Co-regeneration of difficult-to-regenerate plants

Abstract

The present invention relates to a method for producing a shoot of a plant comprising a germline progenitor cell of a difficult to regenerate plant, the germline progenitor cell being optionally modified to contain a mutation in a sequence of interest. The present invention further relates to a plant obtainable by the method of the invention, the plant preferably comprising at least the L2 meristem layer of the difficult to regenerate plant.

Description

[Technical field]

[0001] The present invention relates to the field of molecular plant biology, in particular to the field of plant regeneration. The present invention relates to a method for improving the regeneration potential and / or efficiency of plants. [Background technology]

[0002] Many plant biotechnology workflows require the regeneration of whole plants from single cells. The regeneration step is often a critical bottleneck in such workflows, since plant cells generally have limited regeneration capacity. Regeneration potential is highly dependent on the plant species, plant cultivar, and plant tissue origin. Even with established protocols, the percentage of cells that are successfully regenerated into plants is usually quite low (Srinivasan et al., Planta 2007, 225:341-351). Plant species or cultivars that fail to regenerate or are inefficient are considered recalcitrant.

[0003] Non-limiting examples of workflows where regeneration is a bottleneck are the general propagation of plant material (clonal propagation), especially in the case of haploid plant material or genetically complex (e.g. high ploidy and heterozygous) F1 populations, but also more advanced plant biotechnology workflows such as, but not limited to, targeted plant genome editing, generation of transformants (stable or transient) and doubled haploid derivation.

[0004] Genome editing (GE) with CRISPR / Cas9 or related technologies ranks among a handful of major technological breakthroughs in agricultural biotechnology, potentially allowing for the rapid and efficient creation of directed heritable mutations in plants, which could facilitate the transfer of improved traits to crops. This technology is expected to take off in the next decade and have a significant impact on crop improvement and breeding research and development. To obtain plants carrying heritable mutations, the mutations can be introduced into plant protoplasts, which can then be regenerated into plants. A significant obstacle to this technology is the inability and / or genotype-dependent nature of many crop species to regenerate whole plants from a single edited cell. The latter is a key unsolved factor for the application of GE, especially as GE is moving towards DNA-free systems that rely primarily on delivery to protoplasts (Zhang et al. 2021 Plant Communications 2(100168)p1-p13).

[0005] An alternative approach is to inoculate plants with vectors that induce heritable mutations, such as viral vectors. A major limitation of this approach is that in many systems, viruses are actively excluded from the shoot apical meristem (SAM) and silenced by powerful post-transcriptional gene silencing mechanisms. Thus, only somatic editing can be achieved, and such edits are typically not directly transmitted to progeny, since reproductive tissues arise from the meristem. Therefore, this process would also benefit from improved regeneration protocols. Summary of the Invention [Problem to be solved by the invention]

[0006] Thus, there is a strong need in the art to improve the efficiency of regeneration of plants, preferably of plants that are difficult to regenerate, and in particular, to improve the efficiency of regeneration of plants carrying heritable mutations. [Means for solving the problem]

[0007] The present invention can be summarized in the following embodiments:

[0008] Embodiment 1. A method for generating and selecting shoots of a plant body, comprising: (a) contacting cells of a difficult-to-regenerate plant with cells of a regenerable plant, wherein under conditions permissive for shoot regeneration, the cells of the regenerable plant exhibit a higher regeneration efficiency than the cells of the difficult-to-regenerate plant; (b) allowing the contacted cells of step (a) to form one or more shoots under conditions permissive for shoot regeneration; (c) selecting the shoots formed in step (b), wherein at least a portion of the shoots are composed of cells of the difficult-to-regenerate plant; and optionally (d) growing a plant from the selected shoot of step (c). The method includes:

[0009] Embodiment 2. The method of embodiment 1, wherein in step (c) the selected shoot portion consisting of cells of the difficult to regenerate plant is a tissue containing germline progenitor cells, and optionally the method further comprises step (d) and obtaining seeds or plant progeny of the plant grown in step (d) by sexual propagation, optionally by selfing or backcrossing.

[0010] Embodiment 3. The method according to embodiment 1 or 2, wherein the shoots selected in step (c) consist of cells of a difficult-to-regenerate plant, and optionally the method further comprises step (d) and obtaining a progeny of the plant grown in step (d) by vegetative propagation.

[0011] Embodiment 4. The method according to any one of embodiments 1 to 3, wherein the cells of the difficult-to-regenerate plant and the cells of the regenerable plant in step (a) are isolated cells, preferably protoplasts.

[0012] Embodiment 5. The method according to embodiment 4, wherein the isolated cells in step a) are exposed to a compound that promotes the aggregation of the cell membranes of the cells, preferably by using a plant cell and / or protoplast linking agent, and preferably the linking agent is Yariv's reagent.

[0013] Embodiment 6. The method according to any one of embodiments 1 to 3, wherein the cells of the difficult-to-regenerate plant body and the cells of the regenerable plant body in step (a) are contained in a tissue.

[0014] Embodiment 7. The method of embodiment 6, wherein step (a) is carried out by using a rootstock-scion grafting method and allowing the graft joint to heal.

[0015] Embodiment 8. Step (b) is - creating a wound at or near the graft junction; - allowing callus to form at the wounded graft joint; and - growing a shoot from said callus 8. The method of embodiment 7, comprising:

[0016] Embodiment 9. The cells of the difficult-to-regenerate plant body in step (a) or the cells of the shoot formed in step (b) originating therefrom are (i) a transgene; or (ii) a mutation in the sequence of interest 9. The method of any one of the preceding claims, further comprising introducing:

[0017] Embodiment 10. The method of embodiment 9, wherein the step of introducing a transgene or mutation precedes step (b), and optionally precedes step (a).

[0018] Embodiment 11. The transgene or mutation is present in the shoot formed in step (b). - germline progenitor cells and / or germline cells derived therefrom; and - plant parts of the plants grown in step (d) used for vegetative propagation, 11. The method according to embodiment 9 or 10, comprising at least one of:

[0019] Embodiment 12. The method according to any one of embodiments 9 to 11, wherein the mutation is introduced by programmed genome editing, preferably using a site-specific endonuclease, preferably a CRISPR endonuclease.

[0020] Embodiment 13. A plant obtainable by the method according to any one of embodiments 9 to 12, i) germline progenitor cells of a plant that is difficult to regenerate and / or germline cells derived therefrom; and ii) Plant parts for clonal propagation of difficult-to-regenerate plants In a plant body containing at least one of A plant, wherein the germline progenitor cells, germline cells and / or plant parts contain a mutation in a transgene or sequence of interest.

[0021] Embodiment 14. The plant body described in embodiment 13, wherein the plant body comprises cells of a plant body that is difficult to regenerate and cells of a plant body that can regenerate.

[0022] Embodiment 15. Use of an agent that connects the cell membrane of a cell of a difficult-to-regenerate plant to a cell of a regenerable plant for regenerating said cell of a difficult-to-regenerate plant, preferably said agent being Yariv's reagent.

[0023] definition Throughout the specification and claims, various terms are used in connection with the methods, compositions, uses and other aspects of the invention. Such terms are to be given their ordinary meaning in the art to which the invention pertains, unless otherwise indicated. Other specifically defined terms are to be construed in a manner consistent with the definitions provided herein.

[0024] It will be apparent to one skilled in the art that any methods and materials similar or equivalent to those described herein can be used to practice the present invention.

[0025] The method of carrying out the conventional techniques used in the methods of the present invention will be clear to those skilled in the art. The practice of conventional techniques in molecular biology, biochemistry, computational chemistry, cell culture, recombinant DNA, bioinformatics, genomics, sequencing and related fields is well known to those skilled in the art and is discussed, for example, in the following references: Sambrook et al. Molecular Cloning. A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989; Ausubel et al. Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1987 and regularly updated; and the series Methods in Enzymology, Academic Press, San Diego.

[0026] The singular terms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a cell" includes a combination of two or more cells, and the like. Thus, the indefinite article "a" or "an" generally means "at least one."

[0027] The term "and / or" refers to a situation in which one or more of the stated cases may occur alone or in combination with at least one of the stated cases, up to and including all of the stated cases.

[0028] As used herein, the term "about" is used to express and take into account small variations. For example, the term can refer to ± (+ or -) 10% or less, for example, ± 5% or less, ± 4% or less, ± 3% or less, ± 2% or less, ± 1% or less, ± 0.5% or less, ± 0.1% or less, or ± 0.05% or less. In addition, amounts, ratios, and other numerical values ​​are presented in this specification in the form of a range. It should be understood that such range formats are used for convenience and brevity, and include numerical values ​​that are explicitly specified as range limits, but should be flexibly understood to also include any individual numerical values ​​or subranges encompassed within the range, as if each numerical value and subrange were explicitly specified. For example, a ratio in the range of about 1 to about 200 includes the explicitly recited limits of about 1 and about 200, but should be understood to also include individual ratios such as about 2, about 3, and about 4, as well as subranges such as about 10 to about 50, about 20 to about 100, etc.

[0029] The term "comprising" is intended to be inclusive and open-ended, not exclusive. Specifically, this term and its variations mean that the specified features, steps, or components are included. These terms should not be interpreted as excluding the presence of other features, steps, or components.

[0030] The terms "protein" or "polypeptide" are used interchangeably and refer to a molecule consisting of a chain of amino acids, regardless of its specific mode of action, size, three-dimensional structure, or origin. Thus, a "fragment" or "portion" of a protein can still be referred to as a "protein." An "isolated protein" is used to refer to a protein that is no longer in its natural environment, for example in vitro or in a recombinant bacterial or plant host cell.

[0031] "Plant" refers to any whole plant or any part of a plant tissue or organ available from a plant (e.g., pollen, seeds, roots, leaves, flowers, flower buds, anthers, fruits, etc.), as well as any derivatives and progeny derived from such a plant by selfing or crossing or apomixis. Non-limiting examples of plants include African eggplant, garlic, artichoke, asparagus, barley, sugar beet, bell pepper, bitter melon, ground cherry, bottle gourd, cabbage, canola, carrot, cassava, cauliflower, celery, chicory, kidney bean, corn salad, cotton, cucumber, eggplant, endive, fennel, gherkin, grape, chili pepper, lettuce, corn, melon, oilseed rape, okra, parsley, and the like. Crop plants and cultivated plants include, for example, parsnip, pepino, chili pepper, potato, pumpkin, radish, rice, loofah, rocket, rye, snake gourd, sorghum, spinach, loofah, pumpkin, sugar beet, sugar cane, sunflower, tomatillo, tomato, tomato rootstock, Brassica vegetables, watermelon, wax gourd, wheat, and zucchini.

[0032] "Plant cells" include protoplasts, gametes, suspension cultures, microspores, pollen grains, etc., originating from a plant, either isolated or within a tissue, organ or organism. A plant cell may be part of a multicellular structure, such as, for example, a callus, a meristem, a plant organ or an explant. A plant cell may be a meristematic cell, a somatic cell and / or a reproductive cell.

[0033] "Similar conditions" for the cultivation of plants / plant cells means, inter alia, similar temperature, humidity, nutrient and light conditions, as well as the use of similar watering and light / dark cycles.

[0034] The terms "homology", "sequence identity" and the like are used interchangeably herein. Sequence identity is defined herein as the relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleotide (polynucleotide) sequences, as determined by comparing their sequences. In the art, "identity" also means the degree of sequence relatedness between amino acid sequences or nucleic acid sequences, as the case may be, as determined by the match between a stretch of such sequences. "Similarity" between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. "Identity" and "similarity" can be readily calculated by known methods. The sequence identity / similarity percentage can be determined over the entire length of the sequences.

[0035] As used herein, "sequence identity" refers to the degree to which two optimally aligned polynucleotide or peptide sequences are consistent over the entire alignment window of elements, e.g., nucleotides or amino acids. The "percent identity" for an aligned section of a test sequence and a reference sequence is the number of identical elements shared by the two aligned sequences divided by the total number of elements in the reference sequence section, i.e., the entire reference sequence or a smaller defined portion of the reference sequence. The "percent identity" is the percent identity multiplied by 100.

[0036] "Sequence identity" and "sequence similarity" can be determined by alignment of two peptide or two nucleotide sequences using global or local alignment algorithms depending on the length of the two sequences. Sequences of similar length are preferably aligned using a global alignment algorithm (e.g., Needleman Wunsch) that optimally aligns the sequences over their entire length, while sequences of substantially different lengths are preferably aligned using a local alignment algorithm (e.g., Smith Waterman). Thus, sequences may be referred to as "substantially identical" or "essentially similar" when they share at least a certain minimum percentage of sequence identity (as defined herein) (e.g., when optimally aligned using default parameters with the programs GAP or BESTFIT). Percent sequence identity is preferably determined using the "BESTFIT" or "GAP" programs of the Sequence Analysis Software Package™ (Version 10; Genetics Computer Group, Inc., Madison, Wis.). GAP uses the Needleman and Wunsch global alignment algorithm (Needleman and Wunsch, Journal of Molecular Biology 48:443-453, 1970) to align two sequences over their entire length (full length) in a way that maximizes the number of matches and minimizes the number of gaps. Global alignment is preferably used to determine sequence identity when two sequences have similar lengths. Typically, the GAP default parameters are used: gap creation penalty = 50 (nucleotides) / 8 (protein) and gap extension penalty = 3 (nucleotides) / 2 (protein).For nucleotides the default scoring matrix used is nwsgapdna and for proteins the default scoring matrix is ​​Blosum62 (Henikoff & Henikoff, 1992, PNAS 89, 915-919). Sequence alignments and scores for sequence identity percentages may be determined using computer programs such as the GCG Wisconsin Package, version 10.3, available from Accelrys Inc., 9685 Scranton Road, San Diego, CA 92121-3752 USA, or open source software such as the programs "needle" (which uses the global Needleman-Wunsch algorithm) or "water" (which uses the local Smith-Waterman algorithm) of EmbossWIN, version 2.10.0, using the same parameters as GAP above or using default settings (for both "needle" and "water", and for both protein and DNA alignments, the default gap opening penalty is 10.0 and the default gap extension penalty is 0.5; the default scoring matrices are Blossum62 for proteins and DNAFull for DNA). The gap extension penalty is 0.5; the default scoring matrices are Blossum62 for proteins and DNAFull for DNA). "BESTFIT" performs an optimal alignment of the best similarity intervals between two sequences and inserts gaps to maximize the number of matches using the Smith-Waterman local homology algorithm (Smith and Waterman, Advances in Applied Mathematics, 2:482-489, 1981; Smith et al., Nucleic Acids Research 11:2205-2220, 1983). When sequences have substantially different overall lengths, local alignments, such as those using the Smith-Waterman algorithm, are preferred.

[0037] Useful methods for determining sequence identity are also disclosed in Guide to Huge Computers, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo, H., and Lipton, D., Applied Math (1988) 48:1073. More particularly, preferred computer programs for determining sequence identity include the Basic Local Alignment Search Tool (BLAST) program, publicly available from the National Center for Biotechnology Information (NCBI), National Library of Medicine, National Institutes of Health, Bethesda, Md. 20894; see BLAST Manual, Altschul et al., NCBI, NLM, NIH; Altschul et al., J. Mol. Biol. 215:403-410 (1990); version 2.0 and above of the BLAST program allow the introduction of gaps (deletions and insertions) in the alignment; for peptide sequences, BLASTX can be used to determine sequence identity; and for polynucleotide sequences, BLASTN can be used to determine sequence identity.

[0038] Alternatively, the similarity or identity percentage may be determined by searching public databases using algorithms such as FASTA, BLAST, etc. Thus, the nucleic acid and protein sequences described herein can also be used as "query sequences" to perform searches of public databases to, for example, identify other family members or related sequences. Such searches can be performed using the BLASTn and BLASTx programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to the nucleic acid molecules described herein. BLAST protein searches can be performed with the BLASTx program, score=50, wordlength=3 to obtain amino acid sequences homologous to the protein molecules described herein. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., BLASTx and BLASTn) can be used. See the National Center for Biotechnology Information home page at http: / / www.ncbi.nlm.nih.gov / .

[0039] "Nucleic acid" or "polynucleotide" as used herein may include any polymer or oligomer of pyrimidine and purine bases, preferably cytosine, thymine, and uracil, and adenine and guanine, respectively (see Albert L. Lehninger, Principles of Biochemistry, at 793-800 (Worth Pub. 1982), which is incorporated herein by reference in its entirety for all purposes). Any deoxyribonucleotide, ribonucleotide, or nucleic acid moiety is contemplated, as well as any chemical variant thereof, such as methylated, hydroxymethylated, or glycosylated forms of these bases. The polymers or oligomers may be heterogeneous or homogeneous in composition, isolated from naturally occurring sources, or artificially or synthetically produced. In addition, the nucleic acid may be DNA (optionally cDNA) or RNA, or a mixture thereof, and may exist permanently or transiently in single-stranded or double-stranded form, including homoduplexes, heteroduplexes, and hybrid states.

[0040] "Isolated nucleic acid" is used to refer to a nucleic acid that is no longer in its natural environment, for example in vitro or in a recombinant bacterial or plant cell. The nucleic acid and / or protein may be at least one of a recombinant, synthetic or artificial nucleic acid and / or protein.

[0041] The terms "nucleic acid construct," "nucleic acid vector," "vector," and "expression construct" are used interchangeably herein and are defined herein as an artificially created nucleic acid molecule that results from the use of recombinant DNA technology. Thus, the terms "nucleic acid construct" and "nucleic acid vector" do not include naturally occurring nucleic acid molecules, although a nucleic acid construct may include (a portion of) a naturally occurring nucleic acid molecule.

[0042] The vector backbone can be, for example, a binary or super binary vector (see, e.g., U.S. Pat. No. 5,591,616, U.S. Patent Application Publication No. 2002138879 and WO 95 / 06722), a cointegration vector or a T-DNA vector into which the chimeric gene is integrated, or, if suitable transcriptional regulatory sequences are already present, into which only the desired nucleic acid sequence (e.g., coding sequence, antisense or inverted repeat sequence) is integrated downstream of the transcriptional regulatory sequence, as known in the art and described elsewhere herein. The vector can contain additional genetic elements to facilitate its use in molecular cloning, such as, for example, selectable markers, multiple cloning sites, etc.

[0043] The term "gene" refers to a DNA fragment that includes a region that is transcribed into an RNA molecule (e.g., mRNA) in a cell (transcription region) operably linked to a suitable regulatory region (e.g., promoter). A gene will usually include several operably linked fragments, such as a promoter, a 5' leader sequence, a coding region, and a 3' untranslated sequence (3' end) that includes a polyadenylation site.

[0044] "Gene expression" refers to the process by which a DNA region that is operably linked to appropriate regulatory regions, particularly a promoter, is transcribed into RNA that is biologically active, e.g., RNA capable of being translated into a biologically active protein or peptide, or, e.g., regulatory non-coding RNA.

[0045] The term "operably linked" refers to the linkage of polynucleotide elements in a functional relationship. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, a promoter, or rather a transcriptional regulatory sequence, is operably linked to a coding sequence if it affects the transcription of the coding sequence. Operably linked can mean that the DNA sequences that are linked are contiguous.

[0046] "Promoter" refers to a nucleic acid fragment that functions to control the transcription of one or more nucleic acids. A promoter fragment is preferably located upstream (5') from the transcription start site of a gene in the direction of transcription, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, a transcription start site, and may further include any other DNA sequence, including but not limited to, transcription factor binding sites, repressor and activator protein binding sites, and any other nucleotide sequence known to those of skill in the art that acts to directly or indirectly regulate the amount of transcription from a promoter.

