Activatable Polypeptide Complexes

Abstract

The present disclosure relates to activatable heteromultimeric bispecific polypeptide complexes (HBPCs) and methods of making and using same.

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority to U.S. Provisional Application No. 63 / 256,417, filed October 15, 2021, and U.S. Provisional Application No. 63 / 370,897, filed August 9, 2022, each of which is incorporated by reference in its entirety.

[0002] References to sequence listings submitted electronically via EFS WEB The contents of the electronically submitted Sequence Listing (4681_002PC02_Seqlisting_ST26.xml, size: 190,193 bytes, creation date: October 13, 2022) submitted with this application are incorporated herein by reference in their entirety.

[0003] The present disclosure relates to activatable heteromultimeric bispecific polypeptide complexes (HBPCs) and methods of making and using same. [Background technology]

[0004] The generation and activation of tumor antigen-specific T cells are involved in immune-mediated control of the development and mediation of tumor regression. This requires multiple T cell costimulatory receptors and negative T cell regulatory, or co-inhibitory, receptors to act in concert to control T cell activation, proliferation, and gain or loss of effector function. However, tumor cells have numerous immune evasion mechanisms, making it difficult to initiate and maintain tumor-specific T cell responses in cancer patients. However, attempts have been made to harness T cells for cancer therapy. Such approaches include the use of T cell-inducing bispecifics that bind to surface target antigens on cancer cells and also bind to T cell surface polypeptides, such as CD3, on T cells. In general, by binding to their respective targets, T cell-inducing bispecifics bring T cells into physical proximity to the cancer cells, allowing cytotoxic T cell proteins and enzymes to attack the tumor cells and cause apoptosis, thereby killing the cancer cells.

[0005] Although a potentially promising class of therapeutics for the treatment of cancer, there are hurdles to overcome, including on-target off-tumor toxicity and manufacturing challenges, and therefore there is a need for immunotherapy options with improved safety profiles and manufacturability. Summary of the Invention

[0006] Provided herein is a method for producing a polypeptide comprising: (a) a first polypeptide comprising: (i) a single chain variable fragment (scFv) comprising a first heavy chain variable domain (VH1) and a first light chain variable domain (VL1), wherein the VH1 and VL1 together form a first targeting domain that specifically binds to a first target; (ii) a first masking moiety (MM1); (iii) a first cleavable moiety (CM1); (iv) a second heavy chain variable domain (VH2); and (v) a first monomeric Fc domain (Fc1); and (b) (i) a second light chain variable domain (VH3); and (c) a third polypeptide comprising (i) a second monomeric Fc domain (Fc2) and (ii) no immunoglobulin variable domain. In some embodiments, the first target is a T cell antigen polypeptide and the second target is a cancer cell surface antigen. In some embodiments, the first target is a cancer cell surface antigen and the second target is a T cell antigen polypeptide. In some embodiments, the T cell antigen polypeptide is the epsilon chain of CD3.

[0007] In some embodiments, the first polypeptide further comprises a heavy chain CH1 domain between the antigen targeting domain VH2 and the monomeric Fc domain.

[0008] In some embodiments, the first polypeptide further comprises an immunoglobulin hinge region (HR1) between the CH1 domain and the first monomeric Fc domain.

[0009] In some embodiments, the first polypeptide comprises the amino- to carboxy-terminal structural arrangement of MM1-CM1-scFv-VH2-CH1-HR1-Fc1, where each "-" is independently a direct or indirect linkage.

[0010] In some embodiments of the activatable HBPC described herein, the second polypeptide further comprises a light chain constant domain, CL1. In some embodiments, the second polypeptide comprises the amino- to carboxy-terminal structural arrangement of MM2-CM2-VL2-CL1, where each "-" is independently a direct or indirect linkage.

[0011] In some embodiments of the activatable HBPC described herein, the third polypeptide further comprises an immunoglobulin hinge region (HR2). In some embodiments, the third polypeptide comprises the amino- to carboxy-terminal structural arrangement of HR2-Fc2, where "-" is a direct or indirect linkage.

[0012] In some embodiments of the activatable HBPCs described herein, HR1 of the first polypeptide and HR2 of the second polypeptide comprise the same amino acid sequence. In some embodiments, HR1 of the first polypeptide and HR2 of the second polypeptide comprise different amino acid sequences.

[0013] In some embodiments of the activatable HBPC described herein, the first, second, and / or third polypeptide comprises one or more linkers.

[0014] In some embodiments, the activatable HBPC comprises a linker at one or more of the following positions: (a) between MM1 and CM1; (b) between MM2 and CM2; (b) between the heavy chain variable domain and the light chain variable domain of the scFv; (c) between the heavy chain variable domain and the CH1 domain; (d) between the CH1 domain and the hinge region; (e) between the hinge region and the Fc domain; (g) between CM2 and the light chain variable domain; (h) between the light chain variable domain and the CL; (i) between the CH1 domain and the second Fc domain; (j) between the CH1 domain and the hinge region; and / or (k) between the hinge region and the second Fc domain. In some embodiments, the linker(s) comprises from about 1 to about 20 amino acids.

[0015] In some embodiments of the activatable HBPC described herein, MM1 is linked to CM1 via linker L1. In some embodiments, MM2 is linked to CM2 via linker L2. In some embodiments, the activatable bispecific polypeptide complex comprises both L1 and L2. In some embodiments, MM2 is linked to CM2 via linker L3, and CM2 is linked to the scFv via linker L4. In some embodiments.

[0016] In some embodiments of the activatable HBPCs described herein, the amino acid sequences of L1, L2, L3, and / or L4 are the same. In some embodiments, the amino acid sequence of at least one of L1, L2, L3, and / or L4 is different.

[0017] In some embodiments of the activatable HBPCs described herein, the amino acid sequence of CM1 and the amino acid sequence of CM2 are the same. In some embodiments, the amino acid sequence of CM1 and the amino acid sequence of CM2 are different.

[0018] In some embodiments of the activatable HBPC described herein, CM1 and CM2 each comprise a substrate for a protease present in the tumor microenvironment. In some embodiments, CM1 and CM2 each independently comprise a substrate for the same protease. In some embodiments, CM1 and CM2 each comprise a substrate for a different protease. In some embodiments, CM1 and CM2 each independently comprise a substrate for a protease selected from the group of proteases set forth in Table 3. In some embodiments, at least one of CM1 and CM2 comprises a substrate for a protease selected from the group consisting of serine proteases and matrix metallopeptidases (MMPs). In some embodiments, CM1 and / or CM2 comprise the amino acid sequence of SEQ ID NO:2, SEQ ID NO:14, SEQ ID NOs:73-111, or SEQ ID NOs:156-159.

[0019] In some embodiments of the activatable HBPCs described herein, MM1 and / or MM2 comprises from about 5 amino acids to about 40 amino acids.

[0020] In some embodiments of the activatable HBPCs described herein, each linker is independently selected from the group consisting of: (i) (GS)n, where n is an integer of at least 1, and in some embodiments, n is an integer between 1 and 10; (GGS)n, where n is an integer of at least 1, and in some embodiments, n is an integer between 1 and 10; (GGGS)n (SEQ ID NO:40), where n is an integer of at least 1, and in some embodiments, n is an integer between 1 and 10; (GGGGS)n (SEQ ID NO:126), where n is at least 1), (GSGGS)n (SEQ ID NO:41) (wherein n is an integer of at least 1, and in some embodiments, n is an integer from 1 to 10), GSSGGSGGSG (SEQ ID NO:12), GGSG (SEQ ID NO:42), GGSGG (SEQ ID NO:43), GSGSG (SEQ ID NO:44), GSGGG (SEQ ID NO:45), GGGSG (SEQ ID NO:46), and GSSSG (SEQ ID NO:47), GGGGSGGGGSGGGGSGS (SEQ ID NO:48), GGGGSGS (SEQ ID NO:49), GGGGSGGGGSGGGGS (SEQ ID NO:50), GGGGSGG a glycine-serine based linker selected from the group consisting of GGSGGGGSGGGGS (SEQ ID NO:51), GGGGS (SEQ ID NO:52), GGGGSGGGGS (SEQ ID NO:53), GGGS (SEQ ID NO:54), GGGSGGGS (SEQ ID NO:55), GGGSGGGSGGGS (SEQ ID NO:56), GSSGGSGGSGG (SEQ ID NO:57), GGGSGGGGSGGGGSGGGGSGGGGS (SEQ ID NO:58), GGGSSGGS (SEQ ID NO:127), and GS; and (ii) glycine and serine, as well as lysine, threonine, and is a linker comprising at least one proline, for example, a linker selected from the group consisting of GSTSGSGKPGSSEGST (SEQ ID NO: 59), SKYGPPCPPCPAPEFLG (SEQ ID NO: 60), GGSLDPKGGGGS (SEQ ID NO: 61), PKSCDKTHTCPPCPAPELLG (SEQ ID NO: 62), GKSSGSGSESKS (SEQ ID NO: 63), GSTSGSGKSSEGKG (SEQ ID NO: 64), GSTSGSGKSSEGSGSTKG (SEQ ID NO: 65), and GSTSGSGKPGSGEGSTKG (SEQ ID NO: 66).

[0021] In some embodiments of an activatable HBPC described herein, the first polypeptide comprises a hinge (HR) (hinge 1) having the amino acid sequence of SEQ ID NO: 34. In some embodiments of an activatable HBPC described herein, the second polypeptide comprises a hinge (HR) (hinge 2) having the amino acid sequence of SEQ ID NO: 35.

[0022] Also provided herein are compositions comprising an activatable HBPC as described herein and a pharma- ceutically acceptable carrier. In some embodiments, the compositions comprise water and an activatable HBPC. In some embodiments, the compositions comprise 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or up to 99% water.

[0023] Also provided herein are kits that contain the pharmaceutical compositions described herein.

[0024] Also provided herein are nucleic acids comprising a nucleotide sequence encoding a first polypeptide, a second polypeptide, and / or a third polypeptide of an activatable HBPC described herein. In some embodiments, a nucleic acid comprising a nucleotide sequence encoding a first polypeptide of an activatable HBPC is provided. In some embodiments, a nucleic acid comprising a nucleotide sequence encoding a second polypeptide of an activatable HBPC is provided. In some embodiments, a nucleic acid comprising a nucleotide sequence encoding a third polypeptide of an activatable HBPC is provided. Also provided herein are vectors comprising the nucleic acids described herein. Also provided herein are host cells comprising the vectors described herein.

[0025] Also provided herein is a method of producing an activatable bispecific polypeptide complex, the method comprising: (a) culturing a host cell in a liquid medium under conditions sufficient to produce an activatable HBPC; and (b) recovering the activatable HBPC.

[0026] Also provided herein is a method for treating a disease in a subject, comprising administering a therapeutically effective amount of an activatable heteromultimeric bispecific polypeptide complex (HBPC) or a pharmaceutical composition thereof to the subject. In some embodiments, the subject is a human. In some embodiments, the disease is cancer.

