Alternative generation of allogeneic human T cells

JP2024533375A5Pending Publication Date: 2025-08-04KITE PHARMA INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024515385
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-09-10
Filing Date
2022-09-08
Publication Date
2025-08-04

AI Technical Summary

Technical Problem

Current adoptive immunotherapy using autologous CAR-T cells is limited by scalability, economic constraints, and risks of allogeneic T-cell responses such as graft-versus-host disease (GVHD) and host-versus-graft disease (HvGD), necessitating a standardized approach with allogeneic cells that can be pre-manufactured and administered to a wide range of patients safely.

Method used

Modified immune cells, including CD3δ, CD3ε, CD3γ, and other gene-edited T cells with downregulated endogenous immune genes, are developed using CRISPR-Cas and other gene editing systems to reduce GVHD and HvGD responses, while maintaining effective tumor targeting capabilities.

Benefits of technology

The modified allogeneic T cells exhibit significantly reduced GVHD responses, up to 200 times less than unmodified cells, and maintain potent antitumor activity, enabling safe and efficient treatment for various cancers.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

The present invention provides gene-edited modified immune cells suitable for adoptive T cell therapy, comprising nucleic acids capable of downregulating CD3δ, CD3ε, CD3γ, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP and invariant chain, and further comprising exogenous nucleic acids encoding chimeric antigen receptors (CARs), recombinant T cell receptors (TCRs), killer cell immunoglobulin-like receptors (KIRs), dominant negative receptors and / or switch receptors. Also provided are compositions and methods for generating the modified immune cells, and methods of using the modified immune cells for adoptive therapy and treatment of diseases or conditions.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] CROSS REFERENCE TO RELATED APPLICATIONS: This application claims the benefit of priority to U.S. Provisional Application No. 63 / 242,909, filed September 10, 2021, the contents of which are specifically incorporated by reference. [Background technology]

[0002] Adoptive immunotherapy, which involves the introduction of ex vivo generated autologous antigen-specific T-cells back into patients, has been shown to be a promising strategy for the treatment of cancer, infectious diseases, and auto-immune diseases. T cells used in adoptive immunotherapy are primary cells engineered to express chimeric antigen receptors (CARs) or recombinant T cell receptors (TCRs) and expanded ex vivo to direct primary immune cells to pathological cells, such as cancer cells. CARs are synthetic antibody-like molecules consisting of a targeting moiety associated with one or more signaling domains in a single fusion molecule, engineered to convey antigen specificity to T cells. CARs have been successfully used to redirect T cells against antigens expressed on the surface of tumor cells in a variety of malignancies, including lymphomas and solid tumors. CAR-expressing T cells have also shown long-term efficacy in the treatment of certain types of cancer.

[0003] However, adoptive immunotherapy is currently based on autologous cell transfer. In autologous immunotherapy, patients receive personalized treatment based on their own lymphocytes that are isolated from the patient, genetically modified or selected ex vivo, cultured in vitro, and infused back into the patient. Despite the approval and general success of autologous adoptive immunotherapy, the scalability and feasibility of such treatments remain significant challenges. Autologous adoptive immunotherapy remains fairly complex, requiring expertise and clinical management, as well as expensive dedicated facilities. Also, many patients cannot receive adoptive immunotherapy because their disease progresses rapidly during CAR production or because their immune function declines before treatment. Therefore, the widespread clinical application of cancer immunotherapy is limited by the considerable economic constraints imposed by the personalized preparation of autologous CAR T cells. Therefore, there is a need for standardized adoptive immunotherapy, where allogeneic therapeutic cells are pre-produced, characterized in detail, and can be administered immediately to a wide range of patients.

[0004] Allogeneic immunotherapy is a risky procedure that can cause many complications, such as allogeneic T-cell responses, which manifest clinically as graft-versus-host disease (GVHD) and / or host-versus-graft disease (HvGD, graft rejection). GvHD is caused by the attack of recipient tissues by infused allogeneic CAR-T cells via alloreactive TCRs on donor CAR cells. In particular, the endogenous T cell receptor alpha (TCRα; TRAC) and beta (TCRβ; TRBC) chains on infused T cells recognize major and minor histocompatibility antigens in the receptor and can cause GvHD. Conversely, infused allogeneic CAR T cells can be rejected by the recipient's T lymphocytes, causing HvGD. Thus, the use of allogeneic CAR T cells would improve the applicability and versatility of adoptive immunotherapy if a standard solution to control allogeneic-specific immune responses could be identified.Specific inhibition of GvHD would allow the safe and effective use of allogeneic CAR T cells. Summary of the Invention Problem to be solved by the invention

[0005] Thus, there is a need for improved methods of CAR-T cell generation that do not induce a host immune response. In particular, there is a need for novel alternative compositions and methods for generating allogeneic T cells with improved compatibility.

[0006] The present invention provides methods and compositions that address these needs. overview: [Means for solving the problem]

[0007] In one embodiment, the disclosure provides a modified immune cell comprising: (a) an insertion and / or deletion in one or more loci encoding an endogenous immune protein selected from the group consisting of CD3δ, CD3ε, CD3γ, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii chain), respectively. The insertion and / or deletion can downregulate gene expression of one or more endogenous immune genes. Additionally, the modified immune cell comprises (b) an exogenous nucleic acid encoding a chimeric antigen receptor (CAR), a recombinant T cell receptor (TCR), a killer cell immunoglobulin-like receptor (KIR), an antigen-binding polypeptide, a cell surface receptor ligand, or a tumor antigen. In some embodiments, the modified immune cells further comprise a dominant negative receptor, a switch receptor, a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, CCL21, CCL19, or any combination thereof.

[0008] In some embodiments, the insertions and / or deletions are capable of downregulating gene expression of: (a) a T cell receptor subunit selected from CD3δ, CD3ε and / or CD3γ; (b) an HLA class I molecule selected from B2M, TAP1, TAP2, TAPBP and / or NLRC5; and (c) an HLA class II molecule selected from HLA-DM, RFX5, RFXANK, RFXAP and / or invariant chain (Ii chain).

[0009] In some embodiments, the insertions and / or deletions are capable of downregulating: (a) gene expression of CD3δ, and (b) gene expression of an HLA molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain), and any combination thereof.

[0010] In some embodiments, the insertions and / or deletions are capable of downregulating: (a) gene expression of CD3ε; and (b) gene expression of an HLA molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, NLRC5, CIITA, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain), and any combination thereof.

[0011] In some embodiments, the insertions and / or deletions are capable of downregulating: (a) gene expression of CD3γ; and (b) gene expression of an HLA molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, NLRC5, CIITA, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain), and any combination thereof.

[0012] In some embodiments, the insertions and / or deletions can downregulate the expression of the following genes: (a) CD3ε, B2M and CIITA, (b) CD3ε, B2M and RFX5, (c) CD3ε, B2M and RFXAP, (d) CD3ε, B2M and RFXANK, (e) CD3ε, B2M and HLA-DM, (f) CD3ε, B2M and Ii chain, (g) CD3ε, TAP1 and CIITA, (h) CD3ε, TAP1 and RFX5, (i) CD3ε, TAP1 and RFXAP, (j) CD3ε, TAP1 and RFXANK, (k) CD3ε, TAP1 and HLA-DM, (l) CD3ε, TAP1 and Ii chain, (m) CD3ε, TAP2 and CIITA, (n) CD3ε, TAP2 and RFX5, (o) CD3ε , TAP2 and RFXAP, (p) CD3ε, TAP2 and RFXANK, (q) CD3ε, TAP2 and HLA-DM, (r) CD3ε, TAP2 and Ii chain, (s) CD3ε, NLRC5 and CIITA, (t) CD3ε, NLRC5 and RFX5, (u) CD3ε, NLRC5 and RFXAP, (v) CD3ε, NLRC5 and RFXANK, (w) CD3ε, NLRC5 and HLA-DM, (x) CD3ε, NLRC5 and Ii chain, (y) CD3ε, TAPBP and CIITA, (z) CD3ε, TAPBP and RFX5, (aa) CD3ε, TAPBP and RFXAP, (bb) CD3ε, TAPBP and RFXANK, (cc) CD3ε, TAPBP and HLA-DM or (dd) CD3ε, TAPBP and Ii chain.

[0013] In some embodiments, the insertions and / or deletions can downregulate the expression of the following genes: (a) CD3δ, B2M and CIITA, (b) CD3δ, B2M and RFX5, (c) CD3δ, B2M and RFXAP, (d) CD3δ, B2M and RFXANK, (e) CD3δ, B2M and HLA-DM, (f) CD3δ, B2M and Ii chain, (g) CD3δ, TAP1 and CIITA, (h) CD3δ, TAP1 and RFX5, (i) CD3δ, TAP1 and RFXAP, (j) CD3δ, TAP1 and RFXANK, (k) CD3δ, TAP1 and HLA-DM, (l) CD3δ, TAP1 and Ii chain, (m) CD3δ, TAP2 and CIITA, (n) CD3δ, TAP2 and RFX5, (o ... CD3δ, TAP2 and RFXAP, CD3δ, TAP2 and RFXANK, CD3δ, TAP2 and HLA-DM, (r) CD3δ, TAP2 and Ii chain, (s) CD3δ, NLRC5 and CIITA, (t) CD3δ, NLRC5 and RFX5, (u) CD3δ, NLRC5 and RFXAP, (v) CD3δ, NLRC5 and RFXANK, (w) CD3δ, NLRC5 and HLA-DM, (x) CD3δ, NLRC5 and Ii chain, (y) CD3δ, TAPBP and CIITA, (z) CD3δ, TAPBP and RFX5, (aa) CD3δ, TAPBP and RFXAP, (bb) CD3δ, TAPBP and RFXANK, (cc) CD3δ, TAPBP and HLA-DM or (dd) CD3δ, TAPBP and Ii chain.

[0014] In some embodiments, the insertions and / or deletions can downregulate expression of the following genes: (a) CD3γ, B2M and CIITA, (b) CD3γ, B2M and RFX5, (c) CD3γ, B2M and RFXAP, (d) CD3γ, B2M and RFXANK, (e) CD3γ, B2M and HLA-DM, (f) CD3γ, B2M and Ii chain, (g) CD3γ, TAP1 and CIITA, (h) CD3γ, TAP1 and RFX5, (i) CD3γ, TAP1 and RFXAP, (j) CD3γ, TAP1 and RFXANK, (k) CD3γ, TAP1 and HLA-DM, (l) CD3γ, TAP1 and Ii chain, (m) CD3γ, TAP2 and CIITA, (n) CD3γ, TAP2 and RFX5, (o) CD3γ , TAP2 and RFXAP, (p) CD3γ, TAP2 and RFXANK, (q) CD3γ, TAP2 and HLA-DM, (r) CD3γ, TAP2 and Ii chain, (s) CD3γ, NLRC5 and CIITA, (t) CD3γ, NLRC5 and RFX5, (u) CD3γ, NLRC5 and RFXAP, (v) CD3γ, NLRC5 and RFXANK, (w) CD3γ, NLRC5 and HLA-DM, (x) CD3γ, NLRC5 and Ii chain, (y) CD3γ, TAPBP and CIITA, (z) CD3γ, TAPBP and RFX5, (aa) CD3γ, TAPBP and RFXAP, (bb) CD3γ, TAPBP and RFXANK, (cc) CD3γ, TAPBP and HLA-DM or (dd) CD3γ, TAPBP and Ii chain.

[0015] In some embodiments, the modified immune cells are selected from the group consisting of T cells, natural killer cells (NK cells), natural killer T cells, lymphoid progenitor cells, hematopoietic stem cells, stem cells, macrophages, dendritic cells, or any combination thereof. In some embodiments, the modified immune cells are CD4+ T cells or CD8+ T cells. In some embodiments, the modified immune cells are allogeneic T cells or autologous human T cells.

[0016] In some embodiments, the insertion and / or deletion is the result of gene editing selected from the group consisting of: (a) a CRISPR-associated (Cas) (CRISPR-Cas) endonuclease system and guide RNA, (b) a TALEN gene editing system, a zinc finger nuclease (ZFN) gene editing system, a meganuclease gene editing system, or a megaTALEN gene editing system, and (c) a gene silencing system selected from an antisense RNA, an antigenomeric RNA, an RNAi, an siRNA, or an shRNA. In some embodiments, the CRISPR-Cas system comprises a pAd5 / F35-CRISPR vector. In some embodiments, the Cas endonuclease comprises Cas3, Cas4, Cas8a, Cas8b, Cas9, Cas10, Cas10d, Cas12a, Cas12b, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas13, Cas14, CasX, Cse1, Csy1, Csn2, Cpf1, C2c1, Csm2, Cmr5, Fok1, S. pyogenes Cas9, Staphylococcus aureus Cas9, MAD7 nuclease (a type V CRISPR nuclease), or any combination thereof.

[0017] In some embodiments, the CRISPR-Cas endonuclease system comprises a guide RNA. In some embodiments, the guide RNA comprises a guide sequence that is complementary to a sequence within one or more loci encoding immune proteins selected from the group consisting of CD3 delta, CD3 epsilon, CD3 gamma, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii chain). In some embodiments, the guide RNA is complementary to a sequence within an exon of CD3 delta, CD3 epsilon, or CD3 gamma.

[0018] In some embodiments, the complementary sequence is in the CD3 delta locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 53. In some embodiments, the complementary sequence is in the CD3 epsilon locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 52. In some embodiments, the complementary sequence is in the CD3 epsilon locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 52. In some embodiments, the complementary sequence is in the CD3γ locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 54. In some embodiments, the complementary sequence is in the B2M locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 55. In some embodiments, the complementary sequence is in the CIITA locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 61. In some embodiments, the complementary sequence is in the TAP1 locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 56. In some embodiments, the complementary sequence is in the TAP2 locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 57. In some embodiments, the complementary sequence is in the TAPBP locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 58, SEQ ID NO: 59, or a combination thereof. In some embodiments, the complementary sequence is in the NLRC5 locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 60. In some embodiments, the complementary sequence is in the HLA-DM locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 62. In some embodiments, the complementary sequence is in the RFX5 locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 63, SEQ ID NO: 64, or a combination thereof. In some embodiments, the complementary sequence is in the RFXANK locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 65. In some embodiments, the complementary sequence is in the RFXAP locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 66. In some embodiments, the complementary sequence is in the Ii chain locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 67, SEQ ID NO: 68, or any combination thereof.

[0019] In one aspect of the disclosure, the modified immune cells elicit a reduced immune response in a subject when the modified immune cells are administered to the subject, compared to the immune response elicited by an unmodified immune cell administered to the same subject.

[0020] In some embodiments, the modified immune cells exert a reduced immune response in a subject compared to an immune response exerted by an immune cell comprising an insertion and / or deletion capable of downregulating gene expression of TRAC, TRBC, B2M and CIITA when the modified immune cells are administered to a subject. In some embodiments, the immune response is a graft-versus-host disease (GvHD) response. In some embodiments, the reduced GvHD response by the modified immune cells is compared to a comparable immune cell without a deletion and / or insertion at one or more loci or an immune cell comprising a deletion and / or insertion in TRAC, TRBC, B2M and CIITA. In some embodiments, a reduced GvHD response is elicited against HLA-I mismatched cells or against HLA-II mismatched cells.

[0021] In some embodiments, the GvHD response is reduced by about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 95% or more. In some embodiments, the GvHD response is reduced by about 1 fold or more, about 2 fold or more, about 3 fold or more, about 4 fold or more, about 5 fold or more, about 6 fold or more, about 7 fold or more, about 8 fold or more, about 9 fold or more, about 10 fold or more, about 20 fold or more, about 30 fold or more, about 50 fold or more, about 100 fold or more, about 150 fold or more, or about 200 fold or more.

[0022] In one aspect of the present disclosure, the exogenous nucleic acid encodes a chimeric antigen receptor (CAR). In some embodiments, the CAR comprises an antigen-binding domain, a hinge domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain. In some embodiments, the antigen-binding domain comprises a full-length antibody or an antigen-binding fragment thereof, a Fab, a F(ab)2, a monospecific Fab2, a bispecific Fab2, a trispecific Fab2, a single chain variable fragment (scFv), a diabody, a triabody, a minibody, a V-NAR, or a VhH.

[0023] In some embodiments of the modified immune cells, the transmembrane domain is selected from an artificial hydrophobic sequence, a transmembrane domain of a type I transmembrane protein, the alpha, beta or zeta chain of the T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD2, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, OX40 (CD134), 4-1BB (CD137), ICOS (CD278), CD154, CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, and a transmembrane domain from a killer immunoglobulin-like receptor (KIR).

[0024] In some embodiments of the modified immune cells, the costimulatory domain comprises one or more costimulatory domains of a protein selected from the group consisting of proteins of the TNFR superfamily, CD28, 4-1BB (CD137), OX40 (CD134), PD-1, CD7, LIGHT, CD83L, DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, ICOS (CD278), NKG2C, B7-H3 (CD276), and the intracellular domain from a killer immunoglobulin-like receptor (KIR) or a variant thereof.

[0025] In some embodiments of the modified immune cells, the intracellular signaling domain comprises an intracellular domain selected from the group consisting of a cytoplasmic signaling domain of human CD2, CD3 zeta chain (CD3ζ), FcγRIII, FcsRI, the cytoplasmic tail of an Fc receptor, a cytoplasmic receptor with an immunoreceptor tyrosine-based activation motif (ITAM), TCR zeta, FcR gamma, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d, or a variant thereof.

[0026] In some embodiments of the modified immune cells, the antigen binding domain that targets the tumor antigen is associated with a hematological malignancy and / or associated with a solid tumor. In some embodiments, the antigen binding domain targets a tumor antigen selected from the group consisting of ROR1, mesothelin, c-Met, PSMA, PSCA, folate receptor alpha, folate receptor beta, EGFR, EGFRvIII, GPC2, GPC2, mucin 1 (MUC1), Tn antigen ((TnAg) or (GalNAca-Ser / Thr)), TnMUC1, GDNF family receptor alpha 4 (GFRa4), fibroblast activation protein (FAP), and interleukin-13 receptor subunit alpha 2 (IL-13Ra2 or CD213A2).

[0027] In some embodiments, the CAR comprises (a) a PSMA antigen binding domain, a CD2 costimulatory domain, and a CD3 zeta intracellular signaling domain; or (b) a mesothelin antigen binding domain, a 4-1BB costimulatory domain, and a CD3 zeta signaling domain; or (c) a TnMUC1 antigen binding domain, a CD2 costimulatory domain, and a CD3 zeta signaling domain.

[0028] In one aspect of the disclosure, the modified immune cell further comprises a switch receptor, in some embodiments, the switch receptor comprises an extracellular domain of a signaling protein associated with a negative signal, a transmembrane domain, and an intracellular domain of a signaling protein associated with a positive signal.

[0029] In some embodiments, the modified immune cells further comprise the dominant negative receptor. In some embodiments, the dominant negative receptor comprises (a) a truncated variant of a wild-type protein associated with a negative signaling, or (b) a variant of a wild-type protein associated with a negative signaling, comprising an extracellular domain, a transmembrane domain, and substantially lacking an intracellular signaling domain, or (c) the extracellular domain and a transmembrane domain of a signaling protein associated with a negative signaling. In some embodiments, the dominant negative receptor is a PD1, VSIG3, VISG8, or TGFβR dominant negative receptor.

[0030] In some embodiments, the protein associated with a negative signal is selected from the group consisting of CTLA4, PD-1, TGFβRII, BTLA, VSIG3, VSIG8, and TIM-3. In some embodiments, the protein associated with a positive signal is selected from the group consisting of CD28, 4-1BB, IL12Rβ1, IL12Rβ2, CD2, ICOS, and CD27.

[0031] In some embodiments, the switch receptor is PD-1-CD28, PD-1A132L-CD28, PD-1-CD27, PD-1 A132L -CD27, PD-1-4-1BB, PD-1 A132L -4-1BB, PD-1-ICOS, PD-1 A132L -ICOS, PD-1-IL12Rβ1, PD-1 A132L -IL12Rβ1, PD-1-IL12Rβ2, PD-1 A132L-IL12Rβ2, VSIG3-CD28, VSIG8-CD28, VSIG3-CD27, VSIG8-CD27, VSIG3-4-1BB, VSIG8-4-1BB, VSIG3-ICOS, VSIG8-ICOS, VSIG3-IL12Rβ1, VSIG8-IL12Rβ1, VSIG3-IL12Rβ2, VSIG8-IL12Rβ2, TGFβRII-CD27, TGFβRII-CD28, TGFβRII-4-1BB, TGFβRII-ICOS, TGFβRII-IL12Rβ1 and TGFβRII-IL12Rβ2.

[0032] In some embodiments of the modified immune cells, the transmembrane domain of the switch receptor is selected from a transmembrane domain of a protein selected from the group consisting of CTLA4, PD-1, VSIG3, VSIG8, TGFβRII, BTLA, TIM-3, CD28, 4-1BB, IL12Rβ1, IL12Rβ2, CD2, ICOS, and CD27. In some embodiments, the transmembrane domain of the switch receptor is selected from a transmembrane portion of a protein associated with a negative signal or a transmembrane domain of a protein associated with a negative signal.

[0033] In some aspects, the disclosure provides an isolated modified T cell comprising at least one dysfunctional polypeptide selected from the group consisting of CD3 delta, CD3 epsilon, CD3 gamma, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (li chain). In some embodiments, the modified T cell comprising the dysfunctional polypeptide exhibits at least one of the following: (i) reduced expression of T cell receptor compared to an unmodified T cell, (ii) reduced expression of an impaired polypeptide, (iii) a complete lack of surface expression of the T cell receptor complex, and / or (iv) reduced or insufficient cross-linking of the T cell receptor. In some embodiments, the T cell exhibits a reduced immune response in a subject when the modified T cell is administered to the subject compared to the immune response exhibited by an unmodified T cell administered to the same subject.

[0034] In some embodiments, the T cell comprises two or more dysfunctional polypeptides, and a second dysfunctional polypeptide is a T cell receptor alpha chain (TRAC) and / or a T cell receptor beta chain (TRBC).

[0035] In some embodiments, the modified T cells comprise: (a) three or more dysfunctional polypeptides selected from TRAC, CD3 delta, CD3 epsilon, CD3 gamma, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, or Ii chain; or (b) two dysfunctional polypeptides selected from CD3 alpha, CD3 delta, CD3 epsilon, CD3 gamma, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, or Ii chain; or (c) two dysfunctional polypeptides selected from CD3 alpha, CD3 delta, CD3 epsilon, CD3 gamma, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, or Ii chain. (d) three dysfunctional polypeptides selected from the group consisting of CD3δ, CD3ε and CD3γ and at least one dysfunctional polypeptide selected from TRAC, TRBC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP or Ii chain; or (e) a dysfunctional polypeptide selected from the group consisting of CD3δ, CD3ε and CD3γ and at least one dysfunctional polypeptide selected from TRAC, TRBC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP or Ii chain.

[0036] In some embodiments, the modified T cells comprise: (a) a dysfunctional CD3 delta and at least one dysfunctional polypeptide selected from TRAC, TRBC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, or Ii chain; (b) a dysfunctional CD3 epsilon and at least one dysfunctional polypeptide selected from TRAC, TRBC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, or Ii chain; or (c) a dysfunctional CD3 gamma and at least one dysfunctional polypeptide selected from TRAC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, or Ii chain.

[0037] In some embodiments, the modified T cells comprise two or more impaired polypeptides selected from TRAC, TRBC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, or Ii chain. In some embodiments, the modified T cells have reduced expression of TRAC, TRBC, CD3 delta, CD3 epsilon, CD3 gamma, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, Ii chain, or any combination thereof. In some embodiments, the modified T cells do not express CD3 delta, CD3 epsilon, CD3 gamma, TRAC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, Ii chain, or any combination thereof.

[0038] In some embodiments, the modified T cells further comprise an impaired polypeptide selected from TRAC, TRBC, B2M, and C2TA. In some embodiments, the modified T cells have reduced expression of TRAC, TRBC, B2M, or C2TA, or do not express TRAC, TRBC, B2M, or C2TA. In some embodiments, modification of CD3δ, CD3ε, and / or CD3γ leads to impaired function of the TCR / CD3 complex. At least one of CD3δ, CD3ε, or CD3γ is modified by targeting one or more exons of CD3δ, CD3ε, or CD3γ, optionally exon 1 of CD3δ, CD3ε, or CD3γ.

[0039] One aspect of the disclosure provides a method of generating modified immune cells, comprising: (a) introducing into an immune cell one or more nucleic acids capable of downregulating gene expression of one or more endogenous immune genes encoding endogenous immune proteins selected from the group consisting of CD3δ, CD3ε, CD3γ, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii chain); (b) introducing into the immune cell an exogenous nucleic acid encoding a chimeric antigen receptor (CAR), a recombinant T cell receptor (TCR), a killer cell immunoglobulin-like receptor (KIR), an antigen-binding polypeptide, a cell surface receptor ligand, or a tumor antigen; and (c) expanding the modified immune cell to generate a population of T cells. In some embodiments, the method of generating modified immune cells further comprises introducing into the immune cell an exogenous nucleic acid encoding a dominant negative receptor, a switch receptor, or a combination thereof.

[0040] In some embodiments, the one or more nucleic acids introduced into the modified immune cells are capable of downregulating gene expression of: (a) a T cell receptor subunit selected from CD3δ, CD3ε, or CD3γ; and / or (b) an HLA class I molecule selected from B2M, TAP1, TAP2, TAPBP, or NLRC5; and / or (c) an HLA class II molecule selected from HLA-DM, RFX5, RFXANK, RFXAP, or invariant chain (Ii chain).

[0041] In some embodiments, the one or more nucleic acids introduced into the modified immune cells are capable of downregulating gene expression of CD3δ and an HLA molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain), and combinations thereof. In some embodiments, the one or more nucleic acids introduced into the modified immune cells are capable of downregulating gene expression of CD3ε and an HLA molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, NLRC5, CIITA, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain), and combinations thereof. In some embodiments, the one or more nucleic acids introduced into the modified immune cells are capable of downregulating gene expression of CD3γ and an HLA molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, NLRC5, CIITA, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain), and combinations thereof.

[0042] In some embodiments, the one or more nucleic acids introduced into the modified immune cells are capable of downregulating the expression of the following genes: (a) CD3ε, B2M and CIITA, (b) CD3ε, B2M and RFX5, (c) CD3ε, B2M and RFXAP, (d) CD3ε, B2M and RFXANK, (e) CD3ε, B2M and HLA-DM, (f) CD3ε, B2M and Ii chain, (g) CD3ε, TAP1 and CIITA, (h) CD3ε, TAP1 and RFX5, (i) CD3ε, TAP1 and RFXAP, (j) CD3ε, TAP1 and RFXANK, (k) CD3ε, TAP1 and HLA-DM, (l) CD3ε, TAP1 and Ii chain, (m) CD3ε, TAP2 and CIITA, (n) CD3ε, TAP2 and RFX5, (o) CD3ε, TAP2 and RFXAP, (p) CD3ε, TAP2 and RFXANK, (q) CD3ε, TAP2 and HLA-DM, (r) CD3ε, TAP2 and Ii chain, (s) CD3ε, NLRC5 and CIITA, (t) CD3ε, NLRC5 and RFX5, (u) CD3ε, NLRC5 and RFXAP, (v) CD3ε, NLRC5 and RFXANK, (w) CD3ε, NLRC5 and HLA-DM, (x) CD3ε, NLRC5 and Ii chain, (y) CD3ε, TAPBP and CIITA, (z) CD3ε, TAPBP and RFX5, (aa) CD3ε, TAPBP and RFXAP, (bb) CD3ε, TAPBP and RFXANK, (cc) CD3ε, TAPBP and HLA-DM or (dd) CD3ε, TAPBP and Ii chain.

[0043] In some embodiments, the one or more nucleic acids introduced into the modified immune cells can downregulate the expression of the following genes: (a) CD3δ, B2M and CIITA, (b) CD3δ, B2M and RFX5, (c) CD3δ, B2M and RFXAP, (d) CD3δ, B2M and RFXANK, (e) CD3δ, B2M and HLA-DM, (f) CD3δ, B2M and Ii chain, (g) CD3δ, TAP1 and CIITA, (h) CD3δ, TAP1 and RFX5, (i) CD3δ, TAP1 and RFXAP, (j) CD3δ, TAP1 and RFXANK, (k) CD3δ, TAP1 and HLA-DM, (l) CD3δ, TAP1 and Ii chain, (m) CD3δ, TAP2 and CIITA, (n) CD3δ, TAP2 and RFX5. (o) CD3δ, TAP2 and RFXAP, CD3δ, TAP2 and RFXANK, CD3δ, TAP2 and HLA-DM, (r) CD3δ, TAP2 and Ii chain, (s) CD3δ, NLRC5 and CIITA, (t) CD3δ, NLRC5 and RFX5, (u) CD3δ, NLRC5 and RFXAP, (v) CD3δ, NLRC5 and RFXANK, (w) CD3δ, NLRC5 and HLA-DM, (x) CD3δ, NLRC5 and Ii chain, (y) CD3δ, TAPBP and CIITA, (z) CD3δ, TAPBP and RFX5, (aa) CD3δ, TAPBP and RFXAP, (bb) CD3δ, TAPBP and RFXANK, (cc) CD3δ, TAPBP and HLA-DM or (dd) CD3δ, TAPBP and Ii chain.

[0044] In some embodiments, the one or more nucleic acids introduced into the modified immune cells are capable of downregulating expression of the following genes: (a) CD3γ, B2M and CIITA, (b) CD3γ, B2M and RFX5, (c) CD3γ, B2M and RFXAP, (d) CD3γ, B2M and RFXANK, (e) CD3γ, B2M and HLA-DM, (f) CD3γ, B2M and Ii chain, (g) CD3γ, TAP1 and CIITA, (h) CD3γ, TAP1 and RFX5, (i) CD3γ, TAP1 and RFXAP, (j) CD3γ, TAP1 and RFXANK, (k) CD3γ, TAP1 and HLA-DM, (l) CD3γ, TAP1 and Ii chain, (m) CD3γ, TAP2 and CIITA, (n) CD3γ, TAP2 and RFX5, (o) CD3γ, TAP2 and RFXAP, (p) CD3γ, TAP2 and RFXANK, (q) CD3γ, TAP2 and HLA-DM, (r) CD3γ, TAP2 and Ii chain, (s) CD3γ, NLRC5 and CIITA, (t) CD3γ, NLRC5 and RFX5, (u) CD3γ, NLRC5 and RFXAP, (v) CD3γ, NLRC5 and RFXANK, (w) CD3γ, NLRC5 and HLA-DM, (x) CD3γ, NLRC5 and Ii chain, (y) CD3γ, TAPBP and CIITA, (z) CD3γ, TAPBP and RFX5, (aa) CD3γ, TAPBP and RFXAP, (bb) CD3γ, TAPBP and RFXANK, (cc) CD3γ, TAPBP and HLA-DM or (dd) CD3γ, TAPBP and Ii chain.

[0045] In some embodiments, the immune cells modified are selected from T cells, natural killer cells (NK cells), natural killer T cells, lymphoid progenitor cells, hematopoietic stem cells, stem cells, macrophages, and dendritic cells. In some embodiments, the immune cells modified are CD4+ T cells or CD8+ T cells. In some embodiments, the immune cells modified are allogeneic T cells or autologous T cells.

[0046] In some embodiments, the nucleic acid is introduced into the immune cell by viral transduction. In some embodiments, the viral transduction comprises contacting the immune cell with a viral vector comprising the one or more nucleic acids. In some embodiments, the viral vector is selected from the group consisting of a retroviral vector, a Sendai virus vector, an adenoviral vector, an adeno-associated virus vector, and a lentiviral vector.

[0047] In some embodiments, each of the one or more nucleic acids capable of downregulating one or more endogenous immune gene expression comprises a gene editing system selected from the following group: (a) a CRISPR-associated (Cas) (CRISPR-Cas) endonuclease system and guide RNA, (b) a TALEN gene editing system, a zinc finger nuclease (ZFN) gene editing system, a meganuclease gene editing system or a megaTALEN gene editing system, and (c) a gene silencing system selected from an antisense RNA, an antigenomeric RNA, an RNAi, an siRNA or an shRNA.

[0048] In some embodiments, the Cas endonuclease comprises Cas3, Cas4, Cas8a, Cas8b, Cas9, Cas10, Cas10d, Cas12a, Cas12b, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas13, Cas14, CasX, Csel, Csy1, Csn2, Cpf1, C2c1, Csm2, Cmr5, Fok1, S. pyogenes Cas9, Staphylococcus aureus Cas9, MAD7 nuclease (V-type CRISPR nuclease), or any combination thereof. In some embodiments, the CRISPR-Cas system comprises a pAd5 / F35-CRISPR vector.

[0049] In some embodiments, the guide RNA of the CRISPR-Cas system comprises a guide sequence complementary to a sequence within one or more loci each encoding an immunity protein selected from the group consisting of CD3 delta, CD3 epsilon, CD3 gamma, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii chain).

[0050] In some embodiments, the guide RNA introduced into the modified immune cell is complementary to a sequence within one or more exons of CD3δ, CD3ε, or CD3γ, hi some embodiments, the guide RNA is complementary to a sequence within exon 1 of CD3δ, CD3ε, or CD3γ.

[0051] In some embodiments, the guide RNA introduced into the modified immune cell is complementary to a sequence in the CD3δ locus, where the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 53. In some embodiments, the guide RNA introduced into the modified immune cell is complementary to a sequence in the CD3ε locus, where the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 52. In some embodiments, the guide RNA introduced into the modified immune cell is complementary to a sequence in the CD3γ locus, where the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 54. In some embodiments, the guide RNA introduced into the modified immune cell is complementary to a sequence in the B2M locus, where the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 55. In some embodiments, the guide RNA introduced into the modified immune cell is complementary to a sequence in the CIITA locus, where the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 61. In some embodiments, the guide RNA introduced into the modified immune cell is complementary to a sequence in the TAP1 locus, where the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 56. In some embodiments, the guide RNA introduced into the modified immune cell is complementary to a sequence in the TAP2 locus, where the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 57. In some embodiments, the guide RNA introduced into the modified immune cell is complementary to a sequence in the TAPBP locus, where the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 58, SEQ ID NO: 59, or any combination thereof. In some embodiments, the guide RNA introduced into the modified immune cell is complementary to a sequence in the NLRC5 locus, where the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 60. In some embodiments, the guide RNA introduced into the modified immune cell is complementary to a sequence in the HLA-DM locus, where the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 62.In some embodiments, the guide RNA introduced into the modified immune cell is complementary to a sequence in the RFX5 locus, where the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 63, SEQ ID NO: 64, or any combination thereof. In some embodiments, the guide RNA introduced into the modified immune cell is complementary to a sequence in the RFXANK locus, where the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 65. In some embodiments, the guide RNA introduced into the modified immune cell is complementary to a sequence in the RFXAP locus, where the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 66. In some embodiments, the guide RNA introduced into the modified immune cell is complementary to a sequence in the Ii chain locus, where the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 67, SEQ ID NO: 68, or any combination thereof.

[0052] In some embodiments, the modified immune cells produced by the methods of the disclosure, when administered to a subject, elicit a reduced immune response in a subject compared to the immune response elicited by an unmodified immune cell administered to the same subject.

[0053] In some embodiments, the modified immune cells generated by the methods of the disclosure exert a reduced immune response in a subject compared to the immune response exerted by an immune cell comprising one or more nucleic acids capable of downregulating gene expression of TRAC, TRBC, B2M, and CIITA when the immune cell is administered to a subject. In some embodiments, the reduced GvHD response by the modified immune cells generated by the methods of the disclosure is compared to a comparable immune cell that does not comprise a deletion and / or insertion at one or more gene loci, or an immune cell that comprises a deletion and / or insertion in TRAC, TRBC, B2M, and CIITA.

[0054] In some embodiments, the immune response is a graft-versus-host disease (GvHD) response. In some embodiments, the reduction in the GvHD response is elicited against HLA-I mismatched cells or HLA-II mismatched cells. In some embodiments, the GvHD response elicited by the modified immune cells generated by the methods of the disclosure is reduced by about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 95% or more. In some embodiments, the GvHD response elicited by the modified immune cells generated by the methods of the disclosure is reduced by about 1-fold or more, about 2-fold or more, about 3-fold or more, about 4-fold or more, about 5-fold or more, about 6-fold or more, about 7-fold or more, about 8-fold or more, about 9-fold or more, about 10-fold or more, about 20-fold or more, about 30-fold or more, about 50-fold or more, about 100-fold or more, about 150-fold or more, or about 200-fold or more.

[0055] In some embodiments, the exogenous nucleic acid introduced into the immune cell encodes a chimeric antigen receptor (CAR), hi some embodiments, the CAR comprises an antigen binding domain, a hinge domain, a transmembrane domain, a costimulatory signaling domain, and an intracellular signaling domain.

[0056] In some embodiments, the antigen binding domain that targets a tumor antigen is associated with a hematological malignancy and / or associated with a solid tumor. In some embodiments, the antigen binding domain targets a tumor antigen selected from the group consisting of ROR1, mesothelin, c-Met, PSMA, PSCA, folate receptor alpha, folate receptor beta, EGFR, EGFRvIII, GPC2, GPC2, mucin 1 (MUC1), Tn antigen ((TnAg) or (GalNAca-Ser / Thr)), TnMUC1, GDNF family receptor alpha 4 (GFRa4), fibroblast activation protein (FAP), and interleukin-13 receptor subunit alpha 2 (IL-13Ra2 or CD213A2).

