Improved Fc-silenced anti-oxMIF antibodies with reduced aggregation potential and reduced hydrophobicity

Abstract

The present invention relates to Fc-silenced anti-oxMIF antibodies with improved properties, e.g., reduced aggregation potential and reduced hydrophobicity, due to selected amino acid substitutions in the light and heavy chain variable domains, and their use in the treatment of oxMIF-associated conditions.

Description

[Technical field]

[0001] The present invention relates to Fc-silenced anti-oxMIF antibodies with improved properties, e.g., reduced aggregation potential and reduced hydrophobicity, due to selected amino acid substitutions in the light and heavy chain variable domains, and their use in the treatment of oxMIF-associated conditions. [Background technology]

[0002] The cytokine macrophage migration inhibitory factor (MIF) was described as early as 1966 (David, JR, 1966; Bloom BR and Bennet, B., 1966). After cloning and recombinant expression, MIF's biochemical properties and physiological role were elucidated (Bernhagen et al., 1993; Bernhagen et al., 1994). It is now well accepted that MIF is a crucial regulator of innate immunity and plays a central role in inflammatory responses and cancer. MIF promotes the production of other proinflammatory mediators, such as TNF (Calandra et al., 1994), nitric oxide (Bernhagen et al., 1994), and prostaglandin E2 (Mitchell et al., 1999; Sampey et al., 2001). One of the most striking properties of MIF is its ability to counteract the immunosuppressive effects of glucocorticoids (GCs). In vitro, MIF counteracts GC-induced inhibition of cytokine secretion in monocytes (TNF, IL-1, IL-6, and IL-8) (Calandra et al., 1995) and T cells (Bacher et al., 1996), and abolishes dexamethasone-induced suppression of TNF-induced arachidonic acid release in fibroblasts (Mitchell et al., 1999). In vivo studies have shown that MIF increases the mortality rate of endotoxemic mice treated with dexamethasone (Calandra et al., 1995). Upregulation of MIF serum levels and its association with disease have been most extensively described in patients with severe sepsis (Emonts et al., 2007; Bozza et al., 2004; Sprong et al., 2007). Plasma levels of MIF correlated with the severity of disease and shock state, being significantly higher in deceased than in survivors. MIF concentrations correlated significantly with elevated plasma concentrations of IL-1, IL-6, IL-10, IL-12, and cortisol.Elevated MIF levels in patients have also been measured in many inflammatory diseases, such as rheumatoid arthritis (Onodera et al., 1999; Morand et al., 2002), Crohn's disease (de Jong et al., 2001), psoriasis (Shimizu et al., 2001), and multiple sclerosis (Niino et al., 2000; Rinta et al., 2008).

[0003] MIF further contributes to the maintenance of the inflammatory process by preventing p53-dependent cell death and stimulating survival of monocytes and macrophages (Mitchell et al., 2002).

[0004] Increasing evidence suggests a close link between inflammation and many types of cancer. Inflammatory pathways are designed to defend against infection and injury, but can also promote an environment conducive to tumor growth and metastasis (Conroy et al., 2010). Thus, inflammation has been suggested to be a key factor driving tumorigenesis, with many cancers arising as a result of infection or chronic inflammation (Bucala and Donnelly, 2007; Conroy et al., 2010; Karin, 2009). Furthermore, it is well established that the inflammatory nature of the tumor microenvironment promotes angiogenesis and the breakdown of the extracellular matrix (ECM), which in turn contributes to tumor cell survival, proliferation, and migration (Coussens and Werb, 2002; Hagemann and Balkwill, 2005; Hagemann et al., 2007; Kessenbrock et al., 2010). MIF has been shown to be upregulated in a wide variety of human neoplasms, such as tumors of pancreatic, breast, prostate, colon, brain, skin, and lung origin (Bando et al., 2002; Chen et al., 2010; Kamimura et al., 2000; Meyer-Siegler and Hudson, 1996; Shimizu et al., 1999; Takahashi et al., 1998; Winner et al., 2007). Several studies have reported that MIF expression is closely correlated with tumor aggressiveness and metastatic potential, suggesting that MIF may play an important role in disease severity and cell survival (Rendon et al., 2009). Recent data suggest that extracellular MIF may contribute to a more aggressive tumor phenotype compared to intracellular MIF (Verjans et al., 2009). MIF contributes to a favorable microenvironment for tumor growth, angiogenesis, invasiveness, and metastasis.In addition to its proinflammatory functions, MIF exerts antiapoptotic and proproliferative effects, including inhibition of p53 (Hudson et al., 1999; Mitchell and Bucala, 2000) and activation of the pivotal kinases ERK1 / 2 (Mitchell et al., 1999) and AKT (Lue et al., 2007). MIF has been further described as a proangiogenic factor that promotes angiogenesis (Coleman et al., 2008) and tumor vascularization through stabilization of HIF-1α (Winner et al., 2007) and upregulation of proangiogenic factors such as VEGF and IL-8 (Ren et al., 2004). MIF also functions as a chemokine and is predicted to contribute to the recruitment of inflammatory cells within the tumor environment via the chemokine receptors CXCR2 and CXCR4 (Bernhagen et al., 2007; Rendon et al., 2007).

[0005] However, MIF is strikingly different from other cytokines and chemokines because it is constitutively expressed and present in the circulation of healthy subjects: it is preformed and stored in cytoplasmic pools in macrophages, T cells, and many other cells in the body, including the hypothalamic-pituitary-adrenal axis, allowing for rapid release upon stimulation without de novo synthesis (Bernhagen et al., 1993; Bacher et al., 1997; Fingerle-Rowson et al., 2003).

[0006] Due to the ubiquity of this protein, MIF may be considered an inappropriate target for therapeutic intervention. However, MIF exists in two immunologically distinct conformational isoforms, called reduced MIF (redMIF) and oxidized MIF (oxMIF) (Thiele M. et al., 2015). RedMIF was found to be an abundantly expressed isoform of MIF that can be found in the cytoplasm and circulation of any subject. RedMIF appears to represent a latent, inactive storage form (Schinagl. A. et al., 2018).

[0007] In contrast, oxMIF appears to be a physiologically relevant disease-associated isoform that can be detected in tumor tissues, specifically in tumor tissues from patients with colorectal, pancreatic, ovarian and lung cancer, demonstrating high tumor specificity of oxMIF (Schinagl. A. et al., 2016), as well as in the circulation and inflamed tissues of patients with inflammatory diseases (Thiele et al., 2015).

[0008] There are a limited number of successful drug targets for treating cancers such as the oxMIF-positive indications mentioned above. For example, although over 300 potential immuno-oncology targets have been described, most clinical studies have focused on anti-PD-1 and anti-PD-L1 antibodies (Tang J., et al. 2018). Thus, the scientific and medical communities are eager for promising drugs that target tumor-specific antigens to increase treatment options for cancer patients with poor prognosis.

[0009] Furthermore, there is a high demand for drugs that target inflammatory diseases. Glucocorticoids (GCs) represent the most important and frequently used class of anti-inflammatory drugs in routine clinical practice (Schacke et al., 2002). The usefulness of GCs is mainly related to their ability to effectively block the inflammatory cascade at many levels by reducing the recruitment of inflammatory cells and suppressing the synthesis of proinflammatory cytokines and mediators (Barnes et al., 2003). The oral use of GCs is estimated at 0.5% of the general population and 1.4% of the population over 55 years of age (Ramsey-Goldman, 2002; Walsh et al., 1996). Although GCs are considered to be clearly beneficial, their use is limited by the presence of substantial side effects that are dose-dependent and often irreversible (Pisu et al., 2005). The most concerning side effects include hypertension, obesity, osteoporosis, myopathy, edema, and immunosuppression. Premature atherosclerosis-related deaths are also increasingly observed in inflammatory diseases, including RA and systemic lupus erythematosus (Wallberg-Jonsson et al., 2005; del Rincon et al., 2001; Solomon et al., 2003; El-Magadmi et al., 2004; Manzi et al., 1999). The toxicity of GCs is a considerable burden, and the development of therapeutic approaches that enhance the effect of GCs on inflammatory diseases and allow for reduced doses is required. However, this requires elucidation of factors that control GC sensitivity. In the early 2000s, a unique relationship between the cytokine macrophage migration inhibitory factor (MIF) and GCs was revealed, and MIF was identified as a candidate factor that may control GC sensitivity (Aeberli et al., 2006).

[0010] Antibodies targeting oxMIF have shown efficacy in in vitro and in vivo models of inflammation and cancer (Hussain F. et al., 2013; Schinagl. A. et al., 2016; Thiele et al., 2015).

[0011] In WO 2019 / 234241 A1, an anti-oxMIF / anti-CD3 bispecific antibody is disclosed.

[0012] In WO 2009 / 086920 A1 the anti-oxMIF antibody Bax69 (imalumab) is described.

[0013] Protein aggregation, specifically antibody aggregation, is frequently observed during several stages of bioprocessing, including protein expression, purification and storage. Antibody aggregation can affect the overall yield of therapeutic protein manufacturing processes and contribute to the stability and immunogenicity of therapeutic antibodies.

[0014] Therefore, protein aggregation of antibodies remains a significant problem in their occurrence and remains a major concern in antibody production. Antibody aggregation can be triggered by partial unfolding of its domains, which leads to nucleation and aggregate growth after monomer-monomer association. Although the aggregation tendency of antibodies and antibody-based proteins can be influenced by external experimental conditions, they are strongly dependent on the underlying antibody properties determined by their sequence and structure.

[0015] For example, resistance to aggregation can be achieved by stabilizing the native state (i.e., resistant to unfolding) or by reducing the tendency of the unfolded or partially folded state of the protein to aggregate. The disadvantage of stabilizing the native state is that the protein is more likely to be exposed to an environment that will cause it to unfold. Generally, when a protein is denatured or unfolded, amino acid residues that normally mediate intramolecular contacts within the protein are exposed. Such exposure often makes the protein more susceptible to forming intermolecular contacts and thus more susceptible to aggregation. In contrast to proteins that are resistant to unfolding, proteins that have a reduced tendency to aggregate when unfolded easily refold into a biologically active, non-aggregated state after exposure to such an environment.

[0016] The aggregation resistance or aggregation tendency of proteins, including antibodies and their antigen-binding domains, is usually limited by the number of aggregation-prone domain(s) contained therein and by the strength of their interactions with surrounding domains, if any.

[0017] This is because once a domain unfolds, it may interact with other domains within the same protein or other proteins and form aggregates if it cannot refold. The constant domains of antibodies generally do not aggregate and do not change significantly. Therefore, the weakest domains of antibodies in terms of aggregation potential and stability are generally considered to be the variable domains (e.g., the heavy chain variable domain (V H ) and / or a light chain variable domain (V L ), Ewert S. et al., 2003). In this regard, the aggregation tendency V H Or V LIncorporation of the domain into an otherwise stable recombinant antibody product often confers these generally undesirable properties to the new recombinant design. Thus, engineering a variable domain to be aggregation-resistant will most likely render the entire protein that may contain that variable domain aggregation-resistant. Various strategies have been proposed to reduce variable domain aggregation, such as rational design of aggregation-resistant proteins, complementarity determining region (CDR) grafting, or introduction of disulfide bonds into the variable domain. Rational design of aggregation-resistant proteins typically involves using in silico analysis to predict the effect of point mutations on the aggregation propensity of a protein. However, this approach faces several obstacles. For example, it is not enough to simply identify mutations that may reduce the aggregation of an unfolded protein. More precisely, the mutations must not increase the aggregation of the folded protein, nor must they affect the function of the folded protein, particularly in the case of antibodies, the binding properties, such as affinity or specificity. Furthermore, rational design requires detailed structural analysis of the particular protein to be improved, and is therefore difficult to use with proteins that are not well characterized and cannot be readily applied to a variety of different proteins. CDR grafting involves transplanting CDRs from one variable domain onto the framework region (FR) of another variable domain. This strategy has been shown to be useful in stabilizing anti-EGP-2 scFv (Willuda J. et al., 1999). The disadvantages of this approach include the possible loss of affinity after CDR grafting. This loss of affinity can be overcome by introducing mutations into the FRs, but such mutations may give rise to immunogenic epitopes in the protein, making the protein undesirable from a therapeutic point of view. Furthermore, CDR grafting generally requires crystal structure analysis or homology modeling of the donor and acceptor variable domains to assess the suitability of the graft. Such an approach is laborious and requires specialized knowledge. Moreover, this method is not easily applicable to a variety of molecules, since each variable domain has a different structure.Regarding the methods that include the step of introducing disulfide bonds into the variable domain, the disulfide bonds may help the protein to refold correctly, but at the same time they also introduce inflexibility into the variable domain. Such inflexibility may reduce the affinity of the antibody for the antigen. Moreover, the cysteine ​​residues required for disulfide bond formation cannot be introduced into all variable domains without loss of affinity or introduction of immunogenic epitopes. Moreover, the formation of disulfide bonds at high protein concentrations may cause protein aggregation, negating the potential favorable effect of disulfide bonds.

[0018] However, reduced aggregation propensity has been shown to be accompanied by increased expression titers, indicating that reducing protein aggregation may be beneficial throughout the development process and lead to more efficient pathways to clinical studies. For therapeutic proteins, aggregates are a significant risk factor for adverse immune responses in patients and can form through a variety of mechanisms. Controlling aggregation can improve protein stability, manufacturability, attenuation rate, safety, formulation, titer, immunogenicity, and solubility (Wei Li et al., 2016; Van der Kant R. et al., 2017).

[0019] Further intrinsic properties of proteins, such as hydrophobicity, also play an important role in antibody solubility. The low solubility of these therapeutic proteins due to surface hydrophobicity has been shown to make formulation development more difficult and can lead to poor biodistribution in vivo, undesirable pharmacokinetic behavior and immunogenicity. Therefore, reducing the overall surface hydrophobicity of candidate monoclonal antibodies can provide benefits and cost savings in terms of purification and administration regimens.

[0020] There is also growing interest in controlling antibody effector functions for specific therapeutic purposes. Specifically, Fc null or Fc silenced antibodies may be a strategy to eliminate Fc effector functions and complement interactions (which may be unfavorable to antibody mechanisms) as potent immune effector functions via FcγR. Similarly, controlling neonatal Fc receptor (FcRn) binding of IgG antibodies to control pharmacokinetics is also becoming widely known.

[0021] Strohl WR et al. (2012) describes antibody Fc engineering to increase or decrease FcγR-mediated activity of IgG isotypes.

[0022] WO2017 / 178493A1 describes an antibody targeting TIM-3 (T-cell immunoglobulin and mucin domain containing 3) that contains modified CH1-CH3 domains for Fc silencing. The combination of reduced aggregation potential, reduced hydrophobicity and Fc silencing is believed to result in highly advantageous antibody properties. There is still an unmet need in the art for Fc-silenced anti-oxMIF aggregation-resistant antibodies with reduced hydrophobicity. Summary of the Invention

[0023] It is an object of the present invention to provide improved antibodies or antigen-binding fragments thereof that target Fc-silenced oxMIF and have reduced aggregation tendency and hydrophobicity.

[0024] This object is solved by the subject matter of the present invention.

[0025] The present invention provides an Fc-silenced anti-oxMIF antibody, or antigen-binding fragment thereof, comprising a mutant Fc region of wild-type human IgG comprising SEQ ID NO:1 (CH2-CH3), or alternatively SEQ ID NO:44 (CH1-CH3), with one or more amino acid substitutions or glycosylation modifications, and the following variable domains: (a1) a light chain variable domain comprising SEQ ID NO:2 with at least one of the amino acid substitutions M30L, F49Y, A51G, P80S, W93F, or (a2) comprises SEQ ID NO:2 having one, two, three, four, or five amino acid substitutions; - a conserved tyrosine at position 36, and - a light chain variable domain further comprising at least one of the amino acid substitutions M30L, F49Y, A51G, P80S, W93F; and (b1) a heavy chain variable domain comprising SEQ ID NO:3; or (b2) a heavy chain variable domain comprising SEQ ID NO: 3 and the amino acid substitutions L5Q and / or W97Y; or (b3) a heavy chain variable domain comprising SEQ ID NO: 3 with at least one of the amino acid substitutions L5Q or W97Y and one, two, three, four or five additional amino acid substitutions. Including, wherein the amino acid positions are numbered according to Kabat: the mutant Fc region exhibits reduced FcγR binding compared to the wild-type IgG1 Fc region; Disclosed is an Fc-silenced anti-oxMIF antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof has reduced aggregation ability and reduced hydrophobicity compared to an antibody or antigen-binding fragment thereof comprising SEQ ID NO:2 and SEQ ID NO:3 lacking amino acid substitutions.

[0026] Specifically, the recombinant anti-oxMIF antibody refers to SEQ ID NO:2 and contains the amino acid substitution W93F.

[0027] Specifically, the recombinant anti-oxMIF antibody refers to SEQ ID NO:3 and contains the amino acid substitution W97Y.

[0028] According to a further particular embodiment, the recombinant anti-oxMIF antibody comprises the amino acid substitutions W93F and W97Y.

[0029] According to certain embodiments described herein, the amino acid substitutions in the Fc region are at any one of positions E233, L234, L235, G236, G237, P238, D265, S267, H268, N297, S298, T299, E318, L328, P329, A330, P331 of SEQ ID NO:1 according to the EU numbering index.

[0030] According to an alternative embodiment, the Fc region is aglycosylated.

[0031] More specifically, the amino acid substitutions in the Fc region are at positions L234 and L235 of SEQ ID NO:1, specifically L234A and L235A, according to the EU numbering index.

[0032] Specifically provided herein are Fc-silenced anti-oxMIF antibodies comprising an Fc region comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 5, 6, 7, 8, 9, 43, and 85.

[0033] More specifically, the Fc-silenced anti-oxMIF antibodies described herein comprise variable heavy and light chains. i.) SEQ ID NOs: 3 and 6, ii.) SEQ ID NOs: 9 and 6; iii.) SEQ ID NOs: 4 and 6; iv.) SEQ ID NOs: 4 and 8; v.) SEQ ID NOs: 4 and 5, or vi.) SEQ ID NO:43 and any one of SEQ ID NO:5, 6, 7 or 8 Includes.

[0034] According to one embodiment, the Fc-silenced anti-oxMIF antibody described herein further comprises the CH1-CH3 domains of SEQ ID NO:14.

[0035] According to certain embodiments of the invention, the anti-oxMIF antibody comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 15 and 16 or 17.

[0036] According to a further embodiment, there is provided an Fc-silenced anti-oxMIF antibody or antigen-binding fragment thereof, comprising a mutant Fc region of wild-type human IgG comprising SEQ ID NO:1 with one or more amino acid substitutions or glycosylation modifications, A light chain CDR1 sequence selected from SEQ ID NO: 72 or 78; A light chain CDR2 sequence selected from SEQ ID NO: 73, 79, 80, or 81; A light chain CDR3 sequence selected from SEQ ID NO: 74 or 82; A heavy chain CDR1 sequence selected from SEQ ID NO: 75; A heavy chain CDR2 sequence selected from SEQ ID NO: 76 or 83, and A heavy chain CDR3 sequence selected from SEQ ID NO: 77 or 84 Provided herein is an Fc-silenced anti-oxMIF antibody, or antigen-binding fragment thereof, comprising the sequence:

[0037] In an alternative embodiment, the Fc-silenced anti-oxMIF antibody is A light chain CDR1 sequence selected from SEQ ID NO: 72 or 78; A light chain CDR2 sequence selected from SEQ ID NO: 73, 79, 80, or 81; A light chain CDR3 sequence selected from SEQ ID NO: 82; A heavy chain CDR1 sequence selected from SEQ ID NO: 75; A heavy chain CDR2 sequence selected from SEQ ID NO: 76 or 83, and The heavy chain CDR3 sequence is selected from SEQ ID NO: 77 or 84.

[0038] In an alternative embodiment, the Fc-silenced anti-oxMIF antibody is A light chain CDR1 sequence selected from SEQ ID NO: 72 or 78; A light chain CDR2 sequence selected from SEQ ID NO: 73, 79, 80, or 81; A light chain CDR3 sequence selected from SEQ ID NO: 82; A heavy chain CDR1 sequence selected from SEQ ID NO: 75; A heavy chain CDR2 sequence selected from SEQ ID NO: 76 or 83, and The heavy chain CDR3 sequence is selected from SEQ ID NO:84.

[0039] In an alternative embodiment, the Fc-silenced anti-oxMIF antibody is A light chain CDR1 sequence selected from SEQ ID NO: 72 or 78; A light chain CDR2 sequence selected from SEQ ID NO: 73, 79, 80, or 81; A light chain CDR3 sequence selected from SEQ ID NO: 82; A heavy chain CDR1 sequence selected from SEQ ID NO: 75 or 83; A heavy chain CDR2 sequence selected from SEQ ID NO: 76 or 84, and The heavy chain CDR3 sequence is selected from SEQ ID NO:85.

[0040] According to a further embodiment of the invention, the Fc-silenced anti-oxMIF antibody described herein has an amino acid substitution at any one of positions E233, L234, L235, G236, G237, P238, I253, D265, S267, H268, N297, S298, T299, H310, E318, L328, P329, A330, P331, H435 of SEQ ID NO: 1, in particular the amino acid substitution is at positions L234 and L235, in particular positions L234, L235, H310 and H435 according to the EU numbering index, and / or has an Fc region that is aglycosylated.

[0041] The Fc-silenced anti-oxMIF antibodies described herein may be in any format containing CH2 and CH3 antibody domains, in particular in a format selected from the group consisting of a monospecific antibody, a bispecific antibody (e.g., Crossmab), scFv-Fc, (scFv)2-Fc (two scFv fragments are contained on one arm), scFv / scFv-Fc (i.e., each arm contains an scFv fragment), Fab / scFv-Fc, Fab / (scFv)2-Fc, Fab / Fab-scFv-Fc, Fab / Fab-crossFab-Fc, Fab / crossFab-Fc, IgG-scFv and IgG-(scFv)2.

[0042] In a further embodiment, the Fc-silenced anti-oxMIF antibody described herein is a bispecific antibody further comprising at least one binding site specifically recognizing an epitope of CD3 or histamine-succinyl-glycine (HSG). In a particular embodiment, the Fc-silenced anti-oxMIF antibody is for use in the treatment or detection of solid tumors, wherein the antibody is administered to a subject in a first step and an HSG hapten is administered in a second step, wherein the HSG hapten is conjugated to the antibody and labeled with a radionuclide.

[0043] Also provided herein is an Fc-silenced antibody described herein for use in the preparation of a medicament.

[0044] In further embodiments of the invention, there is also provided herein a pharmaceutical composition comprising an antibody as described herein, optionally together with a pharmaceutical carrier or adjuvant.

[0045] Specifically, the composition comprises an antibody of the invention at 10-250 mg / ml, specifically, greater than 50 mg / ml.

[0046] More specifically, the pharmaceutical composition is formulated for subcutaneous administration.

[0047] As provided herein, the pharmaceutical compositions are for administration as a single entity or as a combined formulation with additional pharmaceutical compositions comprising one or more active agents, preferably selected from the group consisting of antiviral, anticancer, anti-inflammatory, and antibiotic.

[0048] In a further embodiment, there is provided herein a pharmaceutical composition for use in the treatment of patients suffering from inflammatory diseases, infectious diseases, in particular in the treatment of asthma, vasculitis, arthritis, sepsis, septic shock, endotoxic shock, toxic shock syndrome, acquired respiratory distress syndrome, glomerulonephritis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, peritonitis, nephritis, NASH (non-alcoholic steatohepatitis), multiple sclerosis, acute and chronic pancreatitis, type 1 diabetes, IgA nephropathy, interstitial cystitis, post-COVID syndrome, and psoriasis.

[0049] According to an alternative embodiment, the pharmaceutical composition is for use in the treatment of a patient suffering from a hyperproliferative disorder or cancer, in particular in the treatment of colorectal cancer, ovarian cancer, breast cancer, prostate cancer, pancreatic cancer, gastric cancer, and lung cancer.

[0050] Further provided is an isolated nucleic acid encoding an antibody of the invention.

[0051] Also provided herein are expression vectors comprising the nucleic acid molecule(s) described herein.

[0052] In a further embodiment, a host cell is provided containing a nucleic acid or expression vector described herein.

[0053] Further provided is a method for producing an antibody of the invention, comprising culturing a host cell and recovering said antibody from the cell culture.

