Enzymes containing RUVC domains
Patent Information
- Application Number
- JP2024502432
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2022-07-29
- Filing Date
- 2022-08-29
- Publication Date
- 2025-09-05
AI Technical Summary
Current CRISPR/Cas systems, particularly Cas9, exhibit high immunogenicity and limited specificity, posing challenges in gene editing applications, especially in human cells.
Development of engineered RNA-guided class 2, type II Cas endonucleases with modified RuvCIII and HNH domains, combined with engineered guide RNAs, to enhance specificity and reduce immunogenicity, targeting specific genomic loci with high sequence identity.
The engineered systems demonstrate improved specificity and reduced immunogenicity, enabling precise editing of various genomic loci in human cells, including B2M, TRAC, HPRT, TRBC1/2, HAO1, CD2, CD5, FAS, PD-1, hRosa26, TRAC, AAVS1, HAO-1, GPR146, and GPR146 loci, with high sequence identity and reduced antibody response.
Abstract
Description
[Technical field]
[0001] Related Applications This application is related to PCT Application No. PCT / US21 / 31136, which is incorporated herein by reference in its entirety.
[0002] cross reference This application claims the benefit of U.S. Provisional Patent Application No. 63 / 237,791, filed August 27, 2021, No. 63 / 245,629, filed September 17, 2021, No. 63 / 252,956, filed October 6, 2021, No. 63 / 282,909, filed November 24, 2021, No. 63 / 316,895, filed March 4, 2022, No. 63 / 319,681, filed March 14, 2022, No. 63 / 322,944, filed March 23, 2022, and No. 63 / 369,858, filed July 29, 2022, each of which is incorporated by reference herein in its entirety. [Background technology]
[0003] Cas enzymes, along with their associated clustered regularly interspaced short palindromic repeats (CRISPR)-guided ribonucleic acid (RNA), appear to be widespread components of the immune system of prokaryotes (about 45% of bacteria and about 84% of archaea), helping to protect these microorganisms from non-self nucleic acids, such as infectious viruses and plasmids, by CRISPR-RNA-guided nucleic acid cleavage. While deoxyribonucleic acid (DNA) elements encoding CRISPR RNA elements may be relatively conserved in structure and length, their CRISPR-associated (Cas) proteins are highly diverse and contain a wide variety of nucleic acid-interacting domains. Although CRISPR DNA elements have been observed as early as 1987, the programmable endonuclease cleavage capabilities of CRISPR / Cas complexes have only been recognized relatively recently, leading to the use of recombinant CRISPR / Cas systems in a variety of DNA engineering and gene editing applications.
[0004] Sequence Listing This application contains a Sequence Listing that has been submitted electronically in XML format, and is incorporated by reference in its entirety. The XML copy created on August 26, 2022 is named 55921-731_601_SL.xml and is 23,191,225 bytes in size. Summary of the Invention
[0005] In some aspects, the disclosure provides a method of disrupting a beta-2-microglobulin (B2M) locus in a cell, the method comprising contacting the cell with (a) an RNA-guided endonuclease and (b) an engineered guide RNA, the engineered guide RNA being configured to form a complex with the endonuclease and comprising a spacer sequence configured to hybridize to a region of the B2M locus, the region of the B2M locus comprising a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6387-6468. In some embodiments, the RNA-guided endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO:2242 or SEQ ID NO:2244. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs:6305-6386. In some embodiments, the region of the B2M locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 non-degenerate nucleotides of any one of SEQ ID NOs: 6388, 6399, 6401, 6403, 6410, 6413, 6421, 6446, and 6448.
[0006] In some aspects, the disclosure provides a method of editing a T cell receptor alpha constant (TRAC) locus in a cell, the method comprising contacting the cell with (a) an RNA-guided endonuclease and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the TRAC locus, the region of the TRAC locus comprising a targeting sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6509-6548 or 6805. In some embodiments, the RNA-guided endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 6469-6508 or 6804.In some embodiments, the region of the TRAC locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 non-degenerate nucleotides of any one of SEQ ID NOs: 6517, 6520, and 6523.
[0007] In some aspects, the disclosure provides a method of disrupting a hypoxanthine phosphoribosyltransferase 1 (HPRT) locus in a cell, the method comprising contacting the cell with (a) an RNA-guided endonuclease and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the HPRT locus, the region of the HPRT locus comprising a targeting sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6616-6682. In some embodiments, the RNA-guided endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO:2242 or SEQ ID NO:2244. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs:6549-6615. In some embodiments, the region of the HPRT locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs:6619, 6634, 6673, 6675, and 6679.
[0008] In some aspects, the disclosure provides a method of editing a T cell receptor beta constant 1 or T cell receptor beta constant 2 (TRBC1 / 2) locus in a cell, the method comprising contacting the cell with (a) an RNA-guided endonuclease and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the TRBC1 / 2 locus, the region of the TRBC1 / 2 locus comprising a targeting sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6722-6760 or 6782-6802. In some embodiments, the RNA-guided endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO:2242 or SEQ ID NO:2244. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the engineered guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs:6683-6721 and 6761-6781. In some embodiments, the region of the TRBC1 / 2 locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 non-degenerate nucleotides of any one of SEQ ID NOs: 6734, 6753, 6790, and 6800.
[0009] In some aspects, the disclosure provides a method of editing a hydroxyacid oxidase 1 (HAO1) locus in a cell, the method comprising contacting the cell with (a) an RNA-guided endonuclease and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the HAO1 locus, the region of the HAO1 locus comprising a targeting sequence having about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 11802-11820. In some embodiments, the RNA-guided endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2242. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, a region of the HAO1 locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 of the non-degenerate nucleotides of any one of SEQ ID NOs: 11806, 11813, 11816, and 11819.
[0010] In some aspects, the disclosure provides an engineered nuclease system comprising: (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, the engineered guide RNA comprising: (i) 2'-O-methyl nucleotides, (ii) 2'-fluoro nucleotides, or (iii) a phosphorothioate linkage, wherein the RNA-guided endonuclease has at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 421-431 or a variant thereof. In some embodiments, the RNA-guided endonuclease comprises a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO:421.
[0011] In some aspects, the disclosure provides an engineered nuclease system comprising: (a) an endonuclease having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity with any one of SEQ ID NOs: 421-431 or variants thereof; and (b) an engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a target nucleic acid sequence, the system having reduced immunogenicity when administered to a human subject compared to a comparable system comprising a Cas9 enzyme. In some embodiments, the Cas9 enzyme is a SpCas9 enzyme. In some embodiments, the immunogenicity is antibody immunogenicity. In some embodiments, the engineered guide RNA comprises a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of any one of SEQ ID NOs: 5466-5467 and 11160-11162. In some embodiments, the engineered nuclease has at least about 75% sequence identity at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 421 or 423 or a variant thereof.
[0012] In some aspects, the disclosure provides a method of editing a locus in a cell, the method comprising contacting a cell with (a) an RNA-guided endonuclease or a nucleic acid encoding the RNA-guided endonuclease, (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the RNA-guided endonuclease and configured to hybridize to a region of the locus, the cell being a peripheral blood mononuclear cell (PBMC), a hematopoietic stem cell (HSC), or an induced pluripotent stem cell (iPSC). In some embodiments, the RNA-guided endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2242, or a variant thereof. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the RNA-guided endonuclease has at least about 75% sequence identity at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 421 or a variant thereof. In some embodiments, the engineered guide RNA comprises a sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 6804, 6806, and 6808.In some embodiments, the engineered guide RNA comprises a sequence that comprises at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 6803, or a variant thereof. In some embodiments, a region of the locus comprises a sequence that has at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to at least 18 nucleotides of any one of SEQ ID NOs: 6805, 6807, and 6809.
[0013] In some aspects, the disclosure provides a method of editing a CD2 molecule (CD2) locus in a cell, the method comprising contacting a cell with (a) an RNA-guided endonuclease and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the CD2 locus, wherein the engineered guide RNA hybridizes to at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, or at least about 97% of any one of SEQ ID NOs: 6853-6894. The guide RNA comprises or is configured or engineered to hybridize to a sequence having at least 18-22 contiguous nucleotides that are complementary to a sequence having at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a non-degenerate nucleotide of any one of SEQ ID NOs: 6811-6852. In some embodiments, the RNA-guided endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO:2242 or SEQ ID NO:2244, or a variant thereof. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain.In some embodiments, the RNA-guided endonuclease comprises a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 421-431. In some embodiments, the RNA-guided endonuclease comprises a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 421, or a variant thereof. In some embodiments, the engineered guide RNA comprises a sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to the non-degenerate nucleotides of any one of SEQ ID NOs: 6813, 6841, 6843-6847, 6852, or 6852. In some embodiments, the engineered guide RNA further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 6A. In some embodiments, the engineered guide RNA comprises or is configured to hybridize to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6855, 6883, 6885-6889, 6892, or 6984.
[0014] In some aspects, the disclosure provides an isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 6811-6852. In some embodiments, the RNA molecule further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 6A.
[0015] In some aspects, the disclosure provides a method of editing a CD5 molecule (CD5) locus, the method comprising contacting a cell with (a) an RNA-guided endonuclease and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the CD5 locus, wherein the engineered guide RNA is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100%, at least about 101%, at least about 102%, at least about 103%, at least about 104%, at least about 105%, at least about 106%, at least about 107%, at least about 108%, at least about 109%, at least about 200%, at least about 201%, at least about 202%, at least about 203%, at least about 204%, at least about 205%, at least about 206%, at least about 207, at least about 208, at least about 209, at least about 300, at least about 301, at least about 302, at least about 303, at least about 304, at least about 305, at least about 306, at least about 307, at least about 308, at least about 309 ... The guide RNA comprises or is configured or engineered to hybridize to a sequence having at least 18-22 contiguous nucleotides that are complementary to a sequence having 7%, at least about 98%, at least about 99%, or 100% sequence identity, comprising a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of any one of SEQ ID NOs: 5466 or 6895-6958. In some embodiments, the RNA-guided endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO:2242 or SEQ ID NO:2244, or a variant thereof. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain.In some embodiments, the RNA-guided endonuclease comprises an endonuclease comprising a sequence having at least 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 421-431 or variants thereof. In some embodiments, the RNA-guided endonuclease comprises a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 421. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO:5466. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of any one of SEQ ID NOs: 6897, 6904, 6906, 6911, 6928, 6930, 6932, 6934, 6938, 6945, 6950, 6952, and 6958. In some embodiments, the engineered guide RNA further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 7A.In some embodiments, the engineered guide RNA is configured to hybridize to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6961, 6968, 6970, 6975, 6992, 6994, 6996, 6998, 7002, 7009, 7014, 7016, and 7022.
[0016] In some aspects, the disclosure provides an isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 6895-6958. In some embodiments, the RNA molecule further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 7A.
[0017] In some aspects, the disclosure provides a method of editing an RNA locus in a cell, the method comprising contacting a cell with (a) an RNA-guided endonuclease comprising a sequence having at least 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO:2242 or SEQ ID NO:2244, or a variant thereof, and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the RNA locus, wherein the RNA locus does not comprise bacterial or microbial RNA. In some embodiments, the guide RNA comprises a sequence having at least 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO:5466 or SEQ ID NO:5539.
[0018] In some aspects, the disclosure provides a method of disrupting a Fas cell surface death receptor (FAS) locus in a cell, the method comprising: introducing into the cell (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the human FAS locus, wherein the engineered guide RNA has a hybridization affinity of at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100%, at least about 101%, at least about 102%, at least about 103%, at least about 104%, at least about 105%, at least about 106%, at least about 107%, at least about 108%, at least about 109%, at least about 200%, at least about 201%, at least about 202%, at least about 203%, at least about 204%, at least about 205%, at least about 206%, at least about 207, at least about 208, at least about 209. The guide RNA comprises or is configured or engineered to hybridize to a sequence having at least 18-22 contiguous nucleotides that are complementary to a sequence having at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity, comprising a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7023-7056. In some embodiments, the RNA-guided endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2242, or a variant thereof. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain.In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466. In some embodiments, the engineered guide RNA comprises or is configured to hybridize to a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 7059, 7061, 7069, 7070, 7076, 7080, 7083, 7084, 7085, or 7088. In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NO: 421, or a variant thereof. In some embodiments, the guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 7025, 7027, 7035, 7036, 7042, 7046, 7049-7051, or 7054. In some embodiments, the guide RNA further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 8.
[0019] In some aspects, the disclosure provides an isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7023-7056. In some embodiments, the RNA molecule further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 8.
[0020] In some aspects, the disclosure provides a method of disrupting a programmed cell death 1 (PD-1) locus in a cell, the method comprising: introducing into the cell (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the human PD-1 locus, wherein the engineered guide RNA has a hybridization affinity of at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100%, at least about 101%, at least about 102%, at least about 103%, at least about 104%, at least about 105%, at least about 106%, at least about 107%, at least about 108%, at least about 109%, at least about 200%, at least about 201%, at least about 202%, at least about 203. The guide RNA comprises or is configured or engineered to hybridize to a sequence having at least 18-22 contiguous nucleotides that are complementary to a sequence having about 97%, at least about 98%, at least about 99%, or 100% sequence identity, comprising a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7091-7128. In some embodiments, the RNA-guided endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2242, or a variant thereof. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain.In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466. In some embodiments, the engineered guide RNA comprises or is configured to hybridize to a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 7135, 7137, 7146, 7149, 7152, 7156, 7160, 7161, 7164, 7165, or 7166. In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NO: 421, or a variant thereof. In some embodiments, the guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 7097, 7099, 7108, 7111, 7114, 7118, 7122, 7123, 7126, 7127, or 7128. In some embodiments, the guide RNA further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 9.
[0021] In some aspects, the disclosure provides an isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7091-7128. In some embodiments, the RNA molecule further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 9.
[0022] In some aspects, the disclosure provides a method of disrupting the human Rosa26 (hRosa26) locus in a cell, the method comprising: introducing into the cell (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the hRosa26 locus, wherein the engineered guide RNA is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, or at least about 100% identical to any one of SEQ ID NOs: 7199-7230. The guide RNA comprises or is configured or engineered to hybridize to a sequence having at least 18-22 contiguous nucleotides that are complementary to a sequence having at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7167-7198. In some embodiments, the RNA-guided endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2242, or a variant thereof. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain.In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466. In some embodiments, the engineered guide RNA comprises or is configured to hybridize to a sequence having at least 80% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 7205-7206, 7215, 7220, 7223, or 7225. In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NO: 421, or a variant thereof. In some embodiments, the guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 7173, 7174, 7183, 7188, 7191, or 7193. In some embodiments, the guide RNA further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 10.
[0023] In some aspects, the disclosure provides an isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7167-7198. In some embodiments, the RNA molecule further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 10.
[0024] In some aspects, the disclosure provides a method of disrupting a T cell receptor alpha constant (TRAC) locus in a cell, the method comprising: introducing into the cell (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the TRAC locus, wherein the engineered guide RNA has a sequence similar to or similar to any one of SEQ ID NOs: 7235-7238, 7248-7256, 7270, or 7278-7284, wherein the engineered guide RNA is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, The guide RNA comprises or is configured or engineered to hybridize to a sequence having at least 18-22 contiguous nucleotides that are complementary to a sequence having at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity, comprising a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7231-7234, 7239-7247, 7269, or 7271-7277. In some embodiments, the RNA-guided endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NOs: 1512, 1756, 11711-11713, or a variant thereof.In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5473, 5475, 11145, 11714, or 11715. In some embodiments, the engineered guide RNA comprises or is configured to hybridize to a sequence having at least 80% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 7235-7238, 7248-7256, 7270, or 7278-7284. In some embodiments, the guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 7231-7234, 7239-7244, 7269, or 7271-7277. In some embodiments, the engineered guide RNA further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 11.
[0025] In some aspects, the disclosure provides an isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7231-7234, 7239-7247, 7269, or 7271-7277. In some embodiments, the RNA molecule further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 11.
[0026] In some aspects, the disclosure provides a method of disrupting an adeno-associated virus integration site 1 (AAVS1) locus in a cell, the method comprising: introducing into the cell (a) a class 2, type II Cas endonuclease; and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the AAVS1 locus, wherein the engineered guide RNA is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100%, at least about 101%, at least about 102%, at least about 103%, at least about 104%, at least about 105%, at least about 106%, at least about 107%, at least about 108%, at least about 109%, at least about 110%, at least about 111%, at least about 112%, at least about 113%, at least about 114%, at least about 115%, at least about 116%, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138 The guide RNA comprises or is configured or engineered to hybridize to a sequence having at least 18-22 contiguous nucleotides complementary to a sequence having at least about 99% or 100% sequence identity to any one of SEQ ID NOs: 7257-7260 or 7265-7266. The guide RNA comprises a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7257-7260 or 7265-7266. In some embodiments, the RNA-guided endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NOs: 1756 or 11711, or a variant thereof.In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5475 or 11715. In some embodiments, the engineered guide RNA comprises or is configured to hybridize to a sequence having at least 80% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 7261-7263 or 7267-7268. In some embodiments, the guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 7257-7260 or 7265-7266. In some embodiments, the engineered guide RNA further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 12.
[0027] In some aspects, the disclosure provides an isolated RNA molecule comprising a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 7257-7260 or 7265-7266. In some embodiments, the RNA molecule further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 12.
[0028] In some aspects, the disclosure provides a method of disrupting a hydroxyacid oxidase 1 (HAO-1) locus in a cell, the method comprising introducing into the cell (a) an RNA-guided endonuclease, and (b) an engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the HAO-1 locus, wherein the engineered guide RNA comprises or is configured to hybridize to a sequence having at least 18-22 contiguous nucleotides that are complementary to a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11773-11793. In some embodiments, the RNA-guided endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2242, or a variant thereof. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO:5466.In some embodiments, the engineered guide RNA comprises or is configured to hybridize to a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 11773, 11780, 11786, or 11787. In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NO: 421, or a variant thereof.
[0029] In some embodiments, the present disclosure provides an isolated RNA molecule comprising a spacer sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11773-11793, and a scaffold sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO:5466.
[0030] In some aspects, the disclosure provides a method of disrupting a human G protein-coupled receptor 146 (GPR146) locus in a cell, the method comprising: introducing into the cell (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the GPR146 locus, wherein the engineered guide RNA has a sequence identity at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100%, at least about 101%, at least about 102%, at least about 103%, at least about 104%, at least about 105%, at least about 106%, at least about 107%, at least about 108%, at least about 109%, at least about 200%, at least about 201%, at least about 202%, at least about 203%, at least about 204%, at least about 205%, at least about 206%, at least about 207%, at least about 208%, at least about 209%, at least about 210%, at least about 211%, at least about 212%, at least about 213%, at least about 214%, at least about 215%, at least about 216%, at least about 217%, at least about 218%, at least about 219%, at least about 220%, at least about 225%, at least about 226%, at least about 227%, at least about 228%, at least about 229%, at least about 230%, at least about 231%, at least about The guide RNA comprises or is configured or engineered to hybridize to a sequence having at least 18-22 contiguous nucleotides that are complementary to a sequence having 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity, comprising a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11374-11405. In some embodiments, the RNA-guided endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2242, or a variant thereof. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain.In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO:5466. In some embodiments, the engineered guide RNA comprises or is configured to hybridize to a sequence having at least 80% identity to at least 18 consecutive nucleotides of SEQ ID NO:11425. In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NO:421, or a variant thereof. In some embodiments, the guide RNA comprises a sequence having at least 80% identity to SEQ ID NO:11393. In some embodiments, the engineered guide RNA further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 15.
[0031] In some aspects, the disclosure provides an isolated RNA molecule comprising a spacer sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11374-11405. In some embodiments, the RNA molecule further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 15.
[0032] In some aspects, the disclosure provides a method of disrupting a mouse G protein-coupled receptor 146 (GPR146) locus in a cell, the method comprising: introducing into the cell (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the GPR146 locus, wherein the engineered guide RNA has a sequence identity at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100%, at least about 101%, at least about 102%, at least about 103%, at least about 104%, at least about 105%, at least about 106%, at least about 107%, at least about 108%, at least about 109%, at least about 200%, at least about 201%, at least about 202%, at least about 203%, at least about 204%, at least about 205%, at least about 206%, at least about 207, at least about 208, at least about 209, at least about 300, at least about 301, at least about 302, at least about 303, at least about 304, at least about 305, at least about 306, at least about 307, at least about 308, at least about 309, at least about 309, at least about 310, at least about 311, at least about 312, at least about 313, at least about 314. The guide RNA comprises or is configured or engineered to hybridize to a sequence having at least 18-22 contiguous nucleotides that are complementary to a sequence having about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity, comprising a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11438-11472. In some embodiments, the RNA-guided endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to SEQ ID NO: 2242, or a variant thereof. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain.In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 5466. In some embodiments, the engineered guide RNA comprises or is configured to hybridize to a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 11482, 11488, or 11490. In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NO: 421, or a variant thereof. In some embodiments, the guide RNA comprises a sequence having at least 80% identity to SEQ ID NO: 11447, 11453, or 11455. In some embodiments, the engineered guide RNA further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 16.
[0033] In some aspects, the disclosure provides an isolated RNA molecule comprising a spacer sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11438-11472. In some embodiments, the RNA molecule further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 16.
[0034] In some aspects, the disclosure provides a method of disrupting a T cell receptor alpha constant (TRAC) locus in a cell, the method comprising: introducing into the cell (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the TRAC locus, wherein the engineered guide RNA is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100%, at least about 101%, at least about 102%, at least about 103%, at least about 104%, at least about 105%, at least about 106%, at least about 107%, at least about 108%, at least about 109%, at least about 200%, at least about 201%, at least about 202%, at least about 203%, at least about 204%, at least about 205%, at least about 206%, at least about 207, at least about 208, at least about 209, at least about 210, at least about 211, at least about 212, at least about 213, at least about 214, at least about 215, at least about 216, at least about 217, at least about 218, at least about 219, at least about 220, at least about 221, at least about 222, at least about 223, at least about 224, at least about 225, at least about 226, at least about 227, at least about 228, at least about 229, at least The guide RNA comprises or is configured or engineered to hybridize to a sequence having at least 18-22 contiguous nucleotides that are complementary to a sequence having at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity, comprising a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11514-11515. In some embodiments, the RNA-guided endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 11153. In some embodiments, the engineered guide RNA comprises or is configured to hybridize to a sequence having at least 80% identity to at least 18 consecutive nucleotides of any one of SEQ ID NO: 11516.In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NO: 11716, or a variant thereof. In some embodiments, the guide RNA comprises a sequence having at least 80% identity to SEQ ID NO: 11514. In some embodiments, the engineered guide RNA further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 17.
[0035] In some aspects, the disclosure provides an isolated RNA molecule comprising a spacer sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11514-11515. In some embodiments, the RNA molecule further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 17.
[0036] In some aspects, the disclosure provides a method of disrupting an adeno-associated virus integration site 1 (AAVS1) locus in a cell, the method comprising: introducing into the cell (a) an RNA-guided endonuclease; and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the AAVS1 locus, wherein the engineered guide RNA has a hybridization affinity of at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100%, at least about 101%, at least about 102%, at least about 103%, at least about 104%, at least about 105%, at least about 106%, at least about 107%, at least about 108%, at least about 109%, at least about 200%, at least about 201%, at least about 202%, at least about 203%, at least about 204%, at least about 205%, at least about 206%, at least about 207, at least about 208, at least about 209, at least about 300, at least about 301, at least about 302, at least about 303, at least about 304, at least about 305, at least about 306, at least about 307, at least about 308, at least about 309 ... The guide RNA comprises or is configured or engineered to hybridize to a sequence having at least 18-22 contiguous nucleotides that are complementary to a sequence having 5%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity, comprising a nucleotide sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11508-11510. In some embodiments, the RNA-guided endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 11717. In some embodiments, the engineered guide RNA comprises or is configured to hybridize to a sequence having at least 80% identity to at least 18 contiguous nucleotides of SEQ ID NO: 11511.In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NO: 914, or a variant thereof. In some embodiments, the guide RNA comprises a sequence having at least 80% identity to SEQ ID NO: 11508. In some embodiments, the engineered guide RNA further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 17.
[0037] In some aspects, the disclosure provides an isolated RNA molecule comprising a spacer sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any one of SEQ ID NOs: 11508-11510. In some embodiments, the RNA molecule further comprises a pattern of nucleotide modifications listed in any of the guide RNAs listed in Table 17.
[0038] In some aspects, the disclosure provides an engineered nuclease system comprising: (a) an endonuclease having at least about 80%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to a PI domain of any of the Cas effector protein sequences described herein, or a variant thereof; and (b) an engineered guide RNA, and an engineered guide RNA comprising a spacer sequence configured to form a complex with an endonuclease and configured to hybridize to a target nucleic acid sequence, wherein the engineered guide RNA comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the non-degenerate nucleotides of any of the sgRNA sequences described herein. In some embodiments, the engineered nuclease system further comprises a RuvCIII or HNH domain having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to the RuvCIII or HNH domain of any of the Cas effector nucleases described herein. In some embodiments, the endonuclease is configured to have selectivity for any of the PAM sequences described herein.In some embodiments, the endonuclease further comprises a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% sequence identity to any of the Cas effector sequences described herein.
[0039] In some aspects, the disclosure provides for the use of any of the methods described herein to disrupt the B2M locus in a cell.
[0040] In some aspects, the disclosure provides for the use of any of the methods described herein, or any of the RNA molecules described herein, to disrupt the TRAC locus in a cell.
[0041] In some aspects, the disclosure provides for the use of any of the methods described herein to disrupt the HPRT locus in a cell.
[0042] In some aspects, the disclosure provides for the use of any of the methods described herein to disrupt the TRBC1 / 2 locus in a cell.
[0043] In some aspects, the disclosure provides for the use of any of the methods described herein, or any of the RNA molecules described herein, to disrupt the HAO-1 locus in a cell.
[0044] In some aspects, the disclosure provides for the use of any of the methods described herein, or any of the RNA molecules described herein, to disrupt the CD2 locus in a cell.
[0045] In some aspects, the disclosure provides for the use of any of the methods described herein, or any of the RNA molecules described herein, to disrupt the CD5 locus in a cell.
[0046] In some aspects, the disclosure provides for the use of any of the methods described herein, or any of the RNA molecules described herein, to disrupt the FAS locus in a cell.
[0047] In some aspects, the disclosure provides for the use of any of the methods described herein, or any of the RNA molecules described herein, to disrupt the PD-1 locus in a cell.
[0048] In some aspects, the disclosure provides for the use of any of the methods described herein, or any of the RNA molecules described herein, to disrupt the hRosa26 locus in a cell.
