Site-specific gene modification

Abstract

The present invention provides systems, compositions and methods for targeted site-specific insertion of a transgene of interest into the genome of a subject, including systems and methods that facilitate site-specific insertion of a transgene by retroelement-derived reverse transcriptase (RT)-mediated target primed reverse transcription (TPRT).

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Application No. 63 / 137,664, entitled "Site-Specific Gene Transfer into Eukaryotic Genomes Using an RNA Template and Associated Reverse Transcriptase," filed January 14, 2021, the contents of which are incorporated herein by reference in their entirety.

[0002] Sequence Listing Reference This application has been filed with an electronic Sequence Listing, which was created on December 28, 2021 under the file name SeqList.txt and has a file size of 180,293 bytes. The information set forth in the electronic Sequence Listing is incorporated herein by reference in its entirety.

[0003] Government Support Statement This invention was made with United States Government support under Grant Nos. GM130315 and DP1HL156819 awarded by the National Institutes of Health. The United States Government has certain rights in the invention.

[0004] The present disclosure provides compositions, methods and / or uses of engineered proteins and polynucleotides for inserting a transgene into a subject's genome by target primed reverse transcription (TPRT) using non-long terminal repeat (non-LTR) retrotransposons. [Background technology]

[0005] The insertion of transgenes or gene fragments into DNA is a powerful tool that may radically improve the health and well-being of people with various genetic disorders. It may also be transformative in the fields of science, biotechnology and research. The introduction of transgenes into eukaryotic genomes, such as the human genome, is expected to enable the treatment of a wide range of pathologies and diseases, with or without a genetic component. The introduction or insertion of transgenes allows for the improvement, correction and / or modification of gene expression, while also helping to treat diseases and improve disease symptoms by adding deleted or corrected sequences to the genome. There are many genetic problems that could be treated by the insertion of transgenes, and if transgenes can actually be inserted, it is expected that useful results different from knockout, mutation or correction of endogenous gene sequences can be obtained, such as restoration of loss of function, exogenous control of RNA expression or protein expression, specificity of isoform expression, and expression of modified genes or modified proteins.

[0006] However, methods for introducing DNA into cells and integrating it into the genome have significant hurdles to overcome. For example, it is well known that some DNA introduced into the cytoplasm of eukaryotic cells by DNA delivery can induce destructive immune responses or cause harmful changes to the cell or organism. In addition, site-specific integration, where DNA is introduced into the genome by homologous recombination (HR), inevitably introduces genetically and epigenetically mutagenic double-stranded DNA and breaks at the integration site. Furthermore, in higher eukaryotes, DNA integration is often nonspecific, especially in postmitotic cells. This is because HR is suppressed during most of the cell cycle in favor of nonhomologous end joining (NHEJ).

[0007] Although the use of viral vectors for DNA delivery promises improved delivery and reduced toxicity, such expression vectors may not replicate accurately during cell division and / or may induce unacceptable or ineffective levels of semi-random integration or innate immune responses. In addition, there are limitations to the length of DNA (size of transgene) that can be delivered by viral vectors such as adeno-associated virus (AAV).

[0008] Therefore, if it were possible to efficiently and precisely insert transgenes into the genome of living cells, such as the human genome, without relying on a method for introducing transgene DNA into the cytoplasm, and with a method that is flexible in terms of the length of the introduced DNA, this would be a major contribution to human, animal, and plant biology, and would lead to powerful advances in research and clinical applications.

[0009] One approach to solving the need for transgene insertion into living cells is to introduce the transgene sequence as RNA and use it as a template for complementary DNA (cDNA) synthesis by reverse transcriptase (RT). However, to date, no molecular signals have been identified that direct RNA introduced into mammalian cells as a template for transgene insertion into the genome to be copied into sequence-defined safe harbor target sites.

[0010] To address the lack of such molecular signals in mammalian cells, a group of genes known as non-long terminal repeat (non-LTR) retroelements (REs) or, synonymously, non-LTR retrotransposons, offer a promising solution. These genes can self-amplify in the host genome by expressing the non-LTR retrotransposon RT protein (nrRT), which binds to its own retroelement transcript RNA and uses it as a template and a nick introduced into the genomic DNA by the catalytic action of the retroelement EN protein as a primer for the initiation of cDNA synthesis (RT primer extension). This process, known as target-primed reverse transcription (TPRT), generates new copies of double-stranded DNA retroelements in the genome.

[0011] The TPRT process is thought to involve (1) the nrRT protein domain binding to the DNA sequence at the target site, (2) the endonuclease (EN) domain of nrRT introducing a nick into the bottom strand of the target site to provide a primer for reverse transcription, (3) bottom strand cDNA synthesis by the nrRT RT domain, (4) introduction of a nick into the top strand of the target site, and (5) subsequent synthesis of the second strand. Synthesis of the second strand is thought to be performed by reverse transcriptase and / or intracellular polymerases. TPRT has the advantage that no double-stranded DNA cleavage occurs and no HR is required. Furthermore, unlike other genome editing methods, the insertion mechanism does not require DNA replication or cell division.

[0012] Mechanistically, the evolutionary success of RT proteins encoded by non-LTR retrotransposons as selfish transposable elements in the genomes of their evolving hosts requires that they preferentially bind and use their own retroelement RNA transcripts as templates, rather than host cell RNA or other retroelement RNAs. Closely related but distinct lineages of non-LTR retrotransposons are known to grow independently within the same genome, suggesting that at least some elements have high specificity in the function of their template RNA and cognate nrRT. Furthermore, many copies of non-LTR retroelements are transcribed despite being non-functional, suggesting that the evolutionary success of RTs requires that they preferentially recognize the exact same RNA molecules that were used to translate functional proteins. This phenomenon is called "cis-preference" because RT proteins bind to the RNA molecules that were used to translate them. Although the cis-preference of nrRTs, in which nrRTs bind to and copy their own mRNAs, has been reported in the literature, the fundamental requirements for the rebinding of the mRNA-encoded protein product to the mRNA molecule that encodes it remain unknown. It is also unclear what factors determine whether retroelement insertion results in insertion of the full-length element or various truncations at the 5' end.

[0013] Some nrRTs have relaxed RNA template recognition requirements, such as the RT proteins encoded by the two-ORF human LINE-1 retroelements, which can insert cDNA copied from RNA transcripts of short interspersed elemental sequences (SINEs) throughout the human genome.

[0014] Some non-LTR retrotransposons are site-specific, i.e., they insert into specific target loci in the genome. Eukaryotic site-specific retroelements usually insert into multicopy loci that code for essential RNAs that are ubiquitously expressed. For example, R elements insert into loci that code for large rRNAs transcribed by RNAP I. The R2 RT inserts cDNA into a region of the 28S rRNA that is highly conserved during eukaryotic evolution.

[0015] Curiously, no site-specific non-LTR retroelements have been found in mammals. If heterologous R elements could be introduced into and transposed within human cells, it would be expected that the ribonucleoprotein (RNP) complex consisting of nrRT and retroelement RNA would be able to find target sites that are unchanged or minimally changed in sequence and that are not occupied by endogenous retroelements in the host cell. R element rRNA gene (rDNA) target sites are present in each of the hundreds of rDNA loci present in each human cell. Because these target sites are repetitive loci, disruption of a few target sites will not have adverse effects. In fact, some Drosophila lineages have retroelement insertions in more than 50% of rDNA loci. However, the structure and function of non-LTR retroelements are currently poorly understood, and few functional components of wild-type proteins have been characterized or synthesized.

[0016] The prototype non-LTR retroelement has a structure with one open reading frame (ORF) between the 5' untranslated region (5'UTR) and the 3' untranslated region (3'UTR). For example, the R2 non-LTR retroelement has one ORF that produces a multidomain protein that binds to an RNA template and a DNA target site sequence, introduces a nick into one of the target site DNA strands with its endonuclease domain, and exerts RT activity by using the 3' hydroxyl group (OH) of the introduced nick as a primer for TPRT. The R2 retroelement UTR does not have a conserved secondary structure or sequence motif, and its length and sequence vary greatly depending on the organism. The domain structure of the nrRT protein is also diverse (Figure 1). Elements of the D clade subgroup of R2 (e.g., D2 clade elements of R2 in Bombyx mori and D5 clade elements of R2 in Drosophila species) usually have one N-terminal zinc finger (ZF), whereas elements of the A clade subgroup of R2 (e.g., A3 clade elements of R2 in L. polyphemus and O. latipes) usually have three ZFs. Some other R2 clade and R2-like non-LTR retroelements have two or no ZFs. Many single-ORF non-LTR retroelements have high specificity to insert into a single sequence in the genome of the host organism, which may contribute to their avirulence, allowing their long-term evolutionary survival and lineage diversification. There is also another class of non-LTR retroelements with two ORFs, in which the ORF2 protein is catalytic and the "other" ORF1 protein is thought to bind nucleic acid and assist the association, localization and / or function of the ORF2 protein. Two-ORF non-LTR retroelements encode an ORF2 protein with RT activity and another type of endonuclease domain (APE-EN), which is located N-terminally rather than C-terminally to the RT domain.Two-ORF non-LTR retroelements rarely act in a site-specific manner in the insertion of new element copies via TPRT.

[0017] Numerous studies have shown that most copies of retroelements present in eukaryotic genomes have lost transposition activity. For example, less than 1% of copies of the human non-LTR retroelement LINE-1 are active. This is either the inevitable result of spontaneous mutations and / or the result of host selection for retroelements with high transposition activity. Little is known about the structure and structure-function relationships of non-LTR retroelements. In fact, the function of not all regions of the non-LTR RT protein is known. This situation makes it difficult, if not impossible, to identify active copies of non-LTR retroelements based on their sequence.

[0018] Although attempts have been made to modify non-LTR structures to insert transgenes, this has been complicated by the fact that the protein synthesis start site for the protein encoded by the non-LTR retroelement may be unconventionally determined (i.e., may not have a known start codon) and may not be predictable from the RNA sequence. Furthermore, many non-LTR retroelements, such as R1 and R2 retroelements, do not appear to have the internal promoters typically found in LTR retroelements for synthesis of the retroelement transcript. Instead, the ORFs used for protein translation are contained within the transcripts of host cell polymerases that are unconventionally processed and unconventionally translated. For example, in the case of R2 elements, the RNA to be translated must be a processed version of a non-translated precursor transcript encoding ribosomal RNA (rRNA) synthesized by RNA polymerase I (RNAP I). The retroelement RNA sequence to be translated does not have the typical modifications, such as the 5' methylguanosine cap of RNAP II mRNA, or the long polyadenosine tail added post-transcriptionally. These two are believed to be essential for the translation of mRNA in almost all host cells. In addition, translation of non-LTR retroelement transcripts may not use a methionine initiation codon at all. In fact, some non-LTR retroelements (e.g., R2 elements in some species) do not have an in-frame methionine codon upstream of the ORF region that codes for the conserved protein motif. Therefore, the DNA sequence of a non-LTR retroelement may not be able to fully predict the sequence of a biologically active nrRT protein.

[0019] The cellular processes of non-LTRs are poorly understood, making it difficult to know which elements are active, and even more difficult to predict activity in heterologous cells. Many cellular processes and intracellular factors complicate this understanding. It is not clear how the heterologous RT protein and / or the heterologous template RNA move through known or unknown cellular compartments during the formation and maturation of ribonucleoproteins (RNPs). The chromatin at the target site may also be different. Furthermore, the requirements for protein, RNA and RNP stability in the cytoplasm, nucleus and nucleolus of heterologous cells may be different. The binding specificity of RT to the desired template RNA depends not only on the affinity of the RT itself, but also on the binding of competing molecules. Also, the transcriptome differs from organism to organism, and even from cell to cell. Furthermore, slight differences in the sequence of the target site may lead to unexpected results in the insertion of heterologous retroelements in heterologous cells, especially in a heterologous environment. For example, BLAST analysis of 28S rDNA target sites in L. polyphemus, S. mansoni, C. intestinales, D. rerio, T. castaneum, and D. melanogaster revealed highly conserved regions as well as small but potentially influential sequence differences.

[0020] Although it would be useful to search for potential RT proteins across a wide range of species for previously isolated or described proteins, only a limited number of assays have been reported for the ability of site-specific nrRT to synthesize cDNA at genomic DNA nicks, and all of these should be interpreted with caution. There are many caveats when using DNA plasmids to express transgene template RNA in cellular assays. Such assays do not provide conclusive evidence that the transgene sequence appearing in the genome is due to TPRT rather than synthesis or recombination using plasmid DNA as a template. To add further confusion, studies reported prior to this disclosure confirmed that introduction of nicks at target sites by nrRT facilitates DNA-dependent transgene insertion. There have also been contradictory results reported in which proteins that should not have endonuclease activity, designed based on published studies or modeling of active site residues, retained nicking activity. This is not unexpected given the paucity of information known about the mechanism of nrRT endonuclease.

[0021] A key point in understanding the limitations of previously published studies and how they differ from the findings herein is that PCR reactions that amplify regions shared between two separate DNA molecules are prone to false-positive results due to artifacts. For example, PCR using a reverse primer in the rDNA flanking the target site and a forward primer in the retroelement template DNA plasmid can result in collateral junctions between the host chromosome and the plasmid DNA due to annealing and extension of the two linear amplification products (Figure 2). A propensity for false-positive artifacts has been demonstrated in human LINE-1 transposition activity assays, and studies prior to the examples described herein have erroneously reported that transgenes had been inserted by nrRT of R2 in human cells due to such false-positive PCR products. The likelihood of a false-positive PCR product increases in proportion to the length of the DNA strand shared between the template expression plasmid and the genome.

[0022] False positives in confirming stable transgene insertion also occur when second strand synthesis is not successful after TPRT first strand cDNA synthesis. PCR that only detects the 3' insertion junction with rDNA may not be able to prove or confirm that the transgene has been fully integrated, since only first strand cDNA synthesis may have occurred (Figure 2). To prove that the transgene has been fully integrated, a PCR assay of the 5' insertion junction is required. In general, previous transgene insertion assays in the art have not provided a PCR product that can prove that the 5' insertion junction has been detected, although the 3' insertion junction is easily detectable (see Su Y, Nichuguti N, Kuroki-Kami A, Fujiwara H. RNA 2019, an example of a false positive PCR result). The absence of detection of the 5' insertion junction may suggest that TPRT has been performed but that the transgene has not been integrated and / or that the upstream target DNA has been lost from the genome in an uncontrolled manner. Thus, the prior art methods are incomplete and lack a reliable confirmation step to prove that the transgene insertion by TPRT has been correctly performed.

[0023] In addition to the possibility of false positive artifacts and insufficient evidence of 5' insertion junction formation, few reported transgene insertion assays using TPRT have resulted in insertion of the full-length transgene sequence. Of course, to be useful as a transgene insertion method, insertion of the entire transgene cassette of interest, as confirmed by the size and sequence of the 5' insertion junction, is required.

[0024] Further hindering our understanding of non-LTR structure and processes is the fact that the only site-specific nrRT purified for biochemical assays of protein-RNA-DNA interactions and RT activity was the Bombyx mori (i.e., silkworm) R2 protein, and only bacterially produced recombinant Bombyx mori protein was used for the assays. Biochemical studies over the first decade or more utilized this protein, which was thought to be purified, but was later found to bind to an RNA approximately 350 nt from the 5' region of the element ORF (Figure 1). The tightly bound RNA completely alters the DNA interaction site of the protein, making the basic understanding established at that time, and all subsequent studies, erroneous or at least highly misleading.

[0025] Methods to resolve these errors, elucidation of the mechanisms and appropriate use thereof are provided herein. One method of utilizing the structure and process of wild-type non-LTR retrotransposons is proposed to modify them to deliver the RT protein or a sequence encoding the RT protein from a retroelement and a template containing the desired transgene for cDNA synthesis by the RT.

[0026] Various examples known in the art show that the use of recombinant DNA or modified synthetic mRNA to recruit functional proteins to cells and the direct introduction of proteins are interchangeable. Also well known are the signals contained in the introduced DNA expression vectors or modified synthetic mRNAs that induce and regulate the production of proteins. The choice of these delivery methods is determined case by case, depending on a variety of factors, including but not limited to convenience, the type of cell or tissue of interest, and efficacy and approval in clinical applications. As such precedents, the introduction of functional Cas9 protein into cells using DNA expression vectors, purified mRNA or purified protein delivery modes has been established, including but not limited to these examples. Without wishing to be bound by any particular theory, it is believed that Cas9 works in conjunction with small non-coding RNAs that can be expressed from DNA plasmids or directly introduced as RNA due to their small size, intact RNA folding, and protection by tightly bound Cas9 protein.