[0054] Further provided is a method for producing an antibody of the invention comprising expressing nucleic acid encoding the antibody in a host cell. [Brief description of the drawings]

[0055] [Figure 1-1] Chromatographic profiles demonstrating reduced aggregation and hydrophobicity of the newly designed anti-oxMIF antibodies. (A) Comparison of elution profiles of C0008 (control antibody, grey area) and parent antibodies (C0083 and C0090, no Fc silencing) of the newly designed antibodies C0115 and C0118 on an Enrich 650 gel filtration column using 1x PBS as the mobile phase; (B) Comparison of elution profiles of C0008 (control antibody, grey area) and the newly designed antibodies C0115 and C0118 on an Enrich 650 gel filtration column using 1x PBS as the mobile phase. (C) Comparison of elution profiles of C0008 (control antibody, grey area) and the newly designed antibodies C0115 and C0118 and their parent antibodies C0083 and C0090 (no Fc silencing) on ​​a HiTrap Butyl HP HIC column. [Figure 1-2] Chromatographic profiles demonstrating reduced aggregation and hydrophobicity of the newly designed anti-oxMIF antibodies. (A) Comparison of elution profiles of C0008 (control antibody, grey area) and parent antibodies (C0083 and C0090, no Fc silencing) of the newly designed antibodies C0115 and C0118 on an Enrich 650 gel filtration column using 1x PBS as the mobile phase; (B) Comparison of elution profiles of C0008 (control antibody, grey area) and the newly designed antibodies C0115 and C0118 on an Enrich 650 gel filtration column using 1x PBS as the mobile phase. (C) Comparison of elution profiles of C0008 (control antibody, grey area) and the newly designed antibodies C0115 and C0118 and their parent antibodies C0083 and C0090 (no Fc silencing) on ​​a HiTrap Butyl HP HIC column. [Diagram 2]Figure 1 shows the binding curve (KD determination) of the newly designed anti-oxMIF antibody to immobilized oxMIF. The anti-oxMIF antibody was detected by anti-human IgG(Fc)-HRP conjugate, and C0008 was used as the reference antibody. The EC50 value was determined by a sigmoidal 4-parameter equation using GraphPad Prism (mean + / - SEM of two experiments is shown). [Diagram 3] Figure 1 shows the differential binding of the newly designed antibodies to oxMIF compared to redMIF. C0008 was used as the reference antibody and isotype IgG as a negative control. Means + / - SEM of two or three experiments are shown. [Figure 4-1] FIG. 1 shows the strongly reduced effector function of the newly designed Fc-silenced antibodies C0115 and C0118 as determined by reporter assay. (A-B) ADCC reporter bioassay with newly designed Fc-silenced antibodies C0115 and / or C0118 using engineered Jurkat effector cells stably expressing FcyRIIIa (V: high responder genotype, F: low responder genotype) and HCT116-pMIF (A) or A2780-pMIF (B) target cells compared to either anti-oxMIF control antibody C0008 (B) or its parent anti-oxMIF antibodies C0083 and C0090 (A) with wtFc; (C) ADCP reporter bioassay with newly designed Fc-silenced antibodies C0115 and / or C0118 using engineered Jurkat effector cells stably expressing FcyRIIa and HCT116-pMIF target cells compared to their parent antibodies C0083 and C0090 with wtFc. Data were fitted to a sigmoidal 4-parameter equation using GraphPad Prism (means + / - SD of two replicates are shown). [Figure 4-2]FIG. 1 shows the strongly reduced effector function of the newly designed Fc-silenced antibodies C0115 and C0118 as determined by reporter assay. (A-B) ADCC reporter bioassay with newly designed Fc-silenced antibodies C0115 and / or C0118 using engineered Jurkat effector cells stably expressing FcyRIIIa (V: high responder genotype, F: low responder genotype) and HCT116-pMIF (A) or A2780-pMIF (B) target cells compared to either anti-oxMIF control antibody C0008 (B) or its parent anti-oxMIF antibodies C0083 and C0090 (A) with wtFc; (C) ADCP reporter bioassay with newly designed Fc-silenced antibodies C0115 and / or C0118 using engineered Jurkat effector cells stably expressing FcyRIIa and HCT116-pMIF target cells compared to their parent antibodies C0083 and C0090 with wtFc. Data were fitted to a sigmoidal 4-parameter equation using GraphPad Prism (means + / - SD of two replicates are shown). [Diagram 5] Figure 1 shows the strongly reduced CDC activity of the newly designed Fc-silenced antibody C0115 as determined by complement-dependent cytotoxicity bioassay. CDC bioassay with the newly designed Fc-silenced antibody C0115 using BRC as a source of complement and HCT116-HiBiT-pMIF as target cells was compared to its parent anti-oxMIF antibody C0083 with wtFc and Nivolumab as IgG4 negative control. Data (where appropriate) were fitted to a sigmoidal 4-parameter equation using GraphPad Prism (mean + / - SD of two replicates is shown). [Figure 6-1]Figure 1 shows the strongly reduced ADCC activity of the newly designed Fc-silenced antibodies C0115 and C0118 as determined by PBMC-mediated cytotoxicity bioassay. ADCC bioassay with the newly designed Fc-silenced antibodies C0115 (A) and C0118 (B) using PBMC as effector cells and HCT116-HiBiT-pMIF as target cells was compared to anti-oxMIF control antibody C0008 or parental anti-oxMIF antibody of C0115 with wtFc (C0083). Mean and SEM of two replicates using PBMC from two healthy donors are shown. Data was fitted to a sigmoidal 4-parameter equation using GraphPad Prism. [Figure 6-2] Figure 1 shows the strongly reduced ADCC activity of the newly designed Fc-silenced antibodies C0115 and C0118 as determined by PBMC-mediated cytotoxicity bioassay. ADCC bioassay with the newly designed Fc-silenced antibodies C0115 (A) and C0118 (B) using PBMC as effector cells and HCT116-HiBiT-pMIF as target cells was compared to anti-oxMIF control antibody C0008 or parental anti-oxMIF antibody of C0115 with wtFc (C0083). Mean and SEM of two replicates using PBMC from two healthy donors are shown. Data was fitted to a sigmoidal 4-parameter equation using GraphPad Prism. [Figure 7] Figure 1: Reduced non-specific binding of newly designed anti-oxMIF antibodies to A2780 MIF- / - cells as determined by FACS. Staining of A2780 MIF- / - cells with newly designed anti-oxMIF antibodies C0118 and its parental antibody C0090 (A) and C0115 and its parental antibody C0083 (B) and control antibody C0008 and isotype IgG as negative control; GeoMean (mean fluorescence intensity of AF488) of viable cells plotted against antibody concentration. [Figure 8]Figure 1 shows that the newly designed Fc-silenced anti-oxMIF antibody C0115 shows strongly reduced cytokine release from human PBMCs compared to the reference antibody C0008. Anti-oxMIF antibody C0115 with Fc-silencing mutations and the reference antibody C0008 were incubated overnight with human PBMCs and the supernatants were analyzed for human MCP-1 (A), human IL-6 (B) and human TNF-α (C) in a LegendPlex cytometric bead assay (BioLegend). Mean + / - SEM of cytokine concentrations (in pg / ml) from three different PBMC donors are shown. [Figure 9] Tumor penetration and retention of the newly designed Fc-silenced anti-oxMIF antibody C0115 and reference antibody C0008 by infra-red in vivo imaging of mice bearing subcutaneous HCT116 tumors. (A) Infra-red images of mice were taken 1, 6, 24, 48, 72, 96 and 168 hours after injection of IRDye 800CW labeled antibodies C0115 (upper panel) and C0008 (lower panel) dosed at 5 mg / kg; (B) Tumor penetration and retention of C0115 and C0008 quantified by digital image analysis. Average of 3 mice is shown. [Figure 10] Figure 1: The newly designed Fc-silenced anti-oxMIF antibody C0115 ameliorates disease severity in a collagen II-induced DBA / 1j mouse arthritis model. Cumulative disease score (A) and paw thickness (B) were assessed in a mouse arthritis model upon treatment with C0115 (20 mg / ml), high-dose dexamethasone (0.3 mg / kg) as standard of care corticosteroid drug, or vehicle. Mean ± SEM is shown. Statistical analysis used ordinary one-way ANOVA followed by Fisher's LSD test in GraphPad Prism V9.4 (*p<0.05; **p<0.01; ***p<0.001). [Figure 11-1]Figure 1: The newly designed Fc-silenced anti-oxMIF antibody C0115 ameliorates disease severity in a nephrotoxic serum (NTS)-induced rat glomerulonephritis model. Hematuria (dipstick test) (A), proteinuria (B), and glomerular macrophage infiltration were assessed upon treatment of diseased rats with anti-oxMIF antibody C0115, isotype control IgG1, or vehicle in a rat glomerulonephritis model. Means ± SEM are shown and statistical analysis used ordinary one-way ANOVA followed by Dunnett's correction for multiple testing in GraphPad Prism V9.4 (*p<0.05, ***p<0.001, ****p<0.0001). [Figure 11-2] Figure 1: The newly designed Fc-silenced anti-oxMIF antibody C0115 ameliorates disease severity in a nephrotoxic serum (NTS)-induced rat glomerulonephritis model. Hematuria (dipstick test) (A), proteinuria (B), and glomerular macrophage infiltration were assessed upon treatment of diseased rats with anti-oxMIF antibody C0115, isotype control IgG1, or vehicle in a rat glomerulonephritis model. Means ± SEM are shown and statistical analysis used ordinary one-way ANOVA followed by Dunnett's correction for multiple testing in GraphPad Prism V9.4 (*p<0.05, ***p<0.001, ****p<0.0001). [Figure 12] FIG. 1 is a schematic diagram of the newly designed Fc-silenced anti-oxMIF×anti-HSG bispecific antibodies (bsMabs), C0132 (Fab / scFv-Fc) and C0133 (Fab / Fab-scFv-Fc). [Figure 13] Figure 1 shows the binding curves of newly designed Fc-silenced anti-oxMIF x anti-HSG bsMabs C0132 and C0133 to immobilized oxMIF. Bound antibodies were detected by anti-human IgG(Fc)-HRP conjugate and C0008 was used as a reference antibody for bivalent binding to oxMIF. Data were fitted to a sigmoidal 4-parameter equation using GraphPad Prism (mean + / - SEM of two replicates is shown). [Figure 14] Figure 1 shows differential binding of newly designed Fc-silenced anti-oxMIF x anti-HSG bsMabs C0132 and C0133 to oxMIF compared to redMIF. C0008 was used as the reference anti-oxMIF antibody. Means and SEM of three replicates are shown. [Figure 15] Figure 1 shows tumor penetration and retention of newly designed Fc-silenced anti-oxMIF x anti-HSG bsMabs C0132 and C0133 assessed by infra-red in vivo imaging in mice bearing subcutaneous syngeneic CT26 tumors. Infra-red images of mice were taken 1, 8, 24, 48, 72, 96 and 168 hours after injection of IRDye 800CW labeled antibody dosed at 5 mg / kg. [Figure 16-1] (A) Structure of HSG hapten IMP288. (B) Binding of bsMabs C0132 and C0133 to the 177Lu-IMP288 peptide, assessed by iTLC, based on the change in the migration profile of 177Lu-IMP288 upon incubation with bsMabs, compared to the migration profile of the 177Lu-IMP288 peptide alone. [Figure 16-2] (A) Structure of HSG hapten IMP288. (B) Binding of bsMabs C0132 and C0133 to the 177Lu-IMP288 peptide, assessed by iTLC, based on the change in the migration profile of 177Lu-IMP288 upon incubation with bsMabs, compared to the migration profile of the 177Lu-IMP288 peptide alone. [Figure 17-1]Figure 1. PRAIT of syngeneic CT26 murine colorectal carcinoma in Balb / c mice with Fc-silenced anti-oxMIF x anti-HSG bsMab C0132. C0132 was administered on day -3 followed by 177Lu-IMP288 3 days later (day 0). (A) Tumor volume (in %) relative to tumor volume measured on day 0; mean ± SEM is shown (n = max 10). Statistical analysis was performed in GraphPad Prism V9.4 using ordinary one-way ANOVA with Dunnett's correction for multiple testing; **p<0.01 vs. 177Lu-IMP288. (B) Kaplan-Meier survival curves (in %). (C) Body weight (in %) relative to body weight measured on day 0. [Figure 17-2] Figure 1. PRAIT of syngeneic CT26 murine colorectal carcinoma in Balb / c mice with Fc-silenced anti-oxMIF x anti-HSG bsMab C0132. C0132 was administered on day -3 followed by 177Lu-IMP288 3 days later (day 0). (A) Tumor volume (in %) relative to tumor volume measured on day 0; mean ± SEM is shown (n = max 10). Statistical analysis was performed in GraphPad Prism V9.4 using ordinary one-way ANOVA with Dunnett's correction for multiple testing; **p<0.01 vs. 177Lu-IMP288. (B) Kaplan-Meier survival curves (in %). (C) Body weight (in %) relative to body weight measured on day 0. [Figure 18] Figure 1 shows PRAIT of syngeneic CT26 murine colorectal cancer in Balb / c mice with Fc-silenced anti-oxMIF x anti-HSG bsMab C0133. C0133 was administered on day -3, followed by 177Lu-IMP288 3 days later (day 0). The figure shows tumor volume (in %) relative to tumor volume measured on day 0. Mean ± SEM is shown (n = max 10). Statistical analysis was performed in GraphPad Prism V9.4 using ordinary one-way ANOVA with Dunnett's correction for multiple testing; ***p<0.001 vs. 177Lu-IMP288. [Figure 19]Figure 14. Efficacy of anti-oxMIF x anti-HSG bsMab C0132 using the PRAIT approach in Balb / c mice syngeneically implanted with CT26 murine colorectal cancer cells. C0132 was administered at 2.5mg / ml and 5mg / ml on day -5, followed by 177Lu-IMP288 5 days later (day 0); mean ± SEM is shown (n = 10 max). Statistical analysis was performed in GraphPad Prism V9.4 using ordinary one-way ANOVA with Dunnett's correction for multiple testing; ***p<0.001 vs. 177Lu-IMP288. (A) Tumor volume (in %) relative to tumor volume measured on day 0, (B) Kaplan-Meier survival curves (in %). [Figure 20] Figure 14. Efficacy of anti-oxMIF x anti-HSG bsMab C0132 using PRAIT approach in Balb / c nude mice xenografted with CFPAC-1 pancreatic adenocarcinoma cells. C0132 was administered at 5mg / ml on day -5 followed by 177Lu-IMP288 5 days later (day 0). Tumor volume (in %) relative to tumor volume measured on day 0; mean ± SEM is shown (n=max 10). Statistical analysis was performed in GraphPad Prism V9.4 using ordinary one-way ANOVA with Dunnett's correction for multiple testing; **p<0.01 vs vehicle. [Figure 21] Figure 1 shows that the newly designed Fc-silenced anti-oxMIF antibody C0115 improves disease severity of collagen II-induced arthritis in DBA / 1j mice, either alone or in combination with GC. Cumulative disease scores were assessed in a mouse arthritis model following treatment with C0115 (20 mg / kg) alone or in combination with a low dose of 0.1 mg / kg dexamethasone ("Dexa"), low (0.1 mg / kg) and high (0.3 mg / kg) doses of dexamethasone ("Dexa") as a standard of care corticosteroid drug, or with vehicle control. Statistical analysis was performed using ordinary one-way ANOVA followed by Fisher's LSD test in GraphPad Prism V9.4 (*p<0.05; **p<0.01). [Figure 22] Figure 1 shows that the newly designed Fc-silenced anti-oxMIF antibody C0115 ameliorates disease severity in a T-cell-transferred mouse model of colitis, both as a single agent and in combination with GC. Body weight change (A) and cumulative stool score (B) at the end of the experiment, day 83, were assessed following treatment with C0115 (10 mg / kg; alone or in combination with low dose 0.01 mg / kg dexamethasone ("Dexa")), low dose (0.01 mg / kg) and high dose (0.1 mg / kg) dexamethasone ("Dexa") as a standard of care corticosteroid drug, or vehicle control treatment. Statistical analysis used ordinary one-way ANOVA followed by Fisher's LSD test in GraphPad Prism V9.4 (*p<0.05; **p<0.01). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0056] Unless otherwise specified or defined, all terms used herein have their usual meaning in the art and will be apparent to those skilled in the art. For example, see standard handbooks such as Sambrook et al., "Molecular Cloning: A Laboratory Manual" (4th Ed.), Vols. 1-3, Cold Spring Harbor Laboratory Press (2012); Krebs et al., "Lewin's Genes Xi", Jones & Bartlett Learning, (2017), and Murphy & Weaver, "Janeway's Immunobiology" (9th Ed., or more recent), Taylor & Francis Inc, 2017.

[0057] The subject matter of the claims specifically relates to man-made products or methods of using or producing such man-made products, which may be variants of naturally occurring (wild-type) products. Although there may be some sequence identity to naturally occurring structures, it is well understood that the materials, methods and uses of the invention, including, specifically, the isolated nucleic acid sequences, amino acid sequences, fusion constructs, expression constructs, transformed host cells and engineered proteins, are "artificial" or synthetic and therefore cannot be considered the result of the "laws of nature."

[0058] The terms "comprise", "contain", "have" and "include" as used herein can be used synonymously and should be understood as broad definitions, allowing for additional members or parts or elements. "Consisting of" is interpreted as the most closed definition with no additional elements of the defining characteristic it comprises. Thus, "comprising" is broader and includes the definition of "consisting of".

[0059] The term "about" as used herein refers to the same value or a value that differs by + / - 5% from a given value.

[0060] As used in the specification and claims, the singular forms "a," "an," and "the" include plurals unless the context clearly dictates otherwise.

[0061] As used herein, amino acid refers to the 20 naturally occurring amino acids encoded by 61 triplet codons. These 20 amino acids can be divided into neutrally charged, positively charged, and negatively charged amino acids:

[0062] The "neutral" amino acids, along with their respective three-letter and one-letter codes and polarities, are set forth below: alanine (Ala, A; non-polar, neutral), asparagine (Asn, N; polar, neutral), cysteine ​​(Cys, C; non-polar, neutral), glutamine (Gln, Q; polar, neutral), glycine (Gly, G; non-polar, neutral), isoleucine (Ile, I; non-polar, neutral), leucine (Leu, L; non-polar, neutral), methionine (Me, H; non-polar, neutral), riboflavin (R ... The amino acids are: methyl (Met, M; nonpolar, neutral), phenylalanine (Phe, F; nonpolar, neutral), proline (Pro, P; nonpolar, neutral), serine (Ser, S; polar, neutral), threonine (Thr, T; polar, neutral), tryptophan (Trp, W; nonpolar, neutral), tyrosine (Tyr, Y; polar, neutral), valine (Val, V; nonpolar, neutral), and histidine (His, H; polar, positive (10%) and neutral (90%).

[0063] The "positively" charged amino acids are: arginine (Arg, R; polar, positive), and lysine (Lys, K; polar, positive).

[0064] The "negatively" charged amino acids are: aspartic acid (Asp, D; polar, negative), and glutamic acid (Glu, E; polar, negative).

[0065] The antibodies or antigen-binding fragments of the present invention comprise at least one binding site that specifically recognizes oxMIF and, due to targeted amino acid substitutions in the variable heavy and light chain domains, exhibit reduced aggregation tendency and reduced hydrophobicity compared to unmodified antibodies lacking said amino acid substitutions.

[0066] The reduced aggregation ability is due to amino acid substitutions at selected positions within the variable domains of the antibodies described herein.

[0067] The level of antibody aggregation can be measured using a variety of known techniques, including mass spectrometry, size exclusion chromatography (SEC), hydrophobic interaction chromatography (HIC), dynamic light scattering (DLS), light obscuration (LO), dynamic image particle analysis (DIPA) techniques such as microflow imaging (MFI), and Coulter Counter (CC), differential scanning fluorimetry (DSF).

[0068] Reduced hydrophobicity and reduced aggregation potential, as used herein, refer to the reduced surface hydrophobicity and reduced aggregation potential of the newly designed antibody compared to a reference antibody, such as antibody C0008, which comprises SEQ ID NOs: 44 and 2, 3 as disclosed herein. The sequence of C0008 contains the sequence of imalumab published in Proposed INN List 111 (WHO Drug Information, Vol. 28, No. 2, 2014), but lacks the C-terminal lysine. Measurements can be performed using various known techniques, including but not limited to hydrophobic interaction chromatography (HIC) or affinity capture self-interacting nanoparticle spectroscopy (AC-SINS, Estep P. et al., 2015).

[0069] In one embodiment, the oxMIF antibody of the invention with reduced aggregation potential and reduced hydrophobicity is in combination with a light chain variable domain with one or more amino acid substitutions, in particular at positions M30, F49, A51, P80, W93 according to the Kabat numbering, in particular M30L, F49Y, A51G, P80S, W93F, or a heavy chain variable domain comprising SEQ ID NO: 3, or in combination with a heavy chain variable domain comprising an amino acid substitution at positions L5 or W97 according to the Kabat numbering, in particular L5Q or W97Y. or a heavy chain variable domain comprising SEQ ID NO:3 with 1, 2, 3, 4 or 5 amino acid substitutions further comprising one or both of the amino acid substitutions at positions L5 or W97, specifically L5Q or W97Y.

[0070] In alternative embodiments, the light chain variable domain comprising SEQ ID NO:2 has one, two, three, four or five amino acid substitutions, with the proviso that the tyrosine at position 36 is conserved and at least one of the amino acids at positions M30, F49, A51, P80 and W93 is substituted.

[0071] According to a particular embodiment, the amino acid W93 is substituted by F, Y or H.

[0072] In a further embodiment, the anti-oxMIF antibody of the present invention with reduced aggregation ability and reduced hydrophobicity comprises a heavy chain variable domain comprising, in particular, SEQ ID NO: 3 and an amino acid substitution at position W97, in particular W97Y, an amino acid substitution at L5, in particular L5Q, or amino acid substitutions L5Q and W97Y, or a heavy chain variable domain comprising SEQ ID NO: 3 with 1, 2, 3, 4 or 5 amino acid substitutions, optionally further comprising the amino acid substitution W97Y, in combination with L5Q.

[0073] According to a particular embodiment, the amino acid W97 is substituted by F, Y or H.

[0074] In alternative embodiments, the heavy chain variable domain comprising SEQ ID NO:3 has one, two, three, four, five amino acid substitutions, and furthermore at least one of the amino acids is substituted at positions L5 and W93.

[0075] In a preferred embodiment, the anti-oxMIF antibody of the invention with reduced aggregation potential and reduced hydrophobicity specifically comprises amino acid substitutions at positions W93 and W97.

[0076] The tyrosine at position 36 of the light chain is specifically left unmodified to preserve the binding properties of the antibodies described herein. Any modification at this amino acid position may result in unwanted impaired binding properties.

[0077] In particular, the variable light chain domain comprises SEQ ID NO:5 and the variable heavy chain domain comprises any one or more of SEQ ID NOs:3, 4, 9, or 43.

[0078] In particular, the variable light chain domain comprises SEQ ID NO:6 and the variable heavy chain domain is any one or more of SEQ ID NO:3, 4, 9, or 43.

[0079] In particular, the variable light chain domain comprises SEQ ID NO:7 and the variable heavy chain domain is any one or more of SEQ ID NO:3, 4, 9, or 43.

[0080] In particular, the variable light chain domain comprises SEQ ID NO:8 and the variable heavy chain domain is any one or more of SEQ ID NO:3, 4, 9, or 43.

[0081] In a further embodiment, the anti-oxMIF antibody comprises SEQ ID NOs: 14 and 18 in combination with any one of the variable light and heavy domains listed above.

[0082] Fcγ receptors (FcγR) are a well-described protein family that includes membrane-bound surface receptors, atypical intracellular receptors, and cytoplasmic glycoproteins. FcγR regulate humoral and innate immunity and are essential for proper response to infection and prevention of chronic inflammation or autoimmune diseases. Membrane-bound receptors are, for example, FcγRIIa, FcyRIIb, FcyRIIIa, and FcyRIa receptors. Antibodies can regulate immune responses by interacting with FcγR. In innate immune effector cells, activating and inhibitory FcγRs set the threshold for cell activation by immune complexes. Important examples of effector responses controlled by FcγRs are phagocytosis, ADCC and the release of inflammatory mediators. In dendritic cells (DCs), the expression of paired FcγRs controls cell maturation and antigen presentation, thereby indirectly controlling cellular immune responses. In B cells, inhibitory FcγRIIB is essential for the maintenance of humoral tolerance. It acts as a late checkpoint at the level of class-switched memory B cells, plasmablasts or plasma cells. Furthermore, FcγRIIB has an important role in controlling plasma cell homeostasis and survival. Antibody-FcγR interactions are influenced by several factors that affect the expression levels of activating and inhibitory FcγRs (e.g., cytokines) or that change the affinity of antibody-FcγR interactions (e.g., differential antibody glycosylation). Depending on the specific glycosylation pattern, IgG molecules can have pro-inflammatory or anti-inflammatory activities. Importantly, the glycosylation of antibodies is regulated during the immune response.

[0083] Atypical FcγRs are the neonatal Fc receptor (FcRn) and cytoplasmic glycoproteins, such as the complement factor C1q protein. FcRn is expressed by endothelial cells and internalizes serum components, including soluble IgG, from the bloodstream by pinocytosis. IgG binding to FcRn is pH-dependent; the acidic pH (pH 6.0) within endosomal components allows IgG to bind to FcRn. After recycling to the cell surface, at physiological pH (approximately pH 7.2), IgG dissociates from FcRn and is released back into the blood circulation, thereby protecting it from lysosomal degradation and resulting in an extended half-life of IgG. Thus, FcRn functions as a transcytotic recycling receptor involved in the maintenance of IgG and albumin in the circulation. Modifications of the Fc region resulting in a reduced or silenced Fc with respect to FcRn binding are known in the art and are described, for example, in Kenanova V. et al., 2005 and Pyzik M. et al. 2019.

[0084] As used herein, "effector function" refers to a biochemical event that results from the interaction of an antibody Fc region with an Fc receptor or ligand. Effector functions include, but are not limited to, ADCC, ADCP, and CDC.

[0085] As used herein, "effector cells" refers to cells of the immune system that express one or more Fc receptors and mediate one or more effector functions. Effector cells include, but are not limited to, monocytes, macrophages, neutrophils, dendritic cells, eosinophils, mast cells, platelets, B cells, large granular lymphocytes, Langerhans cells, natural killer (NK) cells, and T cells, and can be from any organism, including, but not limited to, human, mouse, rat, rabbit, and monkey. According to the present invention, the anti-oxMIF antibodies described herein have silenced effector functions due to amino acid substitutions at selected positions in the heavy chain constant region, specifically the Fc region. The reduced or silenced effector functions of these antibodies due to reduced complement and FcγR-mediated activity can include reduced or eliminated complement-dependent cytotoxicity (CDC), antibody-dependent cellular cytotoxicity (ADCC), and / or antibody-dependent cellular phagocytosis (ADCP).