[0027] Also provided herein are activatable heteromultimeric bispecific polypeptide complexes (HBPCs) and pharmaceutical compositions thereof for use in inhibiting tumor growth in a subject in need thereof.

[0028] Also provided herein are activatable heteromultimeric bispecific polypeptide complexes (HBPCs) and pharmaceutical compositions thereof for use in the manufacture of a medicament for treating cancer.

[0029] Also provided herein is a method for producing a polypeptide comprising: (a) a first polypeptide comprising: (i) a single chain variable fragment (scFv) comprising a first heavy chain variable domain (VH1) and a first light chain variable domain (VL1), wherein the VH1 and VL1 together form a T cell antigen targeting domain that specifically binds to a T cell antigen polypeptide; (ii) a first masking moiety (MM1); (iii) a first cleavable moiety (CM1); (iii) a heavy chain variable domain (VH2) that specifically binds to a cancer cell surface antigen when paired with a light chain variable domain (VL2); (iv) a first monomeric Fc domain (Fc1); (v) a heavy chain CH1 domain; and (vi) an immunoglobulin hinge region between the CH1 domain and the Fc1; and (b) (i) a light chain variable domain (VL2) that specifically binds to a cancer cell surface antigen when paired with VH2; (ii) a second masking moiety (MM2). Also provided is an activatable heteromultimeric bispecific polypeptide complex (HBPC) comprising: (iii) a second polypeptide comprising a second cleavable moiety (CM2), and (iv) a light chain constant domain, CL1; and (c) a third polypeptide comprising a second monomeric Fc domain (Fc2) and an immunoglobulin hinge region (HR2), wherein the third polypeptide does not comprise an immunoglobulin variable domain, and wherein the first polypeptide comprises the structural arrangement of amino to carboxy terminus of MM1-CM1-scFv1-VH2-CH1-HR1-Fc1, the second polypeptide comprises the structural arrangement of amino to carboxy terminus of MM2-CM2-VL2-CL1, and the third polypeptide comprises the structural arrangement of amino to carboxy terminus of HR2-Fc2, wherein each "-" is independently a direct or indirect linkage.

[0030] Also provided herein is a method for producing a fusion protein comprising: (a) a first polypeptide comprising: (i) a single chain variable fragment (scFv) that specifically binds to a cancer cell surface antigen; (ii) a first masking moiety (MM1); (iii) a first cleavable moiety (CM1); (iv) a heavy chain variable domain (VH2) that specifically binds to a T cell antigen polypeptide when paired with a light chain variable domain (VL2) of a second polypeptide; (v) a first monomeric Fc domain (Fc1); (vi) a heavy chain CH1 domain; and (vii) an immunoglobulin hinge region (HR1) between the CH1 domain and the first monomeric Fc domain; and (b) (i) a light chain variable domain (VL2) that specifically binds to a T cell antigen polypeptide when paired with the VH2 of the first polypeptide; (ii) a second masking moiety (MM2); (iii) a second cleavable moiety (CM1). and (c) a second polypeptide comprising a second monomeric Fc domain (Fc2) and an immunoglobulin hinge region (HR2), wherein the first polypeptide comprises the amino to carboxy-terminus structural arrangement of MM1-CM1-scFv1-VH2-CH1-HR1-Fc1, the second polypeptide comprises the amino to carboxy-terminus structural arrangement of MM2-CM2-VL2-CL1, and the third polypeptide comprises the amino to carboxy-terminus of HR2-Fc2, wherein each "-" represents a direct or indirect linkage, and wherein the third polypeptide does not comprise an immunoglobulin variable domain.

[0031] Also provided herein is a method for producing a T cell antigen polypeptide comprising: (a) a first polypeptide comprising: (i) a single chain variable fragment (scFv) that specifically binds to a cancer cell surface antigen, (ii) a first masking moiety (MM1), and (iii) a first cleavable moiety (CM1), and a heavy chain variable domain (VH2), (iii) a first monomeric Fc domain (Fc1), a heavy chain CH1 domain, and an immunoglobulin hinge region (HR1) between the CH1 domain and the first monomeric Fc domain; and (b) a second polypeptide comprising: (i) a light chain variable domain (VL2) that specifically binds to a T cell antigen polypeptide when paired with the VH2 of the first polypeptide, (ii) a second masking moiety (MM2), (iii) a second cleavable moiety (CM2), and a light chain constant domain CL1. and (c) a third polypeptide consisting of a second monomeric Fc domain (Fc2) and an immunoglobulin hinge region (HR2), wherein the first polypeptide has the amino to carboxy structural arrangement of MM1-CM1-scFv1-VH2-CH1-HR1-Fc1, the second polypeptide has the amino to carboxy structural arrangement of MM2-CM2-VL2-CL1, and the third polypeptide has the amino to carboxy structural arrangement of HR2-Fc2, wherein each "-" is independently a direct or indirect linkage, and the third polypeptide does not comprise an immunoglobulin variable domain.

[0032] Also provided herein is a heteromultimeric bispecific polypeptide complex (HBPC) comprising: (a) a first polypeptide comprising (i) a single chain variable fragment (scFv) comprising a first heavy chain variable domain (VH1) and a first light chain variable domain (VL1), where the VH1 and VL1 together form a first targeting domain that specifically binds to a first target, (ii) a second heavy chain variable domain (VH2), and (iii) a first monomeric Fc domain (Fc1); (b) a second polypeptide comprising a second light chain variable domain (VL2), where the VH2 and VL2 together form a second targeting domain that specifically binds to a second target; and (c) a third polypeptide comprising a second monomeric Fc domain (Fc2), and no immunoglobulin variable domain. [Brief description of the drawings]

[0033] [Figure 1] FIG. 1 is a schematic diagram of an activatable HBPC described herein. [Figure 2A] Binding to EGFR by CI106 (activatable double arm, bivalent anti-CD3, anti-EGFR bispecific antibody control), complex-57 (activatable HBPC), and complex-67 (activatable HBPC), as well as activated CI106, activated complex-57, and activated complex-67, is shown. [Figure 2B] Binding to CD3 by CI106 (control), complex-57 (activatable HBPC), complex-67 (activatable HBPC), as well as activated CI106, activated complex-57, and activated complex-67 are shown. [Figure 3A] 1 shows cytotoxicity against HT29 cells following treatment with activated CI106 (control), conjugate-57, and conjugate-67, as well as CI106 (a double-arm, bivalent bispecific control construct), and conjugate-57. [Figure 3B] Cytotoxicity against HT29 cells following treatment with CI106 (control), complex-67, activated CI106 (control), and activated complex-67 is shown. [Figure 4]1 shows tumor volume as a function of time in an HT29-luc2 xenograft tumor model following treatment with vehicle, 1.0 mg / kg CI106 (control), and 0.2, 0.6, and 1.8 mg / kg conjugate-67. [Diagram 5] 1 shows tumor volume as a function of time in a HCT116 xenograft tumor model following treatment with vehicle, 0.3 mg / kg, and 1 mg / kg of activated conjugate-67 and conjugate-67. [Figure 6] The percentage (%) of monomer versus concentration of CI106 (control), conjugate-57, and conjugate-67 is shown. [Figure 7] Cytotoxicity is shown as percentage of cell lysis for masked activatable HBPC (complex-339), unmasked activatable HBPC control (complex-342), alternative format 2 activatable polypeptide (complex-231), and alternative format 2 unmasked control polypeptide (complex-164). [Figure 8] AC show flow cytometric assessment of CI107 binding to EGFR and CD3 expressed on the surface of HT29 cells (A), HCT116 cells (B), or Jurkat cells (C). Apparent Kd was calculated from duplicate experiments on HT29 cells and triplicate experiments on Jurkat cells. [Figure 9A] Figure 1 shows the percentage of CI107-mediated cytotoxicity in HCT116-Luc2 cells. After 48 hours of culture, HCT116-Luc2 viability and cytotoxicity were measured compared to untreated controls. [Figure 9B] Figure 1 shows the percentage of CI107-mediated cytotoxicity in HT29-Luc2 cells. After 48 hours of culture, HT29-Luc2 viability and cytotoxicity were measured compared to untreated controls. [Figure 9C] The percentage of cytotoxicity mediated by CI107 in HCT116-Luc2 cells is shown. After 16 h of culture, CD69 expression was measured by flow cytometry. MFI, mean fluorescence intensity. [Figure 9D]The percentage of cytotoxicity mediated by CI107 in HT29-Luc2 cells is shown. After 16 h of culture, CD69 expression was measured by flow cytometry. MFI, mean fluorescence intensity. [Figure 10A] Cytokine (IFN-γ) release after treatment with CI107 is shown, measured after 16 hours of culture. [Figure 10B] Cytokine (IL-2) release following treatment with CI107 is shown, measured after 16 hours of culture. [Figure 10C] Cytokine (IL-6) release following treatment with CI107 is shown, measured after 16 hours of culture. [Figure 10D] Cytokine (MCP-1) release after treatment with CI107 is shown, measured after 16 hours of culture. [Figure 10E] Cytokine (TNF-α) release after treatment with CI107 is shown, measured after 16 hours of culture. [Figure 11] Tumor volumes in mice bearing HT29-Luc2 tumors and engrafted with human PBMCs after treatment with test TCBs. (A) Mice were treated with vehicle (PBS) or 0.3 mg / kg CI020, CI011, CI040, or CI048 once a week for 3 weeks (n=8 per group). Tumor volumes were measured twice a week. (B) NSG mice bearing HT29-Luc2 tumors and engrafted with human PBMCs were treated with vehicle or 1 mg / kg CI020, CI011, CI040, or CI048. Tumors were harvested 7 days after dosing and immunohistochemistry for CD3 was performed. Dark staining indicates CD3+ cells. [Figure 12] A-B show tumor volumes after 3 weeks of treatment with CI107 once a week in HT29 (A) and HCT116 (B) xenograft tumors. Tumor volumes were measured twice a week. *p<0.5; **p<0.01; ****p<0.0001. [Figure 13]A-B show levels of IL-6 (A) and IFN-γ (B) measured 8 hours after administration of CI107. C shows levels of aspartate aminotransferase (AST) measured by serum chemistry analysis 48 hours after administration of CI107 (C). D shows plasma concentrations of Act-CI107 and CI107 measured by ELISA using anti-idiotype capture and anti-human Fc detection. The CI107 line represents data from three individual animals administered 2.0 mg / kg CI107. The Act-TCB line represents a single animal administered 0.06 mg / kg or 0.18 mg / kg Act-TCB. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0034] In order that this disclosure may be more readily understood, certain terms are first defined. As used in this application, unless expressly defined otherwise herein, each of the following terms shall have the meaning set forth below. Additional definitions are set forth throughout this application.

[0035] definition As used herein, the term "activatable polypeptide complex" refers to a polypeptide having at least one variable heavy chain domain and at least one variable light chain domain that together form an antigen-binding region, a masking moiety (MM), and a cleavable moiety (CM), where the MM is linked (directly or indirectly) to the antigen-binding region via a CM that is cleavable by a protease.