[0027] To clarify the difference between nrRT-mediated TPRT- and Cas9-mediated transgene insertion, the very large transgene template RNA used by TPRT is folded differently depending on the transgene payload, and almost the entire length of the RNA template is not protected by the interaction with nrRT, which is different from the Cas protein system. Furthermore, without wishing to be bound by a particular theory, it is believed that the function of the Cas9-binding RNA is to statically base-pair with the target DNA, whereas the nrRT template RNA has very dynamic requirements to function as a template for transgene synthesis. For example, the nrRT template RNA must continue to pass through the RT active site from or near its 3' end throughout the entire length of the transgene payload, and its template function must continue even after the RNA loses its specific binding to nrRT by conversion of the 3'-side module of the single-stranded RNA template to a cDNA duplex. Summary of the Invention [Means for solving the problem]

[0028] The present disclosure provides methods for introducing transgenes that involve the site-specific addition of the transgene to a eukaryotic genome using an RNA template in conjunction with reverse transcriptase (RT).

[0029] In some embodiments, the method comprises using a modified R2 retroelement protein, whereby TPRT mediated insertion of the transgene into the rDNA of a human cell occurs using a directly introduced RNA template.

[0030] In some embodiments, the method further comprises: R2 retroelement proteins, the R2 / R8 / R9 domain structures of non-LTR-type RT proteins, native proteins or native protein complexes are not excluded; This does not exclude the use of TPRT to target the insertion of transgenes into other species' genomes or to targets other than genomes; Exogenous additions / modifications to the template, such as, but not limited to, additional nucleic acids, nucleic acid-like substances, chemically synthesized moieties, natural or synthetic peptides or lipids, scaffold binding and release capabilities, etc.; and / or "Delivery" or introduction of RNA into cells is not limited to standard methods such as lipid-based transfection or electroporation (which are employed in all examples described herein).

[0031] In some embodiments, the transgene is a therapeutically effective gene.

[0032] In some embodiments, the methods may include using a non-LTR retroelement protein having activity as an RT to enable TPRT and / or as an endonuclease to introduce nicks into the strand, which is active in an RT primer extension assay and / or an in vitro TPRT assay, and may be site-specific.

[0033] In some embodiments, the method may include using one or more 3' template modules for RT-mediated TPRT, which are 3' template modules of the same species as the cooperating RT, modified versions of the same species, obtained by phylogenetic investigation and rearrangement and modification or rearrangement alone of related retroelements, or by screening for selectivity, efficiency and / or fidelity of 3' and 5' bond formation in vitro and in cells.

[0034] In some embodiments, the method may include using one or more 5' template modules for RT-mediated TPRT that are 5' template modules homologous to the cooperating RT, modified from a homologous native form, obtained by phylogenetic investigation and reconstitution and modification or reconstitution alone of related retroelements, modified 5' regions of heterologous retroelements, modified native or engineered HDV RZ fold structures, or obtained by screening for selectivity, efficiency and fidelity of 3' and 5' bond formation in vitro and in cells.

[0035] In some embodiments, the methods may include making one or more additions to the template ends that improve the selectivity, efficiency and / or fidelity of 3' and 5' bond formation in vitro and in cells, including but not limited to, the addition of 5' and 3' flanking sequences of rRNA that match sequences at or near the target site, including but not limited to, the addition of sequences of 4-29 nucleotides, and not excluding the addition of rRNA of other lengths, where a functional 4-20 nucleotide sequence may be present within a longer sequence.

[0036] In some embodiments, the method may include making one or more additions to the template ends that improve biological delivery to a cell, stability within a cell, or efficiency of site-specific transgene insertion in a cell, including, but not limited to, the addition of a 3' flanking polyadenosine motif and / or a 5' flanking self-cleaving ribozyme motif, or other structures that protect the introduced template RNA from degradation.

[0037] In some embodiments, the methods may include making one or more modifications to the template that improve its delivery, stability, targeting, isolation from interactions, or affect other cellular processes, such as translation, DNA repair, chromatin modification, checkpoint activation, etc.

[0038] In some embodiments, the method may include using one or more transgenes that are inserted into the 28S rDNA of the human cell and functionally expressed. In some embodiments, the human rDNA is a safe harbor site for successful insertion of a transgene protein expression cassette.

[0039] In some embodiments, the methods may include the use of one or more exogenous transgenes that have been introduced into the RNA template, e.g., to restore a loss of function in a human disease or to confer a beneficial function.

[0040] The present disclosure also provides an element insertion system (EIS) that operates to insert (via an RNA intermediate) a biologically active DNA element into a target site in a target cell, comprising: (a) the nrRT module, which generates active nrRT in target cells; and (b) an insertion template module that serves as a template for synthesis of at least one strand of a biologically active DNA element by the action of nrRT at a target site in said target cell by TPRT; Provide an EIS, including:

[0041] In some embodiments, examples of the nrRT module include, but are not limited to, an active nrRT or a suitable inactive proprotein nrRT, deliverable to said target cell by any suitable delivery system; an mRNA, modified mRNA or other nucleic acid, either processed and translated within the cell or translated without intracellular processing, that encodes an nrRT, an nrRT proprotein or other that is capable of inducing an active nrRT within the target cell and that can be delivered to the target cell by any suitable delivery system; and A DNA construct or other nucleic acid that can be delivered to the target cell by any suitable delivery system, from which an mRNA is transcribed that results in the synthesis of an active nrRT in the target cell. Examples include:

[0042] In some embodiments, the insertion template module comprises RNA, modified RNA or other nucleic acid that can be delivered to the target cell by any suitable delivery system and used as a template for cDNA synthesis by nrRT to synthesize at least one strand of a biologically active DNA element at a target site in the target cell by TPRT.

[0043] In some embodiments, the insertion template module may include a plurality of segments configured to facilitate efficient and selective use of the insertion template module in TPRT by nrRT, e.g., the 3' segment that is preferentially used by a particular nrRT; the 5' segment that is preferentially used by a particular nrRT; and Payload segments selected for compatibility with TPRT by nrRT and that can be used as templates for cDNA synthesis of biologically active DNA elements It is.

[0044] In some embodiments, a DNA segment of the biologically active DNA element is configured to be inserted into a target site in the target cell, thereby resulting in a desired modification of a biological property of the cell or an organism containing the cell.

[0045] In some embodiments, the nucleic acid sequence is codon optimized.

[0046] In some embodiments, examples of the DNA having the biological activity include: Therapeutic alterations to a cell or group of cells in the human body; Desirable changes to the characteristics of plants or animals used in agriculture; or Desirable changes to wildlife that result in ecological change, such as the control of invasive species or disease vectors Examples include:

[0047] In some embodiments, the biologically active DNA element optionally comprises: one or more sequence segments that terminate transcription of the element by promoters outside the insertion site; one or more promoter segments that initiate transcription; one or more effector segments encoding one or more proteins or nucleic acids having a biological function; and Other sequence segments may also include

[0048] In some embodiments, the EIS comprises an nrRT module and an insertion template module that have been modified, designed, or specifically tailored to work together efficiently and selectively.

[0049] The present invention includes all combinations of the individual embodiments described herein, all of which are intended to be construed as being herein described. [Brief description of the drawings]

[0050] [Figure 1] Schematic diagram of a representative R2 retroelement. Each unique ORF encodes a protein with a DNA-binding domain (ZF, Myb), a region affecting RNA interaction (RBD), a reverse transcriptase motif (RT), a so-called restriction enzyme-like endonuclease domain (EN), and other conserved modules of unknown function (e.g., zinc knuckle (ZK)). Each component is shown in full-scale from the predicted ORF start (ORFs are shown as thick rectangles, UTRs are shown as elongated rectangles). The region of B. mori R2 RNA that binds tightly and specifically to the R2 protein is shown as BoMo 5' RNA.

[0051] [Diagram 2]FIG. 1 illustrates the potential for artifactual false positive assays when DNA is introduced into cells to generate an RNA transgene template.

[0052] [Diagram 3] Schematic diagram showing example designs of nrRT modules (top) and insertion template modules (bottom). An example non-LTR retroelement is shown between the two module schematics (center). Vertical rough dashed lines indicate example portions of each module derived from portions of the wild-type non-LTR retroelement sequence. Horizontal rough dashed lines represent optional elements. This schematic is not drawn to scale.

[0053] [Figure 4] Schematic diagram of an insertion template module (top) and a close-up of the top insertion template module (bottom) showing various optional elements. This diagram is not drawn to scale. OLS=optional linking sequence. 5'-rRNA=optional 5' flanking rRNA (from the genome of a subject). HDV-RV=optional self-cleaving ribozyme, one of the motifs of Hepatitis Delta virus. 3'-rRNA=optional 3' flanking rRNA (from the genome of a subject). PA=optional short (e.g., 1-25 nt) adenosine stretch. Tags=optional sequence tags and markers.

[0054] [Diagram 5] Analysis of a denaturing PAGE gel. Arrows indicate the expected size of the correct RT product. Lane B contains the reaction product of B. mori nrRT, lane D contains the reaction product of D. simulans nrRT, lane O contains the reaction product of O. latipes nrRT, lane O_RT- contains the reaction product of O. latipes RT with a mutation in an essential reverse transcriptase active site side chain, and lane N contains the reaction product in the absence of enzyme. Each lane is from the same gel.

[0055] [Figure 6A-6B]A shows an example of an experimental design to verify the specificity of nrRT proteins for template constructs with cognate and noncognate R2 element 3'UTRs. B shows spot blot results investigating the selectivity of B. mori, D. simulans, and O. latipes nrRTs for cognate and noncognate 3'UTRs.

[0056] [Figure 7] Denaturing PAGE gel analysis of TPRT reaction products. Arrows indicate the expected size of the correct TPRT product. Lane B contains the reaction products of B. mori nrRT, lane D contains the reaction products of D. simulans nrRT, lane O contains the reaction products of O. latipes nrRT, and lane N contains the reaction products in the absence of enzyme. The gel on the left contains the reaction products of various nrRT proteins with a template containing the O. latipes 3'UTR (lanes labeled "alone") and with a template containing the O. latipes 3'UTR and 4 nt rRNA (lanes labeled "+R4"). The gel on the right contains the reaction products of various nrRT proteins with a template containing the D. simulans 3′UTR (lanes labeled “alone”) and the reaction products of various nrRT proteins with a template containing the D. simulans 3′UTR and 4-nt rRNA (lanes labeled “+R4”).

[0057] [Figure 8] Denaturing PAGE gel analysis of TPRT reaction products of B. mori nrRT and various templates. Arrows indicate the expected size of the correct TPRT product. Circles indicate the length of the product resulting from internal initiation.

[0058] [Figure 9A-9B] This is the result of denaturing PAGE gel analysis of the TPRT reaction products of O. latipes nrRT and various templates.

[0059] [Figure 10]Denaturing PAGE gel analysis of the TPRT reaction products of T. castaneum nrRT and various templates. The lengths of the desired TPRT products are indicated by arrows.

[0060] [Figure 11] The results of inserting a transgene into the 28S rDNA of human cells using the modified nrRT from O. latipes. The schematic on the right shows the primer design used in the first PCR and nested PCR. The image on the left shows the PCR results for the inserted transgene and the 3' junction of the target site rDNA. The expected products are shown in the boxes.

[0061] [Figure 12] The results of inserting a transgene into the 28S rDNA of human cells using the modified nrRT of O. latipes. The top two schematic diagrams show the primer designs used in PCR. The bottom image shows the PCR results for the inserted transgene and the 5' junction of the target site rDNA.

[0062] [Figure 13] Transgene insertion into the 28S rDNA of human cells using the modified nrRT from T. castaneum and the 5' and 3' UTRs of the indicated templates. The correct junction size and sequence of the 3' junction between the transgene and the target rDNA are indicated by a black arrow.

[0063] [Figure 14] Transgene insertion into the 28S rDNA of human cells using the modified nrRT from T. castaneum and the 5' and 3' UTRs of the indicated templates. The correct junction size and sequence of the 5' junction between the target rDNA and the transgene are indicated by a black arrow.

[0064] [Figure 15A-15B]Insertion of a transgene into the 28S rDNA of human cells using modified nrRTs from O. latipes and D. simulans and templates encoding a transgene conferring puromycin resistance. A, Template design and PCR design including the encoded transgene and promoter; in vitro TPRT using a puro transgene expression template containing the OrLa 5'RZ+UTR. Each nrRT was evaluated using a template containing the cognate 3'UTR. B, Transfected cells were serially passaged under puromycin and PCR was performed on the inserted transgene. Arrows indicate the expected length of the PCR product. The nrRT protein and the 3'UTR and downstream rRNA sequences used as templates are indicated above each lane. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0065] I. Introduction The present disclosure provides a system for inserting a transgene into a genome of a subject. The system includes and provides the use of an optionally modified non-long terminal repeat (non-LTR) retroelement reverse transcriptase (nrRT) and a recombinant RNA construct that cooperates therewith. The nrRT has a function of site-specific target primed reverse transcription (TPRT), and the recombinant RNA construct expressed separately from the nrRT is copied into a safe harbor target site defined by a sequence as a template for inserting a transgene. This use enables genome editing of eukaryotic organisms and human gene therapy. In this specification, the term "non-LTR retroelement reverse transcriptase (nrRT)" refers to a protein having reverse transcription activity derived from a non-LTR retroelement.

[0066] As used herein, the terms "safe harbor," "safe harbor site," "safe harbor genomic location," and grammatical equivalents refer to a site in a subject's genome where disruption of the sequence, e.g., by insertion of a heterologous sequence, will not adversely affect the function of the subject's cell. Exemplary safe harbor sites utilized herein include sites in a subject's genome that encode ribosomal RNA (rRNA), specifically sites in the genome that encode 28S rRNA, referred to herein as ribosomal DNA (rDNA).

[0067] In the systems and methods provided herein, the modified RT protein (nrRT) uses the RNA template described above to perform complementary DNA (cDNA) synthesis, which copies the template RNA into cDNA at the target site, resulting in stable insertion of the double-stranded transgene. The cDNA synthesis is primed by the nrRT introducing a nick at the target site. This mechanism of transgene addition allows the insertion and stable inheritance of a DNA sequence of interest into a genome in an unprecedented manner that does not require other genomic DNA at any stage of the process, and does not require DNA integrase, DNA-containing viruses, or HR. Thus, the systems and methods provided herein avoid the induction of immune responses in subjects and genomic mutations that occur due to the undesirable utilization of the introduced DNA, as seen in non-homologous DNA break repair.

[0068] Furthermore, in the system provided herein, because the transgene is inserted using RT expressed separately from the template RNA and the directly introduced template RNA, modifications to the RNA template molecule can be both sequence modifications (e.g., the inserted transgene does not need to contain the nrRT protein ORF) and modifications of nucleotide or non-nucleotide composition (e.g., the RNA template molecule can use a wide variety of chemical groups). Examples of modifications are provided herein, such as modifications that improve biological stability, modifications that reduce toxicity, and modifications that target the introduced RNA to the co-introduced RT. Also provided are RNAs with desired folding structures or properties for selective purification to increase the homogeneity of the template RNA pool.

[0069] II. Element Insertion System Provided herein is an element insertion system (EIS). As used herein, the term "element insertion system" refers to a system of components (modules) used to insert a gene sequence (transgene) into a specific location in the genome of a subject by TPRT (Figure 3). The EIS described herein uses a modified site-specific nrRT protein that binds to a 3' module of a cooperating template and uses the bound template to perform TPRT on rDNA of human cells. The template is expressed separately from the modified nrRT protein. As used herein, the term "cooperating template" refers to an RNA construct that is delivered and used with the nrRT protein to effect cDNA synthesis by the nrRT protein. The transgene RNA template for RT can be designed independently, so that the RT and template are expressed and delivered separately.