[0086] The term "Fc" or "Fc region" (or fragment crystallizable region), as used herein, refers to a polypeptide comprising the constant region of an antibody excluding the first constant region immunoglobulin domain (CH1 domain), and in some cases, a portion of the hinge. The Fc region refers to the C-terminal region of an antibody. The Fc region is composed of two identical protein fragments derived from the second and third constant domains of the two heavy chains of an antibody: the A chain and the B chain. The second and third constant domains are known as the CH2 domain and the CH3 domain, respectively. The CH2 domain comprises the CH2 domain sequence of the A chain and the CH2 domain sequence of the B chain. The CH3 domain comprises the CH3 domain sequence of the A chain and the CH3 domain sequence of the B chain. As used herein, the Fc region comprises the hinge region or a portion thereof.

[0087] The "CH2 domain" of a human IgG Fc region sequence typically extends from about amino acid 231 to about amino acid 340 according to the EU numbering index. The CH2 domain sequence is unique and is not strictly paired with another domain sequence. Rather, two N-linked branched carbohydrate chains are sandwiched between the two CH2 domain sequences of an intact native IgG molecule.

[0088] The "CH3 domain" comprises the stretch of CH2 domain sequence from the C-terminal residue in the Fc region sequence (ie, from about amino acid residue 341 to about amino acid residue 447 of IgG, according to the EU numbering index).

[0089] A "functional Fc region" possesses the "effector functions" and FcRn binding of a native Fc region. Exemplary "effector functions" include C1q binding; complement dependent cytotoxicity; Fc receptor binding; antibody-dependent cellular cytotoxicity (ADCC), and the like. Such effector functions typically require the Fc region to be associated with a binding domain (e.g., an antibody variable domain) and may be assessed using a variety of assays known in the art and disclosed herein.

[0090] A "native Fc region" comprises an amino acid sequence identical to the amino acid sequence of an Fc region found in nature. Native sequence human Fc regions include native sequence human IgG1 Fc regions (non-A and A allotypes); native sequence human IgG2 Fc regions, and native sequence human IgG3 Fc regions, as well as naturally occurring variants thereof.

[0091] A "variant Fc region" comprises an amino acid sequence that differs from that of a native Fc region sequence by "one or more amino acid substitutions." The variant Fc region sequence has at least one amino acid substitution compared to a native Fc region sequence or the Fc region sequence of a parent polypeptide, e.g., from about one to about twenty amino acid substitutions, and preferably from about one to about seventeen amino acid substitutions, in the native Fc region sequence or the Fc region sequence of the parent polypeptide. In certain embodiments, the variant Fc region sequences herein have at least about 80% identity to the native Fc region sequence and / or the Fc region sequence of the parent polypeptide, most preferably at least about 90% identity thereto, and more preferably at least about 95% identity thereto.

[0092] In a particular embodiment, the amino acid substitution is at any one of positions E233, L234, L235, G236, I253, G237, P238, D265, S267, H268, N297, S298, T299, H310, E318, L328, P329, A330, P331 and H435 relative to IgG1 according to the EU numbering index.

[0093] Modifications of the Fc region resulting in reduced or silenced Fc with respect to effector function are known in the art and described in Saunders K., 2019 and Liu R. et al., 2020.

[0094] In alternative embodiments, the amino acid substitutions are at any one or all of the following positions: L234F, H268Q, K274Q, Y296F, A327G, A330S, P331S in the CH2 domain and R355Q, K409R, Q419E, P445L in the CH3 domain.

[0095] Specifically, the Fc-silenced anti-oxMIF antibodies described herein contain one or more of the following combinations of amino acid substitutions or deletions resulting in an aglycosylated antibody: i) L235, G237 and E318, specifically L235A, G237A and E318A; ii) L234, L235, specifically L234A, L235A; iii) S228, L235, specifically S228P, L235E; iv) G236, L328, specifically G236R, L328R; v) S298, T299, specifically S298G, T299A; vi) L234, L235, P331, specifically L234F, L235E, P331S; vii) H268, V309, A330, P331, specifically H268Q, V309L, A330S, P331S; viii) E233, L234, L235, G236, S267, specifically E233P, L234V, L235A, G236del, S267K; ix) L234, L235, P329, specifically L234A, L235A, P329G; x) V234, G237, P238, H268, A330, P331, specifically V234A, G237A, P238S, H268A, A330S, P331S; xi) L234, L235, D265, specifically L234F, L235E, D265A; xii) D265, specifically D265A; xiii) G237, specifically G237A; xiv) E318, specifically E318A; xv) E233, specifically E233P; xvi) G236, L328, specifically G236R, L328R; xvii) L235, specifically L235E; xviii) L234, L235, P331, specifically L234Q, L235F, P331S; xix) L234, L235, G237, P238, H268, A330, P331, specifically L234A, L235A, G237A, P238S, H268A, A330S, P331S xx) N297, specifically N297A, N297Q or N297G.

[0096] Glycosylation, O- and N-glycosylation, are post-translational modifications of Abs and can be regulated by a range of B cell stimuli, including environmental factors such as stress or disease, cytokine activity, and innate immune signaling receptors such as Toll-like receptors. The glycosylation pattern of the parent antibody can be modified by methods well known in the art. Specifically, O-linked glycosylation sites are located in the CH2 and hinge regions.

[0097] In a further embodiment, the amino acid substitutions are at any one or all of positions I253 and H310 in the CH2 domain and H435 in the CH3 domain.

[0098] Specifically, the Fc-silenced anti-oxMIF antibodies described herein contain one or more of the following combinations of amino acid substitutions: i) I253A ii) H310A iii) H435, specifically H435A, H345Q or H435R iv) I253A and H310A v) I253A, H310A and one of H435Q, H435A, and H435R vi) Contains H310A and one of H435Q, H435A, and H435R.

[0099] The silencing and further mutations in the CH domain described herein can, however, also be introduced into the Fc of wild type IgG2, IgG3 or IgG4 at the corresponding positions according to the EU numbering index.

[0100] The term "aglycosylated" indicates that the Fc region is not glycosylated. All human constant regions of the IgG isotype are known to be glycosylated at the asparagine residue at position 297, forming part of an N-glycosylation motif, asparagine 297-X298-serine 299 or threonine 299, where X is the residue of any amino acid except proline. The glycan has a heptasaccharide core and variable extensions, e.g., fucose, galactose, and / or sialic acid. The antibodies of the invention may therefore be aglycosylated by replacement of asparagine 297 in such constant regions with another amino acid that is not glycosylated or deglycosylated by enzymatic means. Any other amino acid residue may be used, but alanine is most preferred. Alternatively, glycosylation at asparagine 297 may be prevented by altering one of the other residues of the motif, e.g., by replacing residue 298 with proline or residue 299 with any amino acid except serine or threonine. Techniques for performing this site-directed mutagenesis are well known to those skilled in the art and can be performed, for example, using a commercially available site-directed mutagenesis kit.

[0101] The term "silenced Fc" refers to an antibody Fc region whose effector function and / or FcRn binding is reduced or eliminated by amino acid substitutions or altered glycosylation patterns resulting in altered glycans that reduce or eliminate binding of the antibody to any FcγR, e.g., FcγRIIaH, FcγRIIaR, FcyRIIb, FcyRIIIaF, FcyRIIIaV, and FcyRIa and / or FcRn receptors, and complement factor C1q protein. Such reduction or elimination of this binding resulting in reduced or eliminated effector function and / or FcRn binding is typically mediated by wild-type IgG Fc regions.

[0102] The term "Fc null" may be used herein when FcγR binding, such as any one of FcγRIIa, FcyRII, FcyRIIIa and FcyRIa and / or FcRn receptors, as well as complement factor C1q protein, is completely abolished.

[0103] Most Fc silencing can be achieved by combining mutations. L234 and L235, residues located near the hinge region, reduce FcyR binding when substituted with alanine. As an example, the combination of L234A and L235A with P329G can result in almost complete inhibition of FcyR interaction for all FcyR isoforms.

[0104] Fc-silenced anti-oxMIF antibodies or antigen-binding fragments thereof with greatly reduced, silenced, negligible or eliminated FcyR and C1q binding affinities have reduced FcyR and C1q binding activity compared to the parent polypeptide or the polypeptide comprising the native Fc region sequence. In some embodiments, Fc-silenced anti-oxMIF antibodies or antigen-binding fragments thereof with greatly reduced, silenced, negligible or eliminated FcR and C1q binding affinities also have greatly reduced, silenced, negligible or eliminated ADCC, ADCP and CDC activity compared to the parent polypeptide or the polypeptide comprising the native Fc region sequence. Fc-silenced anti-oxMIF antibodies or antigen-binding fragments thereof that exhibit reduced or undetectable binding to FcyRs may bind to all FcyRs with lower affinity than the parent polypeptide. Such variants that exhibit reduced binding to FcyRs may have little or no appreciable binding to FcyRs. In a particular embodiment, the variants exhibit 0-20% binding to FcyR compared to a native IgG Fc region, e.g., as measured by a change in equilibrium multiplier. In one embodiment, the variants exhibit 0-10% binding to FcyR compared to a native IgG Fc region. In one embodiment, the variants exhibit 0-5% binding to FcyR compared to a native IgG Fc region. In one embodiment, the variants exhibit 0-1% binding to FcyR compared to a native IgG Fc region.

[0105] Antibodies described herein that have silenced complement activity can be determined by reduced or eliminated binding to C1q as determined by cell-based CDC assays, and, i.e., SPR or ELISA.

[0106] The reduced or silenced CDC activity is determined to be downregulated by at least 1.5-fold, specifically at least 2-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, more specifically at least 10-fold compared to a reference, i.e., unmodified, wild-type antibody, e.g., C0008. The decreased ADCC or ADCP activity was determined to be at least 2-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, and more specifically, at least 10-fold decreased compared to a reference antibody, i.e., an unmodified, wild-type antibody, such as C0008.

[0107] In certain embodiments, the Fc-silenced anti-oxMIF antibody or its antigen-binding fragment exhibits reduced binding to FcRn due to amino acid substitutions at selected positions in the heavy chain constant region. The reduced binding of the Fc-silenced anti-oxMIF antibody of the present invention to FcRn results in reduced half-life in circulation and faster in vivo clearance. FcRn binding and in vivo clearance / half-life determination can also be performed using methods known in the art (see, for example, Petkova, SB, et al., 2006).

[0108] The Fc domain of an Fc-silenced anti-oxMIF antibody, or antigen-binding fragment thereof, that exhibits reduced FcRn binding compared to an anti-oxMIF antibody, or antigen-binding fragment thereof, comprising a wild-type IgG Fc region may preferably comprise an Fc domain comprising one, two or three amino acid substitutions at any one of positions I253, H310, and H435.

[0109] Decreased FcRn binding (i.e., affinity) is determined to be at least a 2-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, and more specifically, at least a 10-fold decreased binding (i.e., affinity) compared to a reference antibody, i.e., an unmodified, wild-type antibody, e.g., C0008.

[0110] In a further embodiment, even greater Fc silencing may be achieved by combining mutations at amino acid positions L234, L235, H310 and H435, which are located in the Fc region and may result in near complete inhibition of FcyR interaction.

[0111] In particular, Fc-silenced anti-oxMIF antibodies comprise any one or more of the CDRs listed in Table 1A as defined according to Kabat, IMGT and MacCallum RM et al., 1996 (CONTACT).

[0112] [Table 1]

[0113] oxMIF binding specificity can be determined by any assay suitable for determining selective binding to oxMIF, for example, any competitive assay against a control antibody, such as imalumab, for binding to oxMIF, or various assays known in the art and disclosed herein.

[0114] The term "antibody" herein is used in the broadest sense and includes polypeptides or proteins consisting of or including antibody domains, understood as constant and / or variable domains of immunoglobulin heavy and / or light chains with or without linker sequences. The term includes various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies such as bispecific antibodies, trispecific antibodies, and antibody fragments, so long as they exhibit the desired antigen binding activity, i.e., binding to oxMIF. The term also includes fusion proteins, such as fusions with immunotoxins, or antibody conjugates, such as antibody drug conjugates that bind to oxMIF.

[0115] Antibody domains may be native structures or modified by mutagenesis or derivatization to modify, for example, antigen binding properties or any other properties, such as stability or functional properties, such as binding to an Fc receptor, e.g., FcRn and / or Fc gamma receptor. A polypeptide sequence is considered to be an antibody domain if it comprises a beta-barrel structure consisting of at least two beta strands of the antibody domain structure connected by a loop sequence.

[0116] It will be understood that the term "antibody" encompasses antigen-binding derivatives, variants and fragments thereof. Derivatives or variants are any combination of one or more antibody domains or antibodies of the invention and / or fusion proteins in which any domain of the antibodies of the invention may be fused at any position to one or more other binding proteins, such as other antibodies or antibody formats, binding structures including, for example, CDR loops, receptor polypeptides, as well as ligands, scaffold proteins, enzymes, labels, toxins, etc.

[0117] The term "antibody" specifically refers to a polypeptide or protein that exhibits binding properties for the target antigen, oxMIF.

[0118] The terms "antibody fragment, antigen-binding fragment, antigen-binding variant or antibody variant" may be used interchangeably and refer to molecules other than intact antibodies that contain an antigen-binding portion of an intact antibody that binds to the antigen to which the intact antibody binds, as well as multispecific antibodies formed from antibody fragments or variants that further contain a variant Fc region as described herein. Examples of antigenic portions include, but are not limited to, Fv, Fab, Fab', Fab'-SH, single chain antibody molecules (e.g., scFv), diabodies, cross-Fab fragments; linear antibodies. According to the present invention, the antibody fragment or variant is fused to a silenced Fc portion or a silenced Fc domain by a hinge region and / or a linker (e.g., (scFv)-Fc, (scFv)2-Fc, scFv / scFv-Fc, Fab / scFv-Fc, Fab / (scFv)2-Fc, Fab / Fab-scFv-Fc, Fab / Fab-crossFab-Fc, IgG-scFv and IgG-(scFv)2).

[0119] Furthermore, the antibody fragment has the characteristics of a VH domain, i.e. L Can be assembled with domains or V L The antibody fragments referred to herein include single chain polypeptides having the characteristics of a VH domain, i.e. capable of assembling together with a VH domain into a functional antigen-binding site, thereby providing the antigen-binding properties of a full-length antibody. The antibody fragments referred to herein also include silenced Fc domains that contain one or more structural loop regions that contain an antigen-binding region, e.g., a full-length antibody format having an IgG structure in which the silenced Fc region is replaced by an Fcab™ that contains a second, different antigen-binding site.

[0120] As used herein, "Fab fragment or Fab" refers to an antibody fragment comprising a light chain fragment comprising the VL domain and the constant domain of the light chain (CL) and a VH domain and the first constant domain (CH1) of the heavy chain. The antibody of the present invention may comprise at least one Fab fragment, in which either the variable or constant regions of the heavy and light chain are exchanged. Due to the exchange of either the variable or constant regions, said Fab fragment is also called "cross-Fab fragment" or "crossover Fab fragment". Two different chain compositions of crossover Fab molecules are possible and included in the antibody of the present invention: the variable regions of the Fab heavy and light chains may be exchanged, i.e. the crossover Fab molecule is composed of peptide chains. According to the present invention, the Fab is fused to a silenced Fc portion or a silenced Fc domain by a hinge region.

[0121] As used herein, "Fab arm" refers to a Fab fragment fused via the hinge region to a silenced Fc portion or a silenced Fc domain.

[0122] "(scFv)2" refers to an artificial monoclonal antibody that is a fusion protein consisting of two single-chain variable fragments (scFvs) of different antibodies or the same antibody, i.e., amino acid sequences from four or two different genes, on a single peptide chain of about 50 kilodaltons.

[0123] "bs(scFv)2" refers to an artificial monoclonal antibody that is a fusion protein consisting of two single-chain variable fragments (scFv) of antibodies with different target antigens, i.e., amino acid sequences from four different genes, on a single peptide chain of approximately 50 kilodaltons.

[0124] The term "functional variant" or "functionally active variant" encompasses naturally occurring allelic variants as well as mutants or any other non-naturally occurring variants. As known in the art, allelic variants (also called homologs) are alternative forms of nucleic acids or peptides characterized as having one or more nucleotide or amino acid substitutions, deletions, or additions that do not essentially alter the biological function of the nucleic acid or polypeptide. Specifically, functional variants may include substitutions, deletions, and / or additions, or combinations thereof, of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acid residues, which substitutions, deletions, and / or additions are conservative modifications and do not alter the antigen binding properties. Specifically, the functional variants described herein contain up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 amino acid substitutions, deletions and / or additions, which are conservative modifications and do not alter the function of the antibody. Specifically, the functionally active variants described herein contain up to 15, preferably up to 10 or 5 amino acid substitutions, deletions and / or additions, which are conservative modifications and do not alter the function of the antibody.

[0125] Functional variants are obtained by sequence alterations, such as one or more point mutations, in a polypeptide or nucleotide sequence, where the sequence alterations retain or improve the function of the unaltered polypeptide or nucleotide sequence when used in the combinations of the present invention. Such sequence alterations may include, but are not limited to, (conservative) substitutions, additions, deletions, mutations and insertions. Conservative substitutions are those that occur within a family of amino acids that are related by their side chains and chemical properties. Examples of such families are amino acids with basic side chains, acidic side chains, non-polar aliphatic side chains, non-polar aromatic side chains, uncharged polar side chains, small side chains, large side chains, etc.

[0126] A point mutation is specifically recognized as a manipulation of a polynucleotide that results in the expression of an amino acid sequence that differs from the unmanipulated amino acid sequence by the deletion or insertion of one or more individual amino acids, or by the replacement of an amino acid by substitution.

[0127] According to certain embodiments, the antibodies described herein may comprise one or more tags for purification and / or detection, for example, but not limited to, an affinity tag, a solubility enhancing tag, and a monitoring tag.

[0128] In particular, the affinity tag is selected from the group consisting of a polyhistidine tag, a polyarginine tag, a peptide substrate for an antibody, a chitin-binding domain, an RNAse S-peptide, Protein A, β-galactosidase, a FLAG tag, a Strep II tag, a streptavidin-binding peptide (SBP) tag, a calmodulin-binding peptide (CBP), a glutathione S-transferase (GST), a maltose-binding protein (MBP), an S-tag, an HA tag, and a c-Myc tag, in particular the tag is a His tag containing one or more Hs, e.g., a hexahistidine tag.

[0129] By "fused" or "conjugated" is meant that the components (e.g., a Fab molecule and an Fc domain subunit) are linked by a peptide bond, either directly or via one or more peptide linkers.

[0130] The term "linker", as used herein, refers to a peptide linker, which is preferably a peptide having an amino acid sequence having a length of 2, 3, 4, 5, 6, 7 or more amino acids, preferably 2 to 10 amino acids, and more preferably 3 to 5 amino acids.

[0131] The term "immunoglobulin" refers to a protein having the structure of a naturally occurring antibody. For example, an immunoglobulin of the IgG class is a heterotetrameric glycoprotein of about 150,000 daltons composed of two light chains and two heavy chains linked by disulfides. Each heavy chain has, from the N-terminus to the C-terminus, a variable region (VH), also called the variable heavy domain or the heavy chain variable domain, followed by three constant domains (CH1, CH2, and CH3), also called the heavy chain constant region. Similarly, each light chain has, from the N-terminus to the C-terminus, a variable region (VL), also called the variable light domain or the light chain variable domain, followed by a constant light (CL) domain, also called the light chain constant region. An immunoglobulin of the IgG class essentially consists of two Fab molecules and an Fc domain linked via an immunoglobulin hinge region. The heavy chains of immunoglobulins may be assigned to one of five types called α (IgA), δ (IgD), ε (IgE), γ (IgG), or μ (IgM), several of which may be further divided into subtypes, e.g., γ1 (IgG1), γ2 (IgG2), γ3 (IgG3), γ4 (IgG4), α1 (IgA1), and α2 (IgA2). The light chains of immunoglobulins may be assigned to one of two types called kappa (κ) and lambda (λ).

[0132] The term "chimeric antibody" refers to an antibody in which a portion of the heavy and / or light chain is derived from a particular source or species, while the remainder of the heavy and / or light chain is derived from a different source or species, usually prepared by recombinant DNA techniques. Chimeric antibodies may contain rabbit or mouse variable regions and human constant regions. Chimeric antibodies are the product of expressed immunoglobulin genes that contain DNA segments encoding immunoglobulin variable regions and DNA segments encoding immunoglobulin constant regions. Methods for producing chimeric antibodies involve conventional recombinant DNA and gene transfection techniques well known in the art (Morrison, SL, et al., 1984).

[0133] A "human antibody" possesses an amino acid sequence that corresponds to that of an antibody produced by a human or human cell, or an antibody derived from a non-human source utilizing a human antibody repertoire, or other human antibody coding sequence. This definition of a human antibody specifically excludes humanized antibodies, which comprise non-human antigen-binding residues. As mentioned with respect to chimeric and humanized antibodies, the term "human antibody" as used herein also includes such antibodies that are modified in the constant region, for example, by "class switching", i.e., changes or mutations in the Fc portion (e.g., IgG1 to IgG4 and / or IgG1 / IgG4 mutations).

[0134] The term "recombinant human antibody", as used herein, is intended to encompass all human antibodies that are prepared, expressed, created or isolated by recombinant means, such as antibodies isolated from host cells such as HEK, NS0 or CHO cells, or from animals (e.g., mice) transgenic for human immunoglobulin genes, or expressed using a recombinant expression vector transfected into a host cell. The amino acid sequences of the VH and VL regions of the recombinant antibodies, while derived from and related to human germline sequences, are sequences that may not naturally exist within the human antibody repertoire in vivo.

[0135] A "human consensus framework" is a framework that represents the most commonly occurring amino acid residues in a selection of human immunoglobulin VL or VH framework sequences. Generally, the selection of human immunoglobulin VL or VH sequences is from a subgroup of variable domain sequences. Generally, the subgroup of sequences is a subgroup as described in Kabat et al., 1991.

[0136] A "humanized" antibody refers to a chimeric antibody that comprises amino acid residues from a non-human HVR and amino acid residues from a human framework region (FR) that has been subjected to humanization. In certain embodiments, a humanized antibody comprises substantially all of at least one, and typically two, variable domains, with all or substantially all of the HVRs (e.g., CDRs) corresponding to those of a non-human antibody and all or substantially all of the FRs corresponding to those of a human antibody. A humanized antibody may optionally comprise at least a portion of an antibody constant region derived from a human antibody. In particular, forms of humanized antibodies are encompassed by the present invention, in which the constant region has been further modified or altered from that of the original antibody to develop new properties, i.e., with respect to reduced or abolished C1q binding and / or Fc receptor (FcR) binding.

[0137] The term "bispecific" as used herein refers to a binding reaction with at least the oxMIF antigen and an additional antigen, such as, but not limited to, the CD3 or HSG antigen. Specifically, a bispecific antibody can contain at least two sites with specific binding properties, where two different target antigens, i.e., oxMIF and an additional antigen, are recognized by the antibody. An exemplary bispecific antibody format can contain two binding sites, where each of the binding sites can specifically bind to a different antigen, e.g., CD3 or HSG, as well as oxMIF. Further exemplary bispecific formats can contain more than two binding sites, where one or more binding sites bind oxMIF and one or more binding sites that can specifically bind to one or more different antigens, e.g., CD3 or HSG.

[0138] A "bispecific antibody" according to the present invention is an antibody with two different binding specificities. Bispecific antibodies can be prepared as full-length antibodies or antibody fragments as described herein, but still contain a silenced Fc region. Immunoglobulin Fc heterodimers can be engineered by modifications to the CH3 domain interface, with different mutations on each domain such that engineered Fc fragments with CH3 mutant pairs preferentially form heterodimers over homodimers (Ha JH.et al.,2016). Examples of bispecific antibody formats may include, but are not limited to, bispecific IgG (BsIgG), i.e. IgG with additional antigen-binding moieties added, BsAb fragments, bispecific fusion proteins, BsAb conjugates, hybrid bsIgG, modified Fc fusion proteins, additional IgGs-HC fusions, additional IgGs-LC fusions, additional IgGs-HC&LC fusions, Fc fusions, CH3 fusions, F(ab')2 fusions, CH1 / CL, modified IgG, Fc modified IgG, diabodies, etc., as described in Spiess C. et al., 2015, and Brinkmann U. and Kontermann RE, 2017.

[0139] In alternative embodiments encompassing bispecific antibodies or antibody fragments as described herein, the term "IgG-scFv" refers to a type of bispecific antibody engineered by fusing one scFv to a monospecific immunoglobulin G (IgG) for bispecificity. According to the present invention, the bispecific antibody is Fc-silenced, i.e., comprises a mutant Fc region of wild-type human IgG with one or more amino acid substitutions or glycosylation modifications as described herein. The specificity of the IgG may be against oxMIF and the specificity of the scFv against CD3 or HSG, or vice versa. Furthermore, either the amino or C-terminus of one of the light or heavy chains can be appended with an scFv to form various types of IgG-scFv bispecific antibodies (BsAbs): (i) IgG(H)-scFv, i.e., an scFv attached to the C-terminus of one of the full-length IgG HC; (ii) scFv-(H)IgG, which is the same as IgG(H)-scFv except that the scFv is attached to the N-terminus of the HC; (iii) IgG(L)-scFv or (iv) scFv-(L)IgG, i.e., an scFv attached to the C-terminus or N-terminus of the IgG light chain, which forms IgG(L)-scFv or scFv-(L)IgG, respectively. Specifically, IgG-scFvs range from 165 kDa to 185 kDa, specifically, about 175 kDa.