[0047] A "constitutive" promoter is a promoter that is active in most tissues under most physiological and developmental conditions. An "inducible" promoter is a promoter that is physiologically regulated (e.g., by exogenous application of certain compounds) or developmentally regulated. A "tissue-specific" promoter is active only in particular types of tissues or cells.

[0048] Optionally, the term "promoter" may also include a 5' UTR region (5' untranslated region) (e.g., as used herein, a promoter may include one or more portions of the transcribed region upstream from the translation start codon, as such regions may have a role in regulating transcription and / or translation).

[0049] "3'UTR" or "3' untranslated sequence" (often referred to as 3' untranslated region, or 3' end) refers to nucleic acid sequences found downstream of the coding sequence of a gene, including, for example, transcription termination sites and (in most, but not all, eukaryotic mRNAs) a polyadenylation signal (such as AAUAAA or variants thereof). After transcription is terminated, the mRNA transcript may be cleaved downstream of the polyadenylation signal and a poly(A) tail may be added, which is involved in transport of the mRNA to the cytoplasm (where translation takes place).

[0050] The term "cDNA" refers to complementary DNA. Complementary DNA is made by reverse transcription of RNA into a complementary DNA sequence. Thus, a cDNA sequence corresponds to an RNA sequence expressed from a gene. Since an RNA sequence expressed from a genome may be spliced, i.e., introns are removed from the pre-mRNA by splicing and exons are spliced ​​together before it is translated into a protein in the cytoplasm, expression of a cDNA is understood to mean expression of the mRNA that encodes the cDNA. Thus, a cDNA sequence may not be identical to the genomic DNA sequence to which it corresponds, since a cDNA may only code for a complete open reading frame consisting of spliced ​​exons for a protein, whereas a genomic DNA sequence may contain exon sequences interspersed with intron sequences. Thus, genetic modification of a gene encoding a protein may involve not only modifying the sequence encoding the protein, but also mutating intron sequences of the genomic DNA and / or other genetic regulatory sequences of the gene.

[0051] The term "regeneration" is defined herein as the formation of new tissues and / or new organs from a single plant cell, a group of cells, callus, explant, tissue, or from an organ. Regeneration may include the formation of new plants from a single plant cell, or from, for example, callus, explant, tissue, or organ. The plant cells for regeneration may be undifferentiated plant cells. Preferred plant cells are protoplasts. The regeneration process may be performed directly from the parent tissue or indirectly, for example through the formation of callus. The regeneration pathway may be somatic embryogenesis or organogenesis. Somatic embryogenesis is understood herein as the formation of a somatic embryo that can develop into a whole plant. Organogenesis is understood herein as the formation of a new organ from an (undifferentiated) cell. Organogenesis may be at least one of meristem formation, adventitious shoot formation, inflorescence formation, root formation, adventitious shoot elongation, and (subsequently) the formation of a complete plant. Preferably, the regeneration is at least one of shoot regeneration, (ectopic) apical meristem formation and root regeneration. Shoot regeneration as defined herein is de novo shoot formation. For example, the regeneration can be the regeneration of (inflorescence) shoots from (elongated) hypocotyl explants.

[0052] The term "normal growth conditions" is understood herein to mean the environment in which the plant grows, including, at a minimum, suitable temperature (i.e., between 0° C. and 60° C.), nutrients, light-dark cycles and watering.

[0053] The term "conditions permissive for regeneration" is understood herein as an environment in which plant cells or tissues can regenerate, preferably including normal growth conditions.

[0054] "Shoot organogenesis" is the regeneration pathway that cells, preferably cells of callus or explants, undergo when they form a de novo shoot apical meristem that develops into a leaf primordium and a shoot with leaves. Since there is only one apical meristem, it is a monopolar structure and no roots are formed at this stage. The vascular system of the shoot is often connected to the parent tissue. Only when the shoot is fully formed and elongated, e.g. when the callus or explant is removed, can root formation be induced in a separate root induction step in a different culture medium (Thorpe, TA (1993) In vitro Organogenesis and Somatic Embryogenesis: Physiological and Biochemical Aspects. In: Roubelakis-Angelakis KA, Van Thanh KT (eds) Morphogenesis in Plants. NATO ASI Series (Series A: Life Sciences), Vol. 253. Springer, Boston, MA).

[0055] Shoot organogenesis can occur spontaneously, i.e., without the exogenous addition of any plant growth regulators (PGRs). Shoot organogenesis can be induced by plant growth regulators, usually cytokinins at various concentrations, either alone or in combination with auxins, where preferably the cytokinins remain a component of the culture medium until the new shoot apical meristem and shoot have completed formation and are fully elongated, e.g., until it is removed from the primary explant or callus. Preferably, the concentration of cytokinins exceeds the concentration of auxins for induction of shoot formation.

[0056] "Somatic embryogenesis" leads to the formation of a bipolar structure resembling a zygotic embryo, which contains a root-shoot axis with a closed, independent vascular system. In other words, both root and shoot primordia are formed simultaneously, and there is no vascular communication with the underlying tissue (Dodds, JH and Roberts, LW (1985) Experiments in plant tissue culture. Cambridge University Press, Cambridge, UK). Somatic embryogenesis can be induced indirectly, for example, from callus or cell suspensions, or it can be induced directly on cells of an explant (Thorpe, supra). Somatic embryo formation passes through a number of different stages, from the globular embryo stage (small, equal-diameter cell mass), through the heart-shaped embryo stage (bilaterally symmetrical structure), to the torpedo-shaped embryo stage (elongation). The transition from globular to cardiac embryos is marked by the production of two cotyledons and the initiation of root development (Zimmerman, JL (1993) Somatic Embryogenesis: A Model for Early Development in Higher Plants. The Plant Cell 5:1411-1423; Von Arnold et al (2002) Developmental pathways of somatic embryogenesis. Plant Cell, Tissue and Organ Culture 69:233-249). Finally, somatic embryos at the torpedo stage can develop into plantlets containing green cotyledons, an elongated hypocotyl, and a developed root with clearly differentiated root hairs in a process termed "germination" (similar to zygotic embryos) or "conversion" or "maturation" (Von Arnold et al., supra). In the direct or indirect induction of somatic embryogenesis, auxins are preferably used to induce an embryogenic state in the callus at an early stage, but embryos are formed with or without reduced auxin levels after passage of the cultures onto medium. Auxins used for somatic embryo induction are, for example, 1-naphthaleneacetic acid (NAA), 2,4-dichlorophenoxyacetic acid (2,4-D), picloram and dicamba.

[0057] The term "endogenous" when used in connection with a protein or nucleic acid in the context of the present invention means that the protein or nucleic acid is still contained within the plant, i.e., is present in its natural environment. In most cases, an endogenous gene will be present in its normal genetic context in the plant.

[0058] "Plant hormones", "plant growth hormones", "plant growth regulators" or "phytohormones" are chemicals that affect the growth and / or development of plant cells and tissues. Plant growth regulators include five groups of chemicals: auxins, cytokinins, gibberellins, abscisic acid (ABA) and ethylene. In addition to these five main groups, two other chemical classes are often considered plant growth regulators: brassinosteroids and polyamines.

[0059] "Targeted mutagenesis" is mutagenesis that can be designed to modify specific nucleotides or nucleic acid sequences, including, but not limited to, oligonucleotide-directed mutagenesis, mutagenesis using RNA-guided endonucleases (e.g., CRISPR technology), meganuclease, TALEN, or zinc finger technology.

[0060] The term "sequence of interest" includes any genetic sequence that is preferably present in a cell, such as, but not limited to, a gene, a part of a gene, or a non-coding sequence within or adjacent to a gene. A sequence of interest may be present in a chromosome, an episome, an organelle genome, such as a mitochondrial or chloroplast genome, or in genetic material that may exist independently of the body of genetic material, such as, for example, an infectious viral genome, a plasmid, an episome, a transposon. A sequence of interest may be within the coding sequence of a gene, within a transcribed non-coding sequence, such as, for example, a leader sequence, a trailer sequence, or an intron. The sequence of interest may be present in a double-stranded or single-stranded nucleic acid molecule. The nucleic acid sequence is preferably present in a double-stranded nucleic acid molecule. A sequence of interest may be any sequence present in a nucleic acid, such as, for example, a gene, a gene complex, a locus, a pseudogene, a regulatory region, a highly repetitive region, a polymorphic region, or a portion thereof. A sequence of interest may also be a region that contains a genetic or epigenetic mutation that is indicative of a phenotype or disease. Preferably, the sequence of interest is a small or longer stretch of contiguous nucleotides (i.e., a polynucleotide) of double-stranded DNA, wherein said double-stranded DNA further comprises a sequence complementary to the sequence of interest on the complementary strand of said double-stranded DNA. The sequence of interest may be, or may be part of, a gene of interest, preferably an endogenous gene of interest. [Brief description of the drawings]

[0061] [Figure 1] Exemplary representations of embodiments of the present invention: (A) Schematic of an in vitro propagated Binche potato scion (2) grafted onto a tomato rootstock (3), showing an optional steel pin for fixation (1); (B) After wound healing, the graft union was decapitated at the time of graft healing, with the cut site indicated (4); (C) The decapitated scion was left in place to regenerate a shoot (5). [Diagram 2] Co-regenerated plants: pure tomato (A); Bintje and tomato marginal chimeras (B); pure Bintje (C). [Diagram 3]Protoplast cultures of Chicory intybus in K1Cg at 28 °C in the dark. A) Protoplasts obtained by overnight enzymatic digestion of chicory leaves, B) initial divisions of chicory protoplasts after 4 days of culture in K1Cg medium, C) microcolonies after 7 days of culture and D) after 11 days of culture. [Figure 4] Protoplast culture of Taraxacum brevicorniculatum in K1Cg medium at 28 °C in the dark. A) Protoplasts obtained by overnight enzymatic digestion of Taraxacum leaves, B) Vacuolated protoplasts showing no signs of division after 3 days of culture in K1Cg medium, C) and D) Protoplasts after 10 and 17 days of culture showing protoplast vacuolation and debris. [Figure 5-1] Regeneration of plantlets from a mixture of chicory and dandelion protoplasts. A) and B) show two different emergences of mixed callus giving rise to chicory and dandelion (dashed circle) plantlets that can be clearly recognized as different due to their phenotypic variability. C) Regeneration of chicory plantlets from control chicory callus and D) Yellow callus picked from a co-culture of mixed protoplasts giving rise to Taraxacum brevicorniculatum plantlets. [Figure 5-2] (As stated above.) [Figure 6] PCR reactions showing two dandelion-specific bands (794 bp) and a chicory-specific band (429 bp) in the dandelion control sample (lane 1), the chicory control sample (lane 2) and leaf material samples from co-regenerants with a dandelion phenotype (lanes 3, 5, 7 and 8) or a chicory-like phenotype (lanes 4 and 6). [Figure 7-1]Development of Maor's chimeras grafted onto C. baccatum. (A); The left side of plant 1 showed a C. baccatum phenotype with C. annuum trichomes, while the right side had a pure C. baccatum phenotype. (B); Plant #2 also had a similar split phenotype, with the left side having a pure C. annuum phenotype including anthocyanin spots, and the right side having a pure C. baccatum phenotype. (C); Plant #7 had C. annuum trichome morphology and C. baccatum growth characteristics. [Figure 7-2] (As stated above.) [Figure 7-3] (As stated above.) [Figure 8] The results of the Caps assay of these two leaf samples (third and fourth leaves) are presented. The results show that plants 1, 2 and 7 are chimeras and plants 3, 4, 5 and 6 are pure C. annuum. [Figure 9] Left: RUBY and vYFP protoplasts attached to a 170 micron Nitex mesh. Right: Protoplast grafts attached from the left to 9M medium after flushing the mesh. Here, clumps of cells are floating freely in the liquid medium. Note that both cell types are clumped together due to the addition of β-D-galactosyl Yarib. [Figure 10] (A) Extensive shoot regeneration from callus at the tip of wild-type tomato hypocotyls. (B) gob mutant hypocotyls produce little callus and have occasional abnormal leaves but no functional shoot meristems. (C) CAPS marker analysis of graft hybrid plants (chi) co-regenerated from the WT-gob graft union. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0062] The inventors have discovered that one or more cells and / or tissues of a difficult to regenerate plant, optionally carrying a heritable mutation or transgene, can be regenerated quite simply by contacting it with one or more cells and / or tissues of a regenerable plant. The present invention therefore relates to the regeneration and clonal and / or vegetative propagation of difficult to regenerate plants. In addition, the present invention relates to a method of producing a plant, preferably a difficult to regenerate plant, carrying a heritable mutation or transgene, preferably in at least a clonally propagated tissue or plant part, and / or for sexual reproduction in a germline progenitor cell. Thus, in one aspect, the present invention provides a method of increasing or inducing the regeneration capacity and / or regeneration efficiency of a cell of a difficult to regenerate plant, comprising the step of contacting said cell with a cell of a regenerable plant.

[0063] The present inventors have found that shoots comprising or consisting of cells or tissues of a difficult-to-regenerate plant can be readily generated using such methods, where "a difficult-to-regenerate plant of" is to be understood herein as being regenerated from cells of the difficult-to-regenerate plant that are contacted with cells of a regenerable plant in the methods of the present invention.

[0064] Thus, in one aspect, the present invention provides a method for generating and selecting shoots of a plant, comprising the steps of: (a) contacting a cell of a difficult-to-regenerate plant with a cell of a regenerable plant; (b) allowing the contacted cells of step (a) to form one or more shoots; and (c) a step of selecting the shoot formed in step (b), wherein at least a part of the shoot is composed of cells of the difficult-to-regenerate plant body. The present invention provides a method comprising:

[0065] Step (b) preferably comprises the formation of several shoots, i.e. two or more shoots.Thus, step (c) of the method of the invention may comprise the step of selecting a shoot from the plurality of shoots formed in step (b), wherein at least a part of said selected shoots comprises cells of the non-regenerative plant.

[0066] Preferably, the difficult-to-regenerate plant or cells thereof are plants or cells that are unable to regenerate under normal growth conditions or that show poor regeneration efficiency. Optionally, the difficult-to-regenerate plant or cells thereof are unable to regenerate or that show poor regeneration efficiency under conditions known in the art to be optimal for regeneration, such as, but not limited to, conditions that allow regeneration in the presence of exogenously supplied growth regulators. Although there may be both difficult-to-regenerate and regenerable cultivars, varieties and / or accessions within a species, pepper, soybean and sugar beet are generally non-limiting examples of difficult-to-regenerate plants and cells thereof are non-limiting examples of difficult-to-regenerate plant cells. However, the method of the invention may be applied to any plant or plant cell that, depending on the circumstances, would benefit from an increased regeneration efficiency. Thus, the difficult-to-regenerate plant or plant cell of step (a) of the method of the invention is in particular a plant or plant cell that shows a lower regeneration efficiency than the regenerable plant or plant cell of step (a) of the method of the invention. In a preferred embodiment, the difficult to regenerate plant or plant cell of step (a) of the method of the invention exhibits a lower regeneration efficiency than the regenerable plant or plant cell of step (a) of the method of the invention under suitable, preferably optimal conditions for the regeneration of regenerable plants or plant cells. Such suitable and / or optimal conditions at least comprise a suitable nutrient supply, optionally supplemented with hormones. Such conditions may further comprise a suitable and / or optimal temperature and / or light / dark regime. Preferably, such suitable and / or optimal conditions are applied in step (b) of the method of the invention. Preferably, the difficult to regenerate plant or plant cell of step (a) is a plant or plant cell that exhibits a lower regeneration efficiency and / or regeneration potential compared to the regenerable plant or plant cell of step (a) when exposed to similar conditions as those applied in step (b) of the method of the invention, except that said difficult to regenerate plant or plant cell is not in contact with said regenerable plant or plant cell.In other words, the difficult-to-regenerate plant or plant cell of step (a) is a plant or plant cell that exhibits a lower regeneration efficiency and / or regeneration potential compared to the regenerable plant or plant cell of step (a) when the difficult-to-regenerate and regenerable cells, preferably without the contacting step (a) as defined herein, are exposed to similar conditions as those applied in step (b) of the method of the present invention. These conditions are preferably suitable conditions for the regenerable plant or its cells to regenerate. The skilled person is aware of suitable conditions for the regeneration of regenerable plant cells. Such conditions may be conditions under which the difficult-to-regenerate plant cells do not or hardly regenerate normally (i.e. when not in contact with regenerable cells).

[0067] Preferably, step (b) of the method of the invention is carried out under conditions suitable for the regenerable plant or cells thereof to regenerate. Optionally, step (b) of the method of the invention may be carried out under conditions under which cells of a non-regenerable plant, unlike cells of a regenerable plant, do not or hardly exhibit any regeneration when not in contact with said regenerable plant cells.

[0068] Preferably, the difficult-to-regenerate plant cells and regenerable plant cells of step (a) of the method of the present invention are somatic cells. Optionally, the difficult-to-regenerate plant or plant cell is modified to contain a positive selection marker. Typical non-limiting examples of plants known in the art to be difficult to regenerate are pepper (Capsicum annuum), sugar beet (Beta vulgaris, more particularly sugar beet (Beta vulgaris subsp. vulgaris)), soybean (Gycine max), sunflower (Helianthus annuus), cotton (Gossipium hirsutum), hemp or cannabis (Cannabis sativa), strawberry (Fragaria x ananassa), hops (Humulus lupulus), melon (Cucumis melo) and cucumber (Cucumis sativus). A difficult-to-regenerate plant may be a plant that does not show any or little regeneration, but may also be a plant in which regeneration can be (further) improved. Thus, and as exemplified herein, a difficult-to-regenerate plant may be, but is not limited to, Capsicum annuum, Solanum tuberosum, or Taraxacum brevicorniculatum. Similarly, a cell of a difficult-to-regenerate plant may be, but is not limited to, a cell of Capsicum annuum, Solanum tuberosum, or Taraxacum brevicorniculatum.

[0069] Preferably, the regenerable plant (or cells thereof) of step (a) of the method of the present invention is capable of regeneration under normal growth conditions, preferably conditions that allow regeneration of the plant (or cells thereof) in the absence of exogenously supplied growth regulators such as auxins and / or cytokinins. Preferably, under such conditions, the regenerable plant is capable of forming shoots on the multicellular tissue de novo. The regeneration is preferably at least one of organogenesis and somatic embryogenesis. Preferably, the regenerable plant is capable of regenerating shoots in vivo after decapitation, i.e. after removal of all preformed shoot apical meristems. Generally, seedling hypocotyls of tomato and tobacco, yellow pepper (Capsicum baccatum), eggplant (Solanum melongena), potato (Solanum tuberosum) are known in the art as examples of regenerable explants, although there may be both non-regenerable and regenerable cultivars, varieties and / or accessions within a species.