[0070] The EIS described herein may include a variety of modules (FIG. 3). In some embodiments, the EIS includes at least one nrRT module. In some embodiments, the EIS includes at least one insertion template module. In some embodiments, the EIS includes at least one nrRT module and at least one insertion template module.

[0071] nrRT Module The element insertion system described herein comprises at least one nrRT module, which comprises or encodes an active nrRT protein. As used herein, the term "nrRT module" refers to a biopolymer construct that comprises or encodes at least one nrRT.

[0072] The nrRT module includes at least one component that generates an active nrRT in the target cell. In some embodiments, the nrRT module may include an active nrRT or a suitable inactive proprotein nrRT that can be delivered to the target cell by any suitable delivery system. In some embodiments, the nrRT module may include an mRNA, modified mRNA, or other nucleic acid that is translated with or without intracellular processing. These nucleic acids encode nrRT or nrRT proprotein and can be delivered to the target cell by any suitable delivery system. In some embodiments, the nrRT module includes a DNA construct or other nucleic acid that transcribes an mRNA that synthesizes an active nrRT in the target cell, and the DNA construct or other nucleic acid can be delivered to the target cell by any suitable delivery system.

[0073] In some embodiments, the nrRT module includes at least one RT protein or encodes at least one RT protein. In some embodiments, the RT protein may be a non-LTR RT protein. In some embodiments, the non-LTR RT protein may be a non-LTR R2 RT protein from Bombyx mori, Drosophila simulans, Tribolium castaneum, or Oryzias latipes. In some embodiments, the RT protein may be modified. In some embodiments, the RT protein may be a protein shown in any one of SEQ ID NOs: 1 to 4, including but not limited to the following.

[0074] In some embodiments, the nrRT module may include a polynucleotide encoding at least one RT protein. In some embodiments, the nrRT module includes a polynucleotide encoding any one of the proteins set forth in SEQ ID NOs: 1 to 4.

[0075] In general, the RT that copies the introduced RNA into cDNA as a template can be provided in the manner that best suits the application, for example, as a protein, as an mRNA, or as a DNA vector that expresses an mRNA or protein. The examples provided herein use an RT expressed from a plasmid vector, but one of skill in the art will of course easily relate this approach to alternative approaches of introducing the RT as purified mRNA or purified protein.

[0076] In some embodiments, nrRTs with high template selectivity are useful. In general, when a template is provided as purified RNA to a site-specific nrRT protein expressed separately from the template, the extent to which the site-specific nrRT protein has functional specificity to bind and copy only the template of interest is unknown from sequence information alone. Without wishing to be bound by a particular theory, it is believed that the lack of specificity for the use of template RNA is related to the fact that the interaction of protein and RNA in this case is different from that of endogenous retroelements. In general, it is known that nrRT proteins of endogenous retroelements have a cis preference to bind to their own mRNA, which is present at a very high local concentration.

[0077] While many of the candidate site-specific nrRT proteins are inactive in the minimal primer extension RT activity assay, some are not, such as the nrRT proteins modified from the genomic sequences of B. mori, D. simulans, and O. latipes, as well as several other nrRT proteins. The only nrRT protein that has been recombinantly expressed in bacteria and purified and assayed to date to have biochemical activity is the B. mori R2 ("BoMo") RT. In some embodiments, screens may identify modified nrRT proteins in inactive and active forms that cannot be simply predicted from the primary sequence alone.

[0078] TPRT activity assay In some embodiments, a candidate nrRT protein may be tested for TPRT activity. In some embodiments, an assay for TPRT activity may include (i) transfecting a cell population with an expression plasmid encoding an nrRT protein with a suitable tag for affinity purification (e.g., a FLAG tag), (ii) lysing the cell population and recovering and purifying the expressed protein product by any suitable method known in the art, (iii) preparing a recombinant template RNA by any method known in the art (e.g., T7 RNA polymerase), (iv) combining the purified nrRT protein, the recombinant template, and a nucleotide solution containing a target site oligonucleotide duplex DNA with a terminally radiolabeled bottom strand in a medium that promotes reverse transcription by the nrRT, and (v) recovering and analyzing the product by any suitable method known in the art (e.g., denaturing PAGE).

[0079] Insert Mold Module The element insertion system (EIS) described herein comprises at least one insertion template module. As used herein, the terms "insertion template module" and "template module" refer to an RNA construct that serves as an RNA template for the nrRT protein. The insertion template module itself is composed of multiple modules (Figures 3 and 4). The multiple modules may include a transgene sequence for insertion into the target genome (i.e., a payload module) and / or modules that affect the interaction of the insertion template module with the genome of interest or the nrRT protein component of the EIS (5' and 3' modules). In general, the 5' and 3' modules do not limit the length or sequence of the transgene located therebetween.

[0080] In some embodiments, the insertion template module comprises at least one 5' module. In some embodiments, the insertion template module comprises at least one 3' module. In some embodiments, the insertion template module comprises at least one payload module. In some embodiments, the insertion template module comprises at least one 5' module, at least one payload module, and at least one 3' module.

[0081] In some embodiments, these modules are designed to have useful functions, such as protecting the template RNA introduced into the cell from damage, specifically binding and activating the associated modified nrRT, promoting full-length first strand cDNA synthesis, promoting second strand synthesis to allow stable insertion of the transgene, etc. One of skill in the art will appreciate that each property conferred by the 5' transgene template module and / or the 3' transgene template module is independently useful.

[0082] Without wishing to be bound by theory, it is believed that an important feature of the 5' and / or 3' template RNA modules is that they can be chemically and enzymatically modified to improve cellular delivery, localization, stability, tissue-selective uptake or function, and other endpoints that may be desired in research or clinical applications. Modifications of RNA that contribute to such endpoints are useful, for example, for developing or improving clinically useful mRNA vaccines and for delivering microRNAs, antisense RNAs, Cas9 guide RNAs, and mRNAs.

[0083] In some embodiments, modification of the 5' and / or 3' template RNA modules can be performed on a pre-made full length template RNA and / or by standard methods such as ligation.

[0084] In some embodiments, the 5' and 3' modules described in this disclosure may contain less than 30 nt of contiguous complementarity with the target site, for example, as little as 4 nt (3' proximal) or as little as 13 nt (5' proximal) of contiguous complementarity with the target site. In some embodiments, the complementarity of the target site may be limited to avoid unwanted intrusion of the first strand cDNA into another site of the genome with sequence complementarity. If this is not avoided, unwanted genome rearrangements may occur, even though second strand synthesis is envisioned without genome rearrangements at other than the desired site.

[0085] In some embodiments, the 5' and 3' modules may contain less than 30 nt of contiguous sequence complementarity with any region of the host cell's genome. In general, this restriction prevents HR from occurring between the inserted transgene and another locus in the genome. HR may result in large-scale genome rearrangements and the insertion of the transgene from the rDNA of the cell. In some embodiments, the transgene payload may contain at least one sequence longer than 30 nt that matches exactly with another site in the genome. In some embodiments, the transgene payload does not need to contain at least one sequence longer than 30 nt that matches exactly with another site in the genome. Without wishing to be bound by theory, it is believed that the cDNA intermediate in double-stranded transgene synthesis does not need to contain 30 nt of contiguous complementarity with another location in the genome, thereby limiting or avoiding invasion of the cDNA strand into a homologous duplex sequence and undesired inappropriate HR. In current technology, a relatively long flanking rDNA, e.g., 100 nt of 3' flanking rRNA, is considered to be an important factor for insertion into a genome by TPRT, but those of skill in the art will recognize that the present disclosure is in contrast to this (see Kuroki-Kami A, Nichuguti N, Yatabe H, Mizuno S, Kawamura S, Fujiwara H. Mob DNA. 2019 and US20200109398, the contents of which regarding the length of necessary or ideal contiguous sequence complementarity are incorporated by reference in this specification).

[0086] In some embodiments, the present disclosure provides compositions for use as an insertion template module. In some embodiments, the insertion template module may include at least one 5' module. In some embodiments, the insertion template module may include at least one 3' module. In some embodiments, the insertion template module may include a payload section. In some embodiments, the insertion template module may include at least one of a 5' module, a 3' module, and / or a payload section.

[0087] In some embodiments, the insertion template module comprises RNA, modified RNA or other nucleic acid that is used as a template for cDNA synthesis by nrRT to synthesize at least one strand of a biologically active DNA element at a target site in the target cell by TPRT.

[0088] 5' module In some embodiments, the 5' module suitable for the transgene template RNA is designed based on different principles than the 3' module. Without wishing to be bound by a particular theory, in terms of efficiency and fidelity of the 5' junction formed during the insertion of the transgene into the rDNA of human cells, the optimal 5' module is a module in which the upstream rRNA sequence is protected by the first loop of a self-cleaving ribozyme (RZ) with a delta hepatitis virus (HDV) fold structure. It has been generally suggested that the R2 element of some species (or lineages within a species), but not all species, encodes this type of self-cleavage activity, which in nature is exerted to release the 5' template end from the large precursor rRNA transcript synthesized by RNAP I and translate protein from the natural ORF (Ruminski DJ, Webb CT, Riccitelli NJ, Luptak A. J Biol Chem. 2011). Of course, in vitro transcribed and directly introduced template RNA does not need to be released from the precursor transcript by the action of RZ, so the results that modified 5' modules with RZ folds are useful for copying the transgene template and that they increase the efficiency and fidelity of the formation of the 5' junction were not self-evident.

[0089] In some embodiments, the RZ may not be required for complete transgene insertion, hi some embodiments, the RZ may increase the efficiency and fidelity of the 5' and 3' transgene insert junctions.

[0090] In some embodiments, the 5' modules can be used interchangeably between the various templates in transgene synthesis by various modified nrRTs. For example, the D. simulans 5'RZ self-cleaves at the exact junction (+0) of the rDNA and the 5' end of the retroelement, whereas the O. latipes 5'RZ self-cleaves 28 nt upstream (towards the promoter) from the position of the first nick on the bottom strand (-28), leaving 26 nt of 5' adjacent rRNA (a 2 bp sequence in the center of the target site is deleted upon natural retroelement insertion).

[0091] In some embodiments, the efficiency and fidelity of the formation of the transgene 5' junction can be further improved by various factors, such as improvements in the folding structure, stability in cells, and other parameters of the design and evaluation of the 5'-side template module. Examples include, but are not limited to, improvements that take advantage of natural or modified ribozymes derived from the HDV plus- and minus-strand genomes, and detailed characterization of the HDV folding ribozyme that exists in nature and has been functionally studied in human cells. In some embodiments, improvements can also be achieved by increasing the amount of HDV folding ribozyme within R2 across lineages.

[0092] In some embodiments, when determining the optimal 5' adjacent rRNA length for each modified nrRT protein (each has a different position when binding to the target site), the HDV folded RZ may be redesigned to protect the 5' adjacent rRNA of each length. In some embodiments, the optimal 5' adjacent rRNA length and the optimal 3' adjacent rRNA length may be correlated. In some embodiments, catalytically inactive mutants of RZ may be screened for use as transgene template 5' modules. In general, this may clarify the importance of maintaining the folded structure of the RZ versus having the 5' hydroxyl group of the cleaved RNA buried in the tertiary structure of the RNA, making it inaccessible to nucleases. In some embodiments, the design of the 5' module may be adjusted to recruit various cellular factors toward the formation of the 5' transgene junction. In some embodiments, the design of the 5' module may be adjusted to include motifs that facilitate folding, purification, or localization of the template RNA.

[0093] In some embodiments, the 5' module comprises at least one element derived from an R2 retroelement sequence. In some embodiments, the 5' module comprises at least one element derived from an R2 retroelement sequence of Bombyx mori, Drosophila simulans, Tribolium castaneum, or Oryzias latipes.

[0094] In some embodiments, the 5' module may be, but is not limited to, an RNA described in or encoded by any of SEQ ID NOs: 5 to 7.

[0095] 3' module In some embodiments, the design of the 3'-side module can be guided by a binding assay of template RNA and / or a TPRT assay to examine the tolerance and specificity of template use.For example, but not limited to, D. simulans RT is not tolerant to the use of O. latipes 3'UTR, and O. latipes RT is not tolerant to the use of D. simulans 3'UTR, but B. mori RT can use both.These TPRT results are consistent with the specificity of RNA interaction in binding assays.

[0096] In some embodiments, the 3'UTR-containing RNAs of O. latipes and D. simulans are considered to be highly suitable as transgene template modules that induce selective template usage, because of their high specificity for binding and copying (by the cognate RT used together). In some embodiments, when the specificity of binding to RNA is high, fewer RT proteins in the cell can bind to the desired template. Therefore, the possibility of unintended transgene synthesis is also reduced. In some embodiments, the specificity, efficiency and fidelity of template binding and template usage can be further improved by optimizing the 3'UTR sequence (or selecting a sequence with equivalent function). This optimization can, among other things, provide optimal length, uniform folding structure, high binding affinity and improved start position of TPRT.

[0097] In some embodiments, it is useful to modify the ends of the template RNA, for example by adding a sequence tag (e.g., a sequence tag used to improve RNA stability) or by covalent linkage (e.g., a covalent linkage used to fuse a peptide to facilitate cellular uptake). In some embodiments, a 20-25 nt adenosine (A) truncate is added. In general, this polyA truncate (PA) does not alter the specificity or fidelity of template usage in TPRT in vitro. For example, as shown in the Examples below, no change was observed in the specificity or fidelity of template usage in TPRT in any combination of modified R2 nrRT and a cognate 3'UTR template with a 3' adjacent rRNA. In some embodiments, the adenosine truncate can protect the 3' end of the template RNA by recruiting intracellular polyadenosine binding proteins or by forming a stably stacked single-stranded RNA base. In some embodiments, the insertion of the transgene in the cell is promoted by the presence of PA. In some embodiments, a terminal extension that does not inhibit TPRT in vitro and may functionally improve TPRT in vivo and / or in vitro can be added after the 3' adjacent rRNA of the transgene template. In general, heterologous terminal extensions are not naturally expressed, have no homology to the target site, and have no known interactions with RT proteins, so the finding that such heterologous terminal extensions can affect the template RNA is contrary to previous perceptions (see Kuroki-Kami A, Nichuguti N, Yatabe H, Mizuno S, Kawamura S, Fujiwara H. Mob DNA. 2019).

[0098] In some embodiments, TPRT by O. latipes RT using a homologous 3'UTR template is facilitated by the presence of 4 nt of 3' flanking rRNA after the 3'UTR sequence. In some embodiments, the efficiency of TPRT by O. latipes RT may be improved by using 20 nt of 3' flanking rRNA. In some embodiments, the presence of 4 nt of 3' flanking rRNA after the end of the 3'UTR sequence of the B. mori 3'UTR template does not affect the efficiency of TPRT by B. mori RT. In some embodiments, the use of 20 nt of 3' flanking downstream rRNA instead of 4 nt results in internal initiation by B. mori RT and reduced fidelity of 3' ligation. Overall, these results are representative of assay results that support our hypothesis that it is useful to tailor the design of the 3' template module to the type of nrRT enzyme. It is believed that the efficiency and / or fidelity of TPRT is altered by the presence or length of the 3' flanking rRNA sequence. Surprisingly, a person skilled in the art would understand that the usefulness of restricting the 3' adjacent rRNA sequence of the template was found to have a conclusion opposite to that of published research results (Kuroki-Kami A, Nichuguti N, Yatabe H, Mizuno S, Kawamura S, Fujiwara H. Mob DNA. 2019). In general, when evaluating the function of the 3' adjacent rRNA sequence, a comparison of template selectivity in TPRT in vitro and template selectivity in TPRT in human cells has not been performed. In some embodiments, the correlation between in vitro and in vivo TPRT may be used to optimize the insertion of the transgene.

[0099] In some embodiments, the 3' module comprises at least one element derived from an R2 retroelement sequence. In some embodiments, the 3' module comprises at least one element derived from an R2 retroelement sequence of Bombyx mori, Drosophila simulans, Tribolium castaneum, or Oryzias latipes.

[0100] In some embodiments, the 3' module may be, but is not limited to, an RNA described in or encoded by any of SEQ ID NOs:8-11.