[0036] The term "activatable", when used in connection with the term "heteromultimeric bispecific polypeptide complex" or "HBPC", refers herein to an HBPC whose binding activity is impaired by the presence of one or more masking moieties added to the structure of the HBPC. The terms "activated" and "act-" can each be used to refer to an activated HBPC. The terms "activated" and "unmasked" are used interchangeably herein.

[0037] As used herein, the term "polypeptide" is a generic term that refers to a polymer of amino acid residues.

[0038] As used herein, the term "T cells" is defined as thymus-derived lymphocytes that are involved in various cell-mediated immune responses. As used herein, the term "regulatory T cells" refers to CD4 T cells that have suppressive properties. + CD25 + FoxP3 + "Treg" refers to regulatory T cells as used herein.

[0039] As used herein, the term "helper T cells" refers to CD4 + Helper T cells recognize antigens bound to MHC class II molecules. There are at least two types of helper T cells, Th1 and Th2, which produce different cytokines. When activated, helper T cells express CD25 + However, FoxP3 + It only becomes so temporarily.

[0040] As used herein, the term "cytotoxic T cells" refers to CD8 + This refers to T cells. Cytotoxic T cells recognize antigens bound to MHC class I molecules.

[0041] The term "variable region" or "variable domain" refers to a domain of a heavy or light chain of an antigen-binding protein (e.g., an antibody) that is involved in binding the antigen-binding protein (e.g., an antibody) to an antigen. The heavy and light chain variable regions or domains (VH and VL, respectively) of an antigen-binding protein such as an antibody can be further subdivided into hypervariable regions (or hypervariable regions where the sequence and / or the form of structurally defined loops may be hypervariable) such as hypervariable regions (HVRs) or complementarity determining regions (CDRs) interspersed with more conserved regions called framework regions (FRs). Generally, each heavy chain variable region has three HVRs (HVR-H1, HVR-H2, HVR-H3) or CDRs (CDR-H1, CDR-H2, CDR-H3) and each light chain variable region has three HVRs (HVR-L1, HVR-L2, HVR-L3) or CDRs (CDR-L1, CDR-L2, CDR-L3). "Framework region" and "FR" are known in the art to refer to the non-HVR or non-CDR portions of the heavy and light chain variable regions. Generally, there are four FRs (FR-H1, FR-H2, FR-H3, and FR-H4) in each full-length heavy chain variable region, and four FRs (FR-L1, FR-L2, FR-L3, and FR-L4) in each full-length light chain variable region. Within each VH and VL, 、The three HVRs or CDRs and four FRs are typically arranged in the following order from amino terminus to carboxy terminus: FR1, HVR1, FR2, HVR2, FR3, HVR3, FR4 for HVRs, or FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 for CDRs (see also Chothia and Lesk J. Mot. Biol., 195, 901-917 (1987)). A single VH or VL domain may be sufficient to confer antigen-binding specificity. Furthermore, antibodies that bind to a particular antigen may be isolated using VH or VL domains from an antibody that binds to the antigen by screening a library of complementary VL or VH domains, respectively. See, e.g., Portolano et al. J. Immunol. 150:880-887 (1993); Clarkson et al., Nature 352:624-628 (1991).

[0042] As used herein, the term "heavy chain variable region" (VH) refers to a region that comprises heavy chain HVR-H1, FR-H2, HVR-H2, FR-H3, and HVR-H3. For example, a heavy chain variable region can comprise heavy chain CDR-H1, FR-H2, CDR-H2, FR-H3, and CDR-H3. In some aspects, the heavy chain variable region also comprises at least a portion of FR-H1 and / or at least a portion of FR-H4.

[0043] As used herein, the term "heavy chain constant region" refers to a region that contains at least three heavy chain constant domains, C H 1. C H 2, and C H 3. Non-limiting exemplary heavy chain constant regions include gamma, delta, and alpha. Non-limiting exemplary heavy chain constant regions also include epsilon and mu.

[0044] As used herein, the term "light chain variable region" (VL) refers to a region that comprises light chain HVR-L1, FR-L2, HVR-L2, FR-L3, and HVR-L3. In some aspects, the light chain variable region comprises light chain CDR-L1, FR-L2, CDR-L2, FR-L3, and CDR-L3. In some aspects, the light chain variable region also comprises FR-L1 and / or FR-L4.

[0045] As used herein, the term "light chain constant region" refers to a light chain constant domain, C L Non-limiting exemplary light chain constant regions include lambda and kappa.

[0046] As used herein, the term "light chain" (LC) refers to a polypeptide comprising at least a light chain variable region, with or without a leader sequence. In some aspects, a light chain comprises at least a portion of a light chain constant region. As used herein, the term "full-length light chain" refers to a polypeptide comprising a light chain variable region and a light chain constant region, with or without a leader sequence.

[0047] The term "antibody" refers to an immunoglobulin molecule or an immunologically active portion of an immunoglobulin (Ig) molecule (i.e., a molecule that contains an antigen-binding site that specifically binds (immunoreacts with) an antigen). An "antigen-binding portion" (also called an "antigen-binding fragment") of an antibody or polypeptide refers to one or more portions of an antibody or polypeptide that specifically binds to a target antigen. Antibodies and antigen-binding portions include, but are not limited to, polyclonal, monoclonal, chimeric, domain antibodies, single-chain antibodies, Fab and F(ab')2 fragments, scFv, Fd fragments, Fv fragments, single domain antibody (sdAb) fragments, dual affinity retargeting antibodies (DART), dual variable domain immunoglobulins, isolated complementarity determining regions (CDRs), and combinations of two or more isolated CDRs that may be optionally linked by synthetic linkers, and Fab expression libraries. Non-human antibodies, such as camelid antibodies, may be humanized by recombinant methods to reduce their immunogenicity in humans.

[0048] The CDR sequences identified herein are determined according to the Kabat numbering system (i.e., "Kabat CDRs") as described in Abhinandan, KRand Martin, ACR (2008) "Analysis and improvements to Kabat and structurally correct numbering of antibody variable domains", Molecular Immunology, 45, 3832-3839, the entire contents of which are incorporated herein by reference. The Kabat CDRs are defined as follows: CDR-L1: residues L24-L34; CDR-L2: residues L50-L56; CDR-L3: residues L89-L97; CDR-H1: residues H31-H35; CDR-H2: residues H50-H65; and CDR-H3: residues H95-H102, where "L" refers to the light chain variable domain and "H" refers to the heavy chain variable domain.

[0049] "Specifically binds" or "immunospecifically binds" refers to a targeting domain, antibody, or antigen-binding fragment that reacts with one or more antigenic determinants of a desired antigen and does not react with other polypeptides or with much lower affinity (Kd>10 -6 ) where a smaller Kd represents a greater affinity. The immunological binding properties of selected polypeptides can be quantified by methods well known in the art. One such method involves measuring the rates of antigen-binding site / antigen complex formation and dissociation, which depend on the concentrations of the complex partners, the affinity of the interaction, and geometric parameters that affect the rate equally in both directions. Thus, the "on-rate constant" (k on ) and the "off rate constant" (k off Both the k and the k ) can be determined by calculating the concentration and the actual rates of association and dissociation. (See Nature 361:186-87 (1993)). off / k on The ratio of Kd allows for the removal of all parameters not related to affinity and is equal to the dissociation constant Kd. (See generally Davies et al. (1990) Annual Rev Biochem 59:439-473.) In some embodiments, an antigen targeting domain, antibody, or antigen-binding fragment that specifically binds to its corresponding antigen exhibits a Kd for the target antigen of less than about 10 μM, and in some embodiments, less than about 100 μM.

[0050] Immunoglobulins may be derived from any of the commonly known isotypes, including, but not limited to, IgA, secretory IgA, IgG, and IgM. IgG subclasses are also well known to those of skill in the art and include, but are not limited to, human IgG1, IgG2, IgG3, and IgG4. "Isotype" refers to the class or subclass of antibody (e.g., IgM or IgG1), which is encoded by heavy chain constant region genes.

[0051] An "anti-antigen" antibody or polypeptide refers to an antibody or polypeptide that specifically binds to an antigen. For example, an anti-CD3 polypeptide specifically binds to CD3.

[0052] As used herein, the terms "MM" and "masking moiety" are used interchangeably to refer to a peptide that prevents the binding of a targeting domain to its corresponding antigen. For example, MM1 is a peptide that prevents the binding of a first targeting domain to a first target, and MM2 is a peptide that prevents the binding of a second targeting domain to a second target. The degree to which a masking moiety prevents the binding of a targeting domain to its corresponding target is quantified by its "masking efficiency". The terms "masking efficiency" and "ME" are used interchangeably herein to refer to a ratio determined as follows: ME = EC50, activatable HBPC (i.e., not cleaved by proteases) EC50, activated HBPC

[0053] As used herein, the terms "CM" and "cleavable moiety" are used interchangeably to refer to a peptide that is susceptible to cleavage by a protease. Protease-mediated cleavage of the CM releases the MM from the structure of the activatable HBPC, thereby generating an "activated" (i.e., unmasked) product, with each corresponding "activated" (i.e., unmasked) first targeting domain and / or second targeting domain free to bind to its corresponding target.

[0054] As used herein, the term "isolated polynucleotide" refers to a polynucleotide of recombinant or synthetic origin, and by virtue of its origin, an "isolated polynucleotide" is (1) not associated with all or a portion of a polynucleotide with which the "isolated polynucleotide" is found in nature, (2) operably linked to a polynucleotide with which it is not naturally linked, or (3) not found in nature as part of a larger sequence. Polynucleotides according to the present disclosure include nucleic acid molecules that encode first, second, and third polypeptides.

[0055] As used herein, the term "operably linked" refers to the positioning of the components so described being in a relationship permitting them to function in their intended manner. A control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.