[0140] According to an alternative embodiment, fusing recombinant variable domains, such as diabodies, to a silenced Fc region (e.g., scDb-Fc) can significantly increase binding valency. The increased size can also increase the half-life of the diabody in serum. The term "diabody" refers to a combination of heavy chain variable (V) H ) and light chain variable (V L(scFv) refers to a non-covalent dimer of single chain Fv (scFv) fragments consisting of a 125 kDa domain. Another form of diabody is single chain (FV)2, in which two scFV fragments are covalently linked to each other. Furthermore, by linking the genes in each chain in tandem using an internal linker, four VH and VL domains can be expressed in tandem and folded as a single chain diabody (scDb), which is also an effective strategy for bispecific antibody production. Specifically, diabody-CH3 has about 125 kDa.

[0141] In certain embodiments, the term Fab / bs(scFv)2-Fc refers to a bispecific antibody that is an IgG in which one Fab arm is replaced by bs(scFv)2 while the other IgG arm is preserved.

[0142] In certain embodiments, the term Fab / scFv-Fc refers to a bispecific antibody that is an IgG in which one Fab arm is replaced by an scFv while the other IgG arm is preserved. Antibody C0132 described herein, shown diagrammatically in Figure 12, serves as a non-limiting example of a Fab / scFv-Fc.

[0143] In certain embodiments, the term Fab / Fab-scFv-Fc refers to a bispecific antibody that is an IgG in which one Fab arm is replaced by a Fab-scFv while the other IgG arm is preserved. The antibody C0133 described herein, shown diagrammatically in Figure 12, serves as a non-limiting example of a Fab / Fab-scFv-Fc.

[0144] The term "CrossMab" (where Mab refers to monoclonal antibody) is a bispecific Ab format derived from independent parent antibodies. Heavy chain mispairing is avoided by applying the KIH (knobs-into-holes) method. Light chain mispairing is avoided because bispecific antibodies are produced by antibody domain exchange, where either the variable domain or the constant domain (CL and CH1) of one Fab arm is swapped between light and heavy chains. This "crossover" maintains the antigen binding affinity and also preserves the two different arms to avoid light chain mispairing. Examples of CrossMab can be, but are not limited to, Fab, VH-VL and CH1-CL with different regions exchanged. In CrossMAb Fab, all of the VH-CH1 and VL-CL regions are exchanged; in CrossMAb VH-VL format, only the VH and VL regions are exchanged; in CrossMAb CH1-CL1 format, the CH1 and CL regions of the bispecific antibody are exchanged. Specifically, the CrossMab is approximately 150 kDa.

[0145] The oxMIF antibody of the present invention may further comprise at least one binding site that specifically recognizes an epitope of human CD3, including, for example, the CD3γ (gamma) chain, the CD3δ (delta) chain, and the CD3ε (epsilon) chain present on the cell surface. For example, clustering of CD3 on T cells by immobilized anti-CD3 antibodies results in T cell activation that is similar to T cell receptor binding but independent of the typical specificity of the clone. In certain embodiments, the CD3 binding domain of the antibody described herein not only exhibits strong CD3 binding affinity with human CD3, but also exhibits excellent cross-reactivity with the respective cynomolgus monkey CD3 protein. In some examples, the CD3 binding domain of the antibody cross-reacts with CD3 from cynomolgus monkeys. In one embodiment, the anti-CD3 binding site comprises one or more (e.g. all three) light chain complementarity determining regions of an anti-CD3 binding domain described herein and / or one or more (e.g. all three) heavy chain complementarity determining regions of an anti-CD3 binding domain described herein, e.g. comprising an anti-CD3 binding domain comprising one or more, e.g. all three LC CDRs, and one or more, e.g. all three HC CDRs.

[0146] According to further embodiments, the antibody may comprise one or more further binding sites which specifically recognize one or more antigens expressed on effector T cells, NK cells or macrophages, in particular one or more of CD3, ADAM17, CD2, CD4, CD5, CD6, CD8, CD11a, CD11b, CD14, CD16, CD16b, CD25, CD28, CD30, CD32a, CD40, CD 40L, CD44, CD45, CD56, CD57, CD64, CD69, CD74, CD89, CD90, CD137, CD177, CEAECAM6, CEACAM8, HLA-DR alpha chain, KIR, LSECtin or SLC44A2, or one or more hapten antigens, i.e. HSG.

[0147] According to an alternative embodiment, the antibody of the invention is a bispecific antibody further comprising one or more CD3 variable binding domains of mosunetuzumab, pasotuxizumab, civisatamab, otelixizumab, teplizumab, visilizumab or foralumab.

[0148] According to certain embodiments, the anti-CD3 binding moiety is selected from the group consisting of muromonab-CD3 (OKT3), otelixizumab (TRX4), teplizumab (MGA031), visilizumab (Nuvion), solitomab, blinatumomab, pasotuxizumab, civisatamab, mosunetuzumab, SP34, X35, VIT3, BMA030 (BW264 / 56), CLB-T3 / 3, CRIS7, YTH12.5, Complementarity determining regions (CDRs) selected from the group consisting of F111-409, CLB-T3.4.2, TR-66, WT32, SPv-T3b, 11D8, XIII-141, XIII-46, XIII-87, 12F6, T3 / RW2-8C8, T3 / RW2-4B6, OKT3D, M-T301, SMC2, F101.01, UCHT-1 and WT-31, and, where applicable, any humanized derivatives thereof.

[0149] Specifically, the CD3 binding domain according to the present invention may be one or more CDRs of the anti-CD3 variable region, or a CDR that comprises or has at least 70%, specifically 80%, 90%, 95% or 99% sequence identity with any of the CDR sequences of muromonab, otelixizumab, teplizumab, visilizumab, solitomab, blinatumomab, pasotuxizumab, civisatamab, or mosunetuzumab.

[0150] The specific CDRs that bind to CD3 are as follows:

[0151] [Table 2]

[0152] [Table 3]

[0153] More specifically, the bispecific anti-oxMIF / anti-CD3 antibody contains 0, 1, or 2 point mutations in each of the above listed CDR sequences.

[0154] A further specific embodiment refers to anti-oxMIF / anti-CD3 bs(scFv)2, the corresponding variable heavy chain region (VH) and the corresponding variable light chain region (VL) are VH(oxMIF)-V L The Fc domains are arranged from the N-terminus to the C-terminus in the order of (oxMIF)-VH(CD3)-VL(CD3), VH(CD3)-VL(CD3)-VH(oxMIF)-VL(oxMIF) or VH(CD3)-VL(CD3)-VL(oxMIF)-VH(oxMIF). According to the invention, the bs(scFv)2 is fused to the silenced Fc portion or the silenced Fc domain by the hinge region.

[0155] According to a further embodiment, the Fc-silenced anti-oxMIF antibody of the invention may further comprise at least one binding site which further specifically recognizes the HSG (histamine-succinyl-glycine) hapten.

[0156] According to certain embodiments, the anti-HSG binding site comprises complementarity determining regions (CDRs) selected from the murine (m) anti-HSG antibody 679 (m679), and, where applicable, any humanized (hz) derivative thereof.

[0157] Such bispecific anti-oxMIF antibodies may comprise a binding site that specifically recognizes HSG comprising the CDRs listed in Tables 3 and 4 below (hz anti-HSG antibody 679 (hz679) sequence from US2009 / 0240037A1).

[0158] [Table 4]

[0159] [Table 5]

[0160] More specifically, the bispecific anti-oxMIF / anti-HSG antibody contains 0, 1, or 2 point mutations in each of the CDR sequences listed above.

[0161] A further specific embodiment refers to anti-oxMIF / anti-HSG bs(scFv)2, the corresponding variable heavy region (VH) and the corresponding variable light region (VL) are VH(oxMIF)-V L The Fc domains are arranged from N-terminus to C-terminus in the order of (oxMIF)-VH(HSG)-VL(HSG), VH(HSG)-VL(HSG)-VH(oxMIF)-VL(oxMIF) or VH(HSG)-VL(HSG)-VL(oxMIF)-VH(oxMIF). According to the invention, the bs(scFv)2 is fused to the silenced Fc portion or the silenced Fc domain by the hinge region.

[0162] In a further embodiment the antibody is an Fc-silenced bispecific antibody, specifically selected from the group consisting of bispecific IgG, IgG with added CD3 or HSG binding sites, BsAb fragments, bispecific fusion proteins, BsAb conjugates.

[0163] Directly radiolabeled antibodies have slow blood clearance and delayed tumor uptake in solid tumors, resulting in continuous high radiation dose exposure to healthy tissues and organs. In vivo pretargeted radioimmunotherapy (PRAIT) allows overcoming these limitations, but the selection and design of bsMab formats for PRAIT remains challenging. PRAIT aims to improve the therapeutic index (tumor to normal tissue ratio) by increasing the delivery of absorbed dose to the tumor compared to directly radiolabeled antibodies or antibody fragments. PRAIT involves the administration of a bsMab against HSG and tumor targets, followed by the administration of a radiolabeled bivalent HSG hapten several days later. Using this technique, a significant amount of bsMab accumulates in the tumor and is largely cleared from the circulation, and the radiolabeled bivalent HSG hapten binds to the tumor-accumulated bsMAb, while the unbound radioactive HSG hapten is cleared from the circulation by the kidney within a few hours. Therefore, exposure of normal organs to radiation is minimized (US2005 / 0025709, Sharkey RM et al., 2005, Rossi EA et al, and Karacay H.et al, 2005).

[0164] Targeted radionuclide therapy includes, for example, the HSG hapten IMP288 (as described in US 2005 / 0025709) and 177 Lu can be used as the radionuclide. IMP288 is a DOTA-conjugated D-Tyr-D-Lys-D-Glu-D-Lys-NH2 tetrapeptide in which both lysine residues are derivatized with HSG moieties via their ε-amino groups.

[0165] The term "antigen", when used interchangeably herein with the terms "target" or "target antigen", refers to the entire target molecule or a fragment of such a molecule that is recognized by an antibody binding site. In particular, substructures of antigens, typically referred to as immunologically relevant "epitopes", such as B-cell epitopes or T-cell epitopes, e.g., polypeptide or carbohydrate structures, may be recognized by such binding sites.

[0166] The term "epitope" as used herein refers in particular to a molecular structure that may completely constitute a specific binding partner or may be part of a specific binding partner for the binding site of an antibody type of the invention. An epitope may be composed of carbohydrates, peptide structures, fatty acids, organic substances, biochemicals or inorganic substances or derivatives thereof and any combination thereof. When an epitope is comprised in a peptide structure such as a peptide, polypeptide or protein, the epitope usually comprises at least 3 amino acids, particularly 5 amino acids to 40 amino acids, and particularly 10 amino acids or less, particularly 4 amino acids to 10 amino acids. An epitope may be either a linear epitope or a conformational epitope. A linear epitope is composed of a single segment of the primary sequence of a polypeptide or carbohydrate chain. Linear epitopes may be contiguous or overlapping. A conformational epitope is composed of amino acids or carbohydrates that are brought together by folding a polypeptide to form a tertiary structure, where the amino acids are not necessarily adjacent to each other in the linear sequence. Such an oxMIF epitope may be the sequence EPCALCS (SEQ ID NO: 42), which is located within the central region of oxMIF.

[0167] The term "antigen-binding domain" or "binding domain" or "binding site" refers to a portion of an antigen-binding moiety that specifically binds to and comprises an area complementary to a portion or all of an antigen. If the antigen is large, an antigen-binding molecule may only bind to a specific portion of the antigen, which is referred to as an epitope. An antigen-binding domain may be provided, for example, by one or more antibody variable domains (also called antibody variable regions). Preferably, the antigen-binding domain comprises an antibody light chain variable region (VL) and an antibody heavy chain variable region (VH).

[0168] The term "binding site", as used herein with respect to an antibody of the invention, refers to a molecular structure capable of binding interaction with an antigen. Usually, binding sites are located within the complementarity determining regions (CDRs) of an antibody, also referred to herein as "CDR binding sites", which are specific regions with different structures that confer binding function to various antigens. The different structures can be derived from natural repertoires of antibodies, e.g., mouse or human repertoires, or can be produced recombinantly or synthetically, e.g., by mutagenesis, in particular by randomization techniques. These include mutagenized CDR regions, loop regions of variable antibody domains, in particular CDR loops of antibodies, e.g., CDR1, CDR2 and CDR3 loops of either VL and / or VH antibody domains. An antibody format as used herein usually comprises one or more CDR binding sites, each specific for an antigen.

[0169] The oxMIF binding site of the antibody described herein is specific for the oxidized form of MIF, i.e., animal, particularly mammalian oxMIF, such as but not limited to mouse, rat, monkey and human, particularly human oxMIF, but does not show substantial cross-reactivity with reduced MIF. oxMIF is a disease-related structural isoform of MIF that can be specifically and predominantly detected in the circulation of subjects with inflammatory diseases and in tumor tissues of cancer patients. In one embodiment, the humanized or human anti-oxMIF binding site comprises one or more (e.g., all three) light chain complementarity determining regions of the humanized or human anti-oxMIF binding domain described herein, such as the CDRs contained in SEQ ID NO: 2, 5, 6, 7 or 8, and / or one or more (e.g., all three) heavy chain complementarity determining regions of the humanized or human anti-oxMIF binding domain described herein, such as SEQ ID NO: 3, 4, 9, or 43.

[0170] The term "specific" as used herein refers to the binding reaction that determines the cognate ligand of interest in a heterogeneous population of molecules.In this specification, the binding reaction is at least the reaction with oxMIF antigen.Therefore, under specified conditions, such as immunoassay conditions, the antibody that specifically binds to a particular target does not bind to other molecules present in the sample in significant amounts, and in particular, the antibody does not show substantial cross-reactivity to reduced MIF.

[0171] A specific binding site typically does not cross-react with other targets. Yet, a specific binding site may specifically bind to one or more epitopes, isoforms, or variants of a target, or may be cross-reactive with other related target antigens, such as homologs or analogs.

[0172] Specific binding means that the binding is selected for target identity, high, medium or low affinity or avidity, depending on the selection. Selective binding is usually achieved when the binding constant or kinetics for a target antigen, such as oxMIF, is at least 10-fold different, preferably at least 100-fold, more preferably at least 1000-fold different, compared to the binding constant or kinetics for an antigen that is not the target antigen.

[0173] The term "valent" as used within this application refers to the presence of a designated number of binding sites in an antibody molecule. Thus, the terms "bivalent," "tetravalent," and "hexavalent" refer to the presence of two binding sites, four binding sites, and six binding sites, respectively, in an antibody molecule.

[0174] The term "monovalent" as used herein with respect to the binding site of an antibody refers to a molecule that contains only one binding site directed against a target antigen. The term "valency" is therefore understood as the number of binding sites that specifically bind to the same or different epitopes of an antigen directed against the same target antigen.

[0175] It is understood that the antibodies of the present invention include monovalent, bivalent, tetravalent or multivalent binding sites that specifically bind oxMIF.

[0176] The term "hypervariable region" or "HVR" as used herein refers to each of the regions of an antibody variable domain that are hypervariable in sequence and / or form structurally defined loops ("hypervariable loops"). Generally, a natural four-chain antibody comprises six HVRs, three in the VH (H1, H2, H3) and three in the VL (L1, L2, L3). HVRs generally comprise amino acid residues from the hypervariable loops and / or from the "complementarity determining regions" (CDRs), the latter of which have the highest sequence variability and / or are involved in antigen recognition (Kabat et al., 1991). Hypervariable regions (HVRs) are also referred to as complementarity determining regions (CDRs), and these terms are used interchangeably herein in reference to the portions of the variable regions that form the antigen-binding region. The exact number of residues that encompass a particular CDR varies depending on the sequence and size of the CDR. Given the variable region amino acid sequence of an antibody, one skilled in the art can routinely determine which residues comprise a particular CDR.

[0177] Kabat defined a numbering system for variable region sequences that is applicable to any antibody. One skilled in the art can unambiguously assign this system of "Kabat numbering" to any variable region sequence without reliance on any experimental data beyond the sequence itself. The Kabat numbering of residues can be determined for a given antibody by alignment of the antibody's sequence in regions of homology with the "standard" Kabat numbered sequence. As used herein, "Kabat numbering" refers to the numbering system described by Kabat et al., 1983, USDept. of Health and Human Services, "Sequence of Proteins of Immunological Interest". Unless otherwise indicated, references to the numbering of specific amino acid residue positions in an antibody variable region follow the Kabat numbering system. Numbering of constant regions follows the EU numbering index.

[0178] CDRs also include "specificity determining residues" or "SDRs", which are residues that contact the antigen. SDRs are contained within regions of CDRs called abbreviated CDRs, or a-CDRs. Unless otherwise indicated, HVR residues and other residues in the variable domain (e.g., FR residues) are numbered according to Kabat et al., supra. CDRs can also be determined according to IMGT (Lefranc MP. 1997). IMGT has its own definitions for framework regions (named FR-IMGT) and CDRs (named CDR-IMGT). The IMGT numbering method counts residues consecutively from 1 to 128 based on a germline V sequence alignment.

[0179] CDRs (or SDRs) can also be determined according to MacCallum RM et al., 1996. Herein, antigen contact residues are analyzed and combined with the site geometry in crystal structures of antibody Fv and Fab available from the Protein Data Bank. Antigen contact propensity is shown for each antibody residue, allowing a definition of CDRs to be proposed based on observed antigen contacts. Contacts are more prevalent with CDR residues located in the center of the combining site; contacts occur only with bulky antigens with some less central CDR residues. Non-contacting residues in CDRs correspond to residues identified as important for defining the "classical" conformation by Chothia and coworkers (Chothia C et al., 1987).

[0180] A "point mutation" is specifically recognized as a manipulation of a polynucleotide that results in the expression of an amino acid sequence that differs from the unmanipulated amino acid sequence, in the substitution or exchange, deletion or insertion of one or more single (discontinuous) or double amino acids for different amino acids. A preferred point mutation refers to the exchange of amino acids of the same polarity and / or charge. In this context, amino acids refer to the 20 naturally occurring amino acids coded for by 61 triplet codons. These 20 amino acids can be divided into neutrally charged, positively charged, and negatively charged amino acids.

[0181] "Percent (%) sequence identity" with respect to the polypeptide sequences identified herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the particular polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and does not take into account any conservative substitutions as part of the sequence identity. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.

[0182] According to the present invention, the sequence identity of the variable or constant region sequences is at least 95%, 96%, 97%, 98%, 99%, 99.5% or 100% with each of the sequences described herein.

[0183] A "subject" is a mammal. Mammals include, but are not limited to, domestic animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates, such as monkeys), rabbits, and rodents (e.g., mice and rats). In certain embodiments, the individual or subject is a human.

[0184] "Isolated nucleic acid" refers to a nucleic acid molecule that has been separated from a component of its natural environment. Isolated nucleic acid includes a nucleic acid molecule contained in a cell that ordinarily contains the nucleic acid molecule, but where the nucleic acid molecule is present extrachromosomally or at a chromosomal location that is different from its natural chromosomal location.

[0185] "Isolated nucleic acid encoding an anti-oxMIF antibody" refers to one or more nucleic acid molecules encoding antibody heavy and light chains (or fragments thereof), including such nucleic acid molecules in a single vector or separate vectors, and such nucleic acid molecules present in one or more locations in a host cell.

[0186] "No substantial cross-reactivity" means that a molecule (e.g., an antibody) does not recognize or specifically bind to an antigen other than the actual target antigen of the molecule (e.g., an antigen closely related to the target antigen), specifically reduced MIF, especially when compared to the target antigen. For example, an antibody may bind less than about 10% to less than about 5% of an antigen other than the actual target antigen, or may bind an antigen other than the actual target antigen in an amount that is less than about 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, or 0.1%, preferably less than about 2%, 1%, or 0.5%, most preferably less than about 0.2% or 0.1% of the antigen other than the actual target antigen. Binding may be determined by methods known in the art, such as, but not limited to, ELISA or surface plasmon resonance.

[0187] Recombinant production of the antibodies of the invention preferably involves an expression system including, for example, an expression construct or vector containing a nucleotide sequence encoding the antibody format.

[0188] The term "expression system" refers to a nucleic acid molecule containing desired coding and control sequences in operable linkage such that a host transformed or transfected with these sequences is capable of producing the encoded protein. To achieve transformation, the expression system may be included on a vector, but the relevant DNA may subsequently be integrated into the host chromosome. Alternatively, the expression system may be used for in vitro transcription / translation.

[0189] As used herein, an "expression vector" is defined as a DNA sequence required for the transcription of a cloned recombinant nucleotide sequence, i.e., recombinant genes, and the translation of their mRNA in a suitable host organism. An expression vector contains an expression cassette, and also usually contains an origin or genome integration site for autonomous replication in a host cell, one or more selectable markers (e.g., amino acid synthesis genes or genes that confer resistance to antibiotics such as zeocin, kanamycin, G418, or hygromycin), multiple restriction enzyme cleavage sites, a suitable promoter sequence, and a transcription terminator, and these components are operably linked together. The terms "plasmid" and "vector" as used herein encompass autonomously replicating nucleotide sequences and genome-integrating nucleotide sequences.

[0190] Specifically, the term refers to a vehicle by which a DNA or RNA sequence (e.g., a foreign gene), such as a nucleotide sequence encoding an antibody format of the present invention, can be introduced into a host cell to transform the host and promote the expression (e.g., transcription and translation) of the introduced sequence. Plasmids are preferred vectors of the present invention.

[0191] A vector usually contains a transmissible piece of DNA into which a foreign gene is inserted. A common method for inserting one segment of DNA into another segment of DNA involves the use of enzymes called restriction enzymes, which cut the DNA at specific sites (specific groups of nucleotides) called restriction sites.

[0192] A "cassette" refers to a DNA coding sequence or segment of DNA that encodes an expression product that can be inserted into a vector at defined restriction sites. The cassette restriction sites are designed to ensure insertion of the cassette in the correct reading frame. Generally, foreign DNA is inserted at one or more restriction sites in the vector DNA and is then carried by the vector along with the transmissible vector DNA into a host cell. A segment or sequence of DNA into which DNA has been inserted or added, such as an expression vector, may also be referred to as a "DNA construct." A common type of vector is the plasmid, which is generally a self-contained molecule of double-stranded DNA that can readily accept additional (foreign) DNA and can be easily introduced into a suitable host cell. Vectors of the invention often contain coding DNA and expression control sequences, such as promoter DNA, and have one or more restriction sites suitable for inserting foreign DNA. Coding DNA is a DNA sequence that codes for a specific amino acid sequence for a particular polypeptide or protein, such as the antibody format of the invention. Promoter DNA is a DNA sequence that initiates, regulates, or otherwise mediates or controls expression of coding DNA. The promoter DNA and the coding DNA may be from the same gene or from different genes, and may be from the same or different organisms. Recombinant cloning vectors of the invention often include one or more replication systems for cloning or expression, one or more markers for selection in the host, e.g., antibiotic resistance, and one or more expression cassettes.

[0193] For example, the procedures used to ligate DNA sequences providing or encoding the elements of the invention, and / or the protein of interest, promoters, terminators and further sequences, respectively, and insert them into suitable vectors containing the information necessary for integration or host replication, are well known to those skilled in the art and are described, for example, in Sambrook et al., 2012.

[0194] A host cell is in particular understood as a cell, recombinant cell or cell line which has been transfected with an expression construct such as a vector according to the invention.

[0195] The term "host cell line," as used herein, refers to an established clone of a particular cell type that has acquired the ability to grow over long periods of time. The term host cell line refers to the cell line that is used to express endogenous or recombinant genes to produce a polypeptide, such as a recombinant antibody format of the present invention.

[0196] "Production host cells" or "production cells" are generally understood to be cell lines or cultures of cells ready for cultivation in a bioreactor to obtain the recombinant antibody format of the invention that is the product of the production process. The host cell type according to the present invention can be any prokaryotic or eukaryotic cell.

[0197] The term "recombinant" as used herein means "prepared by genetic manipulation" or "the result of genetic manipulation," e.g., specifically with heterologous sequences incorporated in a recombinant vector or recombinant host cell.

[0198] The antibodies of the invention may be produced using any of the known well-established expression systems and recombinant cell culture techniques, for example by expression in bacterial hosts (prokaryotic systems) or eukaryotic systems such as yeast, fungi, insect cells or mammalian cells. The antibody molecules of the invention may be produced in transgenic organisms such as goats, plants or transgenic mice, which are engineered mouse strains carrying large fragments of the human immunoglobulin loci and deficient in mouse antibody production. Antibodies may also be produced by chemical synthesis.

[0199] According to a particular embodiment, the host cell is a production cell line of cells selected from the group consisting of CHO, PerC6, CAP, HEK, HeLa, NS0, SP2 / 0, hybridoma and Jurkat. More particularly, the host cell is derived from a CHO cell.

[0200] The host cells of the invention are specifically cultured or maintained in serum-free cultures that contain, for example, as an alternative to serum, other components such as plasma proteins, hormones and growth factors.

[0201] The host cells are most preferred when they are established, adapted and cultured entirely in serum-free conditions, optionally in a medium that is free of any proteins / peptides of animal origin.