[0101] Incomplete RNA synthesis In general, the intracellular expression, co-transcriptional changes, packaging and general fate of long non-protein-coding RNAs (i.e. non-coding RNAs such as the template RNAs described herein) are determined by multiple, diverse and competing pathways that are not clearly defined, resulting in a heterogeneous RNA pool composed of RNAs that differ in sequence, folding, processing and modification. An obstacle to using in vitro synthesis to generate functional long non-coding RNAs is the presumption that intracellular expression is required for functional folding and protein association of long non-coding RNAs. This presumed requirement for intracellular expression is believed to be due to the complex interplay of conditions and mechanisms for co-folding the RNA with chaperones and cofactors that act in turn to modify, fold and transport the RNA precursors and mature RNA, as well as with proteins that act in concert with the RNA. Since the long non-coding RNAs generated in cells and in vitro are not necessarily equivalent, the biological functions of the long non-coding RNAs generated in vitro must be confirmed. In some embodiments, in vitro synthesis, folding and modification combined with selective purification can produce pools of uniformly folded RNA molecules free of unintended activity or toxicity.

[0102] Payload Module In some embodiments, the payload module comprises at least one gene of interest for insertion into the genome of a subject, hi some embodiments, the payload module comprises any gene that can be inserted into the genome of a subject by EIS.

[0103] It will be understood by those skilled in the art that the transgene insertion method we have developed and disclosed herein does not naturally occur in the natural insertion process of non-LTR retroelements. In the natural insertion process, the RNA transcript from the retroelement synthesized in the cell undergoes several unknown steps to become a dual-function mRNA+RNA template molecule that induces both protein synthesis and cDNA synthesis. In some embodiments of the RNA template, the RNA template does not have a dual function. In some embodiments, the RNA template does not induce protein synthesis.

[0104] Those skilled in the art will appreciate that the compositions and methods disclosed herein are different from published work on TPRT by nrRT. In general, the previously disclosed TPRT method by nrRT uses a DNA vector that expresses a transcript containing the entire retroelement sequence that produces a protein and also serves as a template for cDNA synthesis by TPRT. In this case, the inserted transgene necessarily contains the ORF of nrRT and expresses an active nrRT. Furthermore, the sequence expressing this nrRT protein usually cannot be adjusted beyond the constraint of needing to produce both the nrRT protein and a functional template. In some embodiments of the inserted transgene, the inserted transgene does not contain the ORF of nrRT. In some embodiments, the vector expressing the nrRT protein can be adjusted beyond the constraint of needing to produce both the nrRT protein and a functional template.

[0105] Additionally, one of skill in the art will appreciate that the compositions and methods of the present disclosure differ from instances in which the same RNA molecule used to generate a protein later serves as a template (i.e., known in the art as "cis-preferential"). In some embodiments, the present disclosure uses a separately generated nrRT protein and an RNA template (i.e., "trans-preferential"). In some embodiments, the methods and compositions of the present disclosure involve directly introducing an RNA template into a cell, rather than the RNA template being generated within the cell. In some embodiments, the present disclosure uses an nrRT and an RNA template as separately generated components.

[0106] III. Formulation and Delivery delivery vehicle In some embodiments, the EIS described herein can be formulated into a delivery vehicle. Exemplary delivery vehicles suitable for implementing the present disclosure include nanoparticles, such as lipid-based nanoparticles (e.g., lipid nanoparticles (LNPs), liposomes and micelles) and non-lipid-based nanoparticles (e.g., virus-like particles (VLPs) and polymeric delivery particles).

[0107] In some embodiments, the delivery vehicle may include at least one nanoparticle. Generally, as used herein, the term "nanoparticle" may refer to a particle having a size of 10 to 1000 nm.

[0108] lipid-based particles Lipid Nanoparticles In some embodiments, the delivery vehicle may be a lipid nanoparticle (LNP). In general, LNPs have an outer lipid layer with a hydrophilic outer surface in contact with the non-LNP environment, a non-aqueous or aqueous inner space (i.e., micelle-like LNPs and vesicle-like LNPs, respectively), and at least one hydrophobic intermembrane space. The LNP membrane may be a non-lamellar or lamellar structure, and may be composed of one, two, three, four, five, or more than five layers. The LNP may be solid or semi-solid. In some embodiments, the LNP may contain at least one cargo or payload (such as an EIS) in the inner space, intermembrane space, outer surface, or any combination thereof.

[0109] Micellar In some embodiments, the delivery vehicle comprises at least one micelle. In some embodiments, the micelle may be composed of the same components as lipid nanoparticles, but the manufacturing process is fundamentally different. As used herein, "micelle" refers to a small particle that does not have an aqueous intraparticle space. Without wishing to be bound by a particular theory, the intraparticle space of a micelle does not contain lipid head groups, but rather contains the hydrophobic tails of the lipids that make up the micelle membrane and the EIS that may be bound to it.

[0110] Liposomes In some embodiments, the delivery vehicle comprises at least one type of liposome. In some embodiments, the liposome may be composed of the same components and amounts of components as lipid nanoparticles, but the manufacturing process is fundamentally different. As used herein, "liposome" refers to a vesicle composed of at least one lipid bilayer membrane surrounding an aqueous internal nanoparticle space. Furthermore, liposomes are not typically derived from progenitor / host cells, unlike extracellular vesicles. Liposomes include those that contain multiple concentric bilayers separated by narrow aqueous spaces, with diameters of hundreds of nanometers (i.e., (large) multilamellar vesicles (MLVs)), those with diameters of less than 50 nm (small unilamellar vesicles (SUVs)), and those with diameters of 50-500 nm (large unilamellar vesicles (LUVs)).

[0111] Exosomes In some embodiments, the delivery vehicle comprises at least one exosome. In general, "exosome" refers to extracellular vesicles that are small membrane-bound bodies derived from endocytosis. Exosome membranes are generally lamellar structures composed of lipid bilayers and have an aqueous internal nanoparticle space. Exosomes tend to contain components of the host cell membrane / progenitor cell membrane in addition to predefined components. Without wishing to be bound by theory, exosomes are generally released from host cells / progenitor cells into the extracellular environment after multivesicular bodies fuse with the cell plasma membrane.

[0112] Virus-like particles In some embodiments, the delivery vehicle comprises at least one virus-like particle (VLP). In general, virus-like particles are non-infectious vesicles composed mainly of a virus-derived protein capsid, coat, shell or sheath (all of which are used interchangeably herein) capable of carrying an EIS. In some embodiments, the VLP may be synthesized by the self-assembly of viral capsid protein sequences expressed by intracellular machinery and incorporating an EIS. In some embodiments, the VLP may be formed by providing capsid and EIS components and allowing them to self-assemble without the use of intracellular machinery associated with their expression.

[0113] Examples of viral families and species from which VLPs can be derived include, but are not limited to, Parvoviridae, Retroviridae, Flaviviridae, Paramyxoviridae, Adeno-associated virus, HIV, Hepatitis C virus, HPV, bacteriophage, or combinations thereof.

[0114] Direct transfection In some embodiments, the EIS disclosed herein may be directly transfected into target cells without using the delivery vehicle. In some embodiments, the EIS disclosed herein may be transfected into target cells using any technique known in the art. Such techniques include, but are not limited to, chemical transfection (e.g., calcium phosphate contact), physical transfection (e.g., electroporation, microinjection, gene gun delivery), and the like. In some embodiments, direct transfection may be performed using lipid-based transfection reagents, such as, but not limited to, lipofectamine, lipofectamine 2000, and any combination thereof.

[0115] Delivery target site In some embodiments, the EIS disclosed herein may be delivered to a target site, including, but not limited to, a specific cell, tissue, organ, physiological system, or any combination thereof, of a subject.

[0116] IV. Pharmaceutical Compositions and Routes of Administration The present disclosure provides a pharmaceutical composition for administering an EIS to a subject. In some embodiments, the present disclosure provides a pharmaceutical composition for use as a medicament in the treatment of a therapeutic indication. In some embodiments, the pharmaceutical composition comprises at least one active ingredient (e.g., an EIS of the present disclosure) and at least one pharma- ceutically acceptable excipient, adjuvant, carrier, diluent, or any combination thereof. In some embodiments, the pharmaceutical composition is prepared as a formulation suitable for at least one route of administration. In some embodiments, the pharmaceutical composition is prepared as a formulation that delivers a predetermined dose of at least one active ingredient (e.g., an EIS). It can also be prepared as a formulation that delivers on a predetermined schedule.

[0117] As used herein, the term "pharmaceutical composition" refers to a composition that includes at least one active ingredient and may further include one or more pharma- ceutically acceptable excipients. As used herein, the term "active ingredient" generally refers to the EIS, the genetic payload delivered by the EIS for insertion into the genome of a subject, or the expression product of the genetic payload delivered by the EIS described herein.

[0118] In some embodiments, the pharmaceutical compositions may include any excipients, adjuvants, diluents, fillers, preservatives, stabilizers, and the like.

[0119] In some embodiments, formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, methods for preparing such formulations include combining an active ingredient with an excipient and / or one or more other accessory ingredients.

[0120] The EIS, e.g., a pharmaceutical composition comprising an EIS as described herein, may be administered by any delivery route that allows for incorporation of the EIS into the cells of a subject. Acceptable routes of administration include transauricular administration (administration into or through the ear), bile duct perfusion, buccal administration (administration to the inside of the cheek), cardiac perfusion, sacral block, conjunctival administration, transdermal administration, transdental administration (administration to one or more teeth), intracoronary administration, diagnostic administration, ear drops, electroosmosis, endocervical administration, intrasinus administration, intratracheal administration, enema, enteral administration (administration into the intestinal tract), epidermal administration (a puncture above the skin), epidural administration (administration into the epidural space), epi-amniotic administration, administration via an extracorporeal circulation device, ophthalmic administration (administration onto the conjunctiva), gastrointestinal administration, and the like. administration, hemodialysis, infiltration administration, insufflation administration (aspiration through the nose), interstitial administration, intraperitoneal administration, intra-amniotic administration, intra-arterial administration (administration into an artery), intra-articular administration, intra-biliary administration, intra-bronchial administration, intra-vesical administration, intracardiac administration (administration into the heart), intrachondral administration (administration into cartilage), intra-cauda equina administration (administration into the cauda equina), intracavity injection (administration into pathological cavities), intracavernous sinus administration (administration into the base of the penis), intracerebral administration (administration into the cerebrum), intraventricular administration (administration into the ventricles), intracisternal administration (administration into the cisterna magna / cerebellar medullary cistern), intracorneal administration (administration into the cornea), coronary Intra-arterial (administration into a coronary artery), intracavernous (administration into the distensible space of the corpus cavernosum of the penis), intradermal (administration into the skin itself), intradiscal (administration into an intervertebral disc), intraductal (administration into a glandular duct), intraduodenal (administration into the duodenum), intradural (administration into the dura or subdural), intraepidermal (administration into the epidermis), intraesophageal (administration into the esophagus), intragastric (administration into the stomach), intragingival (administration into the gums), intraileal (administration into the distal part of the small intestine), intralesional (administration into or to a local lesion) direct introduction), intracavitary administration (administration into the cavity of a tube), intralymphatic administration (administration into the lymphatic vessels), intramedullary administration (administration into the medullary cavity of a bone), intrameningeal administration (administration into the meninges), intramuscular administration (administration into a muscle), intramyocardial administration (administration into the myocardium), intraocular administration (administration inside the eye), intraosseous injection (administration into the bone marrow), intraovarian administration (administration into the ovary), intraparenchymal administration (administration into brain tissue), intrapericardial administration (administration into the pericardium), intraperitoneal administration (injection or injection into the peritoneal cavity), intrapleural administration (administration into the pleura), intraprostatic administration (administration into the prostate gland),Intrapulmonary (administration into the lungs or their bronchi), intracavitary (administration into the paranasal sinuses or periorbital cavity), intraspinal (administration into the spinal column), intrasynovial (administration into the synovial cavity of a joint), intratendinous (administration into a tendon), intratesticular (administration into the testicle), intrathecal (administration into the spinal canal), intrathecal (administration into the cerebrospinal fluid anywhere in the neuraxis), intrathoracic (administration into the thoracic cavity), intracavitary (administration into the cavity of an organ), intratumoral (administration into a tumor), intratympanic (administration into the middle ear), intrauterine, intravaginal administration, intravascular administration (administration into one or more blood vessels), intravenous administration (administration into a vein), intravenous bolus, intravenous drip, intraventricular administration (administration into the ventricle), intravesical instillation, intravitreal administration (administration inside the eyeball), iontophoresis (the use of an electric current to introduce ions of a soluble salt into living tissue), irrigation (soaking or flushing an open wound or body cavity), laryngeal administration (direct administration into the larynx), nasal administration (administration through the nasal cavity), nasogastric administration (administration through the nasal cavity into the stomach), nerve block, Occlusive therapy (administration by topical route followed by covering the site with an occlusive dressing), ocular (administration to the outside of the eye), oral (administration through the mouth), oropharyngeal (administration directly into the mouth and pharynx), parenteral, transdermal, periarticular, peridural, perineural, periodontal, photopheresis, rectal, respiratory (administration into the respiratory tract by oral or nasal inhalation for a local or systemic effect), retrobulbar (administration behind the pons or behind the eyeball), soft tissue, and intrathecal. These include, but are not limited to, subconjunctival, subcutaneous (administration under the skin), sublabial, sublingual, submucosal, topical, transdermal, transdermal (diffusion through intact skin for systemic distribution), transmucosal (diffusion through mucous membranes), transplacental (administration through or via the placenta), transtracheal (administration through the tracheal wall), transtympanic (administration through or via the tympanic cavity), vaginal, ureteral (administration into the ureter), urethral (administration into the urethra), vaginal, and spinal administration.

[0121] The EIS and / or pharmaceutical compositions comprising the EIS may be administered in any amount (ie, dosage) that produces a desired effect in a subject (eg, a desired therapeutic effect, research result, etc.).

[0122] V. How to use Provided herein is a method for introducing a transgene into a subject. In some embodiments, the method comprises introducing an effective amount of at least one EIS comprising a transgene into the subject.

[0123] In some embodiments, the method includes introducing a transgene, and the method further includes adding the transgene site-specifically to the eukaryotic genome using an RNA template and an associated reverse transcriptase.

[0124] In some embodiments of the method, a modified R2 retroelement protein is used to insert the transgene into the rDNA of a human cell using a directly introduced RNA template by target primed reverse transcription (TPRT) mediated by the modified R2 retroelement protein.

[0125] In some embodiments, the systems and methods of the present invention do not exclude R2 retroelement proteins, R2 / R8 / R9 domain structures of non-LTR type RT proteins, native proteins or native protein complexes.

[0126] In some embodiments, the systems and methods of the present invention do not exclude the genomes of other species or targets other than genomes as targets for transgene insertion by TPRT.

[0127] In some embodiments, the systems and methods of the invention do not exclude exogenous additions / modifications to the template, such as additional nucleic acids, nucleic acid-like substances, chemically synthesized moieties, natural or synthetic peptides or lipids, scaffold binding and release capabilities, etc.

[0128] In some embodiments, "delivery" or introduction of RNA into cells is not limited to standard methods such as lipid-based transfection or electroporation (which are employed in all examples described herein).

[0129] In some embodiments, the transgene is a therapeutically effective gene.

[0130] In some embodiments, the systems and methods of the invention employ non-LTR retroelement proteins that have activity as RTs to enable TPRT and / or as strand-nicking endonucleases, which exhibit activity in RT primer extension assays and / or in vitro TPRT assays, and may be site-specific.

[0131] In some embodiments, the systems and methods of the invention use one or more 3' template modules for RT-mediated TPRT that are the same 3' template module as the cooperating RT, modified versions of the same native form, obtained by phylogenetic investigation and rearrangement and modification or rearrangement alone of related retroelements, or by screening for selectivity, efficiency and / or fidelity of 3' and 5' bond formation in vitro and in cells.

[0132] In some embodiments, the systems and methods of the invention use one or more 5' template modules for RT-mediated TPRT that are 5' template modules homologous to the cooperating RT, modified from homologous native forms, obtained by phylogenetic investigation and reconstitution and modification or reconstitution alone of related retroelements, modified 5' regions of heterologous retroelements, modified natural or engineered Hepatitis Delta Virus (HDV) ribozyme (RZ) fold structures, or obtained by screening for selectivity, efficiency and fidelity of 3' and 5' bond formation in vitro and in cells.