[0056] As discussed herein, minor variations of the amino acid sequences described herein (i.e., each reference sequence) are contemplated as being encompassed by the present disclosure, so long as the resulting analog sequence maintains at least 75%, more preferably at least 80%, 90%, 95%, and most preferably 99% sequence identity to the reference sequence. Specifically, conservative amino acid substitutions are contemplated. Conservative substitutions are those that occur within a family of amino acids that are related in terms of the nature of their side chains. Amino acids can be divided into the following families: (1) acidic amino acids are aspartic acid, glutamic acid; (2) basic amino acids are lysine, arginine, histidine; (3) nonpolar amino acids are alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; (4) uncharged polar amino acids are glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Hydrophilic amino acids include arginine, asparagine, aspartic acid, glutamine, glutamic acid, histidine, lysine, serine, and threonine. Hydrophobic amino acids include alanine, cysteine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, tyrosine, and valine. Other families of amino acids include (i) the aliphatic hydroxy family, serine and threonine; (ii) the amide-containing family, asparagine and glutamine; (iii) the aliphatic family, alanine, valine, leucine, and isoleucine; and (iv) the aromatic family, phenylalanine, tryptophan, and tyrosine. For example, within the polypeptides and polypeptide complexes described herein, independent substitutions of leucine with isoleucine or valine, aspartic acid with glutamic acid, threonine with serine, or similar substitutions of amino acids with structurally related amino acids, are reasonably expected to have no major effect on binding or the properties of the resulting molecules, particularly when the substitutions do not involve amino acids within the CDRs or framework regions.Whether an amino acid change results in a functional polypeptide complex can be easily determined by assaying the specific activity of the resulting molecule, i.e., the resulting analog sequence. The assay is described in detail herein. The preferred amino and carboxy termini of the analog occur near the boundaries of the functional domains. Structural and functional domains can be identified by comparing the nucleotide and / or amino acid sequence data to public or proprietary sequence databases. Preferably, computerized comparison methods are used to identify sequence motifs or predicted protein conformational domains that occur in other proteins of known structure and / or function. Methods for identifying protein sequences that fold into known three-dimensional structures are known. See, for example, Bowie et al. Science 253:164 (1991). Thus, the foregoing examples demonstrate that one skilled in the art can recognize sequence motifs and structural conformations that can be used to define structural and functional domains in accordance with the present disclosure.

[0057] Conservative amino acid substitutions will not substantially alter the structural characteristics of the reference sequence (e.g., the substituted amino acid will not tend to disrupt the helices that occur in the reference sequence or other types of secondary structures that characterize the reference sequence). Examples of art-recognized secondary and tertiary structures of polypeptides are described in Proteins, Structures and Molecular Principles (Creighton, Ed., WH Freeman and Company, New York (1984)); Introduction to Protein Structure (C. Branden and J. Tooze, eds., Garland Publishing, New York, NY (1991)); and Thornton et al. Nature 354:105 (1991).

[0058] Exemplary amino acid substitutions also include those that (1) reduce susceptibility to proteolysis in regions of the activatable polypeptide other than those in the cleavable linker containing the CM, (2) reduce susceptibility to oxidation, (3) alter binding affinity for forming protein complexes, (4) alter binding affinity for antigens, and (4) confer or modify other physicochemical or functional properties of such analogs. Such amino acid substitutions can be identified using known mutagenesis and / or directed molecular evolution methods using the assays described herein. See, for example, International Publication No. WO2001 / 032712, U.S. Patent No. 7,432,083, U.S. Patent Publication No. 2004 / 0180340, and U.S. Patent No. 6,297,053, each of which is incorporated herein by reference. Analogs can be prepared by introducing one or more mutations into a reference sequence in an activatable HBPC. For example, single or multiple amino acid substitutions can be made in a naturally occurring reference sequence, preferably in a portion of the polypeptide other than the domain(s) that form intramolecular contacts.

[0059] As used herein, "pharmacologically acceptable" or "pharmacologically compatible" means a substance that is not biologically or otherwise undesirable, e.g., that can be incorporated into a pharmaceutical composition administered to an individual or subject without causing undesirable biological effects or interacting in a deleterious manner with any other components of the composition in which it is included. A pharma-ceutically acceptable carrier or excipient, for example, has met the required standards of toxicological and manufacturing testing and / or is included in the Inactive Ingredients Guide prepared by the U.S. Food and Drug Administration.

[0060] As used herein, a "patient" includes any patient suffering from cancer. As used herein, the terms "subject" and "patient" are used interchangeably.

[0061] The terms "cancer," "cancerous," or "malignant" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Examples of cancer include melanoma, such as unresectable melanoma or metastatic melanoma, leukemia, lymphoma, blastoma, carcinoma, and sarcoma. More specific examples of such cancers include chronic myeloid leukemia, acute lymphoblastic leukemia, Philadelphia chromosome positive acute lymphocytic leukemia (Ph+ALL), squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, glioma, gastrointestinal cancer, renal cancer, ovarian cancer, liver cancer, colorectal cancer, endometrial cancer, kidney cancer, prostate cancer, thyroid cancer, neuroblastoma, pancreatic cancer, glioblastoma multiforme, cervical cancer, gastric cancer, bladder cancer, hepatocellular carcinoma, breast cancer, colon cancer, head and neck cancer, gastric cancer, germ cell tumors, childhood sarcoma, intranasal natural killer, multiple myeloma, acute myeloid leukemia (AML), and chronic lymphocytic leukemia (CML).

[0062] As used herein, the term "tumor" refers to any mass of tissue resulting from excessive cell growth or proliferation, whether benign (non-cancerous) or malignant (cancerous), including precancerous lesions.

[0063] "Administering" refers to the physical introduction of a composition containing a therapeutic agent into a subject using any of a variety of methods and delivery systems known to those skilled in the art. Routes of administration of the formulations disclosed herein include intravenous, intramuscular, subcutaneous, intraperitoneal, spinal or other parenteral routes of administration, such as by injection or infusion. As used herein, the phrase "parenteral administration" refers to a method of administration other than enteral and topical administration, usually by injection, and includes, but is not limited to, intravenous, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural, and intrasternal injection and infusion, as well as in vivo electroporation. In some embodiments, the formulation is administered via a route other than parenteral, and in some embodiments, orally. Routes other than parenteral include topical, epidermal, or mucosal routes of administration, such as intranasal, intravaginal, intrarectal, sublingual, or topical. Also, administration can be, for example, once, multiple times, and / or over one or more extended periods of time.

[0064] "Treatment" or "therapy" of a subject refers to any type of intervention or process performed on a subject, or administration of an active agent to a subject, for the purpose of reversing, alleviating, ameliorating, inhibiting, or slowing the progression, occurrence, severity, or recurrence of a symptom, complication, or condition, or biochemical manifestation associated with a disease.

[0065] As used herein, "effective treatment" refers to a treatment that results in a beneficial effect, e.g., an improvement in at least one symptom of a disease or disorder. A beneficial effect can take the form of an improvement over a baseline, i.e., an improvement over a measurement or observation made before the initiation of treatment according to the method. A beneficial effect can also take the form of preventing, slowing, delaying, or stabilizing the adverse progression of tumor markers. Effective treatment may refer to the alleviation of at least one symptom associated with cancer. Such effective treatment can, for example, reduce a patient's pain, reduce the size and / or number of lesions, reduce or prevent tumor metastasis, and / or slow tumor growth.

[0066] The term "effective amount" refers to an amount of an agent that produces a desired biological, therapeutic, and / or prophylactic result. The result can be a decrease, alleviation, reversal, reduction, delay, and / or amelioration of one or more of the signs, symptoms, or pathogenesis of a disease, or any other desired change in a biological system. With respect to solid tumors, an effective amount includes an amount sufficient to shrink the tumor and / or reduce the rate of tumor growth (e.g., inhibit tumor growth) or slow other undesirable cell proliferation. In some embodiments, an effective amount is an amount sufficient to prevent or delay tumor recurrence. An effective amount can be administered in one or more administrations. An effective amount of a drug or composition can (i) reduce the number of cancer cells, (ii) reduce tumor size, (iii) inhibit, suppress, slow to some extent, and stop cancer cell invasion into peripheral organs, (iv) inhibit (i.e., slow to some extent and stop) tumor metastasis, (v) inhibit tumor growth, (vi) prevent or delay the onset and / or recurrence of tumors, and / or (vii) relieve to some extent one or more of the symptoms associated with cancer.

[0067] "Immune response" refers to the action of cells of the immune system (e.g., T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells, and neutrophils) and soluble macromolecules (including antibodies, cytokines, and complement) produced by cells of the immune system or the liver, spleen, and / or bone marrow that result in the selective targeting, binding, damaging, destroying, and / or elimination from the vertebrate body of invading pathogens, pathogen-infected cells or tissues, cancerous or other abnormal cells, or, in the case of autoimmunity or pathological inflammation, normal human cells or tissues.

[0068] The schematic diagrams of activatable polypeptides of the present disclosure, e.g., Figure 1, are not intended to be exhaustive. Other sequence elements, such as linkers, spacers, and signal sequences, may be present before, after, or between the sequence elements recited in such schematic diagrams. It should also be understood that the MM and CM may be attached to the VH of an antibody or polypeptide but not to the VL of the antibody or polypeptide, and vice versa.

[0069] The use of the alternative (e.g., "or") should be understood to mean either one, both, or any combination thereof of the alternatives. As used herein, the indefinite article "a" or "an" should be understood to refer to "one or more" of any components in a list or slate.

[0070] The term "and / or", when used herein, should be taken as a specific disclosure of each of two particular features or components, with or without the other. Thus, when used herein in phrases such as "A and / or B", the term "and / or" is intended to include "A and B", "A or B", "A" (single), and "B" (single). Similarly, when used in phrases such as "A, B, and / or C", the term "and / or" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (single); B (single); and C (single).

[0071] Whenever an embodiment is described herein by the term "comprising," it is understood that other similar embodiments described by "consisting of" and / or "consisting essentially of" are also provided.

[0072] The term "about" refers to a value or composition that is within an acceptable error range for a particular value or composition as determined by one of ordinary skill in the art, depending in part on the method of measuring or determining the value or composition, i.e., the limitations of the measurement system. For example, "about" or "essentially including" can mean within or more than one standard deviation, as is customary in the art. Alternatively, "about" or "essentially including" can also mean a range of up to 10% or 20% (i.e., ±10% or ±20%). For example, about 3 mg can include any number between 2.7 mg and 3.3 mg (10%), or between 2.4 mg and 3.6 mg (20%). Furthermore, particularly with respect to biological systems or processes, the term can mean up to an order of magnitude or up to 5 times the value. Unless otherwise stated, when a particular value or composition is provided in the present application and claims, the meaning of "about" is deemed to assume an acceptable error range for the particular value or composition.

[0073] As described herein, any concentration range, percentage range, ratio range, or integer range, unless otherwise specified, is understood to include any integer value within the recited range, and, where appropriate, fractions thereof (such as 1 / 10 and 1 / 100 of an integer).

[0074] Unless otherwise defined, all technical and scientific terms used herein shall have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 5th ed., 2013, Academic Press; and the Oxford Dictionary of Biochemistry and Molecular Biology, 2006, Oxford University Press provide those of ordinary skill in the art with a general dictionary of many of the terms used in this disclosure.

[0075] Units, prefixes, and symbols are denoted in their Systeme International de Unites (SI) accepted format. Numerical ranges are intended to be inclusive of the numbers defining the range. The headings provided herein are not intended to limit the various aspects of the disclosure that may be had by reference to the entire specification. Thus, the terms defined above are more fully defined by reference to the entire specification.

[0076] Various aspects of the invention are described in further detail in the following subsections.

