin 2; g. 2'-O-Me modified nucleotides in H2-1 to H2-15; h. 2'-O-Me modified nucleosides in the last four nucleotides at the 3' end A sgRNA comprising: 39. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end The sgRNA of embodiment 32, further comprising: EMBODIMENT 40. A single guide RNA (sgRNA), a. 2'-O-Me modified nucleosides in the first three nucleotides at the 5' end Chid and b. 2'-O- in LS1, LS6, LS7, LS8, LS11, and LS12 Me modified nucleotides; c. 2'-O-Me modified nucleotides in US1 to US12; d. 2'-O-Me modified nucleotides in H1-1 to H1-12; e. 2'-O-Me modified nucleotides between hairpin 1 and hairpin 2; f. 2'-O-Me modified nucleotides in H2-1 to H2-15; g. 2'-O-Me modified nucleosides in the last four nucleotides at the 3' end A sgRNA comprising: EMBODIMENT 41. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end The sgRNA of embodiment 40, further comprising: EMBODIMENT 42. A single guide RNA (sgRNA), a. 2'-O-Me modified nucleosides in the first three nucleotides at the 5' end Chid and b. 2'-O- in LS1, LS6, LS7, LS8, LS11, and LS12 Me modified nucleotides; c. 2'-F modified nucleotides in LS9 and LS10; d. 2'-O-Me modified nucleotides in US1 to US12; e. 2'-O-Me modified nucleotides in H1-1 to H1-12; f. 2'-O-Me modified nucleotides between hairpin 1 and hairpin 2; g. 2'-O-Me modified nucleotides in H2-1 to H2-15; h. 2'-O-Me modified nucleosides in the last four nucleotides at the 3' end A sgRNA comprising: EMBODIMENT 43. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end The sgRNA of embodiment 43, further comprising: EMBODIMENT 44. A single guide RNA (sgRNA), a. 2'-O-Me modified nucleosides in the first three nucleotides at the 5' end Chid and b. 2'-O-Me modified nucleotides in US1 to US12; c. 2'-O-Me modified nucleotides in H1-1 to H1-12; d. 2'-O-Me modified nucleotides between hairpin 1 and hairpin 2; e. 2'-O-Me modified nucleotides in H2-1 to H2-8; f. 2'-F modified nucleotides in H2-9 to H2-15; g. The penultimate, third penultimate, and fourth penultimate nucleotides at the 3' end 2'-F modified nucleotides in the nucleotides; h. 2'-O-Me modified nucleotide at the last nucleotide at the 3' terminus; , including , sgRNA. EMBODIMENT 45. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end The sgRNA of embodiment 44, further comprising: EMBODIMENT 46. A single guide RNA (sgRNA), a. 2'-O-Me modified nucleosides in the first three nucleotides at the 5' end Chid and b. 2'-O-Me modified nucleotides in US1 to US12; c. H1-2, H1-4, H1-6, H1-8, H1-10, and H1-12 and a 2'-O-Me modified nucleotide, d. In H1-1, H1-3, H1-5, H1-7, H1-9, and H1-11 2'-F modified nucleotides; e. a 2'-F modified nucleotide between hairpin 1 and hairpin 2; f.H2-2, H2-4, H2-6, H2-8, H2-10, H2-12; and H2 a 2'-F modified nucleotide at -14; g.H2-1, H2-3, H2-5, H2-7, H2-9, H2-11; H2-13, and a 2'-O-Me modified nucleotide in H2-15; h. the penultimate and penultimate nucleotides at the 3' terminus 2'-F modified nucleotides; i. 2'-O- at the third to last and last nucleotide at the 3' terminus and an sgRNA comprising: EMBODIMENT 47. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end The sgRNA of embodiment 46, further comprising: 48. A single guide RNA (sgRNA), a. 2'-O-Me modified nucleotides LS8, LS10, LS12, H1-2, H1- 4, H1-6, H1-8, H1-10, H1-12, H2-1, H2-3, H2-5, H 2-7, H2-9, H2-11, H2-13, and H2-15, b.LS7, LS9, LS11, H1-1, H1-3, H1-5, H1-7, H1-9 , H1-11, H1-13, H2-2, H2-4, H2-6, H2-8, H2-10, H 2-12, and 2'-F modified nucleotides at H2-14, . 49. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end The sgRNA of embodiment 48, further comprising: EMBODIMENT 50. a. 2'-OM at the last and penultimate nucleotides at the 3' terminus e modified nucleotides, b. 2 nucleotides at the penultimate and third-to-last nucleotides at the 3' terminus 50. The sgR of any one of embodiments 48 to 49, further comprising a '-F modified nucleotide. N.A. EMBODIMENT 51. An sgRNA comprising any one of the nucleic acids of SEQ ID NOs: 228 to 332. EMBODIMENT 52. Any one of SEQ ID NOs: 235 to 240, 265 to 285, and 309 to 329 The sgRNA comprises one nucleic acid. EMBODIMENT 53. Any one of SEQ ID NOs: 235 to 240, 265 to 285, and 309 to 329 At least 99, 98, 97, 96, 95, 94, 93, 92, 91, The nucleic acids have 90, 85, 80, 75, or 70% identity and the modification pattern is sgRNA that is identical to the modification pattern shown in the reference sequence identifier. EMBODIMENT 54. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end The sgRNA of any one of embodiments 51 to 53, further comprising:

[0130] B. Composition of dgRNA In some embodiments, the compositions and methods of the invention target a nuclease, such as Cas9. The gRNA contains crRNA and trRNA that direct it to a target DNA sequence. In an embodiment, the gRNAs are associated but not separated into two separate RNA molecules (dual guide RNAs). A or dgRNA).

[0131] Table 2 and Figure 21C provide a description of the domains of the crRNA used herein. The 5' terminal region includes a spacer region at or near the 5' end of the crRNA. and directing Cas9 to a target region in DNA, e.g., as described herein. In Table 2, the "n" between the regions is a variable number, e.g. 0 to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 1 2, 13, 14, 15, 16, 17, 18, 19, 20, or more In some embodiments, n is equal to 0. Any dgRNA to be synthesized may contain an "n" between any of the domains.

[0132] Table 3 and Figure 21C provide a description of the domains of trRNA used herein. In Table 3, "n" between regions is a variable number, e.g., 0 to 1, 2, 3, 4, 5 pieces, 6 pieces, 7 pieces, 8 pieces, 9 pieces, 10 pieces, 11 pieces, 12 pieces, 13 pieces, 14 pieces, 15 pieces, 1 It represents 6, 17, 18, 19, 20 or more nucleotides. In some embodiments, n is equal to 0. Any dgRNA described herein can be any It may include "n" between domains.

[0133] 1. dgRNA domain As described in Briner 2014, dgRNAs contain a spacer domain that is involved in targeting. , lower stem domain, bulge domain, upper stem domain, nexus domain, and Certain domains, referred to herein as "domains," include, for example, a nucleotide sequence and a hairpin domain. They can be developed based on functional domains. In dgRNA, the crRNA is g It contains a portion of the RNA, and the trRNA contains a portion of the gRNA.

[0134] The regions of the crRNA are provided in Table 2 and Figure 21C. The regions of the trRNA are provided in Table 3 and Figure 21C. Figure 21C shows a schematic of an exemplary dgRNA. [Table 3] [Table 4]

[0135] a) 5' terminal region In some embodiments, the dgRNA comprises a nucleic acid sequence similar to that shown in Tables 2-3 and FIG. Includes nucleotides at the 5' end of RNA and trRNA.

[0136] In some embodiments, the 5' end of the crRNA contains a nucleotide sequence that targets the Cas protein. In some embodiments, the nucleic acid sequence includes a spacer or guide region that serves to direct the sequence. In some embodiments, the 5' end does not include a spacer or guide region. is a spacer that does not function to direct the Cas protein to the target nucleotide region and additional nucleotides.

[0137] In some embodiments, the guide region is the first 1-10 amino acids at the 5' end of the crRNA. , 11, 12, 13, 14, 15, 16, 17, 18, 19, or In some embodiments, the guide region comprises 20 nucleotides. In some embodiments, the guide region comprises 5, 6, 7, 8, 9, 10, 11 pieces, 12 pieces, 13 pieces, 14 pieces, 15 pieces, 16 pieces, 17 pieces, 18 pieces, 19 pieces, 20 pieces, 21, 22, 23, 24, or 25 or more nucleotides In some embodiments, the guide region may comprise 17 nucleotides. In some embodiments, the guide region may comprise 18 nucleotides. In some embodiments, the guide region may comprise 19 nucleotides.

[0138] In some embodiments, the selection of the guide region is based on a target sequence within the gene of interest for editing. For example, in some embodiments, the crRNA is a target of the gene of interest. It contains a guide region complementary to the sequence.

[0139] In some embodiments, the target sequence in the gene of interest is aligned relative to the guide region of the crRNA. In some embodiments, the guide region of the crRNA and the gene of interest may be complementary. The degree of complementarity or identity of the corresponding target sequence is about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, In some embodiments, the guide region of the crRNA And the target region of the gene of interest may be 100% complementary or identical. In this embodiment, the guide region of the crRNA and the target region of the gene of interest contain at least one misse For example, the guide region of the crRNA and the target region of the gene of interest may contain a match. The region may be at least about 17, 18, 19, 20 or more amino acids long, or may be longer than the total length of the target sequence. If the base pair is more than one, two, three, four, five, six, seven, eight, nine, or In some embodiments, the guide region of the crRNA may contain 10 mismatches. and the target region of the gene of interest comprises at least about 17, 18, 19, If it contains 20 or more nucleotides, it contains 1 to 6 mismatches. In some embodiments, the guide region of the crRNA and the target region of the gene of interest are If the guide sequence contains approximately 20 nucleotides, it can be 1, 2, 3, 4, 5, or may contain six mismatches.

[0140] In some embodiments, the trRNA comprises a 5' end. The 5' end of the trRNA contains the 5' end that partially forms the upper stem of the dgRNA. is not complementary to a region of the target gene.

[0141] b) Lower stem In some embodiments, the dgRNA comprises a lower stem (LS) region. The lower stem region comprises , the crRNA lower stem region and the trRNA lower stem region assembled as depicted in FIG. 21C. In some embodiments, the lower stem region of the crRNA comprises the lower stem region of the trRNA. In some embodiments, the crRN is at least partially complementary to the stem region of the The lower stem region of A is entirely complementary to the lower stem region of the trRNA.

[0142] In some embodiments, the lower stem regions of the crRNA and trRNA each contain six In some embodiments, the lower stem region of the crRNA and the trRNA comprises nucleotides. Each region contains fewer nucleotides than those shown in Tables 2 and 3 and FIG. 21C. In some embodiments, the lower stem region comprises a nucleotide sequence similar to those shown in Tables 2 and 3 and FIG. The lower stem region contains more nucleotides than those shown in Tables 2 and 3 and FIG. C. If the compound contains fewer or more nucleotides than shown in the diagram, it will be apparent to one of skill in the art. In some embodiments, the modification pattern is maintained such that The number of nucleotides differs from the number of nucleotides in the lower stem of the trRNA.

[0143] c) Bulge In some embodiments, the dgRNA comprises a bulge (B) region. The rRNA contains one bulge region, and the trRNA contains one bulge region. In embodiments, each bulge region comprises 1 to 4 nucleotides. The bulge region of rRNA contains 2 nucleotides, and the bulge region of trRNA contains 4 nucleotides. It contains nucleotides.

[0144] In some embodiments, the bulge region of the crRNA is a region that is a region of the lower stem region and an upper stem region of the crRNA. In some embodiments, the bulge region of the crRNA is located between the two nucleotides. In some embodiments, the bulge region of the crRNA comprises the nucleotides listed in Table 2 and FIG. As shown in C, it contains nucleotides B1 and B2.

[0145] In some embodiments, the bulge region of the trRNA comprises an upper stem region and a lower stem region of the trRNA. In some embodiments, the bulge region of the trRNA is located between the four nucleotides in the stem region. In some embodiments, the bulge region of the trRNA comprises a nucleotide sequence as set forth in Table 3 and FIG. As shown in C, it contains nucleotides B1 to B4.

[0146] In some embodiments, the presence of a bulge indicates that the dgRNA is a nucleosome-specific nucleosome. This results in a directional kink between the stem module and the crRNA bulge and The trRNA bulge may be partially complementary. The bulge of the NA may not have complementarity.

[0147] In some embodiments, the bulge regions of the crRNA and trRNA are selected from the group consisting of those listed in Tables 2 and 3. and contains more nucleotides than are shown in FIG. 21C. 3 and contains fewer or more nucleotides than shown in the diagram of FIG. 21C. As will be appreciated by one of skill in the art, the modification pattern is maintained. The number of nucleotides in the bulge of trRNA is different from the number of nucleotides in the bulge of trRNA. .

[0148] d) Upper stem In some embodiments, the dgRNA comprises an upper stem (US) region. The upper stem region comprises , the crRNA upper stem region and the trRNA upper region assembled as depicted in FIG. 21C. In some embodiments, the upper stem region of the crRNA comprises the upper stem region of the trRNA. In some embodiments, the crR is at least partially complementary to the upper stem region. The upper stem region of the NA is entirely complementary to the upper stem region of the trRNA.

[0149] In some embodiments, the upper stem region of the crRNA comprises 14 nucleotides. In some embodiments, the upper stem region of the trRNA comprises 11 nucleotides. In embodiments, the upper stem regions of the crRNA and trRNA are as set forth in Table 2 and Table 3, respectively. 3 and fewer nucleotides than shown in FIG. The upper stem regions of the crRNA and trRNA are shown in Tables 2 and 3 and in FIG. The upper stem region contains more nucleotides than those shown in Tables 2 and 3 and FIG. If the nucleic acid sequence contains fewer or more nucleotides than shown in the schematic of FIG. 1C, it will be apparent to one of skill in the art. As such, the modification pattern is maintained.

[0150] In some embodiments, the upper stem of the crRNA is as shown in Table 2 and FIG. includes nucleotides US1 to US14.

[0151] In some embodiments, the upper stem of the trRNA is as shown in Table 3 and FIG. includes nucleotides US1 to US11.

[0152] e) Nexus In some embodiments, the dgRNA comprises a trRNA that includes a nexus region. In morphology, the nexus is between the lower stem region and the hairpin 1 region of the trRNA. In some embodiments, the nexus is located immediately downstream of the lower stem of the trRNA. In some embodiments, the nexus comprises 18 nucleotides. The nexus region of A is nucleotides N1 to N18 as shown in Table 3 and FIG. 21C. In some embodiments, the nexuses are fewer than those shown in Table 3 and FIG. In some embodiments, the nexus region of the trRNA comprises the nucleotides listed in Table 3 and in FIG. The nexus region contains more nucleotides than are shown in Table 3 and Figure 21C. As will be apparent to one of skill in the art, when the sequence contains fewer or more nucleotides than those shown in The modification pattern is maintained.

[0153] In some embodiments, a nexus region is a region in which the nucleic acid sequences are complementary when read in opposite directions. In some embodiments, the complementarity in the nucleic acid sequence is tyrosine and / or stem-loop secondary structures (e.g., certain In some embodiments, the nucleotides in the nexus region may be base paired with each other. The regions may not be perfectly complementary to each other when read in opposite directions.

[0154] f) hairpin In some embodiments, the hairpin region of the trRNA is downstream of the nexus region. In embodiments, the region of nucleotides immediately downstream of the nexus region is referred to as "Hairpin 1." In some embodiments, the region of nucleotides immediately downstream of the Hairpin 1 region is a "hairpin In some embodiments, the hairpin region includes hairpin 1 and hairpin 2. In some cases, hairpin 1 and hairpin 2 may include one or more nucleotides, such as " n" in some embodiments. In some embodiments, n=1. The trRNA contains only hairpin 1 or hairpin 2.

[0155] Substitution of the hairpin 1 region of trRNA by two nucleotides enhances the editing of Cas RNPs. It has been shown that it is possible to achieve high concentration of cellulose (U.S. Patent Publication No. 20150376586, FIG. 16). In some embodiments, the trRNA is a hairpin sequence determined by the nucleotide "n". Includes permutations of pin 1, where "n" is 1, 50, 40, 30, 20, 15, 10, 5, 4, 3 In some embodiments, the hairpin 1 region of the trRNA is an integer between 2 is replaced by nucleotides.

[0156] In some embodiments, hairpin 1 of the trRNA is located at the 12 amino acid residues immediately downstream of the nexus region. In some embodiments, the hairpin 1 region of the trRNA comprises nucleotides as set forth in Table 3 and As shown in Figure 21C, it includes nucleotides H1-1 through H1-12.

[0157] In some embodiments, the non-hairpin nucleotides are in the hairpin 1 region of the trRNA and the hairpin In some embodiments, one to two non-hairpin nucleotides are present between the nucleotide 2 region. It is located between hairpin 1 and hairpin 2.

[0158] In some embodiments, hairpin 2 of the trRNA is 15 nucleotides after hairpin 1 (3′). In some embodiments, the hairpin 2 region of the trRNA comprises a nucleotide sequence as set forth in Table 3 and FIG. As shown in Figure 21C, it includes nucleotides H2-1 through H2-15. So, the hairpin 2 region of trRNA consists of nucleotides H2-1 to H2-2 as shown in Table 3. and H2-15, and "n" between hairpin 1 and hairpin 2 is 1 or 2. .

[0159] In some embodiments, the hairpin region of the trRNA is as shown in Table 3 and FIG. 21C. The hairpin region contains fewer nucleotides than shown in Table 3 and FIG. As will be appreciated by those skilled in the art, if the nucleic acid sequence contains fewer or more nucleotides, the modification pattern will be maintained. will be done.

[0160] In some embodiments, the hairpin region is a region in which the nucleic acid sequences are complementary when read in opposite directions. In some embodiments, the hairpin region has alternate nucleotides when read in opposite directions. The sequences do not necessarily have to be perfectly complementary (e.g., the top or loop of the hairpin may not be paired). (including nucleotides not included).

[0161] In some embodiments, the trRNA comprises a substitution of hairpin 1 with nucleotide "n". , where "n" is between 1 and 50, 40, 30, 20, 15, 10, 5, 4, 3, and 2. In some embodiments, the hairpin 1 region of the trRNA is 2 nucleotides long. Has been replaced.

[0162] g) 3' end In some embodiments, the dgRNA contains an additional nucleotide after (3') the hairpin region(s). In some embodiments, the 3' terminal region includes a trRNA. The regions are 1, 2, 3, 4, 5, 6, 7, or 8 strands that do not associate with the secondary structure of the hairpin. It may contain 8, 9, 10, 15 or 20 or more nucleotides. In some embodiments, the 3' terminal region may include one, two, three or four amino acids that are not associated with the secondary structure of the hairpin. In some embodiments, the 3' terminal region comprises a hairpin In some embodiments, the 3' terminal region comprises 4 nucleotides that are not associated with the secondary structure of contains 1, 2, or 3 nucleotides that are not associated with the secondary structure of the hairpin.

[0163] 2. dgRNA Modification In some embodiments, the dgRNA comprises a modified crRNA and an unmodified trRNA. In some embodiments, the dgRNA comprises an unmodified crRNA and a modified trRNA. In embodiments, both the crRNA and the trRNA of the dgRNA comprise a modification.

[0164] In some embodiments, the gRNA described herein is comprised of two separate RNA molecules ( The RNA is then inserted into the target gene (dual guide or dgRNA). See Table 2, Table 3, and Figure 21C.

[0165] In some embodiments, the present invention relates to a method for the detection of a crRNA comprising the steps of: a) any of the crRNA sequences of SEQ ID NOs: 1 to 187; and b) any one of the trRNA sequences set forth in SEQ ID NOs: 188 to 227. The present invention includes a dgRNA comprising or consisting of any one of the above.

[0166] In some embodiments, the modified crRNA sequence includes any one of 1-187. A gRNA is provided.