[0049] In some aspects, the disclosure provides the use of any of the methods described herein, or any of the RNA molecules described herein, for disrupting the AAVS1 locus in a cell.
[0050] In some aspects, the disclosure provides the use of any of the methods described herein, or any of the RNA molecules described herein, for disrupting the GPR146 locus in a cell.
[0051] In some aspects, the disclosure provides an engineered nuclease system comprising: (a) an endonuclease comprising a RuvC_III domain and an HNH domain, the endonuclease being derived from an uncultured microorganism and being a class 2, type II Cas endonuclease; and (b) an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease, the engineered guide ribonucleic acid structure comprising (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence, and (ii) a tracr ribonucleic acid sequence configured to bind to the endonuclease. In some embodiments, the RuvC_III domain comprises a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, or at least 98% sequence identity to any one of SEQ ID NOs: 1827-3637.
[0052] In some aspects, the disclosure provides an engineered nuclease system comprising: (a) an endonuclease comprising a RuvC_III domain having at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, or at least 98% sequence identity to any one of SEQ ID NOs: 1827-3637; and (b) an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease, the engineered guide ribonucleic acid structure comprising (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence, and (ii) a tracr ribonucleic acid sequence configured to bind to the endonuclease.
[0053] In some aspects, the disclosure provides an engineered nuclease system comprising: (a) an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising SEQ ID NOs: 5512-5537, the endonuclease being a Class 2, Type II Cas endonuclease; and (b) an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease, the engineered guide ribonucleic acid structure comprising (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence, and (ii) a tracr ribonucleic acid sequence configured to bind to the endonuclease.
[0054] In some embodiments, the endonuclease is from an uncultured microorganism. In some embodiments, the endonuclease is not engineered to bind to a different PAM sequence. In some embodiments, the endonuclease is not a Cas9 endonuclease, a Cas14 endonuclease, a Cas12a endonuclease, a Cas12b endonuclease, a Cas12c endonuclease, a Cas12d endonuclease, a Cas12e endonuclease, a Cas13a endonuclease, a Cas13b endonuclease, a Cas13c endonuclease, or a Cas13d endonuclease. In some embodiments, the endonuclease has less than 80% identity with a Cas9 endonuclease. In some embodiments, the endonuclease further comprises an HNH domain. In some embodiments, the tracr ribonucleic acid sequence comprises a sequence having at least 80% sequence identity to about 60-90 contiguous nucleotides selected from any one of SEQ ID NOs: 5476-5511 and 5538.
[0055] In some aspects, the disclosure provides an engineered nuclease system comprising: (a) an engineered guide ribonucleic acid structure comprising (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence, and (ii) a tracr ribonucleic acid sequence configured to bind to an endonuclease, the tracr ribonucleic acid sequence comprising a sequence having at least 80% sequence identity to about 60-90 contiguous nucleotides selected from any one of SEQ ID NOs: 5476-5511 and 5538; and (b) a class 2, type II Cas endonuclease configured to bind to the engineered guide ribonucleic acid. In some embodiments, the endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence selected from the group consisting of SEQ ID NOs: 5512-5537.
[0056] In some embodiments, the engineered guide ribonucleic acid structure comprises at least two ribonucleic acid polynucleotides, in some embodiments, the engineered guide nucleic acid structure comprises one ribonucleic acid polynucleotide comprising a guide ribonucleic acid sequence and a tracr ribonucleic acid sequence.
[0057] In some embodiments, the guide ribonucleic acid sequence is complementary to a prokaryotic, bacterial, archaeal, eukaryotic, fungal, plant, mammalian, or human genomic sequence. In some embodiments, the guide ribonucleic acid sequence is 15-24 nucleotides in length. In some embodiments, the endonuclease comprises one or more nuclear localization sequences (NLS) proximal to the N-terminus or C-terminus of the endonuclease. In some embodiments, the NLS comprises a sequence selected from SEQ ID NOs: 5597-5612.
[0058] In some embodiments, the engineered nuclease system further comprises a single-stranded or double-stranded DNA repair template comprising, in the 5' to 3' direction: a first homologous arm comprising a sequence of at least 20 nucleotides 5' to a target deoxyribonucleic acid sequence, a synthetic DNA sequence of at least 10 nucleotides, and a second homologous arm comprising a sequence of at least 20 nucleotides 3' to the target sequence. In some embodiments, the first or second homologous arm comprises a sequence of at least 40, 80, 120, 150, 200, 300, 500, or 1,000 nucleotides.
[0059] In some embodiments, the system further comprises a source of Mg2+.
[0060] In some embodiments, the endonuclease and the tracr ribonucleic acid sequence are from separate bacterial species within the same phylum. In some embodiments, the endonuclease is from a bacterium belonging to the genus Dermabacter. In some embodiments, the endonuclease is from a bacterium belonging to the phylum Verrucomicrobia, Candidatus Peregrinibacteria, or Candidatus Melainabacteria. In some embodiments, the endonuclease is from a bacterium that comprises a 16S rRNA gene having at least 90% identity to any one of SEQ ID NOs: 5592-5595.
[0061] In some embodiments, the HNH domain comprises a sequence having at least 70% or at least 80% sequence identity to any one of SEQ ID NOs: 5638-5460. In some embodiments, the endonuclease comprises a SEQ ID NO: 1-1826, or a variant thereof having at least 55% identity thereto. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 1827-1830 or SEQ ID NOs: 1827-2140.
[0062] In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 3638-3641 or 3638-3954. In some embodiments, the endonuclease comprises at least one, at least two, at least three, at least four, or at least five peptide motifs selected from the group consisting of SEQ ID NOs: 5615-5632. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 1-4 or 1-319.
[0063] In some embodiments, the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 5461-5464, 5476-5479, or 5476-5489. In some embodiments, the guide RNA structure comprises an RNA sequence that is predicted to comprise a hairpin consisting of a stem and a loop, wherein the stem comprises at least 10, at least 12, or at least 14 base pair ribonucleotides, and an asymmetric bulge within 4 base pairs of the loop.
[0064] In some embodiments, the endonuclease is configured to bind to a PAM comprising a sequence selected from the group consisting of SEQ ID NOs: 5512-5515 or SEQ ID NOs: 5527-5530.
[0065] In some embodiments, (a) the endonuclease comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 1827, (b) the guide RNA structure comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 5461 or SEQ ID NO: 5476, and (c) the endonuclease is configured to bind to a PAM that comprises SEQ ID NO: 5512 or SEQ ID NO: 5527. In some embodiments, (a) the endonuclease comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 1828, (b) the guide RNA structure comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 5462 or SEQ ID NO: 5477, and (c) the endonuclease is configured to bind to a PAM that comprises SEQ ID NO: 5513 or SEQ ID NO: 5528. In some embodiments, (a) the endonuclease comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 1829, (b) the guide RNA structure comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 5463 or SEQ ID NO: 5478, and (c) the endonuclease is configured to bind to a PAM that comprises SEQ ID NO: 5514 or SEQ ID NO: 5529. In some embodiments, (a) the endonuclease comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 1830, (b) the guide RNA structure comprises a sequence that is at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 5464 or SEQ ID NO: 5479, and (c) the endonuclease is configured to bind to a PAM that comprises SEQ ID NO: 5515 or SEQ ID NO: 5530.
[0066] In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 2141-2142 or SEQ ID NOs: 2141-2241. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 3955-3956 or SEQ ID NOs: 3955-4055. In some embodiments, the endonuclease comprises at least one, at least two, at least three, at least four, or at least five peptide motifs selected from the group consisting of SEQ ID NOs: 5632-5638. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 320-321 or SEQ ID NOs: 320-420. In some embodiments, the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO:5465, SEQ ID NO:5490-5491, or SEQ ID NO:5490-5494. In some embodiments, the guide RNA structure comprises a hairpin comprising at least 8, at least 10, or at least 12 base pair ribonucleotides. In some embodiments, the endonuclease is configured to bind to a PAM comprising a sequence selected from the group consisting of SEQ ID NO:5516 and SEQ ID NO:5531. In some embodiments, (a) the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO:2141, (b) the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO:5490, and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO:5531. In some embodiments, (a) the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO:2142; (b) the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO:5465 or SEQ ID NO:5491; and (c) the endonuclease is configured to bind to a PAM that comprises SEQ ID NO:5516.
[0067] In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 2245-2246. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 4059-4060. In some embodiments, the endonuclease comprises at least one, at least two, at least three, at least four, or at least five peptide motifs selected from the group consisting of SEQ ID NOs: 5639-5648. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 424-425. In some embodiments, the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 5498-5499 and SEQ ID NO: 5539. In some embodiments, the guide RNA structure comprises a guide ribonucleic acid sequence that is predicted to comprise a hairpin having an uninterrupted base-paired region comprising at least 8 nucleotides of the guide ribonucleic acid sequence and at least 8 nucleotides of the tracr ribonucleic acid sequence, the tracr ribonucleic acid sequence comprising, in the 5' to 3' direction, a first hairpin and a second hairpin, the first hairpin having a longer stem than the second hairpin.
[0068] In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 2242-2244 or SEQ ID NOs: 2247-2249. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 4056-4058 and SEQ ID NOs: 4061-4063. In some embodiments, the endonuclease comprises at least one, at least two, at least three, at least four, or at least five peptide motifs selected from the group consisting of SEQ ID NOs: 5639-5648. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 421-423 or SEQ ID NOs: 426-428. In some embodiments, the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 5466-5467, 5495-5497, 5500-5502, and 5539. In some embodiments, the guide RNA structure comprises a guide ribonucleic acid sequence that is predicted to comprise a hairpin having an uninterrupted base-paired region comprising at least 8 nucleotides of the guide ribonucleic acid sequence and at least 8 nucleotides of the tracr ribonucleic acid sequence, the tracr ribonucleic acid sequence comprising, in a 5' to 3' direction, a first hairpin and a second hairpin, the first hairpin having a longer stem than the second hairpin. In some embodiments, the endonuclease is configured to bind to a PAM comprising a sequence selected from the group consisting of SEQ ID NOs: 5517-5518 or SEQ ID NOs: 5532-5534. In some embodiments, (a) the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO:2247; (b) the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO:5500; and (c) the endonuclease is configured to bind to a PAM that comprises SEQ ID NO:5517 or SEQ ID NO:5532.In some embodiments, (a) the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO:2248, (b) the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO:5501, and (c) the endonuclease is configured to bind to a PAM that comprises SEQ ID NO:5518 or SEQ ID NO:5533. In some embodiments, (a) the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO:2249, (b) the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO:5502, and (c) the endonuclease is configured to bind to a PAM that comprises SEQ ID NO:5534.
[0069] In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 2253 or SEQ ID NOs: 2253-2481. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 4067 or SEQ ID NOs: 4067-4295. In some embodiments, the endonuclease comprises a peptide motif according to SEQ ID NO: 5649. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 432 or SEQ ID NOs: 432-660. In some embodiments, the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 5468 or SEQ ID NO: 5503. In some embodiments, the endonuclease is configured to bind to a PAM that comprises a sequence selected from the group consisting of SEQ ID NO: 5519. In some embodiments, (a) the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO:2253; (b) the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO:5468 or SEQ ID NO:5503; and (c) the endonuclease is configured to bind to a PAM that comprises SEQ ID NO:5519.
[0070] In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 2482-2489. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 4296-4303. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 661-668. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 2490-2498. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 4304-4312. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NOs: 669-677. In some embodiments, the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 5504.
[0071] In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 2499 or SEQ ID NO: 2499-2750. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 4313 or SEQ ID NO: 4313-4564. In some embodiments, the endonuclease comprises at least one, at least two, at least three, at least four, or at least five peptide motifs selected from the group consisting of SEQ ID NO: 5650-5667. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 678 or SEQ ID NO: 678-929. In some embodiments, the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO: 5469 or SEQ ID NO: 5505. In some embodiments, the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5520 or 5535. In some embodiments, (a) the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO: 2499, (b) the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO: 5469 or SEQ ID NO: 5505, and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5520 or SEQ ID NO: 5535.
[0072] In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 2751 or SEQ ID NO: 2751-2913. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 4565 or SEQ ID NO: 4565-4727. In some embodiments, the endonuclease comprises at least one, at least two, at least three, at least four, or at least five peptide motifs selected from the group consisting of SEQ ID NO: 5668-5678. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 930 or SEQ ID NO: 930-1092. In some embodiments, the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO: 5470 or SEQ ID NO: 5506. In some embodiments, the endonuclease is configured to bind to a PAM comprising a sequence selected from the group consisting of SEQ ID NO: 5521 or SEQ ID NO: 5536. In some embodiments, (a) the endonuclease comprises a sequence at least 70%, 80%, or 90% identical to SEQ ID NO: 2751, (b) the guide RNA structure comprises a sequence at least 70%, 80%, or 90% identical to SEQ ID NO: 5470 or SEQ ID NO: 5506, and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5521 or SEQ ID NO: 5536.
[0073] In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 2914 or SEQ ID NO: 2914-3174. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 4728 or SEQ ID NO: 4728-4988. In some embodiments, the endonuclease comprises at least one, at least two, or at least three peptide motifs selected from the group consisting of SEQ ID NO: 5676-5678. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 1093 or SEQ ID NO: 1093-1353. In some embodiments, the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 5471, SEQ ID NO: 5507, and SEQ ID NO: 5540-5542. In some embodiments, the guide RNA structure comprises a tracr ribonucleic acid sequence predicted to include at least two hairpins comprising fewer than 5 base pairs of ribonucleotides. In some embodiments, the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5522. In some embodiments, (a) the endonuclease comprises a sequence at least 70%, 80%, or 90% identical to SEQ ID NO: 2914, (b) the guide RNA structure comprises a sequence at least 70%, 80%, or 90% identical to SEQ ID NO: 5471 or SEQ ID NO: 5507, and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5522.
[0074] In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 3175 or SEQ ID NO: 3175-3330. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 4989 or SEQ ID NO: 4989-5146. In some embodiments, the endonuclease comprises at least one, at least two, at least three, at least four, or at least five peptide motifs selected from the group consisting of SEQ ID NO: 5679-5686. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 1354 or SEQ ID NO: 1354-1511. In some embodiments, the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 5472 or SEQ ID NO: 5508. In some embodiments, the endonuclease is configured to bind to a PAM comprising a sequence selected from the group consisting of SEQ ID NO: 5523 or SEQ ID NO: 5537. In some embodiments, (a) the endonuclease comprises a sequence at least 70%, 80%, or 90% identical to SEQ ID NO: 3175, (b) the guide RNA structure comprises a sequence at least 70%, 80%, or 90% identical to SEQ ID NO: 5472 or SEQ ID NO: 5508, and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5523 or SEQ ID NO: 5537.
[0075] In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 3331 or SEQ ID NOs: 3331-3474. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 5147 or SEQ ID NOs: 5147-5290. In some embodiments, the endonuclease comprises at least one, at least two, at least three, at least four, or at least five peptide motifs selected from the group consisting of SEQ ID NOs: 5674-5675 and SEQ ID NOs: 5687-5693. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 1512 or SEQ ID NOs: 1512-1655. In some embodiments, the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 5473 or SEQ ID NO: 5509. In some embodiments, the endonuclease is configured to bind to a PAM that comprises SEQ ID NO: 5524. In some embodiments, (a) the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO: 3331, (b) the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO: 5473 or SEQ ID NO: 5509, and (c) the endonuclease is configured to bind to a PAM that comprises SEQ ID NO: 5524.
[0076] In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 3475 or SEQ ID NO: 3475-3568. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 5291 or SEQ ID NO: 5291-5389. In some embodiments, the endonuclease comprises at least one, at least two, at least three, at least four, or at least five peptide motifs selected from the group consisting of SEQ ID NO: 5694-5699. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 1656 or SEQ ID NO: 1656-1755. In some embodiments, the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO: 5474 or SEQ ID NO: 5510. In some embodiments, the endonuclease is configured to bind to a PAM that comprises SEQ ID NO: 5525. In some embodiments, (a) the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO: 3475, (b) the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO: 5474 or SEQ ID NO: 5510, and (c) the endonuclease is configured to bind to a PAM that comprises SEQ ID NO: 5525.
[0077] In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 3569 or SEQ ID NO: 3569-3637. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 5390 or SEQ ID NO: 5390-5460. In some embodiments, the endonuclease comprises at least one, at least two, at least three, at least four, or at least five peptide motifs selected from the group consisting of SEQ ID NO: 5700-5717. In some embodiments, the endonuclease comprises a sequence that is at least 70%, 80%, or 90% identical to a sequence selected from the group consisting of SEQ ID NO: 1756 or SEQ ID NO: 1756-1826. In some embodiments, the guide RNA structure comprises a sequence that is at least 70%, 80%, or 90% identical to SEQ ID NO: 5475 or SEQ ID NO: 5511. In some embodiments, the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5526. In some embodiments, (a) the endonuclease comprises a sequence at least 70%, 80%, or 90% identical to SEQ ID NO: 3569, (b) the guide RNA structure comprises a sequence at least 70%, 80%, or 90% identical to SEQ ID NO: 5475 or SEQ ID NO: 5511, and (c) the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 5526. In some embodiments, the sequence identity is determined by CLUSTALW using parameters of BLASTP, CLUSTALW, MUSCLE, MAFFT, or Smith-Waterman homology search algorithm. In some embodiments, the sequence identity is determined by a BLASTP homology search algorithm using a BLOSUM62 scoring matrix setting parameters of word length (W) of 3, expectation (E) of 10, and gap costs at presence of 11 and extension of 1, and using a conditional composition score matrix adjustment.
[0078] In some aspects, the disclosure provides an engineered guide ribonucleic acid polynucleotide comprising: (a) a DNA-targeting segment comprising a nucleotide sequence that is complementary to a target sequence in a target DNA molecule; and (b) a protein-binding segment comprising two complementary stretches of nucleotides that hybridize to form a double-stranded RNA (dsRNA) duplex, the two complementary stretches of nucleotides being covalently linked to each other with an intervening nucleotide, the engineered guide ribonucleic acid polynucleotide being configured to form a complex with an endonuclease comprising a RuvC_III domain having at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, or at least 98% sequence identity to any one of SEQ ID NOs: 1827-3637, and to target the complex to the target sequence of the target DNA molecule. In some embodiments, the DNA-targeting segment is positioned 5' of both of the two complementary stretches of nucleotides.
[0079] In some embodiments, (a) the protein-binding segment comprises a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, or at least 98% identity to a sequence selected from the group consisting of SEQ ID NOs: 5476-5479 or SEQ ID NOs: 5476-5489, and (b) the protein-binding segment comprises a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 88%, at least 90%, at least 92%, at least 95%, or at least 98% identity to a sequence selected from the group consisting of SEQ ID NOs: 5490-5491 or SEQ ID NOs: 5490-5494) and SEQ ID NO: 5538. (c) the protein-binding segment comprises a sequence having at least 70%, at least 80%, or at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 5498 to 5499; (d) the protein-binding segment comprises a sequence having at least 70%, at least 80%, or at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 5495 to 5497 and SEQ ID NOs: 5500 to 5502; and (e) the protein-binding segment comprises a sequence having at least 70%, at least 80%, or at least 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 5495 to 5497 and SEQ ID NOs: 5500 to 5502. (f) the protein-binding segment comprises a sequence having at least 70%, at least 80%, or at least 90% identity to SEQ ID NO:5503; (g) the protein-binding segment comprises a sequence having at least 70%, at least 80%, or at least 90% identity to SEQ ID NO:5505; (h) the protein-binding segment comprises a sequence having at least 70%, at least 80%, or at least 90% identity to SEQ ID NO:5506; (i) the protein-binding segment comprises a sequence having at least 70%, at least 80%, or at least 90% identity to SEQ ID NO:5507; (j) the protein-binding segment comprises a sequence having at least 70%, at least 80%, or at least 90% identity to SEQ ID NO:5508; (k) the protein-binding segment comprises a sequence having at least 70%, at least 80%, or at least 90% identity to SEQ ID NO:5509; and (l) the protein-binding segment comprisesor (m) the protein-binding segment comprises a sequence having at least 70%, at least 80%, or at least 90% identity to SEQ ID NO: 5510; or (m) the protein-binding segment comprises a sequence having at least 70%, at least 80%, or at least 90% identity to SEQ ID NO: 5511.
[0080] In some embodiments, (a) the guide ribonucleic acid polynucleotide comprises an RNA sequence comprising a hairpin comprising a stem and a loop, the stem comprising at least 10, at least 12, or at least 14 base pairs of ribonucleotides and an asymmetric bulge within 4 base pairs of the loop; (b) the guide ribonucleic acid polynucleotide comprises a tracr ribonucleic acid sequence predicted to comprise a hairpin comprising at least 8, at least 10, or at least 12 base pairs of ribonucleotides; (c) the guide ribonucleic acid polynucleotide comprises a guide ribonucleic acid sequence predicted to comprise a hairpin having an uninterrupted basepair region comprising at least 8 nucleotides of the guide ribonucleic acid sequence and at least 8 nucleotides of the tracr ribonucleic acid sequence, the tracr ribonucleic acid sequence comprising, in the 5' to 3' direction, a first hairpin and a second hairpin, the first hairpin having a longer stem than the second hairpin; or (d) the guide ribonucleic acid polynucleotide comprises a tracr ribonucleic acid sequence predicted to comprise at least two hairpins comprising fewer than 5 base pairs of ribonucleotides.
[0081] In some aspects, the disclosure provides a deoxyribonucleic acid polynucleotide encoding any of the engineered guide ribonucleic acid polynucleotides described herein.
[0082] In some aspects, the disclosure provides a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, the nucleic acid encoding a Class 2, Type II Cas endonuclease comprising a RuvC_III domain and an HNH domain, the endonuclease being derived from an uncultured microorganism.
[0083] In some aspects, the disclosure provides a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, the nucleic acid encoding an endonuclease comprising a RuvC_III domain having at least 70% sequence identity to any one of SEQ ID NOs: 1827-3637. In some embodiments, the endonuclease comprises an HNH domain having at least 70% or at least 80% sequence identity to any one of SEQ ID NOs: 3638-5460. In some embodiments, the endonuclease comprises SEQ ID NOs: 5572-5591, or a variant thereof having at least 70% sequence identity thereto. In some embodiments, the endonuclease comprises a sequence encoding one or more nuclear localization sequences (NLS) proximal to the N-terminus or C-terminus of the endonuclease. In some embodiments, the NLS comprises a sequence selected from SEQ ID NOs: 5597-5612.
[0084] In some embodiments, the organism is a prokaryote, a bacterium, a eukaryote, a fungus, a plant, a mammal, a rodent, or a human. In some embodiments, the organism is E. coli, and (a) the nucleic acid sequence has at least 70%, 80%, or 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 5572-5575, (b) the nucleic acid sequence has at least 70%, 80%, or 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 5576-5577, (c) the nucleic acid sequence has at least 70%, 80%, or 90% identity to a sequence selected from the group consisting of SEQ ID NOs: 5578-5580, (d) the nucleic acid sequence has at least 70%, 80%, or 90% identity to SEQ ID NO: 5581, and (e) the nucleic acid sequence has at least 70%, 80%, or 90% identity to a sequence selected from the group consisting of SEQ ID NO: 5582, and (f) the nucleic acid sequence has at least 70%, 80%, or 90% identity to SEQ ID NO: 5583; (g) the nucleic acid sequence has at least 70%, 80%, or 90% identity to SEQ ID NO: 5584; (h) the nucleic acid sequence has at least 70%, 80%, or 90% identity to SEQ ID NO: 5585; (i) the nucleic acid sequence has at least 70%, 80%, or 90% identity to SEQ ID NO: 5586; or (j) the nucleic acid sequence has at least 70%, 80%, or 90% identity to SEQ ID NO: 5587. In some embodiments, the organism is a human and (a) the nucleic acid sequence has at least 70%, 80%, or 90% identity to SEQ ID NO:5588 or SEQ ID NO:5589, or (b) the nucleic acid sequence has at least 70%, 80%, or 90% identity to SEQ ID NO:5590 or SEQ ID NO:5591.
[0085] In some aspects, the disclosure provides an engineered vector comprising a nucleic acid sequence encoding a class 2, type II Cas endonuclease comprising a RuvC_III domain and an HNH domain, wherein the endonuclease is derived from an uncultured microorganism.
[0086] In some aspects, the disclosure provides a vector comprising any of the nucleic acids described herein. In some embodiments, the vector further comprises a nucleic acid encoding an engineered guide ribonucleic acid structure configured to form a complex with an endonuclease, the nucleic acid comprising (a) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence, and (b) a tracr ribonucleic acid sequence configured to bind to the endonuclease. In some embodiments, the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV) derived virion, or a lentivirus.
[0087] In some aspects, the disclosure provides a cell comprising any of the vectors described herein.
[0088] In some aspects, the disclosure provides a method of producing an endonuclease comprising culturing any of the cells described herein.
[0089] In some aspects, the disclosure provides a method of binding, cleaving, marking, or modifying a double-stranded deoxyribonucleic acid polynucleotide, the method comprising: (a) contacting the double-stranded deoxyribonucleic acid polynucleotide with a class 2, type II Cas endonuclease in a complex with an endonuclease and an engineered guide nucleic acid structure configured to bind to the double-stranded deoxyribonucleic acid polynucleotide; (b) the double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (PAM); and (c) the PAM comprises a sequence selected from the group consisting of SEQ ID NOs: 5512-5526 or SEQ ID NOs: 5527-5537. In some embodiments, the double-stranded deoxyribonucleic acid polynucleotide comprises a first strand comprising a sequence complementary to a sequence of the engineered guide ribonucleic acid structure and a second strand comprising a PAM. In some embodiments, the PAM is immediately adjacent to the 3' end of the sequence complementary to a sequence of the engineered guide ribonucleic acid structure.
[0090] In some embodiments, the class 2, type II Cas endonuclease is not a Cas9 endonuclease, a Cas14 endonuclease, a Cas12a endonuclease, a Cas12b endonuclease, a Cas12c endonuclease, a Cas12d endonuclease, a Cas12e endonuclease, a Cas13a endonuclease, a Cas13b endonuclease, a Cas13c endonuclease, or a Cas13d endonuclease. In some embodiments, the class 2, type II Cas endonuclease is from an uncultured microorganism. In some embodiments, the double-stranded deoxyribonucleic acid polynucleotide is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide.