[0077] Activatable heteromultimeric bispecific polypeptide complexes (HBPCs) This disclosure: (a) (i) a single chain variable fragment (scFv) comprising a first heavy chain variable domain (VH1) and a first light chain variable domain (VL1), where VH1 and VL1 together form a first targeting domain that specifically binds to a first target; (ii) a first masking portion (MM1); (iii) a first cleavable moiety (CM1) comprising a first substrate for a first protease; (iv) a second heavy chain variable domain (VH2), and (v) a first monomeric Fc domain (Fc1) and a first polypeptide comprising: (b) (i) a second light chain variable domain (VL2), where VH2 and VL2 together form a second targeting domain that specifically binds to a second target, VL2; (ii) a second masking portion (MM2), and (iii) a second cleavable portion (CM2) that comprises a second substrate for a second protease. and a second polypeptide comprising: (c) (i) a second monomeric Fc domain (Fc2), and a third polypeptide comprising Including, the third polypeptide does not comprise an immunoglobulin variable domain; MM1 is a peptide that prevents binding of a first targeting domain to a first target, and MM2 is a peptide that prevents binding of a second targeting domain to a second target. Activatable heteromultimeric bispecific polypeptide complexes are provided.

[0078] In some embodiments, the activatable HBPCs of the present disclosure are selectively activated in conditions more prevalent in tumor microenvironments. However, until such activation occurs, their ability to bind to their targets is impaired. Thus, the activatable bispecific antibodies of the present disclosure (i.e., activatable HBPCs) have the potential to reduce target-associated toxicity by minimizing off-target binding. Structurally, the activatable HBPCs of the present disclosure have only one binding domain for each target (i.e., "monovalent"). Furthermore, these activatable HBPCs do not appear to exhibit substantial concentration-dependent aggregation, allowing the production of activatable HBPCs (activatable bispecific antibodies) with relatively high product purity and high productivity levels.

[0079] In some embodiments, the first polypeptide comprises the structural arrangement of MM1-CM1-scFv-VH2-Fc1 from the amino terminus to the carboxy terminus, where each "-" is independently a direct or indirect linkage. As used herein, "direct linkage" refers to the direct conjugation of two peptides of the HBPC, and "indirect linkage" refers to the conjugation using a linking molecule, such as a spacer or linker. As shown below, an activatable HBPC having the above structure advantageously exhibits increased activity (when activated) and masking efficiency, as well as improved aggregation resistance, compared to an activatable bispecific antibody having another structure.

[0080] In some embodiments, one of the first target and the second target is a surface antigen on an immune effector cell, such as a white blood cell, such as a T cell, a natural killer (NK) cell, a mononuclear effector cell (e.g., a myelomonocytic cell), a macrophage, and / or another immune effector cell. As used herein, the terms "target" and "antigen" are used interchangeably. Suitable immune effector cell targets include, for example, CD3, CD27, CD28, GITR, HVEM, ICOS, NKG2D, OX40, and the like. In some embodiments of the present disclosure, at least one of the first target and the second target is CD3. In certain embodiments, the first target is CD3.

[0081] In certain embodiments, the first target and the second target are different biological targets, and accordingly, the first targeting domain (i.e., VL1 and VH1) and the second targeting domain (i.e., VL2 and VH2) are different. In some embodiments, one of the first target and the second target is a CD3 polypeptide (and accordingly, one of the first targeting domain and the second targeting domain is a CD3 polypeptide targeting domain). In some embodiments, a single-chain variable fragment (scFv) comprises VH1 and VL1 that together form a first targeting domain against a T cell antigen polypeptide (i.e., the first target), and VH2 and VL2 that together form a second targeting domain against a cancer cell surface antigen, such as, for example, a tumor-associated antigen or a tumor-specific antigen (i.e., the second target). Exemplary cancer cell surface antigens include, but are not limited to, EGFR, PSA, PAP, CEA, AFP, HCG, LDH, enolase 2, CA 15-3, and CA 27.29, as well as exemplary targets provided in Table 1. In other embodiments, a single chain variable fragment (scFv) comprises a VH1 and a VL1 that together form a first targeting domain against a cancer cell surface antigen (i.e., a first target), and a VH2 and a VL2 that together form a second targeting domain against a T cell antigen polypeptide. TIFF2024538141000001.tif189159

[0082] In one embodiment, the cancer cell antigen is a growth factor receptor. A growth factor receptor is a receptor that binds to a growth factor. A growth factor is a naturally occurring substance that can stimulate cell growth. There are many different types of growth factors, including adrenomedullin, epidermal growth factor, fibroblast growth factor, hepatocyte growth factor, transforming growth factor, and tumor necrosis factor. Each type of growth factor has a specialized function or cellular process that it may help to regulate. Growth factor receptor domains are rich in cysteines and are found in a variety of eukaryotic proteins. Receptors are involved in signal transduction by enzymes such as tyrosine kinases. Although the types of growth factor receptors are different, they have a common structure that includes the growth factor receptor domain as a disulfide-bonded fold that includes a beta hairpin with two adjacent disulfides.

[0083] In some embodiments of the disclosure, the first polypeptide comprises the structural arrangement from amino terminus to carboxy terminus of MM1-CM1-scFv-VH2-Fc1, where each "-" is independently a direct or indirect linkage.

[0084] In some embodiments, the T cell antigen polypeptide is CD3. As used herein, the term "CD3" or "cluster of differentiation 3" refers to a six-chain protein complex that is a subunit of the T cell receptor complex. (Janeway et al., p. 166, 9 thed.). The α:β heterodimer of the TCR associates with the CD3 subunit to complete the TCR cell surface antigen receptor. Two CD3ε, CD3γ, and CD3δ chains, as well as a homodimer of the CD3ζ chain, complete the T cell receptor complex. This complex is involved in the recognition of peptides bound to major histocompatibility complex classes I and II and is involved in the activation of T cells. The CD3 antigen is expressed by a subset of mature T lymphocytes and thymocytes. As used herein, CD3 can be from any vertebrate source, including mammals such as primates (e.g., humans) and rodents (e.g., mice and rats). The term encompasses "full-length" unprocessed CD3 (e.g., unprocessed or unmodified CD3ε or CD3γ), as well as any form of CD3 that results from processing within the cell. The term also encompasses naturally occurring variants of CD3, including, for example, splice variants or allelic variants. The anti-CD3 targeting domains described herein are capable of specifically binding to human wild-type CD3E (NCBI Accession No. NM_000733.3).

[0085] In some embodiments of the disclosure, the T cell antigen polypeptide is the epsilon chain of CD3. In some embodiments, the scFv (e.g., an anti-CD3 scFv) comprises a heavy chain variable domain (VH1) and a light chain variable domain (VL1).

[0086] In some aspects, the disclosure provides an antibody or antigen-binding fragment thereof (e.g., scFv) comprising VH CDR1-3 and VL CDR1-3 of an anti-CD3 antibody provided in Table 2. In another aspect, the antibody or antigen-binding fragment thereof (e.g., scFv) comprises VH CDR1-3 of SEQ ID NOs: 3-5, respectively, and VL CDR1-3 of SEQ ID NOs: 6-8. In another aspect, the antibody or antigen-binding fragment thereof (e.g., scFv) comprises VH CDR1-3 of SEQ ID NOs: 128, 4, 130, respectively, and VL CDR1-3 of SEQ ID NOs: 131-133, respectively. In another aspect, the antibody or antigen-binding fragment thereof (e.g., scFv) comprises VH CDR1-3 of SEQ ID NOs: 3-5, respectively, and VL CDR1-3 of SEQ ID NOs: 144, 7, 146, respectively. In another aspect, the antibody or antigen-binding fragment thereof (eg, scFv) comprises VH CDRs 1-3 of SEQ ID NOs: 128, 4, 130, respectively, and VL CDRs 1-3 of SEQ ID NOs: 145, 132, 133, respectively.

[0087] Any variable domain and / or scFv of many anti-CD3 antibodies known in the art are suitable for use in the activatable HBPCs of the present disclosure. In some embodiments, the scFv is specific for binding to CD3ε and is or is derived from an antibody or fragment thereof that binds to CD3ε, such as CH2527, FN18, H2C, OKT3, SP34, 2C11, UCHT1, I2C, V9, variants thereof, etc. Anti-CD3 antibodies (and / or variable domains thereof) and masking moieties suitable for use in the activatable HBPCs of the present disclosure include, for example, those described in International Publication Nos. WO2013 / 163631, WO2015 / 013671, WO2016 / 014974, WO2019 / 075405, and WO2019 / 213444, each of which is incorporated herein by reference in its entirety. An activatable HBPC of the disclosure may comprise any of the exemplary anti-CD3 VL and VH CDRs listed in Table 2. TIFF2024538141000002.tif230159TIFF2024538141000003.tif121159

[0088] In some embodiments of the disclosure, the first polypeptide further comprises a heavy chain CH1 domain disposed between the VH2 and the monomeric Fc domain. In some embodiments of the disclosure, the first polypeptide further comprises an immunoglobulin hinge region (HR1) disposed between the CH1 domain and the first monomeric Fc domain.

[0089] In some embodiments of the disclosure, the first polypeptide comprises the amino- to carboxy-terminal structural arrangement of MM1-CM1-scFv-VH2-CH1-HR1-Fc1, where each "-" is independently a direct or indirect linkage.

[0090] In some embodiments, the cancer cell antigen is a tumor cell differentiation antigen or other tumor-associated antigen. Some antigens expressed on tumor cells are also expressed on non-malignant cells of the cell lineage from which the tumor originated, at least during some stages of differentiation. Thus, these lineage-specific antigens can be considered as differentiation markers. Differentiation markers are found on cancer cells because malignant cells usually express at least some of the genes characteristic of the normal cell type from which the tumor cell originates. Thus, the presence of these normal differentiation antigens helps to restrict the cytocidal effect of therapeutic antibodies to a single cell lineage.

[0091] A schematic diagram of an activatable HBPC of the present disclosure is provided in FIG. 1 , which includes (a) a first polypeptide comprising a first masking moiety (MM1) 100, a first cleavable moiety (CM1) 101, an scFv 102 (comprising sequences of VH1 and VL1 connected via a linker), a second heavy chain variable domain VH2 (top) and a CH1 domain (bottom) together shown as 103, which is linked via a hinge region 109 to a first Fc domain 104; (b) a second polypeptide comprising a second masking moiety (MM2) 105, a second cleavable moiety (CM2) 106, and a second light chain variable domain VL2 (top) and a constant light chain domain (bottom), together shown as 107; (c) a third polypeptide comprising a hinge region 110 and a second Fc domain 108; and As shown in FIG. 1, the first Fc domain and the second Fc domain bind to each other, and the second heavy chain variable domain (VH2) and the second light chain variable domain (VL2) form a second targeting domain that specifically binds to a second target. In some embodiments, the scFv is an anti-CD3 scFv, the first target is CD3, and the VH2 and VL2 form a tumor-associated antigen binding domain or a tumor-specific antigen binding domain (i.e., the second target is a tumor-associated antigen or a tumor-specific antigen). Exemplary anti-CD3, anti-EGFR activatable HBPCs and other anti-CD3, anti-tumor associated antigen HBPCs are described in more detail in the Examples below.