[0202] Anti-oxMIF antibodies of the invention can be recovered from the culture medium using standard protein purification methods.

[0203] The term "pharmaceutical formulation" refers to a preparation that is present in a form that allows the biological activity of the active ingredients contained in the preparation to be effective and does not contain additional components that are unacceptably toxic to the subject to which the formulation is administered.

[0204] "Pharmaceutically acceptable carrier" refers to an ingredient in a pharmaceutical formulation other than the active ingredient that is non-toxic to a subject. Some examples of pharmaceutically acceptable carriers are water, saline, phosphate buffered saline, amino acids such as glycine or histidine, dextrose, glycerol, ethanol, and the like, as well as combinations thereof. In many cases, it is suitable to include an isotonic agent in the composition, for example, sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride. Further examples of pharmaceutically acceptable substances are wetting agents, or minor amounts of auxiliary substances such as wetting agents or emulsifying agents, preservatives, or buffers, which enhance the life or effectiveness of the antibody.

[0205] As used herein, "treatment", "treat" or "treating" refers to a clinical intervention that seeks to alter the natural course of the individual being treated and may be performed for prophylaxis or during the course of clinical pathology. The desired effects of treatment include, but are not limited to, prevention of disease onset or recurrence, alleviation of symptoms, reduction of any direct or indirect pathological consequences of the disease, prevention of metastasis, reduction in the rate of disease progression, improvement or palliative of the disease state, and remission or improved prognosis. In some embodiments, the antibodies of the invention are used to delay the onset of disease or to slow the progression of the disease.

[0206] The anti-oxMIF antibodies of the present invention and pharmaceutical compositions comprising the same may be administered in combination with one or more other therapeutic, diagnostic or prophylactic agents, including other anti-cancer, anti-tumor, anti-angiogenic and chemotherapeutic agents, steroids, or checkpoint inhibitors, depending on the disease to be treated.

[0207] The pharmaceutical compositions of the present invention may be in various forms, such as liquid, semi-solid and solid dosage forms, such as liquid solutions (e.g., injectable and infusible solutions), dispersions or suspensions, tablets, pills, powders, liposomes and suppositories. The preferred form depends on the intended mode of administration and therapeutic application. Exemplary preferred compositions are in the form of injectable or infusible solutions, such as compositions similar to those used for passive immunization of humans. The preferred mode of administration is parenteral (e.g., intravenous, subcutaneous, intraperitoneal, intramuscular). In a preferred embodiment, the antibody is administered by intravenous infusion or injection. In another preferred embodiment, the antibody is administered by intramuscular or subcutaneous injection. As will be appreciated by those skilled in the art, the route and / or mode of administration will vary depending on the desired results.

[0208] The optimized advantageous properties of the antibodies of the present invention allow for the administration of high doses of the antibody composition, specifically the composition contains about 10-250 mg / ml of antibody, specifically 25-100 mg / ml, specifically 50 mg / ml or more.

[0209] The anti-oxMIF antibody can be administered once, but more preferably, it is administered multiple times. For example, the antibody can be administered three times a day to once every six months or more. The administration can be performed on a schedule such as three times a day, twice a day, once a day, once every two days, once every three days, once a week, once every two weeks, once a month, once every two months, once every three months, and once every six months.

[0210] The present invention also relates to compositions comprising an anti-oxMIF antibody or an antigen-binding portion thereof for the treatment of a subject in need of treatment for a MIF-related condition, in particular an immune disorder, such as an inflammatory disease or a hyperproliferative disorder. In some embodiments, the subject in need of treatment is a human.

[0211] The term "cancer", as used herein, refers to a proliferative disease, and in particular to solid cancers, such as colorectal cancer, ovarian cancer, pancreatic cancer, lung cancer, melanoma, squamous cell carcinoma (SCC) (e.g., of the head and neck, esophagus, and oral cavity), hepatocellular carcinoma, colorectal adenocarcinoma, renal cancer, medullary thyroid carcinoma, papillary thyroid carcinoma, astrocytoma, neuroblastoma, Ewing's sarcoma, cervical cancer, endometrial cancer, breast cancer, prostate cancer, gastric cancer, and malignant seminiferous carcinoma, including any refractory version of the above cancers, or a combination of one or more of the above cancers.

[0212] The cancer disease or hyperproliferative disorder such as cancer that can be treated by the anti-oxMIF antibody of the present invention involves any tissue or organ, including, but not limited to, brain cancer, lung cancer, squamous cell carcinoma, bladder cancer, gastric cancer, pancreatic cancer, breast cancer, head cancer, neck cancer, liver cancer, kidney cancer, ovarian cancer, prostate cancer, colorectal cancer, esophageal cancer, gynecological cancer, nasopharyngeal cancer, or thyroid cancer, melanoma, lymphoma, leukemia, or multiple myeloma.In particular, the anti-oxMIF antibody of the present invention is useful for treating ovarian, pancreatic, colon, and lung cancer.

[0213] In certain embodiments, Antibodies that are highly suitable for the treatment of cancer diseases, in particular for the treatment of solid tumors, are A recombinant anti-oxMIF antibody, antigen-binding fragment thereof, bispecific anti-oxMIF / anti-CD3 antibody, or bispecific anti-oxMIF / anti-HSG antibody having a silenced Fc and reduced aggregation ability and reduced hydrophobicity, comprising: (a1) a light chain variable domain comprising SEQ ID NO:2 with at least one of the amino acid substitutions M30L, F49Y, A51G, P80S, W93F, or (a2) comprises SEQ ID NO:2 having one, two, three, four, or five amino acid substitutions; - a conserved tyrosine at position 36, and - a light chain variable domain further comprising at least one of the amino acid substitutions M30L, F49Y, A51G, P80S, W93F; and (b1) a heavy chain variable domain comprising SEQ ID NO:3; or (b2) a heavy chain variable domain comprising SEQ ID NO: 3 and the amino acid substitutions L5Q and / or W97Y; or (b3) a heavy chain variable domain comprising SEQ ID NO: 3 with at least one of the amino acid substitutions L5Q or W97Y and one, two, three, four or five additional amino acid substitutions. Including, wherein the amino acid positions are numbered according to Kabat: the mutant Fc region exhibits reduced FcγR binding compared to the wild-type IgG1 Fc region; The above antibody or antigen-binding fragment thereof is a recombinant anti-oxMIF antibody, an antigen-binding fragment thereof, a bispecific anti-oxMIF / anti-CD3 antibody, or a bispecific anti-oxMIF / anti-HSG antibody having reduced aggregation ability and reduced hydrophobicity compared to an antibody comprising SEQ ID NO:2 and SEQ ID NO:3 lacking the amino acid substitutions.

[0214] The invention also encompasses a method for the treatment of inflammatory diseases such as vasculitis, arthritis, sepsis, septic shock, endotoxic shock, toxic shock syndrome, acquired respiratory distress syndrome, glomerulonephritis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, peritonitis, nephritis, atopic dermatitis, asthma, conjunctivitis, fever, malaria, NASH (non-alcoholic steatohepatitis), multiple sclerosis, acute and chronic pancreatitis, type 1 diabetes, IgA nephropathy, interstitial cystitis, post-COVID syndrome, psoriasis, glomerulonephritis, inflammatory bowel disease, nephritis and peritonitis, systemic lupus erythematosus (including SLE - lupus nephritis), asthma, rheumatoid arthritis (RA) and inflammatory bowel disease (IBD) in a subject, including a human, comprising the step of administering to said subject in need thereof a therapeutically effective amount of an anti-oxMIF antibody or an antigen binding portion thereof.

[0215] In certain embodiments, Antibodies highly suitable for the treatment of inflammatory or infectious diseases include: A recombinant anti-oxMIF antibody or antigen-binding fragment thereof, having a silenced Fc and reduced aggregation potential and reduced hydrophobicity, comprising the following variable domains: (a1) a light chain variable domain comprising SEQ ID NO:2 with at least one of the amino acid substitutions M30L, F49Y, A51G, P80S, W93F, or (a2) comprises SEQ ID NO:2 having one, two, three, four, or five amino acid substitutions; - a conserved tyrosine at position 36, and - a light chain variable domain further comprising at least one of the amino acid substitutions M30L, F49Y, A51G, P80S, W93F; and (b1) a heavy chain variable domain comprising SEQ ID NO:3; or (b2) a heavy chain variable domain comprising SEQ ID NO: 3 and the amino acid substitutions L5Q and / or W97Y; or (b3) a heavy chain variable domain comprising SEQ ID NO: 3 with at least one of the amino acid substitutions L5Q or W97Y and one, two, three, four or five additional amino acid substitutions. Including, wherein the amino acid positions are numbered according to Kabat: the mutant Fc region exhibits reduced FcγR binding compared to the wild-type IgG1 Fc region; The above antibody or antigen-binding fragment thereof is a recombinant anti-oxMIF antibody or antigen-binding fragment thereof having reduced aggregation ability and reduced hydrophobicity compared to an antibody comprising sequence numbers 2 and 3 lacking the amino acid substitutions.

[0216] In a further particular embodiment, antibodies highly suitable for the treatment of inflammatory or infectious diseases are recombinant anti-oxMIF antibodies described herein that also have increased preferential binding to the inhibitory receptor FcγRIIB or have enhanced α2,6-N-linked sialylation.

[0217] The present invention further includes the following embodiments. 1. An Fc-silenced anti-oxMIF antibody or antigen-binding fragment thereof, comprising a mutant Fc region of wild-type human IgG comprising SEQ ID NO:1 with one or more amino acid substitutions or glycosylation modifications, and (a1) a light chain variable domain comprising SEQ ID NO:2 with at least one of the amino acid substitutions M30L, F49Y, A51G, P80S, W93F, or (a2) comprises SEQ ID NO:2 having one, two, three, four, or five amino acid substitutions; - a conserved tyrosine at position 36, and - a light chain variable domain further comprising at least one of the amino acid substitutions M30L, A51G, P80S, W93F; and (b1) a heavy chain variable domain comprising SEQ ID NO:3; or (b2) a heavy chain variable domain comprising SEQ ID NO: 3 and the amino acid substitutions L5Q and / or W97Y; or (b3) a heavy chain variable domain comprising SEQ ID NO: 3 with at least one of the amino acid substitutions L5Q or W97Y and one, two, three, four or five additional amino acid substitutions. Including, wherein the amino acid positions are numbered according to Kabat: the mutant Fc region exhibits reduced FcγR binding compared to the wild-type IgG1 Fc region; An Fc-silenced anti-oxMIF antibody or antigen-binding fragment thereof, wherein the antibody or antigen-binding fragment thereof has reduced aggregation ability and reduced hydrophobicity compared to an antibody comprising sequence numbers 2 and 3 lacking amino acid substitutions. 2. A recombinant anti-oxMIF antibody according to embodiment 1, comprising the amino acid substitutions W93F and / or W97Y. 3. An Fc-silenced anti-oxMIF antibody according to embodiment 1 or 2, wherein the amino acid substitution is at any one of positions E233, L234, L235, G236, G237, P238, D265, S267, H268, N297, S298, T299, E318, L328, P329, A330, P331 of SEQ ID NO: 1 according to the EU numbering index. 4. An Fc-silenced anti-oxMIF antibody according to any one of embodiments 1 to 3, wherein the Fc region is aglycosylated. 5. The Fc-silenced anti-oxMIF antibody according to any one of embodiments 1 to 4, wherein the amino acid substitutions are at positions L234 and L235, specifically L234A and L235A. 6. An Fc-silenced anti-oxMIF antibody according to embodiment 1, comprising a variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 5, 6, 7, 8, 9, and 43. 7.i.) SEQ ID NOs: 3 and 6; ii.) SEQ ID NOs: 9 and 6; iii.) SEQ ID NOs: 4 and 6; iv.) SEQ ID NOs: 4 and 8, or v.) SEQ ID NOs: 4 and 5 vi.) SEQ ID NO: 43 and any one of 5, 6, 7, or 8 2. The Fc-silenced anti-oxMIF antibody of embodiment 1, comprising: 8. The Fc-silenced anti-oxMIF antibody of embodiment 7, further comprising SEQ ID NO:14. 9. An Fc-silenced anti-oxMIF antibody according to embodiment 1, comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 15, and 16 or 17. 10. An Fc-silenced anti-oxMIF antibody or antigen-binding fragment thereof, comprising a mutant Fc region of wild-type human IgG comprising SEQ ID NO:1 with one or more amino acid substitutions or glycosylation modifications; A light chain CDR1 sequence selected from SEQ ID NO: 72 or 78; A light chain CDR2 sequence selected from SEQ ID NO: 73, 79, 80, or 81; A light chain CDR3 sequence selected from SEQ ID NO: 74 or 82; A heavy chain CDR1 sequence selected from SEQ ID NO: 75; A heavy chain CDR2 sequence selected from SEQ ID NO: 76 or 83, and A heavy chain CDR3 sequence selected from SEQ ID NO: 77 or 84 With the proviso that SEQ ID NO:74 and SEQ ID NO:77 are not included together, an Fc-silenced anti-oxMIF antibody or antigen-binding fragment thereof. 11. An Fc-silenced anti-oxMIF antibody according to any one of embodiments 1 to 10, wherein the amino acid substitution is at any one of positions E233, L234, L235, G236, G237, P238, I253, D265, S267, H268, N297, S298, T299, H310, E318, L328, P329, A330, P331, H435 of SEQ ID NO: 1, in particular the amino acid substitution is at positions L234 and L235, in particular positions L234, L235, H310 and H435 according to the EU numbering index, and / or the Fc region is aglycosylated. 12. The Fc-silenced anti-oxMIF antibody according to any one of embodiments 1 to 11, selected from the group consisting of bispecific antibodies (i.e. Crossmab), scFv-Fc, (scFv)2-Fc, scFv / scFv-Fc, Fab / scFv-Fc, Fab / (scFv)2-Fc, Fab / Fab-scFv-Fc, Fab / Fab-crossFab-Fc, IgG-scFv and IgG-(scFv)2. 13. An Fc-silenced anti-oxMIF antibody according to any one of embodiments 1 to 12, wherein the antibody is a bispecific antibody further comprising at least one binding site that specifically recognizes an epitope of CD3 or histamine-succinyl-glycine (HSG). 14. An Fc-silenced anti-oxMIF antibody according to item 13 for use in the treatment or detection of solid tumors, wherein the antibody is administered to a subject in a first step and an HSG hapten is administered in a second step, the HSG hapten being conjugated to the antibody and labelled with a radionuclide. 15. An Fc-silenced antibody according to any one of embodiments 1 to 13 for use in the preparation of a medicament. 16. A pharmaceutical composition comprising an antibody according to any one of embodiments 1 to 13, optionally together with a pharmaceutical carrier or adjuvant. 17. The pharmaceutical composition according to embodiment 16, comprising an antibody according to any one of embodiments 1 to 13 at a concentration of 10 to 250 mg / ml, in particular more than 50 mg / ml. 18. The pharmaceutical composition according to embodiment 16 or 17, which is formulated for subcutaneous administration. 19. A pharmaceutical composition according to any one of embodiments 16 to 18, for administration as a single substance or together with a further pharmaceutical composition comprising one or more active substances, preferably selected from the group consisting of antiviral, anticancer, anti-inflammatory and antibiotic. 20. The pharmaceutical composition according to any one of embodiments 16 to 19 for use in the treatment of patients suffering from inflammatory and infectious diseases, in particular in the treatment of asthma, vasculitis, arthritis, sepsis, septic shock, endotoxic shock, toxic shock syndrome, acquired respiratory distress syndrome, glomerulonephritis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, peritonitis, nephritis, NASH (non-alcoholic steatohepatitis), multiple sclerosis, acute and chronic pancreatitis, type 1 diabetes, IgA nephropathy, interstitial cystitis, post-COVID syndrome, and psoriasis. 21. A pharmaceutical composition according to any one of embodiments 16 to 19 for use in the treatment of a patient suffering from a hyperproliferative disorder or cancer, in particular in the treatment of colorectal cancer, ovarian cancer, breast cancer, prostate cancer, pancreatic cancer, gastric cancer, and lung cancer. 22. An isolated nucleic acid encoding an antibody according to any one of embodiments 1 to 13. 23. An expression vector comprising the nucleic acid of embodiment 22. 24. A host cell containing a nucleic acid according to embodiment 22 or an expression vector according to embodiment 23. 25. A method for producing an antibody according to any one of embodiments 1 to 13, comprising culturing a host cell according to embodiment 24, and recovering said antibody from the cell culture. EXAMPLES

[0218] The examples described herein are illustrative of the present invention and are not intended to limit it. Many modifications and variations can be made to the techniques described and illustrated herein without departing from the scope of the present invention. Therefore, it should be understood that the examples are illustrative only and do not limit the scope of the present invention.

[0219] Example 1: Mutant IDs, sequence combinations and sequences of anti-oxMIF antibodies (Table 5A) and anti-oxMIF x anti-HSG bispecific antibodies (Table 5B) used in the Examples section

[0220] [Table 6]

[0221] [Table 7]

[0222] Example 2: Reduced aggregation tendency and reduced hydrophobicity of newly designed anti-oxMIF antibodies To assess hydrophobicity and aggregation, the newly designed antibodies C0115 and C0118 were analyzed in comparison to the control anti-oxMIF antibody C0008 and their non-Fc-silenced parent antibodies C0083 and C0090 using gel filtration (SEC) and hydrophobic interaction chromatography (HIC) using two different SEC columns and running buffer conditions.

[0223] For SEC, samples were diluted to 1 mg / ml in 1x phosphate buffered saline (1x PBS) and 100 μl of sample was applied to an Enrich 650 (Bio-Rad) gel filtration column at a flow rate of 1.25 ml / min. Separation and equilibration were performed in 1x PBS at room temperature. Protein peaks were monitored using absorbance at 280 nm and spectra were analyzed using the ChromLab software package (Bio-Rad). Results were reported as the retention volume of the main peak (Vr, ml) and the presence of aggregates was manually ranked.

[0224] For hydrophobic interaction chromatography (HIC) analysis, all samples were diluted to a final concentration of 1 mg / ml using 50 mM phosphate and 0.75 M ammonium sulfate, pH 6.9. Highly purified samples of antibodies (approximately 100 μg) were loaded independently onto a 1 ml HiTrap Butyl HP column. 100 μl of sample was injected and the column flow rate was maintained at 1 ml / min at 22 °C. Peak separation was performed with a 20 column volume (CV) gradient from 0 to 100% B (buffer B: 50 mM phosphate, 20% isopropanol; pH 7.0). Protein peaks were monitored using absorbance at 280 nm and spectra were analyzed using the ChromLab software package (Bio-Rad).

[0225] Results: The control antibody C0008 showed a retention volume close to the full volume of the size exclusion column (approximately 16-18 ml Enrich 650), which corresponds to a much smaller molecular weight than expected for human IgG (Figure 1A and B). The unusually long retention is mainly due to hydrophobic interactions with the stationary phase surface. Furthermore, at the high retention volume, there was a significant amount of IgG dimers and aggregates present for C0008. All the newly designed antibodies showed reduced retention volumes (Vr), demonstrating reduced interactions with the column and thus reduced hydrophobicity of the molecules (Table 6, Figure 1A and B). The newly designed antibodies C0115 and C0118 showed retention volumes corresponding to the molecular weight of monomeric human IgG when compared to the molecular weight standards (Table 6, Figure 1B). Furthermore, antibody dimers and aggregation were significantly reduced in the samples of the newly designed antibodies C0115 and C0118 (Figure 1B). The Fc silencing mutations of the newly designed antibodies C0115 and C0118 did not alter their SEC profile compared to their parent antibodies C0083 and C0090, respectively, with wtFc.

[0226] HIC column retention volume is a measure of hydrophobicity, with antibodies with low retention volumes being less hydrophobic than those with high retention volumes (Figure 1C). The newly designed antibodies C0115 and C0118 were shown to be less hydrophobic (retention volume 15-16 ml) compared to the control antibody C0008 (retention volume approximately 21 ml) which exhibited very high hydrophobicity. The Fc silencing mutations of the newly designed antibodies C0115 and C0118 did not alter their HIC profile compared to their parent antibodies C0083 and C0090 with wtFc, respectively.

[0227] Conclusion: It is evident from SEC and HIC analyses that the newly designed antibodies have improved biochemical properties, specifically reduced hydrophobicity and aggregation tendency, compared to the control anti-oxMIF antibody C0008.

[0228] [Table 8]

[0229] Figure 1 shows chromatographic profiles demonstrating the reduced aggregation and hydrophobicity of the newly designed anti-oxMIF antibodies. (A) Comparison of the elution profiles of C0008 (control antibody, grey area) and the parent antibodies (C0083 and C0090, without Fc silencing) of the newly designed antibodies C0115 and C0118 on an Enrich 650 gel filtration column using 1x PBS as the mobile phase; (B) Comparison of the elution profiles of C0008 (control antibody, grey area) and the newly designed antibodies C0115 and C0118 on an Enrich 650 gel filtration column using 1x PBS as the mobile phase; (C) Comparison of the elution profiles of C0008 (control antibody, grey area), the newly designed antibodies C0115 and C0118 and their parent antibodies C0083 and C0090 (without Fc silencing) on ​​a HiTrap Butyl HP HIC column.

[0230] Example 3: Binding of newly designed anti-oxMIF antibodies to immobilized MIF (K D decision). Recombinant human MIF at 1 μg / ml diluted in PBS was immobilized on ELISA plates overnight at 4 °C (MIF converted to oxMIF according to Thiele et al., 2015). After blocking, serial dilutions of anti-oxMIF antibodies were added to the plates. Finally, bound antibodies were detected using a goat anti-human IgG(Fc)-HRP conjugate and tetramethylbenzidine (TMB) as substrate. The color reaction was stopped with 3 M H2SO4 and OD was measured at 450 nm. Data from different experiments were normalized to the maximum OD (=100%) of anti-oxMIF antibody C0008 in the respective experiment and EC 50 Values ​​were determined by a four parameter fit using GraphPad Prism (means + / - SEM of two experiments are shown).

[0231] Results and conclusions: Binding of the newly designed antibodies to immobilized MIF (oxMIF) was measured over a wide range of concentrations and the resulting binding curves are shown in Figure 2. Anti-oxMIF antibody C0008 was used as a reference for oxMIF binding. Binding curves and K D Represents the calculated EC 50 The values ​​clearly showed that the newly designed antibodies C0115 and C0118 retained their low nanomolar affinity for oxMIF compared to C0008 (Figure 2, Table 7).

[0232] Figure 2 shows the binding curves (K D Anti-oxMIF antibodies were detected by anti-human IgG(Fc)-HRP conjugate, and C0008 was used as the reference antibody. EC 50 Values ​​were determined by a sigmoidal 4-parameter equation using GraphPad Prism (means + / - SEM of two experiments are shown).

[0233] [Table 9]

[0234] Example 4: Differential binding of newly designed anti-oxMIF antibodies to oxMIF compared to redMIF Anti-oxMIF antibodies and human IgG isotype controls were immobilized on microplates at a concentration of 15 nM overnight at 4°C. After blocking, wells were incubated with 50 ng / ml of redMIF or the oxMIF surrogate NTB-MIF (Schinagl et al., 2018). Captured oxMIF was detected by polyclonal rabbit anti-MIF antibodies and goat anti-rabbit IgG-HRP. Plates were stained with tetramethylbenzidine (TMB) and the color reaction was stopped by adding 30% H2SO4. OD was measured at 450 nm. Data from different experiments were normalized to the maximum OD (=100%) of anti-oxMIF antibody C0008 in the respective experiment and the mean + / - SEM of two or three experiments is shown.

[0235] Results and conclusions: Binding of the newly designed antibodies to soluble oxMIF and redMIF is shown in Figure 3. The results clearly showed that the newly designed antibodies C0115 and C0118 strongly bind to oxMIF but not to redMIF. The newly designed antibodies showed very similar OD to the reference antibody C0008, which was described to distinguish between oxMIF and redMIF (Thiele et al., 2015). No binding was observed with isotype IgG. Thus, the newly designed antibodies with reduced hydrophobicity and aggregation as well as Fc silencing retained their ability to distinguish between oxMIF and redMIF.

[0236] Figure 3 shows the differential binding of the newly designed antibodies to oxMIF compared to redMIF. C0008 was used as the reference antibody and isotype IgG as a negative control. Means + / - SEM of two or three experiments are shown.

[0237] Example 5: Strongly reduced effector functions of newly designed anti-oxMIF antibodies C0115 and C0118 determined by reporter assay As mentioned above, efforts have been made to reduce the ADCC and ADCP capabilities of antibodies by point mutations in the Fc portion, i.e., L234A / L235A. If the Fc portion of a target-binding antibody also binds to Fc receptors on the cell surface of effector cells, multiple cross-linking of the two cell types can occur, leading to ADCC or ADCP pathway activation, which is undesirable for a target-neutralizing antibody to prevent functional Fc-related adverse events.

[0238] Using engineered Jurkat cells stably expressing either human FcγRIIIa V158 (high affinity genotype) to determine ADCC or human FcγRIIa-H131 to determine ADCP as effector cells, and NFAT response element-driven expression of firefly luciferase, antibody biological activity was quantified by luciferase produced as a result of NF-AT pathway activation in effector cells.

[0239] ADCC or ADCP reporter assays were performed essentially as recommended by the manufacturer (Promega #G7010 and #G9991).