[0091] In some embodiments, (a) the PAM comprises a sequence selected from the group consisting of SEQ ID NOs: 5512-5515 and SEQ ID NOs: 5527-5530, (b) the PAM comprises SEQ ID NO: 5516 or SEQ ID NO: 5531, (c) the PAM comprises SEQ ID NO: 5539, (d) the PAM comprises SEQ ID NO: 5517 or SEQ ID NO: 5518, (e) the PAM comprises SEQ ID NO: 5519, (f) the PAM comprises SEQ ID NO: 5520 or SEQ ID NO: 5535, (g) the PAM comprises SEQ ID NO: 5521 or SEQ ID NO: 5536, (h) the PAM comprises SEQ ID NO: 5522, (i) the PAM comprises SEQ ID NO: 5523 or SEQ ID NO: 5537, (j) the PAM comprises SEQ ID NO: 5524, (k) the PAM comprises SEQ ID NO: 5525, or (l) the PAM comprises SEQ ID NO: 5526.
[0092] In some aspects, the disclosure provides a method of modifying a target nucleic acid locus, the method comprising delivering any of the engineered nuclease systems described herein to the target nucleic acid locus, the endonuclease being configured to form a complex with an engineered guide ribonucleic acid structure, the complex being configured to modify the target nucleic acid locus upon binding of the complex to the target nucleic acid locus. In some embodiments, modifying the target nucleic acid locus comprises binding, nicking, cleaving, or marking the target nucleic acid locus. In some embodiments, the target nucleic acid locus comprises deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). In some embodiments, the target nucleic acid comprises genomic DNA, viral DNA, viral RNA, or bacterial DNA. In some embodiments, the target nucleic acid locus is in vitro. In some embodiments, the target nucleic acid locus is in a cell. In some embodiments, the cell is a prokaryotic cell, a bacterial cell, a eukaryotic cell, a fungal cell, a plant cell, an animal cell, a mammalian cell, a rodent cell, a primate cell, or a human cell.
[0093] In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering any of the nucleic acids described herein or any of the vectors described herein. In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a nucleic acid comprising an open reading frame encoding an endonuclease. In some embodiments, the nucleic acid comprises a promoter to which an open reading frame encoding an endonuclease is operably linked. In some embodiments, the engineered nuclease system to the target nucleic acid locus comprises delivering a capped mRNA comprising an open reading frame encoding an endonuclease. In some embodiments, the engineered nuclease system to the target nucleic acid locus comprises delivering a translated polypeptide. In some embodiments, the engineered nuclease system to the target nucleic acid locus comprises delivering a deoxyribonucleic acid (DNA) encoding an engineered guide ribonucleic acid operably linked to a ribonucleic acid (RNA) pol III promoter. In some embodiments, the endonuclease induces a single-stranded or double-stranded break at or proximal to the target locus.
[0094] In some aspects, the disclosure provides an engineered nuclease system comprising: (a) an endonuclease comprising a sequence having 75% sequence identity to any one of SEQ ID NOs: 5718-5846 or 6257; and (b) an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease, the engineered guide ribonucleic acid structure comprising (i) a ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence, and (ii) a ribonucleic acid sequence configured to bind to the endonuclease. In some aspects, the disclosure provides an engineered nuclease system comprising: (a) an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising SEQ ID NOs: 5847-5861 or 6258-6278, the endonuclease being a class 2, type II Cas endonuclease; and (b) an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease, the engineered guide ribonucleic acid structure comprising (i) a ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence, and (ii) a ribonucleic acid sequence configured to bind to the endonuclease. In some embodiments, the endonuclease is derived from an uncultured microorganism. In some embodiments, the endonuclease is not engineered to bind to a different PAM sequence. In some embodiments, the endonuclease is not a Cas9 endonuclease, a Cas14 endonuclease, a Cas12a endonuclease, a Cas12b endonuclease, a Cas12c endonuclease, a Cas12d endonuclease, a Cas12e endonuclease, a Cas13a endonuclease, a Cas13b endonuclease, a Cas13c endonuclease, or a Cas13d endonuclease. In some embodiments, the endonuclease has less than 80% identity to a Cas9 endonuclease.In some embodiments, the ribonucleic acid sequence comprises a sequence having at least 80% sequence identity to a non-degenerate nucleotide of any one of (a) SEQ ID NOs: 5886-5887, 5891, 5893, or 5894, or (b) SEQ ID NOs: 5862-5885, 5888-5890, 5892, 5895-5896, or 6279-6301. In some aspects, the disclosure provides an engineered nuclease system comprising: (a) an engineered guide ribonucleic acid structure comprising (i) a ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a ribonucleic acid sequence configured to bind to an endonuclease, the ribonucleic acid sequence comprising a sequence having at least 80% sequence identity to a non-degenerate nucleotide of (a) any one of SEQ ID NOs: 5886-5887, 5891, 5893, or 5894; or (b) any one of SEQ ID NOs: 5862-5885, 5888-5890, 5892, 5895-5896, or 6279-6301; and a Class 2, Type II Cas endonuclease configured to bind to the engineered guide ribonucleic acid. In some embodiments, the endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence selected from the group consisting of SEQ ID NOs: 5847-5861 or 6258-6278. In some embodiments, the guide ribonucleic acid sequence is 15-24 nucleotides in length or 19-24 nucleotides in length. In some embodiments, the endonuclease comprises one or more nuclear localization sequences (NLS) proximal to the N-terminus or C-terminus of the endonuclease. In some embodiments, the NLS comprises a sequence selected from SEQ ID NOs: 5597-5612. In some embodiments, the system further comprises a single-stranded or double-stranded DNA repair template comprising, in a 5' to 3' direction: a first homologous arm comprising a sequence of at least 20 nucleotides 5' to the target deoxyribonucleic acid sequence, a synthetic DNA sequence of at least 10 nucleotides, and a second homologous arm comprising a sequence of at least 20 nucleotides 3' to the target sequence.In some embodiments, the first or second homology arm comprises a sequence of at least 40, 80, 120, 150, 200, 300, 500, or 1,000 nucleotides. In some embodiments, the sequence identity is determined by BLASTP, CLUSTALW, MUSCLE, MAFFT, or CLUSTALW using the parameters of the Smith-Waterman homology search algorithm. In some embodiments, the sequence identity is determined by the BLASTP homology search algorithm using parameters of word length (W) of 3, expectation (E) of 10, and a BLOSUM62 scoring matrix setting gap costs at 11 presence and 1 extension, with a conditional composition score matrix adjustment.
[0095] In some aspects, the disclosure provides an engineered guide ribonucleic acid polynucleotide comprising: (a) a DNA-targeting segment comprising a nucleotide sequence that is complementary to a target sequence in a target DNA molecule; and (b) a protein-binding segment comprising two complementary stretches of nucleotides that hybridize to form a double-stranded RNA (dsRNA) duplex, the two complementary stretches of nucleotides being covalently linked to each other with an intervening nucleotide, the engineered guide ribonucleic acid polynucleotide configured to form a complex with an endonuclease comprising a sequence having at least 75% sequence identity to any one of SEQ ID NOs: 5718-5846 or 6257, and to target the complex to the target sequence of the target DNA molecule. In some embodiments, the DNA-targeting segment is positioned 5' of both of the two complementary stretches of nucleotides.
[0096] In some aspects, the disclosure provides a deoxyribonucleic acid polynucleotide encoding any of the engineered guide ribonucleic acid polynucleotides described herein.
[0097] In some aspects, the disclosure provides a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, the nucleic acid encoding an endonuclease comprising a sequence having at least 75% sequence identity to any one of SEQ ID NOs: 5718-5846 or 6257. In some embodiments, the endonuclease comprises a sequence encoding one or more nuclear localization sequences (NLS) proximal to the N-terminus or C-terminus of the endonuclease. In some embodiments, the NLS comprises a sequence selected from SEQ ID NOs: 5597-5612. In some embodiments, the organism is a prokaryote, a bacterium, a eukaryote, a fungus, a plant, a mammal, a rodent, or a human.
[0098] In some aspects, the disclosure provides a vector comprising any of the nucleic acids described herein. In some embodiments, the vector further comprises a nucleic acid encoding an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease, the guide ribonucleic acid structure comprising (a) a ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence and (b) a ribonucleic acid sequence configured to bind to the endonuclease. In some embodiments, the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV) derived virion, or a lentivirus.
[0099] In some aspects, the disclosure provides a cell comprising any of the vectors described herein.
[0100] In some aspects, the disclosure provides a method of producing an endonuclease comprising culturing any of the cells described herein.
[0101] In some aspects, the disclosure provides a method of binding, cleaving, marking, or modifying a double-stranded deoxyribonucleic acid polynucleotide, the method comprising contacting the double-stranded deoxyribonucleic acid polynucleotide with a class 2, type II Cas endonuclease in a complex with the endonuclease and an engineered guide nucleic acid structure configured to bind to the double-stranded deoxyribonucleic acid polynucleotide, the double-stranded deoxyribonucleic acid polynucleotide comprising a protospacer adjacent motif (PAM), the PAM comprising a sequence selected from the group consisting of SEQ ID NOs: 5847-5861 or 6258-6278. In some embodiments, the double-stranded deoxyribonucleic acid polynucleotide comprises a first strand comprising a sequence complementary to a sequence of the engineered guide ribonucleic acid structure and a second strand comprising the PAM. In some embodiments, the PAM is immediately adjacent to the 3' end of the sequence complementary to the sequence of the engineered guide ribonucleic acid structure. In some embodiments, the class 2, type II Cas endonuclease is not a Cas9 endonuclease, a Cas14 endonuclease, a Cas12a endonuclease, a Cas12b endonuclease, a Cas12c endonuclease, a Cas12d endonuclease, a Cas12e endonuclease, a Cas13a endonuclease, a Cas13b endonuclease, a Cas13c endonuclease, or a Cas13d endonuclease. In some embodiments, the double-stranded deoxyribonucleic acid polynucleotide is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide.
[0102] In some aspects, the disclosure provides a method of modifying a target nucleic acid locus, the method comprising delivering any of the engineered nuclease systems described herein to the target nucleic acid locus, the endonuclease configured to form a complex with the engineered guide ribonucleic acid structure, the complex configured to modify the target nucleic acid locus upon binding of the complex to the target nucleic acid locus. In some embodiments, the target nucleic acid locus comprises binding, nicking, cleaving, or marking the target nucleic acid locus. In some embodiments, the target nucleic acid locus comprises deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). In some embodiments, the target nucleic acid comprises genomic DNA, viral DNA, viral RNA, or bacterial DNA. In some embodiments, the target nucleic acid locus is in vitro. In some embodiments, the target nucleic acid locus is in a cell. In some embodiments, the cell is a prokaryotic cell, a bacterial cell, a eukaryotic cell, a fungal cell, a plant cell, an animal cell, a mammalian cell, a rodent cell, a primate cell, or a human cell. In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering any of the nucleic acids described herein or any of the vectors described herein. In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a nucleic acid comprising an open reading frame encoding the endonuclease. In some embodiments, the nucleic acid comprises a promoter to which the open reading frame encoding the endonuclease is operably linked. In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a capped mRNA comprising the open reading frame encoding the endonuclease. In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a translated polypeptide.In some embodiments, delivering the engineered nuclease system to the target nucleic acid locus comprises delivering a deoxyribonucleic acid (DNA) encoding the engineered guide ribonucleic acid operably linked to a ribonucleic acid (RNA) pol III promoter. In some embodiments, the endonuclease induces a single-stranded or double-stranded break at or proximal to the target locus.
[0103] In some aspects, the disclosure provides a method of editing a TRAC locus in a cell, the method comprising contacting the cell with (a) an RNA-guided endonuclease and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the TRAC locus, the engineered guide RNA comprising a targeting sequence having at least 80%, at least 82%, at least 84%, at least 86%, at least 88%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 contiguous nucleotides of any one of SEQ ID NOs: 5950-5958 or 5959-5965. In some embodiments, the RNA-guided endonuclease is a class II, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO:2242 or SEQ ID NO:2244. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain.In some embodiments, the RNA-guided endonuclease comprises a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO: 421 or SEQ ID NO: 423. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 5950-5958, and the endonuclease comprises a sequence having at least 75% identity to SEQ ID NO: 421. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 5959-5965, and the endonuclease comprises a sequence having at least 75% identity to SEQ ID NO: 423. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 5953-5957. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 5960-5961 or 5963-5964.
[0104] In some aspects, the disclosure provides a method of editing the TRBC locus in a cell, the method comprising contacting the cell with (a) an RNA-guided endonuclease and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the TRBC locus, the engineered guide RNA comprising a targeting sequence having at least 80%, at least 82%, at least 84%, at least 86%, at least 88%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 contiguous nucleotides of any one of SEQ ID NOs: 5966-6004 or 6005-6025. In some embodiments, the RNA-guided endonuclease is a class II, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO:2242 or SEQ ID NO:2244. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain.In some embodiments, the RNA-guided endonuclease comprises a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO: 421 or SEQ ID NO: 423. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 5966-6004, and the endonuclease comprises a sequence having at least 75% identity to SEQ ID NO: 421. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6005-6025, and the endonuclease comprises a sequence having at least 75% identity to SEQ ID NO: 423. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 5970, 5971, 5983, or 5984. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6006, 6010, 6011, or 6012.
[0105] In some aspects, the disclosure provides a method of editing the GR (NR3C1) locus in a cell, the method comprising contacting the cell with (a) an RNA-guided endonuclease and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the GR (NR3C1) locus, the engineered guide RNA being selected from the group consisting of SEQ ID NOs: 6026-6090 or 6091-6121. In some embodiments, the RNA-guided endonuclease is a class II, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO:2242 or SEQ ID NO:2244. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the RNA-guided endonuclease comprises a sequence having at least 75% identity to SEQ ID NO:421 or SEQ ID NO:423.In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6026-6090, and the endonuclease comprises a sequence having at least 75% identity to SEQ ID NO: 421. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6091-6121, and the endonuclease comprises a sequence having at least 75% identity to SEQ ID NO: 423. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6027-6028, 6029, 6038, 6043, 6049, 6076, 6080, 6081, or 6086. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6092, 6115, or 6119.
[0106] In some aspects, the disclosure provides a method of editing the AAVS1 locus in a cell, the method comprising contacting the cell with (a) an RNA-guided endonuclease and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the AAVS1 locus, wherein the engineered guide RNA comprises a targeting sequence having at least 80%, at least 82%, at least 84%, at least 86%, at least 88%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 contiguous nucleotides of any one of SEQ ID NOs: 6122-6152. In some embodiments, the RNA-guided endonuclease is a class II, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO:2242 or SEQ ID NO:2244. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain.In some embodiments, the RNA-guided endonuclease comprises a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO:421 or SEQ ID NO:423. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6122, 6125-6126, 6128, 6131, 6133, 6136, 6141, 6143, or 6148.
[0107] In some aspects, the disclosure provides a method of editing a TIGIT locus in a cell, the method comprising contacting the cell with (a) an RNA-guided endonuclease and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the TIGIT locus, wherein the engineered guide RNA comprises a targeting sequence having at least 80%, at least 82%, at least 84%, at least 86%, at least 88%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 contiguous nucleotides of any one of SEQ ID NOs: 6153-6181. In some embodiments, the RNA-guided endonuclease is a class II, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO:421 or SEQ ID NO:423.In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 66155, 6159, 616, or 6172.
[0108] In some aspects, the disclosure provides a method of editing a CD38 locus in a cell, the method comprising contacting the cell with (a) an RNA-guided endonuclease and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the CD38 locus, the engineered guide RNA comprising a targeting sequence having at least 80%, at least 82%, at least 84%, at least 86%, at least 88%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity to at least 19, at least 20, at least 21, at least 22, at least 23, or at least 24 contiguous nucleotides of any one of SEQ ID NOs: 6182-6248 or 6249-6256. In some embodiments, the RNA-guided endonuclease is a class II, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO:2242 or SEQ ID NO:2244. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain.In some embodiments, the RNA-guided endonuclease comprises a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO: 421 or SEQ ID NO: 423. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6182-6248, and the endonuclease comprises a sequence having at least 75% identity to SEQ ID NO: 421. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6249-6256, and the endonuclease comprises a sequence having at least 75% identity to SEQ ID NO: 423. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6182-6183, 6189, 6191, 6208, 6210, 6211, or 6215. In some embodiments, the engineered guide RNA comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of SEQ ID NO: 6251.
[0109] In some embodiments of any of the above methods for editing a specific locus in a cell, the cell is a peripheral blood mononuclear cell, a T cell, a NK cell, a hematopoietic stem cell (HSCT), or a B cell, or any combination thereof.
[0110] In some aspects, the disclosure provides an engineered guide ribonucleic acid polynucleotide comprising: (a) a DNA-targeting segment comprising a nucleotide sequence that is complementary to a target sequence in a target DNA molecule; and (b) a protein-binding segment comprising two complementary stretches of nucleotides that hybridize to form a double-stranded RNA (dsRNA) duplex, wherein the two complementary stretches of nucleotides are covalently linked to each other with an intervening nucleotide; the engineered guide ribonucleic acid polynucleotide is a Class 2, Type II and configured to form a complex with a Cas endonuclease and target the complex to the target sequence of the target DNA molecule, wherein the DNA targeting segment comprises at least 19, at least 20, at least 21, at least 22, at least 23, or 24 contiguous nucleotides of any one of SEQ ID NOs: 5950-5965, 5966-6025, 6026-6121, 6122-6152, 6153-6181, or 6182-6256, and at least In some embodiments, the protein-binding segment comprises a sequence having at least 85% identity to any one of SEQ ID NOs: 5466 or 6304, including a sequence having at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity. In some embodiments, the protein-binding segment comprises a sequence having at least 85% identity to any one of SEQ ID NOs: 5466 or 6304.
[0111] In some aspects, the disclosure provides a system for generating an edited immune cell, comprising: (a) an RNA-guided endonuclease; (b) an engineered guide ribonucleic acid polynucleotide of claim 97 configured to bind to the RNA-guided endonuclease; and (c) a single-stranded or double-stranded DNA repair template comprising a first homologous arm and a second homologous arm adjacent to a sequence encoding a chimeric antigen receptor (CAR). In some embodiments, the cell is a peripheral blood mononuclear cell, a T cell, a NK cell, a hematopoietic stem cell (HSCT), or a B cell, or any combination thereof. In some aspects, the RNA-guided endonuclease is a class II, type II Cas endonuclease. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the RNA-guided endonuclease comprises a sequence having at least 75% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, at least 99% identity, or at least 100% identity to SEQ ID NO:421 or SEQ ID NO:423.
[0112] Further aspects and advantages of the present disclosure will become readily apparent to those skilled in the art from the following detailed description, in which only illustrative embodiments of the present disclosure have been shown and described. As will be understood, the present disclosure is capable of other and different embodiments, and its several details are capable of modification in various obvious respects, all without departing from the present disclosure. Accordingly, the drawings and description are to be regarded as illustrative in nature, and not as restrictive. In some aspects, the disclosure provides a method of editing a B2M locus in a cell, the method comprising contacting the cell with (a) an RNA-guided endonuclease and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the B2M locus, the region of the B2M locus comprising a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6387-6468. In some embodiments, the RNA-guided endonuclease is a Cas endonuclease. In some embodiments, the Cas endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the class 2, type II Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 421-431. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO:2242 or SEQ ID NO:2244. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NO:421. In some embodiments, the engineered guide RNA comprises a sequence that is at least 80% identical to any one of SEQ ID NOs:6305-6386. In some embodiments, the region of the B2M locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 non-degenerate nucleotides of any one of SEQ ID NOs:6388, 6399, 6401, 6403, 6410, 6413, 6421, 6446, and 6448. In some embodiments, the engineered guide RNA comprises a sequence that is 80% or at least 90% identical to any one of SEQ ID NOs: 6306, 6317, 6319, 6321, 6328, 6331, 6339, 6364, and 6366.
[0113] In some aspects, the disclosure provides a method of editing a TRAC locus in a cell, the method comprising contacting the cell with (a) an RNA-guided endonuclease and (b) an engineered guide RNA, the engineered guide RNA being configured to form a complex with the endonuclease and comprising a spacer sequence configured to hybridize to a region of the TRAC locus, the region of the TRAC locus comprising a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6509-6548. In some embodiments, the RNA-guided endonuclease is a Cas endonuclease. In some embodiments, the Cas endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the class 2, type II Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 421-431. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO:2242 or SEQ ID NO:2244. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NO:421. In some embodiments, the engineered guide RNA comprises a sequence that is at least 80% sequence identity to any one of SEQ ID NOs:6469-6508. In some embodiments, the region of the TRAC locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 non-degenerate nucleotides of any one of SEQ ID NOs:6517, 6520, and 6523. In some embodiments, the engineered guide RNA comprises a sequence that is 80% or at least 90% identical to any one of SEQ ID NOs:6477, 6480, and 6483.
[0114] In some aspects, the disclosure provides a method of editing an HPRT locus in a cell, the method comprising contacting the cell with (a) an RNA-guided endonuclease and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the HPRT locus, the region of the HPRT locus comprising a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6616-6682. In some embodiments, the RNA-guided endonuclease is a Cas endonuclease. In some embodiments, the Cas endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the class 2, type II Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 421-431. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO:2242 or SEQ ID NO:2244. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NO:421 or SEQ ID NO:423. In some embodiments, the engineered guide RNA comprises a sequence that is at least 80% sequence identity to any one of SEQ ID NOs:6549-6615. In some embodiments, the region of the HPRT locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 non-degenerate nucleotides of any one of SEQ ID NOs:6619, 6634, 6673, 6675, and 6679. In some embodiments, the engineered guide RNA comprises a sequence that is 80% or at least 90% identical to any one of SEQ ID NOs: 6552, 6567, 6606, 6608, and 6612.
[0115] In some aspects, the disclosure provides a method of editing the TRBC1 / 2 locus in a cell, the method comprising contacting the cell with (a) an RNA-guided endonuclease and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the TRBC1 / 2 locus, the region of the TRBC1 / 2 locus comprising a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6722-6760 or 6782-6802. In some embodiments, the RNA-guided endonuclease is a Cas endonuclease. In some embodiments, the Cas endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the class 2, type II Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 421-431. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO:2242 or SEQ ID NO:2244. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NO:421 or SEQ ID NO:423. In some embodiments, the engineered guide RNA comprises a sequence that is at least 80% sequence identity to any one of SEQ ID NOs:6683-6721 and 6761-6781. In some embodiments, the region of the TRBC1 / 2 locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 non-degenerate nucleotides of any one of SEQ ID NOs:6734, 6753, 6790, and 6800. In some embodiments, the engineered guide RNA comprises a sequence that is 80% or at least 90% identical to any one of SEQ ID NOs: 6695, 6714, 6769, and 6779.
[0116] In some aspects, the disclosure provides a method of editing an HAO1 locus in a cell, the method comprising contacting the cell with (a) an RNA-guided endonuclease and (b) an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and configured to hybridize to a region of the HAO1 locus, the region of the HAO1 locus comprising a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 11802-11820. In some embodiments, the RNA-guided endonuclease is a Cas endonuclease. In some embodiments, the Cas endonuclease is a class 2, type II Cas endonuclease. In some embodiments, the class 2, type II Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 421-431. In some embodiments, the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242. In some embodiments, the RNA-guided endonuclease further comprises an HNH domain. In some embodiments, the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NO: 421. In some embodiments, the region of the HAO1 locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 non-degenerate nucleotides of any one of SEQ ID NOs: 11806, 11813, 11816, and 11819. In some embodiments, the cell is a peripheral blood mononuclear cell (PBMC). In some embodiments, the cell is a T cell or a precursor thereof, or a hematopoietic stem cell (HSC).
[0117] Incorporation by Reference All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. [Brief description of the drawings]
[0118] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the invention are utilized, and the accompanying drawings (hereinafter "Figure" and "FIG.").
[0119] [Figure 1] The results of gene editing at the DNA level of B2M are shown. [Figure 2A] This shows the results of gene editing at the DNA level of mouse TRAC. [Figure 2B] This shows the results of gene editing at the DNA level of mouse TRAC. [Diagram 3] The results of gene editing at the DNA level of HPRT are shown. [Figure 4] 1 shows flow cytometry results of gene editing of human TRBC1 / 2. [Diagram 5] Results of guide screening in Hepa1-6 cells are shown, where guides were delivered as mRNA and gRNA using Lipofectamine Messenger Max. [Figure 6] 1 shows analysis of gene editing results by NGS for mRNA electroporation in T cells. [Figure 7]Shown are ELISA results from screening performed at 1:50 serum dilution to detect antibodies against MG-3-6 and MG3-8 (n=50). Tetanus toxoid was used as a positive control due to widespread vaccination against this antigen. Serum samples above the dashed line were considered antibody positive, and this line represents the mean absorbance of the negative control (human albumin) plus two standard deviations from the mean. *P<0.05, **P<0.01, ****P<0.0001, ns, not significant, as determined by unpaired Student's t-test. [Figure 8] 1 shows the results of gene editing of TRAC at the DNA and cell surface protein levels in human peripheral blood B cells. [Figure 9] The results of gene editing at the DNA level of TRAC in hematopoietic stem cells are shown. [Figure 10] FIG. 1 shows gene editing results at the DNA and cell surface protein levels of TRAC delivered as a ribonucleoprotein in MG3-6 induced pluripotent stem cells (iPSCs). [Figure 11] FIG. 1 shows gene editing results at the DNA level of TRAC in MG3-6 induced pluripotent stem cells (iPSCs) delivered as mRNA. [Figure 12] Figure 2 shows the results of gene editing at the DNA level of CD2 in primary T cells. [Figure 13] Figure 1 shows the results of gene editing at the DNA level of CD5 in primary T cells. [Figure 14] Target RNA cleavage by MG3-6 and MG3-8 is shown. [Figure 15] Figure 1 shows the results of gene editing at the DNA level of FAS in T cells. [Figure 16] This shows the results of gene editing at the DNA level of PD-1 in T cells. [Figure 17] Figure 1 shows the results of gene editing at the DNA level of hRosa26 in T cells. [Figure 18-1] 1 shows the results of gene editing at the DNA level of TRAC and AAVS1 in K562 cells. [Figure 18-2]1 shows the results of gene editing at the DNA level of TRAC and AAVS1 in K562 cells. [Figure 19] Shows the activity of chemically modified MG3-6 human HAO-1 guides in Hep3B cells when delivered as mRNA and gRNA using Lipofectamine Messenger Max. [Figure 20] 1 shows the results of gene editing at the DNA level of human GPR146 in Hep3B cells. [Figure 21] 1 shows the results of gene editing at the DNA level of mouse GPR146 in Hepa1-6 cells. [Figure 22] Figure 1 shows the results of gene editing at the DNA level of mouse GPR146 in primary mouse hepatocytes. [Figure 23] 1 shows the results of gene editing at the DNA level of TRAC and AAVS1 in K562 cells. [Figure 24] Phylogenetic analysis of nucleases from the MG3 and MG150 families. PAM SeqLogo representations of some activity candidates are shown. Reference SaCas9 and SpyCas9 sequences were included. [Diagram 25] Phylogenetic analysis of nucleases from the MG15 family. Active candidates are highlighted with circles. Reference SaCas9, SpyCas9, and AcCas9 sequences were included as outgroups. [Figure 26] The SeqLogos of PAM for MG123-1, MG124-2, MG125-1 and MG125-2 are shown. [Figure 27] The SeqLogos of PAMs of MG125-3, MG125-4, MG125-5, and MG150-5 are shown. [Figure 28] The SeqLogos of PAMs of MG150-6, MG150-7, MG150-8 and MG150-9 are shown. [Figure 29] The SeqLogos of PAMs of MG3-18, MG3-89, MG3-90, and MG3-91 are shown. [Diagram 30]The SeqLogos of PAMs of MG3-92, MG3-93, MG3-95, and MG3-96 are shown. [Diagram 31] The SeqLogos of PAMs of MG3-103, MG15-130, MG15-146, and MG15-164 are shown. [Diagram 32] The SeqLogos of PAMs of MG15-166, MG15-171, MG15-172, and MG15-174 are shown. [Diagram 33] The SeqLogos of PAMs of MG15-184, MG15-187, MG15-191, and MG15-193 are shown. [Diagram 34] The SeqLogos of PAMs of MG15-195, MG15-217, MG15-218, and MG15-219 are shown. [Diagram 35] The SeqLogo of PAM of MG15-177 is shown.