[0167] In some embodiments, the modified trRNA sequence includes any one of 188 to 227. A dgRNA that contains the gene is provided.

[0168] In some embodiments, modifications of SEQ ID NOs: 19-31, 53-73, and 104-130 In some embodiments, a dgRNA is provided comprising any one of the crRNA sequences. The present invention relates to modified sequences of SEQ ID NOs: 19 to 31, 53 to 73, and 104 to 130. The dgRNA includes any one of the following sequences: A 5' spacer sequence that is complementary to and directs Cas9 to its target for cleavage. Further includes:

[0169] In some embodiments, the present invention relates to any one of the sequences set forth in SEQ ID NOs: 1-187. In some embodiments, the present invention includes a crRNA comprising SEQ ID NO: 19-31, or comprising any one of the sequences set forth in 53-73 and 104-130; In some embodiments, the present invention includes a crRNA consisting of SEQ ID NOs: 19-31, Any one of the sequences set forth in 53-73 and 104-130 and a spacer Contains crRNA including the sir region.

[0170] In some embodiments, the present invention relates to a method for the preparation of a nucleic acid sequence comprising administering to a subject a nucleic acid sequence selected from the group consisting of sequences set forth in SEQ ID NOs: 188 to 277. It includes a trRNA that includes or consists of any one of them.

[0171] In some embodiments, the present invention relates to a nucleoside analogue comprising any one of SEQ ID NOs: 1-187. At least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90 for chid , 85, 80, 75, or 70% identity to the crRNA. The modification pattern is identical to the modification pattern shown in the reference sequence identifier. Nucleotides A, U, C, and G are 99, 98, 97, ...7, 98, 97, 97, 97, 97, 97, 97, 97, 9 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% different may be added, but the modification remains unchanged.

[0172] In some embodiments, the present invention relates to a nucleic acid sequence comprising any one of SEQ ID NOs: 188-277. At least 99, 98, 97, 96, 95, 94, 93, 92, 91, trRNA containing nucleotides with 90, 85, 80, 75, or 70% identity wherein the modification pattern is identical to the modification pattern shown in the reference sequence identifier, i.e. , nucleotides A, U, C, and G are 99, 98, 9 compared to those shown in the sequence. 7, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% different may be altered, but the modification on each nucleotide remains unchanged.

[0173] 3. Modified crRNA, trRNA, and dgRNA In some embodiments, the crRNA comprises a 5' end, a lower stem, a bulge, an upper stem, and and one or more modified nucleotides within one or more of the 3' termini.

[0174] In some embodiments, the modification comprises 2'-O-Me.

[0175] In some embodiments, the modification comprises a 2'-F.

[0176] In some embodiments, the modification is a phosphorothioate linking one or more nucleotides. In some embodiments, the modification comprises the first four 5'-amino acids at the 5' end. The three PS bonds linking the first nucleotide and the last four nucleotides at the 3' end There are three PS bonds connecting the tides.

[0177] In some embodiments, the modification comprises an inverted abasic nucleotide.

[0178] In some embodiments, a 2'-O-Me modified nucleotide is included at each nucleotide in the upper stem. In some embodiments, the crRNA includes a nucleic acid sequence similar to that of the US-1 or US-2 sequence of the crRNA. and US-14 are each modified with 2'-O-Me. LS1 and LS6 of NA are modified with 2'-O-Me. LS5 of the rRNA is modified with 2'-O-Me.

[0179] In some embodiments, each of the nucleotides in the upper stem, as well as each of the nucleotides in the lower stem crRNA containing 2'-O-Me modified nucleotides in LS1 and LS6 of In some embodiments, the crRNA is For example, during the 5' and / or 3' end modification, one or more 2'-O-Me or 2' Further comprising an -O-moe modified nucleotide.

[0180] In some embodiments, each of the nucleotides in the upper stem and each of the LS1 crRNA containing 2'-O-Me modified nucleotides was provided in LS1, LS2, and LS3. In some embodiments, the crRNA is provided with a 5′ and / or 3′ terminal region, e.g. For example, one or more 2'-O-Me or 2'-O-Me-N-carboxylates may be included in the 5' and / or 3' end modifications. It further comprises an '-O-moe modified nucleotide.

[0181] In some embodiments, the present invention provides a method for the preparation of a LS1, LS2, and LS6 fusion protein in the lower stem. In some embodiments, the crRNA comprises a 2'-F modified nucleotide. The 2'-F modified nucleotides are added to B1 and B2 in the bulge region, respectively. In some embodiments, the present invention includes LS1, LS2, and LS6 in the lower stem. and 2'-F modified nucleotides in B1 and B2 in the bulge region, respectively. In some embodiments, the crRNA comprises a 5' and / or a 5' primer. or 3' terminal region, e.g., one or more 5' and / or 3' end modifications. Further included are 2'-O-Me or 2'-O-moe modified nucleotides.

[0182] In some embodiments, the crRNA comprises nucleotides LS1 and L S6; each of the nucleic acids in the bulge region; and each of the nucleic acids in the upper stem region. In some embodiments, the LS5 nucleotide of the crRNA comprises a 2'-O-Me modified nucleotide. The nucleotides are also modified with 2'-O-Me. In some embodiments, the crRNA comprises 5, LS2, LS3, and LS4. in the 5' and / or 3' terminal region, e.g., in the 5' and / or 3' terminal modification, or further comprising a plurality of 2'-O-Me or 2'-O-moe modified nucleotides.

[0183] In some embodiments, the crRNA comprises LS1, LS2, and LS3 in the lower stem region. 6, as well as 2'-fluoro (2'-F In some embodiments, the crRNA comprises a modified nucleotide in the lower stem region. S1, LS2, and LS6, as well as B2 and the 2'-furan in the bulge region In some embodiments, the crRNA comprises a 2'-F modified nucleotide. At each of nucleotides LS1 to LS6 in the stem region and the bulge region In some embodiments, the crRNA comprises 2'-fluoro (2'-F) modified nucleotides. in the 5' and / or 3' terminal region, e.g., in the 5' and / or 3' terminal modification and further comprising one or more 2'-O-Me or 2'-O-moe modified nucleotides. nothing.

[0184] In some embodiments, the present invention provides a method for the preparation of a nucleotide sequence comprising the steps of: a) isolating a nucleotide sequence from a nucleotide sequence comprising the following regions: the 5' end, the upper stem region; ; lower stem region; nexus region; hairpin 1 region; hairpin 1 region and hairpin 2 region the intervening region between the hairpin 2 region; and one within one or more of the 3' terminal regions. or a trRNA containing multiple modified nucleotides.

[0185] In some embodiments, the modification comprises 2'-O-Me.

[0186] In some embodiments, the modification comprises a 2'-F.

[0187] In some embodiments, the modification is a phosphorothioate linking one or more nucleotides. In some embodiments, the modification comprises the first four 5'-amino acids at the 5' end. The three PS bonds linking the first nucleotide and the last four nucleotides at the 3' end There are three PS bonds connecting the tides.

[0188] In some embodiments, the modification comprises an inverted abasic nucleotide.

[0189] In some embodiments, the trRNA comprises each nucleic acid in the upper stem; B1 and B2 in the bulge region; and B2; LS1 and LS2 in the lower stem region; N3, N4, N5, N15, N16, N17, and N18; each nucleotide in the hairpin 1 region; hairpin nucleotide between the hairpin 1 region and the hairpin 2 region; and each nucleotide in the hairpin 2 region. In some embodiments, the trR comprises 2'-O-Me modified nucleotides. NAs may be modified in the 5' and / or 3' terminal regions, e.g., 5' and / or 3' terminal modifications. In addition, one or more 2'-O-Me or 2'-O-moe modified nucleotides are added to the Included.

[0190] In some embodiments, the trRNA comprises: each nucleotide in the upper stem; each nucleotide in the bulge region; ocids; LS1, LS2, LS5, and LS6 in the lower stem region; and LS7 in the nexus region. N3-N5, N10-N18; each nucleotide in the hairpin 1 region; one nucleotide between the hairpin 2 region; and at each nucleotide in the hairpin 2 region In some embodiments, the crRNA comprises 2'-O-Me modified nucleotides at 5 in the 5' and / or 3' terminal region, e.g., in the 5' and / or 3' terminal modification, or further comprising a plurality of 2'-O-Me or 2'-O-moe modified nucleotides.

[0191] In some embodiments, the trRNA is 2' at N15 to N18 in the nexus region. In some embodiments, the trRNA comprises a 5' and / or -F modified nucleotide. In the 3' terminal region, e.g., in the 5' and / or 3' terminal modifications, one or more 2' Further comprising -F modified nucleotides.

[0192] In some embodiments, the trRNA comprises LS4 and LS5 in the lower stem region, and The nexus region contains 2'-F modified nucleotides at N13 to N18. In embodiments, the trRNA has a 5' and / or 3' terminal region, e.g., Or further comprising one or more 2'-F modified nucleotides in the 3'-terminal modification.

[0193] In some embodiments, the trRNA comprises LS1, LS3, and LS5 in the lower stem. 2'-F modified nucleotides in LS2, LS4, and LS6 in the lower stem and 2'-O-Me modified nucleotides in the

[0194] In some embodiments, the following regions: the first five nucleotides at the 5' end; the stem region; the bulge region; the upper stem region; and the last five nucleotides at the 3' end. CRISPR RNA containing one or more modifications within one or more of the octides ( In some embodiments, the modification is 2'-O-methyl ( In some embodiments, the modification is a 2'-fluoro In some embodiments, the modification is an internucleotide nucleotide. In some embodiments, the first three nucleotides at the 5' end contain a phosphorothioate (PS) bond. nucleotides and the last three nucleotides at the 3' end are modified In some embodiments, the first four nucleotides at the 5' end and the second nucleotide at the 3' end are The last four nucleotides in are linked by phosphorothioate (PS) bonds. In some embodiments, the modification comprises 2'-O-Me. In some embodiments, the first four nucleotides at the 5' end and The last four nucleotides at the 3' end are linked by PS bonds, and the 5' The first three nucleotides at the terminus and the last three nucleotides at the 3' terminus In some embodiments, the first four nucleotides at the 5' end contain a 2'-O-Me modification. The nucleotide and the last four nucleotides at the 3' end are linked by PS bonds. and the first three nucleotides at the 5' end and the last nucleotide at the 3' end Three nucleotides contain 2'-F modifications. In some embodiments, LS1 and LS6 are In some embodiments, the nucleotides in the upper stem region are modified with 2'-O-Me. Each of the dopants is modified with 2'-O-Me.

[0195] In some embodiments, the present invention provides a method for the detection of nucleotides comprising the following steps: and LS6; and 2'-O-Me modified nucleic acids at each nucleotide in the upper stem region. In some embodiments, the crRNA comprises: Three phosphorothioates (PS ) bond and three PS bonds linking the last four nucleotides at the 3' end. In some embodiments, the crRNA comprises the first three nucleotides at the 5' end. 2'-O-Me or 2'-F modified nucleic acid at the base and the last three at the 3' end and 2'-O-Me or 2'-F modified nucleic acids in the nucleotides. In an embodiment, LS1, LS2, and LS6 are modified with 2'-F. In this form, each nucleotide in the bulge region is modified with a 2'-F.

[0196] In some embodiments, the following nucleotides: LS1, LS2, and LS3 in the lower stem region. and LS6, and each nucleotide in the bulge region, containing 2'-F modified nucleic acid. Disclosed herein are spr RNAs (crRNAs). In some embodiments, the crRNAs A is three phosphorothioates linking the first four nucleotides at the 5' end (PS) bond and three PS bonds linking the last four nucleotides at the 3' end In some embodiments, the crRNA further comprises a nucleotide sequence similar to that of the first three nucleotides at the 5' end. 2'-O-Me or 2'-F modified nucleic acids at the nucleotide and Further included are 2'-O-Me or 2'-F modified nucleic acids in the latter three nucleotides.

[0197] In some embodiments, the crRN comprises any one of the nucleic acids of SEQ ID NOs: 1-187. In some embodiments, SEQ ID NOs: 19-31, 53-73, 104-13, 0, and any one of nucleic acids 161 to 187 are provided. In some embodiments, SEQ ID NOs: 19-31, 53-73, 104-130, and 161 At least 99, 98, 97, 96, 95 for any one of ~187 nucleic acids , 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity crR, which contains an acid and the modification pattern is identical to the modification pattern shown in the reference sequence identifier. In some embodiments, the crRNA is provided by combining the first four nucleotides at the 5' end of the crRNA. Three phosphorothioate (PS) bonds link the nucleotides and at the 3' end It further contains three PS bonds linking the last four nucleotides.

[0198] The following regions: the first 5 nucleotides at the 5' end; the upper stem region; the bulge region region; lower stem region; nexus region; hairpin 1 region; hairpin 2 region; and 3' terminus one or more modifications within one or more of the last five nucleotides in Also encompassed are tracr RNAs (trRNAs) that contain the 2' In some embodiments, the modification includes -O-methyl (2'-O-Me) modified nucleotides. In some embodiments, the modification includes 2'-fluoro (2'-F) modified nucleotides. In some embodiments, the 5′ end of the The first four nucleotides at the 3' end and the last four nucleotides at the 3' end are In some embodiments, the 5' end is linked by a phosphorothioate (PS) bond. and the last three nucleotides at the 3' end is modified. In some embodiments, the modification comprises 2'-O-Me. In some embodiments, the modification comprises a 2'-F. The nucleotide and the last four nucleotides at the 3' end are linked by PS bonds. and the first three nucleotides at the 5' end and the last three nucleotides at the 3' end In some embodiments, the 5'-terminus of The first four nucleotides and the last four nucleotides at the 3' end are PS-linked and the first three nucleotides at the 5' end and the 3' end are linked by In some embodiments, the last three nucleotides in the upper sequence include 2'-F modifications. In some embodiments, each nucleotide in the stem region is modified with 2'-O-Me. B1 and B2 in the bulge region are modified with 2'-O-Me. , N3, N4, N5, N15, N16, N17, and N18 in the nexus region are 2'- In some embodiments, each nucleotide in the Hairpin 1 region is modified with O-Me. In some embodiments, each nucleoside in the hairpin 2 region is modified with 2'-O-Me. The tide is modified with 2'-O-Me.

[0199] In some embodiments, the present invention provides the following nucleotides: each nucleotide in the upper stem ; B1 and B2 in the bulge region; N3, N4, N5, N15, and N16 in the nexus region , N17, and N18; each nucleotide in the hairpin 1 region; and each nucleotide in the hairpin 2 region tracr RNA (trRN In some embodiments, the trRNA comprises the first four nucleotides at the 5' end. Three phosphorothioate (PS) bonds linking the nucleotides and the final one at the 3' end In some embodiments, the tr further comprises three PS bonds linking the four nucleotides. RNA has 2'-O-Me or 2'-O-Me in the first three nucleotides at the 5' end. '-F modified nucleotides and 2'- in the last three nucleotides at the 3' terminus In some embodiments, the nucleic acid further comprises an N15, N1 6, N17, and N18 are modified with 2'-F. LS3 and LS5 are modified with 2'-F, and LS2, LS4, and LS6 In some embodiments, the trRNA is modified with 2'-O-Me at the 5' end. Three phosphorothioate (PS) bonds link the first four nucleotides in It further contains three PS bonds linking the last four nucleotides at the 3' end. In some embodiments, the trRNA has a nucleotide sequence similar to that of the first three nucleotides at the 5' end. 2'-O-Me or 2'-F modified nucleic acid and the last three nucleotides at the 3' end and 2'-O-Me or 2'-F modified nucleic acids in the formula:

[0200] In some embodiments, the trp comprises any one of the nucleic acids of SEQ ID NOs: 188-227. In some embodiments, any one of SEQ ID NOs: 188 to 227 is provided. At least 99, 98, 97, 96, 95, 94, 93, 92, 91, The nucleic acids have 90, 85, 80, 75, or 70% identity and the modification pattern is In some embodiments, the trRNA has a modification pattern identical to that shown in the reference sequence identifier. In an embodiment, the trRNA has three nucleotides linking the first four nucleotides at the 5' end. phosphorothioate (PS) bonds and the last four nucleotides at the 3' end It further comprises three linked PS bonds.

[0201] In some cases, dual guides containing crRNA and trRNA are provided, The RNA contains any one of the nucleic acids of SEQ ID NOs: 1 to 187, and the trRNA contains the sequence It contains any one of the nucleic acids in sequence numbers 188 to 227.

[0202] A dual RNA comprising the crRNA disclosed herein and the trRNA disclosed herein The nucleic acid sequence of the present invention includes a nucleic acid sequence including a crRNA and an unmodified trRNA as disclosed herein. In some embodiments, unmodified crRNA and the methods described herein are also included. Dual guides are provided that contain the modified trRNAs shown.