[0092] In some aspects of the disclosure, an activatable HBPC comprises an exemplary anti-CD3 scFv that comprises a heavy chain CDR1 (VH CDR1, also referred to herein as CDRH1), CDR2 (VH CDR2, also referred to herein as CDRH2), and CDR3 (VH CDR3, also referred to herein as CDRH3), and a variable light chain CDR1 (VL CDR1, also referred to herein as CDRL1), CDR2 (VL CDR2, also referred to herein as CDRL2), and CDR3 (VL CDR3, also referred to herein as CDRL3).

[0093] In some embodiments of the disclosure, the scFv comprises: (i) a heavy chain variable domain (VH1) comprising a CDR1 comprising the amino acid sequence KYAMN (SEQ ID NO:3), (ii) a CDR2 comprising the amino acid sequence RIRSKYNNYATYYADSVKD (SEQ ID NO:4), and (iii) a CDR3 comprising the amino acid sequence HGNFGNSYISYWAY (SEQ ID NO:5); and (i) a light chain variable domain (VL1) comprising a CDR1 comprising the amino acid sequence GSSTGAVTSGNYPN (SEQ ID NO:6), (ii) a CDR2 comprising the amino acid sequence GTKFLAP (SEQ ID NO:7), and (iii) a CDR3 comprising the amino acid sequence VLWYSNRWV (SEQ ID NO:8).

[0094] In some embodiments of the disclosure, VH1 comprises a heavy chain variable domain that is at least 90% identical, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 9. In some embodiments of the disclosure, VL1 comprises a light chain variable domain that is at least 90% identical, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:10.

[0095] In some embodiments of the disclosure, the first polypeptide scFv comprises a heavy chain variable domain of SEQ ID NO: 9. In some embodiments of the disclosure, the first polypeptide scFv comprises a light chain variable domain of SEQ ID NO: 10.

[0096] In some aspects, VH1 comprises (i) a VH CDR1 comprising the amino acid sequence KYAMN (SEQ ID NO:3), (ii) a VH CDR2 comprising the amino acid sequence RIRSKYNNYATYYADSVKD (SEQ ID NO:4), and (iii) a VH CDR3 comprising the amino acid sequence HGNFGNSYISYWAY (SEQ ID NO:5); VL1 comprises (i) a VL CDR1 comprising the amino acid sequence GSSTGAVTSGNYPN (SEQ ID NO:6), (ii) a VL CDR2 comprising the amino acid sequence GTKFLAP (SEQ ID NO:7), and (iii) a VL CDR3 comprising the amino acid sequence VLWYSNRWV (SEQ ID NO:8), and MM1 comprises the amino acid sequence of SEQ ID NO:1.

[0097] In an alternative embodiment, the single chain variable fragment comprises a heavy chain variable domain (VH1) comprising: (i) a VH CDR1 comprising the amino acid sequence TYAMN (SEQ ID NO: 128), (ii) a VH CDR2 comprising the amino acid sequence RIRSKYNNYATYYADSVKD (SEQ ID NO: 129), and (iii) a VH CDR3 comprising the amino acid sequence HGNFGNSYVSWFAY (SEQ ID NO: 130); and a light chain variable domain (VL1) comprising: (i) a VL CDR1 comprising the amino acid sequence RSSTGAVTTSNYAN (SEQ ID NO: 131), (ii) a VL CDR2 comprising the amino acid sequence GTNKRAP (SEQ ID NO: 132), and (iii) a VL CDR3 comprising the amino acid sequence ALWYSNLWV (SEQ ID NO: 133).

[0098] In some of these aspects of the disclosure, VH1 comprises the amino acid sequence of SEQ ID NO: 134. In certain aspects of the disclosure, VL1 comprises the amino acid sequence of SEQ ID NO: 135. In certain aspects of the disclosure, the scFv comprises the amino acid sequence of SEQ ID NO: 122 (inclusive of SEQ ID NOs: 134 and 135).

[0099] In some embodiments of the disclosure, VH1 comprises an amino acid sequence that is at least 90% identical, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 134. In some embodiments of the disclosure, VL1 comprises an amino acid sequence that is at least 90% identical, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 135.

[0100] In some embodiments of the disclosure, the first polypeptide single chain variable fragment comprises a heavy chain variable domain (VH1) comprising: (i) a VH CDR1 comprising the amino acid sequence TYAMN (SEQ ID NO: 128); (ii) a VH CDR2 comprising the amino acid sequence RIRSKYNNYATYYADSVKD (SEQ ID NO: 129); (iii) a VH CDR3 comprising the amino acid sequence HGNFGNSYVSWFAY (SEQ ID NO: 130); and wherein the heavy chain variable domain is at least 90% identical, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 135.

[0101] In some embodiments of the disclosure, the VL1 comprises an amino acid sequence comprising: (i) a VL CDR1 comprising the amino acid sequence RSSTGAVTTSNYAN (SEQ ID NO: 131); (ii) a VL CDR2 comprising the amino acid sequence GTNKRAP (SEQ ID NO: 132); and (iii) a VL CDR3 comprising the amino acid sequence ALWYSNLWV (SEQ ID NO: 133), wherein the amino acid sequence of VL1 is at least 90% identical, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 135.

[0102] In some of these embodiments, VH1 comprises (i) a VH CDR1 comprising the amino acid sequence TYAMN (SEQ ID NO: 128), (ii) a VH CDR2 comprising the amino acid sequence RIRSKYNNYATYYADSVKD (SEQ ID NO: 129), and (iii) a VH CDR3 comprising the amino acid sequence HGNFGNSYVSWFAY (SEQ ID NO: 130); VL1 comprises (i) a VL CDR1 comprising the amino acid sequence RSSTGAVTTSNYAN (SEQ ID NO: 131), (ii) a VL CDR2 comprising the amino acid sequence GTNKRAP (SEQ ID NO: 132), and (iii) a VL CDR3 comprising the amino acid sequence ALWYSNLWV (SEQ ID NO: 133), and MM1 comprises the amino acid sequence of SEQ ID NO: 72.

[0103] As mentioned above, the first polypeptide further comprises a monomeric Fc domain (Fc1). Fc domains known in the art are suitable for use in the activatable HBPC of the present disclosure and are described in further detail herein below.

[0104] In some embodiments of the activatable HBPCs described herein, the first polypeptide further comprises a heavy chain CH1 domain disposed between VH2 and Fc1. In some embodiments of the activatable heteromultimeric bispecific polypeptide complexes (HBPCs) described herein, the first polypeptide further comprises an immunoglobulin hinge region disposed between VH2 and Fc1. In some embodiments in which a CH1 domain is present, the immunoglobulin hinge sequence is disposed between the CH1 domain and the Fc1 domain.

[0105] In some embodiments of the activatable HBPC described herein, the first polypeptide comprises the amino- to carboxy-terminal structural arrangement of MM1-CM1-scFv-VH2-CH1-hinge region (HR1)-Fc1, where each "-" is independently a direct or indirect (e.g., via a linker) linkage.

[0106] In some embodiments of the activatable HBPC described herein, the first polypeptide further comprises one or more optional linkers, as described in more detail herein below.

[0107] In some embodiments of the disclosure, an activatable HBPC comprises a first polypeptide comprising an Fc1 having the amino acid sequence set forth in SEQ ID NO: 23 or SEQ ID NO: 24. In some embodiments of the disclosure, an activatable HBPC comprises a first polypeptide comprising a hinge region having the sequence of hinge-1 (SEQ ID NO: 34) or hinge-2 (SEQ ID NO: 35).

[0108] In some embodiments of the disclosure, the activatable HBPC comprises a second polypeptide that comprises a targeting domain that comprises a light chain variable domain (VL2) that comprises a VL CDR1, a VL CDR2, and a VL CDR3.

[0109] In some embodiments of the activatable HBPC described herein, the second polypeptide comprises one or more linkers. In some embodiments, MM2 is linked to CM2 via a linker.

[0110] In some embodiments, the second polypeptide of an activatable HBPC described herein further comprises a linker comprising from about 1 to about 20 amino acids. Linkers suitable for use in the present disclosure are discussed in more detail below.

[0111] In some embodiments, the second polypeptide further comprises a constant light chain domain (CL). Exemplary CLs include any CLs known in the art. In some embodiments, the second polypeptide comprises a CL having the amino acid sequence of SEQ ID NO: 25. In certain of these embodiments, the second polypeptide comprises the structural arrangement from the amino terminus to the carboxy terminus of MM2-CM2-VL2-CL, where each "-" is independently a direct or indirect (e.g., via a linker) linkage.

[0112] In some embodiments, the third polypeptide of an activatable HBPC described herein comprises a monomeric Fc domain (Fc2) and does not comprise an immunoglobulin variable domain. Fc2 can comprise any of the Fc domains discussed herein.

[0113] In some aspects, an activatable HBPC disclosed herein comprises a third polypeptide comprising the structural arrangement from the amino terminus to the carboxy terminus of a hinge region-Fc2, where each "-" is independently a direct or indirect (e.g., via a linker) linkage. In some aspects, the "-" is a direct linkage. In certain aspects, the third polypeptide consists essentially of a hinge region and Fc2, or consists of a hinge region and Fc2. In some aspects, the third polypeptide comprises an Fc2 having an amino acid sequence comprising SEQ ID NO:28 (optionally with a C-terminal lysine, i.e., SEQ ID NO:29). In one aspect, the third polypeptide comprises a hinge comprising the amino acid sequence of SEQ ID NO:35 and an Fc2 comprising the amino acid sequence of SEQ ID NO:28 (optionally with a C-terminal lysine, i.e., SEQ ID NO:29). In one particular aspect, the first polypeptide comprises a hinge comprising the amino acid sequence of SEQ ID NO: 34 and an Fc1 comprising the amino acid sequence of SEQ ID NO: 23 (optionally with a C-terminal lysine, i.e., SEQ ID NO: 137).

[0114] As described above, in some embodiments, the third polypeptide can include a linker, for example, between the hinge region and Fc2. The linker can include any of the linkers discussed herein. In certain embodiments, the third polypeptide does not include a linker.

[0115] The structural arrangement of components in the activatable HBPCs described herein, i.e., comprising the first, second, and third polypeptides described above, advantageously exhibits increased activity (when activated) and improved resistance to aggregation compared to activatable polypeptides having different structural arrangements of the same components. The examples provided herein suggest that the structure of the activatable HBPCs of the present disclosure confers beneficial properties compared to other types of masked bispecific constructs. Results were consistent across different species of constructs and appeared to be independent of the type of antibody variable domain, masking moiety, and other sequence variables.

[0116] The activatable HBPCs provided herein include a first masking moiety and a second masking moiety (MM1 and MM2, respectively). Each MM has an amino acid sequence located within the activatable HBPC that couples or otherwise binds to the activatable HBPC and prevents the HBPC from binding to its target. Thus, the dissociation constant (Kd) of an activatable HBPC is typically greater than the Kd of the corresponding activated HBPC (or HBPC alone). Suitable first and second MMs can be identified using any of a variety of known techniques. For example, peptide MMs can be identified using the methods described in U.S. Patent Application Publication Nos. 2009 / 0062142 and 2012 / 0244154, and PCT Publication No. WO2014 / 026136, each of which is incorporated herein by reference in its entirety.