[0240] To generate highly responsive target cells, HCT116 and A2780 cells were transfected with the huMIF-pDisplay plasmid (Invitrogen), selected by geneticin, and sorted by FACS to generate cell lines (HCT116-pMIF or A2780-pMIF) stably expressing membrane-tethered monomeric human MIF, i.e., MIF is presented as a monomeric protein in which the oxMIF epitope is accessible to anti-oxMIF antibodies (Schinagl et al., Biochemistry 2018). These cell lines show increased presentation of oxMIF at the cell surface and are therefore sensitive tools for in vitro analysis. Briefly, 1 × 10 6 cells were cultured in 100 μl of culture medium (RPMI 1640 medium supplemented with Pen / Strept / L-Glutamine and 4% low IgG FBS) at 2°C for 1 h. 4Cells / well of HCT116-pMIF (Figures 4A and C) or A2780-pMIF (Figure 4B) cells were seeded into 96-well plates and allowed to adhere overnight in a humidified incubator at 37°C / 5% CO. The next day, culture medium was removed and replaced with 25 μl of fresh culture medium. 25 μl of serial dilutions of Fc-silenced newly designed anti-oxMIF antibodies C0115 and C0118, or their parental antibodies C0083, C0090, and control antibody C0008 with wtFc (final concentrations 0.01-100 nM) were added to 25 μl of Jurkat effector cells (Figure 4A-B, highly responsive genotype V158 FcγRIIIa receptor effector cells; Figure 4C, FcγRIIa receptor effector cells) at an effector to target cell ratio of approximately 6:1, and cells were incubated with antibodies and effector cells for 6 hours at 37 °C / 5 °C CO2 in a humidified incubator. Finally, the assay plate was equilibrated to room temperature and 75 μl of Bio-Glo Luciferase Reagent was added. Luminescence (RLU) was measured after 10-20 min incubation (0.5 s integration time) using a Tecan multiplate reader. Data (where appropriate) were fitted to a sigmoidal 4-parameter equation using GraphPad Prism (means + / - SD of two replicates are shown).

[0241] Results: The newly designed antibodies C0115 and C0118 with Fc silencing mutations did not show any activation of reporter cells in ADCC (Figure 4A-B) or ADCP (Figure 4C) reporter assays, whereas the control antibody C0008 (Figure 4B) and their parental antibodies with wtFc, C0083 and C0090 (Figure 4A) induced strong FcyRIIIa (ADCC, Figure 4A-B) or FcyRIIa (ADCP, Figure 4C) mediated activation of effector cells, as demonstrated in Figure 4A-C.

[0242] Conclusion: The newly designed mutants C0115 and C0118 carrying Fc silencing mutations (L234A / L235A) did not show either ADCC or ADCP initiation in reporter bioassays, thus they showed strongly reduced ADCC and ADCP effector functions.

[0243] FIG. 4 shows the strongly reduced effector function of the newly designed Fc-silenced antibodies C0115 and C0118 as determined by reporter assay. (A-B) ADCC reporter bioassay with the newly designed Fc-silenced antibodies C0115 and / or C0118 using engineered Jurkat effector cells stably expressing FcyRIIa and HCT116-pMIF (A) or A2780-pMIF (B) target cells compared to either the anti-oxMIF control antibody C0008 (B) or their parental antibodies C0083 and C0090 (A) with wtFc; (C) ADCP reporter bioassay with the newly designed Fc-silenced antibodies C0115 and / or C0118 using engineered Jurkat effector cells stably expressing FcyRIIa and HCT116-pMIF target cells compared to their parental antibodies C0083 and C0090 with wtFc. Data were fitted to a sigmoidal 4-parameter equation using GraphPad Prism (means + / - SD of two replicates are shown).

[0244] Example 6: Strongly reduced CDC function of the newly designed anti-oxMIF antibody C0115 as determined by complement-dependent cytotoxicity (CDC) assay This assay was performed to determine lysed cells resulting from antibody-driven complement-dependent cytotoxicity (CDC) induced by a newly designed anti-oxMIF antibody. Cytotoxicity was measured by the HiBiT detection assay (Promega), which quantifies the release of HiBiT-tagged proteins from target cells using a non-lytic detection reagent containing LgBiT (LargeBiT) and furimazine (substrate). HiBiT and LgBiT spontaneously assemble into functional NanoBiT® enzyme, which emits a quantifiable luminescent signal in the presence of substrate.

[0245] To generate highly responsive reporter target cells, HCT116 cells were transfected with HaloTag-HiBiT plasmid (Promega #CS1956B17), selected by blasticidin, and sorted as cell pools by FACS. The stable HiBiT-expressing cell pools were then transfected with huMIF-pDisplay plasmid (Invitrogen), selected by geneticin, and sorted by FACS to generate cell pools (HCT116-HiBiT-pMIF) stably expressing intracellular HiBiT and membrane-tethered monomeric human MIF, i.e., MIF is presented as a monomeric protein in which the oxMIF epitope is accessible to anti-oxMIF antibodies (Schinagl et al., Biochemistry 2018). These cell lines show increased presentation of oxMIF on the cell surface and are therefore sensitive tools for in vitro analysis.

[0246] Briefly, 1 × 10 cells were cultured in 100 μl of culture medium (RPMI 1640 medium supplemented with Pen / Strept / L-Glutamine and 10% FBS). 4HCT116-HiBiT-pMIF cells were seeded at 100 cells / well in a 96-well plate and allowed to adhere overnight in a humidified incubator at 37°C and 5% CO2. The next day, culture medium was removed and 50 μl of serum-free RPMI 1640 and 50 μl of serial dilutions of Fc-silenced newly designed anti-oxMIF antibody C0115 or its parental antibody C0083 with wtFc, and nivolumab (human IgG4, negative control) (final concentration 1-100 nM) in serum-free RPMI 1640 were added. After incubation of the antibodies with the cells for 30 min at 37°C, 50 μl of baby rabbit complement (BRC, Sedarlane, diluted 1:10 in serum-free RPMI immediately before the assay) were added to the plate. After complement addition, plates were incubated overnight at 37°C and 5% CO2 in a humidified incubator. The next day, 10 μl of Nano-Glo HiBiT Extracellular Detection Reagent (Promega #N2421) was added and luminescence signal (RLU, 0.1 s integration time) was measured 3 minutes later on a Tecan plate reader. Data (where appropriate) were fitted to a sigmoidal 4-parameter equation using GraphPad Prism (mean + / - SD of two replicates is shown).

[0247] Results and conclusions: Figure 5 clearly shows that the newly designed antibody C0115 with Fc silencing mutations (L234A / L235A) did not induce CDC activity and the measured signal was even lower than the negative control (Nivolumab, IgG4). In contrast, the parent antibody C0083 with wtFc showed complement-dependent cytolysis of HCT116-pMIF cells, as expected for human IgG1. Thus, the newly designed antibody C0115 with Fc silencing (L234A / L235A) mutations shows strongly reduced CDC activity.

[0248] Figure 5 shows the strongly reduced CDC activity of the newly designed Fc-silenced antibody C0115 as determined by complement-dependent cytotoxicity bioassay. CDC bioassay with the newly designed Fc-silenced antibody C0115 using BRC as a source of complement and HCT116-pMIF as target cells was compared to its parent anti-oxMIF antibody C0083 with wtFc and nivolumab as IgG4 negative control. Data (where appropriate) were fitted to a sigmoidal 4-parameter equation using GraphPad Prism (mean + / - SD of two replicates is shown).

[0249] Example 7: Strongly reduced ADCC function of newly designed anti-oxMIF antibodies C0115 and C0118 as determined by PBMC cytolytic bioassay This assay was performed to determine cell lysis resulting from antibody-dependent cellular cytotoxicity (ADCC) induced by a newly designed anti-oxMIF antibody. Cytotoxicity was measured by the HiBiT detection assay (Promega), which uses a non-lytic detection reagent containing LgBiT (LargeBiT) and furimazine (substrate) to quantify the release of HiBiT-tagged proteins from target cells. HiBiT and LgBiT spontaneously assemble into functional NanoBiT® enzymes, which emit a quantifiable luminescent signal in the presence of substrate.

[0250] HCT116-HiBiT-pMIF reporter target cells were generated as described in Example 6.

[0251] Briefly, 1 × 10 cells were cultured in 50 μl of culture medium (RPMI 1640 medium supplemented with Pen / Strept / L-Glutamine and 5% ultra-low IgG FBS (Thermo Scientific)). 4HCT116-HiBiT-pMIF target cells were seeded at 100 cells / well in a 96-well plate and allowed to adhere overnight in a humidified incubator at 37 °C / 5% CO2. The next day, cells were incubated with serial dilutions of the Fc-silenced newly designed anti-oxMIF antibodies C0115 and C0118 or parental antibody of C0115 (C0083 with wtFc), and / or reference antibody C0008 with wtFc (final concentrations 0.01-100 nM) in 50 μl of culture medium and 50 μl of human PBMC effector cells (4 × 10 5 Cells / well; effector to target cell ratio of 40:1) were added to the plates. After antibody and PBMC addition, plates were incubated overnight at 37°C and 5% CO2 in a humidified incubator. The next day, 10 μl of Nano-Glo HiBiT Extracellular Detection Reagent (Promega #N2421) was added and luminescence signal (RLU, integration time 0.1 s) was measured 3 min later on a Tecan plate reader.

[0252] Results and conclusions: It is clear from Figure 6 that the newly designed antibodies C0115 and C0118 with Fc silencing (L234A / L235A) mutations show no or strongly reduced ADCC activity. In contrast, the parent antibody of C0115 (C0083, with wtFc) and the control anti-oxMIF antibody C0008 with wtFc showed antibody-dependent cell lysis of HCT116-HiBiT-pMIF cells, as expected for human IgG1. Thus, the newly designed antibody C0115 with Fc silencing (L234A / L235A) mutations shows strongly reduced ADCC activity.

[0253] Figure 6 shows the strongly reduced ADCC activity of the newly designed Fc-silenced antibodies C0115 and C0118 as determined by PBMC-mediated cytotoxicity bioassay. ADCC bioassay with the newly designed Fc-silenced antibodies C0115 (A) and C0118 (B) using PBMC as effector cells and HCT116-HiBiT-pMIF as target cells was compared with anti-oxMIF control antibody C0008 (B) and parental anti-oxMIF antibody of C0115 with wtFc, i.e., C0083 (A). Mean and SEM of two replicates using PBMC from two healthy donors are shown. Data was fitted to a sigmoidal 4-parameter equation using GraphPad Prism.

[0254] Example 8: A2780 MIF - / - Reduced non-specific binding of newly designed anti-oxMIF antibodies C0115 and C0118 to cells Materials and Methods. A2780MIF - / - The cell line was generated by CRISPR / Cas9 gene editing of the human MIF gene in the A2780 ovarian cancer cell line. Briefly, the target gene sequence was analyzed, and the target site was located according to the usual rules for designing the targeting guide RNA (gRNA) of the GenCRISPR™ system. The guide RNA (gRNA) was designed to specifically recognize the 5' region of the MIF gene (TTGGTGTTTACGATGAACATCGG, SEQ ID NO: 40), and the gRNA sequence was cloned into the PX459 (addgene) vector containing the S.pyogenes Cas9 (SpCas9) nuclease. The A2780 cells were transiently transfected by electroporation and plated into 96-well plates by limiting dilution to generate isogenic single clones. The isogenic single clones in which the endogenous MIF gene was effectively mutated, resulting in the reduction (or elimination) of the expression of MIF protein, were identified by Sanger sequencing screening. The final clone showed a 10 bp deletion at position +2 after the start codon of the human MIF gene. A2780MIF - / -The absence of endogenous human MIF protein in the cell lines was confirmed by Western blotting using a polyclonal anti-human MIF antibody.

[0255] A2780MIF - / - The cells were detached using a Cell Stripper (Corning, Cat#25-056-C1), washed with staining buffer (PBS+5% BSA), and plated in a 96-well U-bottom plate at 2 × 10 cells per well. 5 Cells were plated. Cells were stained with fixable viability dye eFluor780 (ThermoFisher, 1:2000 dilution in PBS) for 20 min at 4°C and washed with staining buffer. Cells were resuspended in 50 μl staining buffer and 50 μl of serial dilutions of newly designed anti-oxMIF antibodies C0115 and C0118 or their parental antibodies C0083 and C0090, respectively, or control anti-oxMIF antibody C0008 or isotype IgG (final concentration 37 nM-9.4 nM) were added. After 40 min incubation at 4°C, cells were washed with staining buffer and resuspended in 100 μl of secondary antibody (goat anti-human IgG (H+L)-AlexaFluor488, 1:100 dilution). After 30 min incubation at 4° C., cells were washed with staining buffer, resuspended in PBS+2% BSA, and acquired on a CytoFlex-S flow cytometer (Beckman Coulter).

[0256] Data was analyzed using FlowJo (BD), and GeoMean (mean fluorescence intensity in the AF488 channel) of viable cells was plotted against antibody concentration in GraphPad Prism.

[0257] Results and conclusions: The newly designed anti-oxMIF antibody C0118 and its parent antibody C0090 (A) and C0118 and its parent antibody C0083 (B) significantly improved the A2780 MIF activity, as their GeoMeans are very close to those of the isotype IgG negative control. - / - As can be seen from Figures 7A and B, the anti-oxMIF antibody C0008 did not bind to A2780MIF cells.- / - The A2780MIF antibody showed significant binding to cells that did not express MIF. Thus, the reduction in hydrophobicity - / - This resulted in a strong reduction or elimination of non-specific binding of the newly designed anti-oxMIF antibodies to the cell surface, whereas the anti-oxMIF control antibody C0008 binds non-specifically to the cell surface due to its hydrophobicity.

[0258] Figure 7. A2780 MIF determined by FACS - / - Reduced non-specific binding of the newly designed anti-oxMIF antibodies to cells. A2780 MIF with the newly designed anti-oxMIF antibodies C0118 and its parent antibody C0090 (A) and C0115 and its parent antibody C0083 (B) and control antibody C0008 and isotype IgG as a negative control. - / - Cell staining; GeoMean (mean fluorescence intensity in the AF488 channel) of viable cells was plotted against antibody concentration.

[0259] Example 9: Strongly reduced non-specific cytokine release from human PBMCs by the newly designed anti-oxMIF antibody C0115 Cytokine release syndrome (CRS) is a form of systemic inflammatory response syndrome (SIRS) that can be triggered by various factors, e.g., infection. CRS is also known as an adverse effect of some monoclonal antibody drugs. CRS occurs when many leukocytes, including B cells, T cells, natural killer cells, macrophages, dendritic cells, and monocytes, become activated and release inflammatory cytokines such as IL-6, IFN-γ, IL-8, MCP-1, etc., which activate more leukocytes in a positive feedback loop of pathogenic inflammation. This process, when dysregulated, can be life-threatening due to systemic hyperinflammation, hypotensive shock, and multiple organ failure. Therefore, the newly designed anti-oxMIF antibody C0115 was evaluated for its ability to release inflammatory cytokines from PMBCs in an in-vitro assay.

[0260] Materials and Methods: The newly designed anti-oxMIF antibody C0115 and the anti-oxMIF reference antibody C0008 were incubated with freshly thawed PBMCs (4–5 × 10 per well) from three healthy donors in RPMI 1640 medium supplemented with 150 μl of 5% ultra-low IgG serum in 96-well plates. 5 Cells were incubated with 100μg / ml PBS (100μg / ml) or with medium alone at 70nM, 7nM, 0.7nM, 0.07nM. After overnight incubation at 37°C / 5%CO2 in a humidified incubator, plates were centrifuged at 300×g for 5 min to pellet cells and clarified supernatants were transferred to 96-well V-bottom plates (BioLegend). Supernatants were analyzed for human MCP-1, human IL-6, and human TNF-α by BioLegend LegendPlex cytometric bead assays according to the manufacturer's protocol. Measurements were performed on a CytoFlex-S cytometer with a 96-well plate loader (Beckman Coulter). The bead sorting channel was APC (excitation from a 638nm laser, bandpass filter 660 / 10nm) whereas the reporter channel was PE (excitation from a 561nm yellow laser, bandpass filter 585 / 42nm). Data were analyzed using LegendPlex analysis software (BioLegend) and graphs were generated in GraphPad Prism. Means + / - SEM from three different PMBC donors are shown.

[0261] Results and conclusions: It is evident from Figure 8 that the newly designed antibody C0115 with manufacturing mutations in the variable region and Fc silencing mutations (L234A / L235A) showed undetectable or only slight release of MCP-1, IL-6 and TNF-α from PBMCs at concentrations up to 70 nM. The reference anti-oxMIF antibody C0008 induced significant release of MCP-1, IL-6 and TNF-α at the highest concentration (70 nM), consistent with its high aggregation tendency and non-specific binding due to its hydrophobicity. Aggregation of antibody therapeutics, even if only slightly, is known to strongly enhance cytokine release from immune cells.

[0262] Figure 8 shows that the newly designed anti-oxMIF antibody C0115 shows a strongly reduced cytokine release from human PBMCs compared to the reference antibody C0008. Anti-oxMIF antibody C0115 with Fc silencing mutations and the reference anti-oxMIF antibody C0008 were incubated overnight with human PBMCs over a broad concentration range (70 nM, 7 nM, 0.7 nM, 0.07 nM) and the supernatants were analyzed for human MCP-1 (A), human IL-6 (B) and human TNF-α (C) in a LegendPlex cytometric bead assay (BioLegend). Mean + / - SEM of cytokine concentrations (in pg / ml) from three different PBMC donors are shown.

[0263] Example 10: Biodistribution of the newly designed anti-oxMIF antibody C0115 and control antibody C0008 in Balb / c nude mice bearing xenografted human HCT116 colon cancer tumors Materials and Methods: The biodistribution of the newly designed anti-oxMIF antibody C0115 was investigated in female Balb / c nude mice bearing subcutaneous tumors of human colon cancer cells HCT116, in comparison with the reference anti-oxMIF antibody C0008. Female Balb / c nude mice were injected with 5 × 10 6 Each mouse received a subcutaneous injection of HCT116 cells. The individual tumor volumes ranged from 150 to 300 mm. 3 Once this was reached, mice were assigned to treatment groups and received a single intravenous dose of 5 mg / kg IRDye 800CW-labeled C0115 and C0008.

[0264] C0115 and C0008 were labeled with IRDye800CW using the IRDye800CW Protein Labeling Kit (High MW, LI-COR Biosciences) according to the manufacturer's instructions. After the labeling process and before injection of the labeled antibody into the mice, the protein concentration and labeling efficiency of the IRDye800CW labeled antibody were determined using Nanodrop technology, and the mice were dosed based on the protein concentration after labeling. In vivo imaging was performed on a LI-COR Pearl® Trilogy imaging device at the time of administration of the labeled antibody at the following time points: 1, 6-8, 24, 48, 72, 96, 168 hours post-administration. Image analysis was performed to quantify the relative fluorescence units (RFU) of the antibody in the tumor (RFU / area = RFU tumor area / mm2). 2 Tumor area-RFU background / mm 2 background area).

[0265] Results and Conclusions: Figure 9 shows significant intratumoral distribution of intravenously administered IRDye 800CW labeled C0115 and C0008, respectively, with tumor retention up to 7 days. Compared to the reference anti-oxMIF antibody C0008, which peaked at approximately 24 hours, it is evident from Figure 9(A) and quantitative image analysis (Figure 9(B)) that the tumor uptake of the newly designed anti-oxMIF antibody C0115 is strongly enhanced and increased over 7 days.

[0266] Figure 9 shows tumor penetration and retention of the newly designed anti-oxMIF antibody C0115 and reference antibody C0008 by infra-red in vivo imaging of mice bearing subcutaneous HCT116 tumors. A: Infra-red images of mice were taken 1, 6, 24, 48, 72, 96 and 168 hours after injection of IRDye 800CW labeled antibodies C0115 (upper panel) and C0008 (lower panel) dosed at 5 mg / kg; (B) Tumor penetration and retention of C0115 and C0008 quantified by digital image analysis. Average of 3 mice is shown.

[0267] Example 11:

[0268] [Table 10-1]

[0269] [Table 10-2]

[0270] [Table 10-3]

[0271] [Table 10-4]

[0272] [Table 10-5]

[0273] Example 12: Efficacy of C0115 antibody in a collagen II-induced arthritis (CIA) mouse model Materials and Methods: Male DBA / 1j (Harlan Laboratories, Italy) mice aged 8-9 weeks (weight range: 18-20 grams) were used in this study. Bovine type II collagen (CII; Chondrex, USA) was dissolved at 2 mg / ml in 0.05 M acetic acid by gentle stirring overnight at 4°C. CFA (complete Freund's adjuvant) was prepared by adding Mycobacterium tuberculosis H37Ra (Difco, Detroit, MI) to IFA (incomplete Freund's adjuvant, Sigma Aldrich, Milano, Italy) at a concentration of 2 mg / ml. Before injection, CII was emulsified with an equal volume of CFA. To induce CIA, mice were injected intradermally at the base of the tail with 100 μl of the resulting emulsion containing CII and CFA (100 μg / mouse). On day 21, a second boost of 100 μl of CII in IFA (100 μg / mouse) was administered. At the onset of disease (arthritis score ranging between 1 and 2), mice were treated twice weekly (ip) for 20 days with vehicle, isotype control IgG1 (40 mg / kg), C0115 (20 mg / kg), or injected daily with standard of care dexamethasone (0.3 mg / kg). At the end of treatment, animals were euthanized, blood collected, and tissues (front and hind paws) harvested. Clinical severity of arthritis was assessed by monitoring body weight and paw thickness (all four paws, using a pachymeter) twice weekly. Paw thickness index was determined by calculating the area under the curve (AUC) of the sum of the thickness of each of the four paws for each mouse during treatment. The arthritis score of the four paws of each mouse ranges from 0 to 4 and is scored as follows: 0 = no signs of arthritis; 1 = swelling and / or redness of the paw or one toe; 2 = affection of two joints; 3 = affection of more than two joints; 4 = severe arthritis of the entire paw and toes (resulting in a maximum score of 12 per mouse). The cumulative disease score for each mouse was calculated for each individual mouse by summing the scores over the treatment period. Calculations were performed in GraphPad Prism and statistical analysis used ordinary one-way ANOVA followed by Fisher's LSD test.

[0274] Results and Conclusions: Figure 10 shows that treatment with C0115 at 20 mg / kg resulted in significant improvements in disease score (A) and paw edema (B) compared to the vehicle-treated group. These effects (particularly the reduction in paw thickness) were comparable to treatment with high doses of the standard of care corticosteroid drug dexamethasone (0.3 mg / kg). The isotype control (IgG)-treated group did not experience a reduction in disease score. All treatment groups experienced similar changes in body weight over the course of the disease.

[0275] FIG. 10 shows that the newly designed Fc-silenced anti-oxMIF antibody C0115 ameliorates disease severity in a collagen II-induced DBA / 1j mouse arthritis model. Cumulative disease score (A) and paw thickness (B) were assessed in a mouse arthritis model upon treatment with C0115 (20 mg / ml), high-dose dexamethasone (0.3 mg / kg) as standard of care corticosteroid drug, or vehicle. Statistical analysis was performed using ordinary one-way ANOVA followed by Fisher's LSD test in GraphPad Prism V9.4 ( * p < 0.05; ** p < 0.01; *** p<0.001).

[0276] Example 13: Efficacy of C0115 antibody in a rat model of glomerulonephritis (GN) Materials and Methods: The efficacy of the newly designed Fc-silenced anti-oxMIF antibody C0115 was evaluated in NTN in WKY rats. This model has a rapid onset of disease with macrophage infiltration, fibrin deposition, and tissue destruction (Tam FWK.et al.,1999). The time course and morphology of this model are very similar to crescentic glomerulonephritis in humans. This model is very robust, and all animals develop nephritis after induction by injection of nephrotoxic serum (NTS). Glomerulonephritis was induced by intravenous injection of 100 μl of rabbit anti-rat NTS (nephrotoxic serum) in male WKY rats (weight range: 190-220 grams). On days 4 and 6 after NTS injection, animals were treated (ip) with vehicle, isotype control IgG1, or C0115 (30 mg / kg). Urine was collected on days 0 (baseline), 4 (onset of disease) and 7 (post-treatment). At the end of the study (day 8), animals were euthanized and blood and tissues (kidneys, liver, spleen and lungs) were collected. Histological (crescent counts; ED-1 macrophage staining, rat and rabbit IgG deposition) and biochemical (proteinuria and hematuria) analyses were performed to assess disease severity. Statistical analysis used ordinary one-way ANOVA followed by Dunnett's correction for multiple testing in GraphPad Prism V9.4 ( * p<0.05, ** p < 0.01; *** p<0.001, **** p<0.0001).

[0277] Results and Conclusions: Treatment with C0115 (30 mg / kg) significantly ameliorated disease as evidenced by reductions in hematuria, proteinuria, and glomerular macrophage infiltration compared to the vehicle-treated group (Figure 11). Treatment with isotype control IgG did not reduce hematuria compared to the vehicle group.

[0278] FIG. 11 shows that the newly designed Fc-silenced anti-oxMIF antibody C0115 ameliorates disease severity in a nephrotoxic serum (NTS)-induced rat glomerulonephritis model. Urinary hematuria (dipstick) (A), proteinuria (B), and glomerular macrophage infiltration (C) were assessed upon treatment of diseased rats with anti-oxMIF antibody C0115, isotype control IgG1, or vehicle in a rat glomerulonephritis model. Means ± SEM are shown and statistical analysis used ordinary one-way ANOVA followed by Dunnett's correction for multiple testing in GraphPad Prism V9.4 ( * p<0.05, *** p<0.001, **** p<0.0001).