[0133] In some embodiments, the systems and methods of the invention provide one or more additions to template ends that improve the selectivity, efficiency and / or fidelity of 3' and 5' bond formation in vitro and in cells, including but not limited to, the addition of 5' and 3' flanking sequences of rRNA that match sequences at or near the target site, including but not limited to, the addition of sequences of 4-29 nucleotides, and not excluding the addition of rRNA of other lengths, where a functional 4-20 nucleotide sequence may be present within a longer sequence.

[0134] In some embodiments, the systems and methods of the invention provide one or more additions to the template ends that improve biological delivery to a cell, stability within a cell, or efficiency of site-specific transgene insertion in a cell, including, but not limited to, the addition of a 3' flanking polyadenosine motif and / or a 5' flanking self-cleaving ribozyme motif, or other structures that protect the introduced template RNA from degradation.

[0135] In some embodiments, the systems and methods of the invention involve one or more modifications to the template that improve delivery, stability, targeting, isolation from interactions, or affect other cellular processes, such as translation, DNA repair, chromatin modification, checkpoint activation, etc.

[0136] In some embodiments, the systems and methods of the invention use one or more transgenes that are inserted and functionally expressed in the 28S rDNA of a human cell, the human rDNA being a safe harbor site for successful insertion of an expression cassette for a transgene protein.

[0137] In some embodiments, the systems and methods of the invention utilize one or more exogenous transgenes that have been introduced into the RNA template to, for example, restore a loss of function in a human disease or to confer a beneficial function.

[0138] Sequence Listing When a protein is described herein as an amino acid sequence, the DNA / RNA sequence (including synthetic DNA) encoding the protein can be easily inferred. When tags or other modifications are included in the protein sequence, the protein is not an endogenous protein, but an engineered protein. When the RNA "module" sequences are described separately without all the components of the template, the combined full-length template can be easily inferred from the combination of components disclosed herein. In some embodiments, the length and position of the 5'rRNA and 3'rRNA, as well as the 3' extension of the 3'rRNA, may be as described in the text. By convention, in sequences shown or represented as RNA sequences, all T's may be understood to be U's. In some embodiments, a representative payload is, for example, puroR (puromycin resistance gene). The structure of puroR used as the payload includes an RNAP I terminator, an RNAP II promoter, a 5'UTR, an ORF, a 3'mRNA cleavage signal, and a polyadenylation signal. The sequence described is the sequence of the entire payload.

[0139] VI. List of Embodiments A method for introducing a transgene comprising site-specifically adding the transgene to a eukaryotic genome using an RNA template in conjunction with reverse transcriptase.

[0140] EMBODIMENT 2 2. The method of embodiment 1, wherein the method uses a modified R2 retroelement protein, and insertion of the transgene into the rDNA of a human cell is achieved by TPRT via the modified R2 retroelement protein using a directly introduced RNA template.

[0141] EMBODIMENT 3 The method does not exclude R2 retroelement proteins, R2 / R8 / R9 domain structures of non-LTR type RT proteins, native proteins or native protein complexes; The method does not exclude the use of other species' genomes or targets other than genomes as targets for transgene insertion by TPRT; The method does not exclude exogenous additions / modifications to the template, such as additional nucleic acids, nucleic acid-like substances, chemically synthesized moieties, natural or synthetic peptides or lipids, scaffold binding and release capabilities, etc.; and / or "Delivery" or introduction of RNA into cells is not limited to standard methods such as lipid-based transfection or electroporation (as employed in all examples described herein); 2. The method of embodiment 1.

[0142] EMBODIMENT 4 2. The method of embodiment 1, wherein the transgene is a therapeutically effective gene.

[0143] EMBODIMENT 5 2. The method of embodiment 1, wherein the method employs a non-LTR retroelement protein having activity as an RT to enable TPRT and / or as an endonuclease to introduce nicks into the strand, the non-LTR retroelement protein exhibiting activity in an RT primer extension assay and / or in an in vitro TPRT assay, which may be site-specific.

[0144] EMBODIMENT 6 The method of embodiment 1, wherein the method uses one or more 3' template modules for RT-mediated TPRT, which are 3' template modules of the same species as the cooperating RT, modified versions of the same species, obtained by phylogenetic investigation and rearrangement and modification or rearrangement only of related retroelements, or obtained by screening for selectivity, efficiency and / or fidelity of 3' and 5' bond formation in vitro and in cells.

[0145] EMBODIMENT 7 The method of embodiment 1, wherein the method uses one or more 5' template modules for RT-mediated TPRT, which are 5' template modules of the same species as the cooperating RT, modified from the same native species, obtained by phylogenetic investigation and rearrangement and modification or only rearrangement of related retroelements, modified 5' regions of heterologous retroelements, modified from natural or engineered HDV RZ fold structures, or obtained by screening for selectivity, efficiency and fidelity of 3' and 5' bond formation in vitro and in cells.

[0146] EMBODIMENT 8 2. The method of embodiment 1, wherein the method comprises making one or more additions to the template ends that improve the selectivity, efficiency and / or fidelity of 3' and 5' bond formation in vitro and in cells, the one or more additions including, but not limited to, addition of 5' and 3' flanking sequences consisting of rRNA that match sequences at or near the target site, the additions including, but not limited to, addition of sequences of 4-29 nucleotides, and not excluding addition of rRNA of other lengths, where a functional 4-20 nucleotide sequence may be present within a longer sequence.

[0147] EMBODIMENT 9 The method of embodiment 1, wherein the method comprises making one or more additions to the template ends that improve biological delivery to a cell, stability within a cell, or efficiency of site-specific transgene insertion in a cell, including, but not limited to, the addition of a 3' flanking polyadenosine motif and / or a 5' flanking self-cleaving ribozyme motif, or other structure that protects the introduced template RNA from degradation.

[0148] EMBODIMENT 10 The method of embodiment 1, wherein the method comprises making one or more modifications to the template that improve its delivery, stability, targeting, isolation from interactions, or effect on other cellular processes, such as translation, DNA repair, chromatin modification, checkpoint activation, etc.

[0149] EMBODIMENT 11 2. The method of embodiment 1, wherein the method uses one or more transgenes that are inserted into the 28S rDNA of the human cell and functionally expressed.

[0150] EMBODIMENT 12 2. The method of embodiment 1, wherein human rDNA is a safe harbor site for successful insertion of an expression cassette for a transgene protein.

[0151] EMBODIMENT 13 2. The method of embodiment 1, wherein the method uses one or more exogenous transgenes that have been introduced into the RNA template, e.g., to restore a loss of function in a human disease or to confer a beneficial function.

[0152] EMBODIMENT 14 An element insertion system (EIS) that operates to insert (via an RNA intermediate) a biologically active DNA element into a target site in a target cell, comprising: an nrRT module that generates active nrRT in target cells; and TPRT provides an insertion template module that serves as a template for the synthesis of at least one strand of a biologically active DNA element at a target site in said target cell by the action of nrRT. Including, EIS.

[0153] EMBODIMENT 15 Examples of the nrRT module include, but are not limited to, an active nrRT or a suitable inactive proprotein nrRT, deliverable to said target cell by any suitable delivery system; an mRNA, modified mRNA or other nucleic acid, either processed and translated within the cell or translated without intracellular processing, that encodes an nrRT, an nrRT proprotein or other that is capable of inducing an active nrRT within the target cell and that can be delivered to the target cell by any suitable delivery system; and A DNA construct or other nucleic acid that can be delivered to the target cell by any suitable delivery system, from which an mRNA is transcribed that results in the synthesis of an active nrRT in the target cell. The EIS of embodiment 14, wherein the EIS includes

[0154] EMBODIMENT 16 The EIS of embodiment 14, wherein the insertion template module comprises RNA, modified RNA or other nucleic acid that can be delivered to the target cell by any suitable delivery system, and which is used as a template for cDNA synthesis by nrRT to synthesize at least one strand of a biologically active DNA element at a target site in the target cell by TPRT.

[0155] EMBODIMENT 17 The insertion template module may include a plurality of segments configured to facilitate efficient and selective use of the insertion template module in TPRT by nrRT, e.g., the 3' segment that is preferentially used by a particular nrRT; the 5' segment that is preferentially used by a particular nrRT; and Payload segments selected for compatibility with TPRT by nrRT and that can be used as templates for cDNA synthesis of biologically active DNA elements 15. The EIS of embodiment 14, wherein

[0156] EMBODIMENT 18 The EIS according to embodiment 14, wherein a DNA segment of a part of the DNA element having biological activity is configured to be inserted into a target site of the target cell, thereby causing a desired modification of the biological properties of the cell or an organism containing the cell.

[0157] EMBODIMENT 19 Examples of DNA having the biological activity include: Therapeutic alterations to a cell or group of cells in the human body; Desirable changes to the characteristics of plants or animals used in agriculture; or Desirable changes to wildlife that result in ecological change, such as the control of invasive species or disease vectors The EIS of embodiment 14, wherein the EIS includes

[0158] EMBODIMENT 20 The biologically active DNA element optionally comprises: one or more sequence segments that terminate transcription of the element by promoters outside the insertion site; one or more promoter segments that initiate transcription; one or more effector segments encoding one or more proteins or nucleic acids having a biological function; and Other sequence segments 15. The EIS of embodiment 14, optionally comprising:

[0159] EMBODIMENT 21 The EIS of embodiment 14, comprising an nrRT module and an insertion template module that have been modified, designed or specially tailored to work together efficiently and selectively.

[0160] EMBODIMENT 22 Insertion of a transgene into the rDNA of a human cell using a directly introduced RNA template by target primed reverse transcription (TPRT) mediated by a modified R2 retroelement protein; This does not exclude R2 retroelement proteins, the R2 / R8 / R9 domain structures of non-LTR RT proteins, native proteins or native protein complexes; This does not exclude other species' genomes or extragenomic targets as targets for transgene insertion by TPRT; does not exclude exogenous additions / modifications to the template, such as additional nucleic acids, nucleic acid-like substances, chemically synthesized moieties, natural or synthetic peptides or lipids, scaffold binding and release capabilities, etc.; and / or that "delivery" or introduction of RNA into cells is not limited to standard methods such as lipid-based transfection or electroporation (as employed in all examples described herein); the transgene is a therapeutically effective gene; the use of a non-LTR retroelement protein having activity as an RT enabling TPRT and / or activity as an endonuclease introducing nicks into the strand, said non-LTR retroelement protein being active in an RT primer extension assay and / or an in vitro TPRT assay, which may be site-specific; the use of one or more 3' template modules for RT-mediated TPRT, which are either the same 3' template module as the associated RT, modified versions of the same native form, obtained by phylogenetic investigation and rearrangement and modification or rearrangement alone of related retroelements, or by screening for selectivity, efficiency and / or fidelity of 3' and 5' bond formation in vitro and in cells; the use of one or more 5' template modules for RT-mediated TPRT, which are either the same 5' template module as the cooperating RT, modified from the same native form, obtained by phylogenetic investigation and reconstitution and modification or only reconstitution of related retroelements, modified 5' regions of heterologous retroelements, modified from natural or engineered Hepatitis Delta Virus (HDV) ribozyme (RZ) fold structures, or obtained by screening for selectivity, efficiency and fidelity of 3' and 5' bond formation in vitro and in cells; making one or more additions to the template ends that improve the selectivity, efficiency and / or fidelity of 3' and 5' bond formation in vitro and in cells, the one or more additions including, but not limited to, the addition of 5' and 3' flanking sequences consisting of rRNA that match sequences at or near the target site, the additions including, but not limited to, the addition of sequences of 4-29 nucleotides, and not excluding the addition of rRNA of other lengths, and functional 4-20 nucleotide sequences may be present within longer sequences; making one or more additions to the template ends that improve biological delivery to a cell, stability within a cell, or efficiency of site-specific transgene insertion in a cell, including, but not limited to, the addition of a 3' flanking polyadenosine motif and / or a 5' flanking self-cleaving ribozyme motif, or other structures that protect the introduced template RNA from degradation; making one or more modifications to the template that improve its delivery, stability, targeting, isolation from interactions, or effect on other cellular processes, e.g., translation, DNA repair, chromatin modification, checkpoint activation, etc.; using one or more transgenes, which are inserted into the 28S rDNA of a human cell and functionally expressed; the human rDNA being a safe harbor site for successful insertion of an expression cassette for a transgene protein; and / or One or more exogenous transgenes are used, and the one or more exogenous transgenes are introduced into the RNA template to, for example, restore a loss of function in a human disease or to confer a beneficial function.

[0161] EMBODIMENT 23 In one embodiment, the present disclosure includes an element insertion system (EIS), which functions to insert a biologically active DNA element into a target site in a target cell. The EIS includes two modules: an nrRT module and an insertion template module.

[0162] EMBODIMENT 24 The nrRT module generates active nrRT in the target cell. Examples of the nrRT module include, but are not limited to, an active nrRT or a suitable inactive proprotein nrRT, deliverable to said target cell by any suitable delivery system; an mRNA, modified mRNA or other nucleic acid, either processed and translated within the cell or translated without intracellular processing, that encodes an nrRT, an nrRT proprotein or other that is capable of inducing an active nrRT within the target cell and that can be delivered to the target cell by any suitable delivery system; and A DNA construct or other nucleic acid that can be delivered to the target cell by any suitable delivery system, from which an mRNA is transcribed that results in the synthesis of an active nrRT in the target cell. Examples include:

[0163] EMBODIMENT 25 The insertion template module may comprise RNA, modified RNA or other nucleic acid that can be delivered to the target cell by any suitable delivery system and used as a template for cDNA synthesis by nrRT to synthesize at least one strand of a biologically active DNA element at a target site in the target cell by TPRT. The insertion template module may comprise a plurality of segments configured to facilitate efficient and selective use of the insertion template module in TPRT by nrRT, for example: the 3' segment that is preferentially used by a particular nrRT; the 5' segment that is preferentially used by a particular nrRT; and Payload segments selected for compatibility with TPRT by nrRT and that can be used as templates for cDNA synthesis of biologically active DNA elements It is.

[0164] EMBODIMENT 26 A DNA segment of the biologically active DNA element is configured to be inserted into a target site in the target cell to bring about a desired modification in the biological properties of the cell or an organism containing the cell. Examples of the biologically active DNA include: Therapeutic alterations to a cell or group of cells in the human body; Desirable changes to the characteristics of plants or animals used in agriculture; or Desirable changes to wildlife that result in ecological change, such as the control of invasive species or disease vectors Examples include: The biologically active DNA element optionally comprises: one or more sequence segments that terminate transcription of the element by promoters outside the insertion site; one or more promoter segments that initiate transcription; one or more effector segments encoding one or more proteins or nucleic acids having a biological function; and Other sequence segments may also include

[0165] EMBODIMENT 27 The EIS may include an nrRT module and an insertion template module that have been modified, designed, or specially tailored to work together efficiently and selectively.

[0166] EMBODIMENT 28 The present disclosure includes all combinations of the individual embodiments described herein, all of which are intended to be construed as being herein described.

[0167] VII. Definition 28S rDNA: As used herein, the term "28S rDNA" refers to the portion of a subject's genome that encodes the ribosomal RNA (rRNA) that constitutes the large subunit (LSU) of the eukaryotic cytoplasmic ribosome.

[0168] 3' junction: As used herein, the term "3' junction" refers to the position where the 3' end of the sequence to be inserted is joined to the 5' end of the genome of the subject.

[0169] 3' region: As used herein, the term "3' region" refers to the portion of a retroelement gene that is located 3' to the open reading frame.

[0170] 3' template module: As used herein, the term "3' template module" refers to a portion of an insertion template module that includes at least one element derived from the 3' region of a retroelement gene.

[0171] 5' junction: As used herein, the term "5' junction" refers to the position where the 3' end of the genome of interest is joined to the 3' end of the sequence to be inserted.

[0172] 5' region: As used herein, the term "5' region" refers to the portion of a retroelement gene that is located 5' to the open reading frame.

[0173] 5' template module: As used herein, the term "5' template module" refers to a portion of an insertion template module that includes at least one element derived from the 5' region of a retroelement gene.

[0174] Activity: As used herein, the term "activity" refers to the state in which something is happening or in which something is being carried out. Proteins and nucleic acids of the disclosure may have activity, which may be involved in one or more biological events.