[0070] The regenerable plant or plant cell may be a naturally occurring regenerable plant or plant cell, i.e. a plant or plant cell with natural regeneration capacity. Alternatively, the plant or plant cell may be genetically modified to increase regeneration potential. Examples of such plants or plant cells include, but are not limited to, the plants and plant cells disclosed in WO 2019 / 211296 and WO 2019 / 193143, which are incorporated herein by reference. As a non-limiting example, the regenerable plant or plant cell may be a plant or plant cell that has been modified to exhibit an induced or increased expression of a histidine kinase selected from the group consisting of CHK4, CHK2 and CHK3, preferably as described in WO 2019 / 193143. Additionally or alternatively, the regenerable plant or plant cell is a plant or plant cell modified to exhibit, preferably transiently, an induced or increased expression of at least one of the transcription factors associated with regeneration, preferably WUSCHEL-related homeobox protein (preferably WOX5, optionally AtWox5 of SEQ ID NO: 16), PLETHORA protein (preferably PLT1, optionally AtPLT1 of SEQ ID NO: 17) and WOUND INDUCED DEDIFFERENTIATION 1 protein (WIND1, optionally AtWIND1 of SEQ ID NO: 18), preferably both WOX5 and PLT1, even more preferably WOX5, PLT1 and WIND1, as described in WO 2019 / 211296. Preferably, the transcription factor is under the control of an inducible promoter, and regeneration is induced by exposing the cell to an agent that causes induction of the inducible promoter. Optionally, the regenerable plant or plant cell is a plant or plant cell transfected with a SHOOT REGENERATION-2 vector or a SHOOT REGENERATION vector, as described in WO 2019 / 211296.The vector may be introduced by transient or stable transfection, and regeneration may be induced by exposing the contacted cells to at least one of dexamethasone and estradiol, preferably both dexamethasone and estradiol, since the indicated regeneration-related transcription factors are under the control of promoters inducible through administration of these compounds (see WO 2019 / 211296 in this regard). Additionally or alternatively, the regenerable plant may be a plant having a mutation in an endogenous gene that results in improved regeneration capacity and / or regeneration efficiency. Non-limiting examples are known in the art, such as ATHB15 mutants as described in Duclerq et al. (Plant biology, 2011, 13, p317-324), KCS1 mutants as described in Shang et al. (PNAS 2016, 113, 5101-5106), ARR mutants as described in Buechel et al. (European Journal of Cell Biology 2010, 89:279-284), and ATRXR2 mutants as described in Lee et al. (2021) Cell Reports 37, 1-13.

[0071] Optionally, the regenerable plant or plant cell is modified to include a negative selection marker. The regenerable plant or plant cell may be, but is not limited to, yellow pepper (Capsicum baccatum), tomato (Solanum lycopersicum) and chicory (Cichorium intybus). In particular, the regenerable plant or plant cell of step (a) of the method of the invention is a plant or plant cell that exhibits a higher regeneration efficiency when compared to the difficult to regenerate plant or plant cell of step (a) of the method of the invention. Preferably, the regenerable plant or plant cell of step (a) of the method of the invention is a plant that exhibits a higher regeneration efficiency when compared to the difficult to regenerate plant or plant cell of step (a) of the method of the invention under suitable, preferably optimal conditions for the regeneration of the regenerable plant or plant cell. Such suitable and / or optimal conditions include at least a suitable nutrient supply, optionally supplemented with hormones. Such conditions may further include suitable and / or optimal temperature and / or light / dark regimes.

[0072] Preferably, the difficult to regenerate plant or plant cell of step (a) of the method of the invention has a different genotype than the regenerable plant or plant cell of step (a) of the method of the invention. The difficult to regenerate plant or plant cell and the regenerable plant or plant cell of step (a) of the method of the invention may be of different genera or of the same genus. Preferably, the difficult to regenerate plant or plant cell and the regenerable plant or plant cell of step (a) of the method of the invention are of the same genus. Optionally, the difficult to regenerate plant cell and the regenerable plant cell of step (a) of the method of the invention are of different species. Preferably, the regenerable plant or plant cell of step (a) of the method of the invention is a plant or plant cell capable of exchanging genetic material with the difficult to regenerate plant or plant cell of step (a) of the method of the invention through conventional breeding methods. Preferably, the cells of the difficult to regenerate plant can be crossed with the cells of the regenerable plant.

[0073] As a non-limiting example, the difficult to regenerate plant cells and the regenerable plant cells may both be from the genus Solanum or Capsicum. For example, the difficult to regenerate plant or its cells may be Capsicum annuum, and the regenerable plant or its cells may be Capsicum baccatum. Similarly, the difficult to regenerate plant or its cells may be Solanum tuberosum, and the regenerable plant or its cells may be Solanum lycopersicum. Furthermore, the difficult to regenerate plant or its cells may be Taraxacum brevicorniculatum, and the regenerable plant or its cells may be Cichorium intybus.

[0074] In a preferred embodiment, the non-regenerative plant or plant cell of step (a) of the method of the invention is a plant that, under the same or similar conditions allowing regeneration, but without contact with each other, exhibits a lower regeneration potential and / or regeneration efficiency when compared to the regenerable plant or plant cell of step (a) of the method of the invention. Said conditions are preferably normal growth conditions suitable for both regenerable and non-regenerative plants or plant cells thereof. More preferably, said conditions are conditions allowing regeneration, even more preferably said conditions are conditions allowing regeneration in the absence of externally supplied growth regulators (e.g. addition of chemicals through human intervention). In a preferred embodiment, said conditions are at least the minimum necessary conditions for the regeneration of the regenerable plant or plant cell. Optionally, said conditions are conditions suitable, optionally optimal conditions, for the regeneration of at least the regenerable plant or plant cell.

[0075] In one aspect, the invention relates to a method for generating and selecting shoots of a plant, wherein the selected shoots comprise germline progenitor cells of a difficult to regenerate plant, i.e. germline progenitor cells regenerated from the difficult to regenerate plant cells of step (a) of the method of the invention. Thus, optionally, the method of the invention comprises: (a) contacting a cell of a difficult-to-regenerate plant with a cell of a regenerable plant; (b) allowing the contacted cells of step (a) to form one or more shoots; and (c) selecting the shoot formed in step (b), wherein the shoot contains germline progenitor cells of the difficult-to-regenerate plant. Includes.

[0076] Additionally or alternatively, the present invention relates to a method for generating and selecting shoots of a plant, wherein the shoots comprise cells that give rise to clonal propagation tissue and / or plant parts of a difficult to regenerate plant, i.e. clonal propagation tissue and / or plant parts regenerated from the difficult to regenerate plant cells of step (a) of the method of the invention. Thus, optionally, the method of the invention comprises: (a) contacting a cell of a difficult-to-regenerate plant with a cell of a regenerable plant; (b) allowing the contacted cells of step (a) to form one or more shoots; and (c) selecting the shoots formed in step (b), wherein the shoots contain cells that give rise to clonal propagation tissues and / or plant parts of the difficult-to-regenerate plant. Includes.

[0077] Optionally, in step (b), the contacted cells of the difficult to regenerate plant form a callus and a shoot grows from the callus. Thus, in one embodiment, the method of the invention comprises generating and optionally selecting a shoot of a plant comprising a germline progenitor cell of the difficult to regenerate plant, the method comprising the steps of: (a) contacting a cell of a difficult-to-regenerate plant with a cell of a regenerable plant; (b) allowing the contacted cells of the difficult-to-regenerate plant of step (a) to form callus, and growing a shoot from the callus; and (c) selecting the shoots obtained in step (b) that contain germline progenitor cells of the refractory plant; The method includes:

[0078] Thus, preferably the method of the invention comprises a step (c) of selecting shoots, wherein at least a portion of said shoots comprises cells of a difficult to regenerate plant (i.e. have been regenerated from the difficult to regenerate plant cells of step (a)), and wherein said portion comprises: i) tissue containing germline progenitor cells; and ii) clonally propagated tissue and / or tissue containing cells giving rise to clonally propagated plant parts; At least one of the following is true:

[0079] Clonal propagation tissue and / or plant parts are herein understood as tissue and / or plant parts that can be used for clonally propagating progeny, i.e. plants of subsequent generations. Such tissue and / or plant parts may be, but are not limited to, tubers, bulbs, corms, bulblets, suckers, scions, crowns, bulbs, rhizomes, stem tips, shoots or cuttings, knob-like bases or cuttings, stolons, tuberous cuttings or eyes, (clonal propagation) seeds, etc. Thus, the genotype of the clonally propagated plant part or tissue (cells giving rise to it) determines the genotype of the progeny of the clonally propagated plant, and any genomic modifications made in this tissue or part (cells giving rise to it) can be inherited in subsequent generations. Thus, transgenes or mutations made in the clonally propagated plant part (cells giving rise to it) are heritable transgenes or mutations.

[0080] Germline progenitor cells are understood herein as cells that will become gametes upon terminal differentiation, or their clonal progeny. Thus, the genotype of the germline progenitor cells determines the genotype of the gametes, and any genomic modifications made to the germline progenitor cells will be inherited by subsequent generations. Thus, the transgenes or mutations introduced into the germline progenitor cells are heritable, i.e. heritable transgenes or heritable mutations. The L2 shoot meristem layer may determine the genotype of the gametes (see, for example, Filippis et al. Using a periclinal chimera to unravel layer-specific gene expression in plants, The Plant Journal, 2013, 75:1039-1049). Preferably, in step (c), the selected shoot portion consisting of cells of the difficult-to-regenerate plant body is a tissue containing germline progenitor cells. Thus, preferably, the germline progenitor cells of the method of the invention are derived from the L2 shoot meristem layer of a difficult to regenerate plant (i.e. the L2 meristem layer regenerated from a difficult to regenerate plant cell of step (a) of the method of the invention). The shoot selected in step (c) of the method of the invention may further comprise at least one of the L1 and L3 shoot meristem layers of the difficult to regenerate plant. Optionally, said shoot comprises the L1, L2 and L3 shoot meristem layers of the difficult to regenerate plant. Alternatively, the shoot selected in step (c) of the method of the invention may comprise the L2 shoot meristem layer regenerated from a difficult to regenerate plant cell of step (a) and at least one of the L1 and L3 shoot meristem layers regenerated from a regenerable plant cell of step (a). The shoot, or at least one shoot, grown in step (b) of the method of the invention and selected in step (c) may be an adventitious shoot, or at least one adventitious shoot.

[0081] In step (a) of the method of the invention, cells of a difficult to regenerate plant are brought into contact with cells of a regenerable plant. Optionally, in step (a) of the method of the invention, one or more cells of a difficult to regenerate plant are brought into contact with one or more cells of a regenerable plant. The contacting step (a) can be carried out using any conventional method known to the skilled person. The contacting step preferably requires bringing cells of a difficult to regenerate plant into physical contact with cells of a regenerable plant. Physical contact of cells is to be understood herein as a stable association or aggregation of cells through cell-cell contact, optionally via a reagent or linker that aggregates the cells. Preferably, plasmodesmata are formed between cells in physical contact. Preferably, the cell-cell contact is such that a common cell wall is formed. Thus, preferably, contact between cells of a difficult to regenerate plant and cells of a regenerable plant results in, for example, sharing of cell walls and / or plasmodesmata.

[0082] As a non-limiting example, the contacting step may include any in vitro technique known in the art, such as conventional techniques for generating peripheral chimeras; such techniques may include at least one of the following: (1) Co-culture of cells, in which side-by-side stem segments from regenerable and non-regenerable plants are cultured together to produce callus, from which adventitious shoots are regenerated, preferably in an in vitro growth medium supplemented with hormones.

[0083] (2) Mixed callus cultures, in which cell suspensions of regenerable and non-regenerable plants are mixed, the mixture is grown into callus, and adventitious shoots are regenerated from the callus, preferably in an in vitro growth medium supplemented with hormones.

[0084] (3) Co-culture of protoplasts, in which protoplast suspensions of regenerable and non-regenerable plants are optionally embedded in agarose and grown to very high cell densities, upon which shoots are regenerated, preferably in an in vitro growth medium supplemented with hormones.

[0085] (4) In vitro graft culture, in which a regenerable plant and a non-regenerable plant are grafted together along their hypocotyls or internodes, preferably under sterile conditions. One of these plants is the "scion" and the other is the "rootstock". The section at the graft junction is cultured to induce adventitious callus and shoots. Such techniques fall under the common denominator of tissue culture and consist of a number of individual protocols that may be specific to individual plant lines or species. Those skilled in the art will know how cells of two different plants can be brought together in tissue culture to regenerate shoots. For a thorough review on plant chimeras, see "Plant Chimeras", Richard A.E.Tilney-Bassett (Cambridge University Press, 1991). Optionally, any one of the above techniques is carried out, optionally as specified in detail herein, whereby the method of the invention results in the generation of at least one (adventitious) shoot comprising or consisting of tissue regenerated from the difficult to regenerate plant cell, preferably comprising germline progenitor cells and / or tissue giving rise to clonally propagated tissue and / or clonally propagated plant part.

[0086] Optionally, the cells of the difficult-to-regenerate plant and the cells of the regenerable plant in step (a) of the method of the present invention are contained in tissues and / or plant parts. The contacting step (a) of the method of the present invention may be carried out by grafting the difficult-to-regenerate plant and the regenerable plant, one of which is a rootstock and the other is a scion. Preferably, the rootstock is a regenerable plant and the scion is a difficult-to-regenerate plant. Thus, preferably, the contacting in step (a) is carried out by grafting the scion of the difficult-to-regenerate plant onto the rootstock of the regenerable plant. Alternatively, the rootstock may be a difficult-to-regenerate plant and the scion may be a regenerable plant, and the contacting in step (a) is carried out by grafting the scion of the regenerable plant onto the rootstock of the difficult-to-regenerate plant. Grafting generally involves joining the scion and the rootstock together in such a way that the vascular tissues grow together to form a graft joint.

[0087] Preferably, the shoot removed from the rootstock plant includes the terminal bud, thereby giving a "capitated" plant. The shoot truncation is preferably at the hypocotyl or epicotyl, or at an internode. Preferably, a cotyledonary node is grafted onto the capitated hypocotyl rootstock. An elongated callus piece is allowed to form at the grafting junction.

[0088] Grafting may be the grafting of a scion onto a rootstock, also indicated herein as the rootstock-scion grafting method. However, the skilled artisan will appreciate that variations are possible and are encompassed by the method of the present invention. As a non-limiting example, a section or "slice" of a regenerable plant may be interposed between the rootstock and the scion of a non-regenerable plant. Preferably, young plant material is used for grafting, where the young plant material is seedling material 1-4 weeks or 1-3 weeks after sowing, preferably about 2 weeks after sowing. Preferably, the young plant material used for grafting is seedling material 0.1-1 mm, 0.1-0.75 mm, 0.1-0.5 mm, or 0.1-0.25 mm. Preferably, the seedling material is used immediately after the emergence of the first true leaves. Preferably, during the grafting process, (very small) steel pins, preferably sterile steel pins, are used for positioning and fixing the seedling material. The steel pin can be inserted into the center of the rootstock and scion as illustrated herein (see, e.g., FIG. 1). Additionally or alternatively, ties, tapes, bands, and / or clamps can be used around the two grafting partners to hold them together, and optionally, adhesive (glue, wax or paste) can be used at the edges of the graft joint for fixation.

[0089] At the grafting junction, the vascular tissues of the rootstock and the scion are connected to each other, allowing nutrients and water to move from the rootstock to the scion. It should be understood that the difficult-to-regenerate and regenerable plants within the scope of this embodiment of the present invention, i.e. utilizing a graft in the contacting step (a) of the method of the present invention, are plants that naturally have the ability to form a grafting junction. Preferably, the difficult-to-regenerate and regenerable plants are both dicotyledonous plants. Optionally, the difficult-to-regenerate and regenerable plants are both monocotyledonous plants. Optionally, the grafting is performed using young plant material, for example, young plant material obtained from in vitro micropropagation, young seedling material, or seeds. Such methods of grafting monocotyledoneous plants are provided, for example, in WO 2020 / 099878 and WO 2020 / 099879, which are incorporated herein by reference.

[0090] After wounding, the graft union is then severed or "wounded", resulting in the production of callus, and adventitious shoots. Among these adventitious shoots, shoots that include or consist of recalcitrant plant cells, such as shoots that include germline progenitor cells of the recalcitrant plant and / or clonally propagated plant tissues and / or plant parts of the recalcitrant plant, may appear spontaneously.

[0091] The cutting is preferably made at the graft union where the non-regenerative plant meets the regenerable plant. Preferably the cut is such that a thin layer of scion cells remains on top. Preferably those scion cells are from the non-regenerative plant. Preferably the cut is just at the wound site of the graft union. Thus, preferably step (b) may comprise generating a wound at or near the graft union and allowing callus to form at the wounded graft union.

[0092] The wounding may be a complete cut, e.g. a transverse cut, which separates the graft into two plant parts. Optionally, the wounding does not completely separate the graft union into two plant parts, but is sufficient to initiate and / or stimulate callus production. Optionally, the wounding is performed by taking a slice of tissue from the graft union, followed by culturing the slice to form callus. Preferably, a shoot is grown from the callus, where the shoot may comprise or consist of tissue regenerated from the non-regenerating plant cells. In other words, preferably, a shoot is grown from the callus, where at least a portion of the shoot consists of cells of the non-regenerating plant body. This particular method is performed under ambient conditions in a growth room or greenhouse.

[0093] Thus, optionally, the contacting in step (a) is performed by grafting a scion of the non-regenerative plant onto a rootstock of the regenerable plant and wounding the graft union. Optionally, the method further comprises generating a wound at or near the graft union in step (b), allowing callus to form at the (wounded) graft union and growing a shoot from the callus, and wherein at least a portion of the shoot consists of cells of the non-regenerative plant.

[0094] In a preferred embodiment, the method of the present invention comprises a method for generating and selecting shoots, the method comprising the steps of: (a) contacting cells of a difficult-to-regenerate plant with cells of a regenerable plant by grafting a scion of one of the difficult-to-regenerate plant and the regenerable plant onto a rootstock of the other of the difficult-to-regenerate plant and the regenerable plant, thereby forming a graft union between the scion and the rootstock; (b) causing callus formation in contacted cells of the regenerative plant of step (a) by generating a wound at or near the graft junction, and growing one or more shoots from the callus; and (c) a step of selecting the shoots grown in step (b), at least a portion of which is composed of cells of a plant body that is difficult to regenerate; The method includes:

[0095] Optionally, one or more cells of the refractory plant within the shoot selected in step (c) are germline progenitor cells. Optionally, the cells of the refractory plant within the shoot selected in step (c) give rise to clonal propagation tissue and / or plant parts.

[0096] Preferably, in step (a), the regenerable and non-regenerable plants are seedlings or young vegetatively propagated (optionally in vitro) clonal plants, preferably as defined herein, and grafting may be facilitated by inserting a steel pin into the centre of the scion and rootstock for alignment and fixation.

[0097] As noted above, alternative methods for contacting cells of different plants are available.

[0098] In an alternative embodiment, the contacting step (a) of the method of the present invention may be carried out by contacting one or more isolated cells of a difficult-to-regenerate plant with one or more isolated cells of a regenerable plant. Thus, the cells of the difficult-to-regenerate plant and the cells of the regenerable plant in step (a) may be isolated cells, preferably protoplasts. Such isolated cells may be single cells. Preferably, the contacting step (a) is carried out by contacting a protoplast of the difficult-to-regenerate plant with a protoplast of a regenerable plant. Preferably, the isolated cells in step (a) of the method of the present invention are treated with a compound that promotes the aggregation of the cell membrane of the cells.