[0057] In some embodiments, the CAR introduced into the modified immune cells comprises (a) a PSMA antigen binding domain (e.g., SEQ ID NO: 73 or 74), a CD2 costimulatory domain, and a CD3 zeta intracellular signaling domain, or (b) a mesothelin antigen binding domain (e.g., SEQ ID NO: 75), a 4-1BB costimulatory domain, and a CD3 zeta signaling domain, or (c) a TnMUC1 antigen binding domain, a CD2 costimulatory domain, and a CD3 zeta signaling domain. In some embodiments, the TnMUC1 CAR comprises the amino acid sequence set forth in SEQ ID NO: 70, and the mesothelin CAR comprises the amino acid sequence set forth in SEQ ID NO: 71 or SEQ ID NO: 72. In some embodiments, the TnMUC1 CAR is encoded by the nucleic acid sequence set forth in SEQ ID NO: 69.

[0058] In one embodiment of the present disclosure, the switch receptor introduced into the modified immune cell comprises (a) an extracellular domain of a signaling protein associated with a negative signal selected from the group consisting of CTLA4, PD-1, VISG3, VSIG8, TGFβRII, BTLA, and TIM-3, (b) a transmembrane domain, and (c) an intracellular domain of a signaling protein associated with a positive signal selected from the group consisting of CD28, 4-1BB, IL12Rβ1, IL12Rβ2, CD2, ICOS, and CD27.

[0059] In some embodiments, the switch receptor is PD-1-CD28, PD-1 A132L -CD28, PD-1 -CD27, PD-1 A132L -CD27, PD-1-4-1BB, PD-1 A132L -4-1BB, PD-1-ICOS, PD-1 A132L -ICOS, PD-1-IL12Rβ1, PD-1 A132L -IL12Rβ1, PD-1-IL12Rβ2, PD-1 A132L-IL12Rβ2, VSIG3-CD28, VSIG8-CD28, VSIG3-CD27, VSIG8-CD27, VSIG3-4-1BB, VSIG8-4-1BB, VSIG3-ICOS, VSIG8-ICOS, VSIG3-IL12Rβ1, VSIG8-IL12Rβ1, VSIG3-IL12Rβ2, VSIG8-IL12Rβ2, TGFβRII-CD27, TGFβRII-CD28, TGFβRII-4-1BB, TGFβRII-ICOS, TGFβRII-IL12Rβ1 and TGFβRII-IL12Rβ2.

[0060] In some embodiments, the dominant negative receptor introduced into the modified immune cells comprises (a) a truncated variant of a wild-type protein associated with negative signaling, or (b) a variant of a wild-type protein associated with negative signaling that comprises an extracellular domain, a transmembrane domain and substantially lacks an intracellular signaling domain, or (c) the extracellular domain and a transmembrane domain of a signaling protein associated with negative signaling. In some embodiments, the dominant negative receptor is a PD1, VSIG3, VISG8 or TGFβR dominant negative receptor.

[0061] In some embodiments, the transmembrane domain of the switch receptor is selected from a transmembrane domain of a protein selected from the group consisting of CTLA4, PD-1, BTLA, TGFβRII, BTLA, TIM-3, CD28, 4-1BB, IL12Rβ1, IL12Rβ2, CD2, ICOS, and CD27. In some embodiments, the transmembrane domain of the switch receptor is selected from a transmembrane portion of a protein associated with a negative signal or a transmembrane domain of a protein associated with a negative signal.

[0062] In one aspect of the disclosure, the method provides for the expansion of the modified immune cells. In some embodiments, the expansion of the modified immune cells comprises culturing the T cells with a factor selected from the group consisting of flt3-L, IL-1, IL-3, IL-2, IL-7, IL-15, IL-18, IL-21, TGFbeta, IL-10, and c-kit ligand. In one aspect of the disclosure, the method further comprises introducing into the immune cells polypeptides and / or nucleic acids encoding Klf4, Oct3 / 4, and Sox2 to induce pluripotency of the immune cells.

[0063] In some embodiments, the immune cells are obtained from a blood sample, a whole blood sample, a peripheral blood mononuclear cell (PBMC) sample, or an apheresis sample. In some embodiments, the apheresis sample is a cryopreserved sample. In some embodiments, the apheresis sample is a fresh sample. In some embodiments, the immune cells are obtained from a human subject.

[0064] In one aspect of the disclosure, there is provided a population of modified immune cells obtained from the method of any one of the preceding embodiments. In some embodiments, the composition comprises the modified immune cells of any one of the preceding embodiments. In some embodiments, the composition comprises a population of modified immune cells produced by the method disclosed in any one of the preceding embodiments and a pharma- ceutically acceptable carrier or excipient.

[0065] One aspect of the present disclosure provides a method of treating a disease or condition associated with immune enhancement in a subject, comprising administering to a subject in need thereof an effective amount of a composition disclosed in any one of the preceding embodiments. In some embodiments, the condition is cancer. In some embodiments, the cancer is selected from the group consisting of breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, renal cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, and any combination thereof. In some embodiments, the cancer is a solid tumor or a hematological malignancy. In some embodiments, the method includes a method of treating cancer comprising administering to a subject the modified immune cells of any one of the preceding embodiments, the population of modified T cells of any one of the preceding embodiments, or the composition of any one of the preceding embodiments.

[0066] One aspect of the present disclosure provides a method of stimulating T cells against a target cell or tissue in a subject comprising administering to the subject an effective amount of a pharmaceutical composition comprising the modified immune cells of any one of the preceding embodiments, a population of modified immune cells of any one of the preceding embodiments, or a composition of any one of the preceding embodiments.

[0067] One aspect of the present disclosure provides a kit comprising the modified immune cells of any one of the preceding embodiments, the population of modified T cells of any one of the preceding embodiments, or the composition of any one of the preceding embodiments, and optionally instructions for use.

[0068] Both the foregoing summary and the following drawings and detailed description are exemplary and explanatory and are intended to provide further details of the present disclosure and are not to be construed as limiting. Other objects, advantages and novel features will be readily apparent to those skilled in the art from the following detailed description of the present disclosure. [Brief description of the drawings]

[0069] 1 shows a schematic diagram of the human T cell receptor (TCR)-CD3 complex, which comprises the variable TCR alpha chain (TCR-α, TRAC) and the TCR beta chain (TCR-β, TRBC) bound to three dimeric modules CD3δ / CD3ε, CD3γ / CD3ε and CD3ζ / CD3ζ. The CD3δ / CD3ε and CD3γ / CD3ε modules are the subject of the present disclosure.

[0070] Figures 2A-2C are bar graphs showing the efficiency of disruption of TCR-α and TCR-β chains on human T cells as measured by flow cytometry following targeted disruption of the CD3δ (Figure 2A), CD3ε (Figure 2B), and CD3γ (Figure 2C) genes using the CRISPR / Cas system.

[0071] Figure 3 is a graph showing the expansion of allogeneic CAR T cells generated using the strategy of Figure 1, showing population doublings over 10 days. The allogeneic CAR T cells tested were recombinant T cells including TRAC knockout (TRAC KO), CD3δ knockout (D1 KO), CD3γ knockout (G4 KO) and CD3ε knockout (E4 KO).

[0072] Figures 4A and 4B show flow cytometry results comparing CRISPR-mediated downregulation of TCR-α chain (TRAC) knockout, CD3δ knockout (D1 KO), CD3γ knockout (G4 KO) and CD3ε knockout (E4 KO). Figure 4A shows that CD3ε knockout (E4 KO) is a better target for T cell receptor knockout as measured by surface expression of TCR-α / β chains. Figure 4B shows that allogeneic CAR T cells containing CD3ε knockout (E4 KO) have higher transduction efficiency and are functionally superior to CAR T cells containing, for example, CD3γ or CD3δ knockout; an embodiment of PSMA CAR T cells is illustrated.

[0073] Figure 5 is a graph showing the tumor killing ability of allogeneic PSMA CAR T cells containing TCR-α chain (TRAC) knockout, CD3δ knockout (D1), CD3ε knockout (E4) and CD3γ knockout (G4), showing that PSMA E4 allogeneic CAR T cells have the best killing ability. Target cells are PC3 cells.

[0074] Figures 6A-6D show CRISPR-Cas activity illustrated using the T7 endonuclease mismatch detection assay (T7E1). Figure 6A shows a representative gel electrophoresis image of T7E1-treated PCR products amplified from three different sites of the CRISPR-Cas C2TA (CIITA) gene using three different gRNAs. Figures 6B-6D show electropherograms generated by an Agilent Bioanalyzer electropherograms of the T7E1 endonuclease assay showing CRISPR-Cas editing efficiency.

[0075] Figures 7A-D show Agilent Bioanalyzer electropherograms and gel electrophoresis of control and T7E1 treated PCRs showing the results of C2TA (CIITA) CRISPR editing efficiency. In particular, Figure 7A shows the combined results for sample C2TA-1-PCR, Figure 7B shows the combined results for sample C2TA-1-T7E1, Figure 7C shows the combined results for sample C2TA-2-PCR, and Figure 7D shows the combined results for sample C2TA-2-T7E1.

[0076] Figure 8 is a graph showing the results of a mixed lymphocyte reaction (MLR) assay; showing the viability of control T cells (second donor), allogeneic PSMA CAR T cells alone or in co-culture; and showing that T cells from a second (unrelated) donor do not proliferate in response to allogeneic PSMA CAR T cells in co-culture, despite the presence of an HLA mismatch. The allogeneic CAR T cells contain a PSMA CAR and a CRISPR-edited TRAC / B2M / C2TA gRNA. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0077] Detailed Description: I. Overview: The T cell receptor (TCR) complex is a large multisubunit complex consisting of at least eight polypeptide subunits (TCRαβ, CD3εγ, CD3εδ, CD3ζζ). The TCRαβ heterodimer is the ligand-binding subunit responsible for the recognition of antigens bound to major histocompatibility complex class I and class II molecules. CD3ε, CD3γ, CD3δ and CD3ζ are organized as dimers to form three dimeric modules CD3δ / CD3ε, CD3γ / CD3ε and CD3ζ / CD3ζ that transduce the signal generated by the TCRαβ heterodimer. To date, the strategy for evading GvHD and / or HvHD has been the generation of allogeneic T cells involving downregulation of the TCRα chain by targeted disruption of the TRAC locus. Prior to the present disclosure, the regulatory role of CD3ε, CD3γ, CD3δ, and CD3ζ in promoting GvHD and HvHD had not been investigated, as disruption of CD3α / β was believed to be important for successful generation of allogeneic T cells. The present disclosure details the surprising discovery that targeted disruption of the CD3ε, CD3γ, CD3δ, and CD3ζ loci generated allogeneic CAR T cells that were equivalent and / or more efficient than CAR T cells containing targeted disruption of the TRAC locus. In the present disclosure, disruption of at least one of the CD3ε, CD3γ, CD3δ genes is preferred.

[0078] The present invention includes methods and compositions for generating modified T cells by knocking down expression of one or more endogenous T cell receptor complex genes and expressing any of a chimeric antigen receptor (CAR), a recombinant T cell receptor (TCR), a killer cell immunoglobulin-like receptor (KIR), an antigen-binding polypeptide, a cell surface receptor ligand, a tumor antigen, a dominant negative receptor, a switch receptor, a chemokine, a chemokine receptor, a cytokine, or a cytokine receptor.

[0079] Thus, the present invention is based on the observation that modified immune cells comprising at least one of gene-edited CD3δ, CD3ε, CD3ζ, and / or CD3γ genes of the T cell receptor complex in combination with a chimeric antigen receptor (CAR) and / or a switch receptor, and / or an immune enhancing factor are improved allogeneic T cells with enhanced fitness that exhibit potent cytoplasmic activity against various cancer cell lines in vitro and significant tumor eradication in vivo when compared to standard allogeneic T cells known in the art.

[0080] Adoptive immunotherapy holds great promise for cancer patients, but there are currently several challenges associated with the production of CAR-T and TCR cells that impact the likelihood of success of adoptive immunotherapy.

[0081] Despite the approval and general success of allogeneic adoptive immunotherapy, the scalability and feasibility of such therapy remain significant challenges. In particular, the widespread clinical application of adoptive immunotherapy is limited by the substantial economic constraints imposed by the personalized preparation of allogeneic CAR T cells. However, standardized adoptive immunotherapy, in which allogeneic cells are pre-manufactured, extensively characterized, and readily available for administration to a wide range of patients, remains a risky method with many potential complications, including allogeneic T-cell reactions. Allogeneic T-cell reactions are clinically manifested as graft-versus-host disease (GVHD) and / or host-versus-graft disease (HvGD, graft rejection). GvHD is caused by the attack of recipient tissues by allogeneic CAR-T cell infusion via alloreactive TCRs on donor CAR cells. In particular, the endogenous T cell receptor alpha (TCRα; TRAC) and beta (TCRβ; TRBC) chains on the infused T cells recognize major and minor histocompatibility antigens in the receptor, leading to GvHD. Conversely, the infused allogeneic CAR T cells may be rejected by the recipient's T lymphocytes, leading to HvGD. In particular, the endogenous T cell receptor alpha (TCRα; TRAC) and beta (TCRβ; TRBC) chains on the infused T cells recognize major and minor histocompatibility antigens in the receptor, leading to GvHD. Conversely, the infused allogeneic CAR T cells may be rejected by the recipient's T lymphocytes, leading to HvGD.

[0082] Prior to the present disclosure, one approach to address allogeneic T cell responses was to use genome editing techniques to engineer allogeneic T cells to eliminate expression of TCRα, TCRβ, and / or one or more major histocompatibility (MHC) class I (MHC I) and / or MHC class II complexes in allogeneic donor T cells. Because the TCRαβ heterodimer is required for assembly and activity of the entire TCR complex, knocking out expression of either the TCRα or β chains results in the inability of donor CAR T cells to recognize host alloantigens, thereby preventing GVHD. Furthermore, editing MHC I in donor T cells conversely prevents recognition of these allogeneic T cells by recipient T cells, thereby preventing graft rejection. To date, deletion of the α-chain by targeted disruption of the TRAC locus has been utilized as a GVHD avoidance strategy, primarily because the β-chain is encoded by two TRBC genes (TRBC1 and TRBC2), so knocking out the TRBC genes may add further complications.

[0083] The optimal protocol to efficiently deliver Cas9 / sgRNA into T cells with minimal toxicity remains to be established. Furthermore, current techniques do not provide TCR knockout in 100% of CAR T cells. This is important because 100% TCR knockout would be beneficial for successful generation of allogeneic cells useful for CAR T therapy.

[0084] To address this issue, the present disclosure details the disruption of CD3ε, CD3γ and / or CD3δ genes (see FIG. 1 ), individually and in combination with at least one other gene knockout, as detailed in Table 1 below. (The CD3ζ gene can also be disrupted). The present disclosure also encompasses constructs and uses thereof in which at least one of CD3ε, CD3γ and / or CD3δ (and optionally the CD3ζ gene) is disrupted. Disruption of at least one of CD3ε, CD3γ and / or CD3δ (and optionally the CD3ζ gene) can also be combined with disruption of one or more of CD3α and CD3β (e.g., knockout of CD3ε and CD3γ genes, knockout of CD3ε and CD3α genes, knockout of CD3γ and CD3δ genes, etc.). See, e.g., Example 2 and Table 1. This illustrates the novel allogeneic CAR T strategy of the present invention, which includes the knockout (KO) of alternative T cell receptor subunits (CD3δ, CD3γ and CD3ε) and additional key genes in the antigen processing and presentation pathway. [Table 1]

[0085] Surprisingly, it was found that two or three (or more) disruptions were successful in preventing T cell receptor expression, resulting in TCR downregulation with minimal toxicity.

[0086] Furthermore, TRAC-negative T cells have been shown to survive longer within tumors (Stadtmauer et. al., Science, 367(6481):eaba7365(2020)), and it was surprising that focusing on disruption of the CD3ε, CD3γ, CD3ζ, and / or CD3δ genes would still generate T cells effective for adoptive immunotherapy (although as noted above, the present disclosure also encompasses disruption of one or more CD3ε, CD3γ, CD3ζ, and / or CD3δ genes in combination with disruption of the CD3α and / or CD3β genes).

[0087] The present disclosure provides novel and alternative approaches to modulate the functional properties of T cells by alternating and regulating TCR signaling associated with allogeneic T cell responses. In particular, the present disclosure shows that downregulating at least one of the CD3ε, CD3γ, CD3ζ and / or CD3δ genes, alone or in combination with one or more additional TCR complex components, significantly reduces allogeneic T cell responses while maintaining the beneficial anti-tumor properties of CAR T cells, thereby generating safe and effective CAR T cells. The advantages of these novel and alternative approaches are described in more detail below. II. Experimental results:

[0088] The percentage of disruption efficiency of TCR-α and TCR-β chains in human T cells was measured by flow cytometry after targeted disruption of CD3δ (FIG. 2A), CD3ε (FIG. 2B) and CD3γ (FIG. 2C) genes using the CRISPR / Cas system (see also Example 3 below). FIG. 2A shows the results after disruption of CD3δ using four different guide RNAs: gRNA1, gRNA2, gRNA3 and gRNA4. Targeted disruption of CD3δ using gRNA1 and gRNA3 guide RNAs in the CRISPR / Cas system resulted in 100% KO efficiency of TCRα / β, whereas using gRNA2 and gRNA4 in the CRISPR / Cas system resulted in about 90% or more KO efficiency of TCRα / β. Therefore, it is preferable to use gRNA1 and gRNA3 in the CRISPR / Cas system to disrupt CD3δ.

[0089] FIG. 2B shows the results after targeted disruption of CD3ε using five different guide RNAs (gRNA1, gRNA2, gRNA3, gRNA4 and gRNA5). Disruption of CD3ε using gRNA4 and gRNA5 guide RNAs in the CRISPR / Cas system resulted in 100% KO efficiency of TCR α / β, whereas use of gRNA1 resulted in only about 50% KO efficiency of TCR α / β, and finally, use of guide gRNA2 and gRNA3 in the CRISPR / Cas system resulted in more than about 90% KO efficiency of TCR α / β. Therefore, the use of gRNA4 and gRNA5 guide RNAs is preferred in the CRISPR / Cas system for disrupting CD3ε.

[0090] FIG. 2C shows the results after targeted disruption of CD3γ using five different guide RNAs (gRNA1, gRNA2, gRNA3, gRNA4, gRNA5). Disruption of CD3ε using gRNA4 guide RNA in the CRISPR / Cas system resulted in 100% KO efficiency of TCR α / β, whereas use of gRNA5 resulted in approximately >95% KO efficiency of TCR α / β, and finally, use of gRNA1, gRNA2 and gRNA3 guide RNA in the CRISPR / Cas system resulted in less favorable KO efficiency of TCR α / β. Therefore, the use of gRNA4 guide RNA is preferred in the CRISPR / Cas system for disrupting CD3γ.

[0091] In another experiment, detailed in Example 4 below, the proliferation of different constructs of allogeneic CAR T cells over a 10-day period was evaluated. This data is important because, if the modified immune cells do not proliferate, sufficient numbers of cells will not be generated for successful therapy. The different constructs tested include allogeneic CAR T cells with (1) TRAC knockout (ALLO(TRAC KO) in FIG. 3) (e.g., knockouts used prior to this disclosure), (2) CD3δ knockout (ALLO(D1 KO) in FIG. 3), (3) CD3γ knockout (ALLO(G4 KO) in FIG. 3), and (4) CD3ε knockout (ALLO(E4 KO) in FIG. 3). The doubling rate of the cell population is displayed on the Y-axis and the number of days is displayed on the X-axis. The results detailed in FIG. 3 show that all modified cells showed approximately 4-fold or greater proliferation over a 9-day period, demonstrating that the modified cells produce useful quantities of substances useful for immunotherapy.

[0092] In Example 5, several different knockout constructs were evaluated to assess surface expression of the TCR-α / β chain. In particular, Figures 4A and 4B show flow cytometry results comparing the downregulation of CRISPR-mediated TCR-α chain (TRAC) knockout (e.g., constructs used prior to this disclosure), CD3δ knockout (D1 KO), CD3γ knockout (G4 KO) and CD3ε knockout (E4 KO). Figure 4A shows that CD3ε knockout (E4 KO) was a better target for T cell receptor knockout as measured by surface expression of TCR-α / β chain. Figure 4B shows that allogeneic CAR T cells containing CD3ε knockout (E4 KO) have higher transduction efficiency and are functionally superior to CAR T cells containing, for example, CD3γ or CD3δ knockout, and an embodiment of PSMA CAR T cells is shown. Furthermore, Figure 4B shows that the majority of the CAR T cells were allogeneic (CD3 and TCR negative), meaning that patients receiving the CAR T cells of the present invention are infused with more allogeneic CAR T cells.

[0093] In further experiments detailed in Example 6 below, the tumor killing capacity of different PSMA CAR T cell constructs was evaluated, as shown in Figure 5. In particular, Figure 5 shows a graph depicting the tumor killing capacity of allogeneic PSMA CAR T cells with TCR-α chain (TRAC) knockout (e.g., constructs used prior to this disclosure), CD3δ knockout (D1), CD3ε knockout (E4), and CD3γ knockout (G4). The results show that PSMA E4 allogeneic CAR T cells have the highest killing capacity. The target cells were PC3 cells, a human prostate cancer cell line. Unexpectedly, E4 was found to be more potent than D1 and G4. Allogeneic CAR T cells made targeting the CD3ε molecule were more potent (e.g., kill tumor cells faster, etc.) compared to other allogeneic CAR T cells evaluated. The high potency of CD3ε knockout (E4) CAR T cells means that the tumor cells targeted by these CAR T cells are eradicated much faster compared to TCR-α chain (TRAC) knockout CAR T cells, CD3δ knockout (D1) CAR T cells and / or CD3γ knockout (G4) CAR T cells, and time is of the essence for the success of our allogeneic therapy strategy in patients.

[0094] Example 7 describes the evaluation of the efficacy of the CRISPR-Cas methodology to effectively knock out targeted genes. In particular, Figures 6A-6D show CRISPR-Cas activity as demonstrated by the T7 endonuclease mismatch detection assay (T7E1). Figure 6A shows a representative gel electrophoresis image of T7E1-treated PCR products amplified from three different CRISPR-Cas C2TA (CIITA) gene sites using three different gRNAs. Figures 6B-6D show electropherograms generated by an Agilent Bioanalyzer electropherogram of the T7E1 endonuclease assay showing CRISPR-Cas editing efficiency.

[0095] Additionally, Figures 7A-D show Agilent Bioanalyzer electropherograms and gel electrophoresis of control and T7E1 treated PCRs showing the results of C2TA (CIITA) CRISPR editing efficiency: Figure 7A shows the overall results of sample C2TA-1-PCR, Figure 7B shows the overall results of sample C2TA-1-T7E1, Figure 7C shows the overall results of sample C2TA-2-PCR, and Figure 7D shows the overall results of sample C2TA-2-T7E1.

[0096] Finally, a mixed lymphocyte assay (MLA) was performed. Figure 8 is a graph showing the results of a mixed lymphocyte reaction (MLR) assay with allogeneic cells only, T cells (second donor, T cells from another donor) only, allogeneic cells in co-culture, and T cells in co-culture (second donor). In particular, recipient T cells (T cells from another donor) were co-cultured with allogeneic CAR T cells for 14 days and T cell proliferation was analyzed. The results show the viability of control T cells (second donor), allogeneic PSMA CAR T cells alone or co-cultured, and demonstrate that the "recipient" T cells did not respond (proliferate) to the presence of allogeneic cells. Thus, Figure 8 shows that T cells from a second (unrelated) donor did not proliferate in response to co-cultured allogeneic PSMA CAR T cells, despite the presence of an HLA mismatch. The allogeneic CAR T contains PSMA CAR T and CRISPR-edited TRAC / B2M / C2TA gRNA. Thus, the allogeneic CAR T cells of the present invention will have the opportunity to kill tumor cells without being detected by the recipient's immune system (i.e., T cells). III. Allogeneic T cells: A. Downregulation of endogenous immune proteins:

[0097] One aspect of the present disclosure provides modified immune cells comprising: (1) an insertion and / or deletion at one or more loci encoding endogenous immune proteins, respectively; and (2) an exogenous nucleic acid encoding a chimeric antigen receptor (CAR), a recombinant T cell receptor (TCR), a killer cell immunoglobulin-like receptor (KIR), an antigen-binding polypeptide, a cell surface receptor ligand, or a tumor antigen. Thus, the modified cells of the present invention are genetically edited to disrupt expression of any of the endogenous genes described herein. In some embodiments, the modified cells comprising the recombinant TCR or CAR expression system of the present invention are genetically edited to disrupt expression of one or more endogenous genes described herein. In some embodiments, one or more of CD3δ, CD3ε, CD3γ, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii chain) are disrupted to generate allogeneic T cells (i.e., universal immune cells). As used herein, the term "universal immune cell" or "universal T cell" refers to allogeneic immune cells or T cells that are pre-modified / pre-manufactured for administration to any patient. In some embodiments, the modified immune cells of the present invention are allogeneic T cell products with reduced or suppressed allogeneic T cell responses. In some embodiments, downregulation of one or more loci of endogenous immune proteins reduces and / or eliminates GvHD and / or HvHD.

[0098] In some embodiments, when the modified immune cells are administered to a subject, the immune cells exert a reduced immune response in the subject compared to the immune response exerted by unmodified immune cells administered to the same subject. In some embodiments, the immune cells of the present disclosure exert a reduced immune response in the subject compared to the immune response exerted by an immune cell comprising an insertion and / or deletion capable of downregulating gene expression of TRAC, TRBC, B2M and CIITA when the modified immune cells are administered to a subject. In some embodiments, the immune response is a graft-versus-host disease (GvHD) or host-versus-graft disease (HvHD; graft rejection) response. In some embodiments, the reduced GvHD response is elicited against HLA-I mismatched cells or against HLA-II mismatched cells. In some embodiments, the GvHD response is reduced by about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 95% or more. In some embodiments, the GvHD response is reduced by about 1 fold or more, about 2 fold or more, about 3 fold or more, about 4 fold or more, about 5 fold or more, about 6 fold or more, about 7 fold or more, about 8 fold or more, about 9 fold or more, about 10 fold or more, about 20 fold or more, about 30 fold or more, about 50 fold or more, about 100 fold or more, about 150 fold or more, or about 200 fold or more. In some embodiments, the reduction in the GvHD response by the modified immune cells is compared to a comparable immune cell without a deletion and / or insertion at one or more gene loci or an immune cell that includes a deletion and / or insertion in TRAC, TCRβ, B2M, and CIITA.

[0099] In some embodiments, the insertion and / or deletion in one or more loci can downregulate gene expression of one or more endogenous immune protein loci. In some embodiments, the endogenous immune protein is one of the components of the TCR complex. In some embodiments, the endogenous immune protein is one or more of CD3ε, CD3γ, CD3δ, and CD3ζ, which are organized as heterodimers and form three dimeric modules CD3δ / CD3ε, CD3γ / CD3ε, and CD3ζ / CD3ζ that transmit signals generated by ligands that bind to the TCRαβ heterodimer. In some embodiments, the ligand is an antigen bound to a major histocompatibility complex class I and class II (MHC-I, MHC-II) molecule, which is recognized by the TCRαβ heterodimer.

[0100] In some embodiments, the endogenous immune proteins are MHC class I (MHC-I) and / or MHC class II (MHC-II) molecules. In some embodiments, the endogenous immune protein is selected from the group consisting of B2M (Beta-2-microglobulin), CIITA (class II transactivator), TAP1 (ABC transporter associated with antigen processing 1; Transport 1, ATP Binding Cassette Subfamily B Member), TAP2 (ABC transporter associated with antigen processing 2; Transport 2, ATP Binding Cassette Subfamily B Member), TAPBP (TAP binding protein; Tapasin; TAP associated protein), NLRC5 (NLR Family CARD Domain Containing 5), HLA-DM, RFX5 (Regulatory Factor X5), and the like. X5), RFXANK (Regulatory Factor X Associated Ankyrin Containing Protein), RFXAP (Regulatory Factor X Associated Protein), and invariant chain (Ii chain).

[0101] Similar to TCR, MHC-I and MHC-II play important roles in activating adaptive immune responses by presenting antigens to T lymphocytes. Humans have three major MHC-I loci (HLA-A, HLA-B, and HLA-C), which are essential for the detection and elimination of viruses, cancer cells, and transplanted cells. In addition, there are three non-classical MHC-I molecules (HLA-E, HLA-F, and HLA-G) that have immune regulatory functions. Human MHC-II molecules also contain three loci (HLA-DP, HLA-DQ, and HLA-DR). MHC classes I and II each contain several regulatory proteins. The MHC-I regulatory proteins include antigen-processing molecules such as beta2-microglobulin (B2M), TAP1, TAP2, and TAPBP, and transcriptional regulators such as NLRC5. The Tap1, Tap2 and TAPBP are part of the TAP transporter complex essential for loading peptide antigens into the class I HLA complex. Downregulation of expression of any of B2M, NLRC5, Tap1, Tap2 and TAPBP reduces cell surface expression of MHC class I proteins and impairs immune responses. In some embodiments, the endogenous immune proteins contemplated by the present disclosure are MHC-I genes selected from the group consisting of B2M, TAP1, TAP2, TAPBP, NLRC5 and combinations thereof.

[0102] MHC-II regulatory proteins include transcriptional regulators CIITA, RFX5, RFXANK, RFXAP; and chaperone proteins involved in the formation and transport of MHC class II peptides, invariant chain (Ii chain) and human leukocyte antigen DM (HLA-DM, HLA-DMA), HLA-DOA and HLA-DOB. RFX5, RFXANK, RFXAP are subunits of the trimeric RFX DNA-binding complex that specifically binds to all MHC class II gene promoters to regulate their transcription. The invariant chain (Ii) functions as an MHC class II chaperone that prevents peptide loading in the ER, stimulates exit from the ER, and regulates antigen peptide loading. Similar to TAPBP, HLA-DM (e.g., HLA-DMA) assists peptide loading of MHC-II molecules during intracellular transport. HLA-DM eliminates / prevents the display of weakly binding peptides to MHC-II proteins by inducing T cell responses to "immunodominant" regions of antigens. In some embodiments, HLA-DM (e.g., HLA-DMA) promotes the elimination of potentially autoreactive T cells in processing self-proteins. In some embodiments, the endogenous immune protein contemplated by the present disclosure is an MHC-II gene selected from the group consisting of CIITA, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain), and combinations thereof.

[0103] Thus, reduction of HvHD or GvHD by efficient removal of the HLA barrier can be achieved by downregulating one or more of the following: (1) targeting polymorphic MHC-I genes (HLA-A, -B, -C) and / or MHC-II genes (HLA-DP, -DQ, -DR); (2) targeting molecules that regulate the transport of all MHC-I molecules to the cell surface, such as B2M, or MHC-I antigen processing molecules, such as TAP1, TAP2 or TAPBP; (3) targeting molecules that regulate the transport of MHC-II molecules, such as invariant chain (Ii or CD74) or HLA-DM; and / or (4) targeting transcriptional regulators of MHC-I (NLRC5) or MHC-II expression (CIITA, RFX-5, RFXANK, RFX-AP).

[0104] In some embodiments, the endogenous immune protein whose gene expression is downregulated by insertion and / or deletion is selected from the group consisting of CD3 delta, CD3 epsilon, CD3 gamma, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain; CD74), or any combination thereof. In some embodiments, modified immune cells (i.e., T cells) having downregulated gene expression of endogenous immune proteins selected from CD3 delta, CD3 epsilon, CD3 gamma, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain, CD74), and combinations thereof, have reduced immunogenicity in an allogeneic environment. In some embodiments, downregulation of the gene expression of CD3δ, CD3ε, CD3γ, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain; CD74) or any combination thereof eliminates surface presentation of the same alloantigen on T cells that may cause HvHD and / or GvHD and / or prevents membrane expression of the T cell receptor.

[0105] In some embodiments, the modified immune cells used to generate an allogeneic T cell product comprise a triple knockout comprising downregulation of one T cell receptor subunit, one HLA class I molecule and one HLA class II molecule. In some embodiments, the T cell receptor subunit is selected from CD3δ, CD3ε or CD3γ, the HLA class I molecule is selected from B2M, TAP1, TAP2, TAPBP or NLRC5, and the HLA class II molecule is selected from HLA-DM, RFX5, RFXANK, RFXAP or invariant chain (Ii chain). In some embodiments, the allogeneic T cell product comprises three or more endogenous immune protein knockouts. In such embodiments, the T cell receptor subunit is selected from CD3δ, CD3ε and / or CD3γ, the HLA class I molecule is selected from B2M, TAP1, TAP2, TAPBP and / or NLRC5, and the HLA class II molecule is selected from HLA-DM, RFX5, RFXANK, RFXAP, and / or invariant chain (Ii chain). In some embodiments, the modified immune cells for generating an allogeneic T cell product comprise one or more endogenous immune protein knockouts, including downregulation of at least two T cell receptor subunits, at least two HLA class I molecules, and at least two HLA class II molecules. In some embodiments, the T cell receptor subunits are selected from at least two of CD3δ, CD3ε, and CD3γ, the HLA class I molecules are selected from at least two of B2M, TAP1, TAP2, TAPBP, and NLRC5, and the HLA class II molecules are selected from at least two of HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii chain).

[0106] In some embodiments, the modified immune cells comprise an insertion and / or deletion that downregulates CD3δ gene expression and gene expression of an HLA molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain), and combinations thereof. In some embodiments, the modified immune cells comprise an insertion and / or deletion that downregulates CD3ε gene expression and gene expression of an HLA molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain), and combinations thereof. In some embodiments, the modified immune cells comprise insertions and / or deletions that downregulate CD3γ gene expression and gene expression of an HLA molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain), and combinations thereof.

[0107] In some embodiments, downregulation of gene expression of CD3δ, CD3ε and / or CD3γ results in downregulation of surface expression of T cell receptors alpha and beta by at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, or at least about 100%. In some embodiments, downregulation of CD3ε produces a higher T cell receptor knockout efficiency compared to downregulation of CD3γ and / or CD3δ. In some embodiments, the T cell receptor knockout efficiency induced by downregulation of CD3ε is higher or equivalent to downregulation of TRAC.

[0108] In some embodiments, the modified immune cells used to generate an allogeneic T cell product comprise a triple knockout. In some embodiments, the modified immune comprises a reduction or elimination of expression of the following genes: (1) CD3ε, B2M and CIITA, (2) CD3ε, B2M and RFX5, (3) CD3ε, B2M and RFXAP, (4) CD3ε, B2M and RFXANK, (5) CD3ε, B2M and HLA-DM, (6) CD3ε, B2M and Ii chain, (7) CD3ε, TAP1 and CIITA, (8) CD3ε, TAP1 and RFX5, (9) CD3ε, TAP1 and RFXAP, (10) CD3ε, TAP1 and RFXANK, (11) CD3ε, TAP1 and HLA-DM, (12) CD3ε, TAP1 and Ii chain, (13) CD3ε, TAP2 and CIITA, (14) CD3ε, TAP2 and RFX5, (15) CD3ε, TAP2 and RFXAP, (16) CD3ε, TAP2 and RFXANK, (17) CD3ε, TAP2 and HLA-DM, (18) CD3ε, TAP2 and Ii chain, (19) CD3ε, NLRC5 and CIITA, (20) CD3ε, NLRC5 and RFX5, (21) CD3ε, NLRC5 and RFXAP, (22) CD3ε, NLRC5 and RFXANK, (23) CD3ε, NLRC5 and HLA-DM, (24) CD3ε, NLRC5 and Ii chain, (25) CD3ε, TAPBP and CIITA, (26) CD3ε, TAPBP and RFX5, (27) CD3ε, TAPBP and RFXAP, (28) CD3ε, TAPBP and RFXANK, (29) CD3ε, TAPBP and HLA-DM, or (30) CD3ε, TAPBP and Ii chain.

[0109] In some embodiments, the modified immunity comprises reduction or elimination of expression of the following genes: (1) CD3δ, B2M, and CIITA; (2) CD3δ, B2M, and RFX5; (3) CD3δ, B2M, and RFXAP; (4) CD3δ, B2M, and RFXANK; (5) CD3δ, B2M, and HLA-DM; (6) CD3δ, B2M, and Ii chain; (7) CD3δ, TAP1, and CIITA; (8) CD3δ, TAP1, and RFX5; (9) CD3δ, TAP1, and RFXAP; (10) CD3δ, TAP1, and RFXANK; (11) CD3δ, TAP1, and HLA-DM; (12) CD3δ, TAP1, and Ii chain; (13) CD3δ, TAP2, and CIITA; (14) CD3δ, TAP2, and RFX5, (15)CD3δ, TAP2, and RFXAP, (16) CD3δ, TAP2 and RFXANK, (17) CD3δ, TAP2 and HLA-DM, (18) CD3δ, TAP2 and Ii chain, (19) CD3δ, NLRC5 and CIITA, (20) CD3δ, NLRC5 and RFX5, (21) CD3δ, NLRC5 and RFXAP, (22) CD3δ, NLRC5 and RFXANK, (23) CD3δ, NLRC5 and HLA-DM, (24) CD3δ, NLRC5 and Ii chain, (25) CD3δ, TAPBP and CIITA, (26) CD3δ, TAPBP and RFX5, (27) CD3δ, TAPBP and RFXAP, (28) CD3δ, TAPBP and RFXANK, (29) CD3δ, TAPBP and HLA-DM, or (30) CD3δ, TAPBP and Ii chain.