[0117] In some embodiments, VH1 and VL1 together form a domain that specifically binds to a T cell antigen polypeptide (i.e., a first target), and MM1 attenuates the ability of the activatable heteromultimeric bispecific polypeptide complex to specifically bind to the T cell antigen polypeptide. In some embodiments, VH2 and VL2 together form a domain that specifically binds to a cancer cell antigen (i.e., a second target), and MM2 attenuates the ability of the activatable heteromultimeric bispecific polypeptide complex to specifically bind to the cancer cell antigen. In some embodiments, MM1 and / or MM2 specifically bind to the antigen binding domain(s).

[0118] For example, masking moieties suitable for use in the practice of the present disclosure in connection with various antibody binding domains include those disclosed in, e.g., PCT Publication Nos. WO2013 / 163631, WO2013 / 192550, WO2014 / 052462, WO2015 / 066279, WO2016 / 014974, WO2016 / 149201, WO2016 / 17928, Anti-CD3 masking moieties suitable for use in the practice of the present disclosure include any known in the art, including, for example, those described in PCT Publication Nos. WO2016 / 014974, WO2019 / 075405, and WO2019 / 213444, each of which is incorporated herein by reference in its entirety. Anti-CD3 masking moieties suitable for use in the practice of the present disclosure include any known in the art, including, for example, those described in PCT Publication Nos. WO2016 / 014974, WO2019 / 075405, and WO2019 / 213444, each of which is incorporated herein by reference in its entirety.

[0119] In some embodiments of the activatable HBPCs provided herein, MM1 and / or MM2 comprise from 5 amino acids to about 40 amino acids, or any range therebetween, including both 5 amino acids and 40 amino acids.

[0120] The activatable HBPC of the present disclosure is activated when the first and second substrates (and thus the first and second CMs) are cleaved by the first and second proteases, respectively, thereby cleaving the masking moiety from the HBPC. In this embodiment, each CM has a sequence site that is cleavable by one or more proteases. The resulting activated HBPC is thus free to bind to the first and second targets. In some embodiments, the first and second substrates (and thus the first and second CMs) are the same. In these embodiments, the first and second substrates (and the first and second CMs) are cleavable by the same protease, i.e., the first and second proteases are the same. In some embodiments, the first and second substrates are different (and thus the first and second CMs are different). In certain of these embodiments, the first and second proteases are the same. In other of these embodiments, the first protease and the second protease are different.

[0121] In some embodiments, the CM is specific for proteases that are upregulated in the tumor microenvironment. Such activatable HBPCs exploit dysregulated protease activity in tumor cells for activation of targeted heteromultimeric bispecific polypeptides (HBPCs) at therapeutic and / or diagnostic sites. Numerous studies have demonstrated the correlation of abnormal protease levels (e.g., uPA, legumain, MT-SP1, matrix metalloproteinases (MMPs), etc.) in solid tumors. (See, e.g., Murthy RV, et al. "Legumain expression in relation to clinicopathologic and biological variables in colorectal cancer," Clin Cancer Res. 11 (2005): 2293-2299; Nielsen BS, et al. "Urokinase plasminogen activator is localized in stromal cells in ductal breast cancer," Lab Invest 81 (2001): 1485-1501; Look OR, et al. "In situ localization of gelatinolytic activity in the extracellular matrix of metastases of colon cancer in rat liver using quenched fluorogenic DQ-gelatin," J Histochem Cytochem. 51 (2003): 821-829.) CM can function as a substrate for multiple proteases, e.g., a serine protease and a second, distinct protease, e.g., an MMP. In some embodiments, a CM can function as a substrate for more than one serine protease, such as matriptase and / or uPA, hi some embodiments, a CM can function as a substrate for more than one MMP, such as MMP9 and MMP14.

[0122] In some embodiments, CM1 and / or CM2 comprise an amino acid sequence that is a substrate for a protease set forth below in Table 3. In particular embodiments, CM1 and CM2 each independently comprise an amino acid sequence that is a substrate for a protease set forth below in Table 3. TIFF2024538141000004.tif230159TIFF2024538141000005.tif54159

[0123] In some embodiments of the activatable HBPC described herein, CM1 and / or CM2 comprise from about 3 amino acids to about 15 amino acids. In some embodiments, CM1 and / or CM2 may comprise two or more cleavage sites. In some embodiments, CM1 may comprise two or more cleavage sites for one protease. In some embodiments, CM2 may comprise two or more cleavage sites for two or more proteases. In some embodiments, the first protease and the second protease are the same protease. In some embodiments, CM1 and CM2 comprise different substrates for the same protease. In some embodiments, CM1 and CM2 comprise the same amino acid sequence. In some embodiments, CM1 and CM2 comprise different amino acid sequences. In some embodiments, CM1 comprises the amino acid sequence of SEQ ID NO: 73. In some embodiments, CM1 comprises the amino acid sequence of SEQ ID NO: 2. In some embodiments, CM2 comprises the amino acid sequence of SEQ ID NO: 14. In certain embodiments, an activatable HBPC described herein comprises a CM1 comprising the amino acid sequence of SEQ ID NO: 2 and a CM2 comprising the amino acid sequence of SEQ ID NO: 14. In some embodiments, an activatable HBPC described herein comprises a CM1 comprising the amino acid sequence of SEQ ID NO: 73 and a CM2 comprising the amino acid sequence of SEQ ID NO: 14.

[0124] Exemplary CM suitable for use in the activatable HBPC described herein include CMs known in the art. Exemplary CMs include, but are not limited to, those described in Table 4, as well as those described in International Publication Nos. WO2009 / 025846, WO2010 / 081173, WO2015 / 013671, WO2015 / 048329, WO2015 / 116933, WO2016 / 014974, and WO2016 / 118629 (each of which is incorporated herein by reference in its entirety).

[0125] In some embodiments, CM1 and / or CM2 comprise an amino acid sequence set forth below in Table 4. In certain embodiments, CM1 and CM2 each independently comprise an amino acid sequence set forth below in Table 4. TIFF2024538141000006.tif227159TIFF2024538141000007.tif53159

[0126] In some embodiments of the activatable heteromultimeric bispecific polypeptides (HBPCs) of the present disclosure, the first polypeptide comprises one or more linkers between the MM and the CM. In some embodiments, MM1 is linked to CM1 via a linker. In some embodiments, MM2 is linked to CM2 via a linker. In some embodiments, MM1 is linked to CM1 via linker L1, and CM1 is linked to the anti-CD3 scFv via linker L2. In some embodiments, MM2 is linked to CM2 via linker L3, and CM2 is linked to the scFv via linker L4. In some embodiments, the amino acid sequences of L1, L2, L3, and / or L4 are the same. In some embodiments, the amino acid sequences of L1, L2, L3, and / or L4 are different.

[0127] In some embodiments, the activatable HBPC comprises a linker between the CM and the targeting domain or its variable domain. Linkers suitable for use in the activatable heteromultimeric bispecific polypeptides (HBPCs) described herein are generally those that provide flexibility to the activatable heteromultimeric bispecific polypeptides (HBPCs) to facilitate inhibition of binding of the activatable polypeptide to the target. Such linkers are generally referred to as flexible linkers. Suitable linkers can be readily selected and may be of different suitable lengths, such as 1 amino acid (e.g., Gly) to 20 amino acids, 2 amino acids to 15 amino acids, 3 amino acids to 12 amino acids, 4 amino acids to 10 amino acids, 5 amino acids to 9 amino acids, 6 amino acids to 8 amino acids, or 7 amino acids to 8 amino acids, and may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids in length.

[0128] Exemplary flexible linkers include glycine polymers (G), glycine-serine polymers (e.g., (GS), (GSGGS), (GGGS), and (GGGGS) (SEQ ID NO: 41 and SEQ ID NO: 40, respectively), where n is an integer of at least 1), glycine-alanine polymers, alanine-serine polymers, and other flexible linkers known in the art. Glycine and glycine-serine polymers are relatively unstructured and can therefore function as neutral tethers between components. Glycine has significant access to more φ-φ space than alanine and is less restricted than residues with longer side chains (see, e.g., Scheraga, Rev. Computational Chem. 11173-142 (1992)). Those skilled in the art will recognize that the design of activatable polypeptides can include all or part of a flexible linker, such that the linker can include not only a flexible linker, but one or more moieties that provide a less flexible structure to provide the desired structure.

[0129] The activatable bispecific polypeptide complexes (i.e., HBPCs) described herein can include a linker at one or more of the following positions: (a) between MM1 and CM1 and / or between CM1 and the scFv (i.e., between CM1 and the heavy chain variable domain (VH1) of the scFv, or between CM1 and the light chain variable domain of the scFv); (b) between MM2 and CM2; (b) between the heavy chain variable domain and the light chain variable domain of the scFv; (c) between the heavy chain variable domain and the CH1 domain; (d) between the CH1 domain and the hinge region; (e) between the hinge region and the Fc domain; (g) between CM2 and the light chain variable domain; (h) between the light chain variable domain and the CL; (i) between the CH1 domain and the second Fc domain; (j) between the CH1 domain and the hinge region; and / or (k) between the hinge region and the second Fc domain.

[0130] In some embodiments, the linker is selected from the group consisting of: (i) (GS)n, where n is an integer of at least 1, and in some embodiments, n is an integer between 1 and 10; (GGS)n, where n is an integer of at least 1, and in some embodiments, n is an integer between 1 and 10; (GGGS)n (SEQ ID NO:40), where n is an integer of at least 1, and in some embodiments, n is an integer between 1 and 10; (GGGGS)n (SEQ ID NO:126), where n is an integer of at least 1; (GSGGS)n (SEQ ID NO:127), where n is an integer of at least 1; row number 41) (wherein n is an integer of at least 1, and in some embodiments, n is an integer from 1 to 10), GSSGGSGGSG (SEQ ID NO: 12), GGSG (SEQ ID NO: 42), GGSGG (SEQ ID NO: 43), GSGSG (SEQ ID NO: 44), GSGGG (SEQ ID NO: 45), GGGSG (SEQ ID NO: 46), and GSSSG (SEQ ID NO: 47), GGGGSGGGGSGGGGSGS (SEQ ID NO: 48), GGGGSGS (SEQ ID NO: 49), GGGGSGGGGSGGGGS (SEQ ID NO: 50), GGGGSGGGGSGGGGSG GGGS (SEQ ID NO:51), GGGGS (SEQ ID NO:52), GGGGSGGGGS (SEQ ID NO:53), GGGS (SEQ ID NO:54), GGGSGGGS (SEQ ID NO:55), GGGSGGGSGGGS (SEQ ID NO:56), GSSGGSGGSG (SEQ ID NO:57), GGGSGGGGSGGGGSGGGGSGGGGS (SEQ ID NO:58), GGGSSGGS (SEQ ID NO:127), and GS; and (ii) GSTSGSGKPGSSEGST (SEQ ID NO:59), SK A linker comprising glycine and serine, and at least one of lysine, threonine, or proline, selected from the group consisting of YGPPCPPCPAPEFLG (SEQ ID NO: 60), GGSLDPKGGGGS (SEQ ID NO: 61), PKSCDKTHTCPPCPAPELLG (SEQ ID NO: 62), GKSSGSGSESKS (SEQ ID NO: 63), GSTSGSGKSSEGKG (SEQ ID NO: 64), GSTSGSGKSSEGSGSTKG (SEQ ID NO: 65), and GSTSGSGKPGSGEGSTKG (SEQ ID NO: 66).