[0279] Example 14: Binding of bispecific antibodies (bsMab) C0132 and C0133 (anti-oxMIF x anti-HSG) to oxMIF Materials and Methods: Recombinant human MIF at 1 μg / ml diluted in PBS (MIF converted to oxMIF according to Thiele et al., 2015) was immobilized on ELISA plates overnight at 4° C. After blocking, serial dilutions of antibodies were added to the plates and ELISA was performed as described in Example 3.

[0280] Results and conclusions: Binding of C0132 and C0133 antibodies to immobilized MIF (oxMIF) was measured over a range of concentrations and the resulting binding curves are shown in Figure 13. Anti-oxMIF antibody C0008 was used as a reference antibody for bivalent oxMIF binding. Binding curves and calculated EC 50 Values ​​indicate that C0133, a bsMab with two anti-oxMIF arms, binds oxMIF with similar affinity to C0008 (EC 50 = 242 pM (C0133) and 158 pM (C0008)), whereas bsMab C0132, which has only one anti-oxMIF arm, has a higher EC 50 The binding was clearly demonstrated with a value of (2508 pM).

[0281] Figure 12: Schematic diagram of the newly designed Fc-silenced anti-oxMIF x anti-HSG bispecific antibodies (bsMabs), C0132 (Fab / scFv-Fc) and C0133 (Fab / Fab-scFv-Fc).

[0282] Figure 13 shows the binding curves of newly designed Fc-silenced anti-oxMIF x anti-HSG bsMabs C0132 and C0133 to immobilized oxMIF. Bound antibodies were detected by anti-human IgG(Fc)-HRP conjugate, and C0008 was used as a reference antibody for bivalent binding to oxMIF. Data were fitted to a sigmoidal 4-parameter equation using GraphPad Prism (mean + / - SEM of two replicates is shown).

[0283] Example 15: Differential binding of C0132 anti-oxMIF x anti-HSG bsMab and C0133 anti-oxMIF x anti-HSG bsMab to oxMIF compared to redMIF Materials and Methods: Anti-oxMIF x anti-HSG bsMabs C0132 and C0133, reference anti-oxMIF mAb C0008, and human IgG1 isotype control were immobilized on microplates overnight at 4°C (oxMIF bivalent antibody at 15 nM, oxMIF monovalent antibody at 30 nM). After blocking, wells were incubated with 50 ng / ml (~1.3 nM) redMIF or the oxMIF surrogate NTB-MIF (Schinagl et al., 2018). Captured oxMIF was detected with polyclonal rabbit anti-MIF antibody and goat anti-rabbit IgG-HRP. Plates were stained with tetramethylbenzidine (TMB) and the color reaction was stopped by adding 30% H2SO4. OD was measured at 450 nm.

[0284] Results and conclusions: Binding of C0132 and C0133 to soluble oxMIF and redMIF is shown in Figure 14. The results clearly showed that both C0132 and C0133 strongly bind to oxMIF but not to redMIF. The newly designed antibodies showed very similar OD values ​​to the reference antibody C0008, which was described to distinguish between oxMIF and redMIF (Thiele et al., 2015). No binding was observed with isotype IgG. Thus, the anti-oxMIF x anti-HSG bsMabs C0132 and C0133 retained the ability to distinguish between oxMIF and redMIF.

[0285] Figure 14 shows differential binding of newly designed Fc-silenced anti-oxMIF x anti-HSG bsMabs C0132 and C0133 to oxMIF compared to redMIF. C0008 was used as the reference anti-oxMIF antibody. Means and SEM of three replicates are shown.

[0286] Example 16: Biodistribution of newly designed Fc-silenced anti-oxMIF x anti-HSG bsMabs C0132 and C0133 in Balb / c mice bearing syngeneic CT26 colon tumors

[0287] Materials and Methods: The biodistribution of the newly designed Fc-silenced anti-oxMIF x anti-HSG bsMabs C0132 and C0133 was investigated in female Balb / c mice bearing subcutaneous tumors of the murine colon cancer CT26 cell line. Female Balb / c mice were injected with 3 × 10 6 Each mouse received a subcutaneous injection of CT26 cells. The individual tumor volumes ranged from 150 to 300 mm. 3 Once this was reached, mice were assigned to treatment groups and received a single intravenous dose of 5 mg / kg IRDye 800CW-labeled C0132 or IRDye 800CW-labeled C0133 or no treatment (control group).

[0288] C0132 and C0133 were labeled with IRDye800CW using the IRDye800CW Protein Labeling Kit (high MW, LI-COR Biosciences) according to the manufacturer's instructions. After the labeling process and before injection of the labeled antibody into the mice, the protein concentration and labeling efficiency of the IRDye800CW labeled antibody were determined using Nanodrop technology, and the mice were dosed based on the protein concentration after labeling. In vivo imaging was performed on a LI-COR Pearl® Trilogy imaging device (performed at an excitation wavelength of 785 nm and an emission wavelength of 820 nm) upon administration of the labeled antibody at the following time points: 1 hour, 8 hours, 24 hours, 48 ​​hours, 72 hours, 96 hours, and 168 hours after administration.

[0289] Results and Conclusions: Figure 15 shows significant intratumoral distribution of intravenously administered IRDye 800CW labeled C0132 and C0133, respectively, with tumor retention up to day 7. It is evident from Figure 15 that the infrared signal observed in the tumor was above background at 1 hour post-injection and all subsequent imaging time points, indicating preferential accumulation of the antibody in the tumor.

[0290] Figure 15 shows tumor penetration and retention of newly designed Fc-silenced anti-oxMIF x anti-HSG bsMabs C0132 and C0133 as assessed by infra-red in vivo imaging in mice bearing subcutaneous syngeneic CT26 tumors. Infra-red images of mice were taken at 1, 8, 24, 48, 72, 96 and 168 hours after injection of IRDye 800CW labeled antibody dosed at 5 mg / kg.

[0291] Example 17: Anti-oxMIF x anti-HSG bispecific antibodies (bsMabs) C0132 and C0133 in a syngeneic CT26 colon cancer mouse model in Balb / c mice 177 Pretargeted Radioimmunotherapy (PRAIT) using Lu-labeled IMP288

[0292] In this example, the efficacy of the newly designed Fc-silenced bispecific anti-oxMIF x anti-HSG antibodies C0132 and C0133 was evaluated using the HSG hapten IMP288 (as described in US2005 / 0025709) and the radionuclide IMP288 as a marker. 177 IMP288 was evaluated using the PRAIT approach with IMP288, a DOTA-conjugated D-Tyr-D-Lys-D-Glu-D-Lys-NH2 tetrapeptide in which both lysine residues are derivatized with HSG moieties via the ε-amino groups (Figure 16A). The DOTA chelating group of IMP288 is 177 It is specifically designed for use with radiometals, including Lu.

[0293] Materials and Methods: The in vivo efficacy of pre-RAIT was evaluated in Balb / c mice bearing subcutaneous CT26 murine colorectal cancer tumors. IMP288 (Genepep, France) has a specific activity of approximately 220MBq / nmol. 177 The IMP288 was labeled with 1111 Lu and showed a radiochemical purity (RCP) of 95% or higher. Briefly, IMP288 was diluted with sterile water to a final concentration of 1 mM (1.45 mg / ml). A 1 / 10 dilution of the IMP288 stock solution was performed in 2-(N-morpholino)ethanesulfonic acid (MES) buffer (500 mM, pH 5.5). 5 mCi (185 MBq) in 0.04 N HCl was added. 177 LuCl3 (EndolucinBeta®, ITG, Germany) was added to the radiolabeling vial, followed by the addition of 40 μl of MES buffer (250 mM, pH 5.5) and 0.84 nmol of diluted IMP288 solution (8.4 μl). The reaction mixture was incubated at 95° C. for 15 min. Afterwards, 5 μl of 10 mM diethylenepenta-diaminetetraacetic acid sodium salt (DTPA-Na) was added to remove unincorporated IgG. 177Lu was complexed and the solution was diluted to 370 MBq / mL in 0.9% NaCl / 10 g / L ascorbate / 0.05% (m / v) BSA. Chelation efficiency and binding to C0132 and C0133 were analyzed by iTLC (instant Thin Layer Chromatography, Agilent Technology, SGI001). Briefly, 1.68 nmol / ml of Lu was complexed, which corresponds to 220 MBq / nmol and 0.084 nmol of IMP288. 177 50 μl of Lu-IMP288 solution was mixed with a 10-fold molar excess of each bsMab (0.84 nmol). Each reaction was incubated at 37° C. for 30 min under gentle agitation. 177 Lu-IMP288 solution and 177 The Lu-IMP288-bsMab solution was applied to an iTLC strip and eluted with a 1:1 (v / v) solution of 0.15 M ammonium acetate (pH 5.5):MeOH. After elution, the iTLC plate was exposed to a phosphorus screen (MS, BAS-IP, Fujifilm 2025) and revealed using a Typhoon IP (Amersham) and associated software ImageQuant TL version 8.2.

[0294] CT26 murine colorectal carcinoma (ATCC-CRL-2638) cells were expanded at 37°C / 5% CO2 in RPMI 1640 medium supplemented with 10% heat-inactivated FBS and 2 mM glutamine. A suspension of CT26 cells was prepared at 10 × 10 6 Balb / c mice were treated with 1 × 10 viable cells / mL of PBS. 6 CT26 cells were injected subcutaneously into the right flank. 3 Once the immunization time reached 1 h (approximately 7-9 days post-inoculation), mice were randomly assigned to treatment groups with 10 mice per group. Antibodies (C0132 or C0133) were injected intravenously at 5 mg / kg on the day of randomization (day -3). 177Lu-IMP288 was administered by intravenous route at a 10:1 bsMAb / HSGIMP288 hapten molar ratio (approximately 4 nmol / kg C0132 bsMAb or approximately 3 nmol / kg C0133 bsMab, corresponding to 18.5 MBq, respectively) 3 days after the injection of the bispecific mAb (day 0). Additionally, a control group received 37 MBq of Lu-IMP288 on day 0 without any prior treatment. 177 Either Lu-IMP288 or vehicle was administered. Tumor volumes and body weights were monitored up to day 21 or when the mice reached 1000 mm 3 Tumor volumes were measured every 2-3 days until the humane endpoint was reached, and survival percentages were determined. Relative tumor volumes (tumor volume on day 0 = 100%), relative body weights (body weight on day 0 = 100%), and Kaplan-Meier survival curves (units: survival percentages) for each treatment group were plotted against time using GraphPrism software. Statistical analysis was performed in GraphPad Prism V9.4 using ordinary one-way ANOVA, with Dunnett's correction for multiple testing.

[0295] Results and conclusions: FIG. 177 Lu-IMP288 and 177 The iTLC profile for Lu-IMP288-bsMab is revealed. As shown in Figure 16B, 177 A shift in the migration profile for Lu-IMP288 was observed after incubation with bsMabs C0132 and C0133. 177 Lu-IMP288 was confirmed to be bound by the bsMabs. Both bsMabs showed >94% binding, calculated from pixel intensities revealed by ImageQuant TL version 8.2. 177 Lu-IMP288 peptide was bound.

[0296] As shown in Figures 17A-B, PRAIT using 5 mg / kg of Fc-silenced anti-oxMIF x anti-HSG bsMab C0132 and 18.5 MBq of IMP288 resulted in potent and significant tumor growth inhibition (Figure 17A) that was sustained throughout the 21-day monitoring period (100% survival, Figure 17B). Statistical analysis (ordinary one-way ANOVA with Dunnett's correction for multiple testing; ** p<0.01) was performed only on day 8 because almost half of the animals in the vehicle group had to be sacrificed after day 8 due to excessive tumor growth, and 177 Lu-IMP288 treatment group 177 Lu-IMP288 group. Moreover, FIG. 17C shows that PRAIT using C0132 was well tolerated as it did not result in substantial weight loss throughout the entire monitoring period (21 days). As can be seen from FIG. 18, PRAIT using 5 mg / kg of bsMab C0133 and 18.5 MBq of IMP288 resulted in potent and significant tumor growth inhibition. Statistical analysis (ordinary one-way ANOVA with Dunnett's correction for multiple testing; *** p<0.001) was performed only on day 8 because almost half of the animals in the vehicle group had to be sacrificed after day 8 due to excessive tumor growth, and 177 Lu-IMP288 treatment group 177 Lu-IMP288 group. In summary, these results highlight the potency of Fc-silenced anti-oxMIF x anti-HSG bsMab combined with radiolabeled HSG hapten as PRAIT. FIG. 16 shows: (A) the structure of HSG hapten IMP288 and (B) the structures of C0132 and C0133 of bsMab. 177 Binding to the Lu-IMP288 peptide, assessed by iTLC, upon incubation with bsMab 177 Based on the changes in the migration profile of Lu-IMP288, 177 The migration profile was compared with that of the Lu-IMP288 peptide alone.

[0297] FIG. 17 shows PRAIT of syngeneic CT26 murine colorectal cancer in Balb / c mice with Fc-silenced anti-oxMIF×anti-HSG bsMab C0132. C0132 was administered on day −3 followed by administration 3 days later (day 0). 177 Lu-IMP288 was administered. (A) Tumor volume (unit: %) relative to tumor volume measured on day 0; mean ± SEM is shown (n = 10 max). Statistical analysis was performed in GraphPad Prism V9.4 using ordinary one-way ANOVA with Dunnett's correction for multiple testing; ** p<0.01 vs. 177 (B) Kaplan-Meier survival curve (unit: percent survival (%)), (C) body weight relative to body weight measured on day 0 (unit: %).

[0298] FIG. 18 shows PRAIT of syngeneic CT26 murine colorectal cancer in Balb / c mice with Fc-silenced anti-oxMIF×anti-HSG bsMab C0133. C0133 was administered on day −3 followed by administration 3 days later (day 0). 177 Lu-IMP288 was administered. The figure shows tumor volume (in %) relative to the tumor volume measured on day 0. Mean ± SEM is shown (n = 10 max). Statistical analysis was performed in GraphPad Prism V9.4 using ordinary one-way ANOVA with Dunnett's correction for multiple testing; *** p<0.001 vs. 177 Lu-IMP288.

[0299] Example 18: Anti-oxMIF x anti-HSG bispecific antibody (bsMab) C0132 and 5 days after C0132 application in a syngeneic CT26 colon cancer mouse model in Balb / c mice 177 Pretargeted Radioimmunotherapy (PRAIT) using Lu-labeled IMP288

[0300] In this example, the efficacy of the newly designed Fc-silenced bispecific anti-oxMIF x anti-HSG antibody C0132 was evaluated using the HSG hapten IMP288 (as described in US2005 / 0025709) and the radionuclide . 177 Together with Lu, the PRAIT approach was used for evaluation.

[0301] Materials and Methods: The in vivo efficacy of RRAIT was evaluated in Balb / c mice bearing subcutaneous CT26 murine colorectal cancer tumors. The study was performed as described in Example 16, with some modifications. Briefly, Balb / c mice (Balb / c ByJ, Janvier Labs, France) were cultured with 1 × 10 IgG1-positive mice suspended in 100 μL of PBS. 6 CT26 cells were injected subcutaneously into the right flank. Tumor growth was monitored by visual observation and palpation until 7 days after inoculation. In vivo treatment studies showed that tumor sizes were approximately 100–200 mm in the three treatment groups (10 mice per group). 3 and one control group (10 mice per group) at approximately 400–500 mm 3 The bsMab C0132 was injected iv at two doses: 2.5 mg / ml and 5 mg / ml, while 177 Lu-labeled IMP288 was injected iv 5 days (vs. 3 days in Example 16) after administration of C0132 (day 0). Keeping the C0132 / radiolabelled HSG IMP288 hapten molar ratio constant at 10 / 1 (same as in Example 16) 177 Lu-labeled IMP288 was administered at 2 nmol / kg (9.3 MBq) and 4 nmol / kg (18.5 MBq), respectively. The control group consisted of mice that were not pretreated with bsMab on day 0. 177The mice consisted of one cohort administered Lu-IMP288 at 8 nmol / kg (37 MBq). Animals were assessed for body weight and tumor volume every 2-3 days for 21 days after administration. Tumor volume was determined by measuring the length, width, and depth of the tumor using digital calipers. Tumor volume was calculated using the following formula: tumor volume = (length x width x depth) x 0.5. Mice were kept for up to 21 days or until the mice reached the pre-defined experimental endpoint: tumor volume >1500 mm 3 The mice were monitored until they reached >20% body weight loss or reached >20% body weight loss. Relative tumor volumes (tumor volume on day 0 = 100%) for each treatment group, and Kaplan-Meier survival curves (units: survival percentage) were plotted against time using GraphPad Prism software. Statistical analysis (ordinary one-way ANOVA with Dunnett's correction for multiple testing, * p<0.05, ** p<0.01, *** p<0.001) in the control group ( 177 Lu-IMP288, no bsMab) had to be sacrificed after day 11 due to excessive tumor growth, so only days 8 and 10 were performed using GraphPad Prism, and each of the two C0132 treatment groups was compared with the control group ( 177 Lu-IMP288 only, no bsMab).

[0302] Results and Conclusions: It is evident from Figure 19 that pre-targeted treatment with C0132 at 2.5 and 5 mg / ml resulted in significant tumor regression (Figure 19A) and survival benefit (Figure 19B). The best survival percentage (100%) was achieved when C0132 was administered at 5 mg / ml, which was sustained for up to 21 days of monitoring.

[0303] Figure 19 shows efficacy of the anti-oxMIF x anti-HSG bsMab C0132 using the PRAIT approach in Balb / c mice syngeneically implanted with CT26 mouse colorectal cancer cells. C0132 was administered at 2.5 mg / ml and 5 mg / ml on day -5, followed by 5 days later (day 0). 177Lu-IMP288 was administered. (A) Tumor volume (unit: %) relative to tumor volume measured on day 0; mean ± SEM is shown (n = 10 max). Statistical analysis was performed in GraphPad Prism V9.4 using ordinary one-way ANOVA with Dunnett's correction for multiple testing; *** p<0.001 vs. 177 (B) Kaplan-Meier survival curves (unit: percent survival (%)).

[0304] Example 19: Anti-oxMIF x anti-HSG bispecific antibody (bsMab) C0132 and 5 days after C0132 application in a xenograft CFPAC-1 pancreatic cancer mouse model in Balb / c nude mice 177 Pretargeted Radioimmunotherapy (PRAIT) using Lu-labeled IMP288 In this example, the efficacy of the newly designed Fc-silenced bispecific anti-oxMIF x anti-HSG antibody C0132 was evaluated in a xenograft model of pancreatic cancer using the HSG hapten IMP288 (as described in US2005 / 0025709) and the radionuclide IL-1. 177 Together with Lu, the PRAIT approach was used for evaluation.

[0305] Materials and Methods: The in vivo efficacy of PRAIT was evaluated in Balb / c nude mice bearing subcutaneous CFPAC-1 pancreatic ductal adenocarcinoma tumors. The study was performed essentially as described in Examples 16 and 17, with some modifications. Human pancreatic ductal adenocarcinoma cells, CFPAC-1, were provided by ATCC (Cat#CRL-1918). Cells were cultured in RPMI 1640 medium supplemented with 10% FBS and 2 mM L-glutamine. A suspension of CFPAC-1 cells was prepared in sterile PBS at 50 × 10 6 The cells were prepared at 1000 x 1000 cells / mL. Balb / c nude mice (Balb / c ByAnNRj-Foxn1 nu / nu ) was suspended in 100 μL of PBS. 6CFPAC-1 cells were injected subcutaneously into the right flank. Tumor growth was monitored by visual observation and palpation until 4 days after inoculation. In vivo treatment studies showed that tumor sizes were approximately 150–300 mm in the treatment groups (10 mice per group). 3 and two control groups (10 mice per group) at approximately 350–500 mm 3 Treatment was initiated when the HSG hapten IMP288 concentration reached 10:1. Treatment groups were initially administered a 5 mg / kg dose of the BsMAb C0132 (day -5). Five days later (day 0), radiolabeled IMP288 was administered using a fixed BsMAb / HSG hapten IMP288 molar ratio of 10:1, i.e. 177 Lu-labeled HSG hapten IMP288 was administered at 4 nmol / kg (18.5 MBq) to each mouse. 177 One cohort received Lu-IMP288 at 8 nmol / kg (37 MBq) but no BsMAb, and one cohort received 177 One cohort received only the vehicle used to dilute Lu-IMP288, and the other cohort received only the vehicle used to dilute Lu-IMP288. Animals were assessed for body weight and tumor volume every 2-3 days for 28 days after dosing. Tumor volume was determined by measuring the length, width, and depth of the tumor using digital calipers. Tumor volume was calculated using the following formula: tumor volume = (length x width x depth) x 0.5. Mice were kept for up to 28 days or until the mice reached the pre-defined experimental endpoint: tumor volume >1500 mm 3 or body weight loss >20%. Relative tumor volumes (tumor volume on day 0 = 100%) for each treatment group were plotted against time using GraphPad Prism software. Statistical analysis (ordinary one-way ANOVA with Dunnett's correction for multiple testing; ** p<0.01) was performed in GraphPad Prism V9.4 on day 14 only, comparing C0132-treated groups with the vehicle group.

[0306] Results and Conclusions: It is evident from FIG. 20 that pre-targeted treatment with C0132 at 5 mg / ml results in significant tumor regression (FIG. 20).

[0307] FIG. 20 shows efficacy of the anti-oxMIF×anti-HSG bsMab C0132 using the PRAIT approach in Balb / c nude mice xenografted with CFPAC-1 pancreatic adenocarcinoma cells. C0132 was administered at 5 mg / ml on day −5, followed by 5 days later (day 0). 177 Lu-IMP288 was administered. Tumor volumes (in %) relative to tumor volumes measured on day 0; mean ± SEM is shown (n = 10 max). Statistical analysis was performed in GraphPad Prism V9.4 using conventional one-way ANOVA with Dunnett's correction for multiple testing; ** p<0.01 vs. vehicle.

[0308] Example 20: Efficacy of C0115 antibody in combination with glucocorticoids (GCs) in a mouse model of type II collagen-induced arthritis (CIA) Glucocorticoids (such as dexamethasone) are potent immunosuppressants commonly used as long-term therapy to control rheumatic diseases in human patients, but are associated with a variety of side effects. In this example, the efficacy of C0115 was evaluated as a monotherapy or in combination with dexamethasone.

[0309] Materials and Methods: Male DBA / 1j (Harlan Laboratories, Italy) mice aged 8-9 weeks (weight range: 18-20 grams) were used in this study. Bovine type II collagen (CII; Chondrex, USA) was dissolved at 2 mg / ml in 0.05 M acetic acid by gentle stirring overnight at 4°C. CFA (complete Freund's adjuvant) was prepared by adding Mycobacterium tuberculosis H37Ra (Difco, Detroit, MI) to IFA (incomplete Freund's adjuvant, Sigma Aldrich, Milano, Italy) at a concentration of 2 mg / ml. Before injection, CII was emulsified with an equal volume of CFA. To induce CIA, mice were injected intradermally at the base of the tail with 100 μl of the resulting emulsion containing CII and CFA (100 μg / mouse). On day 21, a second boost of 100 μl (100 μg / mouse) of CII in IFA was administered. At the onset of disease, mice were treated with vehicle, C0115 (20 mg / kg) alone, or C0115 (20 mg / kg) in combination with daily injections of low dose dexamethasone (0.1 mg / kg) twice weekly (ip) for 20 days. A control group of mice received daily injections of high dose dexamethasone (0.3 mg / kg) as standard treatment. At the end of treatment, animals were euthanized, blood collected, and tissues (front and rear paws) were harvested for further histological analysis. Clinical severity of arthritis was assessed by monitoring body weight and paw thickness (all four paws, using a pachymeter) twice weekly. The arthritis score of the four paws of each mouse ranged from 0 to 4 and was scored as follows: 0 = no signs of arthritis; 1 = swelling and / or redness of the paw or one toe; 2 = affection of two joints; 3 = affection of more than two joints; 4 = severe arthritis of the entire paw and toes (resulting in a maximum score of 12 per mouse). The cumulative disease score for each mouse was calculated for each individual mouse by summing the scores over the treatment period. Statistical analysis was performed in GraphPad Prism using ordinary one-way ANOVA followed by Fisher's LSD test. Results and Conclusions: Figure 21 reveals that treatment with C0115 (20 mg / kg) resulted in significant improvement in clinical arthritic signs as indicated by cumulative disease score compared to the vehicle-treated group. Furthermore, combination treatment with C0115 (20 mg / kg) and low dose dexamethasone (0.1 mg / kg) matched the efficacy of high dose dexamethasone (0.3 mg / kg) and further improved clinical arthritic signs compared to treatment as single agents.

[0310] Example 21: Efficacy of C0115 antibody and in combination with glucocorticoids (GCs) in a T cell transfer mouse model of colitis In this example, the efficacy of C0115 antibody as a single agent or in combination with low-dose dexamethasone was evaluated during chronic intestinal inflammation.

[0311] Materials and Methods: Female BALB / c and CB-17 SCID (Envigo, San Pietro al Natisone, Udine, Italy) mice aged 8-9 weeks (weight range: 18-20 grams) were used in this study.