[0110] In some embodiments, the modified immunity comprises reduction or elimination of expression of the following genes: (1) CD3γ, B2M, and CIITA; (2) CD3γ, B2M, and RFX5; (3) CD3γ, B2M, and RFXAP; (4) CD3γ, B2M, and RFXANK; (5) CD3γ, B2M, and HLA-DM; (6) CD3γ, B2M, and Ii chain; (7) CD3γ, TAP1, and CIITA, (8) CD3γ, TAP1 and RFX5, (9) CD3γ, TAP1 and RFXAP, (10) CD3γ, TAP1 and RFXANK, (11) CD3γ, TAP1 and HLA-DM, (12) CD3γ, TAP1 and Ii chain, (13) CD3γ, TAP2 and CIITA, (14) CD3γ, TAP2 and RFX5, (15) CD3γ, TAP2 and RF XAP, (16) CD3γ, TAP2 and RFXANK, (17) CD3γ, TAP2 and HLA-DM, (18) CD3γ, TAP2 and Ii chain, (19) CD3γ, NLRC5 and CIITA, (20) CD3γ, NLRC5 and RFX5, (21) CD3γ, NLRC5 and RFXAP, (22) CD3γ, NLRC5 and RFXANK, (23) CD3γ, NL RC5 and HLA-DM, (24) CD3γ, NLRC5 and Ii chain, (25) CD3γ, TAPBP and CIITA, (26) CD3γ, TAPBP and RFX5, (27) CD3γ, TAPBP and RFXAP, (28) CD3γ, TAPBP and RFXANK, (29) CD3γ, TAPBP and HLA-DM, or (30) CD3γ, TAPBP and Ii chain.

[0111] In some embodiments, the modified immune cells of the disclosure are T cells, natural killer cells (NK cells), natural killer T cells (NKT), lymphoid progenitor cells, hematopoietic stem cells, stem cells, macrophages, or dendritic cells. In some embodiments, the modified immune cells are modified unstimulated immune cells or their precursor cells. In some embodiments, the modified immune cells are modified unstimulated T cells, modified unstimulated NK cells, or modified unstimulated NKT cells. In some embodiments, the modified immune cells are CD4+ T cells or CD8+ T cells. In some embodiments, the modified immune cells are allogeneic T cells or autologous human T cells. In some embodiments, the modified immune cells are human cells or mammalian cells. B. Modified immune cells:

[0112] One aspect of the present invention provides an isolated modified T cell comprising at least one functionally impaired polypeptide selected from the group consisting of CD3δ, CD3ε, CD3γ, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii chain). As used herein, the term "functionally impaired polypeptide" means that the polypeptide is mutated (e.g., contains a deletion, an insertion, or is a truncated variant) and therefore does not readily bind to other components of the TCR complex or is not incorporated into the TCR complex. In some embodiments, the functionally impaired polypeptide results in a functionally impaired TCR or suppresses the expression of a functional TCR on the cell surface. In some embodiments, the impaired polypeptide can be a dominant negative polypeptide that substantially inhibits the activity of the TCR complex. The modified T cells comprising the aforementioned impaired polypeptides are TCR-deficient T cells that do not produce a functional TCR or express little or no functional TCR at the cell surface. In some embodiments, the impaired polypeptide is a component of a TCR signaling complex. In some embodiments, the impaired polypeptide modulates the formation of a functional TCR. In some embodiments, the impaired polypeptide comprises a mutation that affects the function or expression of a functional protein. In some embodiments, the mutation is a deletion, insertion, substitution, or a combination thereof. In some embodiments, the impaired polypeptide is caused by defective expression of a gene product or lack of expression of a desired gene or gene product.

[0113] For the TCR to function properly, a proper stoichiometric ratio of proteins that make up the TCR complex is required. As shown in FIG. 1, the TCR complex contains the variable TCR-alpha chain (TCR-α, TRAC) and the TCR-beta chain (TCR-β, TRBC), which are bound to three modules CD3δ / CD3ε, CD3γ / CD3ε, and CD3ζ / CD3ζ. The three dimer modules are an integral part of TCR signaling. Each CD3 receptor contains signaling motifs that propagate and amplify TCR receptor activation upon binding of the TCR-α / β heterodimer with an MHC peptide ligand. Upon binding of ligand to TCRαβ, a conformational change occurs in the CD3 subunit and the signaling motifs (e.g., ITAMs) in the CD3 cytoplasmic tail are phosphorylated by intracellular protein tyrosine kinases. Intracellular signaling and adaptor molecules containing SH2 domains are then recruited to the cell membrane, where they directly interact with the CD3 signaling motifs to amplify the TCR activation signal. Thus, the TCRαβ heterodimer is responsible for binding the antigen, and the CD3 subunit functions as a signaling element. Therefore, if one of the required CD3 receptors is missing or impaired, the TCR complex becomes functionally unstable or at least the signaling function of the TCR is compromised. Without wishing to be bound by theory, coordinated expression of all six proteins is required for surface expression of the TCR complex and / or function.

[0114] Each component of the TCR complex is required for the assembly of the TCR complex at the cell surface. Loss of one component of the TCR complex may result in loss of TCR expression at the cell surface. In some embodiments, loss of one component may not result in loss of surface expression of the TCR complex. In such embodiments, some or all of the TCR expression may remain, but it is the function of the TCR receptor that determines whether the TCR receptor induces an immune response. The present invention considers a functional defect, rather than the absence of a complete TCR complex at the cell surface. Without wishing to be bound by theory, the lower the expression of the TCR, the less likely it is that sufficient TCR cross-linking will occur that leads to T cell activation via the TCR complex.

[0115] In some embodiments, the isolated modified T cells comprise two or more dysfunctional polypeptides. In such embodiments, one dysfunctional polypeptide may be the T cell receptor alpha chain (TRAC). The TCR complex is retained intracellularly and does not translocate to the cell membrane in the absence of TRAC. Furthermore, TCR receptors lacking TRAC may become unstable and rapidly degraded. In some embodiments, the modified T cells comprise three or more dysfunctional polypeptides selected from TRAC, TRBC, CD3 delta, CD3 epsilon, CD3 gamma, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, or invariant (Ii) chain. In some embodiments, the modified T cells comprise two dysfunctional polypeptides selected from CD3 alpha, CD3 delta, CD3 epsilon, CD3 gamma, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, or Ii chain. In some embodiments, the modified T cells comprise three dysfunctional polypeptides selected from CD3α, CD3δ, CD3ε, CD3γ, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, or Ii chain. In some embodiments, the modified T cells comprise a dysfunctional polypeptide selected from the group consisting of CD3δ, CD3ε, and CD3γ, and at least one dysfunctional polypeptide selected from TRAC, TRBC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, or Ii chain. In some embodiments, the modified T cells comprise at least one dysfunctional polypeptide selected from the group consisting of CD3δ, CD3ε, and CD3γ, and at least one dysfunctional polypeptide selected from TRAC, TRBC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, or Ii chain.

[0116] In some embodiments, the modified T cells comprise (a) at least one dysfunctional CD3δ, CD3ε, and / or CD3γ, and (b) at least one dysfunctional polypeptide selected from TRAC, TRBC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, or Ii chain. In some embodiments, the modified T cells comprise two or more dysfunctional polypeptides selected from TRAC, TRBC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, or Ii chain.

[0117] In some embodiments, the dysfunctional polypeptide reduces expression of a protein. In such embodiments, the modified T cells have reduced expression of TRAC, TRBC, CD3 delta, CD3 epsilon, CD3 gamma, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, Ii chain, or any combination thereof. In some embodiments, the dysfunctional polypeptide is a lack of encoded gene expression. In such embodiments, the modified T cells do not express CD3 delta, CD3 epsilon, CD3 gamma, TRAC, TRBC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, Ii chain, or any combination thereof.

[0118] In some embodiments, the modified T cells having reduced or absent expression of a polypeptide selected from the group consisting of CD3δ, CD3ε, CD3γ, TRAC, TRBC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, Ii chain further comprise an impaired polypeptide selected from TRAC, TRBC, B2M, and C2TA. In such embodiments, the modified T cells have reduced expression of TRAC, TRBC, B2M, or C2TA and / or do not express TRAC, TRBC, B2M, or C2TA.

[0119] In some embodiments, the modification of CD3δ, CD3ε, and / or CD3γ results in dysfunction of the TCR / CD3 receptor complex. In some embodiments, the dysfunctional polypeptides envisaged in the present invention are generated using gene editing techniques. In some embodiments, the gene editing is selected from the group consisting of CRISPR-associated (Cas) (CRISPR-Cas) endonuclease system, TALEN gene editing system, zinc finger nuclease (ZFN) gene editing system, meganuclease gene editing system or megaTALEN gene editing system, antisense RNA, antigenomeric RNA, RNAi, siRNA and shRNA. In some embodiments, CD3δ, CD3ε or CD3γ is modified by targeting one or more exons of CD3δ, CD3ε or CD3γ, optionally exon 1 of CD3δ, CD3ε or CD3γ.

[0120] Whether a T cell expresses a functional TCR can be determined using known assay methods known in the art or as described herein. In some embodiments, expression of TCR αβ and CD3 can be assessed by flow cytometry and quantitative real-time PCR (QRT-PCR). Expression of TCR-α, TCR-β, CD3ε, CD3δ, CD3γ and CD3-ζ mRNA can be analyzed by QRT-PCR using an ABI7300 real-time PCR machine and gene-specific TAQMAN® primers, using methods similar to those used in Sentman et al., J. Immunol. 173:6760-6766 (2004). Changes in cell surface expression can be determined using antibodies specific for TCR-α, TCR-β, CD3ε, CD8, CD4, CD5 and CD45. To test for TCR / CD3 expression using flow cytometry, fluorochrome-labeled antibodies against specific subunits of the TCR complex are used. In some embodiments, live cells are stained with, for example, a combination of antibodies against CD5, CD8 and CD4, and antibodies against CD3ε, CD3δ, CD3γ, TCRα, TCRβ, TCRγ or TCRδ. When expression of either CD3 or TCR genes is used, the expression of both TCR and CD3 proteins should be significantly reduced in the modified T cells compared to unmodified T cells or T cells expressing a control vector. Isotype control antibodies are used to control for background fluorescence.

[0121] To determine whether expression of dysfunctional polypeptides in the modified T cells is sufficient to alter TCR function and / or modified T cell function, the modified T cells are tested for (1) in vitro cell viability, (2) proliferation in the presence of mitomycin C-treated allogeneic PBMCs, and / or (3) cytokine production in response to allogeneic PBMCs, anti-CD3 mAbs, or anti-TCR mAbs.

[0122] To test for dysfunction of the TCR complex, one can determine the lack of production of key effector cytokines that promote T cell proliferation. For example, the effect of anti-CD3 stimulation on modified T cells can be used to determine the production of interleukin-2 (IL-2) and / or interferon (IFN)-gamma products.

[0123] In some embodiments, the modified T cells comprising dysfunctional polypeptides exhibit reduced expression of T cell receptors compared to non-modified T cells. In some embodiments, the modified T cells comprising dysfunctional polypeptides exhibit reduced expression of dysfunctional polypeptides. In some embodiments, the modified T cells comprising dysfunctional polypeptides exhibit a complete lack of surface expression of T cell receptor complexes. In some embodiments, the modified T cells comprising dysfunctional polypeptides exhibit reduced or insufficient cross-linking of T cell receptors. In some embodiments, the modified T cells express some or all of the TCR subunits that may be present on the cell surface. Without a functional TCR on the surface, the modified T cells are not fully activated. Thus, the modified T cells envisaged in the present invention are unable to mount undesirable responses when introduced into a host. As a result, the modified T cells are unable to cause GvHD or HvHD because they are unable to transmit signals from the host's MHC molecules.

[0124] In some embodiments, when the modified T cells are administered to a subject, the modified T cells exert a reduced immune response in the subject compared to the immune response exerted by an unmodified T cell administered to the same subject. The modified T cells of the present invention can be used in any application of T cell therapy. In some embodiments, the modified T cells are used in any method or composition where T cell therapy is desired. In some embodiments, the modified T cells of the present invention can be used to reduce, ameliorate, or prevent or treat cancer, GVHD, transplant rejection, infectious disease, one or more autoimmune disorders, radiation sickness, or other disease or condition. IV. Gene Editing Systems: A. CRISPR:

[0125] In some embodiments, the modified immune cells of the disclosure are gene-edited modified immune cells. In some embodiments, the insertion and / or deletion in one or more loci encoding the endogenous immune proteins of the disclosure are the result of gene editing. In some embodiments, genes encoding CD3 delta, CD3 epsilon, CD3 gamma, TRAC, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, or li chain are modified by a gene editing system. In some examples, the gene editing system comprises an RNA-guided nuclease, such as a clustered regularly interspersed short palindromic nucleic acid (CRISPR)-Cas system. The CRISPR system (also referred to herein as a CRISPR-Cas system, Cas system, or CRISPR / Cas system) comprises a Cas endonuclease and a guide nucleic acid sequence specific for a target gene, which upon introduction into a cell forms a complex that allows the Cas endonuclease to introduce a break (e.g., a double-stranded break) into the target gene. In some embodiments, the modified immune cells are edited using CRISPR / Cas9 to disrupt one or more endogenous immune proteins.

[0126] In some embodiments, the CRISPR-Cas system is used to disrupt one or more endogenous CD3 delta, CD3 epsilon, CD3 gamma, TRAC, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, or Ii chain, thereby resulting in downregulation of CD3 delta, CD3 epsilon, CD3 gamma, TRAC, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, or Ii chain gene expression. In some embodiments, the insertions and / or deletions capable of downregulating gene expression of one or more endogenous immune proteins downregulate expression of one or more endogenous proteins selected from the group consisting of CD3 delta, CD3 epsilon, CD3 gamma, TRAC, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, or Ii chain. In some embodiments, each of the insertions and / or deletions capable of downregulating gene expression comprises a CRISPR-associated system. In some embodiments, the CRISPR-associated system is a CRISPR-associated Cas endonuclease and a guide RNA.

[0127] In some embodiments, the Cas endonuclease comprises a Cas9 endonuclease. In some examples, the Cas9 endonuclease is derived from or based on a Cas9 molecule of, for example, S. pyogenes (e.g., SpCas9), S. thermophiles, Staphylococcus aureus (e.g., SaCas9), or Neisseria meningitides. In some examples, the Cas9 endonuclease is derived from or based on a Cas9 molecule of, for example, Acidovorax avenae, Actinobacillus pleuropneumoniae, Actinobacillus succinogenes, Actinobacillus suis, Actinomyces sp., cycliphilus denitrificans, Aminomonas paucivorans, Bacillus cereus, Bacillus smithii, Bacillus thuringiensis, Bacteroides sp., Blastopirellula marina, Bradyrhizobium sp., Brevibacillus latemsporus, Campylobacter coli, Campylobacter jejuni, Campylobacter lad, Candidatus Puniceispirillum, Clostridium cellulolyticum, Clostridium perfringens, Corynebacterium accolens, Corynebacterium diphtheria, Corynebacterium matruchotii, Dinoroseobacter sliibae, Eubacterium rectale, Eubacterium dolichum, gamma proteobacterium, Gluconacetobacter diazotrophicus, Haemophilus parainfluenzae, Haemophilus spitorum, Helicobacter canadensis, Helicobacter cinaedi, Helicobacter mustelae, Ilyobacter polytropus, Kingella kingae, Lactobacillus crispatus, Listeria ivanovii, Listeria monocytogenes, Listeriaceae bacterium, Methylocystis sp., Methylosinus trichosporium, Mobiluncus mulieris, Neisseria bacilliformis, Neisseria cinerea, Neisseria flavescens, Neisseria lactamica. Neisseria sp.、Neisseria wadsworthii、Nitrosomonas sp.、Parvibaculum lavamentivorans、Pasteurella multocida、Phascolarctobacterium succinatutens、Ralstonia syzygii、Rhodopseudomonas palustris、Rhodovulum sp.、Simonsiella muelleri、Sphingomonas sp., Sporolactobacillus vineae, Staphylococcus lugdunensis, Streptococcus sp., Subdoligranulum sp., Tislrella mobilis, Treponema sp., or Verminephrobacter eiseniae Cas9 molecule.

[0128] In some embodiments, the Cas9 endonuclease is selected from the group consisting of S. pyogenes (e.g., SF370, MGAS 10270, MGAS 10750, MGAS2096, MGAS315, MGAS5005, MGAS6180, MGAS9429, NZ131, and SSI-1 strains), S. thermophilus (e.g., LMD-9 strain), S. pseudoporcinus (e.g., SPIN 20026 strain), S. mutans (e.g., UA159, NN2025 strains), S. macacae (e.g., NCTC1 1558 strain), S. gallolylicus (e.g., UCN34, ATCC BAA-2069 strain), S. equines (e.g., ATCC 9812, MGCS 124 strain), S. dysdalactiae (e.g., GGS 124 strain), S. bovis (e.g., ATCC 700338 strain), S. centrioles (e.g., F021 1 strain), S. agalactia (e.g., NEM316, A909 strain), Listeria monocytogenes (e.g., F6854 strain), Listeria innocua (L. innocua, e.g., Clip 11262 strain), Enterococcus italicus (e.g., DSM 15952 strain) or Enterococcus faecium (e.g., 1,23,408 strain).

[0129] In some examples, the endonuclease comprises Cas3, Cas4, Cas8a, Cas8b, Cas9, Cas10, Cas10d, Cas12a, Cas12b, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas13, Cas14, CasX, Cse1, Csy1, Csn2, Cpf1, C2c1, Csm2, Cmr5, Fok1, S. pyogenes Cas9, Staphylococcus aureus Cas9, MAD7 nuclease (Type V CRISPR nuclease), or any combination thereof. B. Guide RNA:

[0130] In some embodiments, the guide nucleic acid is a guide RNA (gRNA) molecule that directs the Cas-RNA complex to a target sequence. In some instances, the directing is accomplished by hybridization of a portion of the gRNA to DNA (e.g., via a gRNA targeting domain) and binding of a portion of the gRNA molecule to an RNA-guided nuclease or other effector molecule (e.g., via at least a gRNA tracr). In some embodiments, the gRNA molecule consists of a single contiguous polynucleotide molecule, referred to herein as a "single guide RNA" ("sgRNA"). In other embodiments, the gRNA molecule consists of multiple (usually two) polynucleotide molecules that themselves can be linked, typically via hybridization, referred to herein as a "dual guide RNA" ("dgRNA").

[0131] In some examples, the gRNA molecule comprises a crRNA and a tracr, which can optionally be present on a single polynucleotide or on separate polynucleotides. In some examples, the crRNA comprises a targeting domain and a region that interacts with the tracr to form a flagpole region. The tracr comprises a portion of the gRNA molecule that binds to a nuclease or other effector molecule. In some embodiments, the tracr comprises a nucleic acid sequence that specifically binds to a Cas endonuclease (e.g., Cas9). In some embodiments, the tracr comprises a nucleic acid sequence that forms part of a flagpole. In some embodiments, the targeting domain is a portion of the gRNA molecule that recognizes, e.g., is complementary to, a protospacer sequence in the target DNA.

[0132] A protospacer adjacent motif (PAM) is a 2-6 base pair DNA sequence located adjacent to the 3' end of the protospacer and recognized by a Cas endonuclease. In some examples, each Cas endonuclease recognizes a specific PAM sequence. Exemplary PAM sequences include the NGG sequence recognized by S. pyogenes Cas9 endonuclease, or the NGGNG or NNAGAAW sequences recognized by S. thermophilus Cas9 endonuclease, where N is any nucleotide. One of skill in the art would know how to design a gRNA molecule based on the particular Cas endonuclease to be used with the PAM sequence that the Cas endonuclease recognizes.

[0133] In some embodiments, the guide RNA comprises a guide sequence that is sufficiently complementary to a target sequence of an endogenous immune protein locus selected from the group consisting of CD3δ, CD3ε, CD3γ, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii chain). In some embodiments, the guide RNA comprises a guide sequence that is complementary to a sequence within one or more loci that each encode an immune protein selected from the group consisting of CD3δ, CD3ε, CD3γ, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii chain). In some embodiments, the guide RNA is complementary to a sequence within one or more exons of CD3δ, CD3ε, or CD3γ. In some embodiments, the guide RNA is complementary to a sequence within exon 1 of CD3 delta, CD3 epsilon, or CD3 gamma. In some embodiments, the gRNA nucleic acid sequence of CD3 delta, CD3 epsilon, CD3 gamma, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, or invariant chain (Ii chain) has a nucleic acid sequence disclosed in Table 4.

[0134] In some embodiments, the guide RNA comprises a guide sequence complementary to a sequence in the CD3δ locus, the guide RNA comprises a nucleic acid sequence set forth in SEQ ID NO: 53. In some embodiments, the guide RNA comprises a guide sequence complementary to a sequence in the CD3ε locus, the guide RNA comprises a nucleic acid sequence set forth in SEQ ID NO: 52. In some embodiments, the guide RNA comprises a guide sequence complementary to a sequence in the CD3γ locus, the guide RNA comprises a nucleic acid sequence set forth in SEQ ID NO: 54. In some embodiments, the guide RNA comprises a guide sequence complementary to a sequence in the B2M locus, the guide RNA comprises a nucleic acid sequence set forth in SEQ ID NO: 55. In some embodiments, the guide RNA comprises a guide sequence complementary to a sequence in the CIITA (C2TA) locus, the guide RNA comprises a nucleic acid sequence set forth in SEQ ID NO: 61. In some embodiments, the guide RNA comprises a guide sequence complementary to a sequence in the TAP1 locus, the guide RNA comprises a nucleic acid sequence set forth in SEQ ID NO: 56. In some embodiments, the guide RNA comprises a guide sequence complementary to a sequence in the TAP2 locus, the guide RNA comprises a nucleic acid sequence set forth in SEQ ID NO: 57. In some embodiments, the guide RNA comprises a guide sequence complementary to a sequence in the TAPBP locus, the guide RNA comprises a nucleic acid sequence set forth in SEQ ID NO: 58, SEQ ID NO: 59, or any combination thereof. In some embodiments, the guide RNA comprises a guide sequence complementary to a sequence in the NLRC5 locus, the guide RNA comprises a nucleic acid sequence set forth in SEQ ID NO: 60. In some embodiments, the guide RNA comprises a guide sequence complementary to a sequence in the HLA-DM locus, the guide RNA comprises a nucleic acid sequence set forth in SEQ ID NO: 62. In some embodiments, the guide RNA comprises a guide sequence complementary to a sequence in the RFX5 locus, the guide RNA comprises a nucleic acid sequence set forth in SEQ ID NO: 63, SEQ ID NO: 64, or a combination thereof. In some embodiments, the guide RNA comprises a guide sequence complementary to a sequence in the RFXANK locus, the guide RNA comprises a nucleic acid sequence set forth in SEQ ID NO: 65.In some embodiments, the guide RNA comprises a guide sequence complementary to a sequence in the RFXAP locus, and the guide RNA comprises the nucleic acid sequence set forth in SEQ ID NO: 66. In some embodiments, the guide RNA comprises a guide sequence complementary to a sequence in the Ii chain locus, and the guide RNA comprises the nucleic acid sequence set forth in SEQ ID NO: 67, SEQ ID NO: 68, or any combination thereof.

[0135] In some embodiments, one or more, two or more, three or more, or four or more guide nucleic acids (e.g., guide RNA molecules) are transfected into immune cells using Cas endonuclease. In some examples, about one, two, or three guide nucleic acids (e.g., guide RNA molecules) are transfected into immune cells using Cas endonuclease. In some examples, about three guide nucleic acids (e.g., guide RNA molecules) are transfected into immune cells using Cas endonuclease. In some examples, about two guide nucleic acids (e.g., guide RNA molecules) are transfected into immune cells using Cas endonuclease. In some examples, about one guide nucleic acid (e.g., guide RNA molecule) is transfected into immune cells using Cas endonuclease.

[0136] In some embodiments, a vector drives the expression of the CRISPR system. The art is replete with suitable vectors useful for the present invention. The vectors used are suitable for replication and, if necessary, integration into eukaryotic cells. Typical vectors include transcription and translation terminators, initiation sequences and promoters that help control the expression of the nucleic acid sequence of interest. The vectors of the present invention can also be used in nucleic acid standard gene delivery protocols. Methods of gene delivery are known in the art. Additionally, the vector may be provided to the cell in the form of a viral vector. Viral vector technology is well known in the art and described, for example, in Sambrook et al., 4th Edition, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 2012, and other virology and molecular biology standard manuals. Viruses useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses, Sindbis viruses, gamma retroviruses, lentiviruses, and the like. Without wishing to be bound by theory, a suitable vector comprises an origin of replication functional in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers. In some embodiments, the CRISPR / Cas system comprises an expression vector. In some embodiments, the CRISPR / Cas system comprises a pAd5 / F35-CRISPR vector. C. TALEN:

[0137] In some embodiments, the gene editing system is a TALEN gene editing system. TALENs are artificially generated by fusing TAL effector DNA binding domains to DNA cleavage domains. Transcription activator-like effects (TALEs) are engineered to bind to target DNA. The combination of engineered TALEs and DNA cleavage domains can generate restriction enzymes specific to any target DNA sequence.

[0138] TALEs are proteins secreted by Xanthomonas bacteria. The DNA-binding domain contains a repeating, highly conserved sequence of 33-34 amino acids, except for the 12th and 13th amino acids. These two positions are highly variable and show a strong correlation with specific nucleotide recognition, so they can be engineered to bind to target DNA sequences.

[0139] To produce a TALEN, a TALE protein is fused to a nuclease (N), including, for example, a wild-type or mutant Fok1 endonuclease. The Fok1 domain functions as a dimer, requiring two constructs with unique DNA-binding domains at appropriate orientation and spacing to target sites in the genome. Specificity and off-target effects can be tuned by varying the number of amino acid residues between the TALE DNA-binding domain and the Fok1 cleavage domain, and the number of bases between the two individual TALEN binding sites. D. Zinc Finger Nucleases:

[0140] In some embodiments, the gene editing system is a zinc finger nuclease (ZFN) gene editing system. The zinc finger nuclease is an artificial nuclease that can be used to modify nucleic acid sites of one or more target nucleic acid sequences. Similar to the TALEN editing system, the ZFN comprises a Fok1 nuclease domain (or a derivative thereof) fused to a DNA binding domain. In the case of ZFN, the DNA binding domain is composed of one or more zinc fingers. A zinc finger is a small protein structural motif stabilized by one or more zinc ions. A zinc finger, for example, comprises Cys2His2 and can recognize a sequence of about 3 bp. Various zinc fingers with known specificity can be combined to generate multi-finger polypeptides that recognize sequences of about 6, 9, 12, 15 or 18 bp.

[0141] ZFNs recognize non-palindromic DNA sites. To cleave a target site, a pair of ZFNs dimerize and assemble on opposite strands of the target site. A variety of selection and module assembly techniques are available to generate zinc fingers (and combinations thereof) that recognize specific sequences, including phage display, yeast one-hybrid systems, bacterial one-hybrid and two-hybrid systems, and mammalian cells. E. Meganuclease:

[0142] In some embodiments, the gene editing system is a meganuclease gene editing system. Meganucleases are artificial nucleases that recognize 15-40 base pair cleavage sites. In some examples, meganucleases are classified into families based on structural motifs that affect nuclease activity and DNA recognition. Members of the LAGLIDADG family are characterized by having one or two copies of the conserved LAGLIDADG motif. In some examples, LAGLIDADG meganucleases with one copy of the LAGLIDADG motif form homodimers, while members with two copies of the LAGLIDADG motif are found as monomers. Members of the GIY-YIG family have a GP-YIG module that is 70-100 residues long and contains four or five conserved sequence motifs and four invariant residues, two of which are required for activity. His-Cys box meganucleases are characterized by a highly conserved series of histidines and cysteines over a region containing hundreds of amino acid residues. Members of the NHN family are defined by a motif that contains two pairs of conserved histidines surrounded by asparagine residues. Strategies for engineering meganucleases with altered DNA binding specificity (e.g., binding to a given nucleic acid sequence) are known in the art.

[0143] In some examples, the meganuclease is a hybrid nuclease, termed a megaTAL, that comprises a TALE domain fused to the N-terminus of the meganuclease, hi some examples, the meganuclease is a member of the LAGLIDADG family.

[0144] In some embodiments, the gene editing system is a gene silencing system. Exemplary gene silencing systems include RNAi, siRNA, or shRNA mediated gene silencing systems. V. Exogenous nucleic acids:

[0145] The present invention provides modified immune cells or precursor cells thereof that contain insertions and / or deletions in one or more loci encoding endogenous immune proteins and are capable of downregulating gene expression of endogenous immune proteins and exogenous nucleic acids. In some embodiments, the exogenous nucleic acid encodes a chimeric antigen receptor (CAR), a modified T cell receptor (TCR), a killer cell immunoglobulin-like receptor (KIR), an antigen-binding polypeptide, a cell surface receptor ligand, or a tumor antigen. In some embodiments, modified immune cells expressing exogenous polypeptides are disclosed herein. In some examples, the exogenous nucleic acid encodes a chimeric antigen receptor (CAR). In some examples, the exogenous nucleic acid encodes an antigen-binding polypeptide. In some examples, the exogenous nucleic acid encodes a killer cell immunoglobulin-like receptor (KIR). In additional examples, the exogenous nucleic acid encodes a cell surface receptor ligand or a tumor antigen. A. Chimeric Antigen Receptor:

[0146] The present invention also includes modified T cells and chimeric antigen receptors (CARs) with downregulated gene expression as described herein. In some embodiments, the present invention encompasses modified T cells comprising a CAR or a nucleic acid encoding a CAR, the CAR comprising an antigen binding domain, a hinge domain, a transmembrane domain, a costimulatory domain, and an intracellular signaling domain. Any modified cell comprising a CAR comprising any antigen binding domain, any hinge, any transmembrane domain, any costimulatory domain, and any intracellular signaling domain as described herein is contemplated and can be readily understood and made by one of skill in the art in light of the disclosure herein.

[0147] The antigen binding domain may be operably linked to another domain of the CAR, such as a transmembrane domain or an intracellular domain as described herein, for expression in an immune cell. In one embodiment, a first nucleic acid sequence encoding the antigen binding domain is operably linked to a second nucleic acid sequence encoding a transmembrane domain, which is further operably linked to a third nucleic acid sequence encoding an intracellular domain.

[0148] The antigen binding domains described herein can be combined with any of the transmembrane domains described herein, any of the intracellular or cytoplasmic domains described herein, or any of the other domains described herein that can be included in the CARs of the invention. The subject CARs of the invention can also include a spacer domain described herein. In some embodiments, each of the antigen binding domains, the transmembrane domains, and the intracellular domains are separated by a linker. 1. Antigen-binding domain:

[0149] The antigen binding domain of a CAR is the extracellular region of a CAR that binds to a specific target antigen, such as a protein, carbohydrate, glycolipid, etc. In some embodiments, the CAR comprises an affinity for a target antigen (e.g., a tumor-associated antigen) on a target cell (e.g., a cancer cell). The target antigen may include any type of protein or epitope thereof associated with the target cell. For example, the CAR may have an affinity for a target antigen on a target cell that is indicative of a particular state of the target cell.

[0150] As described herein, the CAR of the present disclosure having affinity for a specific target antigen on a target cell can include a target-specific binding domain. In some embodiments, the target-specific binding domain is a mouse target-specific binding domain, e.g., the target-specific binding domain is derived from a mouse. In some embodiments, the target-specific binding domain is a human target-specific binding domain, e.g., the target-specific binding domain is derived from a human.

[0151] The antigen binding domain includes any domain that binds to an antigen, including, but not limited to, monoclonal antibodies, polyclonal antibodies, synthetic antibodies, human antibodies, humanized antibodies, non-human antibodies, and any fragments thereof. Thus, in one embodiment, the antigen binding domain portion comprises a mammalian antibody or a fragment thereof. In some embodiments, the antigen binding domain comprises a full-length antibody. In some embodiments, the antigen binding domain comprises an antigen binding fragment (Fab), such as a Fab, Fa', F(ab')2, monospecific Fab2, bispecific Fab2, trispecific Fab2, single chain variable fragment (scFv), dAb, tandem scFv, VhH, V-NAR, camelid, diabody, minibody, triabody, or tetrabody.

[0152] In some embodiments, the CAR of the present disclosure may have affinity for one or more target antigens on one or more target cells. In some embodiments, the CAR may have affinity for one or more target antigens on a single target cell. In such embodiments, the CAR is a bispecific or multispecific CAR. In some embodiments, the CAR comprises one or more target specific binding domains that confer affinity for one or more target antigens. In some embodiments, the CAR comprises one or more target specific binding domains that confer affinity for the same target antigen. For example, a CAR that comprises one or more target specific binding domains that have affinity for the same target antigen can bind to different epitopes of the target antigen. When there are multiple target specific binding domains in a CAR, the binding domains may be arranged in tandem and separated by a linker peptide. For example, in a CAR that comprises two target specific binding domains, the binding domains are covalently linked to each other on a single polypeptide chain via a polypeptide linker, an Fc hinge region, or a membrane hinge region.

[0153] As used herein, the term "single-chain variable fragment" or "scFv" refers to a fusion protein in which the variable regions of the heavy (VH) and light (VL) chains of an immunoglobulin (e.g., mouse or human) are covalently linked to form a VH::VL heterodimer. The heavy chains (VH) and light chains (VL) are linked directly or via a peptide-encoding linker or spacer that connects the N-terminus of VH to the C-terminus of VL or the C-terminus of VH to the N-terminus of VL. The terms "linker" and "spacer" are used interchangeably herein. In some embodiments, the antigen-binding domain (e.g., Tn-MUC1 binding domain, PSMA binding domain, or mesothelin binding domain) comprises an scFv having the following configuration, N-terminus to C-terminus, VH- linker -VL. In some embodiments, the antigen-binding domain (e.g., the Tn-MUC1 binding domain, the PSMA binding domain, or the mesothelin binding domain) comprises an scFv having the following configuration, N-terminus to C-terminus, VH-linker-VH. One of skill in the art would be able to select an appropriate configuration for use in the present invention.

[0154] The linker is usually rich in glycine for flexibility and rich in serine or threonine for solubility. The linker can link the heavy and light chain variable regions of the extracellular antigen-binding domain. Non-limiting examples of the linker are disclosed in Shen et al., Anal. Chem. 80(6):1910-1917 (2008) and WO2014 / 087010. Various linker sequences are known in the art, including, but not limited to, glycine serine (GS) linkers, such as (GS)n, (GSGGS)n (SEQ ID NO: 47), (GGGS)n (SEQ ID NO: 48) and (GGGGS)n (SEQ ID NO: 49), where n represents an integer of at least 1. Exemplary linker sequences can include amino acid sequences including, but not limited to, GGSG (SEQ ID NO:29), GGSGG (SEQ ID NO:30), GSGSG (SEQ ID NO:31), GSGGG (SEQ ID NO:32), GGGSG (SEQ ID NO:33), GSSSG (SEQ ID NO:34), GGGGS (SEQ ID NO:49), or GGGSGGGGSGGGGGS (SEQ ID NO:50). One of skill in the art would be able to select an appropriate linker sequence for use in the present invention. In one embodiment, an antigen-binding domain of the invention (e.g., a Tn-MUC1 binding domain, a PSMA binding domain, or a mesothelin binding domain) comprises a heavy chain variable region (VH) and a light chain variable region (VL), wherein the VH and VL are separated by a linker sequence having the amino acid sequence GGGGSGGGSGGGGGS (SEQ ID NO:50). In some embodiments, the linker nucleic acid sequence comprises the nucleotide sequence GGTGGCGGTGGCTCGGGCGGTGGTGGGTCGGGTGGCGGCGGATCT (SEQ ID NO:51).

[0155] Despite the removal of the constant region and the introduction of the linker, the scFv protein retains the specificity of the original immunoglobulin. Single chain Fv polypeptide antibodies can be expressed from nucleic acids containing VH and VL encoding sequences as described in Huston, et al., Proc. Nat. Acad. Sci. USA 85:5879-5883 (1988). Antagonistic scFvs with inhibitory activity have been disclosed. See, e.g., Zhao et al., Hybridoma (Larchmt), 27(6):455-51 (2008). Agonistic scFvs with stimulatory activity have been disclosed. See, e.g., Peter et al., J. Biol. Chem., 25278(38):36740-7 (2003).

[0156] As used herein, "Fab" refers to the fragment of an antibody structure that binds to an antigen but is monovalent and does not have an Fc portion; for example, digestion of an antibody with the enzyme papain produces two Fab fragments and one Fc fragment (e.g., the heavy chain (H) constant region, the Fc region that does not bind to antigen).

[0157] In some instances, the antigen binding domain may be derived from the same species in which the CAR will ultimately be used, for example, for use in humans, the antigen binding domain of the CAR may comprise a human antibody or fragment thereof, as described elsewhere herein.