[0099] Preferably, in this process, the one or more isolated cells of both the non-regenerable plant and the regenerable plant are protoplasts. In a preferred embodiment, protoplasts of the non-regenerable and regenerable plants are contacted using methods known in the art that promote adhesion of the membranes of the protoplasts, such as, but not limited to, aggregation mediated by at least one of polyethylene glycol (PEG), Yariv antigen or reagent (1,3,5-tris(4-β-D-glycopyranosyloxyphenylazo)-2,4,6-trihydroxybenzene), biotin-streptavidin, and antibodies (see, e.g., Yariv et al. (1962) Biochem. J. 85, 383-388; Hartmann et al. Planta (Berl.) 1973, 112; 45-56; Larkin, J. Cell Sci. 1978, 30; 283-282; Kesteren and Tempelaar, Plant Science 1993, 93; 131-141). Such methods may include treating the protoplasts to encourage them to come into close proximity to one another, for example by PEG treatment, preferably with a solution containing about 15% PEG, said PEG being preferably PEG 3350MW. Preferably, said PEG solution is a PEG solution as exemplified in the Examples herein below. Alternatively, or in addition, such methods may include treating the protoplasts with a high Ca solution to allow the aggregated protoplasts to come into intimate contact. 2+ Ionic concentration and high pH, ​​preferably about 50 mM Ca 2+ It may include a treatment to neutralize the normal surface charge, such as a treatment at a pH of at least 10 in terms of concentration of ions, preferably at pH 10.5. Preferably, said neutralization solution is a neutralization solution as illustrated in the examples (Example 2) herein below. In a preferred embodiment, step (a) of the method of the invention comprises the following (sub) steps: (a1) isolating protoplasts of regenerable plants and protoplasts of non-regenerable plants; (a2) mixing isolated protoplasts of a plant that is difficult to regenerate with isolated protoplasts of a plant that can be regenerated; (a3) treating the mixture with PEG; and (a4) treating the mixture with a neutralizing solution Includes.

[0100] Optionally, before step (a2) and after step (a1), the protoplasts of the regenerable plant are treated with an agent that inhibits mitosis.

[0101] Additionally or alternatively, such a method may comprise a step of promoting adhesion or aggregation of protoplasts by linking together the cell membranes of plant cells and / or protoplasts. In other words, preferably, in step a) of the method of the invention, a linking agent can be used which links together the cell membranes of plant cells.

[0102] Preferably, the linking reagent binds, preferably selectively binds, galactan and / or arabinogalactan proteins (AGPs) present in plant cells, thereby linking the plant cells together.

[0103] A preferred linking agent is Yariv. Yariv (1,3,5-tri(p-glycosyloxyphenylazo)-2,4,6-trihydroxybenzene) is a compound capable of linking protoplasts. Preferably, the method of the invention uses a Yariv comprising glycosyl groups selected from the group consisting of glucose, galactose or mannose, maltose, xylose, lactose and cellulose. Preferably, the Yariv comprises three β-D glycosyl groups. Thus, in a further preferred embodiment, step (a) of the method of the invention comprises the following (sub) steps: (ai) isolating protoplasts of regenerable plants and protoplasts of non-regenerable plants; (a-ii) mixing protoplasts of a regenerable plant body with protoplasts of a non-regenerable plant body; (a-iii) treating the mixture with a protoplast ligation reagent; and (a-iv) Recovering ligated protoplasts Includes.

[0104] In step (a-iv), the (ligated) protoplasts are preferably washed with a large volume of protoplast medium, such as but not limited to 9M (9% (w / v) mannitol, 140 mg / L CaCl2.H2O, 580 mg / L MES, pH 5.8). Preferably, the contacted and / or ligated protoplasts of step (a) are subsequently embedded in a hydrogel, preferably an alginate polymer, for culturing in step (b) of the method of the invention.

[0105] The present invention also provides the use of a plant cell membrane linking agent for the regeneration of a difficult to regenerate plant cell as defined herein. Preferably, said linking agent is β-D-galactosyl yab.

[0106] The protoplasts of the regenerable plant and the protoplasts of the non-regenerable plant are preferably mixed in a ratio of about 1:1, 1:2, 1:3, 1:4, 1:5, etc. depending on the cell type and / or species prior to contacting and / or linking. The abundance of the non-regenerable plant cells relative to the regenerable plant cells may be preferred to prevent the non-regenerable plant cells from being able to outcompete the non-regenerable plant cells. Preferably, the contacting in step (a) is carried out by pressing the protoplast mixture together, preferably after or during treatment with a linking agent as indicated herein (i.e. during or after step (a-iii)), thereby further increasing the contact between the mixed protoplasts (preferably about 10 to about 100 protoplasts). This can be achieved using a mesh as exemplified herein, such that the protoplasts are brought into physical contact with each other at the holes in the mesh. In a preferred method, the protoplasts are contacted with one another during treatment of the protoplasts with a linking agent in step (a) of the method of the invention. Ligation, preferably with Yariv's reagent, is preferably carried out for about 15 to about 30 minutes.

[0107] Step (b) is carried out under conditions allowing the regeneration of the regenerable plant or plant cells, preferably under conditions suitable for shoot formation. Such conditions are understood herein as the minimum necessary for at least the regeneration of the regenerable plant or plant cells, and generally include at least the normal growth conditions of said plant or plant cells. Preferably, step (b) is carried out under conditions suitable for the regeneration of the regenerable plant or regenerable plant cells of step (a). Preferably, step (b) comprises the formation of a callus prior to shoot formation. Thus, step (b) may comprise the sub-steps (b1) of causing the contacted cells of at least the non-regenerative plant to form a callus; and (b2) of growing a shoot from said callus, whereby optionally the culture conditions of (b1) and (b2) are different. More particularly, step (b1) may be carried out under conditions suitable for at least the cells of the regenerable plant to form a callus; and step (b2) may be carried out under conditions suitable for the regenerable plant callus to form a shoot. The skilled artisan will be aware of suitable conditions for callus and / or shoot regeneration for regenerable plants. Preferably, in addition to the difficult to regenerate plant cells in step (b), regenerable cells are also regenerated to form shoots. Optionally, in addition to the difficult to regenerate plant cells, regenerable cells are also regenerated in step (b1) to form callus, and optionally, the callus is also regenerated in step (b2) to form shoots. Thus, optionally, regenerable and difficult to regenerate cells are co-regenerated in steps (b), (b1) and / or (b2).

[0108] Callus may be formed during the regeneration process of step (b) by (shoot) organogenesis or somatic embryogenesis. The amount of callus formed may depend, for example, on the plant species used in the method of the invention and / or on the conditions used that allow shoot formation. For example, said callus formation in vitro and / or after grafting and wounding treatments may occur spontaneously, i.e. in the absence of one or more exogenously applied plant hormones. Similarly, shoot formation, for example after optional callus formation in step (b), may also occur spontaneously, i.e. in the absence of one or more exogenously applied plant hormones. Alternatively, said formation of callus may be induced and / or enhanced in the presence of one or more plant hormones. Alternatively, or in addition, shoot formation in step (b) may be induced and / or enhanced in the presence of one or more plant hormones.

[0109] In a particular embodiment, the formation of callus between the contact of the cells in step (a) and the formation of the shoot in step (b) of the method of the invention is minimal. This is particularly preferred as it avoids the cells of the regenerable plant outcompeting the cells of the non-regenerable plant. Thus, a minimal callus stage may increase the likelihood of a shoot growing that includes or consists of cells of the non-regenerable plant.

[0110] To induce shoot regeneration in plant tissue, a combination of one or more cytokinins and one or more auxins may be used.

[0111] The cytokinins that may be used in the method of the present invention may be adenine-type cytokinins or phenylurea-type cytokinins. Similarly, the cytokinins may be naturally produced phytohormones or may be synthetic compounds. The adenine-type cytokinins may be phytohormones synthesized in at least one of roots, seeds, and fruits. In addition, the cambium and other actively dividing tissues may also synthesize cytokinins. Non-limiting examples of naturally occurring adenine-type cytokinins are zeatin and its metabolic precursor 2iP. Non-limiting examples of synthetic adenine-type cytokinins are kinetin and 6-benzylaminopurine (BAP). Substituted urea compounds, such as thidiazuron and CPPU, are not present in planta but can act as cytokinins in tissue culture. The adenine-type cytokinins may be selected from the group consisting of kinetin, zeatin, trans-zeatin, cis-zeatin, dihydrozeatin, 6-benzylaminopurine, and 2iP, and combinations thereof. The phenylurea type cytokinin can be diphenylurea or thidiazuron. It is known in the art that the type of cytokinin to be added depends on the type of plant cell, and a person skilled in the art can easily select a suitable cytokinin according to the need.

[0112] Alternatively, or in addition, the plant hormone may be an auxin. The auxin may be an endogenously synthesized auxin. The endogenously synthesized auxin may be selected from the group consisting of indole-3-acetic acid (IAA), 4-chloroindole-3-acetic acid, phenylacetic acid, indole-3-butyric acid, and indole-3-propionic acid. The auxin may be a synthetic auxin, such as an auxin analog. The synthetic auxin may be at least one of 1-naphthaleneacetic acid, 2,4-dichlorophenoxyacetic acid (2,4-D), α-naphthaleneacetic acid (α-NAA), 2-methoxy-3,6-dichlorobenzoic acid (dicamba), 4-amino-3,5,6-trichloropicolinic acid (trudon or picloram), 1-naphthaleneacetic acid (NAA), indole-3-butyric acid (IBA), and 2,4,5-trichlorophenoxyacetic acid (2,4,5-T). The auxin can be 1-naphthaleneacetic acid (NAA).

[0113] For shoot organogenesis by a combination of cytokinin and auxin, the ratio of cytokinin to auxin should preferably be greater than 1 (Dodds, JH and Roberts, LW (1985) Experiments in plant tissue culture. Cambridge University Press, Cambridge, UK).

[0114] Optionally, in step (b) initial callus formation is stimulated (step b1) followed by shoot formation (step b2). Step (b1) may be performed using conditions that allow callus formation of the regenerable plant. Optionally, step (b1) is performed using minimal conditions that allow callus formation of the regenerable plant. In a preferred embodiment, step (b1) is performed using optimal conditions for callus formation of the regenerable plant. Step (b2) may be performed using conditions that allow shoot formation of the regenerable plant. Optionally, step (b2) is performed using minimal conditions that allow shoot formation of the regenerable plant. In a preferred embodiment, step (b2) is performed using optimal conditions for shoot formation of the regenerable plant.

[0115] The method of the invention may further comprise the step (d) of growing a plant from the shoot selected in step (c).

[0116] Optionally, in step (c) of the method of the invention, a shoot is selected that contains germline progenitor cells of the difficult to regenerate plant. Such shoots can give rise to plants that contain germline progenitor cells and / or germline cells (e.g., gametes, egg cells, sperm cells) derived from the difficult to regenerate plant cells used in step (a). The germline cells can form gametes for sexual reproduction. Such plants can then be used to produce seeds, where the seeds contain embryos and where at least a portion of the genotype of the embryos is derived from the difficult to regenerate plant cells of step (a) of the method of the invention, and optionally the seeds are obtained by selfing or backcrossing.

[0117] Optionally, in step (c) of the method of the invention, a shoot is selected that comprises cells capable of giving rise to clonal propagation tissue or plant parts of the difficult to regenerate plant, i.e. cells capable of giving rise to clonal propagation tissue and / or plant parts regenerated from the difficult to regenerate plant cells of step (a) of the method of the invention. Such shoots are capable of giving rise to plants comprising plant parts derived from the difficult to regenerate plant cells that can be used for clonal propagation. Such plant parts have the same or substantially the same genotype as the difficult to regenerate plant cells of step (a) of the method of the invention.

[0118] The selected shoots may be substantially free of cells of the regenerable plant. Such shoots may consist of cells of a difficult-to-regenerate plant (i.e. from cells regenerated from difficult-to-regenerate plant cells) and can be used for the production of a difficult-to-regenerate plant by (vegetative) propagation of said shoots, i.e. by growing a whole plant from said shoot. The step of selecting shoots can be carried out using any conventional method known to the person skilled in the art.

[0119] The selection may comprise a step of determining phenotypic characteristics and / or molecular markers that are present in cells of the refractory plant and / or that are present in the shoot meristem layer of the refractory plant but that are absent in cells of the regenerable plant and / or that are absent in the shoot meristem layer of the regenerable plant. Alternatively or in addition, the selection may comprise a step of determining phenotypic characteristics and / or molecular markers that are absent in cells of the refractory plant but that are absent in cells of the regenerable plant and / or that are present in the shoot meristem layer of the regenerable plant. Preferably, the selection may comprise a step of determining phenotypic characteristics and / or molecular markers that are present in germline progenitor cells and / or clonally propagated plant parts of the refractory plant but that are absent in germline progenitor cells and / or clonally propagated tissues and / or plant parts of the regenerable plant. Alternatively, or in addition, the selection may comprise determining phenotypic characteristics and / or molecular markers that are not present in the germline progenitor cells and / or clonal propagation tissues and / or plant parts of the non-regenerative plant, but are present in the germline progenitor cells and / or clonal propagation tissues and / or plant parts of the regenerable plant. The molecular markers are preferably genomic sequences that are either present in the non-regenerative plant or present in the regenerable plant.

[0120] Alternatively or additionally, steps (c) and / or (d) may comprise bringing the (regenerated) shoot into contact with a compound that is toxic to the (plant) cells expressing the negative selection marker. In this embodiment, the negative selection marker is expressed in cells of the regenerable plant, preferably the negative selection marker is expressed in at least germline progenitor cells and / or clonal propagation tissues and / or plant parts of the regenerable plant. Optionally, the toxic selection marker is encoded by (the genome of) the regenerable cell, optionally under the control of an inducible promoter. By exposing the cell to a substance that activates the inducible promoter, the toxic selection marker is expressed and preferably the regenerable cell is killed. Optionally, a precursor of the toxic selection marker is encoded by (the genome of) the regenerable cell. By exposing the cell to a substance that activates the conversion of the precursor to the toxic component, preferably the regenerable cell is killed thereby.

[0121] Alternatively, or in addition, steps (c) and / or (d) may comprise bringing the (regenerated) shoot into contact with a compound that is toxic to the (plant) cell but which can be converted to a non-toxic compound by expression of the positive selection marker. In this embodiment, the positive selection marker is expressed in the shoot meristem layer of the regeneratively difficult plant, preferably the positive selection marker is expressed in at least germline progenitor cells and / or clonal propagation tissues and / or plant parts of the regeneratively difficult plant.

[0122] In a preferred embodiment, at least one or more germline progenitor cells and / or clonal propagation tissues and / or plant parts of the developed shoots selected in step (c) of the method of the invention comprise a transgene or mutation in a sequence of interest. Preferably, at least one of the L1, L2 and / or L3 shoot meristem layers of the developed shoots comprises a transgene or mutation in a sequence of interest. Preferably, at least the L2 shoot meristem layer of the developed shoots comprises a transgene or mutation in a sequence of interest.

[0123] The transgene or mutation may be present in the cells of the difficult to regenerate plant in step (a) of the method of the invention, and optionally in the cells of the regenerable plant in step (a) of the method of the invention. Preferably, the transgene or mutation is present in the cells of the difficult to regenerate plant in step (a) of the method of the invention. Preferably, the transgene or mutation is present in at least germline progenitor cells and / or clonal propagation tissues and / or plant parts of the difficult to regenerate plant of the developed shoot selected in step (c) of the method of the invention. Optionally, the transgene or mutation is present in all or substantially all cells of the developed shoot selected in step (c), wherein said cells are cells regenerated from the difficult to regenerate plant cells in step (a) of the method of the invention. Preferably, at least the L2 shoot meristem layer of the developed shoot contains the transgene or mutation in the sequence of interest, wherein at least the L2 shoot meristem layer is of the difficult to regenerate plant, or in other words is regenerated from the difficult to regenerate plant cells provided in step (a). Seeds produced from such shoots may then contain the transgene or mutation, preferably within the seed's embryo.

[0124] Thus, preferably, the method of the invention comprises the step of introducing a transgene or a mutation in a sequence of interest into cells of the difficult to regenerate plant of step (a).Alternatively, or in addition, the method of the invention (further) comprises the step of introducing a transgene or a mutation in a sequence of interest into cells originating from the difficult to regenerate plant of step (a) and present in the shoot formed in step (b), and optionally in the callus formed in step (b).

[0125] The transgene or mutation may be introduced into a cell (optionally into one or more cells) of the difficult to regenerate plant before contacting the cell or cells with the cell (optionally into one or more cells) of the regenerable plant in step (a). As a non-limiting example, the transgene or mutation may be introduced into one or more cells of the difficult to regenerate plant, which may then be co-cultured with one or more cells of the regenerable plant. These cells of the difficult to regenerate plant and / or the regenerable plant may optionally be part of a protoplast, or a callus or stem slice (or a junction slice). Similarly, the transgene or mutation may be introduced into one or more cells of the difficult to regenerate plant, and the cells of this difficult to regenerate plant carrying the transgene or mutation may be grafted onto cells of the regenerable plant that are optionally not transformed or mutated.

[0126] Alternatively, or in addition, a transgene or mutation may be introduced into one or more cells of the difficult to regenerate plant after contacting one or more cells of the difficult to regenerate plant with one or more cells of the regenerable plant. The transgene or mutation is preferably introduced before shoot formation. Thus, preferably, the step of introducing the mutation is prior to step (b2) of the method as defined herein, but may be during or after step (a) or (b1).

[0127] As a non-limiting example, one or more cells of a difficult-to-regenerate plant may be contacted or co-cultured in vitro with one or more cells of a regenerable plant, followed by introduction of a transgene or mutation into one or more cells of the difficult-to-regenerate plant. Optionally, the contacted or "co-cultured" cells are first allowed to form callus before introducing the transgene or mutation into at least one or more cells of the difficult-to-regenerate plant. A transgene or mutation may also be introduced into one or more cells of the regenerable plant.

[0128] Similarly, one or more cells of a difficult-to-regenerate plant may be grafted onto one or more cells of a regenerable plant, followed by the introduction of a transgene or mutation in a sequence of interest into one or more cells of the difficult-to-regenerate plant. A transgene or mutation may also be introduced into one or more cells of the regenerable plant. Optionally, the grafted cut surface is first wounded before introducing a transgene or mutation into at least one or more cells of the difficult-to-regenerate plant. Optionally, the grafted union is first cut or "wounded" before introducing a transgene or mutation into at least one or more cells of the difficult-to-regenerate plant. Optionally, the contacted cells are first allowed to form callus before introducing a transgene or mutation into at least one or more cells of the difficult-to-regenerate plant.

[0129] Preferably, the shoot selected in step (c) of the method of the invention comprises a transgene or mutation in a sequence of interest in cells regenerated from the cells of the refractory plant of step (a) of the method of the invention. The shoot preferably comprises a transgene or mutation in at least one of the L1, L2 and L3 shoot meristem layers regenerated from the refractory cell of step (a) of the method of the invention. Preferably, at least the germline progenitor cells and / or clonally propagated tissues and / or plant parts of the selected shoot are regenerated from the refractory cell of step (a) of the method of the invention and comprise a transgene or mutation in a gene of interest. Thus, a preferred method of the invention is a method of generating and selecting shoots of a plant, wherein the shoot comprises germline progenitor cells and / or comprises cells giving rise to clonal propagation tissues and / or plant parts of the refractory plant, and wherein one or more of the germline progenitor cells and / or clonally propagated plant tissues and / or plant parts comprise a transgene or mutation in a sequence of interest. Preferably, all or substantially all of the germline progenitor cells and / or clonal propagation tissues and / or plant parts contain the transgene or mutation in the sequence of interest.

[0130] The transgene or mutation may be present in at least the L2 shoot meristem layer. Thus, a preferred method of the invention is a method of generating and selecting a shoot of a plant, wherein the shoot comprises the L2 shoot meristem layer of a refractory plant, and wherein one or more cells of the L2 shoot meristem layer comprise the transgene or mutation in the sequence of interest. Preferably, all or substantially all cells of at least the L2 shoot meristem layer comprise the transgene or mutation in the sequence of interest. Optionally, the transgene or mutation is present in all or substantially all cells of the generated shoot selected in step (c), wherein said cells are cells regenerated from the refractory plant cells of step (a) of the method of the invention.