[0312] To induce colitis, CD4+CD25- T cells from BALB / c mice were transferred into CB-17 SCID mice (lacking B and T cells). Briefly, splenocytes isolated from Balb / C mice were stimulated in vitro with 4 μg / ml concanavalin A. T cells were isolated by magnetic selection of CD4+CD25- cells, and cell preparations were stained with a viability dye (7-actinomycin-D), FITC-conjugated anti-mouse CD4 antibody (BD, Heidelberg, Germany) and APC-conjugated anti-mouse CD25 antibody (BD, Heidelberg, Germany) and purity controlled by flow cytometry (>95% viable T cells in the CD4+CD25- gate) using a FACS Calibur (BD Bioscience, Heidelberg, Germany) and CellQuest software. Isolated CD4+CD25- T cells were injected ip into CB-17 SCID mice at a concentration of 500,000 cells in a final volume of 0.2 ml saline. One week after T cell transfer, mice were treated (twice weekly; ip) for 83 days with vehicle, C0115 (10 mg / kg) as a single agent, or C0115 (10 mg / kg) combined with daily injections of low-dose dexamethasone (0.01 mg / kg). A control group of mice received daily injections of high-dose dexamethasone (0.1 mg / kg) as standard treatment. At the end of treatment, blood, stool, and colon tissues were collected for further analysis. The clinical severity of colitis was assessed by regular monitoring of body weight change and stool consistency. The cumulative stool score for each mouse was determined by summing the daily stool scores (0 = well-formed pellets; 1 = loose stools; 2 = diarrhea). Statistical analysis used one-way ANOVA followed by Fisher's LSD test in GraphPad Prism V9.4.

[0313] Results and Conclusions: Figure 22 shows that treatment with C0115 (10 mg / kg) resulted in a significant improvement in disease severity as evidenced by a significant reduction in cumulative stool score (A) compared to the vehicle-treated group, which was comparable to high dose dexamethasone (0.1 mg / kg). Combination treatment with 10 mg / kg C0115 and low dose dexamethasone (0.01 mg / kg) further improved disease severity as evidenced by a further significant reduction in cumulative stool score. Surprisingly, combination treatment with 10 mg / kg C0115 and low dose dexamethasone (0.01 mg / kg) resulted in further improvement in colitis as assessed by a significant increase in body weight at the end of treatment (day 83) compared to the vehicle-treated group and treatment with the standard of care corticosteroid drug dexamethasone.

[0314] FIG. 22 shows that the newly designed Fc-silenced anti-oxMIF antibody C0115 ameliorates disease severity in T cell-transferred mice in a colitis model, both alone and in combination with GC. Body weight change (A) and cumulative stool score (B) at the end of the experiment at D83 were assessed following treatment with C0115 (10 mg / kg) alone or in combination with a low dose of 0.01 mg / kg dexamethasone, with low (0.01 mg / kg) and high (0.1 mg / kg) doses of dexamethasone as standard of care corticosteroid drug, or with vehicle control treatment. Data are presented as mean ± SEM and statistical analysis was performed using conventional one-way ANOVA followed by Fisher's LSD test (Table 2). * p < 0.05; ** p<0.01).

[0315] Example 22: Reduced aggregation tendency and reduced hydrophobicity of newly designed anti-oxMIF antibodies and their retention of binding to immobilized oxMIF (K D Estimated)

[0316] [Table 11]

[0317] To assess hydrophobicity and aggregation, the newly designed antibodies are analyzed by gel filtration (SEC) and by hydrophobic interaction chromatography (HIC) in a head-to-head comparison with the control anti-oxMIF antibody C0008.

[0318] For SEC, antibodies are diluted to 1 mg / ml in 1x phosphate buffered saline (1x PBS) and 100 μl of sample is applied to an Enrich 650 (Bio-Rad) gel filtration column at a flow rate of 1.25 ml / min. Separation and equilibration are performed in 1x PBS at room temperature. Protein peaks are monitored using absorbance at 280 nm and spectra are analyzed using the ChromLab software package (Bio-Rad). Results are reported as retention volume (Vr, ml) of the main peak and the presence of aggregates is manually ranked.

[0319] For HIC analysis, antibodies are diluted to a final concentration of 1 mg / ml using 50 mM phosphate and 0.75 M ammonium sulfate, pH 6.8. 1 mg of each antibody is injected onto a 1 ml HiTrap Butyl HP column using a 1 ml loading loop and the column flow rate is maintained at 1 ml / min at room temperature. Peak separation is performed with a 20 column volumes (CV) gradient of 0-100% buffer B (50 mM phosphate, 20% isopropanol; pH 7.0). Protein peaks are monitored using absorbance at 280 nm and spectra are analyzed using the Unicorn emulsion software package (GE Healthcare). Results are reported for each peak as Vr (ml) at the maximum peak.

[0320] To assess the binding to oxMIF (apparent affinity), the newly designed antibodies are analyzed by ELISA. Briefly, 1 μg / ml of recombinant human MIF diluted in PBS is immobilized on an ELISA plate overnight at 4°C (MIF is converted to oxMIF according to Thiele et al., 2015). After blocking, serial dilutions of anti-oxMIF antibodies are added to the plate. Finally, bound antibodies are detected using a goat anti-human IgG(Fc)-HRP conjugate and tetramethylbenzidine (TMB) as substrate. The color reaction is stopped with 3M H2SO4 and the OD is measured at 450 nm. The apparent affinity (K D ) stands for EC 50 Values ​​are determined by a four parameter fit using GraphPad Prism.

[0321] References Aeberli D, et al. Endogenous macrophage migration inhibitory factor modulates glucocorticoid sensitivity in macrophages via effects on MAP kinase phosphatase-1 and p38 MAP kinase. FEBS Lett. 2006;580(3):974-981 Bacher M, et al. An essential regulatory role for macrophage migration inhibitory factor in T-cell activation. Proc Natl Acad Sci US A. 1996;93(15):7849-7854 Bacher M, et al. Migration inhibitory factor expression in experimentally induced endotoxemia. Am J Pathol. 1997;150(1):235-246. Bando, H., et al. (2002). Expression of macrophage migration inhibitory factor in human breast cancer: association with nodal spread. Jpn J Cancer Res 93, 389-396. Barnes PJ, Adcock IM. How do corticosteroids work in asthma? Ann Intern Med. 2003;139(5 Pt 1):359-370 Bernhagen, J. et al. (1993). MIF is a pituitary-derived cytokine that potentiates lethal endotoxaemia. Nature 365, 756-759 Bernhagen, J., et al. (1994). Purification, bioactivity, and secondary structure analysis of mouse and human macrophage migration inhibitory factor (MIF). Biochemistry 33, 14144-14155 Bernhagen, J., et al. (2007). MIF is a noncognate ligand of CXC chemokine receptors in inflammatory and atherogenic cell recruitment. Nat Med 13, 587-596 Bloom B.R. and Bennet, B., 1966, Mechanism of a reaction in vitro associated with delayed-type hypersensitivity, Science 153, 80-82 Bozza FA, et al. Macrophage migration inhibitory factor levels correlate with fatal outcome in sepsis. Shock. 2004;22(4):309-313 Brinkmann U. and Kontermann R.E., 2017, The making of bispecific antibodies, MABS, 9, 2, 182-212 Bucala, R., and Donnelly, S. C. (2007). Macrophage migration inhibitory factor: a probable link between inflammation and cancer. Immunity 26, 281-285 Calandra T, et al. The macrophage is an important and previously unrecognized source of macrophage migration inhibitory factor. J Exp Med. 1994;179(6):1895-1902 Calandra T, et al. MIF as a glucocorticoid-induced modulator of cytokine production. Nature. 1995;377(6544):68-71 Chen, R., et al. (2010). Pilot study of blood biomarker candidates for detection of pancreatic cancer. Pancreas 39, 981-988 Chothia C., et al. (1987) Canonical structures for the hypervariable regions of immunoglobulins. J.Mol.Biol., 196, 901-17 Coleman, A. M., et al (2008). Cooperative regulation of non-small cell lung carcinoma angiogenic potential by macrophage migration inhibitory factor and its homolog, D-dopachrome tautomerase. J Immunol 181, 2330-2337 Conroy, H., et al. (2010). Inflammation and cancer: macrophage migration inhibitory factor (MIF)--the potential missing link. Qjm 103, 831-836 Coussens, L. M., and Werb, Z. (2002). Inflammation and cancer. Nature 420, 860-867 David, J.R., 1966, Delayed hypersensitivity in vitro: its mediation by cell-free substances formed by lymphoid cell-antigen interaction, Proc. Natl. Acad. Sci. U.S.A. 56, 72-77 de Jong et al., (2001). Development of chronic colitis is dependent on the cytokine MIF, Nat. Immunol. (11) 1061:6 del Rincon ID, et al. High incidence of cardiovascular events in a rheumatoid arthritis cohort not explained by traditional cardiac risk factors. Arthritis Rheum. 2001;44(12):2737-2745 Ehrenmann F., et al. 2010, MGT / 3Dstructure-DB and IMGT / DomainGapAlign: a database and a tool for immunoglobulins or antibodies, T cell receptors, MHC, IgSF and MhcSF, Nucleic Acids Res. 38, D301-307 El-Magadmi M, et al. Systemic lupus erythematosus: an independent risk factor for endothelial dysfunction in women. Circulation. 2004;110(4):399-404. Emonts M, et al. Association between high levels of blood macrophage migration inhibitory factor, inappropriate adrenal response, and early death in patients with severe sepsis. Clin Infect Dis. 2007;44(10):1321-1328 Estep P. et al., 2015, An alternative assay to hydrophobic interaction chromatography for high-throughput characterization of monoclonal antibodies, MAbs, 7(3), 553-561 Ewert S. et al., 2003, Structure-based improvement of the biophysical properties of immunoglobulin VH domains with a generalizable approach, Biochemistry, 18, 42(6), 1517-28 Fingerle-Rowson G, et al. Regulation of macrophage migration inhibitory factor expression by glucocorticoids in vivo. Am J Pathol. 2003;162(1):47-56 Ha J-H. et al., 2016, Immunoglobulin Fc heterodimer platform technology: From design to applications in therapeutic antibodies and proteins, frontiers Immunol., 7, article 394 Hagemann, T., and Balkwill, F. (2005). MIFed about cancer? Gastroenterology 129, 1785-1787. Hagemann, T., et al. (2007). Ovarian cancer cell-derived migration inhibitory factor enhances tumor growth, progression, and angiogenesis. Mol Cancer Ther 6, 1993-2002 Hong, P., et al. (2012). A review size-exclusion chromatography for the analysis of protein biotherapeutics and their aggregates. In Journal of Liquid Chromatography and Related Technologies (Vol. 35, Issue 20, pp. 2923-2950). Taylor & Francis. https: / / doi.org / 10.1080 / 10826076.2012.743724 Hudson, J. D., et al. (1999). A proinflammatory cytokine inhibits p53 tumor suppressor activity. J Exp Med 190, 1375-1382. Hussain F. et al., 2013, Human anti-macrophage migration inhibitory factor antibodies inhibit growth of human prostate cancer cells in vitro and in vivo, Mol Cancer Ther. Jul;12(7):1223-34 Ianello A. and Ahmad A., 2005, Role of antibody-dependent cell-mediated cytotoxicity in the efficacy of therapeutic anti-cancer monoclonal antibodies, Cancer and Metastasis Review, 24, 487-499 Kabat et al., Sequences of Proteins of Immunological Interest, Fifth Edition, NIH Publication 91-3242, Bethesda MD (1991), vols. 1-3 Kamimura, A., et al. (2000). Intracellular distribution of macrophage migration inhibitory factor predicts the prognosis of patients with adenocarcinoma of the lung. Cancer 89, 334-341 Karacay H. et al., (2005) Pretargeting with bispecifics aCEA x aHSG, Clin Cancer Res, 11(21) Karin, M. (2009). NF-kappaB as a critical link between inflammation and cancer. Cold Spring Harb Perspect Biol 1, a000141 Kenanova V. et al. (2005) Tailoring the Pharmacokinetics and Positron Emission Tomography Imaging Properties of Anti-Carcinoembryonic Antigen Single-Chain Fv-Fc Antibody Fragments. Cancer Res. 2005, 65:622-633 Kessenbrock, K., et al. (2010). Matrix metalloproteinases: regulators of the tumor microenvironment. Cell 141, 52-67. Lefranc MP. Unique database numbering system for immunogenetic analysis. Immunol Today (1997) 18:509. Liu R. et al., 2020, “Fc-Engineering for modulated effector functions-improving antibodies for cancer treatment”, Antibodies, 9, 64 Lue, H., et al. (2007). Macrophage migration inhibitory factor (MIF) promotes cell survival by activation of the Akt pathway and role for CSN5 / JAB1 in the control of autocrine MIF activity. Oncogene 26, 5046-5059 MacCallum R.M et al. (1996) Antibody-antigen Interactions: Contact Analysis and Binding Site Topography, J.Mol.Biol., 262, 5:732-745 Mahalingam D. et al., 2015, ASCO Abstract ID2518 Mahalingam et al. 2020, Phase I study of Imalumab (BAX69), a fully human recombinant antioxidized macrophage migration inhibitory factor antibody in advanced solid tumours, Br J Clin Pharmacol. 86(9):1836-1848 Manzi S, et al. Prevalence and risk factors of carotid plaque in women with systemic lupus erythematosus. Arthritis Rheum. 1999;42(1):51-60 Meyer-Siegler, K., and Hudson, P. B. (1996). Enhanced expression of macrophage migration inhibitory factor in prostatic adenocarcinoma metastases. Urology 48, 448-452. Mitchell RA, et al. Sustained mitogen-activated protein kinase (MAPK) and cytoplasmic phospholipase A2 activation by macrophage migration inhibitory factor (MIF). Regulatory role in cell proliferation and glucocorticoid action. J Biol Chem. 1999;274(25):18100-18106 Mitchell RA, et al. Macrophage migration inhibitory factor (MIF) sustains macrophage proinflammatory function by inhibiting p53: regulatory role in the innate immune response. Proc Natl Acad Sci U S A. 2002;99(1):345-350 Mitchell, R. A., and Bucala, R. (2000). Tumor growth-promoting properties of macrophage migration inhibitory factor (MIF). Semin Cancer Biol 10, 359-366. Morand EF, et al. Macrophage migration inhibitory factor in rheumatoid arthritis: clinical correlations. Rheumatology (Oxford). 2002;41(5):558-562. Morrison, S.L., et al., 1984, Chimeric human antibody molecules: mouse antigen-binding domains with human constant region domains, Proc. Natl. Acad. Sci. 81, 6851-6855 Natsume A. et al., 2009, “Improving effector functions of antibodies for cancer treatment: Enhancing ADCC and CDC”, Drug, Design, development and Therapy, 3, 7-16 Niino M., et al. Macrophage migration inhibitory factor in the cerebrospinal fluid of patients with conventional and optic-spinal forms of multiple sclerosis and neuro-Behcet's disease. J Neurol Sci. 2000;179(S 1-2):127-131 Onodera S., et al. High expression of macrophage migration inhibitory factor in the synovial tissues of rheumatoid joints. Cytokine. 1999;11(2):163-167. Petkova, S.B., et al., 2006, Enhanced half-life of genetically engineered human IgG1 antibodies in a humanized FcRn mouse model: potential application in humorally mediated autoimmune disease, Int'l. Immunol. 18(12) 1759-1769 Pisu M., et al. The cost of glucocorticoid-associated adverse events in rheumatoid arthritis. Rheumatology (Oxford). 2005;44(6):781-788 Pyzik M. et al. 2019. The Neonatal Fc Receptor (FcRn): A Misnomer?, Frontiers in Immunol., Vol 10, 1540: 1-24 Ramsey-Goldman R. Missed opportunities in physician management of glucocorticoid-induced osteoporosis? Arthritis Rheum. 2002;46(12):3115-3120 Ren, Y., et al. (2004). Upregulation of macrophage migration inhibitory factor contributes to induced N-Myc expression by the activation of ERK signaling pathway and increased expression of interleukin-8 and VEGF in neuroblastoma. Oncogene 23, 4146-4154 Rendon, B. E., et al. (2007). Regulation of human lung adenocarcinoma cell migration and invasion by macrophage migration inhibitory factor. J Biol Chem 282, 29910-29918 Rendon, B. E., et al. (2009). Mechanisms of macrophage migration inhibitory factor (MIF)-dependent tumor microenvironmental adaptation. Exp Mol Pathol 86, 180-185. Rinta S., et al. Apoptosis-related molecules in blood in multiple sclerosis. J Neuroimmunol. 2008;205(1-2):135-141 Rossi EA et al., (2006) Stably tethered multifunctional structures of defined composition made by the dock and lock method for use in cancer targeting, PNAS, 103, 18, 6841-6846 Sampey AV, et al. (2001) Regulation of synoviocyte phospholipase A2 and cyclooxygenase 2 by macrophage migration inhibitory factor. Arthritis Rheum. 44(6):1273-1280. Saunders K.O., (2019) “Conceptual approaches to modulating antibody effector functions and circulation half-life, frontiers Immunol., 10, 1-20, doi: 10.3389 / fimmu.2019.01296 Sambrook et al, "Molecular Cloning: A Laboratory Manual" (4th Ed.), Vols. 1 -3, Cold Spring Harbor Laboratory Press (2012). Sharkey RM et al. (2005) Pretargeting with bispecific aCD20 x aHSG, Leukemia, 15,1064-1069 Schacke H., et al. (2002) Mechanisms involved in the side effects of glucocorticoids. Pharmacol Ther. 96(1):23-43 Schinagl, A., et al., (2018) Role of the Cysteine 81 Residue of Macrophage Migration Inhibitory Factor as a Molecular Redox Switch. Biochemistry, 57(9), 1523-1532. https: / / doi.org / 10.1021 / acs.biochem.7b01156 Schinagl. A. et al., (2016) Oxidized macrophage migration inhibitory factor is a potential new tissue marker and drug target in cancer, Oncotarget. Nov 8;7(45):73486-73496 Shimizu, T, et al. (1999). High expression of macrophage migration inhibitory factor in human melanoma cells and its role in tumor cell growth and angiogenesis. Biochem Biophys Res Commun 264, 751-758 Shimizu T., et al. (2001) High macrophage migration inhibitory factor (MIF) serum levels associated with extended psoriasis. J Invest Dermatol. 116(6):989-990 Solomon DH, et al. (2003) Cardiovascular morbidity and mortality in women diagnosed with rheumatoid arthritis. Circulation. 107(9):1303-1307 Spiess C. et al., (2015) Alternative molecular formats and therapeutic applications for bispecific antibodies, Mol.Immunol., 67, 95-106 Sprong T, et al. Macrophage migration inhibitory factor (MIF) in meningococcal septic shock and experimental human endotoxemia. Shock. 2007;27(5):482-487. Strohl W.R. et al. (2012) Antibody Fc engineering for optimal antibody performance, Therapeutic Antibody Engineering, Woodhead Publishing Series in Biomedicine, No. 11, pp. 225-249 Takahashi, N., et al. (1998). Involvement of macrophage migration inhibitory factor (MIF) in the mechanism of tumor cell growth. Mol Med 4, 707-714. Tam FWK, et al., (1999) Development of scarring and renal failure in a rat model of crescentic glomerulonephritis. Nephrol Dial Transplant 14:1658-1666 Tang J., et al., (2018) Comprehensive analysis of the clinical immuno-oncology landscape, Ann Oncol.;29(1):84-91 Thiele, M. et al., (2017). Selective Targeting of a Disease-Related Conformational Isoform of Macrophage Migration Inhibitory Factor Ameliorates Inflammatory Conditions. Journal of Immunology, 195(5), 2343-2352. https: / / doi.org / 10.4049 / jimmunol.1500572 Van der Kant, R. et al., (2017) Prediction and Reduction of the Aggregation of Monoclonal Antibodies, J.Mol.Biol., 429(8), 1244-1261 Verjans, E., et al. (2009). Dual role of macrophage migration inhibitory factor (MIF) in human breast cancer. BMC Cancer 9, 230 Walsh LJ, et al. (1996) Use of oral corticosteroids in the community and the prevention of secondary osteoporosis: a cross sectional study. BMJ. 313(7053):344-346 Wang P, et al., (2008) A systematic assessment of MHC class II peptide binding predictions and evaluation of a consensus approach, PLoS Comput Biol. 4(4):e1000048; Wang P, et al., (2010) Peptide binding predictions for HLA DR, DP and DQ molecules, BMC Bioinformatics. 11:568 Wei Li et al., (2016) Antibody Aggregation: Insights from Sequence and Structure, Antibodies, 5(3), 19 WHO Drug Information, Vol. 28, No. 2, 2014 Willuda J. et al., (1999) High thermal stability is essential for tumor targeting of antibody fragments: engineering of a humanized anti-epithelial glycoprotein-2 (epithelial cell adhesion molecule) single-chain Fv fragment, Cancer Res., 15; 59(22), 5758-67 Winner, M., et al. (2007). Amplification of Tumor Hypoxic Responses by Macrophage Migration Inhibitory Factor-Dependent Hypoxia-Inducible Factor Stabilization. Cancer Research 67, 186-193

Claims

1. 1. An Fc-silenced anti-oxMIF antibody, comprising a variant Fc region of wild-type human IgG comprising SEQ ID NO: 1 with one or more amino acid substitutions or glycosylation modifications, and the following variable domains: (a1) a light chain variable domain comprising SEQ ID NO: 2 with one, two, three, four, or five amino acid substitutions selected from M30L, F49Y, A51G, P80S, W93F; or (a2) a light chain variable domain comprising SEQ ID NO: 2 with one, two, three, four, or five amino acid substitutions selected from M30L, F49Y, A51G, P80S, W93F, and one, two, three, four, or five additional amino acid substitutions, with the proviso that the conserved tyrosine at position 36 is conserved; and, (b1) a heavy chain variable domain comprising SEQ ID NO: 3; (b2) a heavy chain variable domain comprising SEQ ID NO: 3 with one or two amino acid substitutions selected from L5Q and W97Y; or (b3) a heavy chain variable domain comprising SEQ ID NO: 3 with one or two amino acid substitutions selected from L5Q and W97Y, and one, two, three, four, or five additional amino acid substitutions; Including, where the amino acid positions are numbered according to Kabat: the variant Fc Region exhibits reduced FcγR binding compared to a wild-type IgG1 Fc Region, wherein one or more amino acid substitutions in the variant Fc Region are at any one of positions E233, L234, L235, G236, G237, P238, 1253, D265, S267, H268, N297, S298, T299, H310, E318, L328, P329, A330, P331, H435 of SEQ ID NO: 1 according to the EU numbering index, specifically said amino acid substitutions are at positions L234 and L235; and / or the Fc Region is aglycosylated; The antibody has reduced aggregation potential and reduced hydrophobicity compared to an antibody comprising SEQ ID NO: 2 and SEQ ID NO: 3 lacking the amino acid substitution. The Fc-silenced anti-oxMIF antibody.

2. 2. The Fc-silenced anti-oxMIF antibody of claim 1, wherein the light chain variable domain comprises the amino acid substitution W93F and the heavy chain variable region comprises the amino acid substitution W97Y.

3. 2. The Fc-silenced anti-oxMIF antibody of claim 1, comprising a variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 5, 6, 7, 8, 9, and 43.

4. i.) SEQ ID NOs: 3 and 6; ii.) SEQ ID NOs: 9 and 6; iii.) SEQ ID NOs: 4 and 6; iv.) SEQ ID NOs: 4 and 8; v.) SEQ ID NOs: 4 and 5, or vi.) SEQ ID NO: 43 and any one of SEQ ID NOs: 5, 6 or 8; The Fc-silenced anti-oxMIF antibody of claim 1 , comprising:

5. 5. The Fc-silenced anti-oxMIF antibody of claim 4, further comprising SEQ ID NO:

14.

6. An Fc-silenced anti-oxMIF antibody described in claim 1, comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 15 and 16, or SEQ ID NOs: 15 and 17.

7. Bispecific antibody, scFv-Fc, (scFv) ２ -Fc, scFv / scFv-Fc, Fab / scFv-Fc, Fab / (scFv) ２ -Fc, Fab / Fab-scFv-Fc, Fab / crossFab-Fc, IgG-scFv and IgG-(scFv) ２ 2. The Fc-silenced anti-oxMIF antibody of claim 1, selected from the group consisting of:

8. 2. The Fc-silenced anti-oxMIF antibody of claim 1, wherein the antibody is a bispecific antibody further comprising at least one binding site that specifically recognizes an epitope of CD3 or histamine-succinyl-glycine (HSG).

9. 9. An Fc-silenced antibody according to any one of claims 1 to 8 for use in the preparation of a medicament.

10. A pharmaceutical composition comprising an antibody according to any one of claims 1 to 8, optionally together with a pharmaceutical carrier or adjuvant.

11. 11. The pharmaceutical composition of claim 10, formulated for subcutaneous administration.

12. 11. The pharmaceutical composition according to claim 10, for administration as a single substance or together with a further active substance, preferably selected from the group consisting of antiviral, anticancer, anti-inflammatory and antibiotic agents.

13. 11. The pharmaceutical composition of claim 10 for use in the treatment of patients suffering from inflammatory diseases, infectious diseases, in particular in the treatment of asthma, vasculitis, arthritis, sepsis, septic shock, endotoxic shock, toxic shock syndrome, acquired respiratory distress syndrome, glomerulonephritis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, peritonitis, nephritis, NASH (non-alcoholic steatohepatitis), multiple sclerosis, acute and chronic pancreatitis, type 1 diabetes, IgA nephropathy, interstitial cystitis, post-COVID syndrome and psoriasis, or for use in the treatment of patients suffering from hyperproliferative disorders or cancer, in particular in the treatment of colorectal cancer, ovarian cancer, breast cancer, prostate cancer, pancreatic cancer, gastric cancer and lung cancer.

14. An isolated nucleic acid encoding the antibody of any one of claims 1 to 8.

15. An expression vector comprising the nucleic acid of claim 14.

Images