[0120] Brief Description of the Sequence Listing The Sequence Listing submitted herewith provides exemplary polynucleotide and polypeptide sequences for use in the methods, compositions, and systems according to the present disclosure. Below are exemplary descriptions of the sequences therein.
[0121] MG1 SEQ ID NOs: 1 to 319 and 7285 to 7293 show the full-length peptide sequences of MG1 nuclease.
[0122] SEQ ID NOs: 1827 to 2140 show the peptide sequences of the RuvC_III domain of the above-mentioned MG1 nuclease.
[0123] SEQ ID NOs: 3638 to 3955 show peptides of the HNH domain of the above-mentioned MG1 nuclease.
[0124] SEQ ID NOs: 5476 to 5479 show the nucleotide sequences of MG1 tracrRNA derived from the same locus as the above-mentioned MG1 nuclease (for example, the same locus as SEQ ID NOs: 1 to 4, respectively).
[0125] SEQ ID NOs: 5461-5464 and 11130 set forth the nucleotide sequences of sgRNAs engineered to function with MG1 nuclease (e.g., SEQ ID NOs: 1-4, respectively), where N indicates a nucleotide in the targeting sequence.
[0126] SEQ ID NOs: 5572 to 5575 show the nucleotide sequences of E. coli codon-optimized coding sequences for MG1 family enzymes (SEQ ID NOs: 1 to 4).
[0127] SEQ ID NOs: 5588-5589 show the nucleotide sequences of human codon-optimized coding sequences for MG1 family enzymes (SEQ ID NOs: 1 and 3).
[0128] SEQ ID NOs: 5616 to 5632 show peptide motifs characteristic of MG1 family enzymes.
[0129] SEQ ID NOs: 9192 to 9255 show the peptide sequences of the PAM interaction domain of MG1 nuclease.
[0130] SEQ ID NOs: 11229 to 11269 show the nucleotide sequences of the target sites of MG1 nuclease.
[0131] MG2 SEQ ID NOs: 320 to 420 and 7294 to 7358 show the full-length peptide sequences of MG2 nuclease.
[0132] SEQ ID NOs: 2141 to 2241 show the peptide sequences of the RuvC_III domain of the above-mentioned MG2 nuclease.
[0133] SEQ ID NOs: 3955 to 4055 show peptides of the HNH domain of the above-mentioned MG2 nuclease.
[0134] SEQ ID NOs: 5490-5494 and 11159 show the nucleotide sequences of MG2 tracrRNA derived from the same locus as the MG2 nuclease described above (e.g., the same locus as SEQ ID NOs: 320, 321, 323, 325, and 326, respectively).
[0135] SEQ ID NO:5465 shows the nucleotide sequence of an sgRNA engineered to function with MG2 nuclease (e.g., SEQ ID NO:321 above).
[0136] SEQ ID NOs: 5572-5575 show the nucleotide sequence of an E. coli codon-optimized coding sequence for an MG2 family enzyme.
[0137] SEQ ID NOs: 5631 to 5638 show peptide sequences characteristic of MG2 family enzymes.
[0138] SEQ ID NOs: 9256 to 9322 show the peptide sequences of the PAM interaction domain of MG2 nuclease.
[0139] SEQ ID NOs: 11270 to 11275 show the nucleotide sequences of the target sites of MG2 nuclease.
[0140] MG3 SEQ ID NOs: 421 to 431 show the full-length peptide sequences of MG3 nuclease.
[0141] SEQ ID NO: 6803 shows the nucleotide sequence of MG3-6 nuclease, including the 5'UTR, NLS, CDS, NLS, 3'UTR, and polyA tail.
[0142] SEQ ID NOs: 2242 to 2252 show the peptide sequences of the RuvC_III domain of the above-mentioned MG3 nuclease.
[0143] SEQ ID NOs: 4056 to 4066 show peptides of the HNH domain of the above-mentioned MG3 nuclease.
[0144] SEQ ID NOs: 5495 to 5502 and 11160 to 11162 show the nucleotide sequences of MG3 tracrRNA derived from the same locus as the above-mentioned MG3 nuclease (for example, the same locus as SEQ ID NOs: 421 to 428, respectively).
[0145] SEQ ID NOs: 5466-5467, 11131, and 11567-11576 set forth the nucleotide sequences of sgRNAs engineered to function with MG3 nuclease (e.g., SEQ ID NOs: 421-423).
[0146] SEQ ID NOs: 5578-5580 show the nucleotide sequences of E. coli codon-optimized coding sequences for MG3 family enzymes.
[0147] SEQ ID NOs: 5639 to 5648 show peptide sequences characteristic of MG3 family enzymes.
[0148] SEQ ID NOs: 9323 to 9329 show the peptide sequences of the PAM interaction domain of MG3 nuclease.
[0149] SEQ ID NOs: 11108 and 11530 to 11538 show the nucleotide sequences of the single guide PAM of MG3 nuclease.
[0150] SEQ ID NOs: 11276 to 11294 show the nucleotide sequences of the target sites of MG1 nuclease.
[0151] SEQ ID NO: 11373 shows the nucleotide sequence of the DNA sequence encoding MG3-6 mRNA.
[0152] MG3a SEQ ID NOs: 7369 to 7375 show the full-length peptide sequences of MG3a nuclease.
[0153] SEQ ID NO: 11099 shows the peptide sequence of the PAM interaction domain of MG3a nuclease.
[0154] MG3b SEQ ID NOs: 7376 to 7390 show the full-length peptide sequences of MG3b nuclease.
[0155] SEQ ID NOs: 11100 to 11107 show the peptide sequences of the PAM interaction domain of MG3b nuclease.
[0156] MG4 SEQ ID NOs: 432 to 660 and 7391 to 7535 show the full-length peptide sequences of MG4 nuclease.
[0157] SEQ ID NOs: 2253 to 2481 show the peptide sequences of the RuvC_III domain of the above-mentioned MG4 nuclease.
[0158] SEQ ID NOs: 4067 to 4295 show peptides of the HNH domain of the above-mentioned MG4 nuclease.
[0159] SEQ ID NO: 5503 shows the nucleotide sequence of the MG4 tracrRNA, which is derived from the same locus as the MG4 nuclease described above.
[0160] SEQ ID NO: 5468 shows the nucleotide sequence of an sgRNA engineered to function with MG4 nuclease.
[0161] SEQ ID NO: 5649 shows a peptide sequence characteristic of an MG4 family enzyme.
[0162] SEQ ID NOs: 9330 to 9485 show the peptide sequences of the PAM interaction domain of MG4 nuclease.
[0163] SEQ ID NOs: 11295 to 11303 show the nucleotide sequences of the target sites of MG4 nuclease.
[0164] MG5 SEQ ID NOs: 7536 to 7583 show the full-length peptide sequences of MG5 nuclease.
[0165] SEQ ID NOs: 9486 to 9526 show the peptide sequences of the PAM interaction domain of MG5 nuclease.
[0166] MG6 SEQ ID NOs: 661 to 668 and 7584 to 7587 show the full-length peptide sequences of MG6 nuclease.
[0167] SEQ ID NOs: 2482 to 2489 show the peptide sequences of the RuvC_III domain of the above-mentioned MG6 nuclease.
[0168] SEQ ID NOs: 4296 to 4303 show peptides of the HNH domain of the above-mentioned MG3 nuclease.
[0169] SEQ ID NOs: 9527 to 9531 show the peptide sequences of the PAM interaction domain of MG6 nuclease.
[0170] MG7 SEQ ID NOs: 669 to 677 show the full-length peptide sequences of MG7 nuclease.
[0171] SEQ ID NOs: 2490 to 2498 show the peptide sequences of the RuvC_III domain of the above-mentioned MG7 nuclease.
[0172] SEQ ID NOs: 4304 to 4312 show peptides of the HNH domain of the above-mentioned MG3 nuclease.
[0173] SEQ ID NO: 5504 shows the nucleotide sequence of the MG7 tracrRNA, which is derived from the same locus as the MG7 nuclease described above.
[0174] SEQ ID NOs: 9532 to 9535 show the peptide sequences of the PAM interaction domain of MG7 nuclease.
[0175] MG14 SEQ ID NOs: 678 to 929 and 7588 to 7597 show the full-length peptide sequences of MG14 nuclease.
[0176] SEQ ID NOs: 2499 to 2750 show the peptide sequences of the RuvC_III domain of the above-mentioned MG14 nuclease.
[0177] SEQ ID NOs: 4313 to 4564 show peptides of the HNH domain of the above-mentioned MG14 nuclease.
[0178] SEQ ID NOs: 5505 and 11163-11167 show the nucleotide sequence of MG14 tracrRNA, which is derived from the same locus as the MG14 nuclease described above.
[0179] SEQ ID NO: 5581 shows the nucleotide sequence of an E. coli codon-optimized coding sequence for an MG14 family enzyme.
[0180] SEQ ID NOs: 5650 to 5667 show peptide sequences characteristic of MG14 family enzymes.
[0181] SEQ ID NOs: 9536 to 9611 show the peptide sequences of the PAM interaction domain of MG14 nuclease.
[0182] SEQ ID NOs: 11109 to 11113 show the nucleotide sequences of the single guide PAM of MG14 nuclease.
[0183] SEQ ID NOs: 11132-11136 show the nucleotide sequences of sgRNAs engineered to function with MG14 nuclease.
[0184] SEQ ID NOs: 11304 to 11312 show the nucleotide sequences of the target sites of MG14 nuclease.
[0185] MG15 SEQ ID NOs: 930 to 1092, 7598 to 7622, and 11593 to 11616 show the full-length peptide sequences of MG15 nuclease.
[0186] SEQ ID NOs: 2751 to 2913 show the peptide sequences of the RuvC_III domain of the above-mentioned MG15 nuclease.
[0187] SEQ ID NOs: 4565 to 4727 show peptides of the HNH domain of the above-mentioned MG15 nuclease.
[0188] SEQ ID NOs: 5506 and 11168-11172 show the nucleotide sequence of MG15 tracrRNA, which is derived from the same locus as the MG15 nuclease described above.
[0189] SEQ ID NOs: 5470 and 11577-11592 show the nucleotide sequences of sgRNAs engineered to function with MG15 nuclease.
[0190] SEQ ID NO: 5582 shows the nucleotide sequence of an E. coli codon-optimized coding sequence for an MG15 family enzyme.
[0191] SEQ ID NOs: 5668 to 5675 show peptide sequences characteristic of MG15 family enzymes.
[0192] SEQ ID NOs: 9612 to 9671 show the peptide sequences of the PAM interaction domain of MG15 nuclease.
[0193] SEQ ID NOs: 11539 to 11554 show the nucleotide sequences of the single guide PAM of MG15 nuclease.
[0194] MG16 SEQ ID NOs: 1093 to 1353 and 7623 to 7698 show the full-length peptide sequences of MG16 nuclease.
[0195] SEQ ID NOs: 2914 to 3174 show the peptide sequences of the RuvC_III domain of the above-mentioned MG16 nuclease.
[0196] SEQ ID NOs: 4728 to 4988 show peptides of the HNH domain of the above-mentioned MG16 nuclease.
[0197] SEQ ID NOs: 5507 and 11173-11174 show the nucleotide sequence of MG16 tracrRNA, which is derived from the same locus as the MG16 nuclease described above.
[0198] SEQ ID NOs: 5471 and 11137 show the nucleotide sequences of sgRNAs engineered to function with MG16 nuclease.
[0199] SEQ ID NO: 5583 shows the nucleotide sequence of an E. coli codon-optimized coding sequence for an MG16 family enzyme.
[0200] SEQ ID NOs: 5676 to 5678 show peptide sequences characteristic of MG16 family enzymes.
[0201] SEQ ID NOs: 9672 to 9842 show the peptide sequences of the PAM interaction domain of MG16 nuclease.
[0202] SEQ ID NO: 11114 shows the nucleotide sequence of the single guide PAM of MG16 nuclease.
[0203] SEQ ID NOs: 11313 to 11320 show the nucleotide sequences of the target sites of MG16 nuclease.
[0204] MG17 SEQ ID NOs: 7699 to 7715 show the full-length peptide sequences of MG17 nuclease.
[0205] SEQ ID NOs: 9843 to 9856 show the peptide sequences of the PAM interaction domain of MG17 nuclease.
[0206] SEQ ID NO: 11115 shows the nucleotide sequence of the single guide PAM of MG17 nuclease.
[0207] SEQ ID NO: 11138 shows the nucleotide sequence of an sgRNA engineered to function with MG17 nuclease.
[0208] SEQ ID NO: 11175 shows the nucleotide sequence of MG17 tracrRNA, which is derived from the same locus as the MG17 nuclease described above.
[0209] MG18 SEQ ID NOs: 1354 to 1511 show the full-length peptide sequences of MG18 nuclease.
[0210] SEQ ID NOs: 3175 to 3330 show the peptide sequences of the RuvC_III domain of the above-mentioned MG18 nuclease.
[0211] SEQ ID NOs: 4989 to 5146 show peptides of the HNH domain of the above-mentioned MG18 nuclease.
[0212] SEQ ID NO: 5508 shows the nucleotide sequence of the MG18 tracrRNA, which is derived from the same locus as the MG18 nuclease described above.
[0213] SEQ ID NO: 5472 shows the nucleotide sequence of an sgRNA engineered to function with MG18 nuclease.
[0214] SEQ ID NO: 5584 shows the nucleotide sequence of an E. coli codon-optimized coding sequence for an MG18 family enzyme.
[0215] SEQ ID NOs: 5679 to 5686 show peptide sequences characteristic of MG18 family enzymes.
[0216] SEQ ID NOs: 9857 to 9891 show the peptide sequences of the PAM interaction domain of MG18 nuclease.
[0217] SEQ ID NOs: 11321 to 11327 show the nucleotide sequences of the target sites of MG18 nuclease.
[0218] MG21 SEQ ID NOs: 1512 to 1655 and 7716 to 7733 show the full-length peptide sequences of MG21 nuclease.
[0219] SEQ ID NOs: 3331 to 3474 show the peptide sequences of the RuvC_III domain of the above-mentioned MG21 nuclease.
[0220] SEQ ID NOs: 5147 to 5290 show peptides of the HNH domain of the above-mentioned MG21 nuclease.
[0221] SEQ ID NOs: 5509 and 11176-11178 show the nucleotide sequence of MG21 tracrRNA, which is derived from the same locus as the MG21 nuclease described above.
[0222] SEQ ID NOs: 5473 and 11139 show the nucleotide sequences of sgRNAs engineered to function with MG21 nuclease.
[0223] SEQ ID NO: 5585 shows the nucleotide sequence of an E. coli codon-optimized coding sequence for an MG21 family enzyme.
[0224] SEQ ID NOs: 5687 to 5692 and 5674 to 5675 show peptide sequences characteristic of MG21 family enzymes.
[0225] SEQ ID NOs: 9892 to 9951 show the peptide sequences of the PAM interaction domain of MG21 nuclease.
[0226] SEQ ID NO: 11116 shows the nucleotide sequence of the single guide PAM of MG21 nuclease.
[0227] SEQ ID NOs: 11328 to 11336 show the nucleotide sequences of the target sites of MG21 nuclease.
[0228] MG22 SEQ ID NOs: 1656 to 1755 show the full-length peptide sequences of MG22 nuclease.
[0229] SEQ ID NOs: 3475 to 3568 show the peptide sequences of the RuvC_III domain of the above-mentioned MG22 nuclease.
[0230] SEQ ID NOs: 5291 to 5389 show peptides of the HNH domain of the above-mentioned MG22 nuclease.
[0231] SEQ ID NOs: 5510 and 11179-11180 show the nucleotide sequence of MG22 tracrRNA, which is derived from the same locus as the MG22 nuclease described above.
[0232] SEQ ID NO:5474 shows the nucleotide sequence of an sgRNA engineered to function with MG22 nuclease.
[0233] SEQ ID NO: 5586 shows the nucleotide sequence of an E. coli codon-optimized coding sequence for an MG22 family enzyme.
[0234] SEQ ID NOs: 5694 to 5699 show peptide sequences characteristic of MG22 family enzymes.
[0235] SEQ ID NOs: 9952 to 9982 show the peptide sequences of the PAM interaction domain of MG22 nuclease.
[0236] SEQ ID NOs: 11337 to 11344 show the nucleotide sequences of the target sites of MG22 nuclease.
[0237] MG23 SEQ ID NOs: 1756 to 1826 and 7734 to 7735 show the full-length peptide sequences of MG23 nuclease.
[0238] SEQ ID NOs: 3569 to 3637 show the peptide sequences of the RuvC_III domain of the above-mentioned MG23 nuclease.
[0239] SEQ ID NOs: 5390 to 5460 show peptides of the HNH domain of the above-mentioned MG23 nuclease.
[0240] SEQ ID NOs: 5511 and 11181-11182 show the nucleotide sequence of MG23 tracrRNA derived from the same locus as the MG23 nuclease described above.
[0241] SEQ ID NOs: 5475 and 11140 show the nucleotide sequences of sgRNAs engineered to function with MG23 nuclease.
[0242] SEQ ID NO: 5587 shows the nucleotide sequence of an E. coli codon-optimized coding sequence for an MG23 family enzyme.
[0243] SEQ ID NOs: 5700 to 5717 show peptide sequences characteristic of MG23 family enzymes.
[0244] SEQ ID NOs: 9983 to 10004 show the peptide sequences of the PAM interaction domain of MG23 nuclease.
[0245] SEQ ID NOs: 11345 to 11351 show the nucleotide sequences of the target sites of MG23 nuclease.
[0246] MG24 SEQ ID NOs: 7736 to 8027 show the full-length peptide sequences of MG24 nuclease.
[0247] SEQ ID NOs: 10005 to 10162 show the peptide sequences of the PAM interaction domain of MG24 nuclease.
[0248] MG25 SEQ ID NOs: 8028 to 8091 show the full-length peptide sequences of MG25 nuclease.
[0249] SEQ ID NOs: 10163 to 10211 show the peptide sequences of the PAM interaction domain of MG25 nuclease.
[0250] MG38 SEQ ID NOs: 8092 to 8095 show the full-length peptide sequences of MG38 nuclease.
[0251] SEQ ID NOs: 10212 to 10214 show the peptide sequences of the PAM interaction domain of MG38 nuclease.
[0252] MG40 SEQ ID NOs: 5718 to 5750 and 8096 to 8163 show the full-length peptide sequences of MG40 nuclease.
[0253] SEQ ID NOs:5847-5852 show protospacer adjacent motifs associated with MG40 nuclease.
[0254] SEQ ID NOs: 5862-5873 show the nucleotide sequences of sgRNAs engineered to function with MG40 nuclease.
[0255] SEQ ID NOs: 10215 to 10263 show the peptide sequences of the PAM interaction domain of MG40 nuclease.
[0256] SEQ ID NOs: 11183-11188 show the nucleotide sequence of MG40 tracrRNA, which is derived from the same locus as the MG40 nuclease described above.
[0257] MG41 SEQ ID NOs: 8164 to 8286 show the full-length peptide sequences of MG41 nuclease.
[0258] SEQ ID NOs: 10264 to 10304 show the peptide sequences of the PAM interaction domain of MG41 nuclease.
[0259] MG42 SEQ ID NOs: 8287 to 8356 show the full-length peptide sequences of MG42 nuclease.
[0260] SEQ ID NOs: 10305 to 10355 show the peptide sequences of the PAM interaction domain of MG42 nuclease.
[0261] MG43 SEQ ID NOs: 8357 to 8453 show the full-length peptide sequences of MG43 nuclease.
[0262] SEQ ID NOs: 10356 to 10412 show the peptide sequences of the PAM interaction domain of MG43 nuclease.
[0263] SEQ ID NO: 11117 shows the nucleotide sequence of the single guide PAM of MG43 nuclease.
[0264] SEQ ID NO: 11141 shows the nucleotide sequence of an sgRNA engineered to function with MG43 nuclease.
[0265] SEQ ID NO: 11189 shows the nucleotide sequence of MG43 tracrRNA, which is derived from the same locus as the MG43 nuclease described above.
[0266] MG44 SEQ ID NOs: 8454 to 8496 show the full-length peptide sequences of MG44 nuclease.
[0267] SEQ ID NOs: 10413 to 10555 show the peptide sequences of the PAM interaction domain of MG44 nuclease.
[0268] SEQ ID NO: 11190 shows the nucleotide sequence of the MG44 tracrRNA, which is derived from the same locus as the MG44 nuclease described above.
[0269] MG46 SEQ ID NOs: 8497 to 8634 show the full-length peptide sequences of MG46 nuclease.
[0270] SEQ ID NOs: 10556 to 10633 show the peptide sequences of the PAM interaction domain of MG46 nuclease.
[0271] SEQ ID NO: 11191 shows the nucleotide sequence of MG46 tracrRNA, which is derived from the same locus as the MG46 nuclease described above.
[0272] MG47 SEQ ID NOs: 5751 to 5768 and 8635 to 8664 show the full-length peptide sequences of MG47 nuclease.
[0273] SEQ ID NOs:5853-5854 show protospacer adjacent motifs associated with MG47 nuclease.
[0274] SEQ ID NOs: 5878-5881 show the nucleotide sequences of sgRNAs engineered to function with MG47 nuclease.
[0275] SEQ ID NOs: 10634 to 10656 show the peptide sequences of the PAM interaction domain of MG47 nuclease.
[0276] SEQ ID NOs: 11192-11193 show the nucleotide sequence of MG47 tracrRNA, which is derived from the same locus as the MG47 nuclease described above.
[0277] MG48 SEQ ID NOs: 5769-5804 and 8665 show the full-length peptide sequences of MG48 nuclease.
[0278] SEQ ID NOs:5855-5856 show protospacer adjacent motifs associated with MG48 nuclease.
[0279] SEQ ID NOs: 5886, 5890, 5893, and 11194 show the nucleotide sequence of MG48 tracrRNA, which is derived from the same locus as the MG48 nuclease described above.
[0280] SEQ ID NOs: 5887, 5891, and 5894 show CRISPR repeats associated with the MG48 nuclease described herein.
[0281] SEQ ID NOs: 5888-5889, 5892, and 5895-5896 set forth putative sgRNAs designed to function with MG48 nuclease.
[0282] SEQ ID NOs: 10657 to 10662 show the peptide sequences of the PAM interaction domain of MG48 nuclease.
[0283] SEQ ID NOs: 11142-11143 show the nucleotide sequences of sgRNAs engineered to function with MG48 nuclease.
[0284] MG49 SEQ ID NOs: 5805 to 5823 and 8666 to 8677 show the full-length peptide sequences of MG49 nuclease.
[0285] SEQ ID NOs:5857-5858 show protospacer adjacent motifs associated with MG49 nuclease.
[0286] SEQ ID NOs: 5862-5873 show the nucleotide sequences of sgRNAs engineered to function with MG40 nuclease.
[0287] SEQ ID NOs: 5876-5877 show the nucleotide sequences of sgRNAs engineered to function with MG49 nuclease.
[0288] SEQ ID NOs: 10663 to 10675 show the peptide sequences of the PAM interaction domain of MG49 nuclease.
[0289] SEQ ID NOs: 11195-11196 show the nucleotide sequence of MG49 tracrRNA, which is derived from the same locus as the MG49 nuclease described above.
[0290] MG50 SEQ ID NOs: 5824 to 5826 and 8678 to 8682 show the full-length peptide sequences of MG50 nuclease.
[0291] SEQ ID NO:5859 shows the protospacer adjacent motif associated with MG50 nuclease.
[0292] SEQ ID NOs: 5884-5885 show the nucleotide sequences of sgRNAs engineered to function with MG50 nuclease.
[0293] SEQ ID NOs: 10676 to 10682 show the peptide sequences of the PAM interaction domain of MG50 nuclease.
[0294] SEQ ID NO: 11197 shows the nucleotide sequence of the MG50 tracrRNA, which is derived from the same locus as the MG50 nuclease described above.
[0295] MG51 SEQ ID NOs: 5827 to 5830 and 8683 to 8705 show the full-length peptide sequences of MG51 nuclease.
[0296] SEQ ID NO:5860 shows the protospacer adjacent motif associated with MG51 nuclease.
[0297] SEQ ID NOs: 5882-5883 show the nucleotide sequences of sgRNAs engineered to function with MG51 nuclease.
[0298] SEQ ID NOs: 10683 to 10704 show the peptide sequences of the PAM interaction domain of MG51 nuclease.
[0299] SEQ ID NO: 11198 shows the nucleotide sequence of the MG51 tracrRNA, which is derived from the same locus as the MG51 nuclease described above.
[0300] MG52 SEQ ID NOs: 5831 to 5846 and 8706 show the full-length peptide sequences of MG52 nuclease.
[0301] SEQ ID NO:5861 shows the protospacer adjacent motif associated with MG52 nuclease.
[0302] SEQ ID NOs: 5874-5875 show the nucleotide sequences of sgRNAs engineered to function with MG52 nuclease.
[0303] SEQ ID NOs: 10705 to 10710 show the peptide sequences of the PAM interaction domain of MG52 nuclease.
[0304] SEQ ID NO: 11199 shows the nucleotide sequence of the MG52 tracrRNA, which is derived from the same locus as the MG52 nuclease described above.
[0305] MG71 SEQ ID NOs: 10711 to 10712 show the peptide sequences of the PAM interaction domain of MG71 nuclease.