[0203] In some embodiments, the following are included: EMBODIMENT 55. crispr RNA (crRNA), comprising the following regions: a. the first five nucleotides at the 5' end; b. a lower stem region; C. a bulge region; d. an upper stem region; e. one within the last five nucleotides at the 3' terminus and one or more of or a crRNA containing multiple modifications. EMBODIMENT 56. 56. The method of claim 55, wherein the modification comprises 2'-O-methyl (2'-O-Me) modified nucleotides. crRNA. EMBODIMENT 57. The crRN of embodiment 55, wherein the modification comprises 2'-fluoro (2'-F) modified nucleotides. A. EMBODIMENT 58. The cr of embodiment 55, wherein the modification comprises an internucleotide phosphorothioate (PS) bond. RNA. EMBODIMENT 59. The first three nucleotides at the 5' end and the last three nucleotides at the 3' end The crRNA of any one of embodiments 55-58, wherein the nucleic acid is modified. 60. The first four nucleotides at the 5' end and the last four nucleotides at the 3' end 5. The nucleotides are linked by phosphorothioate (PS) bonds. Any one of the eight crRNAs. 61. 60. The crRNA of embodiment 59, wherein the modification comprises 2'-O-Me. 62. 60. The crRNA of embodiment 59, wherein the modification comprises 2'-F. 63. The first four nucleotides at the 5' end and the last four nucleotides at the 3' end The nucleotides are linked by PS bonds and the first three nucleotides at the 5' end and the last three nucleotides at the 3' end contain 2'-O-Me modifications. The crRNA of any one of embodiments 55 to 62. 64. The first four nucleotides at the 5' end and the last four nucleotides at the 3' end The nucleotides are linked by PS bonds, and the first three nucleotides at the 5' end are In an embodiment, the nucleotide sequence of ... Any one of crRNAs 55 to 62. 65. Any of embodiments 55 to 60, wherein LS1 and LS6 are modified with 2'-O-Me. or one crRNA. 66. Each of the nucleotides in the upper stem region is modified with 2'-O-Me. One crRNA of forms 55-60 and 65. 67. crispr RNA (crRNA), a. LS1 and LS6 in the lower stem region; b. each nucleotide in the upper stem region and Including, crRNA. 68. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end The crRNA of embodiment 67, further comprising: 69. 2'-O-Me or 2'-F modification in the first three nucleotides at the 5' end 2'-O- The crRN of embodiment 67 or 68, further comprising Me or 2'-F modified nucleotides. A. EMBODIMENT 70. Any of embodiments 55 to 60, wherein LS1, LS2, and LS6 are modified with 2'-F. Either crRNA. EMBODIMENT 71. 55-60 and any of the embodiments 55-60, wherein each nucleotide in the bulge region is modified with 2'-F. and 70 crRNAs. EMBODIMENT 72. crispr RNA (crRNA), a. LS1, LS2, and LS6 in the lower stem region; b. each nucleotide in the bulge region and rRNA. EMBODIMENT 73. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end The crRNA of any one of embodiments 70-72, further comprising: 74. 2'-O-Me or 2'-F modification in the first three nucleotides at the 5' end 2'-O-Me in the last three nucleotides at the 3' end and or 2'-F modified nucleotides. A. 75. A crRNA comprising any one of the nucleic acids of SEQ ID NOs: 1 to 187. EMBODIMENT 76. Any of SEQ ID NOs: 19 to 31, 53 to 73, 104 to 130, and 161 to 187 crRNA containing any one of the nucleic acids. 77. Any of SEQ ID NOs: 19 to 31, 53 to 73, 104 to 130, and 161 to 187 At least 99, 98, 97, 96, 95, 94, 93, 92 for any one nucleic acid , 91, 90, 85, 80, 75, or 70% identity to the nucleic acid, A crRNA whose sequence is identical to the modification pattern shown in the reference sequence identifier. 78. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end The crRNA of any one of embodiments 75-77, further comprising: 79. A tracr RNA (trRNA), The following areas: a. the first five nucleotides at the 5' end; b. an upper stem region; C. a bulge region; d. a lower stem region; e. Nexus areas; f. hairpin 1 region; g. hairpin 2 region; h. one within the last five nucleotides at the 3' terminus and one or more of or a trRNA containing multiple modifications. 80. 80. The method of claim 79, wherein the modification comprises 2'-O-methyl (2'-O-Me) modified nucleotides. trRNA. 81. The trRN of embodiment 79, wherein the modification comprises a 2'-fluoro (2'-F) modified nucleotide. A. 82. The tr according to embodiment 79, wherein the modification comprises an internucleotide phosphorothioate (PS) bond. RNA. 83. The first four nucleotides at the 5' end and the last four nucleotides at the 3' end 79 to 8, in which the nucleotides are linked by phosphorothioate (PS) bonds. 2 trRNA. 84. The first three nucleotides at the 5' end and the last three nucleotides at the 3' end The trRNA of any one of embodiments 79 to 82, wherein the nucleotide is modified. 85. The trRNA of embodiment 84, wherein the modification comprises 2'-O-Me. 86. The trRNA of embodiment 84, wherein the modification comprises a 2'-F. 87. The first four nucleotides at the 5' end and the last four nucleotides at the 3' end The nucleotides are linked by PS bonds, and the first three nucleotides at the 5' end are The nucleotide sequence and the last three nucleotides at the 3' end contain 2'-O-Me modifications. The trRNA of any one of embodiments 79 to 86. 88. The first four nucleotides at the 5' end and the last four nucleotides at the 3' end The nucleotides are linked by PS bonds, and the first three nucleotides at the 5' end are In an embodiment, the nucleotide sequence of ... Any one of trRNAs 79 to 86. 89. 79. The method of claim 79, wherein each nucleotide in the upper stem region is modified with 2'-O-Me. Any one of ~84 trRNAs. EMBODIMENT 90. Embodiments 79-8, in which B1 and B2 in the bulge region are modified with 2'-O-Me 4 and 89 trRNAs. EMBODIMENT 91. N3, N4, N5, N15, N16, N17, and N18 in the nexus region are 2'- The tr according to any one of embodiments 79 to 84 and 89 to 90, which is modified with O-Me RNA. EMBODIMENT 92. 79. The method of claim 79, wherein each nucleotide in the Hairpin 1 region is modified with 2'-O-Me. ~84 and one of the trRNAs 89–91. EMBODIMENT 93. 79. The method of claim 79, wherein each nucleotide in the hairpin 2 region is modified with 2'-O-Me. ∼84 and one of 89–92 trRNAs. EMBODIMENT 94. A tracr RNA (trRNA), a. each nucleotide in the upper stem, b. B1 and B2 in the bulge region; c. N3, N4, N5, N15, N16, N17, and N18 in the nexus region; d. each nucleotide in the hairpin 1 region, e. each nucleotide in the hairpin 2 region and Including, trRNA. EMBODIMENT 95. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end The trRNA of embodiment 94, further comprising: EMBODIMENT 96. 2'-O-Me or 2'-F modification in the first three nucleotides at the 5' end 2'-O-Me in the last three nucleotides at the 3' end and or a 2'-F modified nucleic acid. EMBODIMENT 97. 79 to 80, wherein N15, N16, N17, and N18 are modified with 2'-F. Any of 84 trRNAs. EMBODIMENT 98. LS1, LS3, and LS5 are modified with 2'-F, and LS2, LS4, and LS6 is modified with 2'-O-Me; The trRNA of any of embodiments 79 to 84 and 97. EMBODIMENT 99. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end The trRNA of any one of embodiments 87 to 98, further comprising: EMBODIMENT 100. 2'-O-Me or 2'-F modification in the first three nucleotides at the 5' end 2'-O- 99. The trRN of embodiment 98 or 99, further comprising Me or 2'-F modified nucleotides. A. EMBODIMENT 101. A trRNA comprising any one of the nucleic acids of SEQ ID NOs: 188 to 227. EMBODIMENT 102. At least 99, 98, or 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% The nucleic acid includes a nucleic acid having an identity, and the modification pattern is the same as the modification pattern shown in the reference sequence identifier. One is trRNA. EMBODIMENT 103. Three phosphorothioates (P S) bond and three PS bonds connecting the last four nucleotides at the 3' end The trRNA of any one of embodiments 101-102, further comprising: EMBODIMENT 104. A dual guide comprising crRNA and trRNA, wherein the crRNA is SEQ ID NO:1. 187, and the trRNA comprises any one of nucleotides of SEQ ID NO: 18 Dual guide containing any one of the nucleic acids 8 to 227. EMBODIMENT 105. The crRNA of any one of embodiments 55 to 78 and the crRNA of embodiments 79 to 103 Dual guide containing one of the trRNAs. EMBODIMENT 106. The method according to any one of embodiments 55 to 78, comprising the crRNA and the unmodified trRNA. , dual guide. EMBODIMENT 107. The method comprises the steps of: Hmm, dual guide.

[0204] C. Terminal Nucleotide Modifications In some embodiments, the 5' or 3' end of any of the guide RNAs described herein The terminal nucleotide is modified. In some embodiments, for example, sgRNA, dg RNA, crRNA, trRNA, or both crRNA and trRNA. 1, 2, 3, 4, 5 or 6 amino acids at the end (i.e., the end) of the 3'-terminal region of the id RNA In some embodiments, one, six, or seven nucleotides are modified. 1, 2, 3, 4, 5, 6, or 7 residues at the end (i.e., the last) of the 3'-terminal region of NA In some embodiments, the 3' or 7' nucleotides include more than one modification. The last (i.e., last) 1, 2, 3, 4, 5, 6, or In some embodiments, at least one of the seven nucleotides is modified. , 1, 2, 3, 4, 5, 6 at the end (i.e., the end) in the 3' terminal region, Or at least two of the seven nucleotides are modified. 1, 2, 3, 4, 5, 6 at the end (i.e., the end) of the 3'-terminal region or at least three of the seven nucleotides are modified. and the modification includes a PS linkage.

[0205] In some embodiments, the 5' end of the 5' termination region is modified, e.g., the sgRNA , dgRNA, crRNA, trRNA, or both crRNA and trRNA The first 1, 2, 3, 4, 5, 6, or 7 nucleotides are modified In some embodiments, the first 1, 2, 3, 4, or 5 amino acids in the 3'-terminal region of the guide RNA are In some embodiments, 5, 6, or 7 nucleotides contain more than one modification. So, what about 1, 2, 3, 4, 5, 6 at the end (i.e., the beginning) of the 5' end? At least one of the seven nucleotides is modified. In this embodiment, one, two, three, four, five, six, or seven of the termini at the 5' end are At least two of the nucleotides are modified. 1, 2, 3, 4, 5, 6, or 7 nucleotide sacs at the ends of At least three of them are modified. In some embodiments, the modification comprises a PS linkage.

[0206] In some embodiments, a guide RNA, e.g., sgRNA, dgRNA, crRNA, The 5' and 3' ends of the trRNA, or both the crRNA and the trRNA (e.g. In some embodiments, both ends of the guide RNA, e.g., sg RNA, dgRNA, crRNA, trRNA, or both crRNA and trRNA In some embodiments, only the 5' end of the guide RNA is modified. RNA, dgRNA, crRNA, trRNA, or both crRNA and trRNA Only the 3' end of one of the sequences is modified.

[0207] In some embodiments, the gRNA is a nucleotide sequence that amplifies the first seven nucleotides at the 5' end of the gRNA. It contains modifications at one, two, three, four, five, six, or seven of the bases. In some embodiments, the gRNA comprises one of the terminal seven nucleotides at the 3' end. In some embodiments, the amino acid sequence includes one, two, three, four, five, six, or seven modifications. can be 2, 3, or 4 of the first 4 nucleotides at the 5' end and and / or two, three, or three of the four terminal nucleotides at the 3' end In some embodiments, the first four nucleotides at the 5' end are modified. Two, three, or four of the peptides are linked by phosphorothioate (PS) bonds. is.

[0208] In some embodiments, the 5' and / or 3' end modifications are 2-terminal modifications to the nucleotide. '-O-methyl (2'-O-Me) or 2'-O-(2-methoxyethyl) (2'-O In some embodiments, the modification includes a 2'-fluoro nucleotide. In some embodiments, the modification is an internucleotide phosphorothioate. In some embodiments, the modification comprises an inverted abasic nucleotide. In some embodiments, the modifications include 2'-O-Me, 2'-O-moe, 2'-fluoro ( 2'-F), phosphorothioate (PS) internucleotide linkages, and inverted abasic nucleotides In some embodiments, the equivalent modifications include more than one selected from Included.

[0209] In some embodiments, a guide RNA, e.g., sgRNA, dgRNA, crRNA, The trRNA, or both the crRNA and the trRNA, consist of the first , 2, 3, 4, 5, 6, or 7 nucleotides between one or more In some embodiments, the guide RNA comprises a phosphorothioate (PS) linkage. gRNA, dgRNA, crRNA, trRNA, or crRNA and trRNA Both have one, two, three, four, five, six, or seven nucleotides at the last 3' end. In some embodiments, the guide RNA comprises one or more PS linkages between the nucleotides. , e.g., sgRNA, dgRNA, crRNA, trRNA, or crRNA and Both trRNAs have one, two, three, or four residues at the end of both the 5' and 3' ends. It contains one or more PS linkages between 4, 5, 6, or 7 nucleotides. In some embodiments, in addition to the PS linkage, the 5' and 3' terminal nucleotides are 2'-O It may contain -Me, 2'-O-moe, or 2'-F modified nucleotides.

[0210] In some embodiments, a guide RNA, e.g., sgRNA, dgRNA, crRNA, The trRNA, or both the crRNA and the trRNA, are expressed at the 5' and 3' ends. Modified nucleotides and one or more of the nucleotides described in Tables 1-3 and FIG. 21A or FIG. 21C. or other regions.

[0211] In some embodiments, the nucleic acid sequence of crRNA, trRNA, or crRNA and trRNA is Both contain modified nucleotides that are not at the 5' or 3' terminus. The turns are described below and in Table 4.

[0212] 3. Delivery of gRNA and Cas Protein In some embodiments, in addition to at least one gRNA, the compositions provided herein The article further comprises a nuclease. In some embodiments, the nuclease is a Cas protein. In some embodiments, the gRNA in combination with the Cas protein is a Cas RN In some embodiments, the Cas protein is referred to as a type II CRISPR / Cas protein. In some embodiments, the Cas protein is Cas9. In some embodiments, the Cas9 protein is a wild-type Cas9. The Cas9 protein is a cass9 protein that is used to infect Streptococcus pyogenes. Cas9 proteins, such as Cas9 from S. pyogenes In some embodiments, the Cas9 protein is derived from S. pyogenes. However, it functions similarly to Cas9 in S. pyogenes and inhibits S. pyogenes. gRNA specific for S. pyogenes Cas9 is not specific for non-S. pyogenes Cas9. In some embodiments, Cas9 directs Cas9 to its target site. The equivalent of the Cas9 protein from S. pyogenes is It is encompassed by the embodiments described herein.

[0213] Cas9 includes its modified and mutated forms. Engineered versions of Cas9 that contain either one of the catalytic domains are called "nickases." Nickase cuts only one strand on the target DNA, thus creating a single-strand break. A single-stranded break may also be known as a "nick." In some embodiments, In some embodiments, the compositions and methods include a nickase. It contains the nickase Cas9, which induces a nick rather than a double-strand break in the NA.

[0214] In some embodiments, the Cas protein contains only one functional nuclease domain. For example, the Cas protein may be modified to contain a nuclease domain. One of the amino acids is mutated or completely or partially deleted to reduce its nucleic acid cleavage activity. In some embodiments, RuvC with reduced activity may be modified to reduce In some embodiments, a nickase Cas having an inactive RuvC domain is used. In some embodiments, a nickase Cas having a domain is used to reduce activity. In some embodiments, a nickase Cas having an HNH domain is used. A nickase Cas with an active HNH domain is used.

[0215] In some embodiments, a conserved amino acid sequence within the nuclease domain of a Cas protein is The acid is substituted to reduce or alter nuclease activity. Cas proteins contain amino acid substitutions in the RuvC or RuvC-like nuclease domain. Exemplary amino acids in the RuvC or RuvC-like nuclease domain include The acid substitution was D10A (based on the Cas9 protein of S. pyogenes). In some embodiments, the Cas protein is an HNH or HNH-like The nuclease domain may contain amino acid substitutions. Exemplary amino acid substitutions in the ribozyme domain include E762A, H840A, and N863A. , H983A, and D986A (Cas9 protein of S. pyogenes (based on quality).

[0216] In some embodiments, the RNP complexes described herein comprise a nickase and a target It contains a pair of guide RNAs that are complementary to the sense and antisense strands of the sequence. In one embodiment, the guide RNA directs the nickase to the target sequence and is the opposite strand of the target sequence. Double-stranded breaks (DSBs) can be eliminated by creating a nick on the target DNA (i.e., double nicking). In some embodiments, the use of double nicking improves specificity and reduces off-target activity. In some embodiments, the nickase Cas can act against the DNA. Used with two separate guide RNAs targeting the same strand, creating a double nick in the target DNA In some embodiments, the nickase Cas is a cascade of two Cas sequences selected to be adjacent. are used with separate guide RNAs to generate a double nick in the target DNA.

[0217] In some embodiments, a domain or region of a protein is a portion of a different protein. In some embodiments, chimeric Cas proteins are used in which the Cas is replaced by a Cas residue. The nuclease domain may be cleaved by a domain from a different nuclease, e.g., Fok1. In some embodiments, the Cas protein is an engineered nuclease. It's fine.

[0218] In some embodiments, the Cas protein is a catalytically inactive Cas protein linked to a heterologous functional domain. The present invention also includes fusion proteins containing Cas9 (see, for example, International Patent Publication No. 20141524 32). In some embodiments, the catalytically inactive Cas9 is S. pyogenes ( In some embodiments, the catalytically inactive Cas9 is derived from Ca In some embodiments, the heterologous functional domain comprises a mutation that inactivates s9. In some embodiments, the heterologous functional domain is a domain that modifies a polypeptide, a histone, or a DNA. The domain may be a transcriptional activator domain or a transcriptional repressor domain.

[0219] A.PAM In some embodiments, the target sequence may be adjacent to the PAM. M may be adjacent to 1, 2, 3, or 4 nucleotides at the 3' end of the target sequence. or within those nucleotides. The length and sequence of the PAM depend on the For example, PAM can be expressed by the Cas protein. 186-191 (2015), which is incorporated herein by reference, Consensus sequences for specific Cas9 proteins or Cas9 orthologues or specific P In some embodiments, the PAM may be selected from 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, The length of the nucleic acid sequence may be, for example, 1, 6, 7, 8, 9, or 10 nucleotides. Specific exemplary PAM sequences include NGG, NAG, NGA, NGAG, NGCG, N NGRRT, TTN, NGGNG, NG, NAAAAN, NNAAAAW, NNNNAC A, GNNNCNNA, and NNNNGATT (where N is any nucleotide) is defined, W is defined as either A or T, and R is defined as either A or G. In some embodiments, the PAM sequence may be NGG. In some embodiments, the PAM sequence may be NGGNG. The AM sequence may be NNAAAAW.

[0220] B. Delivery of modified gRNA Lipid nanoparticles (LNPs) are a well-known approach for the delivery of nucleotide and protein cargoes. Means for delivery of gRNA, mRNA, Cas9, and RNP as disclosed herein In some embodiments, the LNPs may be used to bind nucleic acids, proteins, or Delivering nucleic acids along with proteins.

[0221] In some embodiments, the present invention relates to any one of the gRNAs disclosed herein. In some embodiments, the gRNA is associated with a LNP. In this state, the gRNA / LNP also associates with Cas9 or an mRNA encoding Cas9. is.

[0222] In some embodiments, the invention provides a method for the preparation of a nucleic acid sequence comprising any one of the disclosed gRNAs and a LNP. In some embodiments, the composition comprises a Cas9 or a gene encoding Cas9. It further includes mRNA.

[0223] In some embodiments, the LNPs comprise cationic lipids. , 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-( Diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z) -octadeca-9,12-dienoate), also known as (9Z,12Z)-3-((4 ,4-Bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino) 9,12-Propoxycarbonyloxymethylpropyloctadeca-9,12-dieno In some embodiments, the LNP comprises a cationic ion to the RNA phosphate of about 4.5. The molar ratio of the polyamines to the fatty amines (N:P) is included.

[0224] In some embodiments, the LNPs associated with the gRNAs disclosed herein are useful for treating disease or or for use in the preparation of a medicament for treating a disorder.

[0225] Electroporation is a well-known means for delivery of cargo and is disclosed herein. Any electroporation method for delivery of any one of the gRNAs In some embodiments, electroporation may be performed using the techniques disclosed herein. Any one of the gRNAs and Cas9 or an mRNA encoding Cas9 It may be used to deliver A.

[0226] In some embodiments, the present invention relates to any one of the gRNAs disclosed herein. A method for delivering a gRNA to a cell ex vivo, wherein the gRNA is associated with a LNP or In some embodiments, the gRNA / LNP or LNP is not associated with the gRNA / LNP or LNP. The gRNA also associates with Cas9 or an mRNA encoding Cas9.

[0227] 4. Methods of Gene Modulation In some embodiments, the present invention provides a method for the preparation of a compound as disclosed herein in combination with a pharma- ceutically acceptable carrier. In some embodiments, the present invention includes a pharmaceutical formulation comprising any one of the gRNAs. Any one of the gRNAs disclosed herein and a pharma- ceutically acceptable carrier. In some embodiments, the present invention provides pharmaceutical formulations comprising a pharma- ceutical acceptable carrier and an LNP. Any one of the gRNAs disclosed herein, together with the Cas9 protein or The present invention relates to a pharmaceutical formulation comprising an mRNA encoding a Cas9 protein and an LNP. In embodiments of the present invention, the pharmaceutical formulation is used in the preparation of a medicament for treating a disease or disorder. In some embodiments, the present invention provides a method for the preparation of a gRNA gene as described herein. or any one of the pharmaceutical formulations. include.

[0228] In some embodiments, the present invention relates to a Cas protein or Cas mRNA and Administering or delivering any one or more of the gRNAs disclosed herein. The present invention also includes a method or use for modifying target DNA.

[0229] In some embodiments, the present invention relates to a Cas protein or Cas mRNA and Administering or delivering any one or more of the gRNAs disclosed herein. In some embodiments, the method or use comprises the step of: In some embodiments, the modulation is editing of a target gene. The effect is the alteration of the expression of the protein encoded by the target gene.

[0230] In some embodiments, the method or use results in gene editing. In some embodiments, the method or use results in a double strand break in the target gene. In an embodiment, the method or use results in the formation of indel mutations during non-homologous end joining of DSBs. In some embodiments, the method or use results in In some embodiments, the insertion or deletion of a nucleotide in the target gene The insertion or deletion of an octide results in a frameshift mutation that results in a non-functional protein. In some embodiments, the nucleotide sequence of the target gene is The insertion or deletion of the target gene leads to knockdown or ablation of expression. In some embodiments, the method or use comprises homology directed repair of the DSB. The method further includes delivering a template to the cell, wherein at least a portion of the template is delivered to the cell by Cas. Target DNA at or near the site of the protein-induced double-stranded break is incorporated into the

[0231] In some embodiments, the method or use results in gene modulation. In some embodiments, gene modulation refers to an increase or decrease in gene expression, In some embodiments, the methylation status of NA is changed, or the modification of a histone subunit is changed. In the method or use, the expression of a protein encoded by a target gene is increased or This results in a decrease.