[0158] Thus, for example, immune cells obtained by the methods described herein can be engineered to express a CAR that targets one of the following cancer-associated antigens (tumor antigens): CD19; CD20; CD22 (Siglec 2); 2));CD37;CD123;CD22;CD30;CD171;CS-1 (CD2 subset 1, also called CRACC, SLAMF7, CD319 and 19A24);C-type lectin-like molecule-1 (CLL-1 or CLECL1);CD33;CD133;Epidermal growth factor receptor (EGFR);Epidermal growth factor receptor variant III (EGFRvIII);Human epidermal growth factor receptor (HER1);Ganglioside G2 (GD2);Ganglioside GD3 (aNeu5Ac(2-8)aNeu5Ac(2-3)bDGalp(1-4)bDGlcp(1-l)Cer);TNF receptor family member B cell maturation (BCMA);Tn antigen ((Tn Ag) or (GalNAca-Ser / Thr)); prostate-specific membrane antigen (PSMA); receptor tyrosine kinase-like orphan receptor 1 (ROR1); Fms-like tyrosine kinase 3 (FLT3); tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6; carcinoembryonic antigen (CEA); epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); interleukin-13 receptor subunit alpha 2 (IL-13Ra2 or CD213A2); Met sothelin; interleukin-11 receptor alpha (IL-11Ra); prostate stem cell antigen (PSCA); protease serine 21 (testosin or PRSS21); vascular endothelial growth factor receptor 2 (VEGFR2); Lewis (Y) antigen; CD24; platelet-derived growth factor receptor beta (PDGFR-beta); stage-specific fetal antigen-4 (SSEA-4); folate receptor alpha; receptor tyrosine-protein kinase ERBB2 (Her2 / neu); mucin 1, cell surface associated (MUC 1); GalNAca1-O-Ser / Thr(Tn)MUC 1 (TnMUC1); neural cell adhesion molecule (NCAM); prostase; prostatic acid phosphatase (PAP); elongation factor 2 mutant (ELF2M); ephrin B2; fibroblast activation protein alpha (FAP);Insulin-like growth factor 1 receptor (IGF-I receptor); carbonic anhydrase IX (CAIX); proteasome (prosome, macropain) subunit, beta, type 9 (LMP2); glycoprotein 100 (gp100); oncogene fusion protein consisting of breakpoint cluster region (BCR) and Abelson murine leukemia viral oncogene homolog 1 (Abl) (bcr-abl); tyrosinase; ephrin type A receptor 2 (EphA2); fucosyl GM1; sialyl Lewis adhesion molecule (sLe); ganglioside GM3 (aNeu5Ac(2-3)bDGa lp(1-4)bDGlcp(1-1)Cer); transglutaminase 5 (TGS5); high molecular weight melanoma-associated antigen (HMWMAA); o-acetyl-GD2 ganglioside (OAcGD2); folate receptor beta; tumor endothelial marker 1 (TEM1 / CD248); tumor endothelial marker 7-related (TEM7R); claudin 6 (CLDN6); thyroid-stimulating hormone receptor (TSHR); G protein-coupled receptor class C group 5, member D (GPRC5D); chromosome X open reading frame 61 (CXORF61); CD97; CD17 9a;anaplastic lymphoma kinase (ALK);polysialic acid;placenta specific 1 (PLAC1);hexasaccharide moiety of globoH glycoceramide (GloboH);mammary differentiation antigen (NY-BR-1);uroplakin 2 (UPK2);tyrosine protein kinase Met (c-Met);hepatitis A virus cellular receptor 1 (HAVCR1);adrenergic receptor beta 3 (ADRB3);pannexin 3 (PANX3);G protein-coupled receptor 20 (GPR20);lymphocyte antigen 6 complex, locus K9 (LY6K);olfactory receptor 51E2 (OR51E2);TCR gamma metabolite Alternative reading frame protein (TARP); Wilms tumor protein (WT1); cancer / testis antigen 1 (NY-ESO-1); cancer / testis antigen 2 (LAGE-1a); melanoma-associated antigen 1 (MAGE-A1); ETS translocation mutated gene 6, located on chromosome 12p (ETV6-AML); sperm protein 17 (SPA17); X antigen family, member 1A (XAGEl); angiopoietin-binding cell surface receptor 2 (Tie2); melanoma cancer-testis antigen-1 (MAD-CT-1); melanoma cancer-testis antigen-2 (MAD-CT-2); Fos-related antigen 1;p53 tumor protein (p53); p53 variant; prostein; surviving; telomerase; prostate cancer tumor antigen-1 (PCTA-1 or galectin 8); melanoma antigen 1 recognized by T cells (MelanA or MARTI); rat sarcoma (Ras) variant; human telomerase reverse transcriptase (hTERT); sarcoma translocation breakpoints; melanoma inhibitor of apoptosis (ML-IAP); ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene); N-amino cetylglucosaminyltransferase V (NA17); paired-box protein Pax-3 (PAX3); androgen receptor; cyclin B1; v-myc avian myelocytomatosis viral oncogene neuroblastoma-derived homolog (MYCN); Ras homolog family member C (RhoC); tyrosinase-related protein 2 (TRP-2); cytochrome P4501B1 (CYP1B1); CCCTC-binding factor (zinc finger protein)-like (BORIS or brother of regulator of imprinted sites (BORIS) or Brother of the Regulator of Imprinted Sites), Squamous Cell Carcinoma Antigen Recognized By T Cells 3 (SART3); Paired Box Protein Pax-5 (PAX5); Proacrosin-binding Protein sp32 (OY-TESl); Lymphocyte-specific Protein Tyrosine Kinase (LCK); A-kinase Anchoring Protein 4 (AKAP-4); Synovial Sarcoma, X-breakpoint 2 (SSX2); Receptor for Advanced Glycation End Products (RAGE-1); Renal Ubiquitous 1 (RU1); Renal Ubiquitous 2 (RU2); Legumain; Human Papillomavirus E6 (HPV E6); Human Papillomavirus E7 (HPV E7); Intestinal Carboxylesterase; Heat Shock Protein 70-2 Mutant (mut hsp70-2); CD79a; CD79b; CD72; Leukocyte-associated Immunoglobulin-like Receptor 1 (LAIR1); IgA Fc fragment of receptor (FCAR or CD89); leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2); CD300 molecule-like family member f (CD300LF);C-type lectin domain family 12 member A (CLEC12A); bone marrow stromal cell antigen 2 (BST2); EGF-like module-containing mucin-like hormone receptor-like 2 (EMR2); lymphocyte antigen 75 (LY75); glypican 2 (GPC2); glypican 3 (GPC3); NKG2D; KRAS; GDNF family receptor alpha 4 (GFRa4); IL13Ra2; Fc receptor-like 5 (FCRL5); and immunoglobulin lambda-like polypeptide 1 (IGLL1).

[0159] In some embodiments, the immune cells are engineered to express a CAR that targets CD19, CD20, CD22, BCMA, CD37, mesothelin, PSMA, PSCA, Tn-MUC1, EGFR, EGFRvIII, c-Met, HER1, HER2, CD33, CD133, GD2, GPC2, GPC3, NKG2D, KRAS, or WT1. 2. Transmembrane domain:

[0160] With regard to the transmembrane domain, the CAR can be designed to include a transmembrane domain that connects the antigen-binding domain of the CAR to the intracellular domain. The transmembrane domain of a subject CAR is a region that can penetrate the cell membrane of a cell (e.g., an immune cell or a precursor thereof). The transmembrane domain is for insertion into a cell membrane, e.g., a eukaryotic cell membrane. In some embodiments, the transmembrane domain is interposed between the antigen-binding domain and the intracellular domain of the CAR.

[0161] In one embodiment, the transmembrane domain is naturally associated with one or more domains in the CAR. In some instances, the transmembrane domain may be selected or modified by amino acid substitution to avoid binding of such domains to transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex.

[0162] In some embodiments, the transmembrane domain can be derived from either a natural or synthetic source. If the source is natural, the domain can be derived from any membrane-associated or transmembrane protein, such as a type I transmembrane protein. If the source is synthetic, the transmembrane domain can be any artificial sequence that facilitates the insertion of the CAR into a cell membrane, such as an artificial hydrophobic sequence. In some embodiments, transmembrane domains of particular use in the present invention include, but are not limited to, transmembrane domains derived from the alpha, beta or zeta chains of the T-cell receptor, CD28, CD2, CD3 epsilon, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, and killer immunoglobulin-like receptors (KIR). In some embodiments, the transmembrane domain comprises at least one transmembrane region of a protein selected from the group consisting of the alpha, beta or zeta chain of the T cell receptor, CD28, CD2, CD3 epsilon, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9 and killer immunoglobulin-like receptor (KIR). In some embodiments, the transmembrane domain may be synthetic. In some embodiments, the synthetic transmembrane domain comprises primarily hydrophobic residues such as leucine and valine. In one exemplary embodiment, a triplet of phenylalanine, tryptophan and valine is found at each end of the synthetic transmembrane domain.

[0163] The transmembrane domains described herein can be combined with any of the antigen binding domains described herein, any of the costimulatory signaling domains described herein, any of the intracellular signaling domains described herein, or any of the other domains described herein that may be included in a subject CAR.

[0164] In one embodiment, the transmembrane domain comprises a CD8α transmembrane domain. In some embodiments, the transmembrane domain comprises a CD8α transmembrane domain comprising the amino acid sequence set forth in SEQ ID NO: 23. In some embodiments, the transmembrane domain comprises the nucleotide sequence set forth in SEQ ID NO: 24.

[0165] In some embodiments, the transmembrane domain comprises a CD28 transmembrane domain. In some embodiments, the CAR comprises a CD28 transmembrane domain comprising the amino acid sequence set forth in SEQ ID NO: 27. In some embodiments, the CD28 transmembrane domain comprises the nucleotide sequence set forth in SEQ ID NO: 28.

[0166] Acceptable variations of the transmembrane domain and / or hinge domain while maintaining the intended function are known to those of skill in the art. In some embodiments, the transmembrane domain comprises an amino acid sequence having at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity to any of the amino acid sequences set forth in SEQ ID NO:23 and / or SEQ ID NO:27. In some embodiments, the transmembrane domain is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% sequence identity to any of the nucleotide sequences set forth in SEQ ID NOs: 24 and / or 28. The transmembrane domain can be combined with any hinge domain and / or can include one or more transmembrane domains described herein.

[0167] In some embodiments, the CAR can be any antigen binding domain, the T transmembrane domain of the alpha, beta or zeta chain of the T cell receptor. a transmembrane domain selected from the group consisting of CD28, CD2, CD3 epsilon, CD45, CD4, CD5, CD7, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134 (OX-40), CD137 (4-1BB), CD154 (CD40L), CD278 (ICOS), CD357 (GITR), Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9 and killer immunoglobulin-like receptor (KIR), any costimulatory signaling domain and any intracellular domain or cytoplasmic domain described herein, or any of the other domains described herein that may be included in a CAR, and optionally a hinge domain.

[0168] In some embodiments, the CAR further comprises a spacer domain between the extracellular and transmembrane domains of the CAR, or between the intracellular and transmembrane domains of the CAR. As used herein, the term "spacer domain" generally refers to any oligo- or polypeptide that functions to link a transmembrane domain to either an extracellular or intracellular domain in a polypeptide chain. A spacer domain can contain up to about 300 amino acids, e.g., about 10 to about 100 amino acids or about 25 to about 50 amino acids. In some embodiments, the spacer domain can be a short oligo- or polypeptide linker, e.g., about 2 to about 10 amino acids in length. For example, a glycine-serine doublet provides a particularly suitable linker between the transmembrane and intracellular signaling domains of a subject CAR.

[0169] Thus, a CAR of the present disclosure can comprise any of the transmembrane domains, hinge domains, or spacer domains described herein. 3. Hinge domain:

[0170] In some embodiments, a subject CAR of the present invention comprises a hinge region. The hinge region of the CAR is a hydrophilic region located between the antigen binding domain and the transmembrane domain. In some embodiments, the hinge domain promotes proper protein folding of the CAR. In some embodiments, the hinge domain is an optional component of the CAR. In some embodiments, the hinge domain comprises a domain selected from an Fc fragment of an antibody, an antibody hinge region, an antibody CH2 region, an antibody CH3 region, an artificial hinge sequence, or a combination thereof. In some embodiments, the hinge domain is selected from, but is not limited to, a CD8a hinge, an artificial hinge consisting of a polypeptide that may be as small as three glycines (Gly). In some embodiments, the hinge region is a hinge region polypeptide derived from a receptor. In some embodiments, the hinge region is a hinge region derived from CD8. In one embodiment, the hinge domain comprises an amino acid sequence derived from human CD8 or a variant thereof. In some embodiments, a subject CAR comprises a CD8α hinge domain and a CD8α transmembrane domain. In some embodiments, the CD8α hinge domain comprises the amino acid sequence set forth in SEQ ID NO: 25. In some embodiments, the CD8α hinge domain comprises the nucleotide sequence set forth in SEQ ID NO: 26.

[0171] In some embodiments, the hinge domain comprises an amino acid sequence having at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any of the amino acid sequences set forth in SEQ ID NO:25. In some embodiments, the hinge domain is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to any of the nucleotide sequences set forth in SEQ ID NO:26.

[0172] In some embodiments, the hinge domain connects the antigen binding domain to the transmembrane domain, which is linked to the intracellular domain. In exemplary embodiments, the hinge region can support the antigen binding domain in recognizing and binding to a target antigen on a target cell. See, e.g., Hudecek et al., Cancer Immunol. Res., 3(2):125-135 (2015). In some embodiments, the hinge region is a flexible domain, which allows the antigen binding domain to have a structure that optimally recognizes a particular structure and density of a target antigen on a cell, such as a tumor cell. The flexibility of the hinge region allows the hinge region to adopt a variety of conformations.

[0173] In some embodiments, the length of the hinge domain is selected from about 4 to about 50, about 4 to about 10, about 10 to about 15, about 15 to about 20, about 20 to about 25, about 25 to about 30, about 30 to about 40, or about 40 to about 50 amino acids.

[0174] A suitable hinge region can be readily selected and can be of any suitable length, including from about 1 amino acid (e.g., glycine (Gly)) to about 20 amino acids, from about 2 to about 15, from about 3 to about 12 amino acids, from about 4 to about 10, from about 5 to about 9, from about 6 to about 8, or from about 7 to about 8 amino acids, and can be about 1, about 2, about 3, about 4, about 5, about 6, or about 7 amino acids.

[0175] In some embodiments, the amino acid is glycine (Gly). Glycine and glycine-serine polymers can be used, with both glycine and serine being relatively unstructured and therefore functioning as neutral linkers between components. Glycine polymers can also be used, with glycine having access to a much larger phi-psi space than alanine and being much less restricted than residues with long side chains (see, e.g., Scheraga, Rev. Computational. Chem. (1992) 2:73-142). In some embodiments, the hinge region comprises a glycine polymer (G)n, a glycine-serine polymer. In some embodiments, the hinge region comprises a glycine-serine polymer selected from the group consisting of (GS)n, (GSGGS)n (SEQ ID NO:47) and (GGGS)n (SEQ ID NO:48), where n is an integer of at least 1. In some embodiments, the hinge domain comprises an amino acid sequence including, but not limited to, GGSG (SEQ ID NO: 29), GGSGG (SEQ ID NO: 30), GSGSG (SEQ ID NO: 31), GSGGG (SEQ ID NO: 32), GGGSG (SEQ ID NO: 33), GSSSG (SEQ ID NO: 34). In some embodiments, the hinge region comprises a glycine-alanine polymer, an alanine-serine polymer, or other flexible linker known in the art.

[0176] In some embodiments, the hinge region is an immunoglobulin heavy chain hinge region. The amino acid sequences of immunoglobulin hinge regions are known in the art. In some embodiments, the immunoglobulin hinge domain comprises an amino acid sequence selected from the group consisting of DKTHT (SEQ ID NO:35), CPPC (SEQ ID NO:36), CPEPKSCDTPPPCPR (SEQ ID NO:37) (see, e.g., Glaser et al., J. Biol. Chem. (2005) 280:41494-41503), ELKTPLGDTTHHT (SEQ ID NO:38); KSCDKTHTCP (SEQ ID NO:39), KCCVDCP (SEQ ID NO:40), KYGPPCP (SEQ ID NO:41), EPKSCDKTHTCPPCP (SEQ ID NO:42) (human IgG1 hinge), ERKCCVECPPCP (SEQ ID NO:43) (human IgG2 hinge), ELKTPLGDTTHTCPRCP (SEQ ID NO:44) (human IgG3 hinge); SPNMVPHAHHAQ (SEQ ID NO:45) (human IgG4 hinge), and the like.

[0177] In some embodiments, the hinge region is an immunoglobulin heavy chain hinge region. In some embodiments, the hinge is selected from the CH1 and CH3 domains of an IgG (such as human IgG4). In some embodiments, the hinge domain comprises the amino acid sequence of a human IgG1, IgG2, IgG3 or IgG4 hinge domain. In some embodiments, the hinge region may comprise one or more amino acid substitutions and / or insertions and / or deletions compared to a wild-type (naturally occurring) hinge region. In some embodiments, the histidine at position 229 of the human IgG1 hinge (His229) is substituted with a tyrosine (Tyr). In some embodiments, the hinge domain comprises the amino acid sequence EPKSCDKTYTCPPCP (SEQ ID NO: 46). 4. Costimulatory domain:

[0178] The CAR of the present invention also comprises an intracellular domain. The intracellular or cytoplasmic domain of the CAR is responsible for the activation of the cell in which the CAR is expressed. Thus, the term "intracellular domain" is meant to include any portion of the intracellular domain sufficient to transmit an activation signal. In one embodiment, the intracellular domain comprises a domain responsible for effector function. The term "effector function" refers to a specialized function of a cell. For example, the effector function of a T cell can be a cytolytic activity or a helper activity including secretion of cytokines. In one embodiment, the intracellular domain of the CAR comprises a domain responsible for signal activation and / or transduction. The intracellular domain can transmit signal activation through protein-protein interactions, biochemical changes, or other reactions, and can change the cell's metabolism, shape, gene expression, or other cellular responses to the activation of the chimeric intracellular signaling molecule.

[0179] Examples of intracellular domains for use in the present invention include, but are not limited to, the cytoplasmic portion of the T cell receptor (TCR), any costimulatory molecule, or any molecule that acts in concert with the TCR to initiate signaling in the T cell following antigen receptor binding, as well as any derivatives or variants of these elements, and any synthetic sequences having the same functional capabilities.

[0180] In some embodiments, the intracellular domain comprises a costimulatory signaling domain and an intracellular signaling domain. In certain embodiments, the intracellular domain comprises a costimulatory signaling domain. In one embodiment, the intracellular domain of the CAR comprises a costimulatory signaling domain selected from the group consisting of a portion of a signaling domain from a protein of the TNFR superfamily, an intracellular domain from CD27, CD28, 4-1BB (CD137), OX40 (CD134), PD-1, CD7, LIGHT, CD83L, DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, ICOS CD278), NKG2C, B7-H3 (CD276), and a killer immunoglobulin-like receptor (KIR), any derivative or variant thereof, any synthetic sequence thereof having the same functional capability, and any combination thereof.

[0181] In some embodiments, the costimulatory domain comprises one or more of the costimulatory domains of a protein selected from the group consisting of proteins of the TNFR superfamily, CD28, 4-1BB (CD137), OX40 (CD134), PD-1, CD7, LIGHT, CD83L, DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, ICOS (CD278), NKG2C, B7-H3 (CD276), and the intracellular domain from a killer immunoglobulin-like receptor (KIR), or a variant thereof. In some embodiments, the costimulatory domain comprises one or more of the costimulatory domains of a protein selected from the group consisting of proteins of the TNFR superfamily, CD28, 4-1BB (CD137), OX40 (CD134), CD27, CD2, or a combination thereof. In some embodiments, the costimulatory signaling domain comprises a 4-1BB costimulatory domain. In some embodiments, the costimulatory signaling domain comprises a CD2 costimulatory domain. In some embodiments, the costimulatory signaling domain comprises a CD28 costimulatory domain.

[0182] In one embodiment, the costimulatory domain of the CAR comprises a 4-1BB costimulatory domain comprising the amino acid sequence set forth in SEQ ID NO:1. In some embodiments, the 4-1BB costimulatory domain is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO:2 or 3. In some embodiments, the costimulatory domain of the CAR comprises a CD28 costimulatory domain comprising the amino acid sequence set forth in SEQ ID NO:4. In some embodiments, the CD28 costimulatory domain is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO:5. In some embodiments, the costimulatory domain of the CAR comprises a CD28 (YMFM) costimulatory domain comprising the amino acid sequence set forth in SEQ ID NO:6. In some embodiments, the CD28 (YMFM) costimulatory domain is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO:7. In one embodiment, the intracellular domain of the CAR comprises an ICOS costimulatory domain comprising the amino acid sequence set forth in SEQ ID NO:8. In some embodiments, the ICOS costimulatory domain is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO:9 or SEQ ID NO:10. In some embodiments, the intracellular domain of the CAR comprises an ICOS (YMNM) costimulatory domain comprising the amino acid sequence set forth in SEQ ID NO:11. In some embodiments, the ICOS (YMNM) costimulatory domain is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 12. In some embodiments, the intracellular domain of a subject CAR comprises a CD2 costimulatory domain comprising the amino acid sequence set forth in SEQ ID NO: 13. In some embodiments, the CD2 costimulatory domain is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 14. In one embodiment, the intracellular domain of a CAR comprises a CD27 costimulatory domain comprising the amino acid sequence set forth in SEQ ID NO: 15. In some embodiments, the CD27 costimulatory domain is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 16. In one embodiment, the intracellular domain of a CAR comprises an OX40 costimulatory domain comprising the amino acid sequence set forth in SEQ ID NO: 17.In some embodiments, the OX40 costimulatory domain is encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO:18. 5. Intracellular domain:

[0183] In one embodiment, the intracellular domain comprises an intracellular signaling domain. Examples of intracellular domains include, but are not limited to, fragments or domains from one or more of the following molecules or receptors: TCR, CD3 zeta, CD3 gamma, CD3 delta, CD3 epsilon, CD86, common FcR gamma, FcR beta (Fc epsilon rib), CD79a, CD79b, Fc gamma R11a, DAP10, DAP12, T cell receptor (TCR), CD2, CD8, CD27, CD28, 4-1BB (CD137), OX9, OX40, CD30, CD40, PD-1, ICOS. , KIR family proteins, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, ligand that specifically binds to CD83, CD5, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD127, CD160, CD19, CD4, CD8 alpha, CD8 beta, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA- 6, CD49f, ITGAD, CD1Id, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CDlib, ITGAX, CD11c, ITGBl, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, TRANCE / RANKL, DNAM1(CD226), SLAMF4(CD244, 2B4), CD84, CD96(Tactile), CEACAM1, CRTAM, Ly9(CD229), CD160(BY55), PSGL1, CD100(SEMA4D), CD69, S LAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, NKp44, NKp30, NKp46, NKG2D, Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, syk family tyrosine kinase (Syk, ZAP70, etc.), src family tyrosine kinase (Lck, Fyn, Lyn, etc.),Other costimulatory molecules described herein, their derivatives, variants or fragments, synthetic sequences of costimulatory molecules having the same functional capabilities, and combinations thereof.

[0184] In some embodiments, the intracellular signaling domain comprises an intracellular domain selected from the group consisting of a cytoplasmic signaling domain of human CD2, CD3 zeta chain (CD3ζ), FcγRIII, FcsRI, the cytoplasmic tail of an Fc receptor, an immunoreceptor tyrosine-based activation motif (ITAM)-bearing cytoplasmic receptor, TCR zeta, FcR gamma, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, and CD66d, or variants thereof. In some embodiments, the intracellular signaling domain comprises a CD3 zeta intracellular signaling domain.

[0185] Further examples of intracellular domains include, but are not limited to, first, second and third generation T cell signaling proteins, including CD3, B7 family costimulators and tumor necrosis factor receptor (TNFR) superfamily receptors. Intracellular signaling domains of several types of various other immune signaling receptors are included, but are not limited to. In addition, intracellular signaling domains can include signaling domains used by NK and NKT cells, such as the signaling domains of NKp30 (B7-H6), DAP12, NKG2D, NKp44, NKp46, DAP10 and CD3z.

[0186] Intracellular signaling domains suitable for use in the CARs of the present invention include any desired signaling domain that transmits a signal in response to activation of the CAR (i.e., activation by antigen and dimerization agent). In some embodiments, a clear and detectable signal includes, for example, an increase in the production of one or more cytokines by the cell, a change in the transcription of a target gene, a change in the activity of a protein, a change in cell behavior (e.g., cell death), cell proliferation, cell differentiation, cell survival, and / or modulation of a cell signaling response. For example, in some embodiments, the intracellular signaling domain includes a DAP10 / CD28 type signaling chain. In some embodiments, the intracellular signaling domain is not covalently attached to the membrane-bound CAR, but instead is diffused in the cytoplasm.

[0187] Intracellular signaling domains suitable for use in the CARs of the invention include immunoreceptor tyrosine-based activation motif (ITAM)-containing intracellular signaling polypeptides. In some embodiments, the intracellular signaling domain comprises at least one, at least two, at least three, at least four, at least five, or at least six ITAM motifs, as described below. In some embodiments, the ITAM motif is repeated twice within the intracellular signaling domain, and the first and second instances of the ITAM motif are separated from each other by 6-8 amino acids. In one embodiment, the intracellular signaling domain of a subject CAR comprises three ITAM motifs. In some embodiments, the intracellular signaling domain includes, but is not limited to, a signaling domain of a human immunoglobulin receptor that contains an immunoreceptor tyrosine-based activation motif (ITAM), such as Fc gamma RI, Fc gamma RIIA, Fc gamma RIIC, Fc gamma RIIIA, FcRL5, etc.

[0188] A suitable intracellular signaling domain can be an ITAM motif-containing portion derived from a polypeptide that contains an ITAM motif. For example, a suitable intracellular signaling domain can be an ITAM motif-containing domain from any ITAM motif-containing protein. Thus, a suitable intracellular signaling domain does not need to include the entire sequence of the entire protein from which it is derived. Examples of suitable ITAM motif-containing polypeptides include, but are not limited to, DAP12, FCER1G (Fc epsilon receptor I gamma chain), CD3D (CD3 delta), CD3E (CD3 epsilon), CD3G (CD3 gamma), CD3Z (CD3 zeta) and CD79A (antigen receptor complex-associated protein alpha chain).

[0189] In one embodiment, the intracellular signaling domain is derived from DAP12 (also called TYROBP, TYRO protein tyrosine kinase binding protein, KARAP, PLOSL, DNAX activating protein 12, KAR associated protein, TYRO protein tyrosine kinase binding protein, killer activating receptor associated protein, killer activating receptor associated protein, etc.). In one embodiment, the intracellular signaling domain is derived from FCER1G (also called FCRG, Fc epsilon receptor I gamma chain, Fc receptor gamma chain, fc-epsilon RI-gamma, fcR gamma, fceR1 gamma, high affinity immunoglobulin epsilon receptor subunit gamma, immunoglobulin E receptor, high affinity gamma chain, etc.). In one embodiment, the intracellular signaling domain is derived from the T cell surface glycoprotein CD3 delta chain (also referred to as CD3D, CD3 delta, T3D, CD3 antigen, delta subunit, CD3 delta, CD3d antigen, delta polypeptide (TiT3 complex), OKT3 delta chain, T cell receptor T3 delta chain, T cell surface glycoprotein CD3 delta chain, etc.). In one embodiment, the intracellular signaling domain is derived from the T cell surface glycoprotein CD3 epsilon chain (also referred to as CD3e, T cell surface antigen T3 / Leu-4 epsilon chain, T cell surface glycoprotein CD3 epsilon chain, AI504783, CD3, CD3 epsilon, T3e, etc.). In one embodiment, the intracellular signaling domain is derived from the T cell surface glycoprotein CD3 gamma chain (also referred to as CD3G, T cell receptor T3 gamma chain, CD3 gamma, T3G, gamma polypeptide (TiT3 complex), etc.). In one embodiment, the intracellular signaling domain is derived from the T cell surface glycoprotein CD3 zeta chain (also called CD3Z, T cell receptor T3 zeta chain, CD247, CD3 zeta, CD3H, CD3Q, T3Z, TCRZ, etc.). In one embodiment, the intracellular signaling domain is derived from CD79A (also called B cell antigen receptor complex associated protein alpha chain, CD79a antigen (immunoglobulin-associated alpha), MB-1 membrane glycoprotein, Ig-alpha, membrane-bound immunoglobulin-associated protein, surface IgM-associated protein, etc.).In one embodiment, the intracellular signaling domain suitable for use in a subject CAR of the present disclosure includes a DAP10 / CD28 type signaling chain. In one embodiment, the intracellular signaling domain suitable for use in a subject CAR of the present disclosure includes a ZAP70 polypeptide. In some embodiments, the intracellular signaling domain includes a cytoplasmic signaling domain of TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, or CD66d. In one embodiment, the intracellular signaling domain in a CAR includes a cytoplasmic signaling domain of human CD3 zeta.

[0190] Usually, the entire intracellular signaling domain can be used, but in many cases, it is not necessary to use the entire chain. To the extent that a truncated portion of the intracellular signaling domain is used, such a truncated portion can be used instead of the complete chain, so long as it transmits an effector function signal. The intracellular signaling domain includes any truncated portion of the intracellular signaling domain that is sufficient to transmit an effector function signal.

[0191] The intracellular signaling domains described herein can be combined with any of the costimulatory signaling domains described herein, any of the antigen binding domains described herein, any of the transmembrane domains described herein, or any of the other domains described herein that may be included in a CAR. In some embodiments, the intracellular domain of a CAR comprises dual signaling domains. The dual signaling domains may include fragments or domains from any of the molecules described herein. In some embodiments, the intracellular domain comprises a 4-1BB costimulatory domain and a CD3 zeta signaling domain, a CD28 costimulatory domain and a CD3 zeta signaling domain, a CD2 costimulatory domain and a CD3 zeta signaling domain. In some embodiments, the intracellular domain of a CAR comprises any portion of a costimulatory molecule, such as at least one signaling domain from CD3, CD27, CD28, ICOS, 4-1BB, PD-1, T cell receptor (TCR), any derivative or variant thereof, any synthetic sequence thereof with the same functional capability, and any combination thereof.

[0192] Furthermore, variant intracellular signaling domains suitable for use in the subject CAR are known in the art. The YMFM motif is an SH2 binding motif present in ICOS that recruits both the p85 subunit and the p50 alpha subunit of PI3K, enhancing AKT signaling. In one embodiment, CD28 intracellular domain variants can be generated to contain the YMFM motif.

[0193] In one embodiment, the intracellular domain of a subject CAR comprises a CD3 zeta intracellular signaling domain comprising the amino acid sequence set forth in SEQ ID NO: 19 or SEQ ID NO: 21, which can be encoded by a nucleic acid sequence comprising the nucleotide sequence set forth in SEQ ID NO: 20 or SEQ ID NO: 22, respectively.

[0194] It is known to those skilled in the art how to make acceptable changes to the intracellular domain while maintaining a particular activity. In some embodiments, the intracellular domain comprises an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any of the amino acid sequences set forth in SEQ ID NO: 19 or 21. In some embodiments, the intracellular domain is encoded by a nucleic acid sequence comprising a nucleotide sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any of the nucleotide sequences set forth in SEQ ID NO:20 or 22.

[0195] In one embodiment, the intracellular domain of a subject CAR comprises an ICOS costimulatory domain and a CD3 zeta intracellular signaling domain. In one embodiment, the intracellular domain of a subject CAR comprises a CD28 costimulatory domain and a CD3 zeta intracellular signaling domain. In one embodiment, the intracellular domain of a subject CAR comprises a CD28YMFM variant costimulatory domain and a CD3 zeta intracellular signaling domain. In one embodiment, the intracellular domain of a subject CAR comprises a CD27 costimulatory domain and a CD3 zeta intracellular signaling domain. In one embodiment, the intracellular domain of a subject CAR comprises an OX40 costimulatory domain and a CD3 zeta intracellular signaling domain. In one exemplary embodiment, the intracellular domain of a subject CAR comprises a 4-1BB costimulatory domain and a CD3 zeta intracellular signaling domain. In one exemplary embodiment, the intracellular domain of a subject CAR comprises a CD2 costimulatory domain and a CD3 zeta intracellular signaling domain.

[0196] Table 2 shows exemplary sequences of the domains of the CARs described herein. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10] [Table 2-11] [Table 2-12] [Table 2-13] [Table 2-14] B. Additional antigen-binding polypeptides:

[0197] In some embodiments, the modified T cells express an antigen-binding polypeptide, a cell surface receptor ligand, or a polypeptide that binds to a tumor antigen. In some examples, the antigen-binding domain comprises an antibody that recognizes a cell surface protein or a receptor expressed on a tumor cell. In some examples, the antigen-binding domain comprises an antibody that recognizes a tumor antigen. In some examples, the antigen-binding domain comprises a full-length antibody or an antigen-binding fragment thereof, a Fab, a F(ab)2, a monospecific Fab2, a bispecific Fab2, a trispecific Fab2, a single chain variable fragment (scFv), a diabody, a triabody, a minibody, a V-NAR, or a VhH. C. Cell surface receptor ligands:

[0198] In some embodiments, the modified T cells express a cell surface receptor ligand. In some examples, the ligand binds to a cell surface receptor expressed on a tumor cell. In some examples, the ligand comprises a wild-type protein or a variant thereof that binds to a cell surface receptor. In some examples, the ligand comprises a full-length protein or a functional fragment thereof that binds to a cell surface receptor. In some examples, the functional fragment comprises about 90%, about 80%, about 70%, about 60%, about 50%, or about 40% of the length of the full-length version of the protein, but retains binding to the cell surface receptor. In some examples, the ligand is a novel recombinant protein that binds to a cell surface receptor. Exemplary ligands include, but are not limited to, epidermal growth factor (EGF), platelet-derived growth factor (PDGF), or Wnt3A. D. Tumor antigens:

[0199] In some embodiments, the modified T cells express a polypeptide that binds to a tumor antigen. In some examples, the tumor antigen is associated with a hematological malignancy. Exemplary tumor antigens include, but are not limited to, CD19, CD20, CD22, CD33 / IL3Ra, ROR1, mesothelin, c-Met, PSMA, PSCA, folate receptor alpha, folate receptor beta, EGFRvIII, GPC2, Tn-MUC1, GDNF family receptor alpha 4 (GFRa4), fibroblast activation protein (FAP), and IL13Ra2. In some examples, the tumor antigen comprises CD19, CD20, CD22, BCMA, CD37, mesothelin, PSMA, PSCA, Tn-MUC1, EGFR, EGFRvIII, c-Met, HER1, HER2, CD33, CD133, GD2, GPC2, GPC3, NKG2D, KRAS, or WT1. In some examples, the polypeptide is a ligand of a tumor antigen, such as a full-length protein that binds to the tumor antigen, a functional fragment thereof, or a novel recombinant ligand that binds to the tumor antigen, hi some examples, the polypeptide is an antibody that binds to the tumor antigen. E. Switch Receptors and Dominant Negative Receptors:

[0200] In one aspect, the disclosure also includes modified immune cells with downregulated gene expression as described herein, further comprising an exogenous nucleic acid encoding a dominant negative receptor, a switch receptor, or a combination thereof. In some embodiments, the modified immune cells with downregulated gene expression described herein further comprise a chimeric antigen receptor (CAR) and / or a dominant negative receptor. In some embodiments, the modified immune cells with downregulated gene expression described herein further comprise a CAR and a switch receptor. In some embodiments, the modified immune cells with downregulated gene expression described herein further comprise a recombinant TCR and a switch receptor. In some embodiments, the modified immune cells with downregulated gene expression described herein further comprise a recombinant TCR and a dominant negative receptor. In some embodiments, the modified immune cells with downregulated gene expression described herein further comprise a KIR and a switch receptor. In some embodiments, the modified immune cells with downregulated gene expression described herein further comprise a KIR and a dominant negative receptor. 1. Switch receptor:

[0201] The present invention provides compositions and methods for modified immune cells or their progenitors with downregulated gene expression, including CAR and switch receptors. Tumor cells generate an immunosuppressive microenvironment to protect them from immune recognition and elimination. This immunosuppressive microenvironment can limit the efficacy of immunosuppressive therapies, such as CAR-T or TCR-T cell therapy. For example, the secreted cytokine Transforming Growth Factor β (TGFβ) directly inhibits the function of cytotoxic T cells and also induces the formation of regulatory T cells to further suppress immune responses. T cell immunosuppression by TGFβ in prostate cancer has been previously demonstrated by Donkor et al (2011) and Shalapour et al (2015). To mitigate the immunosuppressive effects of TGF on immune cells, immune cells can be modified to express recombinant TGFβR, for example, containing the extracellular ligand-binding domain of TGFβR fused to the intracellular signaling domain of interleukin 12 receptor (IL12R, TGFβR-IL12R). Thus, a modified immune cell comprising a switch receptor can bind to a negative signaling molecule within the microenvironment of the modified immune cell and convert a negative signaling signal of an inhibitory molecule on the modified immune cell into a positive signal that stimulates the modified immune cell. The switch receptor of the present invention can be designed to reduce the effect of a negative signaling molecule or convert a negative signal into a positive signal by comprising an intracellular domain associated with a positive signal.

[0202] Thus, in some embodiments, the modified immune cells comprising insertions and / or deletions in one or more loci encoding endogenous immune proteins are further genetically modified to express a switch receptor. As used herein, the term "switch receptor" refers to a molecule designed to reduce the effect of a negative signaling molecule on the modified immune cells of the present invention. The switch receptor comprises a first domain from a first polypeptide associated with a negative signal (signaling that suppresses or inhibits activation of a cell or T cell) and a second domain from a second polypeptide associated with a positive signal (signaling that stimulates a cell or T cell). In some embodiments, the protein associated with the negative signal is selected from the group consisting of CTLA4, PD-1, TGFβRII, BTLA, VSIG3, VSIG8, and TIM-3. In some embodiments, the protein associated with the positive signal is selected from the group consisting of CD28, 4-1BB, IL12Rβ1, IL12Rβ2, CD2, ICOS, and CD27.

[0203] In one embodiment, the first domain comprises at least a portion of an extracellular domain of a first polypeptide associated with a negative signal, and the second domain comprises at least a portion of an intracellular domain of a second polypeptide associated with a positive signal. Thus, a switch receptor comprises an extracellular domain associated with a negative signal fused to an intracellular domain associated with a positive signal. In some embodiments, the switch receptor comprises an extracellular domain of a signaling protein associated with a negative signal, a transmembrane domain, and an intracellular domain of a signaling protein associated with a positive signal. In some embodiments, the transmembrane domain of the switch receptor is selected from a transmembrane domain of a protein associated with a negative signal or a transmembrane domain of a protein associated with a negative signal. In some embodiments, the transmembrane domain of the switch receptor is selected from a transmembrane domain of a protein selected from the group consisting of CTLA4, PD-1, VSIG3, VSIG8, TGFβRII, BTLA, TIM-3, CD28, 4-1BB, IL12Rβ1, IL12Rβ2, CD2, ICOS, and CD27.