[0306] SEQ ID NOs: 11144-11145 show the nucleotide sequences of sgRNAs engineered to function with MG71 nuclease.
[0307] SEQ ID NOs: 11200-11201 show the nucleotide sequence of MG71 tracrRNA, which is derived from the same locus as the MG71 nuclease described above.
[0308] MG72 SEQ ID NO: 11202 shows the nucleotide sequence of the MG72 tracrRNA, which is derived from the same locus as the MG72 nuclease described above.
[0309] MG73 SEQ ID NOs: 10713 to 10718 show the peptide sequences of the PAM interaction domain of MG73 nuclease.
[0310] SEQ ID NOs: 11203-11204 show the nucleotide sequence of MG73 tracrRNA, which is derived from the same locus as the MG73 nuclease described above.
[0311] MG74 SEQ ID NOs: 10719 to 10732 show the peptide sequences of the PAM interaction domain of MG74 nuclease.
[0312] SEQ ID NO: 11205 shows the nucleotide sequence of the MG74 tracrRNA, which is derived from the same locus as the MG74 nuclease described above.
[0313] MG86 SEQ ID NOs: 8707 to 8737 show the full-length peptide sequences of MG86 nuclease.
[0314] SEQ ID NOs: 10733 to 10791 show the peptide sequences of the PAM interaction domain of MG86 nuclease.
[0315] SEQ ID NO: 11118 shows the nucleotide sequence of the single guide PAM of MG86 nuclease.
[0316] SEQ ID NOs: 11206-11207 show the nucleotide sequence of MG86 tracrRNA, which is derived from the same locus as the MG86 nuclease described above.
[0317] MG87 SEQ ID NOs: 8738 to 8747 show the full-length peptide sequences of MG87 nuclease.
[0318] SEQ ID NOs: 10792 to 10828 show the peptide sequences of the PAM interaction domain of MG87 nuclease.
[0319] SEQ ID NOs: 11208-11210 show the nucleotide sequence of MG87 tracrRNA, which is derived from the same locus as the MG87 nuclease described above.
[0320] MG88 SEQ ID NOs: 10829 to 10841 show the peptide sequences of the PAM interaction domain of MG88 nuclease.
[0321] SEQ ID NOs: 11211-11213 show the nucleotide sequence of MG88 tracrRNA, which is derived from the same locus as the MG88 nuclease described above.
[0322] MG89 SEQ ID NOs: 10842 to 10854 show the peptide sequences of the PAM interaction domain of MG89 nuclease.
[0323] SEQ ID NOs: 11214-11215 show the nucleotide sequence of MG89 tracrRNA, which is derived from the same locus as the MG89 nuclease described above.
[0324] MG94 SEQ ID NOs: 8748 to 8781 show the full-length peptide sequences of MG94 nuclease.
[0325] SEQ ID NOs: 10855 to 10860 show the peptide sequences of the PAM interaction domain of MG94 nuclease.
[0326] SEQ ID NOs: 11119-11120 show the nucleotide sequence of the single guide PAM of MG94 nuclease.
[0327] SEQ ID NOs: 11146-11147 show the nucleotide sequences of sgRNAs engineered to function with MG94 nuclease.
[0328] SEQ ID NOs: 11216-11217 show the nucleotide sequence of MG94 tracrRNA, which is derived from the same locus as the MG94 nuclease described above.
[0329] MG95 SEQ ID NOs: 8782 to 8785 show the full-length peptide sequences of MG95 nuclease.
[0330] SEQ ID NOs: 10861 to 10863 show the peptide sequences of the PAM interaction domain of MG95 nuclease.
[0331] SEQ ID NOs: 11121-11122 show the nucleotide sequence of the single guide PAM of MG95 nuclease.
[0332] SEQ ID NOs: 11148-11149 show the nucleotide sequences of sgRNAs engineered to function with MG95 nuclease.
[0333] SEQ ID NOs: 11218-11219 show the nucleotide sequence of MG95 tracrRNA, which is derived from the same locus as the MG95 nuclease described above.
[0334] MG96 SEQ ID NOs: 8786 to 8814 show the full-length peptide sequences of MG96 nuclease.
[0335] SEQ ID NOs: 10864 to 10884 show the peptide sequences of the PAM interaction domain of MG96 nuclease.
[0336] SEQ ID NO: 11123 shows the nucleotide sequence of the single guide PAM of MG96 nuclease.
[0337] SEQ ID NO: 11150 shows the nucleotide sequence of an sgRNA engineered to function with MG96 nuclease.
[0338] SEQ ID NO: 11220 shows the nucleotide sequence of the MG96 tracrRNA, which is derived from the same locus as the MG96 nuclease described above.
[0339] MG97 SEQ ID NOs: 8815 to 8818 show the full-length peptide sequences of MG97 nuclease.
[0340] SEQ ID NOs: 10885 to 10887 show the peptide sequences of the PAM interaction domain of MG97 nuclease.
[0341] MG98 SEQ ID NOs: 8819 to 8959 show the full-length peptide sequences of MG98 nuclease.
[0342] SEQ ID NOs: 10888 to 10936 show the peptide sequences of the PAM interaction domain of MG98 nuclease.
[0343] SEQ ID NOs: 11124-11125 show the nucleotide sequence of the single guide PAM of MG98 nuclease.
[0344] SEQ ID NOs: 11151-11152 show the nucleotide sequences of sgRNAs engineered to function with MG98 nuclease.
[0345] SEQ ID NOs: 11221-11222 show the nucleotide sequence of MG98 tracrRNA, which is derived from the same locus as the MG98 nuclease described above.
[0346] MG99 SEQ ID NO: 11153 shows the nucleotide sequence of an sgRNA engineered to function with MG99 nuclease.
[0347] SEQ ID NO: 11223 shows the nucleotide sequence of the MG99 tracrRNA, which is derived from the same locus as the MG99 nuclease described above.
[0348] MG100 SEQ ID NOs: 8960 to 9036 show the full-length peptide sequences of MG100 nuclease.
[0349] SEQ ID NOs: 10937 to 10991 show the peptide sequences of the PAM interaction domain of MG100 nuclease.
[0350] SEQ ID NO: 11126 shows the nucleotide sequence of the single guide PAM of MG100 nuclease.
[0351] SEQ ID NOs: 11154-11155 show the nucleotide sequences of sgRNAs engineered to function with MG100 nuclease.
[0352] SEQ ID NOs: 11224-11225 show the nucleotide sequence of MG100 tracrRNA, which is derived from the same locus as the MG100 nuclease described above.
[0353] MG111 SEQ ID NOs: 9037 to 9126 show the full-length peptide sequences of MG111 nuclease.
[0354] SEQ ID NOs: 10992 to 11046 show the peptide sequences of the PAM interaction domain of MG111 nuclease.
[0355] SEQ ID NOs: 11127-11128 show the nucleotide sequence of the single guide PAM of MG111 nuclease.
[0356] SEQ ID NOs: 11156-11157 show the nucleotide sequences of sgRNAs engineered to function with MG111 nuclease.
[0357] SEQ ID NOs: 11226-11227 show the nucleotide sequence of MG111 tracrRNA, which is derived from the same locus as the MG111 nuclease described above.
[0358] MG112 SEQ ID NOs: 9127 to 9149 show the full-length peptide sequences of MG112 nuclease.
[0359] SEQ ID NOs: 11047 to 11062 show the peptide sequences of the PAM interaction domain of MG112 nuclease.
[0360] MG116 SEQ ID NOs: 9150 to 9191 show the full-length peptide sequences of MG116 nuclease.
[0361] SEQ ID NOs: 11063 to 11098 show the peptide sequences of the PAM interaction domain of MG116 nuclease.
[0362] SEQ ID NO: 11129 shows the nucleotide sequence of the single guide PAM of MG116 nuclease.
[0363] SEQ ID NO: 11158 shows the nucleotide sequence of an sgRNA engineered to function with MG116 nuclease.
[0364] SEQ ID NO: 11228 shows the nucleotide sequence of MG116 tracrRNA, which is derived from the same locus as the MG116 nuclease described above.
[0365] MG123 SEQ ID NOs: 11617 to 11624 show the full-length peptide sequences of MG123 nuclease.
[0366] SEQ ID NO: 11518 shows the nucleotide sequence of the single guide PAM of MG123 nuclease.
[0367] SEQ ID NO: 11555 shows the nucleotide sequence of an sgRNA engineered to function with MG123 nuclease.
[0368] MG124 SEQ ID NOs: 11625-11626 show the full-length peptide sequence of MG124 nuclease.
[0369] SEQ ID NO: 11519 shows the nucleotide sequence of the single guide PAM of MG124 nuclease.
[0370] SEQ ID NO: 11556 shows the nucleotide sequence of an sgRNA engineered to function with MG124 nuclease.
[0371] MG125 SEQ ID NOs: 11627 to 11707 show the full-length peptide sequences of MG125 nuclease.
[0372] SEQ ID NOs: 11520 to 11524 show the nucleotide sequences of the single guide PAM of MG125 nuclease.
[0373] SEQ ID NOs: 11557-11561 show the nucleotide sequences of sgRNAs engineered to function with MG125 nuclease.
[0374] MG150 SEQ ID NOs: 7359 to 7368 and 11708 to 11710 show the full-length peptide sequences of MG150 nuclease.
[0375] SEQ ID NOs: 11525 to 11529 show the nucleotide sequences of the single guide PAM of MG150 nuclease.
[0376] SEQ ID NOs: 11562-11566 show the nucleotide sequences of sgRNAs engineered to function with MG150 nuclease.
[0377] B2M targeting SEQ ID NOs: 6305-6386 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target B2M.
[0378] SEQ ID NOs: 6387 to 6468 show the DNA sequences of the B2M target sites.
[0379] TRAC targeting SEQ ID NOs: 6469-6508 and 6804 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target TRAC.
[0380] SEQ ID NOs: 6509-6548 and 6805 show the DNA sequences of the TRAC target sites.
[0381] HPRT targeting SEQ ID NOs: 6549-6615 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target HPRT.
[0382] SEQ ID NOs: 6616 to 6682 show the DNA sequences of the HPRT target sites. MG3-6 TRBC1 / 2 targeting
[0383] SEQ ID NOs: 6683-6721 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target TRBC1 / 2.
[0384] SEQ ID NOs: 6722 to 6760 show the DNA sequences of the TRBC1 / 2 target sites. MG3-8 TRBC1 / 2 targeting
[0385] SEQ ID NOs: 6761-6781 show the nucleotide sequences of sgRNAs engineered to function with MG3-8 nuclease to target TRBC1 / 2.
[0386] SEQ ID NOs: 6782 to 6802 show the DNA sequences of the TRBC1 / 2 target sites. MG3-6 CD2 targeting
[0387] SEQ ID NOs: 6811-6852 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target CD2.
[0388] SEQ ID NOs: 6853 to 6894 show the DNA sequences of the CD2 target sites. MG3-6 CD5 targeting
[0389] SEQ ID NOs: 6895-6958 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target CD5.
[0390] SEQ ID NOs: 6959 to 7022 show the DNA sequences of the CD5 target site. MG3-6 FAS targeting
[0391] SEQ ID NOs: 7023-7056 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target FAS.
[0392] SEQ ID NOs: 7057 to 7090 show the DNA sequences of the FAS target sites. MG3-6 PD-1 targeting
[0393] SEQ ID NOs: 7091-7128 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target PD-1.
[0394] SEQ ID NOs: 7129 to 7166 show the DNA sequences of PD-1 target sites. MG3-6 hRosa26 targeting
[0395] SEQ ID NOs: 7167-7198 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target hRosa26.
[0396] SEQ ID NOs: 7199 to 7230 show the DNA sequences of the hRosa26 target sites. MG21-1 TRAC targeting
[0397] SEQ ID NOs: 7231-7234 show the nucleotide sequences of sgRNAs engineered to function with MG21-1 nuclease to target TRAC.
[0398] SEQ ID NOs: 7235 to 7238 show the DNA sequences of the TRAC target sites. MG23-1 TRAC targeting
[0399] SEQ ID NOs: 7239-7247 show the nucleotide sequences of sgRNAs engineered to function with MG23-1 nuclease to target TRAC.
[0400] SEQ ID NOs: 7248-7256 show the DNA sequences of the TRAC target sites. MG14-241 AAVS1 targeting
[0401] SEQ ID NOs: 11508-11510 show the nucleotide sequences of sgRNAs engineered to function with MG14-241 nuclease to target AAVS1.
[0402] SEQ ID NOs: 11511 to 11513 show the DNA sequences of the AAVS1 target site. MG23-1 AAVS1 targeting
[0403] SEQ ID NOs: 7257-7260 show the nucleotide sequences of sgRNAs engineered to function with MG23-1 nuclease to target AAVS1.
[0404] SEQ ID NOs: 7261 to 7264 show the DNA sequence of the AAVS1 target site. MG71-2 AAVS1 targeting
[0405] SEQ ID NOs: 7265-7266 show the nucleotide sequences of sgRNAs engineered to function with MG71-2 nuclease to target AAVS1.
[0406] SEQ ID NOs: 7267-7268 show the DNA sequence of the AAVS1 target site. MG73-1 TRAC targeting
[0407] SEQ ID NO: 7269 shows the nucleotide sequence of an sgRNA engineered to function with MG73-1 nuclease to target TRAC.
[0408] SEQ ID NO: 7270 shows the DNA sequence of the TRAC target site. MG89-2 TRAC targeting
[0409] SEQ ID NOs: 7271-7277 show the nucleotide sequences of sgRNAs engineered to function with MG89-2 nuclease to target TRAC.
[0410] SEQ ID NOs: 7278-7284 show the DNA sequences of the TRAC target sites. MG99-1 TRAC targeting
[0411] SEQ ID NOs: 11514-11515 show the nucleotide sequences of sgRNAs engineered to function with MG99-1 nuclease to target TRAC.
[0412] SEQ ID NOs: 11516-11517 show the DNA sequences of the TRAC target sites. MG3-6 Human HAO-1 targeting
[0413] SEQ ID NOs: 11352-11372 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target HAO-1. MG3-6 human GPR146 targeting
[0414] SEQ ID NOs: 11374-11405 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target human GPR146.
[0415] SEQ ID NOs: 11406 to 11437 show the DNA sequences of the human GPR146 target site. MG3-6 Mouse GPR146 Targeting
[0416] SEQ ID NOs: 11438-11472 show the nucleotide sequences of sgRNAs engineered to function with MG3-6 nuclease to target mouse GPR146.
[0417] SEQ ID NOs: 11473 to 11507 show the DNA sequence of the mouse GPR146 target site. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0418] While various embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions may occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be used.
[0419] The practice of some of the methods disclosed herein employs, unless otherwise indicated, techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA. See, e.g., Sambrook and Green, Molecular Cloning: A Laboratory Manual, 4 thEdition (2012), the series Current Protocols in Molecular Biology (FMAusubel, et al. eds.), the series Methods In Enzymology (Academic Press, Inc.), PCR 2:A Practical Approach (MJ MacPherson, BD Hames and GRTaylor eds. (1995)), Harlow and Lane, eds. (1988) Antibodies, A Laboratory Manual, and Culture of Animal Cells:A Manual of Basic Technique and Specialized Applications,6 th Edition (RI Freshney, ed. (2010)), which is hereby incorporated by reference in its entirety.
[0420] As used herein, the singular forms "a," "an," and "the" are intended to include the plural forms unless the context clearly indicates otherwise. Furthermore, to the extent the terms "comprising," "including," "having," "having," "having," or variations thereof are used in either the detailed description and / or claims, such terms are intended to be inclusive in a manner similar to the term "comprising."
[0421] The term "about" or "approximately" means within an acceptable error range for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within one or more standard deviations, as is customary in the art. Alternatively, "about" can mean within a range of up to 20%, up to 15%, up to 10%, up to 5%, or up to 1% of a given value.
[0422] As used herein, "cell" generally refers to a biological cell. A cell may be the basic structural, functional, or biological unit of a living organism. A cell may originate from any organism having one or more cells. Some non-limiting examples include prokaryotic cells, eukaryotic cells, bacterial cells, archaeal cells, single-cell eukaryotic cells, protozoan cells, cells from plants (e.g., cells from plant crops, fruits, vegetables, grains, soybeans, corn, maize, wheat, seeds, tomatoes, rice, cassava, sugarcane, pumpkins, hay, potatoes, cotton, cannabis, tobacco, flowering plants, conifers, gymnosperms, ferns, club mosses, hornworts, bryophytes, mosses), algae cells (e.g., Botryococcus braunii, Chlamydomonas reinhardtii, Nannochloropsis gaditana, Chlorella pyrenoidosa, Sargassum patens C. agarwal), and the like). C. Agardh), seaweed (e.g., kelp), fungal cells (e.g., yeast cells, cells from mushrooms), animal cells, cells from vertebrates (e.g., fruit flies, cnidarians, echinoderms, nematodes, etc.), cells from vertebrates (e.g., fish, amphibians, reptiles, birds, mammals), cells from mammals (e.g., pigs, cows, goats, sheep, rodents, rats, mice, non-human primates, humans, etc.), etc. In some cases, the cells are not derived from a naturally occurring organism (e.g., the cells may be synthetically produced and sometimes referred to as artificial cells).
[0423] As used herein, the term "nucleotide" generally refers to a base-sugar-phosphate combination. A nucleotide may include synthetic nucleotides. A nucleotide may include synthetic nucleotide analogs. A nucleotide may be a monomeric unit of a nucleic acid sequence (e.g., deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)). The term nucleotide may include ribonucleoside triphosphates adenosine triphosphate (ATP), uridine triphosphate (UTP), cytosine triphosphate (CTP), guanosine triphosphate (GTP) and deoxyribonucleoside triphosphates, such as dATP, dCTP, dITP, dUTP, dGTP, dTTP, or derivatives thereof. Such derivatives may include, for example, [αS]dATP, 7-deaza-dGTP and 7-deaza-dATP, as well as nucleotide derivatives that confer nuclease resistance to nucleic acid molecules containing them. As used herein, the term nucleotide may refer to dideoxyribonucleoside triphosphates (ddNTPs) and their derivatives. Examples of dideoxyribonucleoside triphosphates include, but are not limited to, ddATP, ddCTP, ddGTP, ddITP, and ddTTP. Nucleotides may be unlabeled or detectably labeled, such as by using a moiety that includes an optically detectable moiety (e.g., a fluorophore). Labeling may also be performed using quantum dots. Detectable labels may include, for example, radioisotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels, and enzyme labels. Fluorescent labels for nucleotides include, but are not limited to, fluorescein, 5-carboxyfluorescein (FAM), 2'7'-dimethoxy-4'5-dichloro-6-carboxyfluorescein (JOE), rhodamine, 6-carboxyrhodamine (R6G), N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), 6-carboxy-X-rhodamine (ROX), 4-(4'dimethylaminophenylazo)benzoic acid (DABCYL), Cascade Blue, Oregon Green, Texas Red, cyanine, and 5-(2'-aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS).Specific examples of fluorescently labeled nucleotides include [R6G]dUTP, [TAMRA]dUTP, [R110]dCTP, [R6G]dCTP, [TAMRA]dCTP, [JOE]ddATP, [R6G]ddATP, [FAM]ddCTP, [R110]ddCTP, [TAMRA]ddGTP, [ROX]ddTTP, [dR6G]ddATP, [dR110]ddCTP, [dTAMRA]ddGTP, and [dROX]ddTTP available from Perkin Elmer, Foster City, Calif.; fluoro-conjugated deoxynucleotides, fluoro-conjugated Cy3-dCTP, fluoro-conjugated Cy5-dCTP, fluoro-conjugated fluoro-X-dCTP, fluoro-conjugated Cy3-dUTP, and fluoro-conjugated Cy5-dUTP available from Amersham, Arlington Heights, Ill.; Fluorescein-15-dATP, fluorescein-12-dUTP, tetramethyl-rhodamine-6-dUTP, IR770-9-dATP, fluorescein-12-ddUTP, fluorescein-12-UTP, and fluorescein-15-2'-dATP available from Mannheim, Indianapolis, Ind., and Molecular Examples of chromosomal labeling nucleotides available from Probes, Eugene, Oreg. include BODIPY-FL-14-UTP, BODIPY-FL-4-UTP, BODIPY-TMR-14-UTP, BODIPY-TMR-14-dUTP, BODIPY-TR-14-UTP, BODIPY-TR-14-dUTP, Cascade Blue-7-UTP, Cascade Blue-7-dUTP, Fluorescein-12-UTP, Fluorescein-12-dUTP, Oregon Green 488-5-dUTP, Rhodamine Green-5-UTP, Rhodamine Green-5-dUTP, Tetramethylrhodamine-6-UTP, Tetramethylrhodamine-6-dUTP, Texas Red-5-UTP, Texas Red-5-dUTP, and Texas Red-12-dUTP. Nucleotides may also be labeled or marked by chemical modification. The chemically modified single nucleotide may be a biotin-dNTP.Some non-limiting examples of biotinylated dNTPs include biotin-dATP (e.g., bio-N6-ddATP, biotin-14-dATP), biotin-dCTP (e.g., biotin-11-dCTP, biotin-14-dCTP), and biotin-dUTP (e.g., biotin-11-dUTP, biotin-16-dUTP, biotin-20-dUTP).
[0424] The terms "polynucleotide", "oligonucleotide", and "nucleic acid" are generally used interchangeably to refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof, in single-stranded, double-stranded, or multiple-stranded form. A polynucleotide may be exogenous or endogenous to a cell. A polynucleotide may be present in a cell-free environment. A polynucleotide may be a gene or a fragment thereof. A polynucleotide may be DNA. A polynucleotide may be RNA. A polynucleotide may have any three-dimensional structure and may perform any function. A polynucleotide may contain one or more analogs (e.g., modified backbones, sugars, or nucleobases). If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer. Some non-limiting examples of analogs include 5-bromouracil, peptide nucleic acid, heterologous nucleic acid, morpholino, locked nucleic acid, glycol nucleic acid, threose nucleic acid, dideoxynucleotides, cordycepin, 7-deaza-GTP, fluorophores (e.g., rhodamine or fluorescein attached to the sugar), thiol-containing nucleotides, biotin-linked nucleotides, fluorescent base analogs, CpG islands, methyl-7-guanosine, methylated nucleotides, inosine, thiouridine, pseudouridine, dihydrouridine, queosine, and wyosine. Non-limiting examples of polynucleotides include coding or non-coding regions of genes or gene fragments, loci (locuses) defined from binding analysis, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), short hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, cell-free polynucleotides including cell-free DNA (cfDNA) and cell-free RNA (cfRNA), nucleic acid probes, and primers. The sequence of nucleotides may be interrupted by non-nucleotide components.
[0425] The term "transfection" or "transfected" generally refers to the introduction of a nucleic acid into a cell by non-viral or viral-based methods. The nucleic acid molecule may be a genetic sequence encoding a complete protein or a functional portion thereof. See, e.g., Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, 18.1-18.88.
[0426] The terms "peptide", "polypeptide" and "protein" are used interchangeably herein and generally refer to a polymer of at least two amino acid residues linked by peptide bonds. The term does not refer to a particular length of the polymer, and is not intended to imply or distinguish whether the peptide is produced using recombinant technology, chemical or enzymatic synthesis, or naturally occurring. The term applies to naturally occurring amino acid polymers as well as amino acid polymers that contain at least one modified amino acid. In some cases, the polymer may be interrupted by non-amino acids. The term includes amino acid chains of any length, including full-length proteins and proteins with or without secondary or tertiary structure (e.g., domains). The term also encompasses amino acid polymers that have been modified by any other manipulation, such as, for example, disulfide bond formation, glycosylation, lipid formation, acetylation, phosphorylation, oxidation, and conjugation with a labeling component. As used herein, the terms "amino acid" and "amino acids" generally refer to natural and unnatural amino acids, including, but not limited to, modified amino acids and amino acid analogs. Modified amino acids may include natural amino acids and unnatural amino acids, which are chemically modified to include a non-naturally occurring group or chemical moiety on the amino acid. An amino acid analog may refer to an amino acid derivative. The term "amino acid" includes both D- and L-amino acids.
[0427] As used herein, "non-natural" may generally refer to a nucleic acid or polypeptide sequence that is not found in a natural nucleic acid or protein. Non-natural may refer to an affinity tag. Non-natural may refer to a fusion. Non-natural may refer to a naturally occurring nucleic acid or polypeptide sequence that includes a mutation, insertion, or deletion. A non-natural sequence may exhibit or encode an activity (e.g., an enzyme activity, a methyltransferase activity, an acetyltransferase activity, a kinase activity, an ubiquitination activity, etc.) that may also be exhibited by the nucleic acid or polypeptide sequence to which the non-natural sequence is fused. A non-natural nucleic acid or polypeptide sequence may be linked to a naturally occurring nucleic acid or polypeptide sequence (or a variant thereof) by genetic engineering to generate a chimeric nucleic acid or polypeptide sequence that encodes a chimeric nucleic acid or polypeptide.
[0428] As used herein, the term "promoter" generally refers to a regulatory DNA region that controls the transcription or expression of a gene and may be located adjacent to or overlapping the nucleotide or region of nucleotides where RNA transcription is initiated. A promoter may contain specific DNA sequences that bind protein factors, often called transcription factors, which promote the binding of RNA polymerase to DNA to result in gene transcription. A "basal promoter", also called a "core promoter", may generally refer to a promoter that contains all the basic elements to promote the transcriptional expression of an operably linked polynucleotide. A eukaryotic basal promoter may contain a TATA-box and / or a CAAT box.
[0429] As used herein, the term "expression" generally refers to the process by which a nucleic acid sequence or polynucleotide is transcribed from a DNA template (e.g., into mRNA or other RNA transcript) or by which a transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. The transcript and the encoded polypeptide may be collectively referred to as a "gene product." If the polynucleotide is derived from genomic DNA, expression includes splicing of the mRNA in eukaryotic cells.
[0430] As used herein, "operably linked," "operably linked," "operably linked," or grammatical equivalents thereof generally refer to the juxtaposition of genetic elements, such as promoters, enhancers, polyadenylation sequences, and the like, where the elements are in a relationship that allows them to operate in an expected manner. For example, a regulatory element, which may include a promoter sequence or an enhancer sequence, is operably linked to a coding region if the regulatory element helps initiate transcription of the coding sequence. There may be intervening residues between the regulatory element and the coding region, so long as this functional relationship is maintained.
[0431] As used herein, a "vector" generally refers to a polymer or an association of polymers that contains or associates with a polynucleotide and can be used to mediate delivery of the polynucleotide to a cell. Examples of vectors include plasmids, viral vectors, liposomes, and other gene delivery vehicles. A vector generally includes genetic elements, such as control elements, operably linked to a gene to facilitate expression of the gene in a target.