[0232] In some embodiments, any of the gRNAs disclosed herein is used to treat a disease or They may be useful in the preparation of a medicament for treating a disorder.

[0233] A. Measuring Gene Modulation The efficacy of modified gRNAs can be tested in vitro and in vivo. In some embodiments, the present invention relates to a method for the preparation of a gene encoding one or more of the gRNAs disclosed herein. The gRNA, when delivered to cells along with Cas9, results in gene modulation. In some embodiments, the efficacy of the gRNA is determined by in vitro or in vivo assays. It can be measured in an in vivo assay.

[0234] 1. In vitro measurement of Cas efficacy In some embodiments, the activity of a CasRNP comprising a modified sgRNA is greater than or equal to that of an unmodified sgRNA. The activity of the Cas RNP is compared to that of the Cas RNP containing

[0235] In some embodiments, the activity of a Cas RNP comprising a dgRNA that comprises a modified trRNA is , compared to the activity of a Cas RNP containing a dgRNA that contains an unmodified trRNA.

[0236] In some embodiments, the activity of a Cas RNP comprising a dgRNA that comprises a modified crRNA is , compared to the activity of a Cas RNP containing a dgRNA that contains an unmodified crRNA.

[0237] In some embodiments, the CRNA comprises a dgRNA comprising a modified crRNA and a modified trRNA. The activity of AS RNPs was determined by the Cas RNPs containing unmodified crRNA and unmodified trRNA. The activity is compared with that of

[0238] In some embodiments, the efficacy of the gRNA in increasing or decreasing expression of the target protein is The activity is determined by measuring the amount of the target protein. The invention includes any one of the gRNAs described herein, wherein the gRNA is a targeting In some embodiments, the gene expression level increases or decreases the amount of protein produced from the gene. The present invention relates to a method for treating a cancer cell line comprising administering to a subject any one of the gRNAs disclosed herein. and wherein the gRNA is a gene encoding a target protein. and expression of the target protein is mediated by Cas9. is increased or decreased compared to a gRNA control that does not target that gene.

[0239] In some embodiments, the efficacy of editing with a particular gRNA is evaluated using Cas9 and gRNA. Delivery of A (either sgRNA or dgRNA containing crRNA and trRNA) In some embodiments, the target region is determined by the edit that is present at the target position in the genome. The efficiency of editing using a particular gRNA is measured by next-generation sequencing. In some embodiments, the editing percentage of the target region of the subject is determined. has a nucleotide insertion or deletion in the target region of interest relative to the total number of sequence reads The total number of sequence reads generated is measured after delivery of the gRNA and Cas9. The present invention also provides a method for the preparation of a method for the preparation of a cell comprising administering to a cell any one of the modified gRNAs described herein. and a method for increasing the efficacy of gene editing, comprising: The percentage of genomic DNA fragments that express gRNAs is increased compared to a similarly unmodified control gRNA.

[0240] In some embodiments, the efficiency of editing with a particular gRNA can be determined by successful gene editing. In some embodiments, the expression of a nucleotide sequence is determined by the presence of an introduced nucleotide insertion or deletion. The present invention relates to a method for administering or delivering any one of the modified gRNAs described herein to a cell. The present invention also includes a method for creating an insertion or deletion of a nucleotide in a gene, comprising: The nucleic acid residues are inserted or deleted relative to a similarly unmodified control gRNA. In some embodiments, the activity of Cas9 and gRNA is tested in a biochemical assay. In some embodiments, the activity of Cas9 and gRNA is determined in a cell-free cleavage assay. In some embodiments, the activity of Cas9 and gRNA is tested in a Neuro2 Tested in A cells.

[0241] In some embodiments, Cas9 and sgRNA or modified crRNA and / or The dgRNA containing the trRNA is an unmodified sgRNA or an unmodified crRNA and a trRNA. The dgRNAs exhibit similar, greater, or reduced activity compared to dgRNAs containing NA. In this embodiment, Cas9 and modified sgRNA or modified crRNA and / or The dgRNA containing the trRNA is an unmodified sgRNA or an unmodified crRNA and a trRNA. Showing enhanced activity compared to dgRNA containing RNA.

[0242] 2. In vivo measurement of Cas efficacy In some embodiments, the activity of the modified gRNA can be determined by the association of the modified gRNA and a Cas protein or or after in vivo administration of LNPs containing mRNA encoding Cas proteins. will be done.

[0243] In some embodiments, the in vivo use of the gRNA or compositions provided herein The efficacy of the assay was evaluated by extracting the cells from tissues (e.g., liver tissue) after administration of gRNA and Cas9. The efficiency of editing is determined by the efficiency of editing measured in the DNA that has been edited.

[0244] 3. In vivo measurement of immune system activation The modifications of the gRNA disclosed herein are of interest for in vivo administration of the gRNA. In some embodiments, activation of the immune response of a subject may be achieved by: sgRNP together with Cas9 mRNA or protein (e.g., formulated in a LNP) A or sites after in vivo administration of dgRNA containing trRNA and crRNA In some embodiments, the cytokine is measured by serum concentration of Interferon-alpha (IFN-alpha), interleukin 6 (IL-6), Monocyte chemotactic protein 1 (MCP-1), and / or tumor necrosis factor alpha (TNF In some embodiments, the present invention relates to a method for the preparation of gRNAs disclosed herein. Reducing a subject's immune response to delivery of gRNA, comprising administering any one of The method includes the step of: In some embodiments, the present invention provides a method for the production of a gRNA that is capable of inhibiting GABAergic deficiency, comprising administering the gRNA to a subject in need thereof, in a manner similar to that described herein, relative to a control gRNA that is not similarly modified. The present invention includes a method for reducing activation of the immune system in a subject.

[0245] In some embodiments, a modified gRNA (e.g., sgRNA or dgRNA) is combined with Administration of as RNP or Cas9 mRNA reduced immunity compared with administration of unmodified sgRNA. In some embodiments, the present invention provides a method for producing a lower serum concentration(s) of an immunocytokine. The present invention relates to an immune suppressor comprising administering any one of the gRNAs disclosed herein. The method includes a method of reducing the serum concentration of a cytokine in a subject, the gRNA being similarly modified. Generate lower concentrations of immune cytokines in the serum of subjects compared to control gRNA without .

[0246] This description and the exemplary embodiments should not be construed as limiting. For purposes of the appended claims, unless otherwise indicated, the specification and claims All amounts, percentages, or proportions used in the range and other numerical values The numbers are, in all instances, preceded by the term "about" unless already qualified otherwise. It should be understood that the term is more qualified than the term itself. Unless otherwise specified, the numerical parameters set forth in the following specification and appended claims are are approximations that may vary depending on the desired properties to be obtained. This is not an attempt to limit the application of the doctrine of equivalents to the scope of the claims, but rather to at least in accordance with the number of significant figures reported and with normal rounding techniques applied. should be interpreted in accordance with the

[0247] As used in this specification and the appended claims, the singular form "a" (one) is used interchangeably with "an" (one) or "an" (one) or "an" (one). ", "an" and "the" and any singular form of any word Use of the term in this context includes multiple referents unless it is explicitly and unambiguously limited to one referent. As used herein, the term "comprises" and its grammatical meanings are The variations are intended to be non-limiting, and the recitation of an item in a list represents an alternative to the listed item. or other similar matters which may be added. EXAMPLES

[0248] The following examples are provided to illustrate certain disclosed embodiments. , and should not be construed as limiting the scope of the present disclosure in any way.

[0249] Example 1 - Materials and Methods A. Synthetic guide RNA (gRNA) Dual (dgRNA, i.e., crRNA and trRNA) and single guide RNAs The modified nucleotides provided by the vendor in Table 4 were used in both the sgRNA and sgRNA formats. The gRNA was chemically synthesized using nucleotides and ligation.

[0250] B. Cas9 mRNA in vitro transcription ("IVT") In vitro amplification using linearized plasmid DNA template and T7 RNA polymerase Capped and polyadenylated Ca containing N1-methyl pseudo-U by ro transcription The s9 mRNA was generated using a T7 promoter and a 100 nucleotide (nt) poly( Plasmid DNA containing the (A / T) region was linearized with XbaI and then purified using a commercial The IVT reactions to generate modified mRNA with Cas9 were incubated at 37°C for 4 h. , with the following conditions: 50 ng / μL linearized plasmid; 2 mM each of GTP, ATP, and CTP , and N1-methyl pseudo UTP (Trilink); 10 mM ARCA (Tri link); 5U / μL T7 RNA polymerase (NEB); 1U / μL mouse 0.004 U / μL inorganic E. coli pyrophosphatase inhibitor (NEB); and 1× reaction buffer. Incubation time: 4 hours. After incubation, TURBO DNase (ThermoFisher) was added at 0.01 U / μl. Add 100 µL of ... Removed. MegaClear Transcription Clean-up k Silica-bonded columns such as it (ThermoFisher) or LiCl followed by NaO The enzyme was purified using a standard protocol that included a precipitation step using EtOH containing Ac. Cas9 mRNA was purified from nucleotides and nucleotides. The absorbance at 260 nm was measured ( Transcript concentrations were determined using a Nanodrop™ and a Bioanlayzer (Ag Transcripts were analyzed by capillary electrophoresis using a fluorometric ilent.

[0251] C. Transfection of Cas9 mRNA and gRNA in Neuro2A cells tion Culture the mouse cell line Neuro2A in DMEM medium supplemented with 10% fetal bovine serum. 24 hours before transfection, 15,000 cells / well were plated in a 96-well plate. On the day of transfection, the medium was aspirated from the cells and replaced with fresh The medium was replaced with Lipofectamine-2000 (Invitrogen). was diluted 1:50 (v / v) in Opti-MEM (Invitrogen). s9 mRNA and single guide RNA were diluted separately in Opti-MEM. For dual guide formats, crRNA and trRNA can be used together in Opti- Both Cas9 mRNA and gRNA were diluted in MEM at a 1:1 molar ratio. Mix 1:1 (v / v) with diluted Lipofectamine-2000 and After 5 min of incubation, 100 ng of Cas9 was added to the lipoplex. to a final concentration of 0.4 μL total lipofection reagent and mRNA / well Lipoplexes were added to the cells sequentially. For each experiment, 25 nM and 2.5 nM, 16.7nM and 1.67nM, 10nM and 1nM, 8.3nM and 0.83n The guide was tested at 100 nM and two dose levels including 3 nM and 0.3 nM. For guided transfection, this concentration is determined by equimolar amounts of crRNA and trRNA, e.g., 2 25 nM crRNA and 25 nM trRNA to generate 5 nM total dual guides 24 hours after transfection, cells were lysed and the lysates were directly subjected to PCR. The reactions were then analyzed for editing by NGS.

[0252] Cas9 mRNA with 1xNLS (SEQ ID NO:359): GGGUCCCGCAGUCGGCGUCCAGCGGCUCUGCUUGUUCGUGUGUGUCGUUGCAGGCCUUAUUCGGAUCCAUGGAUAAGA AGUACUCAAUCGGGCUGGAUAUCGGAACUAAUUCCGUGGGUUGGGCAGUGAUCACGGAUGAAUACAAAGUGCCGUCCAAG AAGUUCAAGGUCCUGGGGAACACCGAUAGACACAGCAUCAAGAAAAAUCUCAUCGGAGCCCUGCUGUUUGACUCCGGCGA AACCGCAGAAGCGACCCGGCUCAAACGUACCGCGAGGCGACGCUACACCCGGCGGAAGAAUCGCAUCUGCUAUCUGCAAG AGAUCUUUUCGAACGAAAUGGCAAAGGUCGACGACAGCUUCUUCCACCGCCUGGAAGAAUCUUUCCUGGUGGAGGAGGAC AAGAAGCAUGAACGGCAUCCUAUCUUUGGAAACAUCGUCGACGAAGUGGCGUACCACGAAAAGUACCCGACCAUCUACCA UCUGCGGAAGAAGUUGGUUGACUCAACUGACAAGGCCGACCUCAGAUUGAUCUACUUGGCCCUCGCCCAUAUGAUCAAAU UCCGCGGACACUUCCUGAUCGAAGGCGAUCUGAACCCUGAUAACUCCGACGUGGAUAAGCUUUUCAUUCAACUGGUGCAG ACCUACAACCAAGUUCGAAAACCCAAUCAAUGCUAGCGGCGUCGAUGCCAAGGCCAUCCUGUCCCGCCGGCUGUC GAAGUCGCGGCGCCUCGAAAACCUGAUCGCACAGCUGCCGGGAGAGAAAAAGAACGGACUUUCGGCAACUUGAUCGCUC UCUCACUGGGACUCACUCCCAAUUUUUGACCUGGCCGAGGACCGGAAGCUGCAACUCUCAAAGGACACC UACGACGACGACUUGGACAAUUUGCUGGCACAAAUUGGCGAUCAGUACGCGAUCUGUUCCUUGCCGCUAAGAACCUUUC GGACGCAAUCUUGCUGUCCGAUAUCCUGCGCGUGAACACCGAAAUACCAAAGCGCCGCUUAGCGCCUCGAUAUUAAGC GGUACGACGAGCAUCACCAGGAUCUCACGCUGCUCAAAGCGCUCGUGAGACAGCAACUGCCUGAAAAGUACAAGGAGAUC UUCUUCGACCAGUCCAAGAAUGGGUACGCAGGUACAUCGAUGGAGGCCGCUAGCCAGGAAGAUGUUCUAUAAGUUCAUCAA GCCAAUCCUGGAAAGAUGGACGGAACCGAAGAACUGCUGGUCAAGCUGAACGGGAGGAUCUGCUCCGGAAACAGAGAA CCUUUGAACGGAUCCAUUCCCCACCAGAUCCAUCUGGGUGAGCUGCACGCCAUCUUGCGGCCCAGGAGGACUUUUAC CCAUUCCUCAAGGACAACCGGGAAAAGAUCGAGAAAAUUCUGACGUUCCGCAUCCCGUAUUACGUGGGCCCACUGGCGCG CGGCAAUUCGCGCUUCGCGUGGAUGACUAGAAAUCAGAGGAAACCAUCUCCUUGGAAUUUCGAGGAAGUUGUGGAUA AGGGAGCUUCGGCACAAAGCUUCAUCGAACGAAUGACCAACUUCGACAAGAAUCUCCCAAACGAGAAGGUGCUUCCUAAG CACAGCCUCCUUUACGAAUACUACUGUGCUACGAACUGACUAAGUGAAAUACGUACUGACGAAGGAAGGAAGCC GGCCUUUCUGUCCGGAGAACAGAGAAAGCAAUUGUCGAUCUGCUGUUCAAGACCAACGCAAGGUGACCGUCAAGCAGC UUAAAAGGACUACUUCAAGAAGAUCGAGUGUUUCGACUCAGUGGAAAUCAGCGGGGUGGAGGACAGAUUCAACGCUUCG CUGGGAACCUAUCAUGAUCUCCUGAGAUAUCAAGGACAAGGACUUCCUUGACAACGAGGAGAACAGGACAUCCUUGGA AGAUAUCGUCCUGACCUUGACCCUUUCGAGGAUCGCGAGAUGAUCGAGGAGAGGCUUAAGACCUACGCUCAUCUCUUCG ACGAUAAGGUCAUGAAAACAACUCAAGCGCCCGCCGGUACACUGGUUGGGGCCCGCCUCUCCCGCAAGCUGAUCAACGGUAU CGCGAUAAACAGAGCGGUAAAACUAUCCUGGAUUUCCUCAAAUCGGAUGGCUUCCGCUAAUCGUAACUUCAUGCCAAUUGAU CCACGACGACAGCCUGACCUUUAAGGAGGACAUCCAAAAAGCACAAGUGUCCGGACAGGGAGACUCACUCCAUGAACACA UCGCGAAUCUGGCCGGUUCGCCGGCGAUUAAGAAGGGAAUUCUGCAAACUGUGAAGGUGGUCGACGAGCUGGGUAGGUC AUGGGACGGCACAAACCGGAGAAUAUCGUGAUUGAAAUGGCCCGAGAAACCAGACUACCCCAGAAGGGCCAGAAAAACUC CCGCGAAAGGAUGAAGCGGAUCGAAGAAGGAAUCAGGAGCUGGCAGCCAGCAGUCCUGAAAGAGCACCCGGUGGAAAACA CGCAGCUGCAGAACGAAGCUCUACCUGUAUUUGCAAAAUGGACGGGACAUGUACGUGGACCAAGAGCUGGACAUC AAUCGGUUCUGAUACGACGUGGACCACAUCGUUCCCACAGUCCUUUCUGAGGAUGACGUACGAUCGUAACAAGGGUUG GACUCGCAGCGACAAGAACAGAGGGAAGUCAGAUAAUGUGCCAUCGGAGGAGGUGUCGUGAAGAGAUGAAGAAUUACUGGC GGCAGCUCCUGAAUGCGAAGCUGUAUACCCAGAGAAAGUAAUGACAAUCUCACUAAAGCCGAGCGCGGCGGACUCUCAGAG CUGGAUAAGGCUGGAUUCAUCAAACGGCAGCUGGUCGGAGACUCGGCAGAUUACCAAGCACGUGGCGCAGAUCUUGGACUC CCGCAUGAACAUAAAUACGACGAGAACGAUAAAGCUCAUCCGGGAAGUGAAGGUGUAUUACCCUGAAAAGCAAACUUGUGU CGGACUUUCGGAAGGACUUUCAGUUUUACAAAGUGAGAGAAUACAACACUACCAUCCACGCGCAUGACCGAUACCUCAAC GCUGUGGUCGGUACCGCCCUGAUCAAAAAGUCCCUAAAACUGAAUCGGAGUUUGUGUACGGAGACUACAAGGUCUACGA CGUGAGGAAGAUGAUAGCCAAGUCCGAACAGGAAAUCGGGAAAGCAACUGCGAAAUACUUUUUAUCUCAAACAUCAUGA ACUUUUUCAAGACUGAAAUUACGCUGGCCAAUGGAGAAAUCAGGAAGGGCCACUGAUCGAACUAACGGAAGAAACGGGGC GAAAUCGUGUGGGACAAGGGCAGGACUUCGCAACUGUUCGCAAAGUGCUCUCUAUGCCGCAAGUCAAUAUUGUGAAGAA AACCGAAGUGCAAACCGGCGGAUUUUCAAAGGAAUCGAUCCUCCCCAAAGAGAAUAGCGACAAGCUCAUUGCACGCAAGA AAGACUGGGACCCGAAGAAGUACGGAGGAUUCGAUUCGCCGACUGUCGCAUACUCCGUCCUCGUGGUGGGCCAAGGUGGGAG AAGGGAAAGAGCAAAAAGCUCAAAUCCGUCAAAGAGCUGCUGGGGAUUACCAUCAUGGAACGAUCCUCGUUCGAGAAGAA CCCGAUUGAUUCCUCGAGGCGAAGGGUACAAGGAGGUGAAGAGGAUCUGAUCAUAACUCCCCAAGUACUCACUGU UCGAACUGGAAAAUGGUCGGGAAGCGCAUGCUGGCUUCGGCCGGAGAAACUCCAAAAAGGAAAUGAGCUGGCCUUGCCUAGC AAGUACGUCAACUUCCUCUAUCUUGCUUCGCACUACGAAAAACUCAAAGGGUCACCGGAAGAUAACGAACAGAAGCAGCU UUUCGUGGAGCAGCACAAGCAUUAUCUGGAUGAAAUCAUCGAACAAAUCUCCGAGUUUUCAAAGCGCGUGAUCCUCGCCG ACGCCAACCUCGACAAAGUCCUGUCGGCCUACAAUAAGCAUAGAGAUAAGCCGAUCAGAGAACAGGCCGAGAACAUUAUC CACUUGUUCACCCUGACUAACCUGGGAGCCCCAGCCGCCUUCAAGUACUUCGAUACUACUAUCGAUCGCAAAAGAUACAC GUCCACCAAGGAAGUUCUGGACGCGACCCUGAUCCACCAAAGCAUCACUGGACUCUACGAAACUAGGAUCGAUCUGUCGC AGCUGGGUGGCGAUGGCGGUGGAUCUCCGAAAAAAGAAGAGAAAGGUGUAAUGAGCUAGCCAUCACAUUUAAAAGCAUCUC AGCCUACCAUGAGAAUAAGAGAAAGAAAAUGAAGAUCAAUAGCUUAUUCAUCUCUUUUUCUUUUUCGUUGGUGUAAAGCC AACACCCUGUCUAAAAAACAUAAAUUUUUUAAUCAUUUUGCCUCUUUUCUCUGUGCUUCAAUUAAUAAAAAAUGGAAAG AACCUCGAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAUCUAG

[0253] Cas9 mRNA with 2xNLS and HA tag (SEQ ID NO:360): GGGUCCCGCAGUCGGCGUCCAGCGGCUCUGCUUGUUCGUGUGUGUCGUUGCAGGCCUUAUUCGGAUCCAUGGAUAAGA AGUACUCAAUCGGGCUGGAUAUCGGAACUAAUUCCGUGGGUUGGGCAGUGAUCACGGAUGAAUACAAAGUGCCGUCCAAG AAGUUCAAGGUCCUGGGGAACACCGAUAGACACAGCAUCAAGAAAAAUCUCAUCGGAGCCCUGCUGUUUGACUCCGGCGA AACCGCAGAAGCGACCCGGCUCAAACGUACCGCGAGGCGACGCUACACCCGGCGGAAGAAUCGCAUCUGCUAUCUGCAAG AGAUCUUUUCGAACGAAAUGGCAAAGGUCGACGACAGCUUCUUCCACCGCCUGGAAGAAUCUUUCCUGGUGGAGGAGGAC AAGAAGCAUGAACGGCAUCCUAUCUUUGGAAACAUCGUCGACGAAGUGGCGUACCACGAAAAGUACCCGACCAUCUACCA UCUGCGGAAGAAGUUGGUUGACUCAACUGACAAGGCCGACCUCAGAUUGAUCUACUUGGCCCUCGCCCAUAUGAUCAAAU UCCGCGGACACUUCCUGAUCGAAGGCGAUCUGAACCCUGAUAACUCCGACGUGGAUAAGCUUUUCAUUCAACUGGUGCAG ACCUACAACCAACUGUUCGAAGAAAACCCAAUCAAUGCUAGCGGCGUCGAUGCCAAGGCCAUCCUGUCCGCCCGGCUGUC GAAGUCGCGGCGCCUCGAAAACCUGAUCGCACAGCUGCCGGGAGAGAAAAAGAACGGACUUUUCGGCAACUUGAUCGCUC UCUCACUGGGACUCACUCCCAAUUUCAAGUCCAAUUUUGACCUGGCCGAGGACGCGAAGCUGCAACUCUCAAAGGACACC UACGACGACGACUUGGACAAUUUGCUGGCACAAAUUGGCGAUCAGUACGCGAUCUGUUCCUUGCCGCUAAGAACCUUUC GGACGCAAUCUUGCUGUCCGAUAUCCUGCGCGUGAACACCGAAAUACCAAAGCGCCGCUUAGCGCCUCGAUAUUAAGC GGUACGACGAGCAUCACCAGGAUCUCACGCUGCUCAAAGCGCUCGUGAGACAGCAACUGCCUGAAAAGUACAAGGAGAUC UUCUUCGACCAGUCCAAGAAUGGGUACGCAGGUACAUCGAUGGAGGCCGCUAGCCAGGAAGAUGUUCUAUAAGUUCAUCAA GCCAAUCCUGGAAAGAUGGACGGAACCGAAGAACUGCUGGUCAAGCUGAACGGGAGGAUCUGCUCCGGAAACAGAGAA CCUUUGAACGGAUCCAUUCCCCACCAGAUCCAUCUGGGUGAGCUGCACGCCAUCUUGCGGCCCAGGAGGACUUUUAC CCAUUCCUCAAGGACAACCGGGAAAAGAUCGAGAAAAUUCUGACGUUCCGCAUCCCGUAUUACGUGGGCCCACUGGCGCG CGGCAAUUCGCGCUUCGCGUGGAUGACUAGAAAUCAGAGGAAACCAUCUCCUUGGAAUUUCGAGGAAGUUGUGGAUA AGGGAGCUUCGGCACAAAGCUUCAUCGAACGAAUGACCAACUUCGACAAGAAUCUCCCAAACGAGAAGGUGCUUCCUAAG CACAGCCUCCUUUACGAAUACUACUGUGCUACGAACUGACUAAGUGAAAUACGUACUGACGAAGGAAGGAAGCC GGCCUUUCUGUCCGGAGAACAGAGAAAGCAAUUGUCGAUCUGCUGUUCAAGACCAACGCAAGGUGACCGUCAAGCAGC UUAAAAGGACUACUUCAAGAAGAUCGAGUGUUUCGACUCAGUGGAAAUCAGCGGGGUGGAGGACAGAUUCAACGCUUCG CUGGGAACCUAUCAUGAUCUCCUGAGAUAUCAAGGACAAGGACUUCCUUGACAACGAGGAGAACAGGACAUCCUUGGA AGAUAUCGUCCUGACCUUGACCCUUUCGAGGAUCGCGAGAUGAUCGAGGAGAGGCUUAAGACCUACGCCUAUCUCUUCG ACGAUAAGGUCAUGAAAACAACUCAAGCGCCCGCGGGUACACUGGUUGGGGCCCGCCUCUCCCGCAAGCUGAUCAACGGUAU CGCGAUAAACAGAGCGGUAAAACUAUCCUGGAUUUCCUCAAAUCGGAUGGCUUCCGCUAAUCGUAACUUCAUGCCAAUUGAU CCACGACGACAGCCUGACCUUUAAGGAGGACAUCCAAAAAGCACAAGUGUCCGGACAGGGAGACUCACUCCAUGAACACA UCGCGAAUCUGGCCGGUUCGCCGGCGAUUAAGAAGGGAAUUCUGCAAACUGUGAAGGUGGUCGACGAGCUGGGUAGGUC AUGGGACGGCACAAACCGGAGAAUAUCGUGAUUGAAAUGGCCCGAGAAACCAGACUACCCCAGAAGGGCCAGAAAAACUC CCGCGAAAGGAUGAAGCGGAUCGAAGAAGGAAUCAGGAGCUGGCAGCCAGCAGUCCUGAAAGAGCACCCGGUGGAAAACA CGCAGCUGCAGAACGAAGCUCUACCUGUAUUUGCAAAAUGGACGGGACAUGUACGUGGACCAAGAGCUGGACAUC AAUCGGUUCUGAUACGACGUGGACCACAUCGUUCCCACAGUCCUUUCUGAGGAUGACGUACGAUCGAUCAUAAAGGUGU GACUCGCAGCGACAAGAACAGAGGGAAGUCAGAUAAUGUGCCAUCGGAGGAGGUGUCGUGAAGAAGAUGAAGAAUUACUGGC GGCAGCUCCUGAAUGCGAAGCUGUAUACCCAGAGAAAGUAAUGACAAUCUCACUAAAGCCGAGCGCGGCGGACUCUCAGAG CUGGAUAAGGCUGGAUUCAUCAAACGGCAGCUGGUCGGAGACUCGGCAGAUUACCAAGCACGUGGCGCAGAUCUUGGACUC CCGCAUGAACAUAAAUACGACGAGAACGAUAAAGCUCAUCCGGGAAGUGAAGGUGUAUUACCCUGAAAAGCAAACUUGUGU CGGACUUUCGGAAGGACUUUCAGUUUUACAAAGUGAGAGAAUACAACACUACCAUCCACGCGCAUGACCGAUACCUCAAC GCUGUGGUCGGUACCGCCCUGAUCAAAAAGUCCCUAAAACUGAAUCGGAGUUUGUGUACGGAGACUACAAGGUCUACGA CGUGAGGAAGAUGAUAGCCAAGUCCGAACAGGAAAUCGGGAAAGCAACUGCGAAAUACUUUUUAUCUCAAACAUCAUGA ACUUUUUCAAGACUGAAAUUACGCUGGCCAAUGGAGAAAUCAGGAAGGGCCACUGAUCGAACUAACGGAAGAAACGGGGC GAAAUCGUGUGGGACAAGGGCAGGACUUCGCAACUGUUCGCAAAGUGCUCUCUAUGCCGCAAGUCAAUAUUGUGAAGAA AACCGAAGUGCAAACCGGCGGAUUUUCAAAGGAAUCGAUCCUCCCCAAAGAGAAUAGCGACAAGCUCAUUGCACGCAAGA AAGACUGGGACCCGAAGAAGUACGGAGGAUUCGAUUCGCCGACUGUCGCAUACUCCGUCCUCGUGGUGGGCCAAGGUGGGAG AAGGGAAAGAGCAAAAAGCUCAAAUCCGUCAAAGAGCUGCUGGGGAUUACCAUCAUGGAACGAUCCUCGUUCGAGAAGAA CCCGAUUGAUUCCUCGAGGCGAAGGGUACAAGGAGGUGAAGAGGAUCUGAUCAUAACUCCCCAAGUACUCACUGU UCGAACUGGAAAAUGGUCGGGAAGCGCAUGCUGGCUUCGGCCGGAGAAACUCCAAAAAGGAAAUGAGCUGGCCUUGCCUAGC AAGUACGUCAACUUCCUCUAUCUUGCUUCGCACUACGAAAAACUCAAAGGGUCACCGGAAGAUAACGAACAGAAGCAGCU UUUCGUGGAGCAGCACAAGCAUUAUCUGGAUGAAAUCAUCGAACAAAUCUCCGAGUUUUCAAAGCGCGUGAUCCUCGCCG ACGCCAACCUCGACAAAGUCCUGUCGGCCUACAAUAAGCAUAGAGAUAAGCCGAUCAGAGAACAGGCCGAGAACACUUAUC CACUUGUUCACCCCUGACUAACCUGGGAGCCCCAGCCGCCUUCAAGUACUUCGAUACUACUAUCGAUCGCAAAAAGAUACAC GUCCACCAAGGAAGUUCUGGACGCGACCCUGAUCCACCAAAGCAUCACUGGACUCUACGAAACUAGGAUCGAUCUGUCGC AGCUGGGUGGCGAUGGCUCGGCUUACCCAUACGACGUGCCUGACUACGCCUCGCUCGGAUCGGGCUCCCCCAAAAAGAAA CGGAAGGUGGACGGAUCCCCGAAAAAAGAAGAGAAAGGUGGACUCCGGAUGAGAAUUAUGCAGUCUAGCCAUCACAUUUAA AAGCAUCUCAGCCUACCAUGAGAAUAAGAGAAAGAAAAUGAAGAUCAAUAGCUUAUUCAUCUCUUUUUCUUUUUCGUUGG UGUAAAGCCAACACCCUGUCUAAAAAACAUAAAUUUCUUUAAUCAUUUUGCCUCUUUUCUCUGUGCUUCAAUUAAUAAAA AAUGGAAAGAACCUCGAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAUCUAG

[0254] D. Primary hepatocytes Primary mouse hepatocytes (PMH) (Gibco) were cultured according to the manufacturer's protocol (Invitro gen, protocol 11.28.2012). Briefly, Thaw the cells and place them in Hepatocyte Thawing Medium (Gibco, product no. CM7000) containing supplements. After resuspension, the cells were centrifuged at 100 g for 10 min. The supernatant was discarded and the pelleted cells were Hepatocyte plating medium with additive pack (Invitrogen, product no. A1 The cells were counted and resuspended in Bio-coat 1000 mL (217601 and CM3000). A 96-well plate coated with IgG I (ThermoFisher, product no. The cells were plated at a density of 15,000 cells / well on a 100-well plate (No. 877272) and incubated at 37°C and 5% CO. The cells were incubated in a CO2 atmosphere for 5 hours to allow the formation of a monolayer. After 5 hours, the cells were plated. Remove the medium and add Cas9 mRNA and guide RNA plus 3% mouse serum. Supplemented hepatocyte culture medium containing LNP (Invitrogen, product no. A121 7601 and CM4000). LNPs were replaced with 100 ng of Ca per well. Starting dose levels of s9 mRNA and guide RNA were diluted at approximately 30 nM per well. A serial dilution was performed down to 0.1 ng of mRNA and 0.03 nM guide per well. After approximately 48 hours of incubation at 37° C. and 5% CO2 atmosphere, Cell lysis and next generation sequencing (NGS) analysis were performed.

[0255] E. Lipid Nanoparticle ("LNP") Formulation LNPs were prepared with a molar ratio of cationic lipid amine to RNA phosphate (N:P) of approximately 4.5. The lipid nanoparticle components were dissolved in 100% ethanol in the following molar ratios: 4 5 mol % (12.7 mM) of cationic lipid (e.g., 3-((4,4-bis(octyl oxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbamoyl (9Z,12Z)-octadeca-9,12-dienoic acid (9Z,12Z)-3-((4,4-bis(octyloxy)butanoate) yl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy ) methyl) propyl octadeca-9,12-dienoate; 44 mol% (12.4 mM ) of helper lipid (e.g., cholesterol); 9 mol % (2.53 mM) of neutral lipid ( and 2 mol% (0.563 mM) of PEG (e.g., PEG2k -DMG). The RNA cargo was prepared in 25 mM sodium acetate buffer, pH 4.5. The concentration of RNA cargo was approximately 0.45 mg / mL.

[0256] Precision Nanosystems NanoAssemblr(TM)B The enchtop Instrument was used according to the manufacturer's protocol. LNPs were formed by microfluidic mixing of protein and RNA solutions. A 2:1 ratio of aqueous to organic solvent was maintained throughout.

[0257] LNP Formulation Procedure A: After mixing, the LNPs were collected and diluted with phosphate buffered saline (PBS, approximately 1:1 ) and then diluted with 10kDa Slide-a-LyzerTM G2 Dialys is Cassette (ThermoFisher Scientific) Add the remaining buffer to PBS (100-fold excess of sample volume) and mix overnight at 4 °C with gentle agitation. The LNPs were concentrated (4 The resulting mixture was then centrifuged at 4000 g at 25 °C to achieve the desired concentration. The mixture was filtered using a 0.2 μm sterile filter. The resulting filtrate was diluted with water and diluted with 100% water. Stored at 8°C.

[0258] LNP formulation procedure B: After mixing, the LNPs were collected and diluted in 50 mM Tris, pH 7.5. After (approximately 1:1), 10kDa Slide-a-LyzerTM G2 Dialys is Cassette (ThermoFisher Scientific) The LNPs were soaked in 50 mM Tris (pH 7.5) at 4°C overnight with gentle agitation. The mixture was exchanged into a 100-fold excess of the original volume. A 10 kDa Amicon spin filter was used. The LNPs were then concentrated (centrifuged at 4000 g at 4°C) to achieve twice the desired concentration. These concentrated LNPs were dissolved in 50 mM Tris, 90 mM NaCl, 10 mM NaCl, pH 7.5. % sucrose (2X TSS) in a 1:1 ratio. The resulting mixture was then The resulting filtrate was stored at -80°C for 1 h. Stored at .

[0259] LNP formulation procedure C: In 25 mM sodium citrate, 100 mM sodium chloride, p RNA cargo was prepared in H5 to a concentration of approximately 0.45 mg / mL of RNA cargo. The LNPs were then collected in water at a ratio of 3:1. The LNPs were incubated at room temperature for 1 hour and then resuspended in water. They were then mixed 1:1 with PD-10 columns using the manufacturer's protocol. (GE Healthcare) on 1X TSS (50 mM Tris, 45 mM Na The buffer was exchanged into 10 kDa Amicon gel (HCl, 5% sucrose, pH 7.5). Concentrate the LNPs using pin filters (centrifugation at 4000 g at 4 °C) to the desired concentration. The resulting mixture was then sieved through a 0.2 μm sterile filter. The resulting filtrate was stored at -80°C.

[0260] F. Next Generation Sequencing ("NGS") and Analysis of On-Target Cleavage Efficiency To quantitatively determine the efficiency of editing at targeted positions in the genome, we performed deep sequencing. Mapping was used to identify the presence of insertions and deletions introduced by gene editing.

[0261] Design PCR primers around the target site (e.g., TTR, FVII) and target the genomic region of interest. The primer sequences are provided in Table 5 below. [Table 5] Follow the manufacturer's protocol (Il) to add the chemicals required for sequencing. Additional PCR was performed according to the Illumina MiSeq i Amplicons were sequenced using the instrument. After removing unwanted sequences, the reads are aligned to a human reference genome (e.g., hg38). The resulting files containing the reads were then combined with the reference genome (BAM files). ) and select reads that overlap with the target region of interest and identify insertions, substitutions, or The number of wild-type reads relative to the number of reads containing the deletion was calculated.

[0262] The editing percentage (e.g., "editing efficiency" or "percent editing") is calculated by comparing the wild type It is defined as the total number of sequence reads with an insertion or deletion relative to the total number of sequence reads containing can be.

[0263] G. LNP delivery in vivo Female CD-1 mice ranging in age from 6 to 10 weeks were used in each study. The animals were weighed and Grouped according to body weight to prepare dosing solutions based on average loop weight via the lateral tail vein in a volume of 0.2 mL per animal (approximately 10 mL per kilogram of body weight). LNP was administered at 100 mg / kg / day. Animals were observed approximately 6 hours after administration for adverse effects. After 2 h, the animals were weighed and exsanguinated via cardiac puncture under isoflurane anesthesia. Animals were euthanized at various time points by 500 mg / mL. Blood was collected in serum separator tubes or is collected in a tube containing buffered sodium citrate for plasma as described herein. For studies involving in vivo editing, we used DNA samples from each animal for extraction and analysis. Liver tissue was harvested from the median lobe of each specimen.

[0264] H. Cytokine Induction Analysis For this analysis, approximately 50-100 μL of blood was collected by incising the tail vein. Blood was allowed to clot for approximately 2 hours at room temperature and then diluted with 1 mL of ethanol. After centrifugation at 000×g for 10 min, serum was collected. IL-6, TNF-alpha Luminex-based magnetic bead matrix assay for measuring IFN-alpha, IFN-alpha, and MCP-1 Multiplex assay (Affymetrix ProcartaPlus, Catalog No. Exp040-00000-801) for cytokine analysis in collected samples Kit reagents and standards were prepared as directed in the manufacturer's protocols. 25 μL of diluted antibody-coated magnetic beads were added to the wells. L of mouse serum was added. The plates were incubated at room temperature for 2 hours and then washed. Diluted biotin antibody (50 μL) was added to the beads and incubated at room temperature for 1 hour. After washing the beads again, 50 μL of diluted streptavidin-PE was added to each well. The beads were washed once more and then washed with 100 μL of wash buffer. The mixture was suspended in 0.5% CO and read on a Bio-Plex 200 instrument (Bio-Rad). The linear regression coefficients were calculated from the standard curve using a five-parameter logistic curve fit. Using the cytokine concentrations obtained, Bioplex Manager ver.6.1 analysis package was used. The data were analyzed using cages.

[0265] I. Genomic DNA Isolation For in vivo studies, the bead-based extraction kit MagMAX-96 D NA Multi-Sample Kit (ThermoFisher, product number 441 3020) by homogenizing the tissue in lysis buffer (approximately 400 μL per 10 mg of tissue). The tissue was extracted from 10 mg of tissue using the manufacturer's protocol, which included centrifugation. Genomic DNA was extracted and subjected to PCR and subsequent NGS analysis as described herein. For analysis, all DNA samples were normalized to a concentration of 100 ng / μL.