[0131] Introducing a transgene or mutation in a sequence of interest in the methods of the invention preferably results in one or more improved phenotypic characteristics, including, but not limited to, increased yield, disease resistance, agronomic traits, abiotic traits, protein composition, oil composition, starch composition, insect resistance, fertility, silage, and morphological traits.

[0132] The transgene may be introduced by stable or transgenic transfection using any method known to those skilled in the art for transfecting plants, plant parts, callus, plant cells or protoplasts.

[0133] Mutations are herein understood to be either modifications of the genetic code of a nucleotide sequence (insertion, deletion or substitution of one or more nucleotides) or epigenetic modifications such as methylation changes. Mutations may be introduced by random or targeted mutagenesis, the latter also referred to as programmed genome editing. Random mutagenesis may be, but is not limited to, chemical mutagenesis and gamma irradiation. Non-limiting examples of chemical mutagenesis include, but are not limited to, EMS (ethyl methanesulfonate), MMS (methyl methanesulfonate), NaN3 (sodium azide) D), ENU (N-ethyl-N-nitrosourea), AzaC (azacytidine) and NQO (4-nitroquinoline 1-oxide). Optionally, a mutagenesis system such as TILLING (Targeting Induced Local Lesions IN Genomics; McCallum et al., 2000, Nat Biotech 18:455, and McCallum et al. 2000, Plant Physiol. 123, 439-442, both of which are incorporated herein by reference) can be used to create mutations in cells of the difficult-to-regenerate plant. TILLING uses traditional chemical mutagenesis (e.g., EMS mutagenesis) followed by high-throughput screening for mutations. In this way, TILLING can be used to obtain plants, seeds and tissues containing genes with one or more of the desired mutations. Preferably, plants, seeds and tissues containing genes with one or more of the desired mutations can be obtained using KeyPoint® Breeding as described in WO 2007 / 037678, which is incorporated herein by reference.

[0134] Targeted mutagenesis or programmed genome editing is mutagenesis that can be designed to modify specific nucleotides or nucleic acid sequences, including but not limited to oligo-directed mutagenesis, RNA-guided endonucleases (e.g., CRISPR technology), TALEN, meganuclease or zinc finger technology.

[0135] Preferably, the targeted mutagenesis is introduced by a site-specific protein, preferably a site-specific endonuclease.The site-specific endonuclease is preferably at least one of the following: CRISPR protein complexed with guide RNA, TALEN, zinc finger protein, meganuclease and Argonaute complex.Preferably, the site-specific endonuclease is CRISPR protein complexed with guide RNA.

[0136] The CRISPR protein that is part of the CRISPR protein complex used in the methods of the present invention is preferably at least one of a CRISPR endonuclease, a CRISPR nickase, and a CRISPR deaminase. Preferably, the CRISPR protein is a CRISPR endonuclease.

[0137] CRISPR protein can be any suitable CRISPR protein known in the art. Optionally, CRISPR protein comprises a nuclear localization signal (NLS) that directs CRISPR protein to the nucleus of plant cells. Any known nuclear localization signal can be suitable for use in the present invention. Preferred nuclear localization signals include, but are not limited to, the NLS of SV40 large T antigen, MEDPTMAPKKKRKV (SEQ ID NO: 1), and the NLS of nucleoplasmin, KRPAATKKAGQAKKKK (SEQ ID NO: 2).

[0138] CRISPR endonuclease comprises nuclease domain and at least one domain that interacts with guide RNA.When complexed with guide RNA, CRISPR protein complex is guided to specific nucleic acid sequence by guide RNA.Guide RNA interacts with CRISPR endonuclease and target specific nucleic acid sequence, so that when CRISPR endonuclease is guided to the site that contains target nucleic acid sequence by guide sequence, it can introduce double-strand break at target site.

[0139] If the CRISPR protein is a CRISPR endonuclease, both domains of the nuclease are catalytically active and the protein is capable of introducing a double-stranded break at the target site. If the CRISPR protein is a CRISPR nickase, one domain of the nuclease is catalytically active and one domain is catalytically inactive and the protein is capable of introducing a single-stranded break at the target site.

[0140] The skilled artisan is well aware of how to design a guide RNA such that, when combined with a CRISPR endonuclease or CRISPR nickase, it achieves the introduction of a single- or double-stranded break at a predetermined site in a nucleic acid molecule.

[0141] CRISPR proteins can be broadly classified into six major types (types I-VI) based on the content and sequence of the core elements, which are further subdivided into subtypes (Makarova et al., 2011, Nat Rev Microbiol 9:467-77 and Wright et al., 2016, Cell 164(1-2):29-44). In general, the two key elements of the CRISPR protein complex are the CRISPR protein and the guide RNA.

[0142] Type II CRISPR protein complexes contain a single protein (~160KDa) and signature Cas9 protein that has the ability to specifically cleave double-stranded DNA. Cas9 proteins typically have two nuclease domains, a RuvC-like nuclease domain near the amino terminus and an HNH (or McrA-like) nuclease domain near the middle of the protein. Each nuclease domain of the Cas9 protein is specialized to cleave one strand of the double helix (Jinek et al, 2012, Science 337(6096):816-821). The Cas9 protein is an example of a CAS protein in the type II CRISPR-CAS protein complex, which forms an endonuclease when combined with crRNA and a second RNA called trans-activating crRNA (tracrRNA). The crRNA and tracrRNA together function as guide RNAs. The CRISPR protein complex introduces a DNA double-strand break (DSB) at a location in the genome defined by the crRNA. Jinek et al. (2012, Science 337:816-820) demonstrated that a single-stranded chimeric guide RNA (defined herein as "sgRNA" or "single guide RNA") made by fusing the essential portions of crRNA and tracrRNA was able to form a functional CRISPR protein complex in combination with the Cas9 protein.

[0143] A type V CRISPR protein complex, Clustered Regularly Interspaced Short Palindromic Repeats 1 or CRISPR / Cpf1 from the genera Prevotella and Francisella, has been described. The Cpf1 gene encodes an endonuclease that associates with the CRISPR locus and targets DNA using crRNA. Cpf1 is a smaller endonuclease than Cas9 and may overcome some of the limitations of the CRISPR-Cas9 system. Cpf1 is a single RNA-guided endonuclease that lacks tracrRNA, which utilizes a T-rich protospacer adjacent motif. Cpf1 cleaves DNA with sticky-end type DNA double-strand breaks (Zetsche et al (2015) Cell 163(3):759-771). The V-type CRISPR protein system preferably includes at least one of Cpf1, C2c1 and C2c3.

[0144] The CRISPR protein complex used in the present invention can comprise any CRISPR protein as defined herein above.Preferably, the CRISPR protein is type II CRISPR protein, preferably type II CRISPR endonuclease, such as Cas9 (e.g., protein of SEQ ID NO: 3, or protein of SEQ ID NO: 5, encoded by SEQ ID NO: 4) or type V CRISPR protein, preferably type V CRISPR endonuclease, such as Cpf1 (e.g., protein of SEQ ID NO: 6, encoded by SEQ ID NO: 7) or Mad7 (e.g., protein of SEQ ID NO: 8 or 9), or a protein derived therefrom, preferably with said protein over its entire length at least about 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity.

[0145] Preferably, the CRISPR protein is a type II CRISPR endonuclease, preferably a Cas9 endonuclease.

[0146] Those skilled in the art know how to find and prepare CRISPR proteins for use in the methods of the present invention. Numerous reports are available in the prior art regarding their design and use. For example, see the review by Haeussler et al. (J Genet Genomics. (2016) 43(5): 239-50. doi: 10.1016 / j.jgg.2016.04.008.) regarding the design of guide RNA and its use in combination with CAS protein (originally obtained from S. pyogenes), or the review by Lee et al. (Plant Biotechnology Journal (2016) 14(2) 448-462).

[0147] Generally, CRISPR endonucleases such as Cas9 contain two catalytically active nuclease domains. For example, Cas9 protein can contain RuvC-like nuclease domain and HNH-like nuclease domain. RuvC and HNH domains work together to both break single strands, thus creating double strand breaks in DNA (Jinek et al., Science, 337:816-821).

[0148] Dead CRISPR endonuclease comprises a modification such that none of the nuclease domains show cleavage activity.CRISPR nickase can be a mutant of CRISPR endonuclease in which one of the nuclease domains is mutated so that it is no longer functional (i.e., there is no nuclease activity).One example is the SpCas9 mutant with either D10A or H840A mutation.

[0149] The CRISPR protein may comprise or consist of the entire CRISPR type II or type V protein or a variant or functional fragment thereof, preferably such a fragment binds to a guide RNA and at least partially retains endonuclease activity.

[0150] Preferably, the CRISPR protein used in the methods of the present invention is a Cas9 protein. The Cas9 protein is expressed in the bacteria Streptococcus pyogenes (SpCas9; NCBI reference sequence NC_017053.1; UniProtKB-Q99ZW2), Geobacillus thermodenitrificans (UniProtKB-A0A178TEJ9), Corynebacterium ulcerous (NCBI references: NC_015683.1, NC_017317.1); Corynebacterium diphtheria (NCBI references: NC_016782.1, NC_016786.1); Spiroplasma syrphidicola (NCBI reference: NC_021284.1); Prevotella intermedia (NCBI reference: NC_021284.1); intermedia (NCBI Reference: NC_017861.1); Spiroplasma taiwanense (NCBI Reference: NC_021846.1); Streptococcus iniae (NCBI Reference: NC_021314.1); Belliella baltica (NCBI Reference: NC_018010.1); Psychroflexus torquis (NCBI Reference: NC_018721.1); Streptococcus thermophilus (NCBI Reference: YP_820832.1); Listeria innocua (NCBI Reference: NP_472073.1); Campylobacter jejuni jejuni (NCBI Reference: YP_002344900.1); or Neisseria meningitidis (NCBI Reference: YP_002342100.1).From these, Cas9 mutants having inactive HNH or RuvC domains homologous to SpCas9, such as SpCas9_D10A or SpCas9_H840A, or Cas9s that have been made into nickases by having equivalent substitutions at positions corresponding to D10 or H840 of the SpCas9 protein, are included.

[0151] The CRISPR protein used in the method of the present invention may be or be derived from Cpf1, for example, Cpf1 from Acidaminococcus sp.; UniProtKB-U2UMQ6. The mutant may be a Cpf1 nickase with an inactivated RuvC or NUC domain, where the RuvC or NUC domain no longer has nuclease activity. Those skilled in the art are well aware of techniques available in the art, such as site-directed mutagenesis, PCR-mediated mutagenesis, and total gene synthesis that allow inactivated nucleases, such as inactivated RuvC or NUC domains. One example of a Cpf1 nickase with an inactive NUC domain is Cpf1 R1226A (see Gao et al. Cell Research (2016) 26: 901-913, Yamano et al. Cell (2016) 165 (4): 949-962). In this mutant, there is an arginine to alanine (R1226A) conversion in the NUC domain, which renders the NUC domain inactive.

[0152] The CRISPR protein used in the methods of the invention may be or may be derived from CRISPR-CasΦ, a nuclease that is approximately half the size of Cas9. CRISPR-CasΦ uses a single crRNA for targeting and cleaving nucleic acids, as described, for example, in Pausch et al (CRISPR-CasΦ from huge phages is a hypercompact genome editor, Science (2020); 369 (6501): 333-337).

[0153] In the methods of the present invention, for example, active, partially active or dead CRISPR proteins may be used to guide a fused functional domain, as detailed herein, to a specific site in DNA as determined by a guide RNA.

[0154] Thus, the CRISPR protein may be fused to a functional domain. Optionally, such a functional domain is for epigenetic modification, for example, a histone modification domain. The domain for epigenetic modification may be selected from the group consisting of methyltransferase, demethylase, deacetylase, methylase, deacetylase, deoxygenase, glycosylase and acetylase (Cano-Rodriguez et al, Curr Genet Med Rep (2016) 4: 170-179). The methyltransferase may be selected from the group consisting of G9a, Suv39h1, DNMT3, PRDM9 and Dot1L. The demethylase may be LSD1. The deacetylase may be SIRT6 or SIRT3. The methylase may be at least one of KYP, TgSET8 and NUE. The deacetylase may be selected from the group consisting of HDAC8, RPD3, Sir2a and Sin3a. The deoxygenase may be at least one of TET1, TET2 and TET3, preferably TET1cd (Gallego-Bartolome J et al, Proc Natl Acad Sci US A. (2018); 115(9): E2125-E2134). The glycosylase may be TDG. The acetylase may be p300.

[0155] Optionally, the functional domain is a deaminase selected from the group consisting of apolipoprotein B mRNA editing complex (APOBEC) deaminase family, activation-induced cytosine deaminase (AID), ACF1 / ASE deaminase, adenine deaminase, and ADAT family deaminase, or a functional fragment thereof. Alternatively, or in addition, the deaminase or functional fragment thereof may be ADAR1 or ADAR2, or a variant thereof.

[0156] The Apolipoprotein B mRNA editing complex (APOBEC) cytosine deaminase enzyme family includes eleven proteins that act to induce mutagenesis in a controlled and beneficial manner. Preferably, the APOBEC deaminase is selected from the group consisting of APOBEC1, APOBEC2, APOBEC3A, APOBEC3B, APOBEC3C, APOBEC3D, APOBEC3F, APOBEC3G, APOBEC3H, APOBEC4 and activation-induced (cytidine) deaminase. Preferably, the APOBEC family cytosine deaminase is activation-induced cytosine (or cytidine) deaminase (AID) or apolipoprotein B editing complex 3 (APOBEC3). Preferably, the deaminase domain fused to a CRISPR protein APOBEC1 family deaminase.

[0157] Another exemplary suitable type of deaminase domain that can be fused to CRISPR system nuclease is adenine or adenosine deaminase, such as ADAT adenine deaminase family. Furthermore, the adenine deaminase can be TadA or a variant thereof, as described in Gaudelli et al., 2017 (Gaudelli et al. 2017 Nature 551:464-471). Furthermore, the CRISPR system nuclease can be fused to an adenine deaminase domain, for example, from ADAR1 or ADAR2. The deaminase domain of the present invention can comprise or consist of the entire deaminase protein or a catalytically active fragment thereof. Preferably, the deaminase domain has deaminase activity. Optionally, the CRISPR protein is further fused to a UDG inhibitor (UGI) domain.

[0158] The CRISPR protein used in the method of the present invention is complexed with a guide RNA molecule, and the guide RNA molecule guides the CRISPR protein to a specific location in the genome of the plant cell to achieve targeted genome modification.Preferably, the plant cell is a cell of a plant body that is difficult to regenerate.Optionally, the plant cell is a cell that gives rise to the germline or germline progenitor cell and / or clonal propagation tissue and / or plant part of the plant body that is difficult to regenerate.

[0159] A complex comprising a CRISPR protein and a guide RNA may also be annotated as a ribonucleoprotein complex.

[0160] The guide RNA molecule directs the complex to a defined target site, also known as the protospacer sequence, within the double-stranded nucleic acid molecule. The guide RNA molecule preferably comprises a sequence for targeting the CRISPR protein complex to the protospacer sequence that is near, at, or within the range of the sequence of interest in the genome of the plant cell. The guide RNA may be a single guide (sg) RNA or a combination of crRNA and tracrRNA (e.g., for Cas9) or only crRNA (e.g., for Cpf1 and CasΦ).

[0161] The CRISPR protein complex used in the method of the present invention may thus comprise a guide RNA molecule, where the guide RNA molecule comprises a combination of crRNA and tracrRNA, and where preferably the CRISPR protein is Cas9. The crRNA and tracrRNA are preferably combined to form a sgRNA (single guide RNA). Alternatively, the CRISPR protein complex used in the method of the present invention may comprise a guide RNA molecule, where the guide RNA molecule comprises a crRNA, and where preferably the CRISPR protein is Cpf1 or CasΦ.

[0162] The guide RNA molecules used in the methods of the invention may comprise a sequence capable of hybridizing to or adjacent to a sequence of interest, preferably a sequence of interest as defined herein. The guide RNA molecule may comprise a nucleotide sequence that is fully complementary to a sequence in the sequence of interest, i.e. the sequence of interest comprises a protospacer sequence. Alternatively, or in addition, the guide RNA molecules used in the methods of the invention may comprise a sequence capable of hybridizing to or adjacent to the complement of the sequence of interest.

[0163] The portion of the crRNA that is complementary to the protospacer sequence is designed to have sufficient complementarity with the protospacer sequence to hybridize with the protospacer sequence and direct sequence-specific binding of the complexed CRISPR protein. The protospacer sequence is preferably adjacent to a protospacer adjacent motif (PAM) sequence, which can interact with the CRISPR protein of the RNA-guided CRISPR protein complex. For example, when the CRISPR protein is S. pyogenes Cas9, the PAM sequence is preferably 5'-NGG-3', where N can be any one of T, G, A, or C.

[0164] The skilled artisan has the ability to engineer the crRNA to target any desired sequence, preferably by engineering the sequence to be at least partially complementary to any desired protospacer sequence for hybridization thereto. Preferably, the complementarity between a portion of the crRNA sequence and its corresponding protospacer sequence is at least 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 100% when optimally aligned using a suitable alignment algorithm. The portion of the crRNA sequence that is complementary to the protospacer sequence may be at least about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 75 nucleotides in length, or more. In some preferred embodiments, the sequence complementary to the sequence of interest is less than about 75, 50, 45, 40, 35, 30, 25, 20 nucleotides in length. Preferably, the length of the sequence complementary to the sequence of interest is at least 17 nucleotides. Preferably, the complementary crRNA sequence is about 10-30 nucleotides in length, about 17-25 nucleotides in length, or about 15-21 nucleotides in length. Preferably, the portion of the crRNA complementary to the protospacer sequence is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length, preferably 20 or 21 nucleotides, preferably 20 nucleotides.

[0165] Molecules suitable as crRNA and tracrRNA are well known in the art (see, for example, WO 2013142578 and Jinek et al., Science (2012) 337, 816-821). The guide RNA molecules crRNA and tracrRNA can be linked together to form a single guide (sg)RNA. The crRNA and tracrRNA can be linked, preferably covalently linked, using any conventional method known in the art. Covalent linkage of the crRNA and tracrRNA is described, for example, in Jinek et al., supra, and WO 13 / 176772, which are incorporated herein by reference. The crRNA and tracrRNA can be covalently linked, for example, using linker nucleotides or via a direct covalent linkage between the 3' end of the crRNA and the 5' end of the tracrRNA.

[0166] Preferably, the method of the present invention uses at least one CRISPR protein complex comprising CRISPR nuclease and guide RNA.However, those skilled in the art will easily understand that the method of the present invention can use additional CRISPR protein complexes, for example, by using at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more different guide RNAs.These different guide RNAs can be designed to target and bind to the same sequence of interest.Alternatively, different guide RNAs can direct CRISPR protein complexes to different genes of interest.

[0167] The transgene or mutation in the sequence of interest may be introduced before, during and / or after callus formation. The transgene or mutation is preferably introduced before shoot formation begins. Preferably, the transgene or mutation is present in at least the germline progenitor cells and / or the clonal propagation tissue and / or the plant part of the shoot formed in step b) of the method of the invention. Preferably, the transgene or mutation is present in at least the germline progenitor cells of the shoot selected in step c) and / or in the cells giving rise to the clonal propagation tissue and / or the plant part. Preferably, the transgene or mutation is present in all the germline progenitor cells and / or all the clonal propagation tissue and / or the plant part of the shoot formed in step b). Preferably, the transgene or mutation is present in at least one cell of the L2 shoot meristem layer of the shoot formed in step b) of the method of the invention. Preferably, the transgene or mutation is present in all the cells of the L2 shoot meristem layer of the shoot formed in step b). The transgene or mutation may also be present in other cells, such as cells of the L1 and L3-shoot meristem layers. Optionally, all cells of the shoot formed in step c) of the method of the invention contain the transgene or the mutation in the sequence of interest.