[0204] In some embodiments, the switch receptor is PD-1-CD28, PD-1 A132L -CD28, PD-1 -CD27, PD-1 A132L -CD27, PD-1-4-1BB, PD-1 A132L -4-1BB, PD-1-ICOS, PD-1 A132L -ICOS, PD-1-IL12Rβ1, PD-1 A132L -IL12Rβ1, PD-1-IL12Rβ2, PD-1 A132L-IL12Rβ2, VSIG3-CD28, VSIG8-CD28, VSIG3-CD27, VSIG8-CD27, VSIG3-4-1BB, VSIG8-4-1BB, VSIG3-ICOS, VSIG8-ICOS, VSIG3-IL12Rβ1, VSIG8-IL12Rβ1, VSIG3-IL12Rβ2, VSIG8-IL12Rβ2, TGFβRII-CD27, TGFβRII-CD28, TGFβRII-4-1BB, TGFβRII-ICOS, TGFβRII-IL12Rβ1, and TGFβRII-IL12Rβ2.

[0205] In some embodiments, the switch receptor is PD-1-CD28 and comprises the amino acid sequence set forth in SEQ ID NO: 78. In one embodiment, the switch receptor is PD-1 A132L In one embodiment, the switch receptor is PD-1-4-1BB and comprises the amino acid sequence set forth in SEQ ID NO: 84. In one embodiment, the switch receptor is PD-1 A132L In one embodiment, the switch receptor is TGFβRII-IL12Rβ1 and comprises the amino acid sequence set forth in SEQ ID NO: 88. In one embodiment, the switch receptor is TGFβRII-IL12Rβ2 and comprises the amino acid sequence set forth in SEQ ID NO: 90. In one embodiment, the switch receptor is encoded by a nucleic acid sequence set forth in SEQ ID NO: 79, 81, 83, 85, 87, 89, or 91.

[0206] Acceptable mutations of the switch receptor while maintaining the intended biological activity (e.g., converting a negative signal to a positive signal when expressed in a cell) are known to those of skill in the art. Thus, in some embodiments, the switch receptor of the present invention can be encoded by a nucleic acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 79, 81, 83, 85, 87, 89 or 91. In some embodiments, a switch receptor of the invention can comprise an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to SEQ ID NO:78, 80, 82, 84, 86, 88, or 90.

[0207] In some embodiments, the modified immune cells are CD3, B2M and CIITA, CAR, and PD-1-CD28, PD-1 A132L -CD28, PD-1 -CD27, PD-1 A132L -CD27, PD-1-4-1BB, PD-1 A132L -4-1BB, PD-1-ICOS, PD-1 A132L -ICOS, PD-1-IL12Rβ1, PD-1 A132L -IL12Rβ1, PD-1-IL12Rβ2, PD-1 A132L- comprising an insertion and / or deletion capable of downregulating a switch receptor selected from the group consisting of: IL12Rβ2, VSIG3-CD28, VSIG8-CD28, VSIG3-CD27, VSIG8-CD27, VSIG3-4-1BB, VSIG8-4-1BB, VSIG3-ICOS, VSIG8-ICOS, VSIG3-IL12Rβ1, VSIG8-IL12Rβ1, VSIG3-IL12Rβ2, VSIG8-IL12Rβ2, TGFβRII-CD27, TGFβRII-CD28, TGFβRII-4-1BB, TGFβRII-ICOS, TGFβRII-IL12Rβ1 and TGFβRII-IL12Rβ2. In some embodiments, the modified immune cells are endogenous immune proteins selected from the group consisting of CD3δ, CD3ε, CD3γ, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain), and combinations thereof, CAR, and PD-1-CD28, PD-1 A132L -CD28, PD-1 -CD27, PD-1 A132L -CD27, PD-1-4-1BB, PD-1 A132L -4-1BB, PD-1-ICOS, PD-1 A132L -ICOS, PD-1-IL12Rβ1, PD-1 A132L -IL12Rβ1, PD-1-IL12Rβ2, PD-1 A132L - comprising insertions and / or deletions at one or more loci encoding a switch receptor selected from the group consisting of: IL12Rβ2, VSIG3-CD28, VSIG8-CD28, VSIG3-CD27, VSIG8-CD27, VSIG3-4-1BB, VSIG8-4-1BB, VSIG3-ICOS, VSIG8-ICOS, VSIG3-IL12Rβ1, VSIG8-IL12Rβ1, VSIG3-IL12Rβ2, VSIG8-IL12Rβ2, TGFβRII-CD27, TGFβRII-CD28, TGFβRII-4-1BB, TGFβRII-ICOS, TGFβRII-IL12Rβ1 and TGFβRII-IL12Rβ2. 2. Dominant Negative Receptors:

[0208] The present invention provides compositions and methods for modified immune cells or their progenitors with downregulated gene expression, including CAR and dominant negative receptors. Thus. In some embodiments, modified immune cells comprising insertions and / or deletions in one or more loci encoding endogenous immune proteins are further genetically modified to express a dominant negative receptor. As used herein, the term "dominant negative receptor" refers to a molecule designed to reduce the effect of a negative signaling molecule (e.g., the effect of a negative signaling molecule on the modified immune cells of the present invention). A dominant negative receptor is a truncated variant of a wild-type protein associated with a negative signal. In some embodiments, the protein associated with a negative signal is selected from the group consisting of CTLA4, PD-1, BTLA, TGFβRII, VSIG3, VSIG8, and TIM-3.

[0209] The dominant negative receptors of the present invention can bind to negative signaling molecules (e.g., CTLA4, PD-1, BTLA, TGFβRII, VSIG3, VSIG8, and TIM-3) and reduce the effect of the negative signaling molecule by the extracellular domain associated with the negative signaling molecule. For example, a modified immune cell containing a dominant negative receptor can bind to a negative signaling molecule in the microenvironment of the modified immune cell, but this binding does not transmit the signal intracellularly and modify the activity of the modified T cell. Rather, the binding sequesters the negative signaling molecule and prevents it from binding to endogenous receptors / ligands, thereby reducing the effect of the negative signaling molecule on the modified immune cell. Thus, to reduce the immunosuppressive effect of a molecule, an immune cell can be modified to express a dominant negative receptor that is a dominant negative receptor.

[0210] In some embodiments, the dominant negative receptor comprises a truncated variant of a wild-type protein associated with a negative signal. In some embodiments, the dominant negative receptor comprises a variant of a wild-type protein associated with a negative signal that comprises an extracellular domain, a transmembrane domain, and substantially lacks an intracellular signaling domain. In some embodiments, the dominant negative receptor comprises an extracellular domain and a transmembrane domain of a signaling protein associated with a negative signal. In some embodiments, the dominant negative receptor is a PD-1, CTLA4, BTLA, TGFβRII, VSIG3, VSIG8, or TIM-3 dominant negative receptor. In some embodiments, the dominant negative receptor is PD-1 or TGFβRII. In some embodiments, the TGFβRII comprises the amino acid sequence set forth in SEQ ID NO:76. In some embodiments, the TGFβRII is encoded by the nucleic acid sequence set forth in SEQ ID NO:77.

[0211] Acceptable mutations of dominant negative receptors while maintaining their intended biological activity (e.g., blocking negative signals and / or sequestering molecules with negative signals when expressed in cells) are known to those skilled in the art. Thus, in some embodiments, the dominant negative receptor of the present invention can be encoded by a nucleic acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the nucleic acid sequence shown in SEQ ID NO:77. In some embodiments, a dominant negative receptor of the present invention may comprise an amino acid sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to SEQ ID NO:76. F. Chemokines and cytokines as immune enhancers for health promotion:

[0212] The present invention provides compositions and methods for modified immune cells comprising a CAR and further having downregulated immune gene expression including a dominant negative receptor, a switch receptor, a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, interleukin-7 (IL-7), interleukin-7 receptor (IL-7R), interleukin-15 (IL-15), interleukin-15 receptor (IL-15R), interleukin-21 (IL-21), interleukin-18 (IL-18), CCL21, CCL19, or a combination thereof. In some embodiments, a chemokine, chemokine receptor, cytokine, cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, CC Motif Chemokine Ligand 21 (CCL21) or CC Motif Chemokine Ligand 19 (CCL19) is an immune function-enhancing factor that improves the fitness of the claimed modified immune cells. Without wishing to be bound by theory, the addition of a chemokine, chemokine receptor, cytokine, cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, CCL21 or CCL19 to the modified immune cells enhances the immunity-inducing effect and antitumor activity of the modified immune cells.

[0213] Without wishing to be bound by theory, interleukins and chemokines may promote increased T cell priming and / or T cell infiltration in solid tumors. For example, in microsatellite stable colorectal cancer (CRC), which has low T cell infiltration, IL-15 promotes T cell priming. In some embodiments, the combination of CAR and chemokine / interleukin receptor complex promotes T cell priming. Additionally, IL-15 may induce NK cell infiltration. In some embodiments, the response to IL-15 / IL-15RA complex may result in NK cell infiltration. In some embodiments, the modified immune cells described herein further comprise an IL-15 / IL-15Ra complex. In some embodiments, the IL-15 / IL-15Ra complex is selected from NIZ985 (Novartis), ATL-803 (Altor), or CYP0150 (Cytune). In some embodiments, the IL-15 / IL-15RA complex is NIZ985. In some embodiments, IL-15 stimulates natural killer cells to eliminate (e.g., kill) pancreatic cancer cells. In some embodiments, a therapeutic response to modified immune cells described herein further comprising IL-15 / IL15Ra is associated with natural killer cell infiltration in an animal model of colon cancer. In some embodiments, the IL-15 / IL-15Ra complex comprises human IL-15 complexed with a soluble form of human IL-15Ra. The complex may comprise IL-15 covalently or non-covalently bound to a soluble form of IL-15Ra. In certain embodiments, human IL-15 is non-covalently bound to a soluble form of IL-15Ra.

[0214] The ineffectiveness of CAR T cell therapy for solid tumors is due in part to the limited recruitment and accumulation of immune cells and CAR T cells in solid tumors. One way to solve this problem is to engineer CAR T cells that mimic the function of T-zone fibroblastic reticular cells (FRCs). Lymph nodes are responsible for detecting pathogens and immunogens. The T-zone contains three types of cells: (1) innate immune cells such as dendritic cells, monocytes, macrophages, and granulocytes, (2) adaptive immune cells such as CD4 and CD8 lymphocytes, and (3) stromal cells (FRCs). These cells cooperate to promote the activation, differentiation, and maturation of CD4 T cells to mount an effective immune response against pathogens. FRCs are particularly important because they form a network that allows dendritic cells and T cells to travel throughout the lymph node and attract B cells. In particular, FRCs provide a network for (i) releasing two chemokines (CCL21 and CCL19) to recruit naive T cells, B cells, and dendritic cells to lymph nodes, (ii) secreting IL-7, a survival factor especially for naive T cells, to promote T cell survival, and (iii) directing CD4 T cells toward germinal centers (GCs, another part of lymph nodes). Thus, CARs armored with exogenous CCL21 or CCL19 and IL-7 enhance the recruitment of T cells, B cells, and dendritic cells to solid tumors. In some embodiments, the modified T cells comprise a nucleic acid encoding an immune function enhancer, where the nucleic acid encoding the immune function enhancer is a nucleic acid encoding interleukin 7 and a nucleic acid encoding CCL19 or CCL21.

[0215] In some embodiments, a nucleic acid of an immune function enhancer (i.e., a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, CCL21, or CCL19) is fused to the CAR. In some embodiments, the chemokine, chemokine receptor, cytokine, cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, CCL21, or CCL19 is fused to the CAR via a self-cleaving peptide, such as P2A, T2A, E2A, or F2A. VI. Methods for generating modified T cells:

[0216] One aspect of the invention provides methods of generating modified immune cells (e.g., allogeneic T cells, NK cells, or NKT cells). The modified immune cells of the invention are generally engineered by (1) introducing into the immune cell one or more nucleic acids capable of downregulating gene expression of one or more endogenous immune genes encoding endogenous immune proteins, (2) introducing into the immune cell an exogenous nucleic acid encoding a recombinant receptor, and (3) expanding the modified immune cell to generate modified immune T cells. Such modified immune cells can be included in a therapeutic composition and administered to a patient in need thereof.

[0217] In some embodiments, the method of generating modified immune cells of the present invention comprises introducing into the immune cells one or more nucleic acids capable of downregulating gene expression of one or more endogenous immune genes. The one or more immune genes encode endogenous immune proteins selected from the group consisting of CD3δ, CD3ε, CD3γ, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii chain). In addition, an exogenous nucleic acid encoding a chimeric antigen receptor (CAR), a recombinant T cell receptor (TCR), a killer cell immunoglobulin-like receptor (KIR), an antigen-binding polypeptide, a cell surface receptor ligand, or a tumor antigen is also introduced into the immune cells. In some embodiments, the method further comprises introducing into the immune cells an exogenous nucleic acid encoding a dominant negative receptor, a switch receptor, or a combination thereof. A. Methods for introducing nucleic acids into cells:

[0218] Methods for introducing nucleic acids into cells include physical methods, biological methods, chemical methods, etc. Physical methods for introducing polynucleotides such as RNA into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, etc. RNA can be introduced into target cells using commercially available methods such as electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), ECM830 (BTX) (Harvard Instruments, Boston, Massachusetts), or Gene Pulser II (BioRad, Denver, Colorado), Multiporator (Eppendorf, Hamburg, Germany). RNA can also be introduced into cells using cationic liposome-mediated transfection using lipofection, polymer encapsulation, peptide-mediated transfection, or biolistic particle delivery systems such as "gene guns." 1. Biological methods:

[0219] Biological methods for introducing a polynucleotide of interest into a host cell (e.g., immune cell) include the use of DNA and RNA vectors. Viral vectors, particularly retroviral vectors, have become the most widely used method for inserting genes into mammalian (e.g., human) cells. Other viral vectors can be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, adeno-associated viruses, etc. See, e.g., U.S. Patents Nos. 5,350,674 and 5,585,362.

[0220] In some embodiments, nucleic acids encoding the subject CARs, subject recombinant TCRs, subject KIRs, subject antigen-binding polypeptides, subject cell surface receptor ligands, subject tumor antigens, subject switch receptors, and / or subject dominant negative receptors of the present invention are introduced into cells by expression vectors. Provided herein are expression vectors comprising nucleic acids encoding the subject CARs, subject recombinant TCRs, subject KIRs, subject antigen-binding polypeptides, subject cell surface receptor ligands, subject tumor antigens, subject switch receptors, and / or subject dominant negative receptors. Suitable expression vectors include lentiviral vectors, gamma retroviral vectors, foamy virus vectors, adeno-associated virus (AAV) vectors, adenoviral vectors, recombinant hybrid viruses, naked DNA, including, but not limited to, transposon-mediated vectors such as Sleeping Beauty, Piggyback, and Integrases such as Phi31. Other suitable expression vectors include herpes simplex virus (HSV) and retroviral expression vectors.

[0221] Adenoviral expression vectors are based on adenoviruses, which have low integration into genomic DNA but high transfection efficiency into host cells. Adenoviral expression vectors contain sufficient adenoviral sequences to (a) support the packaging of an expression vector and (b) ultimately express the subject CAR, the subject recombinant TCR, the subject KIR, the subject antigen-binding polypeptide, the subject cell surface receptor ligand, the subject tumor antigen, the subject switch receptor, and / or the subject dominant negative receptor in a host cell. In some embodiments, the adenoviral genome is a 36 kb linear double-stranded DNA containing a foreign DNA sequence. For example, to create the expression vector of the present invention, nucleic acids encoding the subject CAR, the subject recombinant TCR, the subject KIR, the subject antigen-binding polypeptide, the subject cell surface receptor ligand, the subject tumor antigen, the subject switch receptor, and / or the subject dominant negative receptor can be inserted to replace large pieces of adenoviral DNA.

[0222] Another expression vector is based on adeno-associated virus and utilizes the adenovirus binding system. This AAV expression vector has a high integration frequency into the host genome. It can also infect non-dividing cells, making it useful for example for delivering genes to mammalian cells in tissue culture and in vivo. AAV vectors have a wide infectious host range. Details of the generation and use of AAV vectors are described in U.S. Patent Nos. 5,139,941 and 4,797,368.

[0223] Retroviral expression vectors can integrate into the host genome, deliver large amounts of foreign genetic material, infect a wide range of species and cell types, and be packaged into specialized cell lines. Retroviral vectors are constructed by inserting a nucleic acid (e.g., a nucleic acid encoding a subject CAR, a subject recombinant TCR, a subject KIR, a subject antigen-binding polypeptide, a subject cell surface receptor ligand, a subject tumor antigen, a subject switch receptor, and / or a subject dominant-negative receptor) into a specific location in the viral genome to generate a virus that is replication-defective. Retroviral vectors can infect a wide variety of cell types, but the integration and stable expression of a subject CAR, a subject recombinant TCR, a subject KIR, a subject antigen-binding polypeptide, a subject cell surface receptor ligand, a subject tumor antigen, a subject switch receptor, and / or a subject dominant-negative receptor requires the division of the host cell.

[0224] Lentiviral vectors are derived from lentiviruses. Lentiviruses are complex retroviruses that contain other genes with regulatory or structural functions in addition to the common retroviral genes gag, pol, and env. See, e.g., U.S. Patent Nos. 6,013,516 and 5,994,136. Examples of lentiviruses include human immunodeficiency virus (HTV-1, HTV-2) and simian immunodeficiency virus (SIV). Lentiviral vectors have been generated by multiple attenuation of HIV virulence genes, e.g., deletion of env, vif, vpr, vpu, and nef genes, making the vector biologically safe. Lentiviral vectors can infect non-dividing cells and can be used for both in vivo and ex vivo gene transfer and expression of nucleic acids encoding a subject CAR, a subject recombinant TCR, a subject KIR, a subject antigen-binding polypeptide, a subject cell surface receptor ligand, a subject tumor antigen, a subject switch receptor, and / or a subject dominant negative receptor. See, e.g., U.S. Patent No. 5,994,136.

[0225] An expression vector comprising a nucleic acid of the present disclosure can be introduced into a host cell by any means known to one of skill in the art. If necessary, the expression vector can include a viral sequence for transfection. Alternatively, the expression vector can be introduced by fusion, electroporation, biolistics, transfection, lipofection, etc. Prior to introducing the expression vector, the host cell (such as an immune cell) can be grown in culture and then treated appropriately for the introduction and integration of the vector. The host cell (e.g., an immune cell) can then be grown and screened by a marker present in the vector. In some embodiments, the nucleic acid encoding the subject CAR, the subject recombinant TCR, the subject KIR, the subject antigen-binding polypeptide, the subject cell surface receptor ligand, the subject tumor antigen, the subject switch receptor, and / or the subject dominant negative receptor is introduced into the immune cell by viral transduction. In some embodiments, the viral transduction comprises contacting the immune cell with a viral vector comprising one or more nucleic acids. In some embodiments, the viral vector is selected from the group consisting of retroviral vectors, Sendai virus vectors, adenoviral vectors, adeno-associated viral vectors, and lentiviral vectors. Various markers that can be used are known in the art, including hprt, neomycin resistance, thymidine kinase, hygromycin resistance, and the like. As used herein, the terms "cell," "cell line," and "cell culture" may be used interchangeably. In some embodiments, the host cell is an immune cell or a precursor thereof. In some embodiments, the genetically modified cell is a genetically modified T lymphocyte (T cell), a naive T cell (TN), a memory T cell (e.g., a central memory T cell (TCM), an effector memory cell (TEM)), a natural killer cell (NK cell), and a macrophage that can give rise to therapeutically important progeny. In some embodiments, the host cell is a T cell, a NK cell, or a NKT cell.In some embodiments, the immune cell is selected from the group consisting of a T cell, a natural killer cell (NK cell), a natural killer T cell, a lymphoid progenitor cell, a hematopoietic stem cell, a stem cell, a macrophage, and a dendritic cell. In some embodiments, the immune cell is a CD4+ T cell or a CD8+ T cell. In some embodiments, the immune cell is an allogeneic T cell or an autologous T cell. In some embodiments, the allogeneic T cell or the autologous T cell is human.

[0226] The modified immune cells of the present invention (e.g., comprising a nucleic acid capable of downregulating a gene, CAR, KIR, TCR, dominant negative receptor, and / or switch receptor) can be generated by stably transfecting an expression vector comprising a nucleic acid of the present disclosure into a host cell (e.g., an immune cell). Additional methods for generating modified cells of the present disclosure include, but are not limited to, chemical conversion methods (e.g., using calcium phosphate, dendrimers, liposomes, and / or cationic polymers), non-chemical conversion methods (e.g., electroporation, optical conversion, gene electrotransfer and / or hydrodynamic delivery), and / or particle-based methods (e.g., using impafection, gene guns, and / or magnetofection). Transfected cells (i.e., immune cells) expressing a nucleic acid capable of downregulating a gene, CAR, KIR, TCR, dominant negative receptor, and / or switch receptor of the present invention can be propagated ex vivo. 2. Physical method:

[0227] Physical methods for introducing an expression vector into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, etc. Methods for producing cells containing vectors and / or exogenous nucleic acids are well known in the art. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York (2001). 3. Chemical methods:

[0228] Chemical methods for introducing expression vectors into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems such as oil-in-water emulsions, micelles, mixed micelles, liposomes, etc. Chemical means for introducing polynucleotides into host cells include colloidal dispersion systems such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems such as oil-in-water emulsions, micelles, mixed micelles, and liposomes, etc. An exemplary colloidal system used as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).

[0229] Regardless of the method of introducing an exogenous nucleic acid into a host cell or exposing the cell to an inhibitor of the invention, various assays can be performed to confirm the presence of the nucleic acid within the host cell. Such assays include, for example, molecular biological assays well known to those skilled in the art, such as Southern and Northern blotting, RT-PCR and PCR, biochemical assays such as detecting the presence or absence of specific peptides, such as immunological means (ELISA and Western blot) or assays described herein to identify agents within the scope of the invention.

[0230] Furthermore, the nucleic acids can be introduced by any means, such as transduction of the expanded host cells (e.g., immune cells), transfection of the expanded host cells (e.g., immune cells), electroporation of the expanded host cells (e.g., immune cells), etc. Some nucleic acids can be introduced by one method and other nucleic acids can be introduced into the host cells (e.g., immune cells) by another method. 4. RNA:

[0231] In one embodiment, the nucleic acid introduced into the host cell (e.g., immune cell) is RNA. In another embodiment, the RNA is mRNA, including in vitro transcribed RNA or synthetic RNA. The RNA is generated by in vitro transcription using a template generated by polymerase chain reaction (PCR). Using appropriate primers and RNA polymerase, DNA of interest from any source can be directly converted into a template for in vitro mRNA synthesis by PCR. The source of the DNA can be genomic DNA, plasmid DNA, phage DNA, cDNA, synthetic DNA sequences, or any other suitable DNA source.

[0232] PCR can be used to generate templates for in vitro transcription of mRNA, which is then introduced into cells. Methods for performing PCR are well known in the art. Primers used in PCR are designed to have a region that is substantially complementary to a region of DNA used as a template for PCR. As used herein, "substantially complementary" refers to a nucleotide sequence in which most or all of the bases in the primer sequence are complementary or in which one or more bases are non-complementary or mismatched. A substantially complementary sequence is capable of annealing or hybridizing with the intended target DNA under the annealing conditions used for PCR. The primers can be designed to be substantially complementary to any portion of the DNA template. For example, the primers can be designed to amplify a portion of a gene that is normally transcribed in cells (open reading frame), including the 5'UTR and 3'UTR. The primers can also be designed to amplify a portion of a gene that encodes a particular domain of interest. In one embodiment, the primers are designed to amplify the coding region of a human cDNA, including all or part of the 5'UTR and 3'UTR. Primers useful for PCR are generated by synthetic methods well known in the art. "Forward primers" are primers that contain a nucleotide region that is substantially complementary to nucleotides on a DNA template upstream of the DNA sequence to be amplified. As used herein, "upstream" is used to refer to position 5 of the DNA sequence to be amplified relative to the coding strand. "Reverse primers" are primers that contain a nucleotide region that is substantially complementary to a double-stranded DNA template downstream of the DNA sequence to be amplified. As used herein, "downstream" is used to refer to position 3' of the DNA sequence to be amplified relative to the coding strand.

[0233] Chemical structures capable of promoting RNA stability and / or translation efficiency can also be used. The RNA preferably has a 5'UTR and a 3'UTR. In one embodiment, the 5'UTR has a length of 0-3000 nucleotides. The length of the 5' and 3'UTR sequences added to the coding region can be altered by various methods, including but not limited to designing primers for PCR that anneal to different regions of the UTR. Using this approach, one skilled in the art can alter the length of the 5'UTR and 3'UTR required to achieve optimal translation efficiency after transfection of the transcribed RNA.

[0234] The 5'UTR and 3'UTR can be the naturally occurring endogenous 5'UTR and 3'UTR of the gene of interest. Alternatively, UTR sequences that are not endogenous to the gene of interest can be added by incorporating UTR sequences into the forward and reverse primers or by otherwise modifying the template. The use of UTR sequences that are not endogenous to the gene of interest can help modify RNA stability or translation efficiency. For example, it is known that AU-rich elements in the 3'UTR sequence can reduce mRNA stability. Thus, the 3'UTR can be selected or designed to enhance the stability of the transcribed RNA based on the properties of UTRs that are well known in the art.

[0235] In one embodiment, the 5'UTR can include the Kozak sequence of the endogenous gene. Alternatively, if a non-endogenous 5'UTR is added to the gene of interest by PCR as described above, the consensus Kozak sequence can be redesigned by adding the 5'UTR sequence. The Kozak sequence can increase the translation efficiency of some RNA transcripts, but it appears that it is not necessary for all RNAs to allow efficient translation. It is known in the art that many mRNAs require the Kozak sequence. In other embodiments, the 5'UTR can be obtained from an RNA virus whose RNA genome is stable in the cell. In other embodiments, various nucleotide analogs can be used in the 3' or 5'UTR to inhibit exonuclease degradation of the mRNA.

[0236] To be able to synthesize RNA from a DNA template without the need for gene cloning, a transcription promoter must be added to the DNA template upstream of the sequence to be transcribed. If a sequence that functions as a promoter for an RNA polymerase is added to the 5' end of the forward primer, the promoter for the RNA polymerase will be incorporated into the PCR product upstream of the open reading frame to be transcribed. In one embodiment, the promoter is T7 polymerase pro, as described elsewhere herein. Other useful promoters include, but are not limited to, T3 and SP6 RNA polymerase promoters. Consensus nucleotide sequences for T7, T3, and SP6 promoters are known in the art.

[0237] In one embodiment, the mRNA has both a 5'-end cap and a 3' poly(A) tail, which determine ribosome binding, initiation of translation, and stability of the mRNA in the cell. On a circular DNA template (e.g., plasmid DNA), RNA polymerase generates long ligated products that are not suitable for expression in eukaryotic cells. Transcription of plasmid DNA linearized at the end of the 3'UTR results in a normal-sized mRNA that is ineffective for eukaryotic transfection even if it is posttranscriptionally polyadenylated. On a linear DNA template, phage T7 RNA polymerase can extend the 3' end of the transcript beyond the last base of the template (Schenborn and Mierendorf, Nuc Acids Res., 13:6223-36 (1985); Nacheva and Berzal-Herranz, Eur. J. Biochem, 270:1485-65 (2003)).

[0238] The traditional method of incorporating polyA / T stretches into DNA templates is molecular cloning. However, polyA / T sequences incorporated into plasmid DNA can cause plasmid instability, so plasmid DNA templates obtained from bacterial cells are often highly contaminated with deletions and other abnormalities. This makes cloning not only laborious and time-consuming, but also often unreliable. Therefore, a method that allows the construction of DNA templates with polyA / T 3' stretches without cloning is highly desirable. The polyA / T segment of the transcribed DNA template can be generated during PCR using a reverse primer containing a polyT tail, such as a 100T tail (which can be 50-5000T in size), or can be generated after PCR by other methods such as, but not limited to, DNA ligation or in vitro recombination. The poly(A) tail confers stability to the RNA and reduces RNA degradation. In general, the length of the poly(A) tail is positively correlated with the stability of the transcribed RNA. In one embodiment, the poly(A) tail is 100-5000 adenosines.

[0239] The poly(A) tail of the RNA can be further extended after in vitro transcription using a poly(A) polymerase such as E. coli poly(A) polymerase (E-PAP). In one embodiment, increasing the length of the poly(A) tail from 100 nucleotides to 300-400 nucleotides increases the translation efficiency of the RNA by approximately 2-fold. Furthermore, the stability of the mRNA can be increased by adding different chemical groups to the 3' end. Such attachments can include modified / artificial nucleotides, aptamers, and other compounds. For example, ATP analogs can be incorporated into the poly(A) tail using poly(A) polymerase. The ATP analogs can further increase the stability of the RNA. The 5' cap also provides stability to the RNA molecule. In a preferred embodiment, the RNA produced by the methods disclosed herein includes a 5' cap. The 5' cap is provided using techniques known in the art and described herein. Cougot, et al.,Trends in Biochem.Sci.29:436-444(2001);Stepinski,et al,RNA7:1468-95(2001);Elango,et al,Biochim.Biophys.Res.Commun.330:958-966(2005).

[0240] The RNA produced by the methods disclosed herein may also include an internal ribosome entry site (IRES) sequence. The IRES sequence may be any viral, chromosomal or artificially designed sequence that initiates cap-independent ribosome binding to mRNA and promotes initiation of translation. Any solute suitable for cell electroporation may be included, which may include factors that promote cell permeability and viability, such as sugars, peptides, lipids, proteins, antioxidants, detergents, etc. In some embodiments, the RNA is electroporated into cells, such as in vitro transcribed RNA.

[0241] The disclosed methods can be applied to modulating host cell activity in basic research and therapy in the areas of cancer, stem cells, acute and chronic infectious diseases, and autoimmune diseases, including assessing the ability of genetically modified host cells to kill target cancer cells.

[0242] The method also provides the ability to control expression levels over a wide range, for example by varying the amount of promoter or input RNA, allowing expression levels to be individually controlled. Furthermore, PCR-based mRNA production techniques greatly facilitate the design of mRNAs with various structures and domain combinations. One advantage of the RNA transfection method of the present invention is that RNA transfection is essentially transient and vector-free. RNA transgenes can be delivered to lymphocytes and expressed there after a short period of in vitro cell activation, as minimal expressing cassettes, without the need for additional viral sequences. Under such conditions, it is unlikely that the transgene will integrate into the genome of the host cell. Due to the efficiency of RNA transfection and its ability to uniformly modify the entire lymphocyte population, cloning of cells is not required.

[0243] Thus, the present invention provides a method for generating modified immune cells or precursors thereof, comprising introducing into immune cells one or more nucleic acids capable of downregulating gene expression of one or more endogenous immune genes described herein using any of the gene editing techniques described herein or known to those skilled in the art. Downregulating the expression of endogenous genes involved in generating an immune response against the cells, such as TCR alpha chain, TCR beta chain, CD3 delta, CD3 epsilon, CD3 gamma, HLA-I molecules (e.g., beta 2 microglobulin, TAP1, TAP2, TAPBP or NLRC5) or HLA-II molecules (e.g., CIITA, HLA-DM, RFX5, RFXANK, RFXAP or invariant chain), reduces immune-mediated rejection of modified T cells. For example, downregulating the expression of endogenous TCR receptor components, MHC-I or MHC-II, beta 2 microglobulin, CIITA genes removes surface presentation of alloantigens on T cells that may cause rejection by the host immune system. In some embodiments, a nucleic acid capable of downregulating endogenous gene expression is introduced into a T cell, such as by electroporation, transfection, or lentiviral or other viral transduction. In some embodiments, the invention includes modified T cells comprising an electroporated nucleic acid capable of downregulating endogenous gene expression. In some embodiments, the nucleic acid is introduced into an immune cell by viral transduction. In some embodiments, the viral transduction comprises contacting an immune cell with a viral vector comprising one or more nucleic acids. In one embodiment, the viral vector is selected from the group consisting of a retroviral vector, a Sendai virus vector, an adenoviral vector, an adeno-associated viral vector, and a lentiviral vector. B. Methods for gene editing of immune cells:

[0244] In one aspect, the disclosure provides a method of gene editing an immune cell comprising introducing into the immune cell one or more nucleic acids capable of downregulating gene expression of one or more endogenous immune genes encoding endogenous immune proteins selected from the group consisting of CD3δ, CD3ε, CD3γ, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP and invariant chain (Ii chain). In one embodiment, the method of gene editing a modified immune cell comprises introducing into the immune cell a nucleic acid capable of downregulating gene expression of a T cell receptor subunit selected from CD3δ, CD3ε or CD3γ. In one embodiment, the method of gene editing a modified immune cell comprises introducing into the immune cell a nucleic acid capable of downregulating gene expression of an HLA class I molecule selected from B2M, TAP1, TAP2, TAPBP or NLRC5. In one embodiment, a method for gene editing a modified immune cell comprises introducing into the immune cell a nucleic acid capable of downregulating gene expression of an HLA class II molecule selected from HLA-DM, RFX5, RFXANK, RFXAP, or invariant chain (Ii chain).

[0245] In some embodiments, the method of genetically editing an immune cell comprises introducing into the immune cell a nucleic acid capable of downregulating gene expression of CD3δ and an HLA molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain), and combinations thereof. In some embodiments, the method of genetically editing an immune cell comprises introducing into the immune cell a nucleic acid capable of downregulating gene expression of CD3ε and an HLA molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain), and combinations thereof. In some embodiments, the method of gene editing an immune cell comprises introducing into the immune cell a nucleic acid capable of downregulating gene expression of CD3γ and an HLA molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain), and combinations thereof. ...

[0246] In some embodiments, the method of gene editing an immune cell comprises introducing into the immune cell a nucleic acid capable of downregulating expression of the following genes: (1) CD3ε, B2M, and RFX5; (2) CD3ε, B2M, and RFXAP; (3) CD3ε, B2M, and RFXANK; (4) CD3ε, B2M, and HLA-DM; (5) CD3ε, B2M, and Ii chain; (6) CD3ε, TAP1, and CIITA; (7) CD3ε, TAP1, and RFX5; (8) CD3ε, TAP1, and RFXAP; (9) CD3ε, TAP1, and RFXANK; (10) CD3ε, TAP1, and HLA-DM; (11) CD3ε, TAP1, and Ii chain; (12) CD3ε, TAP2, and CIITA; (13) CD3ε, TAP2, and RFX5; (14) CD3ε, TAP 2 and RFXAP; (15) CD3ε, TAP2 and RFXANK; (16) CD3ε, TAP2 and HLA-DM; (17) CD3ε, TAP2 and Ii chain; (18) CD3ε, NLRC5 and CIITA; (19) CD3ε, NLRC5 and RFX5; (20) CD3ε, NLRC5 and RFXAP; (21) CD3ε, NLRC5 and RFXANK; (22) CD3ε , NLRC5 and HLA-DM; (23) CD3ε, NLRC5 and Ii chain; (24) CD3ε, TAPBP and CIITA; (25) CD3ε, TAPBP and RFX5; (26) CD3ε, TAPBP and RFXAP; (27) CD3ε, TAPBP and RFXANK; (28) CD3ε, TAPBP and HLA-DM; or (29) CD3ε, TAPBP and Ii chain.

[0247] In some embodiments, the method of gene editing an immune cell comprises introducing into the immune cell a nucleic acid capable of downregulating expression of the following genes: (1) CD3δ, B2M, and RFX5; (2) CD3δ, B2M, and RFXAP; (3) CD3δ, B2M, and RFXANK; (4) CD3δ, B2M, and HLA-DM; (5) CD3δ, B2M, and Ii chain; (6) CD3δ, TAP1, and CIITA; (7) CD3δ, TAP1, and RFX5; (8) CD3δ, TAP1, and RFXAP; (9) CD3δ, TAP1, and RFXANK; (10) CD3δ, TAP1, and HLA-DM; (11) CD3δ, TAP1, and Ii chain; (12) CD3δ, TAP2, and CIITA; (13) CD3δ, TAP2, and RFX5; (14) CD3δ, TAP 2 and RFXAP; (15) CD3δ, TAP2 and RFXANK; (16) CD3δ, TAP2 and HLA-DM; (17) CD3δ, TAP2 and Ii chain; (18) CD3δ, NLRC5 and CIITA; (19) CD3δ, NLRC5 and RFX5; (20) CD3δ, NLRC5 and RFXAP; (21) CD3δ, NLRC5 and RFXANK; (22) CD3δ , NLRC5 and HLA-DM; (23) CD3δ, NLRC5 and Ii chain; (24) CD3δ, TAPBP and CIITA; (25) CD3δ, TAPBP and RFX5; (26) CD3δ, TAPBP and RFXAP; (27) CD3δ, TAPBP and RFXANK; (28) CD3δ, TAPBP and HLA-DM; or (29) CD3δ, TAPBP and Ii chain.

[0248] In some embodiments, the method of gene editing an immune cell comprises introducing into the immune cell a nucleic acid capable of downregulating expression of the following genes: (1) CD3γ, B2M, and RFX5; (2) CD3γ, B2M, and RFXAP; (3) CD3γ, B2M, and RFXANK; (4) CD3γ, B2M, and HLA-DM; (5) CD3γ, B2M, and Ii chain; (6) CD3γ, TAP1, and CIITA; (7) CD3γ, TAP1, and RFX5; (8) CD3γ, TAP1, and RFXAP; (9) CD3γ, TAP1, and RFXANK; (10) CD3γ, TAP1, and HLA-DM; (11) CD3γ, TAP1, and Ii chain; (12) CD3γ, TAP2, and CIITA; (13) CD3γ, TAP2, and RFX5; (14) CD3γ, TAP 2 and RFXAP; (15) CD3γ, TAP2 and RFXANK; (16) CD3γ, TAP2 and HLA-DM; (17) CD3γ, TAP2 and Ii chain; (18) CD3γ, NLRC5 and CIITA; (19) CD3γ, NLRC5 and RFX5; (20) CD3γ, NLRC5 and RFXAP; (21) CD3γ, NLRC5 and RFXANK; (22) CD3 (23) CD3γ, NLRC5 and Ii chain; (24) CD3γ, TAPBP and CIITA; (25) CD3γ, TAPBP and RFX5; (26) CD3γ, TAPBP and RFXAP; (27) CD3γ, TAPBP and RFXANK; (28) CD3γ, TAPBP and HLA-DM or (29) CD3γ, TAPBP and Ii chain.