[0266] J. ELISA Analysis of Transthyretin (TTR) Blood was collected and serum was isolated as indicated. n(Transthyretin)ELISA Kit(Aviva Systems Total TTR serum levels were determined using the ELISA kit (Biology, product no. OKIA00111). The kit reagents and standards were prepared according to the manufacturer's protocols. Mouse sera were diluted in assay diluent to a final dilution of 10,000. This was done by performing subsequent 50-fold dilutions, resulting in a 2500-fold dilution. A final 4-fold dilution step was performed for a total sample dilution of 10,000. Curve dilutions (100 μL each) and diluted serum samples were pre-coated with capture antibody. The plate was incubated at room temperature for 30 minutes. After that, the wells were washed. Enzyme-antibody conjugate (100 μL per well) was added for 20 minutes. The unbound antibody conjugate was removed and the plate was washed with water. After washing again, a color substrate solution was added. The plate was incubated for 10 minutes, then 1 00 μL of stop solution, e.g., sulfuric acid (approximately 0.3 M), was added. The plates were read on a SpectraMax M5 plate reader at 4 parameters. Logistic curve fit using SoftMax Prove software Serum TTR levels were calculated from the standard curve according to r.6.4.2. The final serum values ​​were assayed. Adjustments were made for dilution.

[0267] Example 2 - Engineering and in vitro testing of modified gRNAs Modified gRNAs in dual guide format (dgRNA) as shown in Table 4 As a result, both modified crRNA and trRNA were designed and chemically synthesized. The modified and unmodified components that form the dgRNA were then paired. The antibodies were transfected into Neuro2A cells at the concentrations indicated and expressed as described in Example 1. Editing efficiency (e.g., percent edited) was measured by NGS as described above.

[0268] Certain modified crRNAs in Table 4 targeting the mouse TTR gene were used as Cas9 mRNA. A and unmodified trRNA (TR000002). The guides included SEQ ID NOs: 1 to 18. As shown in FIG. ) Some of the modified crRNAs conferred similar or enhanced activity compared to unmodified controls However, other modified crRNAs reduced activity.

[0269] In parallel, modified trRNAs from Table 4 were used to target the same sequences in the mouse TTR gene. Transfected with Cas9 mRNA together with crRNA (CR000686). The guides tested included SEQ ID NOs: 188-200, and 204. Thus, many of the modified trRNAs (along with the unmodified crRNA) were similarly expressed compared to the unmodified controls. While most of the modified trRNAs conferred similar or enhanced activity, some of the modified trRNAs had decreased activity.

[0270] In addition to the substitution of chemically modified nucleotides, the crRNA and trRNA pairs tested Part of the sequence can also be engineered by sequence substitution to, for example, introduce GC pairs not found in the parent sequence. The guides tested were SEQ ID NOs: 15 and 201; 16 and 2 02;1 and 188. As shown in FIG. 3, one such pairing ( SEQ ID NOs: 16 and 202) resulted in similar or enhanced activity compared to unmodified controls. However, pairing two of them reduced activity.

[0271] Next, the pairing of modified crRNA and modified trRNA in Table 4 was tested. As shown, a portion of the pairing of modified crRNA with modified trRNA is Although most of the pairings conferred similar or enhanced activity compared to In Figure 4, the column headings represent the different trRNAs used in the experiment, and the row headings represent the To determine the combination used in an experiment, match the columns to the rows. TR000002 and CR000686 are unmodified controls (see bottom right column). (Reflecting light.)

[0272] Based on the design of the dgRNA, modified crRNAs were prepared as depicted in Table 4 and FIG. 15D. A and some aspects of the trRNA are characterized, and the corresponding single guide RNA (sgR These sgRNAs, SEQ ID NOs: 228 to 234, were also engineered in Neuro2A cells. As shown in FIG. 5, each of the modified sgRNAs had a 5' and 3' It showed activity equivalent to the control (G0000209; SEQ ID NO: 228) containing only the terminal modification. Ta.

[0273] A similar set of experiments was performed with additional dgRNA guides depicted in Table 4 and Figure 6. The guides tested included SEQ ID NOs: 32-47, and 1. This was also performed in mouse T Modified crRNA targeting the TR gene was mixed with Cas9 mRNA and unmodified trRNA ( TR000002). As shown in FIG. The portion of modified crRNA (along with NA) was similar compared to the unmodified control (CR000686). Modified crRNAs conferred minimal or enhanced activity, whereas other modified crRNAs reduced activity.

[0274] In parallel, the modified trRNAs in Table 4 were cloned into the same nucleotide sequence of the mouse TTR gene as shown in FIG. Cas9 mRNA together with unmodified crRNA (CR000686) targeting the sequence The guides tested included SEQ ID NOs: 205 to 222, and 1. As shown in Figure 7, most of the modified trRNAs (along with the unmodified crRNAs) are unmodified. The modified t Some of the rRNAs had reduced activity.

[0275] In addition to the substitution of chemically modified nucleotides, the tested crRNA and trRNA sequences from Table 4 Some of the pairings of A can also be engineered by sequence substitution to create, for example, This resulted in GC pairing or GU mismatches ("GU wobbles"). As shown in Figure 8, some of the modifications and pairings showed similar or similar phenotypes compared to the unmodified controls. Although the 14-amino acid sequence conferred enhanced activity, some (e.g., "GU wobbles" or mismatched pairings) FIG. 8 shows the activity of the crRNs shown in SEQ ID NOs: 48 to 52 and 1. Use the trRNA guides shown in SEQ ID NOs: 223-227 and 188 together with the A guide The results are shown below.

[0276] Next, the selected pairings of modified crRNA and modified trRNA from Table 4 are shown in Figure 9. The pairing of modified crRNA with modified trRNA was tested as shown. Although some of the pairings conferred similar or enhanced activity compared to unmodified controls, In FIG. 9, the column headings represent the different trRNAs used in the experiment. The row headings represent the different crRNAs used. Determine the combinations used in the experiment. To do this, match columns to rows. Unmodified controls are TR000002, and CR0006. The number is 86.

[0277] Some of the modified gRNAs (dgRNAs and sgRNAs) from Table 4 are purely biochemical Interestingly, Neu was also tested in a cell-free cleavage assay. Many of the modified gRNAs that were largely inactive in ro2A cells were not detected in biochemical assays. and such biochemical assays are predictive of activity of modified gRNAs in cells. This indicates that there is a possibility that

[0278] Example 3. Further testing of modified gRNAs against other targets Since it has been established that certain modifications affect the activity of gRNAs, (1) or (2) when targeting sequences in different genes. We next tested whether these modifications would affect activity. Targeting sequences in the mouse factor VII (FVII) gene as well as other sequences in the R gene The gRNAs that encode the nucleotides were engineered to have certain modification patterns as tested in Example 2. These gRNAs were synthesized as follows (see Table 4). 2A cells and analyzed for editing efficiency ( For example, percent edits) were measured.

[0279] Mouse TTR gene (a sequence different from that targeted in Example 2) or mouse Modified crRNAs in Table 4 targeting either the FVII gene were used in combination with Cas9 mRNA and The guide RNAs tested were transfected with unmodified trRNA (TR000002). The modified trRNAs included those shown in Figures 12A and 12B. Some of the rRNAs conferred similar or enhanced activity compared to unmodified controls, whereas others Modified crRNA reduced activity.

[0280] In parallel, modified trRNA from Table 4 was cloned into the same sequence of the mouse TTR gene (CR000 705; a sequence different from that targeted in Example 2) or the mouse FVII gene Cas9 mRNA together with unmodified crRNA targeting the same sequence of (CR000657) As shown in Figures 13A and 13B, the (unmodified Many of the modified trRNAs (along with the crRNAs) showed similar or enhanced expression levels compared to unmodified controls. The data suggest that some of the modified trRNAs conferred reduced activity, whereas some of the modified trRNAs conferred reduced activity. These results indicate that a given modification pattern tended to have similar effects across different sequences.

[0281] Based on the above-mentioned design of dgRNA, some forms of modified crRNA and trRNA are The corresponding single guide RNAs (sgRNAs) were engineered to have similar features (see Table 4). These sgRNAs were also tested in Neuro2A cells. The results are shown in Figure 10 ( 11 (mouse TTR) and FIG. 12 (mouse FVII). Some modification patterns are These experiments demonstrate that even gene targeting results in similar effects.

[0282] Example 4. Testing of modified gRNAs in vivo After in vitro testing, it was determined that the modifications conferred some benefit for in vivo editing. The modified sgRNA was delivered to animals in six separate studies to determine whether it would affect the did.

[0283] Chemically modified sgRNA (targeting TTR or FVII) was used as described in Example 1. The LNPs were formulated with IVT Cas9 mRNA along with sgRNP. The ratio of A to B was approximately 1:1 based on the mass of the RNA component. The Cas9 mRNA used in the studies described in the Examples has the sequence of SEQ ID NO: 360. and the LNPs were formulated using LNP formulation procedure A described above.

[0284] In one experiment, mice (n=5 per group) were administered a single dose of LNP at 2 mg / kg. Blood was collected for serum cytokine analysis 4 hours after administration. At autopsy, liver and blood were analyzed for NGS measurement of editing efficiency and serum TTR analysis, respectively. Each of the sgRNAs in this experiment targeted the same sequence in the TTR gene. The only difference between the targeted sgRNAs was the modification made to each (Figure 14A 15A-15D and 15A-15E; see Table 4, SEQ ID NOs:228-234). (Two lots were tested) served as controls for less modified 5' ends of sgRNAs. and at the three terminal nucleotides at both the 3' and 4' ends, Among them, only 2'-O-methyl modifications and phosphorothioate linkages were present (Figure 15D). (see

[0285] The results shown in Figures 14A-D show that the more heavily modified sgRNAs were more potent than the less modified G0 00209 Induces a lower response for each cytokine assayed compared to the control. The more heavily modified sgRNAs also tended to be more highly modified than their less modified counterparts. The more severely modified IgG1 gene was detected in the control (G000209 lot) at approximately 44-47%. Approximately 6 for two of the sgRNAs (e.g., G000263 and G000267) 0%, resulting in higher editing efficiency in the liver of treated animals. Importantly, knockdown of serum TTR levels resulted in better regulation of TTR expression (Figure 15A). The editing efficiency correlated with the phenotypic change, as it was comparable to or significantly higher than the control with fewer mutations. (For example, in FIG. 15A to FIG. 15B, G000263 for lot G000209 and G000267). The differences from 7 are summarized in Figures 15D and 15E (2'-O-Me modified nucleotides are thickened). (The amino acids are indicated by letters, and * indicates a phosphorothioate linkage.)

[0286] In another in vivo study, three mAbs targeted to separate sequences in the mouse TTR gene Three sgRNAs were tested: 2 mg / kg, 1 mg / kg, or 0.3 mg / kg. Mice (n=5 per group) were administered a single dose of LNP. Serum cytokines were measured 4 hours after administration. Blood was collected for in vivo analysis. At autopsy 7 days after administration, the liver and blood were Each patient was then collected for next-generation sequencing (NGS) measurement of editing efficiency and serum TTR analysis. , each of the sgRNAs was modified, one sgRNA was completely unmodified (G000201 (sequence No. 243), another sgRNA has both the 5' and 3' ends of the sgRNA. Each has 2'-O-methyl groups at and between the three terminal nucleotides. The nucleotide sequence of the ... No. 241) and the third sgRNA is G000, which was identified in a previous in vivo study. 267 (G000282 (SEQ ID NO: 242)) and the TTR gene The same sequence in the offspring (a different sequence than that targeted in the previous in vivo study) was targeted.

[0287] As shown in Figures 16A-16D, each of the sgRNAs inhibited the cytokines tested. Each of the two resulted in similar responses in a dose-dependent manner. Regarding this, the unmodified sgRNA (G000201 (SEQ ID NO: 243)) The heavily modified sgRNA (G000282 (SEQ ID NO: No. 242)) confers a level of approximately 60% at a dose of 2 mg / kg, which is the level of modification. Significantly higher than the levels achieved with the less abundant sgRNA (G000211 (SEQ ID NO: 241)). Similar to previous in vivo studies, the level of editing was significantly higher (Fig. 17A and B). correlated with the amount of serum TTR knockdown (Fig. 17C and D).

[0288] Targeting further distinct TTR sequences in the mouse TTR gene (two preceding in Another set of three (targeting sequences different from those targeted in the in vivo studies) A second in vivo study similar to the one described above was then carried out using sgRNA. (n=5 per group) were administered a single dose of 2 mg / kg, 1 mg / kg, or 0.3 mg / kg. LNP was administered. Blood was collected for serum cytokine analysis 4 hours after administration. At autopsy 7 days after administration, liver and blood samples were analyzed for editing efficiency using NGS and serum samples were analyzed for editing efficiency using NGS. In this study, each of the sgRNAs was used for the analysis of TTR. The gRNA was completely unmodified (G000285; (SEQ ID NO: 332)) and another sgRNA was , three terminal nucleoside residues at both the 5' and 3' ends of the sgRNA, respectively. 2'-O-methyl modifications and phosphorothioate linkages in and between the tides (G000269 (SEQ ID NO: 330)) and the third sgRN A is G000267 and G000282 from two previous in vivo studies. (G000283 (SEQ ID NO: 331)) in the TTR gene The same sequence (a different sequence than that targeted in the two previous in vivo studies) was targeted.

[0289] In this study, the unmodified sgRNA (G000285 (SEQ ID NO: 332)) was o conferred little editing, whereas the heavily modified sgRNA (G000283( SEQ ID NO: 331)) confers levels reaching approximately 60% at a dose of 2 mg / kg, which is Levels achieved with less modified sgRNA (G000269 (SEQ ID NO: 330)) As in previous in vivo studies, the amount of editing The levels correlated with the amount of serum TTR knockdown (FIG. 18C).

[0290] In the fourth in vivo study, we examined the effect of modifications to the gRNA on another gene (FVII For within-study comparisons, the α-amyloides tested in the first in vivo study were Two of the sgRNAs were included (G000209 and G000267). (n=5 per group) were administered a single dose of 2 mg / kg, 1 mg / kg, or 0.3 mg / kg. NP was administered and blood was collected for serum cytokine analysis 4 hours after administration. At autopsy 6 days later, livers were harvested for NGS measurement of editing efficiency. Each of the sgRNAs targets the same sequence in the TTR or FVII gene, respectively. For each of the 5' and 3' ends of the sgRNA, one sgRNA is inserted. 2'-O-methyl modifications at and between the three terminal nucleotides in Only terminal modifications with both thiol and phosphorothioate linkages (G0 for FVII) were used. 00208 (sequence number 286), G000209 for TTR, the second sgRNA The results are consistent with previous in vivo studies of G000267, G000282, and G0 00283 (G000373 for FVII (SEQ ID NO: 28 7); G000267 (sequence number 234) for TTR).

[0291] As shown in Figures 19A-19D, each of the sgRNAs inhibited the cytokines tested. Each of the two resulted in similar responses in a dose-dependent manner. For this purpose, a more heavily modified sgRNA targeting FVII (G000373 (sequence No. 287)) was compared with the less modified version ( G000208 (sequence number 286)) (Figure 18A). These results were also observed for sgRNAs targeting TTR (Figures 20A-20 B).

[0292] In another in vivo study, the same sequence in the mouse TTR gene as G000282 was identified. Ten additional sgRNAs targeting G000282 were tested for comparison purposes. Mice (n=5 per group) were given a single dose of 1 mg / kg or 0.5 mg / kg. The LNPs used in this study were administered according to the LNP formulation procedure B described above. At the autopsy 7 days after administration, the liver and blood were analyzed for editing efficiency. The subjects were then collected for next-generation sequencing (NGS) and serum TTR analysis. Each of the sgRNAs targeted the same sequence in the TTR gene. The sequences are varied and include the 5' end, 3' end, hairpin 1, hairpin 2, and nexus of the sgRNA. 2'-OMe, 2'-F, and PS modifications in the base, lower stem, bulge, and upper stem. The percent edited (Figure 22A), the mean and standard deviation of edited (Figure 22B), and the blood The results of this study, including serum TTR levels (Figure 22C), are shown in Figures 22A-22C. These same sgRNAs were tested in primary mouse hepatocytes according to the methods described in The % edited (Figure 24A), dose-response curves (Figure 24B), and EC50 values ​​(Figure 24C) were The results of this dose-response TTR editing study, including the first 24-fold increase in TTR expression, are shown in Figures 24A-24C.

[0293] Another in vivo study targeted the same sequence as G000282 in the mouse TTR gene. Thirteen additional sgRNAs targeting the 5'-terminal nucleotide sequence were tested. For comparison purposes, G000282 was also studied. Mice (n=5 per group) were administered a single dose of LNP at 1 mg / kg. The LNPs used in this study were formulated using LNP formulation procedure C described above. The Cas9 mRNA used in the study had the sequence of SEQ ID NO: 359. Blood was subsequently collected for serum cytokine analysis. At autopsy 7 days after administration, liver and blood were collected for NGS measurement of editing efficiency and analysis of serum TTR, respectively. In this study, each of the sgRNAs targeted the same sequence in the TTR gene. The sgRNAs tested were 5' end, 3' end, hairpin 1, hairpin 2, and The 2'-OMe and PS modifications were added to the upper stem (Figure 23A). The results of this study, including mean % of seroconversion (Figure 23B), and serum TTR levels (Figure 23C), are presented. Shown in Figures 23A to 23C.

Claims

1. A single guide RNA (sgRNA) comprising a 5′ end modification and a. the upper stem region; b. the hairpin 1 region, and c. one or more modifications in one or more of the hairpin 2 regions; The 5' end modification is at least one of the first seven nucleotides at the 5' end of the 5' terminus. An sgRNA comprising at least two phosphorothioate (PS) linkages.

2. At least one modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide.

2. The sgRNA of claim 1.

3. At least one modification comprises a 2'-fluoro (2'-F) modified nucleotide. 1 or 2. The sgRNA of claim 1.

4. At least one modification comprises an internucleotide phosphorothioate (PS) bond. The sgRNA according to any one of claims 1 to 3.

5. 5. The method according to claim 1, further comprising one or more modifications in the upper stem region. The sgRNA described.

6. The sgRNA of claim 5, comprising modifications in US1 to US12.

7. 7. The method according to claim 1, comprising one or more modifications in the hairpin 1 region. The sgRNA described.

8. The sgRNA of claim 7, comprising a modification in H1-1.

9. 9. The method according to claim 1, comprising one or more modifications in the hairpin 2 region. The sgRNA described.

10. The sgRNA of claim 9, comprising a modification in H2-1.

11. The s according to any one of claims 1 to 10, which comprises modifications in H1-1 to H1-12. gRNA.

12. The s according to any one of claims 1 to 11, comprising modifications in H2-1 to H2-15. gRNA.

13. Within each of the upper stem region, the hairpin 1 region, and the hairpin 2 region The sgRNA of any one of claims 1 to 12, comprising one or more modifications to:

14. The nucleic acid sequence according to any one of claims 1 to 13, comprising a modified nucleotide between the hairpin 1 region and the hairpin 2 region. The sgRNA described in any one of claims 1 to 5.

15. 15. The sgA polypeptide of claim 1, further comprising a lower stem region comprising a modification. RNA.

16. The sgR according to any one of claims 1 to 15, further comprising a 3' terminal region comprising a modification. N.A.

17. The sgRNA of Claim 16, further comprising a 3' end modification in the 3' terminus.

18. At least two of the last four nucleotides at the 3' end of the 3' terminus The sgRNA of claim 17, wherein one of the sgRNAs is modified.

19. At least two of the last four nucleotides at the 3' end of the 3' terminus 17. One of the amino acids is modified with 2'-O-Me, 2'-F, or 2'-O-moe. The sgRNA described in.