[0168] A transgene or a mutation in the sequence of interest may be introduced into cells of the difficult to regenerate plant and / or into cells of the regenerable plant. Preferably, a transgene or a mutation in the sequence of interest is introduced into at least cells of the difficult to regenerate plant in step (a) of the method of the invention and / or into cells of the difficult to regenerate plant co-regenerated in step (b) of the method of the invention.

[0169] Mutation can be introduced by transfecting plant cells with site-specific endonuclease, preferably CRISPR endonuclease.Transgene can be introduced by transfecting plant cells with transgene of interest.Transfection of plant cells can be carried out by any conventional means known to those skilled in the art.

[0170] By "transfection" or "transformation" is herein understood the delivery of a transgene and / or a site-specific endonuclease protein or a nucleic acid molecule encoding a transgene and / or a site-specific endonuclease to a plant cell. The nucleic acid molecule may be a DNA or an RNA encoding the transgene and / or the site-specific nuclease. Optionally, the transgene and / or the site-specific endonuclease is introduced by transfection of (pre)mRNA. The transfection may further comprise the delivery of a guide RNA or a nucleic acid molecule encoding the guide RNA that (will) associate with the site-specific endonuclease to the plant cell. Optionally, the site-specific endonuclease is delivered as a CRISPR endonuclease complex comprising the CRISPR endonuclease complexed with the guide RNA. Alternatively or additionally, the CRISPR endonuclease and the guide RNA are delivered to the plant cell and form a complex within the cell. Alternatively, or in addition, the CRISPR endonuclease is expressed from the transfected nucleic acid and forms a complex with the optionally expressed guide RNA within the cell.

[0171] Preferably, the transgene and / or site-specific endonuclease, or the nucleic acid encoding it, can be introduced into the cells of the difficult-to-regenerate plant body as a protein or, in the case of CRISPR endonuclease, as a protein-guide RNA complex (also called a ribonucleoprotein complex) by any conventional means known to those skilled in the art. Non-limiting examples of transfection include, but are not limited to, viral infection, conjugation, protoplast fusion, electroporation, particle gun technology, calcium phosphate precipitation, direct microinjection, silicon carbide whisker technology, Agrobacterium-mediated transformation, etc. The choice of method generally depends on the type of cell to be transformed and the context in which the transformation is performed (i.e., in vitro, ex vivo, or in vivo; protein transfection or nucleic acid transfection).

[0172] Transfection methods based on the soil bacterium Agrobacterium tumefaciens can be particularly useful for introducing nucleic acid molecules into plant cells. Methods for co-cultivating Agrobacterium with cultured plant cells or wounded tissues, such as leaf tissue, root explants, lower cotyledons, stem segments, or tubers, are well known in the art. See, for example, Glick and Thompson, (eds.), Methods in Plant Molecular Biology and Biotechnology, Boca Raton, Fla.: CRC Press (1993). Microprojectile-mediated transformation can also be used to transfect plant cells. This method, first described by Klein et al. (Nature 327:70-73 (1987)), relies on microprojectiles, such as gold or tungsten, that are coated with the desired nucleic acid molecule by precipitation with calcium chloride, spermidine, or polyethylene glycol. Microprojectile particles are accelerated to high speeds using an instrument such as the BIOLISTIC PD-1000 (Biorad; Hercules Calif.) and into the angiosperm tissue.

[0173] The nucleic acid encoding the transgene and / or site-specific endonuclease, optionally the guide RNA, may be introduced into the plant in such a way that the nucleic acid can enter the plant cell, for example by in vivo or ex vivo protocols. By "in vivo" is meant that the nucleic acid is administered to the living plant, for example by infiltration. By "ex vivo" is meant that cells or explants are modified outside the plant, and then such cells or organs are regenerated into shoots of the plant.

[0174] A number of vectors suitable for transformation of plant cells and / or for establishing transgenic plants have been described, including those described in Weissbach and Weissbach, (1989) Methods for Plant Molecular Biology Academic Press, and Gelvin et al., (1990) Plant Molecular Biology Manual, Kluwer Academic Publishers. Examples include Agrobacterium tumefaciens-mediated transformation, as well as methods disclosed, for example, by Herrera-Estrella et al. (1983) Nature 303:209, Bevan (1984) Nucl Acid Res. 12:8711-8721, Klee (1985) Bio / Technology 3:637-642. Conventional methods for transforming plant cells include, but are not limited to, biolistic bombardment, polyethylene glycol transformation, and microinjection (see, e.g., Danieli et al Nat. Biotechnol 16:345-348, 1998; Staub et al Nat. Biotechnol 18:333-338, 2000; O'Neill et al Plant J. 3:729-738, 1993; Knoblauch et al Nat. Biotechnol 17:906-909; U.S. Pat. Nos. 5,451,513, 5,545,817, 5,545,818, and 5,576,198; WO 95 / 16783; and Boynton et al., Methods in Enzymology, vol. 11, no. 1, pp. 1111-1115, 2002). 217:510-536 (1993), Svab et al., Proc. Natl. Acad. Sci. USA 90:913-917 (1993), and McBride et al., Proc. Natl. Acad. Sci. USA 91:7301-7305 (1994).

[0175] Preferably, a transgene is introduced into the cells of the recalcitrant plant and / or there is a mutation in the sequence of interest in the cells of the recalcitrant plant. The cells of the recalcitrant plant are preferably transfected with at least one of the transgene, the CRISPR endonuclease and / or a guide RNA. Preferably, the CRISPR endonuclease and the guide RNA form a ribonucleoprotein complex that is transfected into the cells of the recalcitrant plant. Preferably, the cells are protoplasts. Preferably, the protoplasts are transfected with the transgene protein and / or the CRISPR-guide RNA ribonucleoprotein complex using polyethylene glycol transformation, such as described, for example, in WO 2017 / 222370 or WO 2020 / 089448, which are incorporated herein by reference. The cells may be cells in a single cell suspension, cells present in a protoplast, callus or slice, and / or cells present in the plant, preferably present at the graft union.

[0176] Alternatively or in addition, the cells of the difficult-to-regenerate plant may be transfected with a nucleic acid molecule encoding a transgene and / or at least one site-specific endonuclease and / or at least one guide RNA. Optionally, the cells are protoplasts. Optionally, the protoplasts are transfected with one or more plasmids encoding a transgene and / or a CRISPR endonuclease and guide RNA, for example, using polyethylene glycol transformation, such as described in WO 2018 / 115390 and WO 2020 / 011985, which are incorporated herein by reference.

[0177] Preferably, the codon sequence of the transgene and / or the site-specific endonuclease is optimized for expression in plant cells. The nucleic acid molecule encoding at least one transgene and / or the site-specific endonuclease and / or at least one guide RNA is preferably comprised in a nucleic acid vector. The nucleic acid vector is preferably a vector for transient expression of the transgene and / or the site-specific endonuclease and / or the guide RNA. Alternatively, the nucleic acid vector is a vector for stable expression of the transgene and / or the site-specific endonuclease and / or the guide RNA. Optionally, the cell of the difficult-to-regenerate plant body of step a) of the method of the present invention comprises, integrated in its genome, a transgene encoding a gene of interest and / or a programmable endonuclease, preferably a CRISPR endonuclease, wherein said transgene and / or the programmable endonuclease may be stably expressed or wherein expression of said transgene and / or the programmable endonuclease is under the control of an inducible or tissue-specific promoter.

[0178] The transgene and / or the site-specific endonuclease, and optionally at least one guide RNA, may thus be transcribed from an expression cassette contained in a vector. The vector backbone may be, for example, a plasmid into which the expression cassette is integrated or, if suitable transcriptional regulatory sequences are already present (e.g., an (inducible) promoter), into which only the desired nucleotide sequence (e.g., the sequence encoding the transgene and / or the site-specific endonuclease) is integrated downstream of the transcriptional regulatory sequences.

[0179] The vector used in the methods of the invention may further comprise genetic elements that facilitate its use in molecular cloning, e.g., selectable markers, multiple cloning sites, etc. The vector backbone may be, for example, a binary or super binary vector (see, e.g., U.S. Pat. No. 5,591,616, U.S. Patent Publication No. 2002138879 and WO 95 / 06722), a cointegration vector or a T-DNA vector, as known in the art.

[0180] The vectors used in the methods of the invention are preferably particularly suitable for introducing expression of transgenes and / or site-specific endonucleases, optionally one or more guide RNAs, into plant cells. Preferred expression vectors are naked DNA, DNA complexes or viral vectors.

[0181] Preferred naked DNA is a linear or circular nucleic acid molecule, such as a plasmid. A plasmid refers to a circular double-stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques. The DNA complex may be a DNA molecule coupled to any carrier suitable for delivering DNA to cells. Preferred carriers are selected from the group consisting of lipoplexes, liposomes, polymersomes, polyplexes, PEG, dendrimers, inorganic nanoparticles, virosomes and cell-penetrating peptides.

[0182] The vector used in the method of the present invention is preferably a viral expression vector.The viral vector can be a DNA virus or an RNA virus.The viral vector can be or be based on tobamovirus, tobravirus, potexvirus, geminivirus, alphamovirus, cucumovirus, potyvirus, tombusvirus, hordeivirus, or nucleorhabdovirus.

[0183] The tobamovirus viral vector can be at least one of Tobacco Mosaic Virus (TMV) and Sun Hemp Mosaic Virus (SHMV). The tobravirus viral vector can be Tobacco Rattle Virus (TRV). The potexvirus viral vector can be at least one of Potato Virus X (PVX) and Papaya Mosaic Potexvirus (PapMV). The geminivirus viral vector can be Comovirus Cowpea Mosaic Virus (CPMV). Further examples of suitable geminivirus viral vectors can include Cabbage Leaf Curl Virus, Tomato Golden Mosaic Virus, Bean Yellow Dwarf Virus, African Cassava Mosaic Virus, Wheat Dwarf Virus, Oogi Stripe Mastre Virus, Tobacco Yellow Dwarf Virus, Tomato Yellow Leaf Curl Virus, Bean Golden Mosaic Virus, Beet Curly Top Virus, Maize Stripe Virus, and Tomato Pseudo Curly Top Virus. The alphamovirus can be Alfalfa Mosaic Virus (AMV). The cucumovirus may be Cucumber Mosaic Virus (CMV). The potyvirus may be Plum Pox Virus (PPV). The tombusvirus may be Tomato Bushy Stunt Virus (TBSV). The hordeivirus may be Wheat Stripe Mosaic Virus. The nucleorhabdovirus may be Sonchus Yellow Net Virus (SYNV) (see, e.g., Hefferon K, Plant Virus Expression Vectors: A Powerhouse for Global Health, Biomedicines). 2017, 5(3):44 and Lico et al, Viral vectors for production of recombinant proteins in plants, J Cell Physiol, 2008; 216(2):366-77).

[0184] Preferably, the viral vector is selected from the group consisting of tobacco rattle virus (TRV), tobacco mosaic virus (TMV), sonchus yellow net virus (SYNV) and potato virus X (PVX). Preferably, the viral vector is at least one of tobacco rattle virus (TRV), tobacco mosaic virus (TMV) and sonchus yellow net virus (SYNV).

[0185] The viral vector used in the method of the present invention may contain a gene deletion to increase the packaging capacity of the virus. Preferably, the virus contains a deletion of the gene encoding the coat protein (CP). A preferred viral vector containing a deletion of the coat protein is a tobamovirus or a tobravirus. A preferred viral vector containing a deletion of the coat protein is a tobamovirus, preferably a tobacco mosaic virus (TMV). A preferred viral vector is a TMV RNA-based overexpression vector (TRBO), for example, as described in Lindbo (TRBO: A High-Efficiency Tobacco Mosaic Virus RNA-Based Overexpression Vector, Plant Physiol, 2007; 145(4): 1232-40). The viral vector may be a self-replicating RNA, for example, as described in WO 2018 / 226972, which is incorporated herein by reference.

[0186] The vector, preferably a viral vector, may initially be contained in Agrobacterium to introduce the viral vector into plant cells of the plant. After infection, the viral vector is expressed from Agrobacterium in the plant cells. The viral vector can replicate and infect surrounding plant cells. The viral vector may be modified, for example, by deletion of a coat protein that prevents the virus from spreading systemically.

[0187] The cells of the recalcitrant plant that are transfected will preferably develop into tissues that are part of the newly formed shoot, where the tissues include one or more germline progenitor cells and / or clonal propagation tissues and / or one or more cells that give rise to the plant part. The recalcitrant cells that are transfected may be primary transfected cells, or, for example, secondary or subsequently transfected cells. As a non-limiting example, cells of the regenerable plant may be transfected with vectors that express transgenes and / or site-specific endonucleases, such as Agrobacterium and / or viral vectors. Viruses produced in such initially infected cells may spread and infect cells of the recalcitrant plant, i.e., secondary infections.

[0188] For example, one or more cells of a regenerable plant may be infected with Agrobacterium containing a viral vector expressing a transgene and / or a site-specific endonuclease. At the graft union, the produced virus may be transferred to cells of the recalcitrant plant. Infection with the viral vector then results in expression of the transgene and / or the site-specific endonuclease in one or more cells of the recalcitrant plant. The site-specific endonuclease will introduce a mutation in the sequence of interest in the recalcitrant cell, and upon shoot formation, this mutation will be present in the formed shoot. The transgene may be incorporated into the recalcitrant plant upon shoot formation, and the transgene may be present in the formed shoot.

[0189] As noted above, the method of the present invention may further comprise step (d) of growing a plant from the shoot selected in step (c). Optionally, particularly in cases where root regeneration is troublesome, step (d) may comprise grafting the selected shoot onto a suitable rootstock. The plant grown in step (d) preferably comprises at least one inflorescence for reproduction, i.e. for generating seeds and / or progeny plants.

[0190] More particularly, the present invention provides a method for generating a plant, comprising steps (a), (b) and (c) as defined herein, further comprising a step of generating a plant from said shoot, wherein preferably said plant comprises at least one inflorescence. Optionally, the generated plant does not comprise or substantially does not comprise cells of the regenerable plant of step (a). In other words, optionally, the generated plant is a non-chimeric plant having the same or substantially the same genotype as the difficult to regenerate plant of step (a) of the method of the invention. Thus, the generated plant may also be a difficult to regenerate plant, preferably of the same species and variety as the difficult to regenerate plant cells of step (a), as defined herein. When the method of the invention involves the introduction of a mutation and / or a transgene, preferably at least one, and optionally all, of the cells of the generated plant also comprises said mutation and / or transgene. Thus, "substantially the same genotype" is to be understood herein as the same genotype, even if it comprises a mutation and / or a transgene that may be introduced using the method of the invention.

[0191] Additionally or alternatively, the germline cells, preferably gametes, of the generated plant may have the same or substantially the same genotype as the gametes of the refractory plant of step (a) of the method of the invention, optionally including the mutations and / or transgenes introduced into the cells of the refractory plant of step (a) of the method of the invention as further detailed herein. Optionally, the plant may be a chimeric plant further comprising a cell or tissue layer of a regenerable plant. Optionally, the plant is used to generate seeds and / or progeny by crossing, selfing and / or apomictic propagation (i.e. apomictic reproduction) in the case of germline progenitor cells of apomictic genotype. Optionally, the plant is pollinated and / or the pollen is used to pollinate another plant or the same plant (selfing). Optionally, the plant is used to produce tissue and / or plant parts for clonal propagation as defined herein, and optionally the tissue and / or plant parts are isolated and used for clonal or vegetative propagation.Thus, the present invention also provides a method of producing a plant or seed, comprising steps (a), (b) and (c) as defined herein, and further comprising the step of generating a plant by vegetative or clonal propagation from a shoot selected in step (c), preferably said plant comprising at least one inflorescence; optionally generating seeds and / or progeny plants of the generated plant by sexual or apomictic reproduction.

[0192] Thus, the method of the present invention is a method for producing a plant or a seed, comprising the steps of: (a) contacting a cell of a difficult-to-regenerate plant with a cell of a regenerable plant; (b) allowing the contacted cells of (a) to form shoots; and (c) selecting the shoots formed in step (b), wherein at least a portion of the shoots are composed of cells of the difficult-to-regenerate plant; (d) growing a plant from the shoot selected in step (c); optionally (e) producing seeds and / or progeny from the plant of step (d). The method may include:

[0193] Where the method of the invention involves the introduction of a mutation and / or transgene, seeds and / or progeny of the developing plant may be selected to carry said mutation and / or transgene. The seed (or embryo of said seed) produced may optionally have the same or substantially the same genotype as the progeny of the refractory plant from which the refractory plant cell of step (a) was isolated or is part of, except for the mutation and / or transgene introduced.

[0194] Optionally, step (b) of regenerating shoots from the cells contacted in step (a) comprises the formation of a callus prior to shoot regeneration. Thus, the method of the invention may be a method of producing a plant, wherein the plant comprises germline progenitor cells and / or tissues and / or plant parts for clonal propagation of a difficult to regenerate plant, and wherein the method comprises: (a) contacting one or more cells of a non-regenerable plant with one or more cells of a regenerable plant; (b) allowing the contacted cells of the difficult-to-regenerate plant body of step (a) to form callus, and growing a shoot from the callus obtained in step (b); (c) selecting the shoots obtained in step (b) that contain germline progenitor cells and / or clonal propagation tissues and / or cells that give rise to plant parts of the difficult-to-regenerate plant; and (d) growing a plant from the shoot selected in step (c). Includes.

[0195] Optionally, a plurality of seeds and / or progeny plants are produced, the method preferably further comprising the step of selecting at least one seed and / or progeny plant after genotyping and / or evaluating the presence of mutations and / or transgenes that may have been introduced in the refractory cells of step (a) of the method of the invention as detailed herein. The seeds and / or progeny plants may be genotyped to evaluate whether the plant has the same or substantially the same genotype as the cells of the refractory plant of step (a). The seeds may be allowed to germinate and develop into plants.

[0196] Optionally, the cells of the difficult to regenerate plant in step (a) of the method of the invention are cells with ploidy abnormalities and may be haploid. Thus, the method of the invention may be a method of propagating haploid plant material. The method may further comprise the step of screening the regenerated plants and / or seeds for ploidy level.

[0197] Optionally, during co-regeneration in step (b), the genome may be doubled naturally or chemically, resulting in the development of at least one shoot comprising or consisting of a doubled haploid cell. The genotype of the developed shoot may then differ from the unregenerate plant cell in that the genome has been doubled. Thus, the method of the invention may be a method of producing doubled haploid plant material, and the method of the invention may include a step of screening the regenerated plants and / or seeds for ploidy level.

[0198] In another embodiment, the selected shoots of step (c) are not isolated, but an inflorescence can be grown on the plant structure developed in step (b) of the method of the present invention, said plant structure optionally including further shoots. The inflorescence can be used for sexual or apomictic reproduction. The inflorescence can be pollinated or the pollen of the inflorescence can be used to pollinate another plant or the same plant (i.e. the inflorescence is self-pollinating).

[0199] As noted herein, the method includes injecting a cell of the difficult-to-regenerate plant body in step (a) or a cell originating therefrom in the regenerated shoot in step (b), (i) a transgene; or (ii) a mutation in the sequence of interest The method may further include the step of introducing:

[0200] Preferably, said sequence of interest is an endogenous sequence of interest. In the method comprising the introduction of a transgene or a mutation, preferably the step of introducing the transgene or mutation precedes step (b), even more preferably precedes step (a).