[0175] Modulated: As used herein, the term "modulated" refers to a change in a protein or amino acid sequence to change, add or remove its properties and / or activity.

[0176] Additive: As used herein, the term "additive" means to increase the number of elements that make up a composition or method of the present disclosure.

[0177] Assay: As used herein, the term "assay" when used as a verb is used in its broadest sense to mean the act of conducting a test using any suitable method known in the art. As used herein, the term "assay" when used as a noun means a test used to measure a property, condition and / or activity of the subject of the assay.

[0178] Linked: As used herein, the terms "linked with," "conjugated," "linked," "attached," and "tethered," when used in reference to two or more moieties, mean that the two or more moieties are physically linked or connected, either directly or through one or more other moieties that function as linking agents, to form a structure that is sufficiently stable so that the two or more moieties can maintain their physical association under conditions in which the structure is used, e.g., physiological conditions. A "link" does not necessarily have to be a chemical bond via a direct covalent bond. A "link" can also refer to an ionic or hydrogen bond, or hybridization-based connection that is sufficiently stable to allow the "linked" moieties to maintain their physical association.

[0179] Biological delivery: As used herein, the term "biological delivery" refers to the act or method of delivering a compound, substance, object, moiety, cargo or payload to a living cell or living organism. Unless otherwise indicated, the terms "delivery" and "biological delivery" may be used interchangeably.

[0180] Biological Property: As used herein, the terms "biological property" and "property" refer to a measurable or observable characteristic or activity of an organism, physiological system, organ, tissue, cell, or molecule.

[0181] Cargo: When not used in the context of a delivery vehicle, the terms "cargo" or "payload" can refer to a nucleic acid sequence (e.g., a gene of interest) contained in an element insertion system (EIS) intended for insertion into the genome of a subject. In the context of a delivery vehicle, the terms "cargo" and "payload" typically refer to a compound or structure (e.g., an element insertion system of the present disclosure) intended for delivery to, to, or in the vicinity of a cell, tissue, organ, or physiological system of a subject.

[0182] Cell: As used herein, the term "cell" is used in the broadest possible sense to mean a living membrane-bound structure.

[0183] Cellular process: As used herein, the term "cellular process" and grammatical equivalents refer to a process that takes place at the cellular level, which may or may not be limited to a single cell.

[0184] Feature: As used herein, the terms "feature" and "characteristic" may be used interchangeably.

[0185] Checkpoint activation: As used herein, the term "checkpoint activation" refers to the activation of at least one cell cycle regulatory mechanism.

[0186] Chromatin modification: As used herein, the term "chromatin modification" refers to a modification of chromatin structure that alters the condensation state of the genome, thereby altering access to genomic DNA.

[0187] Homologous: As used herein, the term "homologous" refers to elements of an EIS that are derived from the same retroelement gene.

[0188] Compatible: As used herein, the term "compatible" means capable of being used as an element constituting an EIS without negatively affecting target primed reverse transcription.

[0189] Impart: As used herein, the term "impart" and grammatical equivalents refer to the addition of additional functionality to an object.

[0190] Construct: As used herein, the noun "construct" refers to an artificially designed biopolymer. Examples of biopolymers include DNA, RNA, and polypeptides. Typically, the constructs described herein are designed for use in EIS.

[0191] Degradation: As used herein, "degradation" refers to the loss of functionality of a composition over time.

[0192] Delivery: As used herein, "delivery" refers to the act or method of delivering a compound, substance, object, moiety, cargo or payload.

[0193] Delivery system: As used herein, the term "delivery system" refers to a composition, method, or combination thereof that, when formulated in combination with the EIS of the present invention, is capable of delivering components of the EIS into the cytoplasm of a target cell. Examples of delivery systems include, but are not limited to, systems comprised of a delivery vehicle and systems for direct transfection.

[0194] Designed: As used herein, the term "designed" refers to a composition that has been altered from its natural or existing state so as to have new and desired properties and / or activities.

[0195] Disease Vector: As used herein, the term "disease vector" refers to a biological agent that carries and transmits an infectious agent to another living organism.

[0196] DNA and RNA: As used herein, the term "RNA", "RNA molecule" or "ribonucleic acid molecule" refers to a polymer of ribonucleotides. As used herein, the term "DNA", "DNA molecule" or "deoxyribonucleic acid molecule" refers to a polymer of deoxyribonucleotides. DNA and RNA can be naturally synthesized. For example, DNA can be naturally synthesized by copying DNA, and RNA can be naturally synthesized by transcription of DNA. DNA and RNA can also be chemically synthesized. DNA and RNA can be single-stranded (i.e., ssRNA or ssDNA) or multi-stranded (e.g., double-stranded, i.e., dsRNA or dsDNA). As used herein, the term "mRNA" or "messenger RNA" refers to a single-stranded RNA that codes for the amino acid sequence of one or more polypeptide chains.

[0197] DNA repair: As used herein, the term "DNA repair" refers to the endogenous process carried out within cells to correct damage that has occurred to the genome within the cell.

[0198] Ecological: As used herein, the term "ecological" refers to the relationships of living organisms to one another and to the physical environment that surrounds them.

[0199] Effector segment: As used herein, the term "effector segment" refers to a DNA or RNA sequence that encodes a functional product.

[0200] Efficient: As used herein, the term "efficient" and grammatical equivalents in relation to target primed reverse transcription refer to the effectiveness of any combination of nrRT protein, 5' and 3' modules in inserting the entire length of the payload module at a desired target site.

[0201] Element: As used herein, the term "element" refers to an individual component of a molecule, a system, or a method step.

[0202] Element Insertion System: As used herein, the term "element insertion system (EIS)" refers to a system of components (modules) used by TPRT to insert a genetic sequence (transgene) into a specific location in the genome of a subject.

[0203] Encapsulate: As used herein, the term "encapsulate" means to contain, surround, or contain.

[0204] Encode: As used herein, the term "encode" refers broadly to the process of using information written into a polymer macromolecule (a first molecule) to induce the production of a second molecule that is different from itself. The second molecule may have a chemical structure with different chemical properties than the first molecule.

[0205] Endonuclease: As used herein, the term "endonuclease" refers to a protein or a portion thereof that cleaves a polynucleotide chain by degrading nucleotides other than those at both ends.

[0206] Exosomes: As used herein, "exosomes" are vesicles secreted by mammalian cells or complexes involved in the degradation of RNA.

[0207] Facilitate: As used herein, the term "facilitate" is used in its broadest sense to mean making some action or process more likely to occur by the addition of a particular element.

[0208] Fidelity: As used herein, the term "fidelity" refers to the accuracy with which a gene of interest is inserted into a target genome. High fidelity corresponds to the insertion of a gene of interest with relatively few errors in terms of nucleotide identity, sequence length and target site position. For example, if a template RNA containing about 5,000 nucleotides can be copied by nrRT protein to produce cDNA without mismatched base pairs, this gene insertion has high fidelity. Although it depends on the purpose of the insertion of a transgene, even if a small number of mismatches occur, a sufficiently high fidelity can produce a functional transgene.

[0209] Adjacent: As used herein, the term "adjacent" means that one element is located 5' (5'-proximal) or 3' (3'-proximal) of another element. Adjacent elements may be directly linked to each other, or there may be another element between the adjacent elements.

[0210] Formulation: As used herein, a "formulation" includes at least one component of the EIS described herein and at least one delivery agent, a pharma- ceutically acceptable excipient, or both.

[0211] Functional / active: As used herein, the term "functional" as used in reference to a biomolecule means a biomolecule in a form in which it exhibits a property and / or activity that characterizes it.

[0212] Gene: As used herein, the term "gene" is used in the broadest sense to mean a distinct nucleotide sequence that forms part of a chromosome, or that may form part of a chromosome, the order of which determines the order of monomers in a polypeptide or nucleic acid molecule.

[0213] Produce: As used herein, the verb "produce" and its conjugations are used in the broadest sense to mean a process for obtaining a particular product.

[0214] Genome: As used herein, the term "genome" is used in the broadest sense to mean all of the genetic material present in a cell.

[0215] Hepatitis Delta Virus (HDV) Ribozyme (RZ) Fold: As used herein, the term "HDV RZ fold" refers to an RNA sequence derived from the ribozyme of the Hepatitis Delta Virus (HDV) that retains ribozyme function.

[0216] Heterologous: As used herein, the term "heterologous" refers to a gene or protein sequence or structure that is not normally made in a cell when that gene or protein sequence or structure is introduced into that cell.

[0217] Homologous recombination: As used herein, the term "homologous recombination" refers to the process of transgene insertion that depends on homology between the transgene and the genome of the subject.

[0218] In vitro: As used herein, the term "in vitro" refers to reactions or processes that are performed outside a living cell or living organism.

[0219] In vivo: As used herein, the term "in vivo" refers to reactions or processes that take place within or on a living cell or living organism.

[0220] Inactive: As used herein, the term "inactive" as used in reference to a biomolecule means a form of the biomolecule that does not exhibit the properties and / or activity that characterize it.

[0221] Inactive Ingredient: As used herein, the term "inactive ingredient" refers to one or more agents that do not contribute to the activity of the active ingredient of the pharmaceutical composition contained in the formulation. In some embodiments, all of the inactive ingredients that may be used in the formulations of the present disclosure may be approved by the U.S. Food and Drug Administration (FDA), some of which may be approved by the FDA, and all of the inactive ingredients that may be used in the formulations of the present disclosure may not be approved by the FDA.

[0222] Induce: As used herein, the term "induce" and grammatical equivalents refer to a process that produces a particular result, without specific limitations to the steps.

[0223] Insertional template module: As used herein, the term "insertion template module" refers to an RNA construct that serves as an RNA template for the nrRT protein.

[0224] Introducing: As used herein, the term "introducing" refers to the addition of genetic material, often DNA, into a cell.

[0225] Insert: As used herein, the term "insert" refers to the addition of nucleotides to a DNA sequence.

[0226] Invasive Organism: As used herein, the term "invasive organism" refers to an organism that is reproducing outside of its native habitat.

[0227] Junction: As used herein, the term "junction" refers to the position at which the cDNA of a transgene inserted into the genome of a subject is joined to the DNA of the genome of the subject at the insertion site.

[0228] Lipid nanoparticle: As used herein, "lipid nanoparticle" or "LNP" refers to a delivery vehicle comprising one or more lipids (e.g., cationic lipids, non-cationic lipids, PEG-modified lipids).

[0229] Liposome: As used herein, "liposome" refers to a vesicle that is usually composed of one or more bilayers or spherical bilayers composed of lipids (eg, amphipathic lipids).

[0230] Loss of function: As used herein, the term "loss of function" refers to an alteration in a gene of interest that results in a gene product that lacks the function of the wild-type gene.

[0231] Mediate: As used herein means to produce a result (e.g., a physiological effect).

[0232] Modified: As used herein, "modified" means that a change has been made to the state or structure of a molecule. Molecules may be chemically, structurally, or functionally modified in a variety of ways.

[0233] Motif: As used herein, the term "motif" refers to a region of a biopolymer that has a recognizable structure, which may or may not be defined by a distinct chemical or biological function.

[0234] Naturally occurring: As used herein, the term "naturally occurring" refers to a wild-type or naturally occurring compound, biomolecule (eg, a protein or nucleic acid), or composition.

[0235] Non-long terminal repeat retroelement reverse transcriptase: As used herein, the term "non-long terminal repeat (non-LTR) retroelement reverse transcriptase (nrRT)" refers to a protein with reverse transcription activity derived from a non-LTR retroelement gene.

[0236] Non-LTR retroelement reverse transcriptase: As used herein, the term "non-LTR retroelement reverse transcriptase (nrRT)" refers to a protein having reverse transcription activity derived from a non-LTR retroelement.

[0237] Non-LTR type retroelements: As used herein, the term "non-LTR type retroelements" refers to a group of retroelement genes (also known as retrotransposons) that do not contain long terminal repeats.

[0238] nrRT module: As used herein, the term "nrRT module" refers to a biopolymer construct that includes or encodes at least one nrRT.

[0239] Outside: As used herein, the term "outside" in reference to an insertion site means any part of the genome more than about 60 bp away from the 5' or 3' end of the insertion site.

[0240] Cooperative reverse transcriptase (RT): As used herein, "cooperative RT" refers to a reverse transcriptase (RT) used in combination with at least one module, including an insertion template module. A module may be homogenous to its cooperating RT, meaning that all elements contained in this module and the RT are derived from the same retroelement gene. A module may not be homogenous to its cooperating RT, meaning that at least one element contained in this module is not derived from the same retroelement gene as the RT.

[0241] Peptide: As used herein, a "peptide" is 50 amino acids or less in length, e.g., about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length.

[0242] Pharmaceutical composition: As used herein, the term "pharmaceutical composition" means a composition that contains at least one active ingredient and may further contain one or more pharma- ceutically acceptable excipients.

[0243] Phylogenetic search: As used herein, the term "phylogenetic search" refers to a method that utilizes evolutionary relationships to select candidate sequences that can be used as components of an EIS.

[0244] Polyadenosine: As used herein, the term "polyadenosine" refers to an adenosine nucleotide sequence of any length.

[0245] Polyadenosine tail: As used herein, the term "polyadenosine tail" or "tail" refers to an adenosine nucleotide sequence of about 50 nucleotides or greater in length.

[0246] Polyadenosine strand: As used herein, the terms "polyadenosine strand," "poly A strand," and "A strand" (all abbreviated as PA) refer to the same thing, are used interchangeably, and refer to an adenosine nucleotide sequence of about 1 to 50 nucleotides in length.

[0247] Promoter: As used herein, the term "promoter" refers to a DNA sequence to which proteins bind and initiate transcription.

[0248] Proprotein: As used herein, the terms "protein precursor," "proprotein," and "propeptide" refer to an inactive protein that can be converted to an active form by post-translational modification.

[0249] Protect: As used herein, the term "protect" and grammatical equivalents refer to a composition or process that prevents the degradation of all or part of a biopolymer.

[0250] Protein: As used herein, "protein" refers to a biopolymer of amino acids that is greater than 50 amino acids in length. Examples of proteins, as used herein, include, but are not limited to, enzymes, reverse transcriptases, and endonucleases.

[0251] Recombinant RNA: As used herein, "recombinant RNA" refers to RNA produced by non-endogenous expression. "Synthetic RNA" refers to RNA not found in nature. "Nick" refers to the break in the phosphodiester backbone of one strand of a duplex. "Cut" refers to the break in the phosphodiester backbone of both strands of a duplex.

[0252] Reconstitution: As used herein, the term "reconstitution" refers to the process of assembling DNA samples from secondary materials to construct functional sequences.

[0253] Region: As used herein, the term "region" refers to a portion of a nucleotide sequence or a portion of an amino acid sequence. A region may be of unknown or undefined length, in which case it is defined by the function it exhibits or by its position relative to other elements in the sequence.

[0254] Retroelements / retrotransposons: As used herein, the terms "retroelements" and "retrotransposons" are used interchangeably to refer to a group of eukaryotic genes that can replicate at new locations within their own genome via an RNA intermediate.

[0255] Reverse transcriptase: As used herein, the term "reverse transcriptase" refers to a protein capable of synthesizing cDNA from an RNA template sequence.

[0256] Ribosomal DNA: As used herein, the term "ribosomal DNA (rDNA)" refers to the portion of a subject's genome that encodes ribosomal RNA.

[0257] Ribosomal RNA: As used herein, the term "ribosomal RNA (rRNA)" refers to the non-coding RNA that is the major component of the ribosome.

[0258] Reverse transcriptase primer extension: As used herein, "reverse transcriptase (RT) primer extension" refers to the process by which cDNA is synthesized by using the 3' end of a primer (usually a DNA oligonucleotide) that base pairs with a template polynucleotide to synthesize DNA complementary to the template.

[0259] Screening: As used herein, the term "screening" refers to the systematic search for particular gene sequences or particular protein sequences.

[0260] Segment: As used herein, the term "segment" refers to a portion of a sequence. For example, a segment of a nucleotide sequence may include any portion of a gene that is less than the entire length of the gene.

[0261] Selective: As used herein, the terms "selective" and "selectivity" refer to the tendency of a molecule, such as, but not limited to, an enzyme, enzymatic protein, or gene, to bind to another molecule of a very limited type, structure, protein sequence, or gene sequence.