[0432] As used herein, "expression cassette" and "nucleic acid cassette" are generally used interchangeably to refer to a combination of nucleic acid sequences or elements that are expressed together or operably linked for expression. In some cases, an expression cassette refers to a combination of a gene or genes with regulatory elements that are operably linked for expression.
[0433] A "functional fragment" of a DNA or protein sequence generally refers to a fragment that retains a biological activity (either functional or structural) substantially similar to that of the full-length DNA or protein sequence. The biological activity of a DNA sequence may be the ability to affect expression in a manner attributable to the full-length sequence.
[0434] As used herein, an "engineered" subject generally refers to a subject that has been modified by human intervention. By way of non-limiting examples, a nucleic acid may be modified by altering its sequence to a sequence that does not occur in nature, a nucleic acid may be modified by ligating to a nucleic acid with which it is not naturally associated such that the ligated product has a function not present in the original nucleic acid, an engineered nucleic acid may be synthesized in vitro with a sequence that does not occur in nature, a protein may be modified by changing its amino acid sequence to a sequence that does not occur in nature, and an engineered protein may acquire a new function or property. An "engineered" system includes at least one engineered component.
[0435] As used herein, "synthetic" and "artificial" are used interchangeably to refer to proteins or domains thereof that have low sequence identity (e.g., less than 50% sequence identity, less than 25% sequence identity, less than 10% sequence identity, less than 5% sequence identity, less than 1% sequence identity) with naturally occurring human proteins. For example, the VPR domain and the VP64 domain are synthetic transactivation domains.
[0436] As used herein, the term "tracrRNA" or "tracr sequence" can generally refer to a nucleic acid having at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% sequence identity or similarity to a wild-type exemplary tracrRNA sequence (e.g., tracrRNA from S.pyogenes, S.aureus, etc., or SEQ ID NOs: 5476-5511). A tracrRNA can refer to a nucleic acid having up to about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% sequence identity or similarity to a wild-type exemplary tracrRNA sequence (e.g., tracrRNA from S.pyogenes, S.aureus, etc.). tracrRNA can refer to modified forms of tracrRNA that may include nucleotide changes such as deletions, insertions, or substitutions, variants, mutations, or chimeras. tracrRNA can refer to a nucleic acid that may be at least about 60% identical to a wild-type exemplary tracrRNA (e.g., tracrRNA from S.pyogenes, S.aureus, etc.) sequence over a stretch of at least six consecutive nucleotides. For example, a tracrRNA sequence may be at least about 60% identical, at least about 65% identical, at least about 70% identical, at least about 75% identical, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical, or 100% identical to a wild-type exemplary tracrRNA (e.g., tracrRNA from S.pyogenes, S.aureus, etc.) sequence over a section of at least six consecutive nucleotides. Type II tracrRNA sequences can be predicted on a genomic sequence by identifying regions that have complementarity to parts of the repeat sequences in the adjacent CRISPR array.
[0437] As used herein, a "guide nucleic acid" can generally refer to a nucleic acid that can hybridize to another nucleic acid. A guide nucleic acid can be RNA. A guide nucleic acid can be DNA. A guide nucleic acid can be programmed to bind to a sequence of a nucleic acid in a site-specific manner. The nucleic acid to be targeted, or the target nucleic acid, can include nucleotides. A guide nucleic acid can include nucleotides. A portion of a target nucleic acid can be complementary to a portion of a guide nucleic acid. A strand of a double-stranded target polynucleotide that is complementary to a guide nucleic acid and hybridizes with the guide nucleic acid can be referred to as a complementary strand. A strand of a double-stranded target polynucleotide that is complementary to a complementary strand and therefore not complementary to the guide nucleic acid can be referred to as a non-complementary strand. A guide nucleic acid can include a polynucleotide strand and can be referred to as a "single guide nucleic acid". A guide nucleic acid can include two polynucleotide strands and can be referred to as a "double guide nucleic acid". Otherwise, the term "guide nucleic acid" can be inclusive, referring to both single and double guide nucleic acids. A guide nucleic acid may include a segment that may be referred to as a "nucleic acid targeting segment" or a "nucleic acid targeting sequence." The nucleic acid targeting segment may include a sub-segment that may be referred to as a "protein binding segment" or a "protein binding sequence" or a "Cas protein binding segment."
[0438] The term "sequence identity" or "percent identity" in the context of two or more nucleic acid or polypeptide sequences generally refers to two (e.g., in a pairwise alignment) or more (e.g., in a multiple sequence alignment) sequences that are identical or have a certain percentage of identical amino acid residues or nucleotides when compared and aligned for maximum correspondence over a local or global comparison window, as measured using a sequence comparison algorithm. Suitable sequence comparison algorithms for polypeptide sequences include, for example, BLASTP using the BLOSUM62 scoring matrix setting parameters of a word length (W) of 3, expectation I of 10, and gap costs at 11, extension of 1, and using a conditional composition score matrix adjustment for polypeptide sequences longer than 30 residues; BLASTP using parameters of a word length (W) of 2, expectation (E) of 1,000,000, and PAM30 scoring setting gap costs at 9 for open gaps and 1 for extended gaps for sequences shorter than 30 residues (these are the default parameters for BLASTP in the BLAST suite available at https: / / blast.ncbi.nlm.nih.gov); the Smith-Waterman homology search algorithm with parameters of match of 2, mismatch of -1, and gap of -1; CLUSTALW with parameters; MUSCLE with default parameters; MAFFT with parameters, retree of 2 and maxiteration of 1000; Novafold with default parameters; HMMER with default parameters. hmmalign is one example.
[0439] The present disclosure includes any variant of the enzymes described herein that have one or more conservative amino acid substitutions. Such conservative substitutions can be made in the amino acid sequence of a polypeptide without destroying the three-dimensional structure or function of the polypeptide. Conservative substitutions can be achieved by substituting amino acids with similar hydrophobicity, polarity, and R chain length. Additionally or alternatively, conservative substitutions can be identified by comparing aligned sequences of homologous proteins from different species, and identifying amino acid residues (e.g., non-conserved residues) that have changed between species without changing the basic function of the encoded protein. Such conservatively substituted variants may be used in conjunction with the endonuclease protein sequences described herein (e.g., MG1, MG2, MG3, MG3a, MG3b, MG4, MG5, MG6, MG7, MG14, MG15, MG16, MG17, MG18, MG21, MG22, MG23, MG24, MG25, MG38, MG40, MG41, MG42, MG43, MG44, MG46, MG47, MG48, MG49, MG50, MG51, MG52, MG71, MG72, MG73, MG74, MG86, MG87, MG88, MG89, MG94, MG95, MG96, MG97, MG98, MG99, MG100, MG111, MG112, MG116, The present invention may include variants having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity to any one of the following endonucleases: MG123, MG124, MG125, or MG150 family endonucleases. In some embodiments, such conservatively substituted variants are functional variants.Such functional variants can include sequences with substitutions of key active site residues of the endonuclease such that activity is not destroyed, hi some embodiments, a functional variant of any of the proteins described herein lacks at least one conserved or functional residue substitution.
[0440] Conservative substitution tables providing functionally similar amino acids are available in a variety of references (e.g., Creighton, Proteins: Structures and Molecular Properties (WH Freeman & Co ., 2nd edition (December 1993). Each of the following eight groups contains amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G), 2) Aspartic acid (D), glutamic acid (E), 3) Asparagine (N), Glutamine (Q), 4) Arginine (R), Lysine (K), 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V), 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W), 7) Serine (S), Threonine (T), and 8) Cysteine (C), Methionine (M)
[0441] Variants of any of the nucleic acid sequences described herein with one or more substitutions are included in the present disclosure. Such variants may include variants having at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity with any of the nucleic acid sequences described herein.
[0442] As used herein, the term "RuvC_III domain" generally refers to the third discontinuous segment of the RuvC endonuclease domain (the RuvC nuclease domain is composed of three discontinuous segments, RuvC_I, RuvC_II, and RuvC_III). The RuvC domain or a segment thereof can generally be identified by alignment to a documented domain sequence, structural alignment to a protein with annotated domains, or comparison to a hidden Markov model (HMM) constructed based on a documented domain sequence (e.g., Pfam HMM PF18541 for RuvC_III).
[0443] As used herein, the term "HNH domain" generally refers to an endonuclease domain having characteristic histidine and asparagine residues. HNH domains can generally be identified by alignment to documented domain sequences, structural alignment to proteins with annotated domains, or comparison to hidden Markov models (HMMs) constructed based on documented domain sequences (e.g., Pfam HMM PF01844 for domain HNH).
[0444] overview
[0445] The discovery of new Cas enzymes with unique functionality and structure may offer the potential to further disrupt deoxyribonucleic acid (DNA) editing technologies to improve speed, specificity, functionality, and ease of use. Compared to the predicted prevalence of clustered regularly interspaced short palindromic repeats (CRISPR) systems in microbes and the net diversity of microbial species, a relatively small number of functionally characterized CRISPR / Cas enzymes exist in the literature. This is in part because the vast number of microbial species are not easily cultured under laboratory conditions. Metagenomic sequencing from natural environmental niches representing a large number of microbial species could dramatically increase the number of documented new CRISPR / Cas systems and confer the potential to expedite the discovery of new oligonucleotide editing functions. A fruitful recent example of such an approach is illustrated by the 2016 discovery of the CasX / CasY CRISPR system from metagenomic analysis of natural microbial communities.
[0446] CRISPR / Cas systems are RNA-directed nuclease complexes that have been described to function as adaptive immune systems in microorganisms. In their natural context, CRISPR / Cas systems occur in CRISPR (clustered regularly interspaced short palindromic repeats) operons or loci, which generally contain two parts: (i) an array of short repeat sequences (30-40 bp) separated by equally short spacer sequences that encode RNA-based targeting elements, and (ii) an ORF that encodes a Cas that encodes a nuclease polypeptide directed by the RNA-based targeting element flanked by accessory proteins / enzymes. Efficient nuclease targeting of a specific target nucleic acid sequence generally requires both (i) complementary hybridization between the first 6-8 nucleic acids of the target (target seed) and the crRNA guide, and (ii) the presence of a protospacer adjacent motif (PAM) sequence within a defined vicinity of the target seed (PAM is usually a sequence that is not commonly represented in the host genome). Depending on the exact function and composition of the system, CRISPR-Cas systems are commonly organized into two classes, five types, and 16 subtypes based on shared functional characteristics and evolutionary similarities.
[0447] Class I CRISPR-Cas systems have large, multi-subunit effector complexes and include types I, III, and IV.
[0448] Type I CRISPR-Cas systems are considered to be of intermediate complexity in terms of components. In Type I CRISPR-Cas systems, an array of RNA targeting elements is transcribed as a long precursor crRNA (pre-crRNA) that is processed at the repeat elements to release a short mature crRNA that directs the nuclease complex to the nucleic acid target, followed by an appropriate short consensus sequence called the protospacer adjacent motif (PAM). This processing occurs via the endoribonuclease subunit (Cas6) of a large endonuclease complex called Cascade, which also contains the nuclease (Cas3) protein component of the crRNA-directed nuclease complex. Cas I nuclease functions primarily as a DNA nuclease.
[0449] Type III CRISPR systems can be characterized by the presence of a central nuclease known as Cas10, along with repeat-associated mysterious proteins (RAMPs) that contain Csm or Cmr protein subunits. Similar to type I systems, mature crRNA is processed from pre-crRNA using a Cas6-like enzyme. Unlike type I and II systems, type III systems appear to target and cleave DNA-RNA duplexes (such as the DNA strand used as a template for RNA polymerase).
[0450] Type IV CRISPR-Cas systems possess an effector complex consisting of a highly reduced large subunit nuclease (csf1), two genes for RAMP proteins of the Cas5 (csf3) and Cas7 (csf2) family, and in some cases a predicted small subunit gene; such systems are commonly present on endogenous plasmids.
[0451] Class II CRISPR-Cas systems generally have a single polypeptide multi-domain nuclease effector and include types II, V and VI.
[0452] Type II CRISPR-Cas systems are considered the simplest in terms of components. In Type II CRISPR-Cas systems, processing of the CRISPR array into mature crRNA does not require the presence of a special endonuclease subunit, but rather a small transcoding crRNA (tracrRNA) with a region complementary to the array repeat sequence, which interacts with both its corresponding effector nuclease (e.g., Cas9) and the repeat sequence to form a precursor dsRNA structure, which is cleaved by endogenous RNAse III to generate a mature effector enzyme loaded with both tracrRNA and crRNA. Cas II nucleases are known as DNA nucleases. Type 2 effectors generally exhibit a structure consisting of a RuvC-like endonuclease domain that fits into an RNase H fold with an unrelated HNH nuclease domain inserted into the fold of the RuvC-like nuclease domain. The RuvC-like domain is involved in cleavage of the target (e.g., crRNA-complementary) DNA strand, while the HNH domain is involved in cleavage of the replacement DNA strand.
[0453] Type V CRISPR-Cas systems are characterized by a nuclease effector (e.g., Cas12) structure similar to that of type II effectors, including a RuvC-like domain. Like type II, most (but not all) type V CRISPR systems use tracrRNA to process pre-crRNA into mature crRNA, but unlike type II systems that require RNAse III to cleave pre-crRNA into multiple crRNAs, type V systems can cleave pre-crRNA using the effector nuclease itself. Like type II RISPR-Cas systems, type V CRISPR-Cas systems are known DNA nucleases. Unlike type II CRISPR-Cas systems, some type V enzymes (e.g., Cas12a) appear to have robust single-stranded non-specific deoxyribonuclease activity that is activated by the first crRNA-directed cleavage of the double-stranded target sequence.
[0454] Type VI CRIPSR-Cas systems have an RNA-guided RNA endonuclease. Instead of a RuvC-like domain, the single polypeptide effector of type VI systems (e.g., Cas13) contains two HEPN ribonuclease domains. Unlike both type II and V systems, type VI systems also do not appear to require a tracrRNA to process pre-crRNA to crRNA. However, similar to type V systems, some type VI systems (e.g., C2C2) appear to have robust single-stranded non-specific nuclease (ribonuclease) activity that is activated by cleavage of the target RNA by the initial crRNA.
[0455] Class II CRISPR-Cas are simpler constructs and therefore have been the most widely applied in engineering and development as engineered nuclease / genome editing applications.
[0456] One of the early applications of such a system for in vitro use can be found in Jinek et al. (Science. 2012 Aug 17, 337(6096):816-21, incorporated herein by reference in its entirety). Jinek's study first described a system involving (i) recombinantly expressed, purified full-length Cas9 (e.g., class II, type II Cas enzyme) isolated from S. pyogenes SF370, (ii) purified mature ∼42 nt crRNA (the entire crRNA transcribed in vitro from a synthetic DNA template carrying a T7 promoter sequence) with ∼20 nt of 5' sequence complementary to the target DNA sequence desired to be cleaved followed by a 3' tracr binding sequence, (iii) purified tracrRNA transcribed in vitro from a synthetic DNA template carrying a T7 promoter sequence, and (iv) Mg2+. Jinek later described an improved engineered system in which the (ii) crRNA is attached to the 5' end of (iii) by a linker (e.g., GAAA) to form a single fusion synthetic guide RNA (sgRNA) that can itself guide Cas9 to a target.
[0457] Mali et al. (Science. 2013 Feb 15, 339(6121):823-826.), which is incorporated herein by reference in its entirety, later adapted this system for use in mammalian cells by providing a DNA vector encoding (i) an ORF encoding a codon-optimized Cas9 (e.g., a class II, type II Cas enzyme) under a suitable mammalian promoter with a C-terminal nuclear localization sequence (e.g., SV40 NLS) and a suitable polyadenylation signal (e.g., TK pA signal), and (ii) an ORF encoding an sgRNA (having a 5' sequence starting with G, followed by a 3' tracr binding sequence, a linker, and 20 nt of complementary targeting nucleic acid sequence attached to the tracrRNA sequence) under a suitable polymerase III promoter (e.g., U6 promoter).
[0458] MG enzyme In one aspect, the present disclosure provides engineered nuclease systems discovered through metagenomic sequencing. In some cases, metagenomic sequencing is performed on a sample. In some cases, the sample can be collected from a variety of environments. Such environments can be human microbiomes, animal microbiomes, hot environments, cold environments. Such environments can include sediments.
[0459] MG3 enzyme In one aspect, the disclosure provides an engineered nuclease system that includes (a) an endonuclease. In some cases, the endonuclease is a Cas endonuclease. In some cases, the endonuclease is a type II, class II Cas endonuclease. The endonuclease can include a RuvC_III domain, the RuvC_III domain having at least about 70% sequence identity to any one of SEQ ID NOs: 2242-2251. In some cases, the endonuclease may comprise a RuvC_III domain, which may have at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity to any one of SEQ ID NOs: 2242-2251. In some cases, the endonuclease may comprise a RuvC_III domain, which may be substantially identical to any one of SEQ ID NOs: 2242-2251. The endonuclease may comprise a RuvC_III domain having at least about 70% sequence identity to any one of SEQ ID NOs: 2242-2244. In some cases, the endonuclease may comprise a RuvC_III domain having at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity to any one of SEQ ID NOs: 2242-2244.In some cases, the endonuclease can include a RuvC_III domain substantially identical to any one of SEQ ID NOs: 2242-2244.
[0460] The endonuclease may comprise an HNH domain having at least about 70% identity to any one of SEQ ID NOs: 4056-4066. In some cases, the endonuclease may comprise an HNH domain that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to any one of SEQ ID NOs: 4056-4066. The endonuclease may comprise an HNH domain that is substantially identical to any one of SEQ ID NOs: 4056-4066. The endonuclease may comprise an HNH domain that is at least about 70% identical to any one of SEQ ID NOs: 4056-4058. In some cases, the endonuclease can include an HNH domain that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identical to any one of SEQ ID NOs: 4056-4058. The endonuclease can include an HNH domain that is substantially identical to any one of SEQ ID NOs: 4056-4058.
[0461] In some cases, the endonuclease may include a variant having at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to any one of SEQ ID NOs: 421-431. In some cases, the endonuclease may be substantially identical to any one of SEQ ID NOs: 421-431. In some cases, the endonuclease may include a variant having at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to any one of SEQ ID NOs: 421-423. In some cases, the endonuclease may be substantially identical to any one of SEQ ID NOs: 421-423.
[0462] In some cases, the endonuclease may include a variant having one or more nuclear localization sequences (NLS). The NLS may be proximal to the N-terminus or C-terminus of the endonuclease. The NLS may be added to the N-terminus or C-terminus of any one of SEQ ID NOs: 421-431, or to a variant having at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to any one of SEQ ID NOs: 421-431. The NLS may be an SV40 large T antigen NLS. The NLS may be a c-myc NLS. The NLS may comprise a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99% identity to any one of SEQ ID NOs: 5593-5608. The NLS may comprise a sequence that is substantially identical to any one of SEQ ID NOs: 5593-5608.
[0463] In some cases, sequence identity may be determined by the CLUSTALW algorithm using BLASTP, CLUSTALW, MUSCLE, MAFFT, Novafold, or Smith-Waterman homology search algorithm parameters. Sequence identity may be determined by the BLASTP algorithm using parameters of word length (W) of 3, expectation (E) of 10, and using the BLOSUM62 scoring matrix setting gap costs at presence of 11, extension of 1, and using a conditional composition score matrix adjustment.
[0464] In some cases, the system may include (b) at least one engineered synthetic guide ribonucleic acid (sgRNA) capable of complexing with an endonuclease having a 5' targeting region complementary to a desired cleavage sequence. In some cases, the 5' targeting region may include a PAM sequence compatible with the endonuclease. In some cases, the 5' most nucleotide of the targeting region may be a G. In some cases, the 5' targeting region may be 15-23 nucleotides in length. The guide sequence and the tracr sequence may be provided as separate ribonucleic acids (RNAs) or a single ribonucleic acid (RNA). The guide RNA may include a crRNA tracrRNA binding sequence 3' to the targeting region. The guide RNA may include a tracrRNA sequence preceded by a 4 nucleotide linker 3' to the crRNA tracrRNA binding region. The sgRNA may include, in a 5' to 3' direction, a non-natural guide nucleic acid sequence capable of hybridizing to a target sequence in a cell and a tracr sequence. In some cases, the non-native guide nucleic acid sequence and the tracr sequence are covalently linked.
[0465] In some cases, the tracr sequence may have a particular sequence. The tracr sequence may have at least about 80% of at least about 60-100 (e.g., at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, or at least about 90) contiguous nucleotides of a native tracrRNA sequence. The tracr sequence may have at least about 80% sequence identity with at least about 60-100 (e.g., at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, or at least about 90) contiguous nucleotides of any one of SEQ ID NOs: 5495-5502. In some cases, the tracrRNA may have at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity to at least about 60-90 (e.g., at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, or at least about 90) contiguous nucleotides of any one of SEQ ID NOs: 5495-5502. In some cases, the tracrRNA may be substantially identical to at least about 60-100 (e.g., at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, or at least about 90) contiguous nucleotides of any one of SEQ ID NOs: 5495-5502. The tracrRNA may include any of SEQ ID NOs: 5495-5502.
[0466] In some cases, at least one engineered synthetic guide ribonucleic acid (sgRNA) capable of forming a complex with an endonuclease may comprise a sequence having at least about 80% identity to any one of SEQ ID NOs: 5466-5467. The sgRNA may comprise a sequence having at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to any one of SEQ ID NOs: 5466-5467. The sgRNA may comprise a sequence that is substantially identical to any one of SEQ ID NOs: 5466-5467.
[0467] In some cases, the system may include two different sgRNAs targeting a first region and a second region for cleavage at a target DNA locus, the second region being 3' to the first region. In some cases, the system may include a single-stranded or double-stranded DNA repair template including, in the 5' to 3' direction: a first homologous arm comprising a sequence of at least about 20 (e.g., at least about 40, 80, 120, 150, 200, 300, 500, or 1 kb) nucleotides 5' to the first region, a synthetic DNA sequence of at least about 10 nucleotides, and a second homologous arm comprising a sequence of at least about 20 (e.g., at least about 40, 80, 120, 150, 200, 300, 500, or 1 kb) nucleotides 3' to the second region.
[0468] In one aspect, the disclosure provides a method of modifying a target nucleic acid locus of interest. The method may include delivering any of the non-natural systems disclosed herein, including an enzyme and at least one synthetic guide RNA (sgRNA) disclosed herein, to the target nucleic acid locus. The enzyme may form a complex with at least one sgRNA, and when the complex is bound to the target nucleic acid locus of interest, the target nucleic acid locus of interest may be modified. Delivering the enzyme to the locus may include transfecting a cell with the system or a nucleic acid encoding the system. Delivering a nuclease to the locus may include electroporating a cell with the system or a nucleic acid encoding the system. Delivering a nuclease to the locus may include incubating the system in a buffer with a nucleic acid comprising the locus of interest. In some cases, the target nucleic acid locus comprises deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). The target nucleic acid locus may comprise genomic DNA, viral DNA, viral RNA, or bacterial DNA. The target nucleic acid locus may be within a cell. The target nucleic acid locus may be in vitro. The target nucleic acid locus may be in a eukaryotic or prokaryotic cell. The cell may be an animal cell, a human cell, a bacterial cell, an archaeal cell, or a plant cell. The enzyme may induce a single- or double-stranded break at or proximal to the target locus of interest.
[0469] Where the target nucleic acid locus may be intracellular, the enzyme may be supplied as a nucleic acid containing an open reading frame encoding an enzyme having a RuvC_III domain having at least about 75% (e.g., at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%) identity to any one of SEQ ID NOs:2242-2251. The deoxyribonucleic acid (DNA) containing an open reading frame encoding the endonuclease can include a sequence substantially identical to any of SEQ ID NOs: 5578-5580, or a variant sequence having at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity to any one of SEQ ID NOs: 5578-5580. In some cases, the nucleic acid includes a promoter to which the open reading frame encoding the endonuclease is operably linked. The promoter can be a CMV, EF1a, SV40, PGK1, Ubc, human beta actin, CAG, TRE, or CaMKIIa promoter. The endonuclease may be provided as a capped mRNA containing the open reading frame encoding the endonuclease. The endonuclease may be provided as a translated polypeptide. At least one engineered sgRNA may be provided as a deoxyribonucleic acid (DNA) containing a gene sequence encoding the at least one engineered sgRNA operably linked to a ribonucleic acid (RNA) pol III promoter. In some cases, the organism may be a eukaryote. In some cases, the organism may be a fungus. In some cases, the organism may be a human.
[0470] The disclosed system may be used for a variety of applications, such as, for example, nucleic acid editing (e.g., gene editing), binding to nucleic acid molecules (e.g., sequence-specific binding), etc. Such systems may be used, for example, to address (e.g., remove or replace) genetically inherited mutations that may cause disease in a subject, to inactivate genes to confirm their function in cells, as diagnostic tools to detect disease-causing genetic elements (e.g., via cleavage of reverse-transcribed viral RNA or amplified DNA sequences encoding disease-causing mutations), as inactivated enzymes combined with probes to target specific nucleotide sequences (e.g., sequences encoding antibiotic resistance in bacteria), to inactivate viruses by targeting viral genomes or to prevent them from infecting host cells, to add genes or modify metabolic pathways to engineer organisms to produce valuable small molecules, macromolecules, or secondary metabolites, to establish gene drive elements for evolutionary selection, and as biosensors to detect cellular perturbations by exogenous small molecules and nucleotides. EXAMPLES
[0471] Example 1 - Metagenomic analysis of novel proteins Metagenomic samples were collected from sediments, soils, and animals. Deoxyribonucleic acid (DNA) was extracted using Zymobiomics DNA miniprep kit and sequenced on an Illumina HiSeq® 2500. Samples were collected with the consent of the owners. Additional raw sequence data from public sources included animal microbiome, sediment, soil, hot springs, hydrothermal vents, ocean, peat, permafrost, and sewage sequences. To identify novel Cas effectors, metagenomic sequence data was searched using a hidden Markov model generated based on documented Cas protein sequences, including type II Cas effector proteins. Novel effector proteins identified by the search were aligned against documented proteins to identify potential active sites. This metagenomic workflow led to the delineation of the family of class II, type II CRISPR endonucleases described herein.
[0472] Example 2 - (General Protocol) PAM Sequence Identification / Validation of Endonucleases Described Herein The PAM sequence was determined by sequencing a plasmid containing a randomly generated PAM sequence that could be cleaved by a putative endonuclease expressed in an E. coli lysate-based expression system (myTXTL, Arbor Biosciences). In this system, an E. coli codon-optimized nucleotide sequence was transcribed and translated from a PCR fragment under the control of a T7 promoter. A second PCR fragment with a tracr sequence under a T7 promoter and a minimal CRISPR array consisting of a T7 promoter followed by a repeat spacer repeat sequence were transcribed in the same reaction. Successful expression of the endonuclease sequence and the tracr sequence in the TXTL system, followed by CRISPR array processing, yielded an active in vitro CRISPR nuclease complex.