[0201] Additionally or alternatively, in said method, at least the germline progenitor cells of the shoot regenerated in step (b) and / or the clonal propagation tissue and / or the cells giving rise to the plant part contain a transgene or a mutation. Optionally, the mutation is introduced by programmed genome editing, preferably using a site-specific endonuclease, preferably a CRISPR endonuclease.

[0202] Optionally, the cells of the difficult to regenerate plant in step (a) of the method of the invention are (highly) heterologous and the method of the invention is a method for propagating heterologous plant material. Optionally, the cells of the difficult to regenerate plant in step (a) are axenic and the method of the invention is a method for propagating axenic plant material.

[0203] Plants can be grown from the shoots selected in step (c) of the method of the invention using any conventional culture conditions known to those skilled in the art. These culture conditions may depend on the plant produced by the method of the invention, and the skilled artisan will know how to adjust these conditions to generate an optimal environment for growing the plant produced by the method of the invention. The plant grown in step (d) may contain a transgene or a mutation in the sequence of interest as defined herein.

[0204] The method of the invention may further comprise a step (e) of producing or obtaining progeny of the plant grown in step (d). The progeny may be produced, for example, by sexual propagation, i.e. through the production of seeds by fusion of pollen and eggs. Preferably, at least one of the pollen and eggs originates from the plant grown in step (d). When the method comprises the introduction of a transgene or mutation in a sequence of interest as defined herein, preferably at least one of the pollen and eggs contains a transgene or mutation in the sequence of interest. Optionally, both the pollen and eggs originate from the plant grown in step (d). Preferably, the pollen and eggs contain the same transgene and / or mutation in the sequence of interest. Alternatively, the progeny is obtained by asexual (vegetative) propagation of the plant grown in step (d). Preferably, in such an embodiment, the transgene and / or mutation in the sequence of interest is present in tissues and / or plant parts that form the next generation by clonal propagation.

[0205] The present invention also relates to a plant obtainable by the method of the present invention, preferably obtainable in step (d) by the method of the present invention. The plant may be a chimeric plant comprising cells with the same or substantially the same genotype of a difficult to regenerate plant and cells or tissues with the same or substantially the same genotype of a regenerable plant. Preferably, the plant comprises a germline or germline progenitor cell and / or a clonal propagation tissue and / or a plant part of a difficult to regenerate plant. Preferably, the plant comprises an L2 shoot meristem layer of a difficult to regenerate plant. Optionally, the plant is a perichondrium and / or a plant, preferably a difficult to regenerate plant or a perichondrium comprising a transgene or a mutation in the sequence of interest. Thus, the plant may be a non-natural plant, an artificially created plant, a mutant plant and / or a transformed plant.

[0206] In one embodiment, the present invention thus relates to a periclinal chimera obtainable from the method of the present invention, preferably obtainable from step (d) as defined herein. A "periclinal chimera" is a chimera in which one or more of the entire cell (tissue) layers L1, L2, and / or L3 are genetically distinct from another cell layer. In the case of periclinal chimeras, the single tissue layer is itself homogenous and not chimeric. Periclinal chimeras are the most stable form of chimera and produce distinctive and valuable plant phenotypes. Such plants produce axillary buds with the same apical configuration as the terminal meristem from which they originated. Periclinal chimeras can therefore be propagated by vegetative propagation to maintain their chimeric layer configuration.

[0207] The peripheral chimeric plant obtainable from the method of the present invention preferably comprises at least one shoot meristem layer of a difficult to regenerate plant and at least one shoot meristem layer of a regenerable plant. Preferably, at least one of the L1, L2 and L3 shoot meristem layers is from a difficult to regenerate plant. The shoot meristem layers not from a difficult to regenerate plant are preferably from a regenerable plant. Preferably, the L2 shoot meristem layer of the peripheral chimera is from a difficult to regenerate plant and at least one of the L1 and L3 shoot meristem layers is from a regenerable plant.

[0208] The L2 meristem layer and the L1 and L3 shoot meristem layers of the peripheral plants may be of the same genus or of different genera. Preferably, the L2 meristem layer and the L1 and L3 shoot meristem layers of the peripheral plants are of the same genus. As a non-limiting example, the L1, L2 and L3 shoot meristem layers are of the genus Solanum or Capsicum. For example, the L2 shoot meristem layer may be from a Capsicum annuum plant, and at least one of the L1 and L3 shoot meristem layers may be from a Capsicum baccatum plant. Similarly, the L2 shoot meristem layer may be from a Solanum tuberosum plant, and at least one of the L1 and L3 shoot meristem layers may be from a Solanum lycopersicum plant.

[0209] The periclinal chimera may further comprise a transgene or a mutation in a sequence of interest. The mutation is preferably present at least in the germline or germline progenitor cells and / or clonal propagation tissues and / or plant parts of the difficult to regenerate plant. Preferably, the transgene or mutation is present in cells located in at least one of the L1, L2 and L3 shoot meristem layers of the periclinal chimera. Preferably, the transgene or mutation is present in cells located in at least the L2 shoot meristem layer of the periclinal chimera.

[0210] In a further aspect, the invention relates to a plant obtainable from the method of the invention, the plant comprising a transgene and / or a mutation in a sequence of interest. The plant may therefore be a transgenic and / or mutant plant. The plant may also be an artificially created plant. Preferably, the transgene or mutation in the sequence of interest is located in the germline or germline progenitor cells and / or clonal propagation tissues and / or plant parts of the difficult to regenerate plant. Thus, preferably, the plant comprises at least the germline or germline progenitor cells of the difficult to regenerate plant and / or clonal propagation tissues and / or plant parts of the difficult to regenerate plant, preferably comprising a transgene or a mutation in the sequence of interest. Preferably, the plant of the invention is not obtained by or is not obtained exclusively by an essentially biological process. The plant of the invention preferably differs from a plant occurring in nature at least in that it comprises at least one transgene or mutation in one sequence of interest. The transgene or mutation in the sequence of interest is preferably located in at least the germline or germline progenitor cells and / or clonal propagation tissues and / or plant parts of the plant. The transgene or mutation in the sequence of interest is preferably located in at least the L2 shoot meristem layer. The transgene or mutation in the sequence of interest is preferably present in at least one of the pollen and ovum of the plant.

[0211] The plant preferably comprises at least the germline or germline progenitor cells and / or clonal propagation tissue and / or plant parts of a difficult to regenerate plant. The plant preferably comprises at least the L2 shoot meristem layer of a difficult to regenerate plant. The plant obtainable from the method of the invention is preferably a difficult to regenerate plant, preferably comprising a transgene or a mutation in a sequence of interest.

[0212] The present invention further relates to progeny or seeds from a plant or perichondrium as defined herein. The progeny may be produced by sexual or asexual (vegetative) propagation. The progeny preferably comprises a transgene or a mutation in the sequence of interest as defined herein. The seed coat may have a different genotype than the embryo. Preferably, the genotype of the coat is from a regenerable plant and the genotype of the embryo is from a non-regenerable plant.

[0213] The present invention also relates to a plant part or a plant product derived from a plant obtained from the method of the present invention, preferably of step (c), (d) or (e) of the method of the present invention. Optionally, said plant part or plant product is characterized in that it comprises genetic material originating from both a difficult to regenerate plant as well as a regenerable plant. Preferably, said plant part or plant product comprises cells or tissues or genetic material derived from a difficult to regenerate plant. Optionally, said plant part or plant product is free or substantially free of cells or tissues or genetic material derived from a regenerable plant. Optionally, said plant part or plant product consists of cells or tissues or plant material characterized in that it comprises the genotype of a difficult to regenerate plant. Optionally, the plant part or plant product is characterized in that it comprises a transgene or a mutation in a sequence of interest. Such genetic material may be genomic DNA or a fragment of genomic DNA. Such genetic material may be mitochondrial DNA or a fragment of mitochondrial DNA. Such genetic material may be chloroplast DNA or a fragment of chloroplast DNA.

[0214] The plant part may be propagating or non-propagating material.

[0215] All patents and references cited herein are hereby incorporated by reference in their entirety.

[0216] Optionally, the cells in step (a) of the method of the invention are contacted using a tissue grafting method. The inventors have found that a grafting method utilizing a steel pin for fixation (preferably a sterile steel pin), i.e. by inserting said steel pin into the center of the rootstock and the scion as exemplified herein (see e.g. FIG. 1), is surprisingly effective. Such a grafting method using a steel pin is particularly useful when using seedling material, i.e. young plant material, preferably seedling material 1-4 or 1-3 weeks after sowing, preferably seedling material about 2 weeks after sowing, preferably seedling material of 0.1-1 mm, 0.1-0.75 mm, 0.1-0.5 mm, or 0.1-0.25 mm, preferably the seedling material is used immediately after the emergence of the first true leaves. This grafting method may be used in step (a) of the method of the invention, but may also be used to generate periclinal chimeras. The grafting method in which steel pins are used for fastening can be, but is not limited to, the method as described herein, where said periclinal chimera comprises the germ line or germ line progenitor cells and / or clonal propagation tissue and / or plant part of a non-regenerative plant. Optionally, said grafting method, e.g., the grafting method for producing a periclinal chimera, finds a wider application. Such a method may comprise the same steps as the method for generating and selecting a shoot of a plant optionally comprising the germ line or germ line progenitor cells and / or clonal propagation plant part of a non-regenerative plant as defined herein, except that the plant to be grafted in step (a) is not limited to being non-regenerative and / or regenerative, only that both plants must have different genotypes, and the resulting shoot to be selected in step (d) is a periclinal chimera, and does not necessarily comprise the germ line or germ line progenitor cells and / or clonal propagation tissue and / or plant part of a non-regenerative plant. Optionally, plants are grown from such periclinal chimeras, which may find application such as, but not limited to, those specified in WO 2018 / 115395 and / or WO 2018 / 115396. Such methods and the resulting periclinal chimeras may be considered as further inventions provided herein. EXAMPLES

[0217] Example 1 Potato propagation (Solanum tuberosum cv. Bintje, origin: The Netherlands) was performed by rooting single-node cuttings (internodes with axillary buds) on hormone-free solid MS20 medium (Murashige Skoog, vitamins, 20 g / L sucrose, no hormones). Dutch native tomato genotypes of various origins (i.e., hybrids between Solanum lycopersicum cv. Money Maker and Solanum habrochaites accessions LA1392 or PI27826, Solanum pennellii accession LA716, or Solanum lycopersicum accession LA3579) were sown on sterile filter paper soaked in sterile tap water and, after rooting, placed on MS20. Grafting was performed using a tomato seedling hypocotyl in MS20 (approximately 2 weeks after sowing, just after its first true leaf appeared) as rootstock, a potato nodal shoot tip of a young single-node cutting as scion, and a sterile steel pin (0.15 mm diameter) inserted through the centre of the rootstock and scion for fixation as shown in Figure 1a. The scion was placed on MS20 medium in a sterile tissue culture vessel at 23°C and a 16 / 8 h light / dark regime.

[0218] A total of 251 scion plants were allowed to heal for 6–9 days, after which they were decapitated leaving a thin layer (approximately 1 mm) of potato on the tomato rootstock as shown in Figure 1b, and the shoots were placed vertically in MS20 as shown in Figure 1c and allowed to regenerate without the addition of any hormones.

[0219] While tetraploid clonally propagated potatoes such as Bintje do not regenerate in the absence of exogenously supplied phytohormones, tomatoes regenerate extremely quickly from cut hypocotyls in MS20, with the first signs of shoot emergence appearing after 6–12 days. By scoring morphological characteristics (1) leaf shape and (2) trichomes, three potato tissue-containing shoots were identified within 7–14 days from a total of 251 scions. This amount increased to a total of 10 potato tissue-containing shoots one month after grafting across the different scions of Bintje combined with various tomato genotypes. Thus, potato tissue regeneration appears to be independent of the tomato genotype used. Of these 10 shoots, three were pure potato, six were incomplete periclinal chimeras, and one was a periclinal chimera. These shoot regenerations occurred at the graft interface (junction). Therefore, we conclude that potato regenerates under the influence of coexisting tomato cells at the graft union.

[0220] FIG. 2 shows photographs of pure tomatoes, periclinal chimeras, and Bintje regenerants.

[0221] Example 2 Seeds of Chicory intybus L. (Roodlof Indigo, Vreeken's Zaden, The Netherlands), hereafter referred to as chicory, were surface sterilized in 70% ethanol for 30 seconds, then sterilized in 2% bleach (sodium hypochloride solution) for 15 minutes, rinsed three times in sterile MQ for 15 minutes each rinse, and sown in pots of MS (Murashige and Skoog, 1962) 20 hormone-free medium, pH 5.8 and 0.8% agar, in the dark.

[0222] Seeds of Taraxacum brevicorniculatum, hereafter referred to as dandelion (kindly provided by Dr. Jan Kirschner, Institute of Botany, Pruohonice, Czech Republic), were first rinsed with 70% ethanol for 30 seconds and then sterilized with 1% bleach for 15 minutes. The seeds were then rinsed four times with sterile MQ water. The seeds were placed on a rotary shaker during the entire sterilization process. The seeds were then sown in MS20 at pH 5.8 and 0.2% agar in the dark, supplemented with cefotaxime and vancomycin. Once the seeds germinated, they were placed in pots of MS20 hormone-free medium and allowed to grow to plantlets under normal light conditions (16 hours light and 8 hours dark).

[0223] Chicory intybus is highly regenerative, while Taraxacum brevicorniculatum is poorly regenerative.

[0224] Protoplast isolation When the plants were 4-6 weeks old, chicory and dandelion protoplasts were isolated from leaf material of chicory and dandelion plants, respectively, as follows. The three youngest leaves of these plants were cut along the leaf veins with a sterile scalpel (sterile No. 10 surgical blade, Swaan Morton) in CPW9M (27 mg / L KH2PO4, 100 mg / L KNO3, 200 mg CaCl2.2H2O, 512 mg MgSO4.7H2O, 0.16 μg KI, 0.39 ng CuSO4.H2O, 9% mannitol, 2.5 mg / L Fe(SO4)3.6H2O, and 580 mg / L MES, pH 5.8) and plasmolyzed by incubation in 25 mL CPW9M in a Petri dish (Greiner 664161) for 30 min, followed by addition of 25 mL of enzyme solution (4.44 μM BAP (6-benzylaminopurine), 10.74 μM NAA (1-naphthaleneacetic acid), and 0.9 μM 1-naphthaleneacetic acid). CPW9M was replaced with 1% Cellulase Onozuka RS (C8003, Duchefa), 0.2% Macerozyme R-10 (M8002, Duchefa) prepared in CPW9M at pH 5.8 supplemented with 2,4-D (dichlorophenoxyacetic acid) and digested overnight (16-17 h; see Figures 3A and 4A, respectively) at 25 °C in the dark. After digestion, chicory and dandelion protoplasts were purified using a 12.5% ​​(w / v) sucrose solution.

[0225] Chicory protoplast inactivation Purified chicory protoplasts used for co-regeneration were resuspended in CPW9M and treated with 10 mM iodoacetamide (IOA, Sigma) for 30 min. IOA acts as an irreversible inhibitor of mitotic spindle assembly during mitotic prophase, thus preventing cell division (Varotto et al. 2001). After IOA treatment, protoplasts were rinsed twice with CPW9M.

[0226] Dandelion protoplast staining Purified dandelion protoplasts were also resuspended in CPW9M. Dandelion protoplasts do not divide in the selective chicory media K1Cg and K5Cg, so there is no need to treat them with IOA. Instead, for visualization purposes, dandelion protoplasts were treated with fluorescein diacetate (FDA, Widholm 1972) for 5 min.

[0227] PEG treatment IOA-treated chicory and FDA-treated dandelion protoplasts were cultured at 1 × 10 6 The mixtures were mixed at a total protoplast density of every mL. To bring the protoplasts into close proximity with each other, each of these mixtures was treated with a PEG (polyethylene glycol) 3350 MW solution (30 g PEG 3350 MW, 150 mg CaCl2H2O, 10 mg KH2PO4, in a final volume of 100 mL H2O, pH 5.5) using either method 1 or method 2, followed by a neutralization solution (735 mg CaCl2.2H2O, 375 mg glycine, 8 g mannitol, in a final volume of 100 mL H2O, pH 10.5).

[0228] Method 1 For each experiment, 1 mL of the protoplast mixture was gently pipetted onto 4 drops onto a 6 cm Petri dish (Greiner 628102, SigmaAldrich). The same volume of PEG 3350MW solution was gently added dropwise around the protoplast mixture. The protoplast mixture and PEG solution were mixed very carefully and incubated at room temperature for 30 min. Then, 10 mL of neutralization solution was added to the mixture. The mixture was then centrifuged at 800 rpm for 5 min and rinsed twice with 9M (9% (w / v) mannitol, 140 mg / L CaCl2.H2O, 580 mg / L MES, pH 5.8) before they were embedded in alginate disks as further detailed below.

[0229] Method 2 For each experiment, 200 μL of the protoplast mixture was placed in a petri dish and three volumes of the PEG 3350MW solution indicated above were added dropwise to the protoplast mixture. After 1 min of incubation, 700 μL of the neutralization solution indicated above was added twice at 1 min intervals. After 5 min, 2 mL of CPW9M was added three times at 5 min intervals. After 10-15 min of incubation at room temperature, the fusion mixtures were centrifuged at 800 rpm for 10 min and rinsed twice with 9M before they were embedded in alginate disks as further detailed below.

[0230] Protoplast culture The protoplast suspension in 9M was gently mixed 1:1 with a 1.6% sodium alginate (S1320, Duchefa) solution containing 9% (w / v) mannitol to obtain 0.25 × 10 6A final protoplast density per mL was achieved and the protoplasts were then embedded in alginate disks by gently spreading 1 mL of this mixture onto a calcium agar plate. This was done for the protoplast mixture as well as for pure (i.e. unmixed) chicory and dandelion protoplasts as controls. The alginate disks were allowed to polymerize by incubating at room temperature for 45 minutes. Four mL of K1Cg medium (1.9 g / L KNO3, 600 mg / L CaCl2.2H2O, 300 mg / L MgSO4.7H2O, 170 mg / L KH2PO4, 300 mg / L KCl, 750 μg / L KI, 3 mg / L H3BO3, 10 mg / L MnSO4.H2O, 2 mg / L ZnSO4.7H2O, 250 μg / L Na2MoO4.2H2O, 25 μg / L CuSO4.5H2O, 25 μg / L Na2MoO ... CoCl2.6H2O, 20 mg / L sodium pyruvate, 40 mg / L citric acid, 40 mg / L malic acid, 40 mg / L fumaric acid, and 100 mg / L myo-inositol, supplemented with 2.5 mg / L sucrose, 2.5 mg / L fructose, 2.5 mg / L ribose, 2.5 mg / L xylose, 2.5 mg / L mannose, 2.5 mg / L rhamnose, 2.5 mg / L cellobiose, 2.5 mg / L sorbitol, and 2.5 mg / L mannitol, 1% (v / v) Kao and Michayluk vitamin solution (K3129, Sigma-Aldrich), 2% (v / v) coconut water (C5915, Sigma-Aldrich), 27.8 mg / L FeSO4.7H2O, 37.7 mg / L The disks were transferred to 6 cm Petri dishes (Greiner 62810, Sigma-Aldrich) containing Na2EDTA.2H2O, 68.4 g / L glucose, 300 mg / L glutamine, 2 mg / L NAA, and 1 mg / L BAP, pH 5.8.