[0262] Self-cleaving ribozyme: As used herein, the term "self-cleaving ribozyme" refers to a class of RNAs that catalyze sequence-specific intramolecular (or intermolecular) cleavage.

[0263] Selectivity: As used herein, "selectivity" refers to the degree of tendency of an nrRT to utilize non-cognate 5' or 3' template modules.

[0264] Sequence: As used herein, the term "sequence" refers to the order of amino acids written from the N-terminus to the C-terminus of a biopolymer or the order of nucleotides written from the 5' to the 3' end of a biopolymer.

[0265] Site-specific: As used herein, the term "site-specific" refers to a locus, for example, a locus consisting of a region of about 60 bp.

[0266] Stability: As used herein, the term "stability" refers to the ability of a composition to retain its properties over time.

[0267] TPRT has been performed: As used herein, the term "TPRT has been performed" means that a transgene has been inserted into a target site.

[0268] Suitable: As used herein, the term "suitable" means effective, efficient, or suitable for a particular purpose or use.

[0269] Synthetic: As used herein, the term "synthetic" means artificially manufactured, prepared and / or produced. Synthesis of polynucleotides or polypeptides or other molecules of the disclosure may be chemical or enzymatic.

[0270] Synthetic: As used herein, the term "synthetic" refers to an artificial molecular sequence that mimics the function and structure of a natural or wild-type sequence.

[0271] Target cell: As used herein, the term "target cell" refers to one or more cells of interest. A target cell may be present in vitro, in vivo or in situ, or in a tissue or organ of an organism. The organism may be an animal, preferably a mammal, more preferably a human, and most preferably a patient.

[0272] Target Primed Reverse Transcription (TPRT): As used herein, the term "target primed reverse transcription (TPRT)" refers to a process in which reverse transcriptase initiates cDNA synthesis by using the 3' end of available DNA at the target site as a primer.

[0273] Template: As used herein, the terms "template" and "RNA template" refer to an RNA sequence that is transcribed into cDNA by RT.

[0274] Template end: As used herein, the term "template end" refers to the 5' or 3' end of an RNA template.

[0275] Therapeutically effective: As used herein, the term "therapeutically effective" refers to a gene or gene product that is capable of treating or alleviating a therapeutic indication in a subject.

[0276] Transcription: As used herein, the term "transcription" refers to the formation or synthesis of an RNA molecule by RNA polymerase using a DNA molecule as a template.

[0277] Transfection: As used herein, the term "transfection" refers to a method of introducing exogenous nucleic acid into a cell. Transfection methods include, but are not limited to, chemical methods, physical treatments, and cationic lipids or cationic mixtures.

[0278] Transgene: As used herein, the term "transgene" refers to a gene that is inserted into the genome of a subject.

[0279] Transgene protein expression cassette: As used herein, the term "transgene protein expression cassette" refers to at least one gene of interest intended to be inserted into the genome of a subject and additional elements which may control the expression of the gene of interest.

[0280] Translation: As used herein, the term "translation" refers to the formation of a polypeptide molecule by ribosomes from an RNA template.

[0281] Treatment and prevention: As used herein, the terms "treat" or "prevent" and terms derived therefrom do not necessarily mean 100% or complete treatment or prevention. Indeed, there are various degrees of treatment or prevention that one skilled in the art would recognize as useful or likely to be therapeutic. Furthermore, "prevention" may include delaying the onset of a disease, its symptoms, or condition.

[0282] Unmodified: As used herein, the term "unmodified" refers to a substance, compound, or molecule before it has been altered in any way. "Unmodified" can refer to, but is not necessarily limited to, the wild-type or naturally occurring form of a biomolecule. A molecule may undergo multiple modifications, in which a modified molecule may be used as the "unmodified" starting molecule in a subsequent modification.

[0283] Vector: As used herein, the term "vector" refers to a molecule or moiety that transports, transduces, or acts as a carrier for a heterologous molecule.

[0284] VIII. Equivalence and Scope Those skilled in the art will recognize, and be able to ascertain using no more than routine experimentation, numerous equivalents to the specific embodiments of the disclosure described herein. The scope of the disclosure is not intended to be limited to the above description in the specification, but is instead defined in the appended claims.

[0285] In the claims, articles such as "a," "an," and "the" may mean one or more unless otherwise indicated or clear from the context. Any claim or description containing "or" between one or more elements in a group is deemed to mean that one, multiple, or all elements in the group are present in, used in, or relevant to a given product or process, unless otherwise indicated or clear from the context. The disclosure includes embodiments in which one element in a group is present in, used in, or relevant to a given product or process. The disclosure includes embodiments in which multiple elements or all elements in a group are present in, used in, or relevant to a given product or process.

[0286] It should also be noted that the term "comprising" is intended to be open-ended and allows for, but does not require, the inclusion of additional elements or steps. When the term "comprising" is used herein, "consisting of" is also included and disclosed.

[0287] When ranges are specified, the endpoints are included. Moreover, unless otherwise indicated or apparent in light of the context and the understanding of one of ordinary skill in the art, values ​​expressed as ranges will be understood to contemplate any specific value or subrange within the ranges set forth in various embodiments of the present disclosure, to the nearest tenth of the lower limit of the range, unless the context clearly dictates otherwise.

[0288] It will also be understood that certain embodiments of the present disclosure that fall within the prior art may be expressly excluded from any one or more of the claims. Such embodiments may be excluded even if the exclusion is not expressly set forth herein, since they are deemed known to those skilled in the art. Also, any particular embodiment of the composition of the present disclosure (e.g., any antibiotic, therapeutic agent or active ingredient; any method of manufacture; any method of use; etc.) may be excluded from any one or more of the claims for any reason, whether or not related to what exists in the prior art.

[0289] It will be understood that the words which have been used are for purposes of description rather than of limitation, and that changes may be made within the purview of the claims without departing from the true scope and spirit of the present disclosure in its broader form.

[0290] While the present disclosure has been described at some length and with a certain degree of specificity with respect to certain illustrated embodiments, the present disclosure is not intended to be limited to such specifics or embodiments or to any particular embodiment, but rather, with reference to the appended claims, in light of the prior art, is to be interpreted as providing the broadest possible interpretation of the claims, that is, as effectively encompassing the intended scope of the present disclosure.

[0291] The present disclosure is further illustrated by, but not limited to, the following examples. EXAMPLES

[0292] Example 1 In vitro RNA transcription (IVT) DNA templates for in vitro RNA transcription (IVT) were generated by PCR using Q5 DNA polymerase (NEB) and purified by column purification (Bio Basic). IVT reactions were performed in 25 μL reactions containing 1 μg of DNA template. The reaction mixture contained 40 mM Tris pH 7.9, 2.5 mM spermidine, 26 mM MgCl2, 0.01% Triton X-100, approximately 30 mM DTT, 8 mM GTP, 4 mM other rNTPs, 0.5 μL of RiboLock (Thermo Scientific), 0.5 μL of inorganic pyrophosphatase (NEB) and 0.5 μL of T7 polymerase (purified after bacterial overexpression and stored at 50 mg / mL in a solution containing 20 mM KPO4 pH 7.5, 100 mM NaCl, 50% glycerol, 10 mM DTT, 0.1 mM EDTA and 0.2% NaN3). The reaction mixture was incubated at 37 °C for 3-4 hours, after which 1 μL of DNase RQ1 (Promega), 1.5 μL of 20 mM CaCl2 and 2 μL of HO were added. The template was then purified by desalting (Roche miniquick spin columns), extraction with organic solvents and precipitation.

[0293] Example 2 nrRT Protein Screening Recombinant protein production and purification A plasmid expressing the modified nrRT from Bombyx mori (SEQ ID NO: 12), the modified nrRT from Drosophila simulans (SEQ ID NO: 13), or the modified nrRT from Oryzias latipes (SEQ ID NO: 14), or a plasmid expressing the inactive nrRT from O. latipes (SEQ ID NO: 15) with a mutation in the essential reverse transcriptase active site side chain, was transfected into HEK293T cells. All sequences contain the start codon AUG, and an artificial Kozak sequence is placed upstream of it so that translation is canonically initiated. In addition, a translation stop codon is placed following the 3'FLAG tag sequence.

[0294] Cells were lysed and lysates were harvested. RT protein was purified by binding to FLAG antibody-immobilized resin (Sigma) and elution. Parallel immunoblotting against the protein tag showed that similar amounts of proteins other than D. simulans RT were recovered, but the expression level of D. simulans RT was approximately 10-fold lower than that of the other RTs.

[0295] RT activity screening assay Each recombinant nrRT protein was 32 The primer annealed to the template with the 5′-end overhang was mixed with the template in a dNTP solution containing P-labeled dGTP (Perkin Elmer) at physiological temperature and allowed to react for a time sufficient for cDNA synthesis. Primer sequences: CAGCACTAGATTTTTGGGGTTGAATG (SEQ ID NO: 16) Template sequence: ATACCCGCTTAATTCATTCAGATCTGTAATAGAACTGTCATTCAACCCCAAAAATCTAGTGCTGATATAACCTTCACCAATTAGGTTCAAATAAGTGGTAATGCGGGACAAAAGACTATCGACATTTGATACACTATTTATCAATGGATGTCTTATTTTTTTT (SEQ ID NO: 17) Templates were prepared by IVT reaction as in Example 1. Reaction products were separated by denaturing PAGE, and the electrophoresed gels were imaged with a Typhoon Trio image analyzer.

[0296] As can be seen from the lanes labeled O, D, and B in Figure 5, the results of PAGE image analysis showed that the nrRTs from B. mori, D. simulans, and O. latipes were biochemically active and capable of cDNA synthesis. As expected, no cDNA products were observed in lane N, which contains the reaction products of dNTP obtained in the absence of RT protein / enzyme, and in lane O_RT-, which contains the reaction products of dNTP with the mutationally inactivated O. latipes nrRT.

[0297] Example 3 Interaction of nrRT+template 3'-side module In vivo nrRT assay to confirm 3'UTR specificity One of the plasmids expressing the modified nrRT proteins from B. mori, D. simulans, and O. latipes described in Example 1 was transfected into nine HEK293T cell populations in combination with another plasmid expressing the 3'UTR RNA of the R2 element from B. mori (SEQ ID NO: 18), D. simulans (SEQ ID NO: 19), or O. latipes (SEQ ID NO: 20) (see FIG. 6(A)). Each nrRT protein was co-expressed with the combined 3'UTR RNA.

[0298] After allowing sufficient time for the nrRT protein generated by transcription and translation of the nrRT protein plasmid to associate with the transcribed 3'UTR RNA, the cells were lysed and the nrRT protein + RNA template complex was purified by immunopurification using FLAG (Sigma FLAG antibody immobilized resin). The RNA present in each lysate before immunopurification and the RNA in each immunopurified sample were purified separately. Equal aliquots were taken from each of the pre-immunopurified RNA samples and each of the nrRT-bound RNA samples and spotted in a grid pattern on Hybond N+ membranes (Cytiva). To confirm that the desired 3'UTR RNA was present on the membranes containing spots of various 3'UTR RNAs, the desired 3'UTR RNAs were stained with T4 polynucleotide kinase (NEB). 32Hybridization was performed with complementary oligonucleotide probes radiolabeled at the 5' end with P to confirm the presence of B. mori 3'UTR sequences in samples of cells expressing the B. mori R2 3'UTR (probes for B. mori 3'UTR are CATCATGGATTAGGATCGGAAGACCCCCG (SEQ ID NO: 21), GTACGCCGGCGAAATTGGATCAGTAGATG (SEQ ID NO: 22), and GAGAAACAGACGGGCCTGATCTACACCC (SEQ ID NO: 23)). The presence of D. simulans 3'UTR sequences was confirmed in samples expressing the 3'UTR of D. simulans R2 (probes for D. simulans 3'UTR are CTATCTGAACCGAAGTTCCGCAACGCCTACGTAC (SEQ ID NO: 24), CACTGCGTGTGGTCAGTTTTCCTAGCATGCACG (SEQ ID NO: 25), and GATGTTATGCCAAGACAGCAAGCAAATGTTTTGAACCAAACG (SEQ ID NO: 26)). The presence of O. latipes 3'UTR sequences was confirmed in samples expressing the 3'UTR of O. latipes R2 (probes for O. latipes 3'UTR are TTGAGGCGAGTCACCACTCGCTTTCCGG (SEQ ID NO: 27) and GTGTCCGTCACGGGGACGACATCCGAGTG (SEQ ID NO: 28)).

[0299] As can be seen from Fig. 6(B), the modified nrRT protein of B. mori bound not only to the 3'UTR sequence of its homologue but also to the 3'UTR sequence of the R2 element of D. simulans or O. latipes, but the modified proteins of D. simulans and O. latipes showed higher selectivity. B. mori nrRT was found to exhibit relatively nonspecific RNA interaction in human cells.

[0300] In vitro TPRT assay The following in vitro TPRT assay was used throughout Example 2. nrRT protein was prepared in the same manner as in Example 1. Template RNA for TPRT was prepared by IVT reaction in the same manner as in Example 1. nrRT protein and template were mixed with double-stranded DNA (SEQ ID NO: 29 or SEQ ID NO: 30) consisting of target site oligonucleotides (target site length 64 bp or 84 bp) in a magnesium-containing reaction buffer containing dNTPs, and incubated at 37°C for 30 minutes to perform TPRT. The bottom strand of this double-stranded DNA was cleaved at the 5' end with T4 polynucleotide kinase (NEB). 32 The reaction products were separated by denaturing PAGE, and the gels were imaged on a Typhoon Trio image analyzer.

[0301] In vitro specificity of nrRT for the 3'UTR of its cognate template The nrRT proteins of B. mori, D. simulans and O. latipes were synthesized and purified in the same manner as described above. The template DNAs prepared were one with a T7 RNA polymerase promoter followed by the 3'UTR of O. latipes, and one with 4nt rRNA immediately downstream of the target site (SEQ ID NO: 31) and one without 4nt rRNA (SEQ ID NO: 32). The template DNAs prepared were one with a T7 RNA polymerase promoter followed by the 3'UTR of D. simulans, and one with 4nt rRNA immediately downstream of the target site (SEQ ID NO: 33) and one without 4nt rRNA (SEQ ID NO: 34). The template DNAs were used to generate template RNAs by IVT, which were purified and used in the in vitro TPRT assay.

[0302] Next, the above-described in vitro TPRT assay was performed using each nrRT in combination with each template construct.

[0303] D. simulans RT did not use the O. latipes 3'UTR for TPRT, and O. latipes RT did not use the D. simulans 3'UTR for TPRT, but B. mori RT used both 3'UTRs for TPRT (Fig. 7). B. mori RT copied the template nonspecifically by TPRT, unlike other R2 modified nrRT proteins, e.g., O. latipes R2(OrLa) RT and D. simulans R2(DrSi) RT.

[0304] This screen identified engineered nrRT proteins that displayed varying degrees of preference for their homologous 3'UTR as a template, differences that were not simply predicted by the primary sequence of each protein or by the relative levels of reverse transcriptase activity of proteins similarly expressed in human cells and purified.

[0305] Effect of 3' module modifications on the efficiency of nrRT in B. mori The nrRT protein of B. mori was synthesized and purified in the same manner as described above. The template constructs contained 3'UTR derived from B. mori, and included one type without rRNA following the 3'UTR (R26_BM3UTR, SEQ ID NO: 35), four types with 4nt rRNA immediately downstream of the target site following the 3'UTR (GG_BM3UTR_R4, SEQ ID NO: 36; GGG-R4_BM3UTR_R4, SEQ ID NO: 37; and R26_BM3UTR_R4, SEQ ID NO: 38), one type with 4nt rRNA and 20-25nt polyA tail following the 3'UTR (R26_BM3UTR_R4_PA, SEQ ID NO: 39), and one type with 20nt rRNA immediately downstream of the target site following the 3'UTR (R26_BM3UTR_R20, SEQ ID NO: 40). The template RNA was synthesized by IVT reaction in the same manner as in Example 1. Templates with an ID starting with R4 have a 4 nt 5' rRNA extension adjacent to the 5' end of the incorporated native element, and templates with an ID starting with R26 have a 26 nt 5' rRNA extension. Some of the above sequences have multiple guanosines (G) added to the 5' end to enhance transcription by T7 RNA polymerase.