[0249] In some embodiments, the method of gene editing an immune cell comprises introducing into the immune cell a nucleic acid capable of downregulating gene expression, comprising a gene editing system selected from the group consisting of antisense RNA, antigenomeric RNA, siRNA, shRNA, and a CRISPR system. Expression of endogenous immune genes can be downregulated, knocked down, reduced, and / or inhibited, for example, by antisense RNA, antigenomeric RNA, siRNA, shRNA, a CRISPR system, etc. In one embodiment, the method of gene editing an immune cell comprises introducing into the immune cell a nucleic acid capable of downregulating gene expression, comprising a CRISPR-associated (Cas) (CRISPR-Cas) endonuclease system and a guide RNA. In some embodiments, the nucleic acid capable of downregulating gene expression comprises a Cas endonuclease selected from the group consisting of Cas3, Cas4, Cas8a, Cas8b, Cas9, Cas10, Cas10d, Cas12a, Cas12b, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas13, Cas14, CasX, Csel, Csy1, Csn2, Cpf1, C2c1, Csm2, Cmr5, Fok1, S. pyogenes Cas9 (spCas9), Staphylococcus aureus Cas9 (saCas9), MAD7 nuclease (type V CRISPR nuclease), and any combination thereof. Methods of gene editing a cell are well known in the art and described herein.

[0250] In some embodiments, a method of genetically editing an immune cell comprises introducing CRISPR / Cas into the immune cell to disrupt one or more endogenous immune genes in the modified cell (e.g., a modified T cell). In some embodiments, CRISPR / Cas9 is used to disrupt one or more endogenous immune proteins selected from the group consisting of CD3δ, CD3ε, CD3γ, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii chain). In an exemplary embodiment, CRISPR / Cas9 is used to disrupt one or more of endogenous CD3δ, CD3ε, CD3γ, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii chain), thereby resulting in downregulation of CD3δ, CD3ε, CD3γ, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii chain). Suitable gRNAs for use in disrupting one or more of endogenous TRAC, TRBC, B2M, CIITA, and / or PD1 are described in Figures 26 and 27. In some embodiments, a method of genetically editing an immune cell comprises introducing CRISPR / Cas and a guide RNA into an immune cell to disrupt one or more endogenous immune genes in the modified cell (e.g., a modified T cell). In one embodiment, a method of genetically editing an immune cell comprises introducing CRISPR / Cas and a guide RNA into an immune cell, wherein the guide RNA comprises a guide sequence complementary to a sequence in one or more loci selected from the group consisting of CD3 delta, CD3 epsilon, CD3 gamma, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii chain). Suitable guide RNAs (gRNAs) for disrupting one or more of endogenous CD3δ, CD3ε, CD3γ, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP and invariant chain (Ii chain) are shown in Table 4.

[0251] In one embodiment, the method of genetically editing an immune cell comprises introducing into the immune cell a nucleic acid capable of downregulating gene expression comprising a TALEN gene editing system. In one embodiment, the method of genetically editing an immune cell comprises introducing into the immune cell a nucleic acid capable of downregulating gene expression comprising a zinc finger nuclease (ZFN) gene editing system. In one embodiment, the method of genetically editing an immune cell comprises introducing into the immune cell a nucleic acid capable of downregulating gene expression comprising a meganuclease gene editing system. In one embodiment, the method of genetically editing an immune cell comprises introducing into the immune cell a nucleic acid capable of downregulating gene expression comprising a megaTALEN gene editing system. In one embodiment, the method of genetically editing a modified immune cell comprises introducing into the immune cell a nucleic acid capable of downregulating gene expression comprising a gene silencing system selected from antisense RNA, antigenomeric RNA, RNAi, siRNA or shRNA. C. Expansion of Modified Immune Cells:

[0252] In yet another embodiment, the method of generating modified T cells described herein further comprises expanding the modified immune cells to generate a population of modified T cells. Whether before or after modifying the immune cells to express a CAR, TCR, dominant negative receptor and / or switch receptor, the modified cells can be activated and expanded in number using methods known in the art. For example, the immune cells of the invention can be expanded by contacting them with a surface having attached thereto an agent that stimulates a CD3 / TCR complex-associated signal and a ligand that stimulates a costimulatory molecule on the surface of the modified immune cells. In particular, the modified immune cell population can be stimulated by contact with an anti-CD3 antibody or an antigen-binding fragment thereof or an anti-CD2 antibody immobilized on the surface, or by contact with a protein kinase C activator (e.g., bryostatin) in combination with a calcium ionophore. For costimulation of an accessory molecule on the surface of the modified immune cells, a ligand that binds to the accessory molecule is used. For example, the modified immune cells can be contacted with an anti-CD3 antibody and an anti-CD28 antibody under conditions suitable for stimulating the proliferation of the immune cells. Examples of anti-CD28 antibodies include 9.3, B-T3, XR-CD28 (Diaclone, Besançon, France) that can be used in the present invention, as well as other methods and reagents known in the art.

[0253] The expansion of modified immune cells by the methods disclosed herein can be increased by about 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 200-fold, 300-fold, 400-fold, 500-fold, 600-fold, 700-fold, 800-fold, 900-fold, 1000-fold, 2000-fold, 3000-fold, 4000-fold, 5000-fold, 6000-fold, 7000-fold, 8000-fold, 9000-fold, 10,000-fold, 100,000-fold, 1,000,000-fold, 10,000,000-fold or more, and any integer or sub-integer therebetween. In one embodiment, the modified immune cells are expanded in the range of about 20-fold to about 50-fold.

[0254] After culturing, the modified immune cells can be incubated in cell medium in the culture device for a period of time or until the cells reach confluency or high cell density for optimal passaging, after which the cells can be transferred to another culture device. The culture device can be any culture device commonly used for culturing cells in vitro. Before transferring the cells to another culture device, it is preferable that the confluence level is 70% or more. More preferably, the confluence level is 90% or more. The period can be any time suitable for culturing cells in vitro. The immune cell medium can be replaced at any time during the culture of the immune cells. It is desirable to replace the immune cell medium about every 2 to 3 days. The immune cells are then harvested from the culture device, and the modified immune cells can be used immediately or cryopreserved for later use. In one embodiment, the present invention includes cryopreserving the expanded modified immune cells. The cryopreserved immune cells are thawed before introducing a nucleic acid into the immune cells.

[0255] In another embodiment, the method includes isolating the immune cells and expanding the immune cells. In another embodiment, the invention further includes cryopreserving the immune cells prior to expansion. In yet another embodiment, the cryopreserved immune cells are thawed and electroporated with RNA encoding the chimeric membrane protein.

[0256] In yet another embodiment, the method of generating modified T cells described herein further comprises expanding the modified immune cells ex vivo. In some embodiments, the ex vivo culture and expansion of the modified immune cells comprises the addition of cell growth factors. However, other factors can also be added, such as flt3-L, IL-1, IL-3, c-kit ligand, etc. In some embodiments, expanding the modified T cells comprises culturing the modified T cells with a factor selected from the group consisting of flt3-L, IL-1, IL-3, IL-2, IL-7, IL-15, IL-18, IL-21, TGF beta, IL-10, and c-kit ligand. The culturing step described herein (following contact with an agent described herein or electroporation) can be very short, e.g., less than 24 hours, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 hours. The culture step can be as long as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 days or more.

[0257] Various terms are used to describe cells in culture. Cell culture generally refers to cells taken from a living organism and grown under controlled conditions. A primary cell culture is a culture of cells, tissues, or organs taken directly from an organism prior to the first subculture. Cells grow in culture when placed in a growth medium under conditions that promote cell growth and division, resulting in a larger cell population. When cells are grown in culture, the rate of cell growth is usually measured by the time it takes for the cell population to double, or doubling time.

[0258] Suitable conditions for immune cell culture include an appropriate medium (e.g., Minimum Essential Medium or RPMI Medium 1640 or X-vivo 15 (Lonza)) that may contain factors necessary for growth and survival, including serum (e.g., fetal bovine serum or human serum), interleukin-2 (IL-2), insulin, IFN-gamma, IL-4, IL-7, GM-CSF, IL-10, IL-12, IL-15, TGF-beta, and TNF-a, as well as other additives for cell growth known to those of skill in the art, including, but not limited to, detergents, plasmanate, and reducing agents such as N-acetylcysteine ​​and 2-mercaptoethanol.

[0259] Media include RPMI1640, AIM-V, DMEM, MEM, a-MEM, F-12, X-Vivo 15, X-Vivo 20, Optimizer, etc., and are supplemented with amino acids, sodium pyruvate, vitamins, and are serum-free or supplemented with an appropriate amount of serum (or plasma) or a defined set of hormones and / or cytokines in sufficient amounts for immune cell growth and proliferation. Antibiotics such as penicillin and streptomycin are included only in the experimental cultures, not in the culture of cells injected into the subject. Target cells are maintained under conditions necessary to support growth, such as appropriate temperature (e.g., 37°C) and atmosphere (e.g., air + 5% CO2).

[0260] The medium used to culture the immune cells may contain an agent that can costimulate the immune cells. For example, an agent that can stimulate CD3 is an antibody against CD3, and an agent that can stimulate CD28 is an antibody against CD28. This is because, as demonstrated by the methods disclosed herein, cells isolated by the methods disclosed herein can be expanded by about 10x, 20x, 30x, 40x, 50x, 60x, 70x, 80x, 90x, 100x, 200x, 300x, 400x, 500x, 600x, 700x, 800x, 900x, 1000x, 2000x, 3000x, 4000x, 5000x, 6000x, 7000x, 8000x, 9000x, 10,000x, 100,000x, 1,000,000x, 10,000,000x, or more. In one embodiment, by culturing the electroporated population, the immune cells are expanded by a factor ranging from about 20x to about 50x or more. In one embodiment, human T regulatory cells are expanded via anti-CD3 antibody-coated KT64.86 artificial antigen presenting cells (aAPCs). Methods for expanding and activating immune cells are described in U.S. Patent Nos. 7,754,482, 8,722,400, and 9,555,105, the contents of which are incorporated herein in their entirety. D. Source of immune cells:

[0261] Prior to expansion, a source of immune cells is obtained from a subject for ex vivo manipulation. Sources of cells for ex vivo manipulation include, for example, autologous or heterologous donor blood, umbilical cord blood, bone marrow, etc. For example, the source of immune cells can be taken from the subject to be treated with the modified immune cells of the present invention, such as the subject's blood, the subject's umbilical cord blood, or the subject's bone marrow. Non-limiting examples of subjects include humans, dogs, cats, mice, rats, and transgenic species thereof. Preferably, the subject is a human.

[0262] Immune cells can be obtained from a number of sources, including blood, peripheral blood mononuclear cells, bone marrow, lymph node tissue, spleen tissue, umbilical cord, lymph or lymphoid organs. Immune cells are cells of the immune system, such as cells of innate or adaptive immunity, such as myeloid and lymphoid cells, including lymphocytes, typically T cells and NK cells. Other exemplary cells include stem cells, such as multipotent and pluripotent stem cells, including induced pluripotent stem cells (iPSCs). In some aspects, the cells are human cells. With respect to the subject to be treated, the cells may be allogeneic and / or autologous. The cells are typically primary cells, such as cells isolated directly from the subject and / or cells isolated and frozen from the subject.

[0263] In certain embodiments, the immune cell is a T cell, e.g., a CD8 positive T cell (e.g., a CD8 positive naive T cell, a central memory T cell, or an effector memory T cell), a CD4 positive T cell, a natural killer T cell (NKT cell), a regulatory T cell (Treg), a stem cell memory T cell, a lymphoid progenitor cell, a hematopoietic stem cell, a natural killer cell (NK cell), or a dendritic cell. In some embodiments, the cell is a monocyte or a granulocyte, e.g., a myeloid cell, a macrophage, a neutrophil, a dendritic cell, a mast cell, an eosinophil, and / or a basophil. In one embodiment, the target cell is an induced pluripotent stem (iPS) cell or a cell derived from an iPS cell, e.g., an iPS cell that is generated from a subject and engineered to change (e.g., induce a mutation) or manipulate the expression of one or more target genes and differentiated into, e.g., a T cell, e.g., a CD8 positive T cell (e.g., a CD8 positive naive T cell, a central memory T cell, or an effector memory T cell), a CD4 positive T cell, a stem cell memory T cell, a lymphoid progenitor cell, or a hematopoietic stem cell.

[0264] In some embodiments, the cells include one or more subsets of T cells or other cell types, such as the entire T cell population, CD4+ cells, CD8+ cells and subpopulations thereof, such as those defined by function, activation state, maturity, differentiation potential, proliferation, recirculation, localization and / or persistence capacities, antigen specificity, type of antigen receptor, presence in a particular organ or compartment, marker or cytokine secretion profile, and / or degree of differentiation.

[0265] Subtypes and subpopulations of T cells and / or CD4+ and / or CD8+ T cells include naive T (TN) cells, effector T cells (TEFF), memory T cells and their subtypes (e.g., stem cell memory T (TSCM), central memory T (TCM), effector memory T (TEM) or terminally differentiated effector memory T cells, etc.), tumor-infiltrating lymphocytes (TIL), immature T cells, mature T cells, helper T cells, cytotoxic T cells, mucosal-associated invariant T (MAIT) cells, naturally occurring and adaptive regulatory T (Treg) cells, helper T cells (e.g., TH1 cells, TH2 cells, TH3 cells, TH17 cells, TH9 cells, TH22 cells, follicular helper T cells, alpha / beta T cells, and delta / gamma T cells, etc.). In certain embodiments, any number of T cell lines available in the art can be used.

[0266] In some embodiments, the method includes isolating immune cells from a subject and preparing, treating, culturing and / or modifying them. In some embodiments, preparing the recombinant cells includes one or more culturing and / or preparation steps. The described cells for recombination may be isolated from a sample, e.g., a biological sample obtained from or derived from a subject. In some embodiments, the subject from which the cells are isolated is a subject having a disease or condition, or in need of or to which cell therapy is administered. The subject in some embodiments is a human in need of a particular therapeutic intervention, such as adoptive cell therapy, from which the cells are isolated, treated and / or modified. Thus, in some embodiments, the cells are primary cells, e.g., primary human cells. The samples include tissues, body fluids, and other samples taken directly from a subject, as well as samples obtained from one or more processing steps, such as separation, centrifugation, genetic modification (e.g., transduction with a viral vector), washing, incubation, etc. The biological sample may be a sample obtained directly from a biological source or a processed sample. Said biological samples include, but are not limited to, bodily fluids such as blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine, sweat, etc., tissue and organ samples (including processed samples obtained therefrom).

[0267] In certain aspects, the sample from which immune cells are derived or isolated is a blood or blood-derived sample, or is or is derived from an apheresis or leukocyte product. Exemplary samples include whole blood, peripheral blood mononuclear cells (PBMCs), leukocytes, bone marrow, thymus, tissue biopsy, tumor, leukemia, lymphoma, lymph node, gut-associated lymphoid tissue, mucosa-associated lymphoid tissue, spleen, other lymphoid tissue, liver, lung, stomach, intestine, colon, kidney, pancreas, breast, bone, prostate, cervix, testis, ovary, tonsil, or other organ, and / or cells derived therefrom. The samples include, in the context of cell therapy (e.g., adoptive cell therapy), samples from autologous and allogeneic sources.

[0268] In some embodiments, the cells are derived from a cell line, e.g., a T cell line. The cells in some embodiments are obtained from heterologous sources, e.g., mouse, rat, non-human primate, and pig. In some embodiments, the isolation of the cells includes one or more preparative and / or non-affinity based cell separation steps. In some examples, the cells are washed, centrifuged, and / or incubated in the presence of one or more reagents, e.g., to remove unwanted components, enrich for desired components, or lyse or remove cells sensitive to a particular reagent. In some examples, the cells are separated based on one or more properties, such as density, adhesion properties, size, sensitivity, and / or resistance to a particular component.

[0269] In some examples, cells from the circulating blood of a subject are obtained, for example, by apheresis or leukapheresis. The sample includes lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells and / or platelets, in some embodiments, and cells other than red blood cells and platelets. In some embodiments, blood cells collected from a subject are washed, for example, to remove the plasma fraction and place the cells in an appropriate buffer or medium for subsequent processing steps. In some embodiments, the cells are washed with phosphate buffered saline (PBS). In some cases, a washing step is performed by tangential flow filtration (TFF) according to the manufacturer's instructions. In some embodiments, the cells are resuspended in various biocompatible buffers after washing. In some embodiments, components of the blood cell sample are removed and the cells are resuspended directly in culture medium. In some embodiments, the method includes a density-based cell separation method, such as preparing white blood cells from peripheral blood by lysing red blood cells and centrifuging through a Percoll or Ficoll gradient.

[0270] In one embodiment, the immune cells are obtained by apheresis or leukapheresis from the circulating blood of an individual. The apheresis product typically includes lymphocytes, such as T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets. The cells collected by apheresis are washed to remove the plasma fraction and placed in a suitable buffer or medium, such as phosphate buffered saline (PBS) or wash solution (which may lack calcium, lack magnesium, or lack many, if not all, divalent cations), for subsequent processing steps. As will be readily appreciated by those of skill in the art, the washing step can be accomplished by methods known to those of skill in the art, such as using a semi-automated "flow-through" centrifuge (e.g., Cobe 2991 cell processor, Baxter CytoMate, or Haemonetics Cell Saver5) following the manufacturer's instructions. After washing, the cells are washed by, for example, centrifugation using a centrifuge containing Ca, HCl ... 2+ Does not contain Mg 2+ The cells can be resuspended in a variety of biocompatible buffers such as PBS free of phosphate-buffered saline, PlasmaLyte A, or other saline solutions with or without buffer. In some embodiments, undesirable components of the apheresis sample can be removed and the cells can be resuspended directly in culture medium.

[0271] In some embodiments, the isolation method includes separating different cell types based on the expression or presence in cells of one or more specific molecules, such as surface markers (e.g., surface proteins), intracellular markers, or nucleic acids. In some embodiments, any known separation method based on such markers can be used. In some embodiments, the separation is an affinity or immunoaffinity based separation. For example, the isolation in some aspects includes separating cells and cell populations based on the cellular expression or expression level of one or more markers, typically cell surface markers, e.g., incubation with an antibody or binding partner that specifically binds such marker, typically followed by a washing step, and separating cells that are bound to the antibody or binding partner from cells that are not bound to the antibody or binding partner. Such separation steps can be based on positive selection, where cells that are bound to the reagent are retained for further use, and / or negative selection, where cells that are not bound to the antibody or binding partner are retained. In some examples, both fractions are retained for further use. Negative selection is particularly useful when antibodies that specifically identify cell types in a heterogeneous population are not available, and separation is best performed based on markers expressed by cells outside the desired population. The separation does not necessarily result in 100% enrichment or removal of a particular cell population or cells expressing a particular marker. For example, positive selection or enrichment for a particular type of cell, such as cells expressing a marker, means to increase the number or percentage of such cells, but does not necessarily result in the complete absence of cells not expressing the marker. Similarly, negative selection, removal, or depletion of a particular type of cell, such as cells expressing a marker, means to reduce the number or percentage of such cells, but does not necessarily result in the complete removal of all such cells.In certain exemplary embodiments, the separation step is performed multiple times, and the positively or negatively selected fraction from one step is subjected to another separation step, such as a subsequent positive or negative selection. In certain exemplary embodiments, cells expressing multiple markers simultaneously can be depleted in a single separation step, such as by incubating the cells with multiple antibodies or binding partners, each specific for a marker that is subject to negative selection. Similarly, multiple cell types can be positively selected simultaneously by incubating the cells with multiple antibodies or binding partners expressed in different cell types.

[0272] In some embodiments, one or more tire T cell populations are positive (marker positive) or have high levels (marker high) of one or more particular markers, such as surface markers. high ) or express negative (marker-) or relatively low levels (marker low) of one or more markers. low)) are enriched or depleted. For example, in certain embodiments, specific subpopulations of T cells, such as cells expressing positive or high levels of one or more surface markers, such as CD28+, CD62L+, CCR7+, CD27+, CD127+, CD4+, CD8+, CD45RA+, and / or CD45RO+ T cells, are isolated by positive or negative selection techniques. In some examples, such markers are markers that are absent or expressed at relatively low levels in certain T cell populations (e.g., non-memory cells) but present or expressed at relatively high levels in certain other T cell populations (e.g., memory cells). In one embodiment, the cells (e.g., CD8 positive cells or T cells, e.g., CD3 positive cells) are enriched (i.e., positively selected) for cells that are positive for or express high surface levels of CD45RO, CCR7, CD28, CD27, CD44, CD127, and / or CD62L, and / or are depleted (e.g., negatively selected) for cells that are positive for or express high surface levels of CD45RA. In some embodiments, the cells are enriched or depleted for cells that are positive for or express high surface levels of CD122, CD95, CD25, CD27, and / or IL7-Ra (CD127). In an exemplary embodiment, CD8 positive T cells are enriched for CD45RO positive (or CD45RA negative) and CD62L positive cells. For example, CD3 positive, CD28 positive T cells can be reliably selected using CD3 / CD28 conjugated magnetic beads (e.g., DYNABEADS® M-450 CD3 / CD28 T cell Expander).

[0273] In some embodiments, T cells are separated from the PBMC sample by negative selection of markers expressed on non-T cells, such as B cells, monocytes, or other white blood cells, such as CD14. In certain aspects, a CD4+ or CD8+ selection step is used to separate CD4+ helper T cells and CD8+ cytotoxic T cells. Such CD4+ and CD8+ populations can be further classified into subpopulations by positive or negative selection against markers that are expressed or expressed to a relatively high degree on one or more naive, memory, and / or effector T cell subpopulations. In some embodiments, the CD8+ cells are further enriched or depleted in naive, central memory, effector memory, and / or central memory stem cells, such as by positive or negative selection based on surface antigens associated with each subpopulation. In some embodiments, enrichment of central memory T (TCM) cells is performed to enhance efficacy, such as improving long-term survival, proliferation, and / or engraftment after administration, which in certain aspects is particularly potent in such subpopulations.

[0274] In some embodiments, combining TCM-enriched CD8+ T cells with CD4+ T cells further enhances efficacy. In some embodiments, memory T cells are present in both the CD62L+ and CD62L+ subsets of CD8+ peripheral blood lymphocytes. PBMCs can be enriched or depleted for CD62L+ CD8+ and / or CD62L+ CD8+ fractions using, for example, anti-CD8 and / or anti-CD62L antibodies. In some embodiments, CD4+ and / or CD8+ T cell populations are enriched for central memory (TCM) cells. In some embodiments, enrichment of central memory T (TCM) cells is based on positive selection or high surface expression of CD45RO, CD62L, CCR7, CD28, CDS and / or CD127, and in some aspects, negative selection of cells expressing or highly expressing CD45RA and / or granzyme B. In certain embodiments, the isolation of a CD8 positive population enriched for TCM cells is performed by depletion of cells expressing CD4, CD14, CD45RA and positive selection or enrichment of cells expressing CD62L. In one embodiment, the enrichment of central memory T (TCM) cells is performed starting from a negative fraction of cells selected on the basis of CD4 expression, which is subjected to negative selection on the basis of CD14 and CD45RA expression and positive selection on the basis of CD62L. In certain embodiments, such selections are performed simultaneously, and in other embodiments, sequentially in either order. In certain methods, the same CD4 expression-based selection step used in preparing the CD8 positive cell population or subpopulation is also used to generate the CD4 positive cell population or subpopulation, and both the positive and negative fractions from the CD4-based separation are retained and used in subsequent steps of the method, following one or more further positive or negative selection steps as required.

[0275] CD4 positive T helper cells are classified into naive, central memory and effector cells by identifying cell populations bearing cell surface antigens. CD4 positive lymphocytes can be obtained by standard methods. In some embodiments, naive CD4 positive T lymphocytes are CD45RO negative, CD45RA positive, CD62L positive, CD4 positive T cells. In some embodiments, central memory CD4 positive cells are CD62L positive and CD45RO positive. In some embodiments, effector CD4 positive cells are CD62L and CD45RO. In one example, to enrich for CD4 positive cells by negative selection, the monoclonal antibody cocktail typically includes antibodies against CD14, CD20, CD11b, CD16, HLA-DR and CDS. In some embodiments, the antibodies or binding partners are bound to a solid support or matrix, such as magnetic or paramagnetic beads, allowing for the separation of cells for positive and / or negative selection.

[0276] In some embodiments, the cells are incubated and / or cultured prior to or in conjunction with genetic modification. Incubation steps include culturing, culturing, stimulating, activating, and / or growing. In some embodiments, the composition or cells are incubated in the presence of stimulatory conditions or agents. Such conditions include conditions designed to induce proliferation, expansion, activation, and / or survival of cells in a population, mimic antigen exposure, and / or prepare cells for genetic modification, such as introduction of a recombinant antigen receptor. The conditions include one or more of a particular medium, temperature, oxygen content, carbon dioxide content, time, factors (nutrients, amino acids, antibiotics, ions, etc.) and / or stimulatory agents (cytokines, chemokines, antigens, binding partners, fusion proteins, recombinant soluble receptors, etc.) and other factors designed to activate cells. In some embodiments, the stimulatory conditions or agents include one or more agents, e.g., ligands, capable of activating the intracellular signaling domain of the TCR complex. In one aspect, the agent turns on or initiates the TCR / CD3 intracellular signaling cascade in the T cell. Such agents include antibodies specific for TCR components and / or costimulatory receptors, such as, for example, anti-CD3, anti-CD28 and / or one or more cytokines, bound to a solid support, such as beads. Optionally, the expansion method may further include adding anti-CD3 and / or anti-CD28 antibodies to the culture medium (e.g., at a concentration of at least about 0.5 ng / ml). In some embodiments, the stimulatory agents include IL-2 and / or IL-15, e.g., the IL-2 concentration is at least about 10 units / ml.

[0277] In another embodiment, T cells are isolated from peripheral blood by lysing red blood cells and depleting monocytes, for example by centrifugation through a PERCOLL® gradient. Alternatively, T cells can be isolated from umbilical cord. In either case, specific subpopulations of T cells can be further isolated by positive or negative selection techniques.

[0278] The cord blood mononuclear cells thus isolated can be depleted of cells expressing certain antigens, including but not limited to CD34, CDS, CD14, CD19 and CD56. Depletion of these cells can be accomplished using isolated antibodies, biological samples containing antibodies such as ascites fluid, antibodies bound to physical supports, and antibodies bound to cells.

[0279] Enrichment of T cell populations by negative selection can be achieved using a combination of antibodies that target surface markers specific to the negatively selected cells. Exemplary methods include cell sorting and / or selection by negative magnetic immunoadhesion or flow cytometry using a cocktail of monoclonal antibodies against cell surface markers present on the negatively selected cells. For example, to enrich for CD4 positive cells by negative selection, the monoclonal antibody cocktail typically includes antibodies against CD14, CD20, CD11b, CD16, HLA-DR and CDS.

[0280] To isolate the desired cell population by positive or negative selection, the concentration of cells and surfaces (e.g., particles such as beads) can be varied. In certain embodiments, it may be desirable to significantly reduce the volume in which the beads and cells are mixed (i.e., increase the concentration of cells) to maximize cell-to-bead contact. For example, in one embodiment, a concentration of 2 billion cells / ml is used. In one embodiment, a concentration of 1 billion cells / ml is used. In a further embodiment, more than 100 million cells / ml are used. In a further embodiment, a cell concentration of 10, 15, 20, 25, 30, 35, 40, 45, or 50 million cells / ml is used. In yet another embodiment, a cell concentration of 75, 80, 85, 90, 95, or 100 million cells / ml is used. In further embodiments, concentrations of 125 million / ml or 150 million / ml can be used. The use of higher concentrations increases cell yield, cell activation and cell proliferation.

[0281] The T cells can also be frozen after the washing step, in which case the monocyte depletion step is not necessary. Without wishing to be bound by theory, the freezing and subsequent thawing steps remove granulocytes and to some extent monocytes in the cell population, providing a more homogenous product. After a washing step that removes plasma and platelets, the cells can be suspended in a freezing solution. Many freezing solutions and parameters are known in the art and will be useful in this context, but as a non-limiting example, one method includes using PBS or other suitable cell freezing media containing 20% ​​DMSO and 8% human serum albumin. The cells are then frozen at a rate of 1°C per minute to -80°C and stored in the vapor phase of a liquid nitrogen storage tank. Immediate uncontrolled freezing at -20°C or liquid nitrogen as well as other controlled freezing methods can be used.

[0282] In one embodiment, the T cell population is comprised within cells such as peripheral blood mononuclear cells, umbilical cord blood cells, purified T cell populations and T cell lines. In another embodiment, peripheral blood mononuclear cells comprise the population of T cells. In yet another embodiment, purified T cells comprise the T cell population.

[0283] In some embodiments, the immune cells are obtained from a blood sample, a whole blood sample, a peripheral blood mononuclear cell (PBMC) sample, or an apheresis sample. In some instances, cells from the circulating blood of a subject are obtained, for example, by apheresis or leukapheresis. In one embodiment, the immune cells are obtained from the circulating blood of an individual by apheresis or leukapheresis. The apheresis product typically includes lymphocytes, such as T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets. In some embodiments, the apheresis sample is a cryopreserved sample. In some embodiments, the apheresis sample is a fresh sample. In some embodiments, the immune cells are obtained from a human subject. V11. Composition:

[0284] In one aspect, the invention provides compositions comprising modified immune cells as described herein or a population of modified immune cells obtained from any of the methods described herein. In some embodiments, the compositions of the invention may comprise modified unstimulated T cells or modified stimulated T cells as described herein. In some embodiments, the compositions may comprise pharmaceutical compositions. In some embodiments, the compositions comprise pharmaceutical compositions and further comprise one or more pharma- ceutically or physiologically acceptable carriers, diluents, adjuvants or excipients. Such compositions may include buffers such as neutral buffered saline, phosphate buffered saline, carbohydrates such as glucose, mannose, sucrose, dextran, mannitol, proteins, polypeptides or amino acids such as glycine, antioxidants, chelating agents such as EDTA or glutathione, adjuvants (e.g., aluminum hydroxide), and preservatives. The compositions of the invention are preferably formulated for parenteral administration (e.g., intravenous administration). In some embodiments, a therapeutically effective amount of a pharmaceutical composition comprising the modified T cells may be administered to a subject in need thereof. VIII. Treatment method:

[0285] In one aspect, the disclosure provides a method for adoptive cell transfer therapy comprising administering the modified immune cells of the invention to a subject in need thereof. In some embodiments, disclosed herein is a method of treating a disease or condition in a subject, comprising administering to the subject a population of modified T cells as described herein, e.g., a population of modified unstimulated T cells or a population of modified stimulated T cells as described herein. In some embodiments, the invention includes a method of treating a disease or condition in a subject, comprising administering to a subject in need thereof a composition comprising the modified immune cells as described herein. In some embodiments, a method of treating a disease or condition in a subject comprises administering to a subject in need thereof modified immune cells (e.g., T cells) comprising insertions and / or deletions at one or more genetic loci each encoding an endogenous immune protein selected from the group consisting of CD3δ, CD3ε, CD3γ, B2M, CIITA, TAP1, TAP2, TAPBP, NLRC5, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii chain), and an exogenous nucleic acid encoding a chimeric antigen receptor (CAR), a recombinant T cell receptor (TCR), a killer cell immunoglobulin-like receptor (KIR), an antigen-binding polypeptide, a cell surface receptor ligand, or a tumor antigen. In some embodiments, the insertions and / or deletions can downregulate gene expression of one or more endogenous immune genes.

[0286] In some embodiments, the modified immune cells further comprise a dominant negative receptor, a switch receptor, a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, CCL21, CCL19, or a combination thereof. In some examples, the disease is cancer, and in some examples, a solid tumor or a hematological malignancy. In some examples, the modified unstimulated T cells or the modified stimulated T cells, respectively, express an antigen binding domain specific for an antigen expressed by the cancer. In some embodiments, the method comprises administering to a subject in need thereof a modified immune cell (e.g., a T cell) comprising a nucleic acid capable of downregulating gene expression, a TCR, a KIR, a CAR, a dominant negative receptor, and / or a switch receptor, as described elsewhere herein. In some embodiments, the modified immune cell is a universal TCR redirected T cell (e.g., an allogeneic T cell).

[0287] In some embodiments, the cancer is a solid tumor. Exemplary solid tumors include, but are not limited to, bladder cancer, bone cancer, brain cancer (e.g., glioma, glioblastoma, neuroblastoma), breast cancer, colon cancer, esophageal cancer, eye cancer, head and neck cancer, kidney cancer, lung cancer, melanoma, mesothelioma, ovarian cancer, pancreatic cancer, prostate cancer, or gastric cancer. In some examples, the solid tumor can be brain cancer (such as glioma, glioblastoma, neuroblastoma), breast cancer, lung cancer, melanoma, mesothelioma, ovarian cancer, pancreatic cancer, or prostate cancer. In some examples, the solid tumor can be a metastatic cancer. In some examples, the solid tumor is a recurrent or refractory solid tumor.

[0288] In some embodiments, the cancer is a hematological malignancy. In some embodiments, the hematological malignancy is a B cell malignancy or a T cell malignancy. In some embodiments, the hematological malignancy is a lymphoma, leukemia, or myeloma. In some embodiments, the hematological malignancy is a Hodgkin's lymphoma or a non-Hodgkin's lymphoma. Exemplary hematological malignancies include chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), follicular lymphoma (FL), diffuse large B cell lymphoma (DLBCL), mantle cell lymphoma (MCL), Waldenstrom's macroglobulinemia, multiple myeloma, extranodal marginal zone B cell lymphoma, nodal marginal zone B cell lymphoma, Burkitt's lymphoma, non-Burkitt's high-grade B cell lymphoma, and / or other hematological malignancies. In some instances, the hematological malignancy includes, but is not limited to, large B-cell lymphoma, primary mediastinal B-cell lymphoma (PMBL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma, B-cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma, mediastinal (thymic) large B-cell lymphoma, intravascular large B-cell lymphoma, primary effusion lymphoma, or lymphomatoid granulomatosis. In some instances, the hematological malignancy is a metastatic hematological malignancy. In some instances, the hematological malignancy is a relapsed or refractory hematological malignancy.

[0289] In some embodiments, the method of treating the disease further comprises administering to the subject an additional therapeutic agent or additional therapy. In some examples, the additional therapeutic agent disclosed herein includes a chemotherapeutic agent, an immunotherapeutic agent, a targeted therapy, a radiation therapy, or a combination thereof. Exemplary additional therapeutic agents include alkylating agents such as altretamine, busulfan, carboplatin, carmustine, chlorambucil, cisplatin, cyclophosphamide, dacarbazine, lomustine, melphalan, oxalaplatin, temozolomide, or thiotepa, 5-fluorouracil (5-FU), 6-mercaptopurine (6-MP), antimetabolites such as capecitabine, cytarabine, floxuridine, fludarabine, gemcitabine, hydroxyurea, methotrexate, or pemetrexed, daunorubicin, doxorubicin, cyclophosphamide ... The additional therapeutic agent may include, but is not limited to, anthracyclines such as rubicin, epirubicin, idarubicin, topoisomerase I inhibitors such as topotecan or irinotecan (CPT-11), topoisomerase II inhibitors such as etoposide (VP-16), teniposide, or mitoxantrone, mitotic inhibitors such as docetaxel, estramustine, ixabepilone, paclitaxel, vinblastine, vincristine, or vinorelbine, or corticosteroids such as prednisone, methylprednisolone, or dexamethasone. In some examples, the additional therapeutic agent comprises a first-line therapy. As used herein, "first-line therapy" refers to a primary treatment for a cancer patient. In some examples, the cancer is a primary cancer. In other cases, the cancer is a metastatic or recurrent cancer. In some examples, chemotherapy is administered as the first-line therapy. In other cases, the first line treatment is radiation therapy. A skilled artisan will readily appreciate that different first line treatments are applicable to different types of cancer. In some instances, the additional therapeutic agent includes an immune checkpoint inhibitor.In some examples, immune checkpoint inhibitors include inhibitors such as antibodies or fragments thereof (e.g., monoclonal antibodies, human, humanized, or chimeric antibodies); RNAi molecules; small molecules against PD-1, PD-L1, CTLA4, PD-L2, LAG3, B7-H3, KIR, CD137, PS, TFM3, CD52, CD30, CD20, CD33, CD27, OX40, GITR, ICOS, BTLA (CD272), CD160, 2B4, LAIR1, TIGHT, LIGHT, DR3, CD226, CD2, or SLAM. Exemplary checkpoint inhibitors include pembrolizumab, nivolumab, tremelimumab, or ipilimumab. In some embodiments, the additional treatment comprises radiation therapy.

[0290] In some embodiments, the additional treatment comprises surgery. IX. KITS AND ARTICLES OF MANUFACTURE:

[0291] In some embodiments, the kits or articles of manufacture described herein include one or more populations of modified T cells (e.g., modified unstimulated T cells or modified stimulated T cells). In some examples, the kits or articles of manufacture described herein further include a carrier, package, or vessel that is compartmentalized to house one or more containers, such as vials, tubes, and the like, each of which contains one of the individual elements used in the methods described herein. Suitable vessels include, for example, bottles, vials, syringes, test tubes, and the like. In one embodiment, the vessels are formed from a variety of materials, such as glass and plastic.