[0231] After 1 week, the K1Cg medium was removed and 4 mL of K5CgK medium (600 mg / L CaCl2.2H2O, 300 mg / L MgSO4.7H2O, 170 mg / L KH2PO4, 300 mg / L KCl, 750 μg / L KI, 3 mg / L H3BO3, 10 mg / L MnSO4.H2O, 2 mg / L ZnSO4.7H2O, 250 μg / L Na2MoO4.2H2O, 25 μg / L CuSO4.5H2O, 25 μg / L CoCl2.6H2O, 20 mg / L sodium pyruvate, 40 mg / L citric acid, 40 mg / L malic acid, 40 mg / L fumaric acid, and 100 mg / L myo-inositol, supplemented with 2.5 mg / L sucrose, 2.5 mg / L fructose, 2.5 mg / L ribose, 2.5 mg / L xylose, 2.5 mg / L mannose, 2.5 mg / L rhamnose, 2.5 mg / L cellobiose, 2.5 mg / L sorbitol, and 2.5 mg / L mannitol, 1% (v / v) Kao and Michayluk vitamin solution (K3129, Sigma-Aldrich), 2% (v / v) coconut water (C5915, Sigma-Aldrich), 27.8 mg / L FeSO4.7H2O, 37.7 mg / L The medium was then replaced with Na2EDTA.2H2O (containing 52.5 g / L glucose, 600 mg / L glutamine, 750 mg / L KCl, 0.5 mg / L NAA, and 0.5 mg / L BAP, pH 5.8), and protoplasts were cultured in the dark at 28°C. After 2 weeks of culture in K5CgK, the alginate disks were cut into approximately 5 mm strips and transferred to solid B5g-10 medium supplemented with 2.69 μM l NAA and 2.22 μM BAP and 1% sea plaque agarose (S1202, Duchefa).

[0232] Once microcolonies had formed, 1–3 mm sized microcalli (2–3 weeks) were manually picked with precision tweezers and 50 microcalli were placed in square Petri dishes (Greiner 688102, SigmaAldrich) containing MS10 medium supplemented with 1.43 μM IAA (indole acetic acid, Duchefa) and 1.11 μM BAP. After 3 weeks, the calli (first signs of regeneration) were then transferred to SH (Schenk-Hildebrand medium, Duchefa) 10 medium containing the same hormone combination. Once shoot-like structures were observed, they were transferred to pots (OS60 pots, Duchefa) of SH10 containing 1.43 μM IAA and 1.11 μM BAP. Developing shoots were then transferred to square pots (Aarts plastics) containing SH10 hormone-free medium and incubated at 25°C under 16 h light and 8 h dark conditions. Regenerated plants were genotyped with chicory- and dandelion-specific primers.

[0233] result co-reproduction Pure chicory protoplasts began to undergo initial divisions during the first week of protoplast culture in K1Cg medium supplemented with NAA and BAP 3–4 days after isolation (Figure 3B), and microcolonies formed after 4 days (Figure 3C). Chicory colonies were visible after 11 days of culture (Figure 3D).

[0234] Pure dandelion protoplasts were poorly regenerative and did not divide in K1Cg medium, as shown in Figures 4B-4D. Even after 3 days of culture, there was no sign of early division. After 10 and 17 days of culture, dandelion protoplasts became vacuolated and showed no signs of viability.

[0235] Co-cultivation of chicory and dandelion protoplasts mixed at 1:1 and 1:2 resulted in the formation of yellowish calli after 8-10 weeks of protoplast culture after isolation. These calli were clearly phenotypically distinct from the chicory whitish watery calli. These yellowish calli appeared in both PEG treatment protocols (Method 1 and Method 2) in experiments using protoplast mixtures at 1:1 and 1:2 chicory and dandelion protoplast ratios. As these calli began to show signs of regeneration, it was observed that within each single callus, two distinctive phenotypes emerged (Figure 5A and Figure 5B).

[0236] Plantlets derived from the whitish chicory callus had larger leaves like chicory, while the yellowish callus produced thin leaves like dandelion (FIGS. 5C and 5D).

[0237] Leaves of regenerated plantlets were sampled and DNA samples from these leaves were subjected to 35 cycles of PCR at an annealing temperature of 57° C. using chicory-specific or dandelion-specific primer sets, respectively. The chicory-specific forward primer had the sequence 5′-CAGACACAATGGTAGATGATGG-3′ (SEQ ID NO: 10) and the chicory-specific reverse primer had the sequence 5′-CTTCATCGCCATGCCCAGAAG-3′ (SEQ ID NO: 11) to generate a 429 bp band. The forward primer of the dandelion primer set had the sequence 5′-TAAGAAACCGAAGCAAACTC-3′ (SEQ ID NO: 12) and the reverse primer of the dandelion primer had the sequence 5′-GCGCTTTCTACAATCTTACA-3′ (SEQ ID NO: 13) to generate a 794 bp band.

[0238] It was observed that plantlets from co-cultures with a Taraxacum-like phenotype only displayed dandelion-specific bands, whereas those with a chicory-like phenotype only displayed chicory-specific bands (Figure 6).

[0239] This is a proof of concept that two very different species, Chicory intybus (highly regenerable) and Taraxacum brevicorniculatum (difficult to regenerate), co-regenerated from protoplast co-cultures using PEG 3350MW.

[0240] Example 3 Maor pepper (Capsicum annuum; Israel) is known to be a difficult-to-regenerate plant, showing no shoot meristem regeneration even after wounding and / or tissue culture. A total of 201 scions were prepared and truncated by grafting Maor cotyledonary nodes as scions onto seedling hypocotyls of C. baccatum (cv. rainforest, Vreeken's Zaden, The Netherlands) as rootstock, following the same method as described in Example 1, except that the scions were placed on MS10 containing 1% sucrose instead of MS20 containing 2% sucrose. As in Example 1, the stumps were left after truncation and regenerated without the addition of any hormones.

[0241] From a total of 201 scions, two leaves containing Maor tissue (incomplete periclinal chimeras) and five plants with pure Maor leaves and shoots were identified within 7–10 days based on trichome morphology. The left side of chimera 1 showed an overall C. baccatum phenotype with C. annuum trichomes, appearing as a periclinal chimera. The right side showed a pure C. baccatum phenotype. The left side was labeled 1-1 and the right side was labeled 1-2 for further analysis (Figure 7A). Chimera 2 had a similar phenotype, where the left side showed a pure C. annuum phenotype and the right side showed pure C. baccatum (Figure 7B). After transfer to the greenhouse, plant number 7, which was identified as pure C. annuum based on trichome morphology, displayed a C. baccatum growth phenotype and was therefore identified as a likely periclinal chimera (Figure 7C).

[0242] For the CAPS marker assay, PCR amplification was performed on these seven plant samples with a forward primer with the sequence 5'atactaatttccacccaacaacgt3' (SEQ ID NO: 14) and a reverse primer with the sequence 5'tctcaacattaaacatgtcgccac3' (SEQ ID NO: 15). In particular, PCR amplification was performed on DNA isolated from leaf samples using these primers with 34 cycles and an annealing temperature of 55°C. The 515 bp product was incubated with EcoRV for 1 hour. Since an EcoRV recognition site was present in the amplified genomic sequence of C. baccatum, which was absent in the amplified genomic sequence of Maor, EcoRV incubation of the amplicon from Maor resulted in a 515 bp fragment, while EcoRV incubation of the amplicon from Maor resulted in fragments of 348 bp and 167 bp. FIG. 8 shows that samples taken from each plant support this phenotypic analysis, with plants 1, 2 and 7 being chimeras and plants 3, 4, 5 and 6 being pure C. annuum.

[0243] Example 4 Protoplast grafting and co-regeneration of tobacco (Nicotiana benthamiana; Herbalistics, Australia) was performed using two transgenic tobacco cell lines. One cell line carrying Venus yellow fluorescent protein under the control of the 35S promoter (35S::vYFP) and the second cell line carrying cytoplasmic RUBY under the control of the 35S promoter (He et al. Horticulture Research (2020) 7:152) (35S::RUBY). To prepare the grafts, in vitro shoot cultures of tobacco grown in hormone-free MS20 medium with an 18 / 8 h photoperiod, 25 °C and 60%-70% relative humidity were used.

[0244] Tobacco protoplasts were isolated from these shoot cultures. Young fresh leaves were harvested from tobacco plants and placed upside down in a square Petri dish containing 5 mL of CPW9M (27 mg / L KH2PO4, 100 mg / L KNO3, 200 mg / L CaCl2.2H2O, 512 mg / L MgSO4.7H2O, 0.16 μg / L KI, 0.39 ng / L CuSO4.H2O, 9% mannitol, 2.5 mg / L Fe(SO4)3.6H2O, and 580 mg / L MES, pH 5.8). The leaves were carefully pressed down and the lower epidermis was sliced ​​perpendicular to the midrib into 1 mm slices using a fresh scalpel. The sliced ​​leaves were transferred to a 15 cm Petri dish containing 15 mL of CPW9M. Once all the leaves were sliced, the sliced ​​material was transferred to a 15 cm Petri dish and 5 mL of Enzyme stock SR1 (0.75% Cellulase Onozuka RS (C8003, Duchefa), 0.5% Driselase (D8037, Sigma), 0.25% Macerozyme R-10 (M8002, Duchefa) prepared in CPW9M pH 5.8) was added to the dish and gently mixed. The dish was covered with plastic wrap and incubated at 25°C for 18 hours. The plate was continuously mixed to detach the protoplasts.

[0245] The protoplasts were then washed using the following steps: A stainless steel 50 μm sieve was pre-wetted with CPW9M. The protoplast solution was pipetted onto the sieve without picking up any large debris. 25 mL of KC (2 g / L CaCl2.2H2O, 19 g / L KCl and 580 mg / L MES, pH 5.8) was added to the remaining debris to detach additional protoplasts, which were carefully transferred onto the sieve. This step was repeated using 12.5 mL of KC, followed by rinsing the sieve with an additional 15.3 mL of KC. The flow-through was dispensed into a centrifuge tube and spun down at 85×g for 5 min. After removing the supernatant, the pellet was resuspended by adding 5 mL of CPW9M. The two tubes were combined into one and the centrifugation step was repeated. After removing the supernatant, the pellet was again resuspended in 5 mL of CPW15S (CPW supplemented with 150 g / L sucrose). The pellet was then covered with 2 mL of CPW9M, without mixing the two layers. The centrifugation step was repeated for 10 min to recover the protoplasts from the interphase without disturbing the sucrose layer. The final protoplast density was set to 2 × 106 per mL in CPW9M.

[0246] To conjugate the protoplasts, we used a sterile 2 x 2 cm piece of precision mesh (Nitex #03-177 / 34) with 170 micron mesh openings and 220 micron thickness, which was dried and stored in a sterile condition until use. The precision mesh was plated on a K8P agar plate with the following components: (600 mg / L CaCl2.2H2O, 300 mg / L MgSO4.7H2O, 170 mg / L KH2PO4, 300 mg / L KCl, 600 mg / L NH4NO3, 1.9 g / L KNO3, 750 μg / L KI, 3 mg / L H3BO3, 10 mg / L MnSO4.H2O, 2 mg / L ZnSO4.7H2O, 250 μg / L Na2MoO4.2H2O, 25 μg / L CuSO4.5H2O, 25 μg / L CoCl2.6H2O, 20 mg / L sodium pyruvate, 40 mg / L citric acid, 40 mg / L malic acid, 40 mg / L fumaric acid, and 100 mg / L myo-inositol, supplemented with 2.5 mg / L sucrose, 2.5 mg / L fructose, 2.5 mg / L ribose, 2.5 mg / L xylose, 2.5 mg / L mannose, 2.5 mg / L rhamnose, 2.5 mg / L cellobiose, 2.5 mg / L sorbitol, and 2.5 mg / L mannitol, 1% (v / v) Kao and Michayluk vitamin solution (K3129, Sigma-Aldrich), 2% (v / v) coconut water (C5915, Sigma-Aldrich), 27.8 mg / L FeSO4.7H2O, 37.7 mg / L Na2EDTA.2H2O, 68.4 g / L glucose, 3 mg / L NAA, 1 mg / L BAP, pH 5.8) was applied to the cells in a manner that avoided trapping air underneath the mesh. A 50 μL aliquot of protoplasts of each of these two cell types was mixed in a 2 mL Eppendorf tube using a wide-tip pipette and 2 μL of β-D-galactosyl Yariv (2 mg / mL, Biosupplies Australia Pty. Ltd., Cat. No.: 100-8A) solution was added. Yariv ensures aggregation of the protoplasts, thus allowing co-regeneration. In the absence of Yariv solution, no bonding occurred between the protoplasts (data not shown).The mixture was immediately spotted dropwise onto the mesh, ensuring saturation of the mesh pores with cells and allowing to sit for 5 min to ensure no visible dome-shaped droplets. The spots were carefully covered with a K8P 1.6% agar coverslip, pushing any excess cells away from the mesh, and allowed to aggregate for 25 min. The agar slide was removed from the mesh, as was the mesh from the agar plate. The mesh was rinsed with 1 mL of 9M medium (90 g / L mannitol, 140 mg / L CaCl2.2H2O, pH 5.8) and placed in a 5 cm Petri dish (see FIG. 10). To embed the protoplasts, 1 mL of 9M+ aggregate suspension was added with 1 mL of alginate solution (1.6% Na alginate (S1320, Duchefa), 140 mg / L CaCl2.2H2O, 9% (w / v) mannitol) and mixed gently. The resulting mixture was spread on a Ca-agar plate (72.50 g / L mannitol, 7.35 g / L CaCl2.2H2O, 0.8% microagar, pH 5.8) and left for 1 h. After 1 h, the disk was transferred to 4 mL of K8P culture medium, sealed, and incubated at 28 °C in the dark for 5 days.

[0247] To allow callus formation, the plates were incubated for 5 days with 0.5MS+2% sucrose+6% mannitol+0.03mg / L NAA+0.1mg / L BAP, followed by replacement of K8p medium and incubation for 7 days. The alginate was dissolved using sodium citrate (14.7g / L 3Na citrate.2H2O, 36.4g / L mannitol, pH 6.5) and passed through a 160 micron sterile mesh (Nitex) to select large colonies. The colonies were embedded in alginate as described above and fresh 0.5MS+2% sucrose+6% mannitol+0.03mg / L NAA+0.1mg / l BAP was added. The sealed plates were incubated at 25°C in the dark. After 5 days, the medium was changed to 0.5MS+2% sucrose+3% mannitol+0.03 mg / L NAA+0.1 mg / L BAP and incubated as above. The medium was changed to 0.5MS+2% sucrose+0.25 mg / L zeatin and incubated at 25°C in the light. They were transferred to fresh medium every 3 weeks until regeneration was evident. The disks or calli were transferred to petri dishes containing 0.5MS+2% sucrose+0.25 mg / L zeatin+0.8% microagar and shoots were allowed to develop and screened for the desired regenerant species.

[0248] In several independent experiments, chimeric leaves developed from selected hand-picked calli (10 of 96 picked calli). These chimeric calli were striking in that they had red + green organs on a solid green or solid red background. Some of these chimeras developed as incomplete periclinal chimeras, from which periclinal chimeras were developed using axillary buds.

[0249] Example 5 Co-regeneration was also tested in tomato (RZ52201, Rijk Zwaan, The Netherlands) by grafting a regenerable wild type (WT) onto a nonregenerable goblet mutant (gob; Berger Y. et al. (2009) The NAC-domain transcription factor GOBLET specifies leaflet boundaries in compound tomato leaves. Development 136(5):823-832). A homozygous gob null mutant (gob-1, Berger et al. 2009) is unable to generate shoots due to a defect in stem cell specification / maintenance (Figures 10A and 10B). Shoots were regenerated from graft unions formed by grafting a gob null mutant scion onto a WT rootstock (n=79 scions) and then by culturing slices from these graft unions. All were WT, with the exception of one stable (peripheral) chimera in which gob nulls formed a functionally normal epidermal L1 layer ( Fig. ​ (Fig.10C 10C ). Thus, junctional patterning during adventitious shoot formation, i.e., co-renewal, confers a stable stem cell identity to gob cells.

Claims

1. 1. A method for generating and selecting shoots of a plant, comprising: (a) contacting cells of a difficult-to-regenerate plant with cells of a regenerable plant, wherein the cells of the regenerable plant exhibit a higher regeneration efficiency than the cells of the difficult-to-regenerate plant under conditions permissive for shoot regeneration; (b) allowing said contacted cells of (a) to form shoots under conditions permissive for shoot regeneration; (c) selecting the shoots formed in step (b), wherein at least a portion of the shoots are composed of cells of the difficult-to-regenerate plant; and optionally (d) growing a plant from the selected shoot of step (c). The method comprising:

2. 2. The method of claim 1, wherein the portion of the selected shoot consisting of cells of the difficult to regenerate plant in step (c) is a tissue containing germline progenitor cells, and optionally the method further comprises step (d) and obtaining seeds or plant progeny of the plant grown in step (d) by sexual propagation, optionally by selfing or backcrossing.

3. 3. The method according to claim 1 or 2, wherein in step (c) the selected shoots consist of cells of the difficult to regenerate plant, and optionally the method further comprises step (d) and a step of obtaining a progeny of the plant grown in step (d) by vegetative propagation.

4. The method according to claim 1, wherein the cells of the non-regenerative plant and the cells of the regenerable plant in step (a) are isolated cells, preferably protoplasts.

5. 5. The method according to claim 4, wherein the isolated cells in step a) are exposed to a compound that promotes the aggregation of the cell membranes of the cells, preferably by using a plant cell and / or protoplast linking agent, preferably said linking agent being Yariv's reagent.

6. The method according to claim 1 , wherein the cells of the difficult-to-regenerate plant body and the cells of the regenerable plant body in step (a) are contained in tissue.

7. 7. The method of claim 6, wherein step (a) is carried out by using a rootstock-scion grafting method and allowing the graft joint to heal.

8. Step (b) - creating a wound at or near the graft joint; - allowing callus to form at the wounded graft joint; and - growing a shoot from said callus The method of claim 7, comprising:

9. to the cells of the difficult-to-regenerate plant body in step (a) or to the cells of the shoot formed in step (b) originating therefrom, (i) a transgene; or (ii) Mutations in the sequence of interest The method of claim 1 further comprising the step of introducing:

10. 10. The method of claim 9, wherein the step of introducing the transgene or the mutation precedes step (b) and optionally precedes step (a).

11. The transgene or the mutation is present in the shoot formed in step (b). - said germline progenitor cells and / or germline cells derived therefrom; and - plant parts of the plants grown in step (d) used for vegetative propagation The method according to claim 9 or 10, comprising at least one of the steps:

12. 10. The method of claim 9, wherein the mutation is introduced by programmed genome editing, preferably using a site-specific endonuclease, preferably a CRISPR endonuclease.

13. A plant obtainable from the method according to claim 9, i) germline progenitor cells and / or germline cells derived therefrom of the difficult-to-regenerate plant; and ii) A plant part for clonal propagation of the difficult-to-regenerate plant body. In a plant body containing at least one of The plant, wherein said germline progenitor cells, germline cells and / or plant parts comprise said transgene or said mutation in said sequence of interest.

14. The plant body described in claim 13, wherein the plant body comprises cells of the difficult-to-regenerate plant body and cells of the regenerable plant body.

15. 2. Use of an agent that links the cell membrane of a cell of a difficult-to-regenerate plant body to a cell of a regenerable plant body for regenerating said cell of a difficult-to-regenerate plant body, preferably said agent being Yariv's reagent.

Images