[0306] In vitro TPRT assays were performed using the O. latipes nrRT protein in combination with each template as described above, using the 64-bp and 84-bp target sites.

[0307] As can be seen from Figure 8, the 3' end of the B. mori 3'UTR RNA did not significantly affect the efficiency of TPRT by B. mori RT. Thus, the 3' flanking rRNA was not required as a template for TPRT. However, when 20 nt 3' downstream rRNA was used, the fidelity of the 3' junction was reduced (circle position) due to the possibility of internal initiation, unlike the high fidelity observed in TPRT using a template with 4 nt 3'rRNA (arrow indicates region where 3' junction was formed with high fidelity). In other words, the 20 nt 3' flanking rRNA sequence was at a disadvantage compared to the 4 nt 3' flanking rRNA sequence. On the other hand, it is noteworthy that the efficiency and fidelity of synthesis of the correct product was not lost when the 3' flanking rRNA was extended with an adenosine chain longer than 20 nt.

[0308] Effect of 3' module modifications on the efficiency of nrRT in O. latipes The nrRT protein of O. latipes was synthesized and purified in the same manner as described above. The template constructs contained 3'UTR derived from O. latipes, and one type (R26_OL, SEQ ID NO: 41) without rRNA following the 3'UTR, two types (R4_OL_R4, SEQ ID NO: 42 and R26_OL_R4, SEQ ID NO: 43) with 4nt rRNA following the 3'UTR, one type (R26_OL_R20, SEQ ID NO: 44) with 20nt rRNA following the 3'UTR, and one type (R26_OL_R4_PA, SEQ ID NO: 45) with 4nt rRNA and polyA tail following the 3'UTR were prepared. The template RNA was synthesized by IVT reaction in the same manner as in Example 1. Templates with an ID starting with R4 have a 4 nt 5' extension of rRNA adjacent to the 5' end of the incorporated native element, and templates with an ID starting with R26 have a 26 nt 5' extension of rRNA adjacent to the 5' end of the incorporated native element.

[0309] In vitro TPRT assays were performed in the same manner as described above using the nrRT protein of O. latipes in combination with each template.

[0310] As can be seen in Figure 9(A), the O. latipes 3'UTR lacking the 3' extension by rRNA was not efficiently used for TPRT by the O. latipes RT, which is different from the results shown in Figure 8, which showed that the B. mori 3'UTR RNA lacking the 3' flanking rRNA was efficiently used for TPRT. Also, as with the B. mori construct, extending the 3' flanking rRNA with an adenosine stretch longer than 20 nt did not inhibit TPRT by the O. latipes RT.

[0311] This experiment was repeated using template constructs that did not contain the 5' rRNA extension and contained 0 nt 3' rRNA (R0-OL3-R0, SEQ ID NO: 46), 4 nt 3' rRNA (R0-OL3-R4, SEQ ID NO: 47), 8 nt 3' rRNA (R0-OL3-R8, SEQ ID NO: 48), 12 nt 3' rRNA (R0-OL3-R12, SEQ ID NO: 49), 16 nt 3' rRNA (R0-OL3-R16, SEQ ID NO: 50) or 20 nt 3' rRNA (R0-OL3-R20, SEQ ID NO: 51). Template RNAs were synthesized as described for the in vitro TPRT assay.

[0312] As can be seen in Figure 9(B), the results confirmed the previous findings: the absence of the 3' extension of rRNA resulted in insufficient copy amount and inappropriate internal initiation by the O. latipes RT, whereas the presence of 4-nt rRNA was sufficient to improve the accuracy of TPRT and 3' binding.

[0313] Tribolium castaneum nrRT protein The nrRT protein from T. castaneum was synthesized and purified using an expression plasmid (SEQ ID NO: 52) in the same manner as described above. The template constructs include R25-UTR-R4 (SEQ ID NO: 53), which has the native 3'UTR of T. castaneum R2 flanked by 25 nt 5'rRNA and 4 nt 3'rRNA, R25-UTR-R4_PA (SEQ ID NO: 54), which has 25 nt 5'flanking rRNA and 4 nt 3'flanking rRNA followed by 20-25 nt tandem adenosine A strands, and R25-UTR-R10 (SEQ ID NO: 55), which has 25 nt 5'flanking rDNA and 10 nt 3'rRNA. Template RNA was synthesized in the same manner as described for the in vitro TPRT assay.

[0314] In vitro TPRT assay was performed as described above.

[0315] As can be seen from Figure 10, TPRT by T. castaneum nrRT showed that nrRT was biochemically active and reacted with the cognate 3'UTR to perform efficient TPRT at the target site. Furthermore, extension of the 3'-flanking rRNA with an adenosine tract longer than 20 nt did not inhibit TPRT. No significant effect was observed even when the 3'rRNA length exceeded 4 nt.

[0316] Example 4 In vivo template insertion O. latipes 293T cells were transfected to express a protein (SEQ ID NO: 14) that was modified from the ORF of the O. latipes R2 retroelement with one translation initiation codon AUG sequence. The RNA obtained by in vitro transcription with T7 RNA polymerase was then transfected into the same cells to serve as a template for TPRT at the R2 target site of 28S rDNA.

[0317] Template RNAs were prepared that contained the 3'UTR of the O. latipes element and the 5' region of O. latipes, and those that did not contain the 5' region of O. latipes. The 5' region of O. latipes extends from the 5' end of the self-cleaving ribozyme (leaving 26 nt of 5' adjacent rRNA) to the 5'UTR and may extend into the natural ORF region (corresponding to SEQ ID NO: 56 and SEQ ID NO: 57, respectively, since the actual translation start site was unknown). In the template RNAs that had the 3'UTR but not the 5'UTR, no retroelement sequence was added to the 5' end of the RNA, and the rRNA sequence was retained at the 5' junction of the natural retroelement. The 3'UTR was present at the 3' end of the template RNA, and a 4 nt rRNA sequence was present downstream of the 3' insertion junction.

[0318] To detect the 3' insertion junction, which indicates TPRT in the 28S rDNA, we performed a first round of PCR and a nested PCR using genomic DNA from the transfected cell pool and primers that overlap the predicted junction between the 3' end of the template and the 5' end of the target 28S rDNA.

[0319] The first PCR primers were as follows: Forward primer: GACAGCTGGGAGTCTCGGCATG (SEQ ID NO:58) Reverse primer: CCGTTCCCTTGGCTGTGGTTTCGC (SEQ ID NO:59) The nested PCR primers are as follows: Forward primer: AAAAGCTGGGTACCGGGCCCCAAATCTTGCGCTGCACTCGGATG (SEQ ID NO: 60) Reverse primer: ATTGGAGCTCCACCGCGGTGCCATTCATGCGCGTCACTAATTAGATGAC (SEQ ID NO: 61)

[0320] Detection of the desired product was dependent on both expression of the RT protein and transfection of the RNA template (Figure 11). Sequence analysis revealed that the desired product was the correct junction that matched that of the genomic sequence of the endogenous R2 element.

[0321] Genomic DNA from the transfected cell pool was amplified by PCR using the following primers, which overlap the predicted binding site between the 3' end of the target 28S rDNA and the 5' end of the template. Forward primer: CTAGCAGCCGACTTAGAACTGGTGCGG (SEQ ID NO: 62) Reverse primer: CTTGAGGCGAGTCACCACTCGC (SEQ ID NO: 63)

[0322] This process detected the 5' insertion junction and confirmed that TPRT had taken place in the 28S rDNA. Detection of the desired product, i.e., the correct junction matching that of the genomic sequence of the endogenous R2 element, depended on both expression of the RT protein and transfection of the desired RNA template for TPRT (Figure 12).

[0323] Sequence analysis revealed that most 5' and 3' junctions in 293T cells were seamless junctions between the template element sequences and rDNA, with no overlapping rRNA sequences present in both the target site in 293T cells and the transgene template RNA. The desired product was detected only when both RT protein expression and RNA template transfection occurred (Figure 12).

[0324] T. castaneum 293T cells were transfected to express a protein (SEQ ID NO: 52) engineered from one of three strains of R2 of T. castaneum (TriCas) with a synthetic sequence ORF that displays a single translation initiation codon AUG. The RNA obtained by in vitro transcription with T7 RNA polymerase was then transfected into the same cells to serve as a template for TPRT at the R2 target site of 28S rDNA.

[0325] Template RNAs containing the 3'UTR of the T. castaneum element, with or without the 5' region, were examined in this experiment. The 5' region extends from the 5' end of the self-cleaving ribozyme through the top strand site of the human genome opposite the first nick on the bottom strand (designed to leave 13 nt of 5' flanking rRNA that matches the human genome but not the Tribolium genome), to the 5'UTR of T. castaneum. The 5' region is thought to extend into the ORF region, but the actual translation initiation site was unknown. The 3' end of the template RNA consists of 4 nt rRNA, 4 nt rRNA with 20-25 nt polyA tail (PA), or 10 nt rRNA. An overview of the template constructs and their sequences is shown in Table 1. [Table 1]

[0326] To detect the 3' insertion junction indicative of TPRT in the 28S rDNA, genomic DNA from the transfected cell pool was amplified by PCR using the following primers (Figure 13). Forward primer: CTCCTGACCAACTAGCTCACTGACTAATTTTAAAC (SEQ ID NO: 70) Reverse primer: CCACTTATTCTACACCTCTCATGTCTCTTCACCG (SEQ ID NO: 71) The formation of the 3' junction was confirmed only when both RT protein expression and transfection of the RNA template occurred. The 5' module improved the efficiency and specificity of the 3' junction formation, as did the addition of a polyA tail after the 4 nt rRNA sequence following the 3' UTR.

[0327] To detect the 5' insertion junction indicative of TPRT in the 28S rDNA, genomic DNA from the transfected cell pool was amplified by PCR using the following primers (Figure 14). Forward primer: CTAGCAGCCGACTTAGAACTGGTGCGG (SEQ ID NO: 62) Reverse primer: CTTCGTCTTCGGAATCCATGTCCATAGC (SEQ ID NO: 72) The 5' insertion junction was detected only when both RT protein expression and RNA template transfection occurred. A 3' module containing a 4-nt rRNA sequence followed by a poly(A) tail increased the efficiency and specificity of 5' junction formation.

[0328] The 5' module, which contains a form of the T. castaneum R2 retroelement RZ, significantly improved the efficiency and accuracy of 5' and 3' insertion ligation of transgenes by TriCas RT (Figures 13 and 14). The 5'RZ self-cleaves 13 nt upstream (-13) of the position of the first nick in the bottom strand, leaving 13 nt of foreign 5' flanking rRNA that matches the human genome but not the T. castaneum genome, which is an additional nt from the 5' ligation of the native T. castaneum element.

[0329] Puromycin resistance HEK293T cells were transfected with a pcDNA3.1 plasmid vector expressing D. simulans R2 with a synthetic sequence ORF showing one translation initiation codon AUG (SEQ ID NO: 13), a pcDNA3.1 plasmid vector expressing O. latipes R2 with a synthetic sequence ORF showing one translation initiation codon AUG (SEQ ID NO: 14), or an empty pcDNA3.1 plasmid vector (SEQ ID NO: 73). Three days later, the same cells were transfected with purified template RNA prepared by IVT encoding a transgene conferring puromycin resistance (SEQ ID NO: 74). On the fourth day, the cells were transferred to selection medium containing 0.75 μg / ml puromycin. After about 15 cell divisions in the selection medium, the cells were harvested and genomic DNA was extracted. In Figure 15, the lane marked "low" indicates a cell population that has undergone 5 to 10 fewer cell divisions than the harvest time of the lane without a label, and the lane marked "high" indicates a cell population that has undergone 5 to 10 more cell divisions than the harvest time of the other lanes. The presence of the template RNA sequence copied into DNA was confirmed by amplifying a partial region of the exogenous puromycin resistance cassette using a PCR assay.

[0330] Once the template RNA is copied and introduced, it provides an RNAP II expression cassette for the puromycin resistance protein (Figure 15). The template RNA also contains the 5' region of O. latipes R2, which extends from the 5' end of the self-cleaving ribozyme (leaving 26 nt of 5' flanking rRNA behind), and the retroelement 3' UTR, homologous to RT. The 3' end of the template RNA contains either 4 nt or 20 nt of 3' flanking rRNA, with or without a polyA tail (data not shown). An overview of the template constructs and their sequences is given in Table 2. [Table 2]

[0331] To detect the inserted puromycin resistance cassette sequence, genomic DNA of the transfected cell pool was amplified by PCR using the following primers: Forward primer: CACCGAGCTGCAAGAACTCTTCCTCACG (SEQ ID NO: 79) Reverse primer: CTTGCGGGTCATGCACCAGGTGC (SEQ ID NO: 80) The obtained PCR product indicated that TPRT had been carried out using the introduced gene as a template.

[0332] The inserted transgene was strongly detected in cultures transfected with transgene RNA templates containing the 3'UTR and 5'region of O. latipes R2 together with variants of the O. latipes R2 RT protein, and also in cell cultures transfected with transgene RNA templates containing the 3'UTR of D. simulans R2 and the 5'region of the non-cognate O. latipes R2 together with variants of the D. simulans R2 RT protein (Figure 15).

[0333] When the D. simulans RT was combined with directly introduced cognate 5′UTR and 3′UTR, a D. simulans transgene template, and a D. simulans 5′RZ, insertion of the transgene into the rDNA of human cells (and associated detection) was not efficient (data not shown).

[0334] It was unexpected that the use of the O. latipes 5′ RNA region containing the heterologous RZ improved the efficiency of transgene insertion and fidelity of ligation (use of the heterologous 5′ module is shown in Figure 15 ).

Claims

1. A system that operates to insert a biologically active DNA element (via an RNA intermediate) into a target site within a target cell genome, comprising: a nrRT module that generates an active non-long terminal repeat (non-LTR) retrotransposon reverse transcriptase protein (nrRT) in the target cell; and an insert mold module; the nrRT module comprises a nucleic acid encoding an R2 retroelement protein; wherein the insertion template module comprises RNA, modified RNA or other nucleic acid that is used as a template for cDNA synthesis by the R2 retroelement protein to synthesize at least one strand of a biologically active DNA element at a target site in the target cell by target primed reverse transcription (TPRT); the 5' region and the R2 retroelement protein are not homologous; or A system in which the 3' untranslated region (3' UTR) and the R2 retroelement protein are not homologous.

2. The system of claim 1, wherein the R2 retroelement protein is derived from Bombyx mori, Drosophila simulans, Tribolium castaneum or Oryzias latipes.

3. The system of claim 1 or 2, wherein the R2 retroelement protein comprises a sequence selected from any one of SEQ ID NOs: 1 to 4.

4. The system according to any one of claims 1 to 3, wherein the 5' region is derived from an R2 retroelement sequence of Bombyx mori, Drosophila simulans, Tribolium castaneum or Oryzias latipes.

5. The system according to any one of claims 1 to 3, wherein the 3' UTR is derived from an R2 retroelement sequence of Bombyx mori, Drosophila simulans, Tribolium castaneum or Oryzias latipes.

6. The system of any one of claims 1 to 5, wherein the nucleic acid encoding the R2 retroelement protein is an mRNA, modified mRNA or other nucleic acid that is translated with or without intracellular processing.

7. The system of any one of claims 1 to 6, wherein the insertion template module comprises one or more terminal structures that protect the introduced template RNA from degradation.

8. The system of claim 7 , wherein the insertion template module comprises a 5′ adjacent self-cleaving ribozyme motif.

9. The system of claim 7 or 8, wherein the insertion template module comprises a 3' flanking polyadenosine sequence.

10. A cell comprising the system according to any one of claims 1 to 9.

11. 1. A method for introducing a transgene into a eukaryotic genome of a target cell, comprising the steps of: using a modified R2 retroelement protein, wherein the modified R2 retroelement protein-mediated target primed reverse transcription (TPRT) results in insertion of the transgene into the ribosomal DNA (rDNA) of the human cell using a directly introduced RNA template; the 5' region of the RNA template and the R2 retroelement protein are not homologous; or wherein the 3' UTR of the RNA template and the R2 retroelement protein are not homologous; A method that is not a method of treating the human or animal body by surgery or therapy.

12. A system according to any one of claims 1 to 9 or a cell according to claim 10 for use in therapy.

Images