[0473] A library of target plasmids containing a spacer sequence matching that in the minimal array followed by 8N mixed bases (putative PAM sequence) was incubated with the products of the TXTL reaction. After 1-3 hours, the reaction was stopped and DNA was recovered via a DNA clean-up kit, e.g., Zymo DCC, AMPure XP beads, QiaQuick, etc. The adapter sequence was blunt-end ligated to DNA with an active PAM sequence that had been cleaved by the endonuclease, while uncleaved DNA was inaccessible for ligation. A DNA segment containing the active PAM sequence was then amplified by PCR using primers specific for the library and adapter sequence. The PCR amplification products were resolved on a gel to identify amplicons corresponding to the cleavage events. The amplified segments of the cleavage reaction were also used as templates for the preparation of an NGS library. Sequencing this resulting library, a subset of the starting 8N library, revealed sequences containing the correct PAM for the active CRISPR complex. For PAM testing with single RNA constructs, the same procedure was repeated except that in vitro transcribed RNA was added along with the plasmid library and the tracr / minimal CRISPR array template was omitted. For endonucleases for which NGS libraries were prepared, seqLogo (see, e.g., Huber et al. Nat Methods. 2015 Feb, 12(2):115-21) representations were constructed. The seqLogo module used to construct these representations takes a position weight matrix of DNA sequence motifs (e.g., PAM sequences) and plots the corresponding sequence logo, introduced by Schneider and Stephens (see, e.g., Schneider et al. Nucleic Acids Res. 1990 Oct 25, 18(20):6097-100). Letters representing sequences in the seqLogo representation are stacked on top of each other for each position in the aligned sequence (e.g., PAM sequences). The height of each letter is proportional to its frequency, and the letters are sorted so that the most common letters are at the top.
[0474] Example 3 - (General Protocol) RNA Folding of tracrRNA and sgRNA Constructs The folding structure of the guide RNA sequence at 37° C. was calculated using the method of Andronescu et al. Bioinformatics. 2007 Jul 1, 23(13):i19-28, which is incorporated herein by reference in its entirety.
[0475] Example 4 - (General Protocol) In Vitro Cleavage Efficiency of MG CRISPR Complexes The endonuclease was expressed as a His-tagged fusion protein from an inducible T7 promoter in a protease-deficient E. coli B strain. Cells expressing the His-tagged protein were lysed by sonication, and the His-tagged protein was purified by Ni-NTA affinity chromatography on a HisTrap FF column (GE Lifescience) on an AKTA Avant FPLC (GE Lifescience). The eluate was separated by SDS-PAGE on an acrylamide gel (Bio-Rad) and stained with InstantBlue Ultrafast coomassie (Sigma-Aldrich). Purity was determined using densitometry of the protein bands with ImageLab software (Bio-Rad). The purified endonuclease was dialyzed into a storage buffer consisting of 50 mM Tris-HCl, 300 mM NaCl, 1 mM TCEP, 5% glycerol, pH 7.5, and stored at -80°C.
[0476] Target DNA containing spacer and PAM sequences (e.g., as determined in Example 2) was constructed by DNA synthesis. When the PAM had degenerate bases, a single representative PAM was selected for testing. The target DNA included 2200 bp linear DNA derived from a plasmid via PCR amplification with the PAM and spacer located 700 bp from one end. Successful cleavage resulted in fragments of 700 and 1500 bp. The target DNA, in vitro transcribed single RNA, and purified recombinant protein were mixed in cleavage buffer (10 mM Tris, 100 mM NaCl, 10 mM MgCl) containing excess protein and RNA. 2 ) and incubated for 5 min to 3 h, typically 1 h. Reactions were stopped via the addition of RNAse A and a 60 min incubation. Reactions were then resolved on a 1.2% TAE agarose gel and the fraction of cleaved target DNA was quantified with ImageLab software.
[0477] Example 5 - (General Protocol) Testing the Genome Cleavage Activity of MG CRISPR Complexes in E. coli E. coli lacks the ability to efficiently repair double-stranded DNA breaks. Thus, genomic DNA breaks can be a lethal event. Taking advantage of this phenomenon, we tested the endonuclease activity in E. coli by recombinantly expressing the endonuclease and tracrRNA in a target strain in which the spacer / target sequence and the PAM sequence were integrated into its genomic DNA.
[0478] In this assay, the PAM sequence is specific for the endonuclease being tested, as determined by the method described in Example 2. The sgRNA sequence was determined based on the sequence and predicted structure of the tracrRNA. A repeat-anti-repeat pair of 8-12 bp (usually 10 bp) was selected, starting from the 5' end of the repeat. The remaining 3' end of the repeat and the 5' end of the tracrRNA were replaced with a tetraloop. Generally, the tetraloop was GAAA, but other tetraloops can be used, especially if the GAAA sequence is predicted to interfere with folding. In these cases, a TTCG tetraloop was used.
[0479] The engineered strains with the PAM sequence integrated into the genomic DNA were transformed with DNA encoding the endonuclease. The transformants were then made chemically competent and transformed with 50 ng of single guide RNA, either specific for the target sequence ("on-target") or non-specific for the target ("non-target"). After heat shock, the transformants were allowed to recover for 2 hours at 37°C in SOC. Nuclease efficiency was then determined by a 5-fold dilution series grown on induction medium. Colonies were quantified from the dilution series in triplicate.
[0480] Example 6a - (General Protocol) Testing the Genome Cleavage Activity of MG CRISPR Complexes in Mammalian Cells To demonstrate targeting and cleavage activity in mammalian cells, the MG Cas effector protein sequence was tested in two mammalian expression vectors: (a) with a C-terminal SV40 NLS and a 2A-GFP tag, and (b) without a GFP tag and with two SV40 NLS sequences, one on the N-terminus and one on the C-terminus. In some cases, the nucleotide sequence encoding the endonuclease is codon-optimized for expression in mammalian cells.
[0481] The corresponding single guide RNA sequence (sgRNA) with the targeting sequence appended is cloned into a second mammalian expression vector. The two plasmids are co-transfected into HEK293T cells. 72 hours after co-transfection of the expression plasmid and the sgRNA targeting plasmid into HEK293T cells, DNA is extracted and used for preparation of NGS libraries. The rate of NHEJ is measured via indels in the sequencing of the target sites to indicate the targeting efficiency of the enzyme in mammalian cells. At least 10 different target sites were selected to test the activity of each protein.
[0482] Example 6b - (General Protocol) Testing the Genome Cleavage Activity of MG CRISPR Complexes in Mammalian Cells To demonstrate targeting and cleavage activity in mammalian cells, MG Cas effector protein sequences were cloned into two mammalian expression vectors: (a) with SV40 NLS sequences flanking the N- and C-termini, a C-terminal His tag, and a 2A-GFP tag at the C-terminus after the His tag (Scaffold 1), and (b) with flanking NLS sequences and a C-terminal His tag but without the T2A GFP tag (Scaffold 2). In some cases, the nucleotide sequences encoding the endonucleases were either codon-optimized for expression in E. coli cells or were native sequences codon-optimized for expression in mammalian cells.
[0483] The corresponding single guide RNA sequence (sgRNA) with the appended targeting sequence was cloned into a second mammalian expression vector. The two plasmids were co-transfected into HEK293T cells. 72 h after co-transfection of the expression plasmid and the sgRNA targeting plasmid into HEK293T cells, DNA was extracted and used for preparation of NGS libraries. The rate of NHEJ was measured via indels in sequencing of the target sites to show the targeting efficiency of the enzyme in mammalian cells. Approximately 7-12 different target sites were selected to test the activity of each protein. An arbitrary threshold of 5% indels was used to identify active candidates.
[0484] Example 7 - Gene editing results at the DNA level of B2M Primary T cells were purified from PBMCs using a negative selection kit (Miltenyi) according to the manufacturer's recommendations. Nucleofection of MG3-6 RNP (106 pmol protein / 160 pmol guide) (sequence numbers 6305-6386) was performed on T cells (200,000) using a Lonza 4D electroporator. Cells were harvested 5 days after transfection and genomic DNA was prepared. PCR primers suitable for use in NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA (sequence numbers 6387-6468). Amplicons were sequenced on an Illumina MiSeq machine and analyzed using proprietary Python scripts to measure gene editing (Figure 1).
[0485] [Table 1-1]
[0486] [Table 1-2]
[0487] [Table 1-3]
[0488] [Table 1-4]
[0489] [Table 1-5]
[0490] [Table 1-6]
[0491] [Table 1-7]
[0492] [Table 1-8]
[0493] [Table 1-9]
[0494] [Table 2-1]
[0495] [Table 2-2]
[0496] [Table 2-3]
[0497] [Table 2-4]
[0498] Example 8 - Gene editing results at the DNA level of mouse TRAC Primary T cells were purified from C57BL / 6 mouse spleens. Nucleofection of MG3-6 RNP (126 pmol protein / 160 pmol guide) (SEQ ID NOs: 6469-6508) was performed on T cells (200,000) using a Lonza 4D electroporator and 100 pmol transfection enhancer (IDT). Cells were harvested 5 days after transfection and genomic DNA was prepared. PCR primers suitable for use in NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA (SEQ ID NOs: 6509-6548). Amplicons were sequenced on an Illumina MiSeq machine and analyzed using proprietary Python scripts to measure gene editing (Figure 2). For flow cytometric analysis, 3 days after nucleofection, 100,000 mouse T cells were stained with anti-mouse CD3 antibody (clone 17A2, Invitrogen 11-0032-82) for 30 min at 4°C and analyzed on an Attune Nxt flow cytometer.
[0499] [Table 3-1]
[0500] [Table 3-2]
[0501] [Table 3-3]
[0502] [Table 3-4]
[0503] [Table 3-5]
[0504] [Table 4-1]
[0505] [Table 4-2]
[0506] [Table 4-3]
[0507] Example 9 - Gene editing results at the DNA level with HPRT Primary T cells were purified from PBMCs using a negative selection kit (Miltenyi) according to the manufacturer's recommendations. Nucleofection of MG3-6 RNP (126 pmol protein / 160 pmol guide) (sequence numbers 6549-6615) was performed on T cells (200,000) using a Lonza 4D electroporator. Cells were harvested 5 days after transfection and genomic DNA was prepared. PCR primers suitable for use in NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA (sequence numbers 6616-6682). Amplicons were sequenced on an Illumina MiSeq machine and analyzed using proprietary Python scripts to measure gene editing (Figure 3).
[0508] [Table 5-1]
[0509] [Table 5-2]
[0510] [Table 5-3]
[0511] [Table 5-4]
[0512] [Table 5-5]
[0513] [Table 5-6]
[0514] [Table 5-7]
[0515] [Table 5-8]
[0516] [Table 6-1]
[0517] [Table 6-2]
[0518] [Table 6-3]
[0519] [Table 6-4]
[0520] Example 10 - Gene editing results at the DNA level of human TRBC1 / 2 Primary T cells were purified from PBMCs using a negative selection kit (Miltenyi) according to the manufacturer's recommendations. Nucleofection of MG3-6 or MG3-8 RNP (106 pmol protein / 160 pmol guide) (MG3-6: SEQ ID NOs: 6683-6721, MG3-8: SEQ ID NOs: 6761-6781) was performed on T cells (200,000) using a Lonza 4D electroporator. For analysis by flow cytometry, 3 days after nucleofection, 100,000 T cells were stained with anti-CD3 antibody for 30 min at 4 °C and analyzed on an Attune Nxt flow cytometer (Figure 4).
[0521] [Table 7-1]
[0522] [Table 7-2]
[0523] [Table 7-3]
[0524] [Table 7-4]
[0525] [Table 7-5]
[0526] [Table 7-6]
[0527] [Table 7-7]
[0528] [Table 8-1]
[0529] [Table 8-2]
[0530] [Table 8-3]
[0531] [Table 8-4]
[0532] Example 11 - MG3-6 guided screening of mouse HAO-1 gene using mRNA transfection Guides for MG3-6 were identified in exons 1, 2, 3, and 4 of the human HAO1 gene using a guide discovery algorithm that searches for suitable PAM sequences. A total of 19 guides were selected for evaluation in mammalian cells. 300 ng of mRNA and 120 ng of single guide RNA were transfected into Hepa1-6 cells as follows: One day prior to transfection, Hepa1-6 cells cultured for less than 10 days in Pen / Step-free DMEM, 10% FBS, 1x NEAA medium were seeded into TC-treated 24-well plates. Cells were counted and a volume equivalent to 60,000 viable cells was added to each well. Additional pre-equilibrated medium was added to each well to bring the total volume to 500 μL. On the day of transfection, 25 μL of OptiMEM medium and 1.25 μL of Lipofectamine Messenger Max Solution (Thermo Fisher) were mixed in a master mix solution, vortexed, and left at room temperature for at least 5 minutes. In separate tubes, 300ng of MG3-6 mRNA and 120ng of sgRNA were mixed with 25μL of OptiMEM medium and vortexed briefly. An appropriate amount of MessengerMax solution was added to each RNA solution, the tube was flicked to mix, and spun down briefly at low speed. The complete editing reagent solution was incubated at room temperature for 10 minutes and then added directly to the Hepa1-6 cells. Two days after transfection, the medium was aspirated from each well of Hepa1-6 cells and genomic DNA was purified by automated magnetic bead purification with KingFisher Flex using the MagMAX™ DNA Multisample Ultra 2.0 Kit. The activity of the guides is summarized in Table 5A and Figure 5, while the primers used are summarized in Table 5B.
[0533] [Table 9]
[0534] [Table 10]
[0535] Example 12 - Guiding chemistry optimization of MG3-6 type II nuclease (predictive) Various chemically modified guides are designed and tested for activity. The most active guide in the guide screening of mouse hepatocytes (Hepa1-6 cells) - targeting albumin intron 1 - is selected as a spacer sequence model for inserting various chemical modifications. The gRNA contains a spacer located at 5' followed by CRISPR repeats and transactivating CRISPR RNA (tracr). The CRISPR repeats and tracr are identical to MG3-6. The CRISPR repeats and tracr form a structured RNA containing three stem loops. Different regions of the stem loops were modified by replacing the 2' hydroxyl of the ribose with a 2'-O-methyl group or by replacing the phosphodiester backbone with a phosphorothioate (PS) bond. Furthermore, the 5' spacer of the guide is modified by adding 2'-O-methyl, PS bond, and 2'-fluoro. The editing activity of guides with the exact same base sequence but different chemical modifications is evaluated in Hepa1-6 cells by co-transfection of the guides with mRNA encoding MG3-6. Guides with the same base sequence and commercially available chemical modifications, called AltR1 / AltR2, are used as controls. The spacer sequences in these guides target a 22-nucleotide region of albumin intron 1 of the mouse genome.
[0536] A stability assay using crude cell extracts is used to test the stability of chemically modified guides compared to guides without chemical modifications (natural RNA). Crude cell extracts from mammalian cells were chosen because they contain a mixture of nucleases that guide RNAs are exposed to when delivered to mammalian cells in vitro or in vivo. Hepa1-6 cells are harvested by adding 3 ml of cold PBS per 15 cm dish of confluent cells and using a cell scraper to release the cells from the surface of the dish. The cells are pelleted at 200 g for 10 minutes and frozen at -80°C for future use. For the stability assay, the cells are resuspended in 4 volumes of cold PBS (e.g., for a 100 mg pellet, the cells are resuspended in 400 μL of cold PBS). Triton X-100 is added at a concentration of 0.2% (v / v) and the cells are vortexed for 10 seconds, placed on ice for 10 minutes, and vortexed again for 10 seconds. Triton X-100 is a mild non-ionic detergent that disrupts cell membranes but does not inactivate or denature proteins at the concentrations used. Stability reactions are set up on ice and contain 20 μL of crude cell extract with 2 pmoles of each guide (1 μL of 2 μM stock). Six reactions per guide are set up: input, 0.5 h, 1 h, 4 h, 9 h, and possibly 21 h (time in hours refers to the length of time each sample is incubated). Samples are incubated at 37°C for 0.5 h up to 21 h, while input controls are placed on ice for 5 min. After each incubation period, reactions are stopped by adding 300 μL of a mixture of phenol and guanidine thiocyanate (Tri Reagent, Zymo Research), which immediately denatures all proteins and efficiently inhibits ribonucleases, facilitating subsequent recovery of RNA. After adding Tri Reagent, samples are vortexed for 15 s and stored at -20°C. RNA is extracted from samples using a Direct-zol RNA miniprep kit (Zymo Research) and eluted in 100 μL of nuclease-free water.Detection of modified guides is performed using Taqman RT-qPCR using Taqman miRNA assay technology (Thermo Fisher). Data are plotted as a function of the percentage of remaining sgRNA relative to the input sample.
[0537] Example 13 - Efficiency of mRNA electroporation in T cells Primary T cells were purified from PBMCs using a negative selection kit (Miltenyi) according to the manufacturer's recommendations. Nucleofection of mRNA was performed as follows: 200,000 cells were co-transfected with 500 ng of mRNA and the indicated amount of guide RNA using a Lonza 4D electroporator (DS-120). Cells were harvested 3 days after the initial transfection and genomic DNA was prepared. For the condition labeled "+gRNA", cells were nucleofected with the indicated amount of additional guide 15 hours after the initial transfection. PCR primers suitable for use in NGS-based DNA sequencing were generated, optimized, and used to amplify the individual target sequences of each guide RNA. Amplicons were sequenced on an Illumina MiSeq machine and analyzed using a proprietary Python script to measure gene editing (Figure 6).
[0538] Example 14 - ELISA assay to evaluate pre-existing antibody responses MG3-6 and MG3-8 were expressed and purified in human HEK293 cells using the Expi293™ Expression System Kit (ThermoFisher Scientific). Briefly, 293 cells were lipofected with a plasmid encoding a nuclease driven by a strong viral promoter. Cells were grown in suspension culture with stirring and harvested 2 days after transfection. The nuclease protein was fused to a 6-His affinity tag and purified to 50-60% purity by metal affinity chromatography. In parallel, lysates were made from mock-transfected cells and subjected to an identical metal affinity chromatography process. Cas9 was purchased from IDT and was >95% pure.
[0539] MaxiSorp® ELISA plates (Thermo Scientific) were coated with 0.5 μg of nuclease or control protein diluted in 1× phosphate-buffered saline (PBS) and incubated overnight at room temperature. Plates were then washed and incubated with 1% (w / v) bovine serum albumin (BSA) (Sigma-Aldrich) / 1× PBS solution (1% BSA-PBS) at room temperature for 1 h. After another washing step, wells were incubated with more than 50 separate serum samples (1:50 dilution in 1% BSA-PBS) from randomly selected donors at room temperature for 1 h. Plates were then washed and incubated with peroxidase-labeled goat anti-human (Fcγ fragment specific) secondary antibody (Jackson Immuno Research) diluted 1:50,000 in 1% BSA-PBS at room temperature for 1 h. The assay was developed using a 3,3',5,5'-tetramethylbenzidine (TMB) liquid substrate system kit (Sigma-Aldrich) according to the manufacturer's specifications. Antibody titers are reported as absorbance values measured at 450 nm (Figure 7). Tetanus toxoid was used as a positive control due to the widespread vaccination against this antigen and was purchased from Sigma Aldrich.
[0540] Example 15 - Gene editing results at the DNA and cell surface protein levels of TRAC in human peripheral blood B cells Human peripheral blood B cells were purchased from STEMCELL Technologies and expanded for 2 days using the ImmunoCult™ Human B Cell Expansion Kit prior to nucleofection. Nucleofection of MG3-6 RNP (106 pmol protein / 160 pmol guide) was performed on B cells (200,000) using a Lonza 4D electroporator. Cells after nucleofection were immediately harvested in medium containing AAV-6 obtained from Virovek. Cells were harvested 5 days after transfection and genomic DNA was prepared. For NGS analysis, the target sequence of TRAC 6 guide RNA (sequence number 6804) was amplified using PCR primers suitable for use in NGS-based DNA sequencing. Amplicons were sequenced on an Illumina MiSeq machine and analyzed using a proprietary Python script to measure gene editing. For analysis by flow cytometry, 100,000 cells were stained for viability, expression of the B cell surface marker CD19 (CD19 monoclonal antibody (HIB19), APC, eBioscience™), and transgene (SEQ ID NO: 6810) insertion as measured by expression of tLNGFR (CD271 (LNGFR) antibody, anti-human, REAfinity™). Cells were stained for 30 minutes at 4° C. and data were acquired on an Attune Nxt flow cytometer. Cells expressing tLNGFR were gated on single live CD19+ cells (FIG. 8).
[0541] [Table 11]
[0542] Example 16 - Gene editing results at the DNA level of TRAC and AAVS1 in hematopoietic stem cells (HSCs) Mobilized peripheral blood CD34+ cells were obtained from AllCells and cultured in STEMCELL StemSpan™ SFEM II medium supplemented with StemSpam™ CC110 cytokine cocktail for 48 hours prior to nucleofection. Nucleofection of MG3-6 RNP (106 pmol protein / 120 pmol guide for standard dose, 52 pmol protein / 60 pmol guide for half dose) was performed on HSCs (200,000) using a Lonza 4D electroporator. Cells were harvested 3 days after transfection and genomic DNA was prepared. PCR primers suitable for use in Sanger and NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA (sequence numbers 6804, 6806, and 6808). NGS amplicons were sequenced on an Illumina MiSeq machine and analyzed using proprietary Python scripts to measure gene editing. ICE amplicons were sent to Elim Biopharmaceuticals Inc. for Sanger sequencing and analyzed with a proprietary Python script to measure gene editing (Figure 9).
[0543] [Table 12]
[0544] Example 17 - Gene editing results at the DNA and cell surface protein levels of TRAC in MG3-6 induced pluripotent stem cells (iPSCs) delivered as a ribonucleoprotein ATCC-BXS0116 Human (Non-Hispanic Caucasian Female)
[0545] Induced pluripotent stem (IPS) cells are cultured on Corning Matrigel-coated plasticware in mTESR Plus medium (STEMCELL Technologies) containing 10 μM ROCK inhibitor Y-27632 for 24 hours prior to nucleofection. Nucleofection of MG3-6 RNP (106 pmol protein / 120 pmol guide) was performed on iPSCs (200,000) using a Lonza 4D electroporator. Cells were harvested with Accutase for flow cytometry and genomic DNA extraction 5 days after transfection. Individual target sequences of TRAC 6 gRNA were amplified using PCR primers suitable for use in NGS-based DNA sequencing (sequence number 6804). Amplicons were sequenced on an Illumina MiSeq machine and analyzed using proprietary Python scripts to measure gene editing. For analysis by flow cytometry, 100,000 iPSCs per sample were stained 5 days after nucleofection with the LIVE / DEAD™ Fixable Near-IR Dead Cell Stain kit and CD271 (LNGFR) antibody, anti-human, REAfinity™ to measure viability and transgene (SEQ ID NO: 6810) insertion, respectively. Cells were fixed, permeabilized (Inside Stain Kit, Miltenyi) and further stained for pluripotency transcription factors Oct4 and Sox2 (anti-Oct3 / 4 isoform A-APC, human and mouse REA338 1, Anti-Sox2-FITC, human and mouse REA320). Cells were acquired on an Attune NxT flow cytometer and analyzed for tLNGFR expression based on gating on single live Oct4+Sox2+ cells (Figure 10).
[0546] [Table 13]
[0547] Example 18 - DNA-protein level gene editing results of TRAC in MG3-6 induced pluripotent stem cells (iPSCs) delivered as mRNA ATCC-BXS0116 Human (Non-Hispanic Caucasian Female)
[0548] Induced pluripotent stem (IPS) cells are cultured on Corning Matrigel-coated plasticware in mTESR Plus (STEMCELL Technologies) containing 10 μM ROCK inhibitor Y-27632 for 24 hours prior to nucleofection. Nucleofection of MG3-6 RNP (106 pmol protein / 120 pmol guide) or mRNA (250 or 500 ng mRNA / 12 pmol guide) was performed on iPSCs (200,000) using a Lonza 4D electroporator. Five days after transfection, cells were harvested with Accutase for genomic DNA extraction. PCR primers suitable for use in NGS-based DNA sequencing were used to amplify individual target sequences of TRAC 6 gRNA (sequence number 6804). Amplicons were sequenced on an Illumina MiSeq machine and analyzed using a proprietary Python script to measure gene editing (Figure 11).
[0549] [Table 14]
[0550] Example 19 - Gene editing results at the DNA level of CD2 Primary T cells were purified from PBMCs using a negative selection kit (Miltenyi) according to the manufacturer's recommendations. Nucleofection of MG3-6 RNP (106 pmol protein / 160 pmol guide) was performed into T cells (200,000) using a Lonza 4D electroporator. Five days after transfection, cells were harvested and genomic DNA was prepared. PCR primers suitable for use in NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA. Amplicons were sequenced on an Illumina MiSeq machine and analyzed using proprietary Python scripts to measure gene editing (Figure 12).
[0551] [Table 15-1]
[0552] [Table 15-2]
[0553] [Table 15-3]
[0554] [Table 15-4]
[0555] [Table 15-5]
[0556] [Table 16-1]
[0557] [Table 16-2]
[0558] [Table 16-3]
[0559] Example 20 - Gene editing results at the DNA level of CD5 Primary T cells were purified from PBMCs using a negative selection kit (Miltenyi) according to the manufacturer's recommendations. Nucleofection of MG3-6 RNP (106 pmol protein / 160 pmol guide) was performed on T cells (200,000) using a Lonza 4D electroporator. Five days after transfection, cells were harvested and genomic DNA was prepared. PCR primers suitable for use in NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA. Amplicons were sequenced on an Illumina MiSeq machine and analyzed using a proprietary Python script to measure gene editing (Figure 13).