20. one or more of the last four nucleotides at the 3' end of the 3' terminus Any one of claims 17 to 19, further comprising a phosphorothioate (PS) bond between the numbers. The sgRNA described in paragraph .

21. The sgRN of any one of claims 1 to 20, further comprising a bulge region comprising a modification. A.

22. 22. The sgR of any one of claims 1 to 21, further comprising a nexus region comprising a modification. N.A.

23. at least the first three nucleotides at the 5' end of the 5' terminus, and the last three nucleotides at the 3' end of the 3' terminus are modified. Item 23. The sgRNA according to any one of items 1 to 22.

24. the first four nucleotides at the 5' end of the 5' terminus, and the 3' terminus The last four nucleotides at the 3' end of The sgRNA of any one of claims 1 to 23, wherein the sgRNA is linked by more than one amino acid.

25. 25. The sgRNA of claim 24, wherein the terminal modification comprises 2'-O-Me.

26. The sgRNA of claim 24, wherein the terminal modification comprises a 2'-F.

27. The first four nucleotides at the 5' end of the 5' terminus and the first four nucleotides at the 3' end of the the last four nucleotides at the 3' end are linked by PS bonds; and the first three nucleotides at the 5' end and before the 3' end of the 5' end The last three nucleotides at the 3' end of the nucleic acid sequence of claim 1 to 3' include 2'-O-Me modifications.

27. The sgRNA according to any one of claims 26.

28. The first four nucleotides at the 5' end and the last four nucleotides at the 3' end nucleotides are linked by PS bonds, and the first three at the 5' end nucleotides and the last three nucleotides at the 3' end are 2'-O-M Any of claims 1 to 26, comprising 2'-e, 2'-F, and / or 2'-O-moe modifications.

2. The sgRNA described in claim 1.

29. LS1, LS6, LS7, LS8, LS11, and / or LS12 are 2'-O-M The sgRNA according to any one of claims 1 to 28, which is modified with e.

30. each of said nucleotides in said bulge region is modified with 2'-O-Me; The sgRNA described in any one of claims 1 to 29.

31. At least 50% of the nucleotides in the bulge region are modified with 2'-O-Me. The sgRNA according to any one of claims 1 to 29.

32. Each of the nucleotides in the upper stem region is modified with 2'-O-Me. The sgRNA according to any one of claims 1 to 31.

33. N16, N17, and / or N18 in the nexus region are modified with 2'-O-Me The sgRNA according to any one of claims 1 to 32,

34. N15, N16, N17, and / or N18 in the nexus region are modified; The sgRNA according to any one of claims 1 to 32.

35. wherein the modifications in the nexus region are selected from 2'-O-Me and 2'F. 33 or 34. An sgRNA according to claim 33 or 34.

36. Any of claims 32 to 35, wherein N16, N17, and N18 are linked by a PS bond. The sgRNA described in any one of claims 1 to 5.

37. Each of the nucleotides in the hairpin 1 region is modified with 2'-O-Me. The sgRNA described in any one of claims 1 to 36.

38. Each of the nucleotides in the hairpin 2 region is modified with 2'-O-Me. The sgRNA described in any one of claims 1 to 37.

39. A single guide RNA (sgRNA) comprising 2'-O-Me modified nucleotides. Bottom position: a. the first 3 nucleotides at the 5' end of the 5' terminus; b. LS1, LS6, LS7, LS8, LS11, and / or in the lower stem region LS12 and c. B1 and / or B2 in the bulge region; d. each nucleotide in the upper stem region; e. N16, N17, and / or N18 in the nexus region; f. each nucleotide in the Hairpin 1 region; g. each nucleotide in the hairpin 2 region, h. The last 4 nucleotides at the 3' end of the sgRNA.

40. The sgRNA of claim 39, wherein B3 to B6 are modified with 2'-O-Me.

41. The 5' terminus is joined to three phosphodiesterases linking the first four nucleotides at the 5' end. A holothioate (PS) bond and the last four nucleotides at the 3' end of the 3' terminus 40. The sgRNA of claim 39, further comprising three PS linkages linking the nucleotides.

42. LS9 and LS10 are, for example, modified with 2'-F or 2'-OMe. The sgRNA according to any one of claims 1 to 41.

43. N15, N16, N17, and N18 are modified, for example, with 2'-F or 2'-OMe. The sgRNA of any one of claims 1 to 42, wherein the sgRNA is decorated with a nucleotide sequence similar to that of claim 1 .

44. H2-9, H2-10, H2-11, H2-12, H2-13, H2-14, and H The sgRN according to any one of claims 1 to 43, wherein 2-15 is modified with 2'-F. A.

45. The penultimate, third penultimate, and fourth penultimate nucleotides at the 3' end The sgRN of any one of claims 1 to 44, wherein the leucine is modified at 2'-F. A.

46. A single guide RNA (sgRNA) comprising 2'-F modified nucleotides at the following positions: Place: a. LS9 and LS10 in the lower stem region; b. N15, N16, N17, and N18 in the nexus region; c. H2-9, H2-10, H2-11, H2-12, and H2-13 in the hairpin 2 region , H2-14, and H2-15, and an sgRNA comprising:

47. The penultimate, third penultimate, and fourth penultimate nucleotides at the 3' end The sgRNA of claim 46, further comprising a 2'-F modified nucleotide at the base.

48. The 5' terminus is joined to three phosphodiesterases linking the first four nucleotides at the 5' end. A holothioate (PS) bond and the last four nucleotides at the 3' end of the 3' terminus 48. The method of claim 46 or claim 47, further comprising three PS bonds linking the nucleotides. sgRNA.

49. 2'-O-M in the first three nucleotides at the 5' end of the 5' terminus at the 3' end of said 3' terminus, In the last four nucleotides in the The sgRNA of any one of claims 46 to 48, further comprising an otide.

50. A single guide RNA (sgRNA), a. 2'-O-Me modified nucleotides in the first three nucleotides at the 5' end of the 5' terminus Cleotide and b. 2'-O-Me modified nucleotides at US1 to US12; c. 2'-O-Me modified nucleotides in H1-1 to H1-12; d. 2'-O-Me modified nucleotides in H2-1 to H2-15; e. 2'-O-Me modification in the last four nucleotides at the 3' end of the 3' terminus and a modified nucleotide.

51. further comprising 2'-O-Me modified nucleotides in LS1 and / or LS6; The sgRNA described in claim 50.

52. The method further comprises the steps of:

52. The sgRNA of claim 50 or claim 51.

53. A single guide RNA (sgRNA), a. 2'-O-Me modification in the first three nucleotides at the 5' end of the 5' terminus A decorative nucleotide, b. 2'-F modified nucleotides in LS1 to LS6; c. 2'-O-Me modified nucleotides in US1 to US12; d. 2'-O-Me modified nucleotides in H1-1 to H1-12; e. a 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2; f. 2'-O-Me modified nucleotides in H2-1 to H2-15; g. 2'-O-Me modification in the last four nucleotides at the 3' end of the 3' terminus and a modified nucleotide.

54. A single guide RNA (sgRNA), a. 2'-O-Me modification in the first three nucleotides at the 5' end of the 5' terminus A decorative nucleotide, b. 2'-F modified nucleotides in LS2 to LS5; c. 2'-O-Me modified nucleotides in LS1 and LS6; d. 2'-O-Me modified nucleotides at US1 to US12; e. 2'-O-Me modified nucleotides in H1-1 to H1-12; f. a 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2; g. 2'-O-Me modified nucleotides in H2-1 to H2-15; h. 2'-O-Me modification in the last four nucleotides at the 3' end of the 3' terminus and a modified nucleotide.

55. A single guide RNA (sgRNA), a. 2'-O-Me modification in the first three nucleotides at the 5' end of the 5' terminus A decorative nucleotide, b. 2'-O-Me modified nucleotides at US1 to US12; c. 2'-O-Me modified nucleosides in LS7, LS8, LS11, and LS12 Chid and d. 2'-O-Me modified nucleotides in H1-1 to H1-12; e. a 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2; f. 2'-O-Me modified nucleotides in H2-1 to H2-15; g. 2'-O-Me modification in the last four nucleotides at the 3' end of the 3' terminus and a modified nucleotide.

56. A single guide RNA (sgRNA), a. 2'-O-Me modification in the first three nucleotides at the 5' end of the 5' terminus A decorative nucleotide, b. 2'-O-Me modified nucleotides at US1 to US12; c. 2'-O-Me modified nucleosides in LS7, LS8, LS11, and LS12 Chid and d. 2'-F modified nucleotides in LS9 and LS10; e. 2'-O-Me modified nucleotides in H1-1 to H1-12; f. a 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2; g. 2'-O-Me modified nucleotides in H2-1 to H2-15; h. 2'-O-Me modification in the last four nucleotides at the 3' end of the 3' terminus and a modified nucleotide.

57. A single guide RNA (sgRNA), a. 2'-O-Me modification in the first three nucleotides at the 5' end of the 5' terminus A decorative nucleotide, b. 2'-O-Me modified nucleotides at US1 to US12; c. 2'-O-Me modified nucleotides at LS8, LS10, and LS12; d. 2'-O-F modified nucleotides in LS7, LS9, and LS11; e. 2'-O-Me modified nucleotides in H1-1 to H1-12; f. a 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2; g. 2'-O-Me modified nucleotides in H2-1 to H2-15; h. 2'-O-Me modification in the last four nucleotides at the 3' end of the 3' terminus and a modified nucleotide.

58. A single guide RNA (sgRNA), a. 2'-O-Me modification in the first three nucleotides at the 5' end of the 5' terminus A decorative nucleotide, b. 2'-O- in LS1, LS6, LS7, LS8, LS11, and LS12 Me modified nucleotide; c. 2'-O-Me modified nucleotides in US1 to US12; d. 2'-O-Me modified nucleotides in H1-1 to H1-12; e. a 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2; f. 2'-O-Me modified nucleotides in H2-1 to H2-15; g. 2'-O-Me modification in the last four nucleotides at the 3' end of the 3' terminus and a modified nucleotide.

59. A single guide RNA (sgRNA), a. 2'-O-Me modification in the first three nucleotides at the 5' end of the 5' terminus A decorative nucleotide, b. 2'-O- in LS1, LS6, LS7, LS8, LS11, and LS12 Me modified nucleotide; c. 2'-F modified nucleotides in LS9 and LS10; d. 2'-O-Me modified nucleotides at US1 to US12; e. 2'-O-Me modified nucleotides in H1-1 to H1-12; f. a 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2; g. 2'-O-Me modified nucleotides in H2-1 to H2-15; h. 2'-O-Me modification in the last four nucleotides at the 3' end of the 3' terminus and a modified nucleotide.

60. A single guide RNA (sgRNA), a. 2'-O-Me in the first three nucleotides at the 5' end of the 5' end A modified nucleotide; b. 2'-O-Me modified nucleotides at US1 to US12; c. 2'-O-Me modified nucleotides in H1-1 to H1-12; d. a 2'-O-Me modified nucleotide between hairpin 1 and hairpin 2; e. 2'-O-Me modified nucleotides in H2-1 to H2-8; f. 2'-F modified nucleotides in H2-9 to H2-15; g. The penultimate, third penultimate, and fourth penultimate nucleotides at the 3' end 2'-F modified nucleotides in the nucleotide; h. A 2'-O-Me modified nucleotide at the last nucleotide at the 3' end of the 3' terminus and a nucleotide sequence comprising:

61. A single guide RNA (sgRNA), a. 2'-O-Me modification in the first three nucleotides at the 5' end of the 5' terminus A decorative nucleotide, b. 2'-O-Me modified nucleotides at US1 to US12; c. In H1-2, H1-4, H1-6, H1-8, H1-10, and H1-12 a 2'-O-Me modified nucleotide; d. In H1-1, H1-3, H1-5, H1-7, H1-9, and H1-11 2'-F modified nucleotides; e. a 2'-F modified nucleotide between hairpin 1 and hairpin 2; f. H2-2, H2-4, H2-6, H2-8, H2-10, H2-12; and H2 a 2'-F modified nucleotide at -14; g. H2-1, H2-3, H2-5, H2-7, H2-9, H2-11; H2-13, and a 2'-O-Me modified nucleotide at H2-15; h. at the penultimate and penultimate nucleotides at the 3' terminus 2'-F modified nucleotides; i. at the third to the end and the last nucleotide at the 3' end of the 3' terminus and 2'-O-Me modified nucleotides.

62. The 5' terminus is joined to three phosphodiesterases linking the first four nucleotides at the 5' end. A holothioate (PS) bond and the last four nucleotides at the 3' end of the 3' terminus 62. The method according to any one of claims 50 to 61, further comprising three PS bonds linking the nucleotides. The sgRNA described.

63. at least one nucleotide within the first seven nucleotides at the 5' end of the 5' terminus 62. The method according to any one of claims 50 to 61, further comprising a phosphorothioate (PS) bond. sgRNA.

64. A single guide RNA (sgRNA), a. 2'-O-Me modified nucleotides LS8, LS10, LS12, H1-2, H1- 4, H1-6, H1-8, H1-10, H1-12, H2-1, H2-3, H2-5, H 2-7, H2-9, H2-11, H2-13, and H2-15, b. LS7, LS9, LS11; H1-1, H1-3, H1-5, H1-7, H1-9 , H1-11, H1-13, H2-2, H2-4, H2-6, H2-8, H2-10, H 2-12, and 2'-F modified nucleotides at H2-14, 。

65. Three phosphorothioates linking the first four nucleotides at the 5' end of the 5' terminus The last four nucleotides at the 3' end of the 3' terminus are The sgRNA of claim 64, further comprising three PS linkages linking the sgRNA.

66. a. 2 nucleotides at the last and penultimate nucleotides at the 3' end of the 3' terminus '-O-Me modified nucleotide; b. the penultimate and penultimate nucleotides at the 3' end of the 3' terminus and a 2'-F modified nucleotide in the The sgRNAs shown above.

67. An sgRNA comprising any of SEQ ID NOs:228-332, including modifications in Table 4.

68. SEQ ID NOs:235-240, 265-285, and 309-329, including the modifications in Table 4 The sgRNA comprises any one of the following:

69. An sgRNA comprising sequence number 240.

70. 240, comprising the modifications in Table 4.

71. 242, comprising the modifications in Table 4.

72. An sgRNA comprising a modification of SEQ ID NO:242 as depicted in Table 4.

73. An sgRNA comprising sequence number 358.

74. Any one of SEQ ID NOs: 235-240, 265-285, and 309-329 At least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity to a nucleic acid having a reference in Table 4 The modifications at each nucleotide of the sgRNA corresponding to the nucleotide of the sequence identifier are shown in Table 4. The sgRNA has the same or equivalent modifications as set forth in the reference sequence identifier in.

75. Three phosphorothioates linking the first four nucleotides at the 5' end (PS) bond and three P linking the last four nucleotides at the 3' end The sgRNA of any one of claims 66 to 74, further comprising an S linkage.

75. at least three PS bonds linking said nucleotides in said hairpin 1 region; The sgRNA according to any one of claims 1 to 74, comprising:

76. and at least three PS bonds linking said nucleotides in said hairpin 2 region. The sgRNA according to any one of claims 1 to 75, comprising:

77. at least three PS bonds linking said nucleotides in said upper stem region; The sgRNA according to any one of claims 1 to 76, comprising:

78. The present invention relates to a method for the preparation of a ribonucleoprotein complex that forms a ribonucleoprotein complex with Cas9 of S. pyogenes.

78. The sgRNA of any one of claims 1 to 77.

79. A guide RNA comprising a 2'-O-Me modification at each nucleotide in the upper stem region. 。

80. The following nucleotides: US1, US2, US3, US4, US5, US6, US7, US 1, 2, 3, or 4, 5 of S8, US9, US10, US11, and US12 , 6, 7, 8, 9, 10, or 11 of the guide RNs include 2'-O-Me modifications. A.

81. 50% or more of the nucleotides in the hairpin 1 and hairpin 2 regions A guide RNA comprising a 2'-O-Me modification.

82. comprising a 2'-O-Me modification at each nucleotide in the upper stem region and 2' at 50% or more of the nucleotides in the hairpin 1 region and hairpin 2 region A guide RNA comprising an -O-Me modification.

83. Each nucleotide starting from H2-1 or H2-2 to the last nucleotide of the 3' terminus A guide RNA comprising or consisting of a 2'-O-Me modification in the

84. comprising or consisting of 2'-O-Me modifications in LS1 and / or LS6, and comprising no modifications in LS2 to LS5.

85. Two or more of LS8, LS9, LS10, LS11, and / or LS12 A guide RNA, more than one of which comprises 2'-O-Me modified nucleotides.

86. At least LS8 and LS10 are modified with 2'-O-Me. The guide RNA described above.

87. 2'-O-M at 50% or more of the nucleotides in the nexus region The guide RNA of any one of claims 79 to 86, further comprising an e modification.

88. At least 55%, 60%, 65%, 70% of the nucleotides in the nexus region , 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% The guide RNA of claim 87, which is modified with 2'-O-Me.

89. A guideline comprising 2'-O-Me modifications in up to 50% of the nucleotides in the nexus region. DoRNA.

90. 2'-O-Me modifications at four or more nucleotides in the nexus region A guide RNA comprising:

91. at least one, two, three of nucleotides N2 to N6 in the nexus region; The guide RNA of claim 90, wherein four or five are modified with 2'-O-Me. 。

92. 2'-O-Me modifications at 10 or more nucleotides in the nexus region A guide RNA comprising a modified nucleotide.

93. The guide of claim 92, wherein at least N2 to N6 are modified with 2'-O-Me. RNA.

94. 2'-O-Me modification at 50% or more of the nucleotides in the bulge region A guide RNA comprising:

95. at least 55%, 60%, 65%, 70% of said nucleotides in said bulge region; 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% are 2 The guide RNA of claim 94, which is modified with '-O-Me.

96. 95. The method of claim 94, wherein B2, B3, and / or B4 are modified with 2'-O-Me. The guide RNA described above.

97. 2'-O-Me modified nucleotides at three or more nucleotides in the bulge region A guide RNA comprising a nucleotide.

98. 98. The method of claim 97, wherein B2, B3, and / or B4 are modified with 2'-O-Me. The guide RNA described above.

99. The guide RNA has the modification pattern according to any one of claims 1 to 98. A guide RNA comprising the nucleotides of SEQ ID NO:

357.

100. The guide RNA has the modification pattern according to any one of claims 1 to 99. A guide RNA comprising the nucleotides of SEQ ID NO:

356.

101. The first three, four, or five nucleotides at the 5' end of the 5' terminal region The method according to any one of claims 79 to 100, further comprising a 2'-O-Me modification at the Guide RNA.

102. the last three, the last four, or the last five at the 3' end of the 3' terminal region Any of claims 79 to 100, further comprising a 2'-O-Me modification in the nucleotide of A guide RNA according to any one of claims 1 to 10.

103. wherein the last nucleotide at the 3' end of the 3' terminal region is unmodified. The guide RNA described in claim 102.

104. The penultimate and third-to-last nucleotides at the 3' end of the 3' terminal region The guide RNA of claim 102, wherein only the nucleotide is modified.

105. The penultimate, third penultimate, and fourth penultimate nucleotides in the 3'-terminal region The guide RNA of claim 102, wherein only the nucleotide is modified.

106. of the first 3, 4, or 5 nucleotides at the 5' end of the 5' terminus The guide RNA of any one of claims 79 to 100, further comprising a PS bond therebetween.

107. the first four nucleotides at the 5' end of the 5' terminus are linked by a PS bond The guide RNA of claim 106,

108. of the last 3, 4, or 5 nucleotides at the 3' end of the 3' terminus The guide RNA of any one of claims 79 to 100, further comprising a PS bond therebetween.

109. The last four nucleotides at the 3' end of the 3' terminus are linked by a PS bond The guide RNA of claim 108,

110. the first three or four nucleotides at the 5' end of the 5' terminus and the last three or four nucleotides at the 3' end of the 3' terminus are 2'-O-M A guide RNA according to any one of claims 79 to 100, comprising an e modification.