[0292] The articles of manufacture provided herein include packaging materials. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, bags, containers, bottles, and any packaging material appropriate for the selected formulation and intended mode of administration and method of treatment.

[0293] The kit typically includes a label describing the contents and / or instructions for use, and a package insert with instructions for use. An instruction manual is also typically included. IX. Definition:

[0294] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described herein.

[0295] It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0296] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of tissue culture, immunology, molecular biology, microbiology, cell biology, and recombinant DNA, which are within the skill of those in the art. For example, Green and Sambrook eds. (2012) Molecular Cloning: A Laboratory Manual, 4th edition, the series Ausubel et al. eds.(2015)Current Protocols in Molecular Biology, the series Methods in Enzymology (Academic Press, Inc., NY), MacPherson et al. (2015) PCR 1:A Practical Approach (IRL Press at Oxford University Press), MacPherson et al. (1995) PCR 2:A Practical Approach; McPherson et al. (2006) PCR: The Basics (Garland Science), Harlow and Lane eds.(1999)Antibodies, A Laboratory Manual、 Greenfield ed.(2014)Antibodies,A Laboratory Manual;Freshney(2010)Culture of Animal Cells:A Manual of Basic Technique,6th edition、 Gait ed.(1984)Oligonucleotide Synthesis、 Hames and Higgins eds.(1984)Nucleic Acid Hybridization、 Anderson(1999)Nucleic Acid Hybridization、 Herdewijn ed.(2005)Oligonucleotide Synthesis:Methods and Applications、 Hames and Higgins eds.(1984)Transcription and Translation、 Buzdin and Lukyanov ed.(2007)Nucleic Acids Hybridization:Modern Applications、 Immobilized Cells and Enzymes(IRL Press (1986))、 Grandi ed.(2007) in vtro Transcription and Translation Protocols,2nd edition、 Guisan ed.(2006)Immobilization of Enzymes and Cells、 Perbal(1988)A Practical Guide to Molecular Cloning,2nd edition、 Miller and Calos eds, (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory), Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells, Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London), Lundblad and Macdonald eds.(2010) Handbook of Biochemistry and Molecular Biology, 4th edition, and Herzenberg et al. eds. (1996) Weir's Handbook of Experimental Immunology, 5th edition.

[0297] As used herein, the singular forms "a," "an," and "the" are intended to include plural referents unless the context clearly dictates otherwise. For example, the term "a cell" includes a plurality of cells (including mixtures thereof) and means one cell or one or more cells.

[0298] As used herein, the term "about" is used to indicate that the value includes the error of the standard deviation of the device or method being used to determine the value. The term "about" used before a numerical designation such as temperature, time, amount, concentration, etc., indicates an approximation that may vary (+) or (-) (±) 20%, 15%, 10%, 5%, 3%, 2% or 1%, including ranges. Preferably, the variation is ±5%, more preferably ±1%, and even more preferably ±0.1% from the stated value, and such variations are appropriate for carrying out the disclosed method.

[0299] As used herein, the term "activated" refers to a state of T cells that have been stimulated sufficiently to induce detectable cell proliferation. Activation may also be associated with induced cytokine production and detectable effector functions. The term "activated T cells" refers, inter alia, to T cells undergoing cell division.

[0300] "Allogeneic" refers to a material derived from a different animal of the same species as the individual into which it is introduced. Two or more individuals are said to be allogeneic to one another if their genes at one or more loci are not identical. In some embodiments, allogeneic material from individuals of the same species may be sufficiently genetically different to interact antigenically.

[0301] As used herein, the term "allogeneic T cell target" or "allogeneic T cell target" The term "allogeneic T cell" refers to proteins that mediate or contribute to a host versus graft response, mediate or contribute to a graft versus host response, or are targets of immunosuppressive drugs, as well as genes encoding said molecules and their associated regulatory elements (e.g., promoters). It will be understood that the term allogeneic T cell target, when used in connection with a target sequence or gRNA molecule, refers to a gene (and its associated regulatory elements) encoding an allogeneic T cell target protein. Without being bound by theory, inhibition or elimination of one or more allogeneic T cell targets (e.g., by the methods and compositions disclosed herein) may improve the efficacy, survival, function, and / or viability of the allogeneic cells. In some embodiments, the efficacy, survival, function, and / or viability of the allogeneic cells is improved by reducing or eliminating undesirable immunogenicity (such as a host versus graft response or a graft versus host response). In some embodiments, inhibition of a protein that mediates or contributes to a graft versus host response or a host versus graft response is used to improve the efficacy, survival, function, and / or viability of the allogeneic cells. The protein is one or more components of the T cell receptor complex. In some embodiments, the component of the T cell receptor complex is the constant domain of the T cell receptor alpha, or TCR alpha (TRAC; TCRα). In some embodiments, the component of the T cell receptor is the T cell receptor beta chain (TRBC; TCR-β), such as the constant domain 1 (TRBC1) or constant domain 2 (TRBC2) of the TCR beta. In some embodiments, the component of the T cell receptor is the T cell receptor delta chain (CD3δ), the T cell receptor epsilon chain (CD3ε), the T cell receptor zeta chain (CD3ζ; CD247), and / or the T cell receptor gamma chain (CD3γ). In some embodiments, when the protein encoded by the allogeneic T cell target is a component of a TCR signaling complex, the gene encoding the allogeneic T cell target can be, for example, TRAC, TRBC1, TRBC2, CD3δ, CD3ε, CD3γ, or CD3ζ (CD247), or any combination thereof.

[0302] As used herein, the term "antibody" refers to an immunoglobulin molecule that specifically binds to an antigen. Antibodies may be intact immunoglobulins obtained from natural or recombinant sources, or may be immunoreactive portions of intact immunoglobulins. Antibodies are usually tetramers of immunoglobulin molecules. Antibodies in the present invention may exist in various forms, including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab, F(ab)2, as well as single chain antibodies (scFv) and humanized antibodies. In some embodiments, antibodies refer to assemblies (e.g., intact antibody molecules, immunoadhesins, or variants thereof) that have a significant known specific immunoreactive activity against an antigen of interest (e.g., a tumor-associated antigen). Antibodies and immunoglobulins comprise light and heavy chains, with or without interchain covalent bonds between them. The basic immunoglobulin structure in vertebrate systems is relatively well understood.

[0303] The term "antibody fragment" refers to a portion of an intact antibody and refers to the antigen-determining variable region of the intact antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab')2, Fv fragments, linear antibodies, scFv antibodies, multispecific antibodies formed from antibody fragments, etc.

[0304] As used herein, the term "antibody heavy chain" refers to the larger of the two polypeptide chains present in all antibody molecules in their naturally occurring conformation.

[0305] As used herein, "antibody light chain" refers to the smaller of the two polypeptide chains naturally occurring in all antibody molecules. The α and β light chains refer to the two major antibody light chain isotypes.

[0306] As used herein, the term "synthetic antibody" refers to an antibody produced using recombinant DNA techniques, such as an antibody expressed by a bacteriophage as described herein. The term should also be taken to mean a DNA molecule produced by synthesis of an antibody-encoding DNA molecule and expressing an antibody protein or an amino acid sequence specifying the antibody, where the DNA or amino acid sequence is obtained using synthetic DNA or amino acid sequence techniques available and well known in the art.

[0307] Antigen-binding domains (e.g., chimeric antigen receptors) include antibody variants. As used herein, the term "antibody variant" includes antibodies that contain at least two heavy chain portions but not two complete heavy chains (such as domain deleted antibodies or minibodies), multispecific forms of antibodies (bispecific, trispecific, etc.) that have been altered to bind to two or more different antigens or different epitopes on a single antigen, synthetic and engineered forms of antibodies that have been altered so as not to occur in nature, such as heavy chain molecules combined into scFv molecules. Additionally, the term "antibody variant" includes multivalent forms of antibodies (e.g., trivalent, tetravalent, etc., antibodies that bind three, four or more copies of the same antigen).

[0308] As used herein, the term "antigen" or "Ag" is defined as a molecule that elicits an immune response. This immune response involves either antibody production or activation of specific immunologically-competent cells, or both. The skilled artisan will appreciate that virtually any macromolecule, including any protein or peptide, can function as an antigen. Furthermore, antigens can be derived from recombinant or genomic DNA. The skilled artisan will appreciate that DNA that includes a nucleotide sequence or a partial nucleotide sequence that encodes a protein that elicits an immune response encodes an "antigen" as the term is used herein. Furthermore, the skilled artisan will appreciate that an antigen need not be encoded solely by the full-length nucleotide sequence of a gene. It will be readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of one or more genes, which nucleotide sequences are arranged in various combinations to elicit a desired immune response. Furthermore, the skilled artisan will appreciate that an antigen need not be encoded by a "gene" at all. It will be apparent that an antigen can be synthetically produced or extracted from a biological sample. Such biological samples include, but are not limited to, a tissue sample, a tumor sample, a cell or a biological fluid.

[0309] As used herein, the term "anti-tumor effect" refers to a biological effect that may be manifested by a reduction in tumor volume, a reduction in tumor cell number, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with a cancerous condition. In some embodiments, an "anti-tumor effect" may also be manifested by the ability of the peptides, polynucleotides, cells, and antibodies of the invention to prevent the development of tumors in the first place.

[0310] As used herein, the term "auto-antigen" refers, in accordance with the present invention, to any self-antigen that is recognized as foreign by the immune system. In some embodiments, auto-antigens include, but are not limited to, cellular proteins, phosphorylated proteins, cell surface proteins, cellular lipids, nucleic acids, glycoproteins, including cell surface receptors.

[0311] As used herein, the term "autoimmune disease" is defined as a disease resulting from an autoimmune reaction. Autoimmune disease is the result of an inappropriate and excessive response to self-antigens. Examples of autoimmune diseases include, but are not limited to, Addison's disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune parotitis, cancer, Crohn's disease, diabetes mellitus (type I), dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barre syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjogren's syndrome, spondyloarthropathy, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia, ulcerative colitis, etc.

[0312] As used herein, the term "autologous" is intended to refer to any material derived from the same individual to which it may later be re-introduced.

[0313] As used herein, the term "cancer" refers to a disease characterized by the rapid and uncontrollable growth of abnormal cells. Cancer cells can spread locally or to other parts of the body through the bloodstream or lymphatic system. Examples of cancers include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colon cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, metastatic castration-resistant prostate cancer, melanoma, synovial sarcoma, advanced TnMuc1 positive solid tumors, neuroblastoma, neuroendocrine tumors, and the like. In one embodiment, the cancer is medullary thyroid carcinoma. In one embodiment, the cancer is prostate cancer. In one embodiment, the cancer is mesothelioma or mesothelin expressing cancer. In some embodiments, the cancer is metastatic castration-resistant prostate cancer. As used herein, the terms "cancer" and "tumor" are used interchangeably and both terms encompass solid and liquid tumors, diffuse or circulating tumors. In some embodiments, the cancer or tumor includes premalignant and malignant cancers and tumors.

[0314] As used herein, the terms "cancer associated antigen" or "tumor antigen" refer interchangeably to a molecule (typically a protein, carbohydrate, or lipid) that is expressed on the surface of cancer cells, either in whole or as a fragment (e.g., MHC / peptide), and that is useful for preferential targeting of pharmacological agents to cancer cells. In some embodiments, a tumor antigen is a marker expressed by both normal and cancer cells (e.g., a lineage marker such as CD19 on B cells). In some embodiments, a tumor antigen is a cell surface molecule that is overexpressed on cancer cells compared to normal cells, e.g., 1-fold overexpression, 2-fold overexpression, 3-fold or more overexpression compared to normal cells. In some embodiments, a tumor antigen is a cell surface molecule that is inappropriately synthesized in cancer cells, e.g., a molecule that contains deletions, additions, or mutations compared to the molecule expressed on normal cells. In some embodiments, a tumor antigen is expressed only on the cell surface of cancer cells, either in whole or as a fragment (e.g., MHC / peptide), and is not synthesized or expressed on the surface of normal cells. In some embodiments, the CARs of the invention include CARs that contain an antigen-binding domain (e.g., an antibody or antibody fragment) that binds to an MHC presented peptide. Typically, peptides derived from endogenous proteins fill the pockets of major histocompatibility complex (MHC) class I molecules and are recognized by T cell receptors (TCRs) on CD8 positive T lymphocytes. MHC class I complexes are constitutively expressed by all nuclear cells. In the cancers, virus-specific and / or tumor-specific peptide / MHC complexes represent a unique class of cell surface targets for immunotherapy. TCR-like antibodies have been described that target peptides derived from viral or tumor antigens in the context of human leukocyte antigen (HLA)-A1 or HLA-A2. For example, TCR-like antibodies can be identified by screening libraries such as human scFv phage display libraries.

[0315] As used herein, the terms "cancer-supporting antigen" or "tumor-supporting antigen" refer interchangeably to molecules (typically proteins, carbohydrates, or lipids) that are not themselves cancerous, but that support cancer cells by promoting their growth or survival (e.g., resistance to immune cells). Exemplary cells of this type include stromal cells and myeloid-derived suppressor cells (MDSCs). A tumor-supporting antigen itself need not play a role in supporting tumor cells, so long as it is present on a cell that supports the cancer cells.

[0316] As used herein, the terms "Cas", "Cas molecule" or "Cas molecule" refer to an enzyme from a bacterial Type II CRISPR / Cas system responsible for DNA cleavage. Cas includes wild-type proteins as well as functional and non-functional variants thereof.

[0317] As used herein, the term "chimeric antigen receptor" or "CAR" refers to an artificial T cell receptor that is expressed on an immune effector cell or its precursor cell and engineered to specifically bind to an antigen. CARs can be used in adoptive cell therapy by adoptive cell transfer. In some embodiments, adoptive cell transfer (or therapy) involves removing T cells from a patient and modifying the T cells to express a receptor specific for a particular antigen. In some embodiments, the CAR has specificity for a selected target, such as ROR1, mesothelin, c-Met, PSMA, PSCA, folate receptor alpha, folate receptor beta, EGFR, EGFRvIII, GPC2, GPC2, mucin 1 (MUC1), Tn antigen ((Tn Ag) or (GalNAca-Ser / Thr)), TnMUC1, GDNF family receptor alpha 4 (GFRa4), fibroblast activation protein (FAP), or interleukin 13 receptor subunit alpha 2 (IL-13Ra2 or CD213A2). In some embodiments, the CAR may also comprise an intracellular activation domain, a transmembrane domain, and an extracellular domain comprising a tumor associated antigen binding region. In some aspects, the CAR comprises a fusion of a monoclonal antibody derived from a single chain variable fragment (scFv) fused to a CD3 zeta transmembrane domain and an intracellular domain. The specificity of the CAR design may be derived from the ligand (e.g., peptide) of the receptor. In some embodiments, CARs can target cancer by redirecting the specificity of T cells expressing the CAR specific for a tumor-associated antigen.

[0318] As used herein, the term "cleavage" refers to the breakage of covalent bonds such as the backbone of a nucleic acid molecule. Cleavage can be initiated by a variety of methods, including, but not limited to, enzymatic or chemical hydrolysis of phosphodiester bonds. Both single-strand and double-strand breaks are possible. Double-strand breaks can occur as a result of two different single-strand cleavage events. DNA cleavage produces blunt or alternating ends. In some embodiments, fusion polypeptides can be used to target cleaved double-stranded DNA.

[0319] As used herein, the term "complementary" when used in reference to nucleic acids refers to base pairing, i.e., A with T or U and G with C. The term complementary refers to perfectly complementary nucleic acid molecules that form A with T or U pairs and G with C pairs throughout the reference sequence, as well as molecules that are at least 80%, 85%, 90%, 95%, 99% complementary.

[0320] As used herein, the term "conservative sequence modifications" refers to amino acid modifications that do not significantly affect or alter the binding properties of an antibody containing the amino acid sequence. Such conservative modifications include amino acid substitutions, additions, and deletions. Modifications can be introduced into the antibodies of the invention by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are those in which an amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (such as lysine, arginine, histidine), acidic side chains (such as aspartic acid, glutamic acid), uncharged polar side chains (such as glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (such as threonine, valine, isoleucine), aromatic side chains (such as tyrosine, phenylalanine, tryptophan, histidine). Thus, one or more amino acid residues in the CDR regions of an antibody can be replaced with other amino acid residues from the same side chain family, and the altered antibodies can be tested for the ability to bind antigen using the functional assays described herein.

[0321] As used herein, the term "co-stimulatory ligand" includes a molecule on an antigen presenting cell (e.g., aAPC, dendritic cell, B cell, etc.) that specifically binds to a cognate co-stimulatory molecule on a T cell, thereby providing a signal that mediates a T cell response, including, but not limited to, proliferation, activation, differentiation, etc., in addition to the primary signal provided by, for example, the binding of a peptide-loaded MHC molecule to the TCR / CD3 complex. As used herein, the term "co-stimulatory ligand" includes a molecule on an antigen presenting cell (e.g., aAPC, dendritic cell, B cell, etc.) that specifically binds to a cognate co-stimulatory molecule on a T cell, thereby providing a signal that mediates a T cell response, including, but not limited to, proliferation, activation, differentiation, etc., in addition to the primary signal provided by, for example, the binding of a peptide-loaded MHC molecule to the TCR / CD3 complex. Costimulatory ligands include, but are not limited to, CD2, CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L, inducible costimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin beta receptor, 3 / TR6, ILT3, ILT4, HVEM, agonists or antibodies that bind to the Toll ligand receptor, and ligands that specifically bind B7-H3. Costimulatory ligands also include, but are not limited to, antibodies that specifically bind to costimulatory molecules present on T cells, such as CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83.

[0322] As used herein, the term "co-stimulatory molecule" refers to a cognate binding partner on a T cell that specifically binds to a costimulatory ligand, thereby mediating a costimulatory response (such as proliferation) by the T cell. A costimulatory molecule is a cell surface molecule other than an antigen receptor or its ligand, which contributes to an efficient immune response. Costimulatory molecules include, but are not limited to, MHC class I molecules, BTLA, Toll ligand receptor, CD28, 4-1BB (CD137), OX40 (CD134), PD-1, CD7, LIGHT, CD83L, DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, ICOS (CD278), NKG2C, B7-H3 (CD276), and intracellular domains derived from killer immunoglobulin-like receptors (KIR). In some embodiments, costimulatory molecules include OX40, CD27, CD2, CD28, ICOS (CD278), and 4-1BB (CD137).Further examples of such costimulatory molecules include CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD160, CD19, CD4, CD8 alpha, CD8 beta, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, NKG2D, NKG2C, TNFR2, TRANCE These include ligands that specifically bind to RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, Lyl08), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, CD19a, and CD83.

[0323] As used herein, the term "co-stimulatory signal" refers to a signal that combines with a primary signal, such as TCR / CD3 ligation, leading to T cell proliferation and / or up-regulation or down-regulation of key molecules. A costimulatory intracellular signaling domain can be the intracellular portion of a costimulatory molecule. Costimulatory molecules can be represented by protein families such as TNF receptor proteins, immunoglobulin-like proteins, cytokine receptors, integrins, signaling lymphocyte activation molecules (SLAM proteins) and activating NK cell receptors. Examples of such molecules include CD27, CD28, 4-1BB (CD137), OX40, GITR, CD30, CD40, ICOS, BAFFR, HVEM, ICAM-1, lymphocyte function-associated antigen-1 (LFA-1), CD2, CDS, CD7, CD287, LIGHT, NKG2C, NKG2D, SLAMF7, NKp80, NKp30, NKp44, NKp46, CD160, B7-H3, and a ligand that specifically binds to CD83.

[0324] As used herein, the term "CRISPR" refers to a clustered regularly interspaced short palindromic repeats system. The terms "CRISPR system", "CRISPR / Cas", "CRISPR / Cas system" or "CRISPR" refer to a DNA locus that contains short repeats of a base sequence. Each repeat is followed by a short segment of spacer DNA from a previous exposure to a virus. Bacteria and archaea have evolved an adaptive immune defense called the CRISPR-CRISPR associated (Cas) system that uses short RNAs to induce degradation of foreign nucleic acids. In bacteria, CRISPR systems provide acquired immunity against invading foreign DNA via RNA-guided DNA cleavage. In Type II CRISPR / Cas systems, short segments of foreign DNA called "spacers" are integrated within the CRISPR genomic locus and transcribed and processed into short CRISPR RNAs (crRNAs). These crRNAs anneal to trans-activating crRNAs (tracrRNAs) and induce sequence-specific cleavage and silencing of pathogenic DNA by Cas proteins. Recent studies have shown that target recognition by the Cas9 protein requires a "seed" sequence within the crRNA and a protospacer adjacent motif (PAM) sequence containing a conserved dinucleotide upstream of the crRNA-binding region.

[0325] In some embodiments, the terms "CRISPR system," "CRISPR / Cas," "CRISPR / Cas system," or "CRISPR" refer to a set of molecules that includes an RNA-guided nuclease or other effector molecule and a gRNA molecule, which are necessary and sufficient to guide and carry out the modification of a nucleic acid of a target sequence by the RNA-guided nuclease or other effector molecule. In some embodiments, the CRISPR system comprises a gRNA and a Cas protein, such as Cas3, Cas4, Cas8a, Cas8b, Cas9, Cas10, Cas10d, Cas12a, Cas12b, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas13, Cas14, CasX, Csel, Csy1, Csn2, Cpf1, C2c1, Csm2, Cmr5, Fok1, S. pyogenes Cas9 (spCas9) or Staphylococcus aureus Cas9 (saCas9) protein. Such systems that comprise Cas or modified Cas molecules are referred to herein as "Cas systems" or "CRISPR / Cas systems." In some embodiments, the gRNA molecule and the Cas molecule can be complexed to form a ribonucleoprotein (RNP) complex.

[0326] A crRNA-tracrRNA fusion transcript (hereafter referred to as "guide RNA" or "gRNA") can be designed from the human U6 polymerase III promoter to instruct Cas9 to cleave a sequence of interest. CRISPR / CAS-mediated genome editing and regulation have highlighted their transformative potential for basic science, cell engineering, and therapy.

[0327] As used herein, the term "crRNA" used in reference to a gRNA molecule is the portion of the gRNA molecule that contains the targeting domain and the region that interacts with tracr to form the flagpole region.

[0328] As used herein, the term "CRISPRi" refers to a CRISPR system for sequence-specific gene silencing or inhibition of gene expression, such as at the transcriptional level.

[0329] As used herein, the term "derived from" refers to the relationship between a first molecule and a second molecule. It defines the structural similarity between the first molecule and the second molecule, and does not imply or include any limitations on the process or source of the first molecule derived from the second molecule. For example, in the case of an intracellular signaling domain derived from a CD3 zeta molecule, the intracellular signaling domain retains sufficient CD3 zeta structure to have the required function, i.e., the ability to generate a signal under appropriate conditions. This does not imply or include any limitations on the particular process of generating the intracellular signaling domain. It does not mean that one must start with the CD3 zeta sequence and delete unnecessary sequences or impose mutations to arrive at the intracellular signaling domain in order to provide the intracellular signaling domain.

[0330] As used herein, the term "disease" refers to a state of health in an animal in which the animal is unable to maintain homeostasis and the animal's health continues to deteriorate if the disease is not ameliorated. In contrast, the term "disorder" in an animal refers to a state of health in which the animal is able to maintain homeostasis, but the animal's health is less favorable than it would be in the absence of the disorder. If left untreated, a disorder does not necessarily cause the animal's health to deteriorate further.

[0331] As used herein, a "disease associated with expression of a tumor antigen" includes, but is not limited to, a disease associated with expression of a tumor antigen or a condition associated with cells expressing a tumor antigen, including, but not limited to, a proliferative disease such as cancer or a malignant tumor, or a precancerous condition such as myelodysplasia, myelodysplastic syndrome, preleukemia, or a noncancer related indication associated with cells expressing a tumor antigen. In some embodiments, the cancer associated with expression of a tumor antigen is a hematological cancer. In some embodiments, the cancer associated with expression of a tumor antigen is a solid cancer. Further diseases associated with expression of a tumor antigen include, but are not limited to, atypical and / or atypical cancers, malignant tumors, precancerous conditions, or a proliferative disease associated with expression of a tumor antigen. Noncancer related indications associated with expression of a tumor antigen include, but are not limited to, autoimmune diseases (e.g., lupus), inflammatory disorders (allergies and asthma), transplantation, and the like. In some embodiments, the tumor antigen expressing cells express, or at any time express, mRNA encoding the tumor antigen. In some embodiments, the tumor antigen-expressing cells produce a tumor antigen protein (e.g., wild-type or mutant), and the tumor antigen protein may be present at normal or reduced levels. In some embodiments, the tumor antigen-expressing cells produce detectable levels of tumor antigen protein at one time and then produce substantially no detectable tumor antigen protein thereafter.

[0332] As used herein, the term "downregulation" refers to the reduction or elimination of gene expression of one or more genes.

[0333] As used herein, the term "encoding" refers to the inherent property of a particular nucleotide sequence within a polynucleotide (such as a gene, cDNA, or mRNA) to serve as a template for the synthesis of other polymers and macromolecules in biological processes having either a defined nucleotide sequence (such as rRNA, tRNA, and mRNA) or a defined amino acid sequence and the biological properties resulting therefrom. Thus, a gene, cDNA, or RNA encodes a protein when the protein is produced in a cell or other biological system by transcription and translation of the mRNA corresponding to that gene. Both the coding strand (whose nucleotide sequence is identical to the mRNA sequence, usually provided in a sequence listing) and the non-coding strand (used as a template for transcription of the gene or cDNA) can be said to encode the protein or other product of that gene or cDNA. Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. A nucleotide sequence encoding a protein or RNA may contain introns to the extent that a nucleotide sequence encoding a protein may contain introns in some version.

[0334] "Effective amount" or "therapeutically effective amount", as used interchangeably herein, refers to an amount of a compound, formulation, material, pharmaceutical product, or composition described herein that is effective to achieve a desired physiological, therapeutic, or prophylactic result in a subject in need thereof. Such results include, but are not limited to, an amount that, when administered to a mammal, induces a detectable level of immune response compared to an immune response detected in the absence of the composition of the present invention. Immune response can be readily assessed by a variety of art-recognized methods. One of skill in the art will appreciate that the amount of the composition administered herein will vary and can be readily determined based on many factors, such as the disease or condition being treated, the age and health and physical condition of the mammal being treated, the severity of the disease, the particular compound being administered, and the like. The effective amount may vary between subjects, depending on the health and physical condition of the subject being treated, the taxonomic group of the subject being treated, the formulation of the composition, an evaluation of the subject's condition, and other relevant factors.

[0335] As used herein, the term "endogenous" refers to a substance that is derived from or produced within an organism, cell, tissue, or system.

[0336] As used herein, the term "expand" means to increase in number, such as an increase in the number of immune cells (e.g., T cells). In some embodiments, the number of immune cells (e.g., T cells) expanded ex vivo is increased relative to the number originally present in the culture. In another embodiment, the immune cells (e.g., T cells) expanded ex vivo are increased in number relative to other cell types in the culture.

[0337] As used herein, the term "expression" refers to the transcription and / or translation of a particular nucleotide sequence driven by a promoter.

[0338] As used herein, the term "exogenous" refers to any substance that is introduced from or produced outside an organism, cell, tissue or system.

[0339] As used herein, the term "expression vector" refers to a vector that contains a recombinant polynucleotide that includes an expression control sequence operably linked to a nucleotide sequence to be expressed. An expression vector contains sufficient cis-acting elements for expression, with other elements for expression being supplied by a host cell or an in vitro expression system. Expression vectors include all those known in the art, such as cosmids, plasmids (e.g., naked or contained in liposomes) and viruses (e.g., Sendai virus, lentivirus, retrovirus, adenovirus and adeno-associated virus) incorporating a recombinant polynucleotide.

[0340] As used herein, the term "ex vivo" refers to cells removed from a living organism (e.g., a human) and grown outside the body (e.g., in a culture dish, test tube, or bioreactor).

[0341] As used herein, the term "flagpole" used in reference to a gRNA molecule refers to the portion of the gRNA where the crRNA and tracr bind or hybridize to each other.

[0342] As used herein, the terms "guide RNA", "guide RNA molecule", "gRNA molecule" or "gRNA" are used interchangeably and refer to a set of nucleic acid molecules that facilitate the specific guidance of an RNA-guided nuclease or other effector molecule (typically in complex with a gRNA molecule) to a target sequence. In some embodiments, the guidance is achieved by hybridization of a portion of the gRNA with DNA (e.g., via a gRNA targeting domain) and binding of a portion of the gRNA molecule with an RNA-guided nuclease or other effector molecule (e.g., via at least a gRNA tracr). In some embodiments, the gRNA molecule consists of a single contiguous polynucleotide molecule, referred to herein as "single guide RNA" or "sgRNA", etc. In some embodiments, the gRNA molecule consists of multiple (usually two) polynucleotide molecules, which themselves can be linked, typically via hybridization, referred to herein as "dual guide RNA" or "dgRNA", etc. gRNA molecules are described in more detail below, but generally include a targeting domain and a tracr. In some embodiments, the targeting domain and the tracr are located on a single polynucleotide. In another embodiment, the targeting domain and tracr are located on separate polynucleotides.

[0343] As used herein, the term "homologous" refers to the subunit sequence identity between two polymer molecules (e.g., between two nucleic acid molecules, e.g., between two DNA molecules or two RNA molecules) or between two polypeptide molecules. If both subunit positions of two molecules are occupied by the same monomeric subunit, then they are homologous at that position. For example, if there is an adenine position in each of the two DNA molecules, then the two DNA molecules are homologous. The homology between two sequences is directly dependent on the number of matching or homologous positions. For example, if half of the positions of the two sequences (e.g., 5 positions in a polymer 10 subunits in length) are homologous, then the two sequences are 50% homologous. If 90% of the positions (e.g., 9 out of 10) are matched or homologous, then the two sequences are 90% homologous.

[0344] As used herein, the term "humanized antibodies" refers to human forms of non-human (e.g., murine) antibodies and are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (e.g., Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) that contain minimal sequence derived from non-human immunoglobulin. Humanized antibodies are most often human immunoglobulins (recipient antibody) in which residues from a complementarity determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and capacity. In some instances, Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues that are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are made to further refine and optimize antibody performance. Generally, the humanized antibody will comprise substantially all of at least one, and usually two, variable domains, with all or substantially all of the CDR regions corresponding to those of a non-human immunoglobulin, and all or substantially all of the FR regions being those of a human immunoglobulin sequence. The humanized antibody optimally also comprises at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details, see Jones et al., Nature 321:522-525 (1986); Reichmann et al., Nature 332:323-329 (1988); Presta, Curr. Op. Struct. Biol. 2:593-596 (1992).

[0345] As used herein, the term "fully human" refers to an immunoglobulin, such as an antibody, whose entire molecule is of human origin or consists of an amino acid sequence identical to the human form of the antibody.

[0346] As used herein, the term "identity" refers to the subunit sequence identity between two polymer molecules, particularly between two amino acid molecules, e.g., between two polypeptide molecules. If two amino acid sequences have the same residue at the same position, they are identical at that position. For example, if each position of two polypeptide molecules is occupied by arginine, the two polypeptides are identical. The identity or degree to which two amino acid sequences have the same residue at the same position in an alignment is often expressed as a percentage. The identity between two amino acid sequences depends directly on the number of matching or identical positions. For example, if half of the positions of the two sequences (e.g., 5 positions in a polymer of 10 amino acids in length) are identical, the two sequences are 50% identical. If 90% of the positions (e.g., 9 out of 10) are matched or identical, the two amino acid sequences are 90% identical.

[0347] As used herein, the term "immunoglobulin" or "Ig" defines a class of proteins that function as antibodies. Antibodies expressed by B cells are sometimes called BCRs (B cell receptors) or antigen receptors. This class of proteins includes five members: IgA, IgG, IgM, IgD, and IgE. IgA is the major antibody present in body secretions such as saliva, tears, breast milk, gastrointestinal secretions, and respiratory and urogenital mucous secretions. IgG is the most common circulating antibody. IgM is the major immunoglobulin produced in the primary immune response in most subjects. It is the most efficient immunoglobulin in agglutination, complement fixation, and other antibody responses, and is important in defense against bacteria and viruses. IgD is an immunoglobulin that has no known function as an antibody but can function as an antigen receptor. IgE is an immunoglobulin that causes immediate hypersensitivity by mediator release from mast cells and basophils upon exposure to allergens.

[0348] As used herein, the term "immune response" is defined as a cellular response to an antigen that occurs when lymphocytes recognize the antigen molecule as foreign and induce the formation of antibodies and / or activate lymphocytes to eliminate the antigen.

[0349] As used herein, the term "immune effector cell" refers to a cell that is involved in an immune response, e.g., promoting an immune effector response. Examples of immune effector cells include T cells (e.g., alpha / eta T cells and gamma / delta T cells), B cells, natural killer (NK) cells, natural killer T (NKT) cells, mast cells, bone marrow-derived phagocytes, and the like.

[0350] As used herein, the term "immune effector function or immune effector response" refers to a function or response that enhances or promotes an immune attack against a target cell. In some embodiments, an immune effector function or response refers to a property of a T cell or NK cell that promotes the killing or inhibition of the growth or proliferation of a target cell. In the case of T cells, primary stimulation and costimulation are examples of immune effector functions or responses.

[0351] As used herein, the term "inhibitory molecule" refers to a molecule that, upon activation, causes or contributes to the inhibition of cell survival, activation, proliferation and / or function, as well as the gene encoding said molecule and its associated regulatory elements (e.g., promoter). In some embodiments, an inhibitory molecule is a molecule expressed on an immune effector cell (e.g., a T cell). Non-limiting examples of inhibitory molecules include PD-1, PD-L1, PD-L2, CTLA4, TIM3, LAG3, CEACAM (e.g., CEACAM-1, CEACAM-3 and / or CEACAM-5), VISTA, TGFβIIR, VSIG3, VSIG8, BTLA, TIGIT, LAIR1, CD160, 2B4, CD80, CD86, B7-H3 (CD276), B7-H4 (VTCN1), HVEM (TNFRSF14 or CD107), KIR, A2aR, MHC class I, MHC class II, GAL9, adenosine, and TGF beta. It will be understood that the term inhibitory molecule, when used in relation to a target sequence or gRNA molecule, refers to the gene (and its associated regulatory elements) that encodes the inhibitory molecule protein. In some embodiments, the gene encoding the inhibitory molecule is BTLA, PD-1, TIM-3, VSIG3, VSIG8, CTLA4, or TGFβIIR. In some embodiments, the gene encoding the inhibitory molecule is VSIG3. In some embodiments, the gene encoding the inhibitory molecule is PD-1. In some embodiments, the gene encoding the inhibitory molecule is TGFβIIR.

[0352] As used herein, the term "induced pluripotent stem cell" or "iPS cell" is generated from adult cells, such as immune cells (i.e., T cells). Expression of reprogramming factors, such as Klf4, Oct3 / 4, and Sox2, in the adult cells converts the cells into pluripotent cells capable of proliferation and differentiation into multiple cell types.

[0353] As used herein, the term "instructional material" includes publications, records, diagrams, or other media of expression that can be used to communicate the utility of the compositions and methods of the invention. Instructions for kits of the invention may, for example, be affixed to a container containing the nucleic acids, peptides, and / or compositions of the invention or shipped together with a container containing the nucleic acids, peptides, and / or compositions. Alternatively, the instructions may be shipped separately from the container, with the intention that the recipient use the instructions in conjunction with the compound.

[0354] As used herein, the term "isolated" means altered or removed from the natural state. For example, a nucleic acid or peptide naturally present in a living animal is not "isolated," but the same nucleic acid or peptide is "isolated" if it is partially or completely separated from the materials with which it coexists in the natural state. An isolated nucleic acid or protein can exist in a substantially purified form or can exist in a non-native environm...

Claims

1. A modified immune cell comprising: (a) Insertions and / or deletions at one or more loci each encoding an endogenous immune protein selected from the group consisting of CD3δ, CD3ε, CD3γ, B2M, CIITA, TAP1, TAP2, TAPBP, NLRRC5, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii chain), wherein the insertions and / or deletions can down-regulate the gene expression of one or more endogenous immune genes, and optionally, (b) An exogenous nucleic acid encoding a chimeric antigen receptor (CAR), a recombinant T cell receptor (TCR), a killer cell immunoglobulin-like receptor (KIR), an antigen-binding polypeptide, a cell surface receptor ligand, or a tumor antigen, and optionally, (c) Further comprising a dominant negative receptor, a switch receptor, a chemokine, a chemokine receptor, a cytokine, a cytokine receptor, IL-7, IL-7R, IL-15, IL-15R, IL-21, IL-18, CCL21, CCL19, or a combination thereof.

2. The modified immune cell according to claim 1, wherein the insertions and / or deletions can down-regulate the following gene expressions: (a) A T cell receptor subunit selected from CD3δ, CD3ε, and / or CD3γ, (b) An HLA class I molecule selected from B2M, TAP1, TAP2, TAPBP, and / or NLRRC5, and (c) An HLA class II molecule selected from HLA-DM, RFX5, RFXANK, RFXAP, and / or invariant chain (Ii chain).

3. (a) The insertions and / or deletions can down-regulate the following: (i) The gene expression of CD3δ, and (ii) The gene expression of an HLA molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, NLRRC5, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain), and combinations thereof, or (b) The insertions and / or deletions can down-regulate the following: (i) The gene expression of CD3ε, and (ii) The gene expression of an HLA molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, NLRRC5, CIITA, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain), and combinations thereof, or (c) The insertion and / or deletion can control the following downward: (i) Gene expression of CD3γ, and (ii) Gene expression of HLA molecules selected from the group consisting of B2M, TAP1, TAP2, TAPBP, NLRRC5, CII TA, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain), and combinations thereof. The modified immune cell according to claim 2.