[0560] [Table 17-1]
[0561] [Table 17-2]
[0562] [Table 17-3]
[0563] [Table 17-4]
[0564] [Table 17-5]
[0565] [Table 17-6]
[0566] [Table 17-7]
[0567] [Table 17-8]
[0568] [Table 18-1]
[0569] [Table 18-2]
[0570] [Table 18-3]
[0571] [Table 18-4]
[0572] Example 21 - Target RNA cleavage by MG3-6 and MG3-8 A 101 nt RNA containing a spacer (GGUCAGGGCGCGUCAGCGGGUGUUGGCGGGUGUCGGGGCUGGCUUAAAUUUUGGACCAGUCGAGGCUUGCGACGUGGUGGCUUUUCCAGUCGGGAAACCUG) with the 5' flanking sequence UUGGACCA was prepared via transcription of a T7 promoter-containing PCR product using the T7 Megascript kit (NEB) according to the manufacturer's instructions. The resulting RNA was purified using Monarch RNA prep spin columns (NEB) and then labeled with the 5' EndTag kit (Vector labs) using FAM-maleimide dye according to the recommended instructions. The resulting RNA has one 5' label and an expected band size of 60 nt if cleaved at a single position within the spacer. To test RNA cleavage, 2 pmol of protein and sgRNA were pre-incubated for 15 min before adding the ssRNA target. The RNP complex was cleaved in cleavage buffer (10 mM Tris, 100 mM NaCl, and 10 mM MgCl 2 ) at a 10:1 ratio (200 nM RNA:2 μM RNP) and incubated for 1 h at 37° C. Reactions were quenched with proteinase K and resolved on a 15% TBE urea-PAGE gel (Bio-rad). The gel shows site-specific RNA cleavage by MG3-6 and MG3-8, as well as the commercial positive control SauCas9 (NEB) ( FIG. 14 ). Results showed that MG3-6 and MG3-8 were capable of targeted RNA cleavage and were comparable to SauCas9 in terms of RNA cleavage.
[0573] Example 22 - Gene editing results at the DNA level of FAS Primary T cells were purified from PBMCs using a negative selection kit (Miltenyi) according to the manufacturer's recommendations. Nucleofection of MG3-6 RNP (104 pmol protein / 120 pmol guide) (sequence numbers 7023-7056) was performed on T cells (200,000) using a Lonza 4D electroporator. Cells were harvested 3 days after transfection and genomic DNA was prepared. PCR primers suitable for use in NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA (sequence numbers 7057-7090). Amplicons were sequenced on an Illumina MiSeq machine and analyzed using a proprietary Python script to measure gene editing (Figure 15).
[0574] [Table 19-1]
[0575] [Table 19-2]
[0576] [Table 19-3]
[0577] [Table 19-4]
[0578] [Table 19-5]
[0579] [Table 19-6]
[0580] Example 23: Gene editing results of PD-1 at the DNA level Primary T cells were purified from PBMCs using a negative selection kit (Miltenyi) according to the manufacturer's recommendations. Nucleofection of MG3-6 RNP (104 pmol protein / 120 pmol guide) (sequence numbers 7091-7128) was performed on T cells (200,000) using a Lonza 4D electroporator. Cells were harvested 3 days after transfection and genomic DNA was prepared. PCR primers suitable for use in NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA (sequence numbers 7129-7166). Amplicons were sequenced on an Illumina MiSeq machine and analyzed using a proprietary Python script to measure gene editing (Figure 16).
[0581] [Table 20-1]
[0582] [Table 20-2]
[0583] [Table 20-3]
[0584] [Table 20-4]
[0585] [Table 20-5]
[0586] [Table 20-6]
[0587] [Table 20-7]
[0588] Example 24 - Gene editing results at the DNA level of hRosa26 Primary T cells were purified from PBMCs using a negative selection kit (Miltenyi) according to the manufacturer's recommendations. Nucleofection of MG3-6 RNP (104 pmol protein / 120 pmol guide) (sequence numbers 7167-7198) was performed on T cells (200,000) using a Lonza 4D electroporator. Cells were harvested 3 days after transfection and genomic DNA was prepared. PCR primers suitable for use in NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA (sequence numbers 7199-7230). Amplicons were sequenced on an Illumina MiSeq machine and analyzed using a proprietary Python script to measure gene editing (Figure 17).
[0589] [Table 21-1]
[0590] [Table 21-2]
[0591] [Table 21-3]
[0592] [Table 21-4]
[0593] [Table 21-5]
[0594] [Table 21-6]
[0595] Example 25 - Gene editing results at the DNA level of TRAC and AAVS1 in K562 cells Nucleofection of MG21-1, MG23-1, MG73-1, MG89-2, and MG71-2 mRNA along with matching guide RNA (500ng mRNA / 150pmol guide) was performed into K562 cells (200,000) using a Lonza 4D electroporator. Cells were harvested 3 days after transfection and genomic DNA was prepared. PCR primers suitable for use in NGS-based DNA sequencing were generated, optimized, and used to amplify the individual target sequences of each guide RNA. Amplicons were sequenced on an Illumina MiSeq machine and analyzed using a proprietary Python script to measure gene editing (Figure 18).
[0596] [Table 22-1]
[0597] [Table 22-2]
[0598] [Table 22-3]
[0599] [Table 22-4]
[0600] [Table 23]
[0601] Example 26 - MG3-6 nuclease-guided screening of human HAO-1 gene using smRNA transfection of Hep3B cells Guide RNAs for MG3-6 nuclease targeting exons 1-4 of the human HAO-1 gene (encoding glycolate oxidase) were identified in silico by searching for the PAM sequence 5' NNRGRYY 3'. A total of 21 guides with the fewest predicted off-target sites in the human genome were chemically synthesized as single guide RNAs with AltR1 / AltR2 end modifications (IDTs). The full sequences of sgRNAs are SEQ ID NOs: 11352-11372.
[0602] [Table 24-1]
[0603] [Table 24-2]
[0604] Hep3B transfection protocol The mRNA encoding MG3-6 was generated by T7 polymerase in vitro transcription of a plasmid into which the coding sequence of MG3-6 was cloned. The MG3-6 coding sequence was codon-optimized using a human codon usage table and was flanked by nuclear localization signals derived from SV40 (at the N-terminus) and nucleoplasmin (at the C-terminus). Additionally, a 5' untranslated region (5'UTR) was included at the 5' end of the coding sequence to improve translation. To improve mRNA stability in vivo, a 3'UTR followed by a polyA tract of approximately 90-110 nucleotides was included in the mRNA (encoded in the plasmid) at the 3' end of the coding sequence. The DNA sequence encoding the MG3-6 mRNA without the polyA tail is shown in SEQ ID NO:22. In vitro transcription reactions included Clean Cap® capping reagent (Trilink BioTechnologies), and the resulting RNA was purified using the MEGAClear™ Transcription Clean-Up Kit (Invitrogen), purity was assessed using TapeStation (Agilent), and was found to consist of >90% full-length RNA.
[0605] 300ng of MG3-6 mRNA and 120ng of each single guide RNA (sgRNA) were transfected into Hep3B cells as follows: One day prior to transfection, Hep3B cells cultured for less than 10 days in EMEM-10% FBS-2mM glutamine-1% NEAA medium without Pen / Step were seeded into TC-treated 24-well plates. Cells were counted and a volume equivalent to 60,000 viable cells was added to each well. Additional pre-equilibrated medium was added to each well to bring the total volume to 500μL. On the day of transfection, 25μL of OptiMEM medium and 1.25μL of Lipofectamine Messenger Max Solution (Thermo Fisher) were mixed in a master mix solution, vortexed, and left at room temperature for at least 5 minutes. In separate tubes, 300ng of MG3-6 / 3-4 mRNA and 120ng of sgRNA were mixed with 25μL of OptiMEM medium and vortexed briefly. An appropriate amount of MessengerMax solution was added to each RNA solution, the tube was flicked to mix, and spun down briefly at low speed. The complete editing reagent solution was incubated at room temperature for 10 minutes and then added directly to the Hep3B cells. Two days after transfection, the medium was aspirated from each well of Hep3B cells and genomic DNA was purified by automated magnetic bead purification on a KingFisher Flex robot using the MagMAX™ DNA Multisample Ultra 2.0 kit.
[0606] Editing analysis by PCR amplification and Sanger sequencing The HAO-1 gene sequences targeted by the different sgRNAs were amplified by PCR from purified genomic DNA using the exon-specific primers in Table 18 and Phusion Flash High-Fidelity PCR Master Mix (Thermo Fisher).
[0607] [Table 25]
[0608] The PCR products were purified and concentrated using DNA clean & concentrator 5 (Zymo Research), and 40 ng of PCR products were subjected to Sanger sequencing (ELIM Biosciences).
[0609] Sanger sequencing chromatograms were analyzed for insertions and deletions (indels) at the predicted target sites of each sgRNA by an algorithm called Tracking of Indels by DEcomposition (TIDE) as described by Brinkman et al. (Nucleic Acids Res. 2014 Dec 16, 42(22):e168. Published online 2014 Oct 9. doi:10.1093 / nar / gku936). From this screen, guides hH364-1, 14, and 15 were identified as having the highest editing activity in Hep3B cells (Figure 19 and Table 19).
[0610] [Table 26-1]
[0611] [Table 26-2]
[0612] Example 27 - Gene editing results at the DNA level of human GPR146 Nucleofection of MG3-6 RNP (104 pmol protein / 120 pmol guide) (sequence numbers 11374-11405) was performed into Hep3B cells (100,000) using a Lonza 4D electroporator. Cells were harvested 3 days after transfection and genomic DNA was prepared. PCR primers suitable for use in NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA (sequence numbers 11406-11437). Amplicons were sequenced on an Illumina MiSeq machine and analyzed using proprietary Python scripts to measure gene editing (Figure 20).
[0613] [Table 27-1]
[0614] [Table 27-2]
[0615] [Table 27-3]
[0616] [Table 27-4]
[0617] [Table 27-5]
[0618] [Table 27-6]
[0619] Example 28 - Gene editing results at the DNA level of mouse GPR146 in Hepa1-6 cells Nucleofection of MG3-6 RNP (104 pmol protein / 120 pmol guide) (sequence numbers 11438-11472) was performed into Hepa1-6 cells (100,000) using a Lonza 4D electroporator. Five days after transfection, cells were harvested and genomic DNA was prepared. PCR primers suitable for use in NGS-based DNA sequencing were generated, optimized, and used to amplify individual target sequences for each guide RNA (sequence numbers 11473-11507). Amplicons were sequenced on an Illumina MiSeq machine and analyzed using proprietary Python scripts to measure gene editing (Figure 21).
[0620] [Table 28-1]
[0621] [Table 28-2]
[0622] [Table 28-3]
[0623] [Table 28-4]
[0624] [Table 28-5]
[0625] [Table 28-6]
[0626] Example 29 - Gene editing results at the DNA level of mouse GPR146 in primary mouse hepatocytes Lipofection of MG3-6 mRNA and guide (0.42ug mRNA, 1:20 molar ratio of nuclease:guide) with MessengerMax was performed in primary mouse hepatocytes (1E5 live cells / guide) using the guide RNAs described in Example 28 above. Cells were harvested 3 days after transfection and genomic DNA was prepared. PCR primers suitable for use in NGS-based DNA sequencing were used to amplify the individual target sequences of each guide RNA. Amplicons were sequenced on an Illumina MiSeq machine and analyzed using a proprietary Python script to measure gene editing (Figure 22). Results showed that GPR146-H2 sgRNA was highly effective for editing in mouse hepatocytes.
[0627] Example 30 - Gene editing results at the DNA level of TRAC and AAVS1 in K562 cells Nucleofection of MG14-241 and MG99-1 mRNA along with matching guide RNA (500ng mRNA / 150pmol guide) was performed into 200,000 human lymphoblastoid cells (K562 cells) using a Lonza 4D electroporator. Three days after transfection, cells were harvested and genomic DNA was prepared. PCR primers suitable for use in NGS-based DNA sequencing were generated, optimized, and used to amplify the individual target sequences of each guide RNA. Amplicons were sequenced on an Illumina MiSeq machine and analyzed using proprietary Python scripts to measure gene editing. (Figure 23).
[0628] [Table 29-1]
[0629] [Table 29-2]
[0630] Example 31 - Novel Type II CRISPR effectors are active nucleases with diverse PAM requirements Phylogenetic analysis identified novel nucleases of the MG3, MG15, MG150, MG123, MG124, and MG125 families. The MG150 family of nucleases is more closely related to the MG3 family than to any other family identified (Figure 24), and the MG15 family of nucleases has been expanded with a new group of divergent effectors (Figure 25). In vitro cleavage activity assays indicate that the nucleases reported herein generally have a preference for cleavage at the third or fourth position from the PAM ( Table 23 ). Furthermore, PAM sequencing of type II nucleases shows diverse PAM requirements, as shown by SeqLogo images from NGS data (Figures 26-35).
[0631] [Table 30-1]
[0632] [Table 30-2]
[0633] [Table 30-3]
[0634] Embodiment The following embodiments are illustrative in nature and are not intended to be limiting in any way. 1. A method of editing a B2M locus in a cell, comprising: (a) an RNA-guided endonuclease, and (b) contacting an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and to hybridize to a region of the B2M locus; A method, wherein the region of the B2M locus comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6387-6468. 2. The method of embodiment 1, wherein the RNA-guided endonuclease is a class 2, type II Cas endonuclease. 3. The method of embodiment 1, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO:2242 or SEQ ID NO:2244. 4. The method of embodiment 3, wherein the RNA-guided endonuclease further comprises an HNH domain. 5. The method of embodiment 1, wherein the engineered guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 6305-6386. 6. The method of embodiment 1, wherein said region of said B2M locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 non-degenerate nucleotides of any one of SEQ ID NOs: 6388, 6399, 6401, 6403, 6410, 6413, 6421, 6446, and 6448. 7. A method of editing the TRAC locus in a cell, comprising: (a) an RNA-guided endonuclease, and (b) contacting an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and to hybridize to a region of the TRAC locus; A method wherein the region of the TRAC locus comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6509-6548. 8. The method of embodiment 7, wherein the RNA-guided endonuclease is a class 2, type II Cas endonuclease. 9. The method of embodiment 7, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. 10. The method of embodiment 9, wherein the RNA-guided endonuclease further comprises an HNH domain. 11. The method of embodiment 7, wherein the engineered guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 6469-6508. 12. The method of embodiment 7, wherein said region of said TRAC locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 non-degenerate nucleotides of any one of SEQ ID NOs: 6517, 6520, and 6523. 13. A method for editing the HPRT locus in a cell, comprising: (a) an RNA-guided endonuclease, and (b) contacting an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and to hybridize to a region of the HPRT locus; A method wherein said region of said HPRT locus comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 6616-6682. 14. The method of embodiment 13, wherein the RNA-guided endonuclease is a class 2, type II Cas endonuclease. 15. The method of embodiment 13, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. 16. The method of embodiment 15, wherein the RNA-guided endonuclease further comprises an HNH domain. 17. The method of embodiment 13, wherein the engineered guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 6549-6615. 18. The method of embodiment 13, wherein said region of said HPRT locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 non-degenerate nucleotides of any one of SEQ ID NOs: 6619, 6634, 6673, 6675, and 6679. 19. A method for editing the TRBC1 / 2 locus in a cell, comprising: (a) an RNA-guided endonuclease, and (b) contacting an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and to hybridize to a region of the TRBC1 / 2 locus; A method, wherein the region of the TRBC1 / 2 locus comprises a targeting sequence having at least 85% identity to at least 18 consecutive nucleotides of any one of SEQ ID NOs: 6722-6760 or 6782-6802. 20. The method of embodiment 19, wherein the RNA-guided endonuclease is a class 2, type II Cas endonuclease. 21. The method of embodiment 19, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242 or SEQ ID NO: 2244. 22. The method of embodiment 21, wherein the RNA-guided endonuclease further comprises an HNH domain. 23. The method of embodiment 19, wherein the engineered guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 6683-6721 and 6761-6781. 24. The method of embodiment 19, wherein the region of the TRBC1 / 2 locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 non-degenerate nucleotides of any one of SEQ ID NOs: 6734, 6753, 6790, and 6800. 25. A method for editing the HAO1 locus in a cell, comprising: (a) an RNA-guided endonuclease, and (b) contacting an engineered guide RNA, the engineered guide RNA comprising a spacer sequence configured to form a complex with the endonuclease and to hybridize to a region of the HAO1 locus; A method, wherein the region of the HAO1 locus comprises a targeting sequence having at least 85% identity to at least 18 contiguous nucleotides of any one of SEQ ID NOs: 11802-11820. 26. The method of embodiment 25, wherein the RNA-guided endonuclease is a class 2, type II Cas endonuclease. 27. The method of embodiment 25, wherein the RNA-guided endonuclease comprises a RuvCIII domain comprising a sequence having at least 75% sequence identity to SEQ ID NO: 2242. 28. The method of embodiment 27, wherein the RNA-guided endonuclease further comprises an HNH domain. 29. The method of embodiment 25, wherein the region of the HAO1 locus comprises a sequence that is at least 75%, 80%, or 90% identical to at least 19 non-degenerate nucleotides of any one of SEQ ID NOs: 11806, 11813, 11816, and 11819. 30. The method of embodiment 1, wherein the RNA-guided endonuclease is a Cas endonuclease. 31. The method of embodiment 2, wherein the Class 2, Type II Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 421-431. 32. The method of any one of embodiments 1-4, 30-31, wherein the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NO: 421. 33. The method of any one of embodiments 1-4, 30-32, wherein the engineered guide RNA comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 6305-6386. 34. The method of any one of embodiments 1-4, 30-32, wherein the engineered guide RNA comprises a sequence that is 80% or at least 90% identical to any one of SEQ ID NOs: 6306, 6317, 6319, 6321, 6328, 6331, 6339, 6364, and 6366. 35. The method of embodiment 7, wherein the RNA-guided endonuclease is a Cas endonuclease. 36. The method of embodiment 8, wherein the Class 2, Type II Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 421-431. 37. The method of any one of embodiments 7 to 10, 35 to 36, wherein the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NO: 421. 38. The method of any one of embodiments 7 to 10, 35 to 37, wherein the engineered guide RNA comprises a sequence that is 80% or at least 90% identical to any one of SEQ ID NOs: 6477, 6480, and 6483. 39. The method of embodiment 13, wherein the RNA-guided endonuclease is a Cas endonuclease. 40. The method of embodiment 14, wherein the Class 2, Type II Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 421-431. 41. The method of any one of embodiments 13 to 16, 39 to 40, wherein the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NO: 421 or SEQ ID NO: 423. 42. The method of any one of embodiments 13-16, 39-40, wherein the engineered guide RNA comprises a sequence that is 80% or at least 90% identical to any one of SEQ ID NOs: 6552, 6567, 6606, 6608, and 6612. 43. The method of embodiment 19, wherein the RNA-guided endonuclease is a Cas endonuclease. 44. The method of embodiment 20, wherein the Class 2, Type II Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 421-431. 45. The method of any one of embodiments 19 to 22, 43 to 44, wherein the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NO: 421 or SEQ ID NO: 423. 46. The method of any one of embodiments 19-22, 43-45, wherein the engineered guide RNA comprises a sequence that is 80% or at least 90% identical to any one of SEQ ID NOs: 6695, 6714, 6769, and 6779. 47. The method of embodiment 25, wherein the RNA-guided endonuclease is a Cas endonuclease. 48. The method of embodiment 26, wherein the class 2, type II Cas endonuclease comprises an endonuclease having at least 75% sequence identity to any one of SEQ ID NOs: 421-431. 49. The method of any one of embodiments 25 to 28, 47 to 48, wherein the RNA-guided endonuclease comprises a sequence that is at least 75%, 80%, or 90% identical to SEQ ID NO: 421. 50. The method of any one of embodiments 1-24, 30-46, wherein the cells are peripheral blood mononuclear cells (PBMCs). 51. The method of any one of embodiments 1-24, 30-46, wherein the cell is a T cell or a precursor thereof, or a hematopoietic stem cell (HSC).
[0635] While preferred embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that such embodiments are provided for illustrative purposes only. The present invention is not intended to be limited by the specific examples provided herein. Although the present invention has been described with reference to the foregoing description, the description and explanation of the embodiments herein are not intended to be construed in a limiting sense. Numerous variations, changes, and substitutions will occur to those skilled in the art without departing from the present invention. Furthermore, it will be understood that all aspects of the present invention are not limited to the specific depictions, configurations, or relative proportions described herein, which depend upon a variety of conditions and variables. It should be understood that various alternatives to the embodiments of the present invention described herein may be used in the practice of the present invention. It is therefore contemplated that the present invention will encompass any such alternatives, modifications, variations, or equivalents. The following claims define the scope of the present invention, and it is intended that methods and structures within the scope of these claims and their equivalents be covered thereby.
[0636] [Table 31-1]
[0637] [Table 31-2]
[0638] [Table 31-3]
[0639] [Table 31-4]
[0640] [Table 31-5]
[0641]
Table 31-6
[0642]
Table 31-7
[0643]
Table 31-8
[0644]
Table 31-9
[0645]
Table 31-10
[0646]
Table 31-11
[0647]
Table 31-12
[0648]
Table 31-13
[0649]
Table 31-14
[0650]
Table 31-15
[0651]
Table 31-16
[0652]
Table 31-17
[0653]
Table 31-18
[0654]
Table 31-19
[0655]
Table 31-20
[0656]
Table 31-21
[0657]
Table 31-22
[0658]
Table 31-23
[0659]
Table 31-24
[0660]
Table 31-25
[0661]
Table 31-26
[0662]
Table 31-27
[0663]
Table 31-28
[0664]
Table 31-29
[0665]
Table 31-30
[0666]
Table 31-31
[0667]
Table 31-32
[0668]
Table 31-33
[0669]
Table 31-34
[0670]
Table 31-35
[0671]
Table 31-36
[0672]
Table 31-37
[0673]
Table 31-38
[0674]
Table 31-39
Claims
1. An engineered nuclease system, the engineered nuclease system comprising: (a) an endonuclease or a ribonucleic acid encoding said endonuclease, wherein said endonuclease comprises a sequence having at least 80% sequence identity to SEQ ID NO: 1433; and (b) an engineered guide ribonucleic acid structure configured to form a complex with said endonuclease, said engineered guide ribonucleic acid structure comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; (ii) a tracr ribonucleic acid sequence configured to bind to the endonuclease; and an engineered guide ribonucleic acid structure comprising: An engineered nuclease system, wherein the engineered guide ribonucleic acid structure comprises a sequence having at least 80% sequence identity to the non-degenerate nucleotides of SEQ ID NO:11145 or SEQ ID NO:11144.
2. The engineered guide ribonucleic acid structure (a) at least two ribonucleic acid polynucleotides, or (b) a single ribonucleic acid polynucleotide comprising the guide ribonucleic acid sequence and the tracr ribonucleic acid sequence; 2. The engineered nuclease system of claim 1, comprising:
3. The engineered nuclease system of claim 1, wherein the engineered guide ribonucleic acid structure comprises a sequence having at least 90% sequence identity to the non-degenerate nucleotides of SEQ ID NO: 11145 or SEQ ID NO: 11144.
4. The engineered nuclease system described in claim 3, wherein the engineered guide ribonucleic acid structure comprises a non-degenerate nucleotide of sequence number 11145.
5. The engineered nuclease system described in claim 1, wherein the tracr ribonucleic acid sequence comprises the sequence of SEQ ID NO: 11201.
6. The engineered nuclease system described in claim 1, wherein the tracr ribonucleic acid sequence comprises a sequence having at least 80% sequence identity to SEQ ID NO: 11201 or SEQ ID NO: 11200.
7. The engineered nuclease system described in claim 6, wherein the tracr ribonucleic acid sequence comprises a sequence having at least 90% sequence identity to SEQ ID NO: 11201 or SEQ ID NO: 11200.
8. The engineered nuclease system of claim 1, wherein the endonuclease is a class 2, type II Cas endonuclease.
9. The engineered nuclease system of claim 1, wherein the endonuclease comprises a RuvCIII domain, and the RuvCIII domain comprises a sequence having at least 80% sequence identity to sequence number 3253.
10. The engineered nuclease system described in claim 9, wherein the RuvCIII domain comprises the sequence of SEQ ID NO: 3253.
11. The engineered nuclease system of claim 1, wherein the endonuclease comprises an HNH domain, and the HNH domain comprises a sequence having at least 80% sequence identity to sequence number 5068.
12. The engineered nuclease system described in claim 11, wherein the HNH domain comprises the sequence of SEQ ID NO: 5068.
13. An engineered nuclease system described in any one of claims 1 to 12, wherein the endonuclease comprises a sequence having at least 90% sequence identity to SEQ ID NO: 1433.
14. The engineered nuclease system described in claim 13, wherein the endonuclease comprises the sequence of SEQ ID NO: 1433.
15. A method for editing a genetic locus in a cell, the method comprising contacting the cell with an engineered nuclease system described in any one of claims 1 to 12.
16. The method described in claim 15, wherein the endonuclease comprises a sequence having at least 90% sequence identity with sequence number 1433.
17. The method described in claim 16, wherein the endonuclease comprises the sequence of SEQ ID NO: 1433.
18. A method for editing a genetic locus in a cell, the method comprising: (a) an endonuclease or a nucleic acid encoding said endonuclease, wherein said endonuclease comprises a sequence having at least 80% sequence identity to SEQ ID NO: 421 or SEQ ID NO: 423; and (b)(i) an engineered guide ribonucleic acid structure configured to form a complex with said endonuclease, said engineered guide ribonucleic acid structure comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 6306, 6308, 6309, 6313, 6317, 6319, 6321, 6328, 6331, 6339, 6364, 6366, 6305, 6307, 6310, 6311, 6312, 6314-6316, 6318, 6320, 6322-6327, 6330, 6332-6338, 6340-6363, 6365, and 6367-6386, and wherein said locus is the beta-2-microglobulin (B2M) locus; (ii) an engineered guide ribonucleic acid structure configured to form a complex with said endonuclease, said engineered guide ribonucleic acid structure comprising a sequence having at least 80% sequence identity to any one of SEQ ID NOs: 6813, 6841, 6843-6847, 6852, 6811, 6812, 6814-6840, 6842, and 6848-6851, and said locus is the CD2 molecule (CD2) locus; or (iii) an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease, wherein the engineered guide ribonucleic acid structure is selected from the group consisting of SEQ ID NOs: 6897, 6904, 6906, 6911, 6928, 6930, 6932, 6934, 6938, 6945, 6950, 6952, 6958, 5466, 6895, 6896, 6898-6 6939-6944, 6946-6949, 6951, and 6953-6957, wherein the locus is the CD5 molecule (CD5) locus. The method of claim 1, wherein the first and second nucleotide sequences are methyl 2-methyl-2-propanol.
19. The method described in claim 18, wherein the endonuclease comprises a RuvCIII domain, and the RuvCIII domain comprises a sequence having at least 75% sequence identity to sequence number 2242 or sequence number 2244.
20. The method described in claim 18, wherein the endonuclease comprises an HNH domain, and the HNH domain comprises a sequence having at least 75% sequence identity to sequence number 4056 or sequence number 4063.
21. A method described in any one of claims 18 to 20, wherein the endonuclease comprises the sequence of SEQ ID NO: 421.