111. The first three or four nucleotides at the 5' end of the 5' terminus are PS-linked and the last three or four at the 3' end of the 3' terminus are linked by The nucleotides of any one of claims 79 to 100 are linked by a PS bond. The guide RNA described.

112. The first three or four nucleotides at the 5' end of the 5' terminus are 2'-O -Me modification and linked by a PS bond, The last three or four nucleotides at the end contain a 2'-O-Me modification, and A guide RNA according to any one of claims 79 to 100, which is linked by a bond.

113. At least one of nucleotides LS8, LS9, LS10, LS11, and LS12 The guide of any one of claims 79 to 100, wherein the other two contain 2'-O-Me modifications. RNA.

114. At least LS8 and LS10 are modified with 2'-O-Me, 00。 00. A guide RNA according to any one of claims 1 to 10.

115. At least 50% of the nucleotides in the nexus region are modified with 2'-O-Me. The guide RNA according to any one of claims 79 to 100.

116. At least 55%, 60%, 65%, 70% of the nucleotides in the nexus region , 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% The guide RNA of claim 115, which is modified with 2'-O-Me.

117. The guide of claim 115, wherein at least N2 to N6 are modified with 2'-O-Me. DoRNA.

118. At least 10 of the nucleotides in the nexus region are 2'-O-Me. The guide RNA of any one of claims 79 to 100, which is modified.

119. The guide of claim 115, wherein at least N2 to N6 are modified with 2'-O-Me. DoRNA.

120. At least 50% of the nucleotides in the bulge region are modified with 2'-O-Me. The guide RNA according to any one of claims 79 to 100.

121. at least 55%, 60%, 65%, 70% of said nucleotides in said bulge region; 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% are 2 The guide RNA of claim 120, which is modified with '-O-Me.

122. 122. The method of claim 121, wherein B2, B3, and / or B4 are modified with 2'-O-Me. The guide RNA described.

123. At least three of said nucleotides in said bulge region are modified with 2'-O-Me The guide RNA according to any one of claims 79 to 100,

124. 124. The method of claim 123, wherein B2, B3, and / or B4 are modified with 2'-O-Me. The guide RNA described.

125. The guide RNA of any one of claims 79 to 124, which is an sgRNA.

126. The guide RNA of any one of claims 79 to 125, which is a dgRNA.

127. At least 55 of said nucleotides in said hairpin 1 region and said hairpin 2 region ％、６０％、６５％、７０％、７５％、８０％、８５％、９０％、９５％、９６％、９７ %, 98%, or 99% are modified with 2'-OMe. The guide RNA described above.

128. The present invention relates to a method for the preparation of a ribonucleoprotein complex that forms a ribonucleoprotein complex with Cas9 of S. pyogenes. The guide RNA according to any one of claims 79 to 127.

129. A single guide RNA (sgRNA), a. the first nucleotides at the 5' end of the 5' terminus; b. each nucleotide in the upper stem region; c. each nucleotide in the Hairpin 1 region; and d. the nucleotide between hairpin 1 and hairpin 2; e. each nucleotide in the hairpin 2 region, f. the last four nucleotides at the 3' end of the 3' terminus and 2'-O-M e. an sgRNA comprising or consisting of modified nucleotides.

130. a PS bond linking the first four nucleotides at the 5' end of the 5' terminus and and a PS bond linking the last four nucleotides at the 3' end of the 3' terminus. The sgRNA of claim 129, further comprising:

131. The modified patterns shown in SEQ ID NOs: 350, 351, 352, or 353 depicted in Table 4 sgRNA having a sequence

132. A single guide RNA (sgRNA), a. the first 3, 4, 5, or 7 nucleotides at the 5' end of the 5' terminus and, b. each nucleotide in the upper stem region; c. each nucleotide in the Hairpin 1 region; and d. the nucleotide between hairpin 1 and hairpin 2; e. each nucleotide in the hairpin 2 region, f. the last four nucleotides at the 3' end of the 3' terminus and 2'-O-M e. an sgRNA comprising or consisting of modified nucleotides.

133. A single guide RNA (sgRNA), a. the first 3, 4, 5, or 7 nucleotides at the 5' end of the 5' terminus and, b. Nucleotides US1, US2, US3, US4, US5, US6, US7, US8 , US9, US10, US11 and US12, c. Nucleotides H1-1, H1-2, H1-3, H1-4, H1-5, H1-6, H 1-7, H1-8, H1-9, H1-10, H1-11, and H1-12, respectively. 、 d. the nucleotide between hairpin 1 and hairpin 2; e. Nucleotides H2-1, H2-2, H2-3, H2-4, H2-5, H2-6, H 2-7, H2-8, H2-9, H2-10, H2-11, H2-12, H2-13, H2 -14, and H2-15, f. the last four nucleotides at the 3' end of the 3' terminus and 2'-O-M e. an sgRNA comprising or consisting of modified nucleotides.

134. a PS bond linking the first four nucleotides at the 5' end of the 5' terminus and and a PS bond linking the last four nucleotides at the 3' end of the 3' terminus. The sgRNA of any one of claims 129 to 133, further comprising:

135. Modification patterns of SEQ ID NO: 350, 351, 352, or 353 as shown in Table 4 The sgRNA has the following structure:

136. The present invention relates to a method for the preparation of a ribonucleoprotein complex that forms a ribonucleoprotein complex with Cas9 of S. pyogenes. The sgRNA according to any one of claims 129 to 135.

137. crispr RNA (crRNA), The following areas: a. the first 5 nucleotides at the 5' end of the 5' terminus; b. a lower stem region; c. a bulge region; d. the upper stem region; and e. the last 5 nucleotides at the 3' end of the crRNA, and or a plurality of regions of the crRNA, each of which contains one or more modifications.

138. and a 5' end modification, the 5' end modification being at the 5' end of the 5' terminus. containing one or more phosphorothioate linkages within the first seven nucleotides of claim 136. The crRNA according to claim 136.

139. and a 5' end modification, the 5' end modification being at the 5' end of the 5' terminus. containing at least two phosphorothioate linkages within the first seven nucleotides of claim 136. The crRNA according to claim 136.

140. At least one modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide. The crRNA described in any one of claims 137 to 139.

141. At least one modification comprises a 2'-fluoro (2'-F) modified nucleotide.

141. The crRNA according to any one of claims 137 to 140.

142. At least one modification comprises an internucleotide phosphorothioate (PS) bond. The crRNA described in any one of claims 137 to 141.

143. The first three nucleotides at the 5' end of the 5' terminus and the first three nucleotides at the 3' end of the Claims 137-14, wherein the last three nucleotides at the 3' end are modified 3. The crRNA according to any one of claims 2 to 3.

144. the first four nucleotides at the 5' end of the 5' terminus, and the 3' terminus The last four nucleotides at the 3' end of The crRNA of any one of claims 137 to 143, wherein the crRNA is linked by more than one amino acid.

145. The crRNA of claim 143, wherein the modification comprises 2'-O-Me.

146. The crRNA of claim 143, wherein the modification comprises 2'-F.

147. The first four nucleotides at the 5' end of the 5' terminus and the first four nucleotides at the 3' end of the the last four nucleotides at the 3' end are linked by PS bonds; and the first three nucleotides at the 5' end and before the 3' end of the 5' end 13. The method of claim 12, wherein the last three nucleotides at the 3' end contain 2'-O-Me modifications. 7 to 146. A crRNA according to any one of claims 7 to 146.

148. The first four nucleotides at the 5' end of the 5' terminus and the first four nucleotides at the 3' end of the the last four nucleotides at the 3' end are linked by PS bonds; and the first three nucleotides at the 5' end and before the 3' end of the 5' end The last three nucleotides at the 3' end contain 2'-F modifications.

46. ​​The crRNA of any one of claims 46.

149. Any of claims 137 to 148, wherein LS1 and LS6 are modified with 2'-O-Me. The crRNA described in any one of claims 1 to 5.

150. Each of the nucleotides in the upper stem region is modified with 2'-O-Me.

150. The crRNA according to any one of clauses 137 to 149.

151. crispr RNA (crRNA), a. LS1 and LS6 in the lower stem region; b. each nucleotide in the upper stem region and CrRNA,

152. Three phosphorothioates linking the first four nucleotides at the 5' end of the 5' terminus P-terminal ester (PS) bond and the last four nucleotides at the 3' end of the 3' terminus The crRNA of claim 151, further comprising three PS bonds.

153. 2'-O-M in the first three nucleotides at the 5' end of the 5' terminus at the 3' end of said 3' terminus, 2'-O-Me or 2'-F modified nucleotides in the last three nucleotides The crRNA of claim 151 or claim 152, further comprising:

154. LS1, LS2, and LS6 are modified with 2'-F according to claims 137 to 153. The crRNA described in any one of claims 1 to 5.

155. Claims 137-15, wherein each nucleotide in the bulge region is modified with 2'-F 5. The crRNA according to any one of claims 4 to 4.

156. crispr RNA (crRNA), a. LS1, LS2, and LS6 in the lower stem region; b. each nucleotide in the bulge region and rRNA.

157. The 5' terminus is joined to three phosphodiesterases linking the first four nucleotides at the 5' end. A holothioate (PS) bond and the last four nucleotides at the 3' end of the 3' terminus Any one of claims 137 to 156, further comprising three PS bonds linking the nucleotides. The crRNA described in item .

158. 2'-O-M in the first three nucleotides at the 5' end of the 5' terminus at the 3' end of said 3' terminus, 2'-O-Me or 2'-F modified nucleotides in the last three nucleotides The crRNA of any one of claims 137 to 157, further comprising:

159. A crRNA comprising any one of SEQ ID NOs: 1-187, including modifications in Table 4.

160. SEQ ID NOs: 19-31, 53-73, 104-130, and 161- 187. A crRNA comprising any one of the following:

161. Any of SEQ ID NOs: 19-31, 53-73, 104-130, and 161-187 At least 99, 98, 97, 96, 95, 94, 93, 92, 91 for any one of them , 90, 85, 80, 75, or 70% identity to a reference sequence in Table 4. The modifications at each nucleotide of the crRNA corresponding to the nucleotide in the sequence identifier are shown in Table 4. The crRNA has a modification identical or equivalent to the modification shown in the reference sequence identifier in the

162. The 5' terminus is joined to three phosphodiesterases linking the first four nucleotides at the 5' end. A holothioate (PS) bond and the last four nucleotides at the 3' end of the 3' terminus Any one of claims 159 to 161, further comprising three PS bonds linking the nucleotides. The crRNA described in item .

163. The crRNA combined with the trRNA is Ca of S. pyogenes. The method according to any one of claims 137 to 162, which forms a ribonucleoprotein complex with s9. of crRNA.

164. tracr RNA (trRNA), The following areas: a. the first 5 nucleotides at the 5' end of the 5' terminus; b. an upper stem region; c. a bulge region; d. a lower stem region; e. A nexus area; f. the hairpin 1 region; g. a hairpin 2 region; h. the last 5 nucleotides at the 3' end of the 3' terminus, and one or more of A trRNA comprising one or more modifications within a number of regions.

165. At least one modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide.

165. The trRNA of claim 164.

166. At least one modification comprises a 2'-fluoro (2'-F) modified nucleotide. 164 or claim 165. A trRNA according to claim 164 or claim 165.

167. At least one modification comprises an internucleotide phosphorothioate (PS) bond. The trRNA according to any one of claims 164 to 166.

168. the first four nucleotides at the 5' end of the 5' terminus, and the 3' terminus The last four nucleotides at the 3' end of The trRNA according to any one of claims 164 to 167, wherein the trRNA is linked by more than one amino acid.

169. The first three nucleotides at the 5' end of the 5' terminus and the first three nucleotides at the 3' end of the The last three nucleotides at the 3' end are modified.

9. A trRNA according to any one of claims 8 to 8.

170. The trRNA of claim 169, wherein the modification comprises 2'-O-Me.

171. The trRNA of claim 169, wherein the modification comprises 2'-F.

172. The first four nucleotides at the 5' end of the 5' terminus and the first four nucleotides at the 3' end of the the last four nucleotides at the 3' end are linked by PS bonds; and the first three nucleotides at the 5' end and before the 3' end of the 5' end 17. The method of claim 16, wherein the last three nucleotides at the 3' end contain 2'-O-Me modifications.

4. A trRNA according to any one of claims 1 to 171.

173. The first four nucleotides at the 5' end of the 5' terminus and the first four nucleotides at the 3' end of the the last four nucleotides at the 3' end are linked by PS bonds; and the first three nucleotides at the 5' end and before the 3' end of the 5' end The last three nucleotides at the 3' end contain 2'-F modifications.

72. A trRNA according to any one of claims 71.

174. 1, wherein each nucleotide in the upper stem region is modified with 2'-O-Me. A trRNA according to any one of claims 64 to 173.

175. 164. The compound according to claim 164, wherein B1 and B2 in the bulge region are modified with 2'-O-Me.

175. A trRNA according to any one of claims 1 to 174.

176. N3, N4, N5, N15, N16, N17, and / or N 18 is modified with 2'-O-Me according to any one of claims 164 to 175. trRNA.

177. 1. The method of claim 1, wherein each nucleotide in the hairpin 1 region is modified with 2'-O-Me. A trRNA according to any one of claims 64 to 176.

178. 1, wherein each nucleotide in the hairpin 2 region is modified with 2'-O-Me. A trRNA according to any one of claims 64 to 177.

179. tracr RNA (trRNA), a. each nucleotide in the upper stem, b. B1 and / or B2 in the bulge region; c. N3, N4, N5, N15, N16, N17, and / or N 18 and d. each nucleotide in the Hairpin 1 region; and e. Each nucleotide in the hairpin 2 region and A trRNA comprising:

180. Three phosphorothioates linking the first four nucleotides at the 5' end of the 5' terminus P-terminal ester (PS) bond and the last four nucleotides at the 3' end of the 3' terminus The trRNA of claim 179, further comprising three PS bonds.

181. 2'-O-M in the first three nucleotides at the 5' end of the 5' terminus at the 3' end of said 3' terminus, In addition, the 2'-O-Me or 2'-F modified nucleic acid is The trRNA of claim 179 or claim 180, comprising:

182. N15, N16, N17, and N18 are modified with 2'-F.

181. A trRNA according to any one of claims 181.

183. LS1, LS3, and LS5 are modified with 2'-F, and LS2, LS4, and and LS6 is modified with 2'-O-Me, The trRNA described herein.

184. The 5' terminus is joined to three phosphodiesterases linking the first four nucleotides at the 5' end. A holothioate (PS) bond and the last four nucleotides at the 3' end of the 3' terminus Any one of claims 164 to 183, further comprising three PS bonds linking the nucleotides. The trRNA according to claim 5.

185. 2'-O-M in the first three nucleotides at the 5' end of the 5' terminus at the 3' end of said 3' terminus, 2'-O-Me or 2'-F modified nucleotides in the last three nucleotides The trRNA of any one of claims 164 to 184, further comprising:

186. A trRNA comprising any one of SEQ ID NOs: 188-227, including the modifications in Table 4.

187. At least 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 85, 80, 75, or 70% identity Each of the trRNAs corresponding to the nucleotides of the reference sequence identifiers in Table 4 comprises a nucleic acid having the following structure: The modification in the nucleotide is the same as or similar to the modification shown in the reference sequence identifier in Table 4. are equivalent to trRNA.

188. Three phosphorothioates linking the first four nucleotides at the 5' end of the 5' terminus P-terminal ester (PS) bond and the last four nucleotides at the 3' end of the 3' terminus The trR according to any one of claims 186 to 187, further comprising three PS bonds that bind to the N.A.

189. The trRNA combined with the crRNA is Ca of S. pyogenes. The method according to any one of claims 164 to 188, which forms a ribonucleoprotein complex with s9. of trRNA.

190. A dual guide comprising a crRNA and a trRNA, wherein the crRNA is selected from the group consisting of any one of SEQ ID NOs: 1-187 depicted, and the trRNA is A dual guide comprising any one of the nucleic acids of SEQ ID NOs: 188-227 depicted in Do.

191. The crRNA according to any one of claims 137 to 163 and claims 164 to 189 A dual guide comprising the trRNA described in any one of claims 1 to 4.

192. A method comprising the steps of: Hmm, dual guide.

193. A method comprising the steps of: Hmm, dual guide.

194. The present invention relates to a method for the preparation of a ribonucleoprotein complex that forms a ribonucleoprotein complex with Cas9 of S. pyogenes. The dual guide of any one of claims 190 to 193.

195. A LN comprising an sgRNA according to any one of claims 1 to 78 and 129 to 136. P composition.

196. A gRN comprising or consisting of the RNA according to any one of claims 1 to 193. An LNP composition comprising:

197. Any one of claims 1 to 78 and 129 to 136 associated with lipid nanoparticles (LNPs). A composition comprising the sgRNA described in paragraph 1.

198. The chromogen according to any one of claims 137 to 163, associated with a lipid nanoparticle (LNP). A composition comprising RNA.

199. The tr according to any one of claims 164 to 189, associated with a lipid nanoparticle (LNP). A composition comprising RNA.

200. The sgRNA according to any one of claims 1 to 78 and 129 to 136, The gRNA according to any one of claims 79 to 128, any one of claims 137 to 163 The crRNA according to any one of claims 164 to 189, A. The dgRNA according to any one of claims 190 to 194, or claim 195. 200, comprising the composition according to any one of claims 1 to 199, The composition further comprises an mRNA encoding the enzyme.

201. The composition of claim 200, wherein the nuclease is a Cas protein.

202. The composition of claim 201, wherein the Cas protein is Cas9.

203. The method of claim 202, wherein the Cas9 is a Cas9 of S. pyogenes. The composition described above.

204. 204. The method according to any one of claims 200 to 203, wherein the nuclease is a nickase. composition.

205. The composition according to any one of claims 200 to 204, wherein the nuclease is modified. Composition.

206. 206. The method of claim 205, wherein the modified nuclease comprises a nuclear localization signal (NLS). The composition described.

207. Any one of claims 200 to 206, comprising an mRNA encoding the nuclease. The composition described in

208. sgRNA according to any one of claims 1 to 78 and 129 to 136, claim 79 A gRNA according to any one of claims 137 to 163. The crRNA of any one of claims 164 to 189, the trRNA of claim 190 dgRNA according to any one of claims 195 to 207, or Item 14. A pharmaceutical formulation comprising the composition described in item 14 and a pharma- ceutical acceptable carrier.

209. 1. A method for modifying a target DNA, comprising: A Cas protein or a nucleic acid encoding a Cas protein and: a. the sgRNA of any one of claims 1 to 78 and 129 to 136; b. a gRNA according to any one of claims 79 to 128; c. the crRNA of any one of claims 137 to 163; d. the trRNA according to any one of claims 164 to 189; e. a dgRNA according to any one of claims 190 to 194; f. the composition of any one of claims 195 to 207; or g. Any one or more of the pharmaceutical formulations of claim 208. The method includes:

210. 210. The method of claim 209, which results in an insertion or deletion in the gene.

211. The method further comprises delivering a template to the cell, wherein at least a portion of the template is of the target DNA at or near the site of a double-stranded break induced by the protein. The method of claim 209, wherein the

212. Claims 1 to 78 for use in the preparation of a medicament for treating a disease or disorder. and the sgRNA of any one of 129 to 136.

213. Claims 737 to 739 for use in the preparation of a medicament for treating a disease or disorder.

163. The crRNA according to any one of claims 163.

214. Claims 164 to 168 for use in the preparation of a medicament for treating a disease or disorder.

189. The trRNA of any one of claims 189.

215. For use in the preparation of a medicament for treating a disease or disorder, Any one of claims 137 to 163 in combination with a trRNA according to any one of claims 189. The crRNA described in any one of claims 1 to 5.

216. A compound according to claim 208 for use in the preparation of a medicament for treating a disease or disorder. The pharmaceutical formulation described herein.

Images