4. The modified immune cell according to claim 1, wherein the insertion and / or deletion can control the following gene expression downward: (I) Any one of the following: (a) CD3ε, B2M, and CII TA, (b) CD3ε, B2M, and RFX5, (c) CD3ε, B2M, and RFXAP, (d) CD3ε, B2M, and RFXANK, (e) CD3ε, B2M, and HLA-DM, (f) CD3ε, B2M, and Ii chain, (g) CD3ε, TAP1, and CII TA, (h) CD3ε, TAP1, and RFX5, (i) CD3ε, TAP1, and RFXAP, (j) CD3ε, TAP1, and RFXANK, (k) CD3ε, TAP1, and HLA-DM, (l) CD3ε, TAP1, and Ii chain, (m) CD3ε, TAP2, and CII TA, (n) CD3ε, TAP2, and RFX5, (o) CD3ε, TAP2, and RFXAP, (p) CD3ε, TAP2, and RFXANK, (q) CD3ε, TAP2, and HLA-DM, (r) CD3ε, TAP2, and Ii chain, (s) CD3ε, NLRRC5, and CII TA, (t) CD3ε, NLRRC5, and RFX5, (u) CD3ε, NLRRC5, and RFXAP, (v) CD3ε, NLRRC5, and RFXANK, (w) CD3ε, NLRRC5, and HLA-DM, (x) CD3ε, NLRRC5, and Ii chain, (y) CD3ε, TAPBP, and CII TA, (z) CD3ε, TAPBP, and RFX5, (aa) CD3ε, TAPBP, and RFXAP, (bb) CD3ε, TAPBP, and RFXANK, (cc) CD3ε, TAPBP, and HLA-DM, or (dd) CD3ε, TAPBP, and Ii chain, or (II) Any one of the following: (a) CD3δ, B2M, and CII TA, (b) CD3δ, B2M, and RFX5, (c) CD3δ, B2M, and RFXAP, (d) CD3δ, B2M, and RFXANK, (e) CD3δ, B2M, and HLA-DM, (f) CD3δ, B2M, and Ii chain, (g) CD3δ, TAP1, and CII TA, (h) CD3δ, TAP1, and RFX5, (i) CD3δ, TAP1, and RFXAP, (j) CD3δ, TAP1, and RFXANK, (k) CD3δ, TAP1, and HLA-DM, (l) CD3δ, TAP1, and Ii chain, (m) CD3δ, TAP2, and CII TA, (n) CD3δ, TAP2, and RFX5, (o) CD3δ, TAP2, and RFXAP, (p) CD3δ, TAP2, and RFXANK, (q) CD3δ, TAP2, and HLA-DM, (r) CD3δ, TAP2, and Ii chain, (s) CD3δ, NLR C5, and CII TA, (t) CD3δ, NLR C5, and RFX5, (u) CD3δ, NLR C5, and RFXAP, (v) CD3δ, NLR C5, and RFXANK, (w) CD3δ, NLR C5, and HLA-DM, (x) CD3δ, NLR C5, and Ii chain, (y) CD3δ, TAPBP, and CII TA, (z) CD3δ, TAPBP, and RFX5, (aa) CD3δ, TAPBP, and RFXAP, (bb) CD3δ, TAPBP, and RFXANK, (cc) CD3δ, TAPBP, and HLA-DM, or (dd) CD3δ, TAPBP, and Ii chain, or (III) Any one of the following: (a) CD3γ, B2M, and CII TA, (b) CD3γ, B2M, and RFX5, (c) CD3γ, B2M, and RFXAP, (d) CD3γ, B2M, and RFXANK, (e) CD3γ, B2M, and HLA-DM, (f) CD3γ, B2M, and Ii chain, (g) CD3γ, TAP1, and CII TA, (h) CD3γ, TAP1, and RFX5, (i) CD3γ, TAP1, and RFXAP, (j) CD3γ, TAP1, and RFXANK, (k) CD3γ, TAP1, and HLA-DM, (l) CD3γ, TAP1, and Ii chain, (m) CD3γ, TAP2, and CII TA, (n) CD3γ, TAP2, and RFX5, (o) CD3γ, TAP2, and RFXAP, (p) CD3γ, TAP2, and RFXANK, (q) CD3γ, TAP2, and HLA-DM, (r) CD3γ, TAP2, and Ii chain, (s) CD3γ, NLR C5, and CII TA, (t) CD3γ, NLR C5, and RFX5, (u) CD3γ, NLR C5, and RFXAP, (v) CD3γ, NLR C5, and RFXANK, (w) CD3γ, NLR C5, and HLA-DM, (x) CD3γ, NLR C5, and Ii chain, (y) CD3γ, TAPBP, and CII TA, (z) CD3γ, TAPBP, and RFX5, (aa) CD3γ, TAPBP, and RFXAP, (bb) CD3γ, TAPBP, and RFXANK, (cc) CD3γ, TAPBP, and HLA-DM, or (dd) CD3γ, TAPBP, and Ii chain.

5. (a) The modified immune cell is selected from the group consisting of T cells, natural killer cells (NK cells), natural killer T cells, lymphoid progenitor cells, hematopoietic stem cells, stem cells, macrophages, and dendritic cells, and / or, (b) The modified immune cell is a CD4-positive T cell or a CD8-positive T cell, and / or (c) The modified immune cell is an allogeneic T cell or an autologous human T cell, The modified immune cell according to claim 1.

6. The modified immune cell according to claim 1, wherein the insertion and / or deletion is the result of gene editing selected from the group consisting of: (a) A CRISPR-associated (Cas) (CRISPR-Cas) endonuclease system and guide RNA, (b) A TALEN gene editing system, a zinc finger nuclease (ZFN) gene editing system, a meganuclease gene editing system, or a megaTALEN gene editing system, and, (c) A gene silencing system selected from antisense RNA, antagomir RNA, RNAi, siRNA, or shRNA.

7. (a) The Cas endonuclease includes Cas3, Cas4, Cas8a, Cas8b, Cas9, Cas10, Cas10d, Cas12a, Cas12b, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas13, Cas14, CasX, Cse1, Csy1, Csn2, Cpf1, C2c1, Csm2, Cmr5, Fok1, S. pyogenes Cas9, Staphylococcus aureus Cas9, MAD7, or any combination thereof, or, (b) The CRISPR-Cas system includes a pAd5 / F35-CRISPR vector, or, (c) The guide RNA includes a guide sequence complementary to a sequence within one or more gene loci encoding an immune protein selected from the group consisting of CD3δ, CD3ε, CD3γ, B2M, CII TA, TAP1, TAP2, TAPBP, NLR C5, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii chain). The modified immune cell according to claim 6.

8. (a) The guide RNA is complementary to (1) one or more exons of CD3δ, CD3ε or CD3γ or (2) a sequence within exon 1 of CD3δ, CD3ε or CD3γ, or (b) The sequence is within the CD3δ locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 53, or (c) The sequence is within the CD3ε locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 52, or (d) The sequence is within the CD3γ locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 54, or (e) The sequence is within the B2M locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 55, or (f) The sequence is within the CIITA locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 61, or (g) The sequence is within the TAP1 locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 56, or (h) The sequence is within the TAP2 locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 57, or (i) The sequence is within the TAPBP locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 58, SEQ ID NO: 59 or a combination thereof, or (j) The sequence is within the NLRAC5 locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 60, or (k) The sequence is within the HLA-DM locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 62, or (l) The sequence is within the RFX5 locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 63, SEQ ID NO: 64 or a combination thereof, or (m) The sequence is within the RFXANK locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 65, or (n) The sequence is within the RFXAP locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 66, or (o) The sequence is within the Ii chain locus and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 67, SEQ ID NO: 68 or a combination thereof. The modified immune cell according to claim 7.

9. (a)When the modified immune cell is administered to a subject, the immune cell exhibits a reduced immune response in the subject as compared to the immune response exerted by an unmodified immune cell administered to the same subject. (b)When the modified immune cell is administered to a subject, the immune cell exhibits a reduced immune response in the subject as compared to the immune response exerted by an immune cell containing an insertion and / or deletion capable of downregulating the gene expression of TRAC, B2M, and CIITA. Optionally, the immune response is a graft-versus-host disease (GvHD) response. Further optionally, the reduction of the GvHD response is induced against HLA-I mismatched cells or HLA-II mismatched cells. The modified immune cell according to claim 1.

10. (a)The GvHD response is reduced by about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 95% or more, or (b)The GvHD response is reduced by about 1-fold or more, about 2-fold or more, about 3-fold or more, about 4-fold or more, about 5-fold or more, about 6-fold or more, about 7-fold or more, about 8-fold or more, about 9-fold or more, about 10-fold or more, about 20-fold or more, about 30-fold or more, about 50-fold or more, about 100-fold or more, about 150-fold or more, or about 200-fold or more, and / or (c)The reduction of the GvHD response by the modified immune cell is compared with an equivalent immune cell without deletions and / or insertions at one or more loci, or an immune cell containing deletions and / or insertions in TRAC, B2M, and CIITA. The modified immune cell according to claim 9.

11. The exogenous nucleic acid encodes a chimeric antigen receptor (CAR), and the CAR comprises an antigen-binding domain, a hinge domain, a transmembrane domain, a co-stimulatory signaling domain, and an intracellular signaling domain. The modified immune cell according to claim 1.

12. (a)The antigen-binding domain comprises a full-length antibody or an antigen-binding fragment thereof, Fab, F(ab)2, monospecific Fab2, bispecific Fab2, trispecific Fab2, single-chain variable fragment (scFv), diabody, triabody, minibody, V-NAR, or VhH, and / or (b) The transmembrane domain is selected from a transmembrane domain of an artificial hydrophobic sequence, a transmembrane domain of a type I transmembrane protein, an alpha chain, a beta chain or a zeta chain of a T cell receptor, CD28, CD3 epsilon, CD45, CD4, CD2, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, OX40 (CD134), 4-1BB (CD137), ICOS (CD278), CD154, CD357 (GITR), a transmembrane domain derived from Toll-like receptor 1 (TLR1), TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9 and killer immunoglobulin-like receptor (KIR), and / or, (c) The co-stimulatory domain comprises one or more co-stimulatory domains of a protein selected from the group consisting of a protein of the TNF receptor superfamily, CD28, 4-1BB (CD137), OX40 (CD134), PD-1, CD7, LIGHT, CD83L, DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1, Lck, TNFR-I, TNFR-II, Fas, CD30, CD40, ICOS (CD278), NKG2C, B7-H3 (CD276) and an intracellular domain or a variant thereof derived from killer immunoglobulin-like receptor (KIR), and / or, (d) The intracellular signaling domain comprises an intracellular domain selected from the group consisting of a cytoplasmic signaling domain of human CD2, CD3 zeta chain (CD3ζ), FcγRIII, FcsRI, a cytoplasmic tail of an Fc receptor, a cytoplasmic receptor having an immunoreceptor tyrosine-based activation motif (ITAM), TCR zeta, FcR gamma, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b and CD66d or a variant thereof, and / or, (e) The antigen-binding domain targeting the tumor antigen is as follows: (i) Related to hematological malignancies, (ii) Related to solid tumors, and / or, (iii) selected from the group consisting of ROR1, mesothelin, c-Met, PSMA, PSCA, folate receptor alpha, folate receptor beta, EGFR, EGFRvIII, GPC2, GPC2, mucin 1 (MUC1), Tn antigen ((TnAg) or (GalNAca-Ser / Thr)), TnMUC1, GDNF family receptor alpha 4 (GFRa4), fibroblast activation protein (FAP), and interleukin-13 receptor subunit alpha 2 (IL-13Ra2 or CD213A2), and / or (f) the intracellular signaling domain comprises the human CD3 zeta chain (CD3ζ), and / or (g) the CAR comprises the following: (i) a PSMA antigen-binding domain, a CD2 co-stimulatory domain, and a CD3 zeta intracellular signaling domain, (ii) a mesothelin antigen-binding domain, a 4-1BB co-stimulatory domain, and a CD3 zeta signaling domain, or (iii) a TnMUC1 antigen-binding domain, a CD2 co-stimulatory domain, and a CD3 zeta signaling domain, The modified immune cell according to claim 11.

13. (a) the switch receptor comprises an extracellular domain, a transmembrane domain of a signaling protein associated with a negative signal, and an intracellular domain of a signaling protein associated with a positive signal, and / or (b) the dominant negative receptor comprises the following: (i) a truncated variant of a wild-type protein associated with a negative signal, (ii) a variant of a wild-type protein associated with a negative signal, comprising an extracellular domain, a transmembrane domain, and substantially lacking an intracellular signaling domain, or (iii) an extracellular domain and a transmembrane domain of a signaling protein associated with a negative signal, The modified immune cell according to claim 1.

14. (a) the protein associated with the negative signal is selected from the group consisting of CTLA4, PD-1, TGFβRII, BTLA, VSIG3, VSIG8, and TIM-3, and / or (b) the protein associated with the positive signal is selected from the group consisting of CD28, 4-1BB, IL12Rβ1, IL12Rβ2, CD2, ICOS, and CD27, and / or (c) The switch receptor is selected from the group consisting of PD-1-CD28, PD-1 A132L -CD28, PD-1-CD27, PD-1 A132L -CD27, PD-1-4-1BB, PD-1 A132L -4-1BB, PD-1-ICOS, PD-1 A132L -ICOS, PD-1-IL12Rβ1, PD-1 A132L -IL12Rβ1, PD-1-IL12Rβ2, PD-1 A132L -IL12Rβ2, VSIG3-CD28, VSIG8-CD28, VSIG3-CD27, VSIG8-CD27, VSIG3-4-1BB, VSIG8-4-1BB, VSIG3-ICOS, VSIG8-ICOS, VSIG3-IL12Rβ1, VSIG8-IL12Rβ1, VSIG3-IL12Rβ2, VSIG8-IL12Rβ2, TGFβRII-CD27, TGFβRII-CD28, TGFβRII-4-1BB, TGFβRII-ICOS, TGFβRII-IL12Rβ1 and TGFβRII-IL12Rβ2, and / or (d) the dominant negative receptor is a PD1, VSIG3, VISG8, or TGFβR dominant negative receptor, and / or (e) The transmembrane domain is as follows: (i) Selected from the transmembrane domains of proteins selected from the group consisting of CTLA4, PD-1, VSIG3, VSIG8, TGFβRII, BTLA, TIM-3, CD28, 4-1BB, IL12Rβ1, IL12Rβ2, CD2, ICOS, and CD27, or (ii) Selected from the transmembrane portion of the protein associated with the negative signal or the transmembrane domain of the protein associated with the negative signal The modified immune cell according to claim 13.

15. An isolated modified T cell comprising at least one dysfunctional polypeptide selected from the group consisting of CD3δ, CD3ε, CD3γ, B2M, C2TA, TAP1, TAP2, TAPBP, NLRRC5, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii chain), The modified T cell comprising the dysfunctional polypeptide exhibits at least one of the following: (i) Decreased expression of the T cell receptor compared to unmodified T cells, (ii) Decreased expression of the dysfunctional polypeptide, (iii) Complete absence of surface expression of the T cell receptor complex, and (iv) Decreased or insufficient cross-linking of the T cell receptor.

16. (a) The modified T cell, when administered to a subject, exhibits a reduced immune response in the subject compared to the immune response exerted by unmodified T cells administered to the same subject, and / or (b) The modified T cell comprises two or more dysfunctional polypeptides, and the second dysfunctional polypeptide is the T cell receptor alpha chain (TRAC), and / or (c) The modified T cell comprises the following: (i) Three or more dysfunctional polypeptides selected from TRAC, CD3δ, CD3ε, CD3γ, B2M, C2TA, TAP1, TAP2, TAPBP, NLRRC5, HLA-DM, RFX5, RFXANK, RFXAP, or Ii chain, (ii) Two dysfunctional polypeptides selected from CD3α, CD3δ, CD3ε, CD3γ, B2M, C2TA, TAP1, TAP2, TAPBP, NLRRC5, HLA-DM, RFX5, RFXANK, RFXAP, or Ii chain (iii) Three dysfunctional polypeptides selected from CD3α, CD3δ, CD3ε, CD3γ, B2M, C2TA, TAP1, TAP2, TAPBP, NLRRC5, HLA-DM, RFX5, RFXANK, RFXAP or Ii chain, (iv) A dysfunctional polypeptide selected from the group consisting of CD3δ, CD3ε and CD3γ and at least one dysfunctional polypeptide selected from TRAC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRRC5, HLA-DM, RFX5, RFXANK, RFXAP or Ii chain, or, (v) A dysfunctional polypeptide selected from the group consisting of CD3δ, CD3ε and CD3γ and a dysfunctional polypeptide selected from TRAC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRRC5, HLA-DM, RFX5, RFXANK, RFXAP or Ii chain, and / or, (d) The modified T cell comprises the following: (i) Dysfunctional CD3δ and at least one dysfunctional polypeptide selected from TRAC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRRC5, HLA-DM, RFX5, RFXANK, RFXAP or Ii chain, (ii) Dysfunctional CD3ε and at least one dysfunctional polypeptide selected from TRAC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRRC5, HLA-DM, RFX5, RFXANK, RFXAP or Ii chain, or, (iii) Dysfunctional CD3γ and at least one dysfunctional polypeptide selected from TRAC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRRC5, HLA-DM, RFX5, RFXANK, RFXAP or Ii chain, and / or, (e) The modified T cell comprises two or more dysfunctional polypeptides selected from TRAC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRRC5, HLA-DM, RFX5, RFXANK, RFXAP or Ii chain, and / or, (f) The modified T cell (i) The expression of TRAC, CD3δ, CD3ε, CD3γ, B2M, C2TA, TAP1, TAP2, TAPBP, NLRRC5, HLA-DM, RFX5, RFXANK, RFXAP, Ii chain or any combination thereof is decreased, or, (ii) that do not express CD3δ, CD3ε, CD3γ, TRAC, B2M, C2TA, TAP1, TAP2, TAPBP, NLRRC5, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain) or any combination thereof, and / or (g) the modified T cell further comprises a dysfunctional polypeptide selected from TRAC, B2M and C2TA, and / or (h) the modified T cell has reduced expression of or does not express TRAC, B2M or C2TA, and / or (i) the modification of CD3δ, CD3ε and / or CD3γ leads to dysfunction of the TCR / CD3 complex, and / or (j) CD3δ, CD3ε or CD3γ is modified by targeting one or more exons of CD3δ, CD3ε or CD3γ, optionally exon 1 of CD3δ, CD3ε or CD3γ. The isolated modified T cell according to claim 15. **Claim 17** A method for generating a modified immune cell, comprising: (a) introducing into an immune cell one or more nucleic acids capable of downregulating the gene expression of one or more endogenous immune genes encoding an endogenous immune protein selected from the group consisting of CD3δ, CD3ε, CD3γ, B2M, CII TA, TAP1, TAP2, TAPBP, NLRRC5, HLA-DM, RFX5, RFXANK, RFXAP and invariant chain (Ii chain); (b) introducing into the immune cell an exogenous nucleic acid encoding a chimeric antigen receptor (CAR), a recombinant T cell receptor (TCR), a killer cell immunoglobulin-like receptor (KIR), an antigen-binding polypeptide, a cell surface receptor ligand or a tumor antigen; and (c) expanding the modified immune cell to generate a population of T cells, and optionally (d) further comprising introducing into the immune cell an exogenous nucleic acid encoding a dominant negative receptor, a switch receptor or a combination thereof. **Claim 18** (a) The one or more nucleic acids can downregulate the following gene expressions: (i) a T cell receptor subunit selected from CD3δ, CD3ε or CD3γ; (ii) an HLA class I molecule selected from B2M, TAP1, TAP2, TAPBP or NLRRC5; and (iii) an HLA class II molecule selected from HLA-DM, RFX5, RFXANK, RFXAP or invariant chain (Ii chain), and / or (b) one or more nucleic acids can down-regulate the gene expression of CD3δ and / or the gene expression of an HLA molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, NLRRC5, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain) and combinations thereof, and / or (c) one or more nucleic acids can down-regulate the gene expression of CD3ε and / or the gene expression of an HLA molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, NLRRC5, CIITA, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain) and combinations thereof, and / or (d) one or more nucleic acids can down-regulate the gene expression of CD3γ and / or the gene expression of an HLA molecule selected from the group consisting of B2M, TAP1, TAP2, TAPBP, NLRRC5, CIITA, HLA-DM, RFX5, RFXANK, RFXAP, invariant chain (Ii chain) and combinations thereof, The method according to claim 17.

19. The method according to claim 17, wherein one or more nucleic acids can down-regulate the following gene expressions: (I) Any one of the following: (a) CD3ε, B2M and CIITA, (b) CD3ε, B2M and RFX5, (c) CD3ε, B2M and RFXAP, (d) CD3ε, B2M and RFXANK, (e) CD3ε, B2M and HLA-DM, (f) CD3ε, B2M and Ii chain, (g) CD3ε, TAP1 and CIITA, (h) CD3ε, TAP1 and RFX5, (i) CD3ε, TAP1 and RFXAP, (j) CD3ε, TAP1 and RFXANK, (k) CD3ε, TAP1 and HLA-DM, (l) CD3ε, TAP1 and Ii chain, (m) CD3ε, TAP2 and CIITA, (n) CD3ε, TAP2 and RFX5, (o) CD3ε, TAP2 and RFXAP, (p) CD3ε, TAP2 and RFXANK, (q) CD3ε, TAP2 and HLA-DM, (r) CD3ε, TAP2 and Ii chain, (s) CD3ε, NLRRC5 and CIITA, (t) CD3ε, NLRRC5 and RFX5, (u) CD3ε, NLRRC5 and RFXAP, (v) CD3ε, NLRC5, and RFXANK, (w) CD3ε, NLRC5, and HLA-DM, (x) CD3ε, NLRC5, and Ii chain, (y) CD3ε, TAPBP, and CII TA, (z) CD3ε, TAPBP, and RFX5, (aa) CD3ε, TAPBP, and RFXAP, (bb) CD3ε, TAPBP, and RFXANK, (cc) CD3ε, TAPBP, and HLA-DM, or (dd) CD3ε, TAPBP, and Ii chain, or, (II) Any one of the following: (a) CD3δ, B2M, and CII TA, (b) CD3δ, B2M, and RFX5, (c) CD3δ, B2M, and RFXAP, (d) CD3δ, B2M, and RFXANK, (e) CD3δ, B2M, and HLA-DM, (f) CD3δ, B2M, and Ii chain, (g) CD3δ, TAP1, and CII TA, (h) CD3δ, TAP1, and RFX5, (i) CD3δ, TAP1, and RFXAP, (j) CD3δ, TAP1, and RFXANK, (k) CD3δ, TAP1, and HLA-DM, (l) CD3δ, TAP1, and Ii chain, (m) CD3δ, TAP2, and CII TA, (n) CD3δ, TAP2, and RFX5, (o) CD3δ, TAP2, and RFXAP, (p) CD3δ, TAP2, and RFXANK, (q) CD3δ, TAP2, and HLA-DM, (r) CD3δ, TAP2, and Ii chain, (s) CD3δ, NLRC5, and CII TA, (t) CD3δ, NLRC5, and RFX5, (u) CD3δ, NLRC5, and RFXAP, (v) CD3δ, NLRC5, and RFXANK, (w) CD3δ, NLRC5, and HLA-DM, (x) CD3δ, NLRC5, and Ii chain, (y) CD3δ, TAPBP, and CII TA, (z) CD3δ, TAPBP, and RFX5, (aa) CD3δ, TAPBP, and RFXAP, (bb) CD3δ, TAPBP, and RFXANK, (cc) CD3δ, TAPBP, and HLA-DM, or (dd) CD3δ, TAPBP, and Ii chain, or, (III) Any one of the following: (a) CD3γ, B2M, and CII TA, (b) CD3γ, B2M, and RFX5, (c) CD3γ, B2M, and RFXAP, (d) CD3γ, B2M, and RFXANK, (e) CD3γ, B2M, and HLA-DM, (f) CD3γ, B2M, and Ii chain, (g) CD3γ, TAP1, and CII TA, (h) CD3γ, TAP1, and RFX5, (i) CD3γ, TAP1, and RFXAP, (j) CD3γ, TAP1, and RFXANK, (k) CD3γ, TAP1, and HLA-DM, (l) CD3γ, TAP1, and Ii chain, (m) CD3γ, TAP2, and CII TA, (n) CD3γ, TAP2, and RFX5, (o) CD3γ, TAP2, and RFXAP, (p) CD3γ, TAP2, and RFXANK, (q) CD3γ, TAP2, and HLA-DM, (r) CD3γ, TAP2, and Ii chain, (s) CD3γ, NLR C5, and CII TA, (t) CD3γ, NLR C5, and RFX5, (u) CD3γ, NLR C5, and RFXAP, (v) CD3γ, NLR C5, and RFXANK, (w) CD3γ, NLR C5, and HLA-DM, (x) CD3γ, NLR C5, and Ii chain, (y) CD3γ, TAPBP, and CII TA, (z) CD3γ, TAPBP, and RFX5, (aa) CD3γ, TAPBP, and RFXAP, (bb) CD3γ, TAPBP, and RFXANK, (cc) CD3γ, TAPBP, and HLA-DM, or (dd) CD3γ, TAPBP, and Ii chain.

20. (a) The immune cell is selected from the group consisting of T cells, natural killer cells (NK cells), natural killer T cells, lymphoid progenitor cells, hematopoietic stem cells, stem cells, macrophages, and dendritic cells, and / or, (b) The immune cell is a CD4-positive T cell or a CD8-positive T cell, and / or, (c) The immune cell is an allogeneic T cell or an autologous T cell. The method according to claim 17.

21. (a) The nucleic acid is introduced into the immune cell by viral transduction, which includes contacting the immune cell with a viral vector containing one or more nucleic acids, and / or, (b) The nucleic acid is introduced into the immune cell by viral transduction, which includes contacting the immune cell with a viral vector containing one or more nucleic acids, and further, the viral vector is selected from the group consisting of retroviral vectors, Sendai viral vectors, adenoviral vectors, adeno-associated viral vectors, and lentiviral vectors, and / or, (c) Each of the one or more nucleic acids capable of downregulating expression includes a gene editing system selected from the following group: (i) A CRISPR-associated (Cas) (CRISPR-Cas) endonuclease system and a guide RNA, (ii) A TALEN gene editing system, a zinc finger nuclease (ZFN) gene editing system, a meganuclease gene editing system, or a megaTALEN gene editing system, and, (iii) A gene silencing system selected from antisense RNA, antagomir RNA, RNAi, siRNA, or shRNA, The method according to claim 17.

22. (a) The Cas endonuclease includes Cas3, Cas4, Cas8a, Cas8b, Cas9, Cas10, Cas10d, Cas12a, Cas12b, Cas12d, Cas12e, Cas12f, Cas12g, Cas12h, Cas12i, Cas13, Cas14, CasX, Cse1, Csy1, Csn2, Cpf1, C2c1, Csm2, Cmr5, Fok1, S. pyogenes Cas9, Staphylococcus aureus Cas9, MAD7, or any combination thereof, and / or, (b) The CRISPR-Cas system includes a pAd5 / F35-CRISPR vector, and / or, (c) The guide RNA includes a guide sequence complementary to a sequence within one or more gene loci encoding an immune protein selected from the group consisting of CD3δ, CD3ε, CD3γ, B2M, CII TA, TAP1, TAP2, TAPBP, NLR C5, HLA-DM, RFX5, RFXANK, RFXAP, and invariant chain (Ii chain), and / or, (d) The guide RNA is complementary to (1) one or more exons of CD3δ, CD3ε, or CD3γ, or (2) a sequence within exon 1 of CD3δ, CD3ε, or CD3γ, and / or, (e) The sequence is within the CD3δ gene locus, and the guide RNA includes a nucleic acid sequence encoded by SEQ ID NO: 53, or, (f) The sequence is within the CD3ε gene locus, and the guide RNA includes a nucleic acid sequence encoded by SEQ ID NO: 52, or, (g) The sequence is within the CD3γ gene locus, and the guide RNA includes a nucleic acid sequence encoded by SEQ ID NO: 54, or, (h) The sequence is within the B2M gene locus, and the guide RNA includes a nucleic acid sequence encoded by SEQ ID NO: 55, or, (i) The sequence is within the CIITA locus, and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 61, or, (j) The sequence is within the TAP1 locus, and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 56, or, (k) The sequence is within the TAP2 locus, and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 57, or, (l) The sequence is within the TAPBP locus, and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 58, SEQ ID NO: 59, or a combination thereof, or, (m) The sequence is within the NLRC5 locus, and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 60, or, (n) The sequence is within the HLA-DM locus, and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 62, or, (o) The sequence is within the RFX5 locus, and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 63, SEQ ID NO: 64, or a combination thereof, or, (p) The sequence is within the RFXANK locus, and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 65, or, (q) The sequence is within the RFXAP locus, and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 66, or, (r) The sequence is within the Ii chain locus, and the guide RNA comprises a nucleic acid sequence encoded by SEQ ID NO: 67, SEQ ID NO: 68, or a combination thereof, The method according to claim 21.

23. (a) The immune cell exhibits a reduced immune response in a subject when administered to the subject, as compared to the immune response exerted by an unmodified immune cell administered to the same subject, and / or, (b) The immune cell exhibits a reduced immune response in a subject when administered to the subject, as compared to the immune response exerted by an immune cell comprising one or more nucleic acids capable of downregulating the gene expression of TRAC, B2M, and CIITA, and / or, (c) The immune cell exhibits a reduced immune response in a subject when administered to the subject, and the immune response is a graft-versus-host disease (GvHD) response, and / or, (d) When the immune cell is administered to a subject, the immune cell exhibits a reduced immune response in the subject, the immune response is a graft-versus-host disease (GvHD) response, and further, the reduction of the GvHD response is induced against HLA-I mismatched cells or HLA-II mismatched cells, and / or (e) When the immune cell is administered to a subject, the immune cell exhibits a reduced immune response in the subject, the immune response is a graft-versus-host disease (GvHD) response, and further, the GvHD response is as follows: (i) It is reduced by about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or about 95% or more, or (ii) The GvHD response is reduced by about 1-fold or more, about 2-fold or more, about 3-fold or more, about 4-fold or more, about 5-fold or more, about 6-fold or more, about 7-fold or more, about 8-fold or more, about 9-fold or more, about 10-fold or more, about 20-fold or more, about 30-fold or more, about 50-fold or more, about 100-fold or more, about 150-fold or more, or about 200-fold or more, and / or (f) When the immune cell is administered to a subject, the immune cell exhibits a reduced immune response in the subject, the immune response is a graft-versus-host disease (GvHD) response, and further, the reduced GvHD response by the modified immune cell is compared with equivalent immune cells that do not contain deletions and / or insertions at one or more loci, or immune cells that contain deletions and / or insertions in TRAC, B2M, and CIIITA. The method according to claim 17.

24. (a) The exogenous nucleic acid encodes a chimeric antigen receptor (CAR), and the CAR includes an antigen-binding domain, a hinge domain, a transmembrane domain, a co-stimulatory signaling domain, and an intracellular signaling domain, and / or (b) The exogenous nucleic acid encodes a chimeric antigen receptor (CAR), the CAR includes an antigen-binding domain, a hinge domain, a transmembrane domain, a co-stimulatory signaling domain, and an intracellular signaling domain, and further, the antigen-binding domain targeting a tumor antigen is as follows: (i) Related to hematological malignancies, (ii) Related to solid tumors, and / or (iii) selected from the group consisting of ROR1, mesothelin, c-Met, PSMA, PSCA, folate receptor alpha, folate receptor beta, EGFR, EGFRvIII, GPC2, GPC2, mucin 1 (MUC1), Tn antigen ((TnAg) or (GalNAca-Ser / Thr)), TnMUC1, GDNF family receptor alpha 4 (GFRa4), fibroblast activation protein (FAP), and interleukin-13 receptor subunit alpha 2 (IL-13Ra2 or CD213A2), and / or (c) the exogenous nucleic acid encodes a chimeric antigen receptor (CAR), the CAR includes an antigen-binding domain, a hinge domain, a transmembrane domain, a co-stimulatory signaling domain, and an intracellular signaling domain, and further the CAR includes the following: (i) a PSMA antigen-binding domain, a CD2 co-stimulatory domain, and a CD3 zeta intracellular signaling domain, (ii) a mesothelin antigen-binding domain, a 4-1BB co-stimulatory domain, and a CD3 zeta signaling domain, or, (iii) a TnMUC1 antigen-binding domain, a CD2 co-stimulatory domain, and a CD3 zeta signaling domain, and / or (d) the switch receptor includes the following: (i) an extracellular domain of a signaling protein associated with a negative signal, selected from the group consisting of CTLA4, PD-1, VISG3, VSIG8, TGFβRII, BTLA, and TIM-3, (ii) a transmembrane domain, and, (iii) an intracellular domain of a signaling protein associated with a positive signal, selected from the group consisting of CD28, 4-1BB, IL12Rβ1, IL12Rβ2, CD2, ICOS, and CD27, and / or (e) the dominant negative receptor includes the following: (i) a truncated variant of a wild-type protein associated with a negative signal, (ii) a variant of a wild-type protein associated with a negative signal, including an extracellular domain and a transmembrane domain, and substantially lacking an intracellular signaling domain, or, (iii) an extracellular domain and a transmembrane domain of a signaling protein associated with a negative signal, and / or (f) The switch receptor is selected from the group consisting of PD-1-CD28, PD-1 A132L -CD28, PD-1-CD27, PD-1 A132L -CD27, PD-1-4-1BB, PD-1 A132L -4-1BB, PD-1-ICOS, PD-1 A132L -ICOS, PD-1-IL12Rβ1, PD-1 A132L -IL12Rβ1, PD-1-IL12Rβ2, PD-1 A132L -IL12Rβ2, VSIG3-CD28, VSIG8-CD28, VSIG3-CD27, VSIG8-CD27, VSIG3-4-1BB, VSIG8-4-1BB, VSIG3-ICOS, VSIG8-ICOS, VSIG3-IL12Rβ1, VSIG8-IL12Rβ1, VSIG3-IL12Rβ2, VSIG8-IL12Rβ2, TGFβRII-CD27, TGFβRII-CD28, TGFβRII-4-1BB, TGFβRII-ICOS, TGFβRII-IL12Rβ1 and TGFβRII-IL12Rβ2, and / or (g) the dominant negative receptor is a PD1, VSIG3, VISG8, or TGFβR dominant negative receptor, and / or (h) the transmembrane domain is as follows: (i) selected from the transmembrane domains of proteins selected from the group consisting of CTLA4, PD-1, BTLA, TGFβRII, BTLA, TIM-3, CD28, 4-1BB, IL12Rβ1, IL12Rβ2, CD2, ICOS and CD27 (ii) selected from the transmembrane portion of the protein associated with the negative signal or the transmembrane domain of the protein associated with the negative signal The method according to claim 17.

25. (a) The proliferation of the modified immune cells includes the step of culturing T cells with a factor selected from the group consisting of flt3-L, IL-1, IL-3, IL-2, IL-7, IL-15, IL-18, IL-21, TGF beta, IL-10 and c-kit ligand, and / or (b) further comprising the step of introducing a polypeptide and / or nucleic acid encoding Klf4, Oct3 / 4 and Sox2 into the immune cells to induce pluripotency of the immune cells, and / or (c) the immune cells are obtained from a blood sample, a whole blood sample, a peripheral blood mononuclear cell (PBMC) sample or an apheresis sample, and / or (d) the immune cells are obtained from an apheresis sample, and further the apheresis sample is a cryopreserved sample, and / or (e) the immune cells are obtained from an apheresis sample, and further the apheresis sample is a fresh sample, and / or (f) the immune cells are obtained from a human subject The method according to claim 17.

26. A population of modified immune cells obtained from the method according to claim 17.

27. A composition comprising the modified immune cells according to claim 1, the modified T cells according to claim 15, or the population of modified immune cells according to claim 26, and a pharmaceutically acceptable carrier or excipient.

28. A method of treating a disease or condition associated with immune enhancement in a subject, comprising administering an effective amount of the composition according to claim 27 to a subject in need thereof.

29. (a) the condition is cancer, and / or (b) the condition is cancer, and further the cancer is selected from the group consisting of breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer and any combination thereof, and / or (c) the condition is cancer, and the cancer is a solid tumor or a hematological malignancy The method according to claim 28.

30. A method for treating cancer, comprising administering to a subject a modified immune cell according to claim 1 or a modified T cell according to claim 15, a population of modified immune cells according to claim 26, or a composition comprising a modified immune cell according to claim 1 or a modified T cell according to claim 15, a population of modified immune cells according to claim 26, and a pharmaceutically acceptable carrier or excipient.

31. The method according to claim 30, wherein the cancer is a solid tumor or a hematological malignancy.

32. A method for stimulating a T cell-mediated immune response against target cells or tissues in a subject, comprising administering to the subject an effective amount of a pharmaceutical composition comprising a modified immune cell according to claim 1 or a modified T cell according to claim 15, a population of modified immune cells according to claim 26, or a composition comprising a modified immune cell according to claim 1 or a modified T cell according to claim 15, a population of modified immune cells according to claim 26, and a pharmaceutically acceptable carrier or excipient.

33. A kit comprising a modified immune cell according to claim 1 or a modified T cell according to claim 15, a population of modified immune cells according to claim 26, or a composition comprising a modified immune cell according to claim 1 or a modified T cell according to claim 15, a population of modified immune cells according to claim 26, and a pharmaceutically acceptable carrier or excipient, optionally including instructions for use.