[0131] In some aspects of the present disclosure, the activatable heteromultimeric bispecific polypeptide complex may include components in addition to the components described above. Such components may include a spacer. The term "spacer" as used herein refers to an amino acid residue or peptide incorporated at the free end of the first, second, and / or third polypeptide. Spacers suitable for use in the practice of the present disclosure include any single amino acid residue or any peptide. Suitable spacers include, for example, any of those described in International Publication Nos. WO2016 / 014974, WO2019 / 075405, and WO2019 / 213444, each of which is incorporated herein by reference in its entirety.

[0132] In some embodiments, the spacer can comprise from about 1 amino acid to about 10 amino acids (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, or 9 amino acids), or any number therebetween. In some embodiments of the activatable heteromultimeric bispecific polypeptide complexes described herein, the spacer is located N-terminal to MM1 and / or MM2. In some embodiments, the spacer has a sequence of QGQSGS (SEQ ID NO: 116). In some embodiments, the spacer has a sequence of QGQSGQG (SEQ ID NO: 117). In some embodiments, the spacer has a sequence of QGQSGS (SEQ ID NO: 118). In some embodiments, the spacer has a sequence of QGQSGQG (SEQ ID NO: 119).

[0133] In some aspects, the first and second Fc domains (Fc1 and Fc2, respectively) of the activatable heteromultimeric bispecific polypeptide complexes described herein are IgG1 or IgG4 Fc domains (e.g., human IgG1 or IgG4 Fc domains), or variants thereof. In some aspects, Fc1 and / or Fc2 are modified variants of a native (e.g., human) IgG1 Fc domain. In some aspects, Fc1 and / or Fc2 are modified variants of a native (e.g., human) IgG4 Fc domain.

[0134] In some embodiments of the present disclosure, the Fc domains used as Fc1 and / or Fc2 are variants of the native Fc amino acid sequence. The mutations may confer desirable beneficial properties to the activatable heteromultimeric bispecific polypeptide (and correspondingly, the activated HBPC). For example, certain mutations in the FcRn binding site are known to modulate effector function (see, for example, Petkova et al., Intl. Immunol. 18:1759-1769, 2006; Deng et al., MAbs 4:101-109, 2012; and Olafson et al., Methods Mol. Biol. 907:537-556, 2012). It is appropriate to include any known mutation that can modulate effector function in the Fc domain. For example, N297A or N297G mutations in the Fc amino acid sequence can be used to reduce IgG effector functions (e.g., ADCC and CDC), potentially reducing target-independent cytotoxicity (see, e.g., Lund et al., Mol. Immunol. 29:35-39, 1992). Suitable Fc domains for use in the context of the present disclosure include, but are not limited to, any Fc domain known in the art, including any known heterodimeric Fc (e.g., knobs-in-holes, etc.).

[0135] In some aspects, the activatable heteromultimeric bispecific polypeptide complexes disclosed herein further comprise an immunoglobulin hinge region. Suitable hinge regions include any hinge region known in the art. For example, hinge regions of any of the five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, or subclasses (isotypes) thereof (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2) are suitable for use in the present disclosure. Different classes of immunoglobulins have different well-known subunit structures and three-dimensional configurations.

[0136] In some embodiments of the activatable heteromultimeric bispecific polypeptide complexes described herein, Fc1 comprises an amino acid sequence that is at least 90% identical, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO:23 (optionally with a C-terminal lysine (i.e., SEQ ID NO:24)).

[0137] In some embodiments, the third polypeptide further comprises a monomeric Fc domain (Fc2) that binds Fc1. In some embodiments, Fc2 comprises an amino acid sequence that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to SEQ ID NO: 28. In some embodiments, Fc2 comprises SEQ ID NO: 28, optionally with a terminal lysine (i.e., SEQ ID NO: 29).

[0138] In some embodiments, the third polypeptide comprises a hinge region having an amino acid sequence selected from the group consisting of SEQ ID NOs:34 and 35.

[0139] As provided elsewhere herein, the format or structure of the activatable heteromultimeric bispecific polypeptide complexes disclosed herein can include any number of optional additional components, including linkers and spacers. By way of example only, the structure described below is one of the contemplated embodiments. However, the embodiment depicted below is in no way limiting of the present disclosure.

[0140] In some embodiments, the activatable heteromultimeric bispecific polypeptide complex comprises a first polypeptide having the structure (I). First Polypeptide Structure (I): (S1)-MM1-(L1)-CM1-L2-VH1-L3-VL1-(L4)-VH2-(L5)-(CH11)-(L6)-(hinge 1)-(L7)-Fc1, During the ceremony, (S1) is an optional spacer; MM1 is a masking portion of the first targeting domain; (L1), (L4), (L5), (L6), and (L7) are each independently an optional linker; L2 and L3 are linkers, (CH11) is an optional CH1 domain, (hinge1) is the optional hinge region, Fc1 is as above.

[0141] In some embodiments, the activatable heteromultimeric bispecific polypeptide complex comprises a second polypeptide having the structure (II). Second Polypeptide Structure (II): (S2)-(L8)-MM2-(L9)-CM2-(L10)-VL2-(CL) During the ceremony, (S2) is an optional spacer; (L8), (L9), and (L10) are each independently an optional linker; MM2 is a masking portion of the second targeting domain; VL2 is as above, (CL) is an optional light chain constant domain.

[0142] In some embodiments, the activatable heteromultimeric bispecific polypeptide complex comprises a third polypeptide having the structure (III). Third Polypeptide Structure (III): (S3)-(CH12)-(L11)-(hinge 2)-(L12)-Fc2 During the ceremony, (S3) is an optional spacer; (CH12) is an optional CH1 domain, (L11) and (L12) are each independently an optional linker; Fc2 is as above.

[0143] Linkers, spacers, MM, CM, Fc domains, CH1 (i.e., CH11 and CH12) domains, hinge regions, and CL suitable for use in structures (I), (II), and (III) include those known in the art or described herein.

[0144] In some embodiments of the disclosure, an activatable HBPC comprises: (a) (i) a single chain variable fragment (scFv) comprising a first heavy chain variable domain (VH1) and a first light chain variable domain (VL1), where the VH1 and VL1 together form a T cell antigen targeting domain that specifically binds to a T cell antigen polypeptide; (ii) a first masking moiety (MM1); (iii) a first cleavable moiety (CM1); (iv) a second heavy chain variable domain (VH2); (v) a first monomeric Fc domain (Fc1); (vi) a heavy chain CH1 domain; and (vii) a first immunoglobulin between the CH1 domain and the Fc1. (b) a second polypeptide comprising (i) a light chain variable domain (VL2), where VH2 and VL2 together form a cancer cell surface antigen targeting domain that specifically binds to a cancer cell surface antigen, (ii) a second masking portion (MM2), (iii) a second cleavable portion (CM2), and (iv) a light chain constant domain CL1; and (c) a third polypeptide comprising (i) a second monomeric Fc domain (Fc2) and an immunoglobulin hinge region, and (ii) no immunoglobulin variable domain.

[0145] In certain embodiments, the first polypeptide comprises: comprising the amino- to carboxy-terminal structural arrangement of MM1-CM1-scFv1-VH2-CH1-HR1-Fc1; The second polypeptide is comprising the amino- to carboxy-terminal structural arrangement of MM2-CM2-VL2-CL1; The third polypeptide comprises the structural arrangement from the amino terminus to the carboxy terminus of HR2-Fc2, where each "-" is independently a direct or indirect (e.g., via a linker) linkage. In some embodiments, the third polypeptide consists essentially of, or consists of, HR2-Fc2, where each "-" is independently a direct or indirect (e.g., via a linker) linkage.

[0146] In some embodiments, HR1 of the first polypeptide and HR2 of the second polypeptide comprise the same amino acid sequence. In some embodiments, HR1 of the first polypeptide and HR2 of the second polypeptide comprise different amino acid sequences.

[0147] The present disclosure also provides a heteromultimeric bispecific polypeptide complex (e.g., an HBPC component of an activatable HBPC described herein) comprising: (a) a first polypeptide comprising: (i) a single chain variable fragment (scFv) comprising a first heavy chain variable domain (VH1) and a first light chain variable domain (VL1), where the VH1 and VL1 together form a first targeting domain that specifically binds to a first target; (ii) a second heavy chain variable domain (VH2); and (iii) a first monomeric Fc domain (Fc1); (b) a second polypeptide comprising a second light chain variable domain (VL2), where the VH2 and VL2 together form a second targeting domain that specifically binds to a second target; and (c) a third polypeptide comprising a second monomeric Fc domain (Fc2), where the third polypeptide does not comprise an immunoglobulin variable domain. In some embodiments, the above HBPC constructs may be generated by "activation" of an activatable HBPC described herein. Any of the VH1, VL1 (and scFv), VH2, VL2, Fc1, Fc2, and optional linker, HR1, HR2, and CH1 components described herein as suitable for the activatable HBPCs of the present disclosure are suitable for the above HBPC constructs. The three polypeptides of HBPC have a structure comprising the following components: (a) a first polypeptide comprising (i) a single-chain variable fragment (scFv) comprising a first heavy chain variable domain (VH1) and a first light chain variable domain (VL1), where the VH1 and VL1 together form a first targeting domain that specifically binds to a first target, (ii) a second heavy chain variable domain (VH2), and (iii) a first monomeric Fc domain (Fc1); (b) a second polypeptide comprising a second light chain variable domain (VL2), where the VH2 and VL2 together form a second targeting domain that specifically binds to a second target; and (c) a third polypeptide comprising a second monomeric Fc domain (Fc2) and no immunoglobulin variable domain.

[0148] kit Provided herein is a kit comprising one or more of the activatable HBPCs or HBPCs thereof described herein, the kit being for diagnostic or therapeutic use. In certain aspects, provided herein is a pack or kit comprising one or more containers filled with one or more of the components of the compositions described herein, such as one or more of the activatable HBPCs or antigen-binding fragments thereof provided herein, and optional instructions for use. In some aspects, the kit comprises the compositions described herein and any diagnostic, prophylactic, or therapeutic agent, such as those described herein.

[0149] Therapeutic Uses and Methods of Treatment In some aspects, provided herein is a method of treating a disease, such as cancer, comprising administering an activatable HBPC or HBPC thereof as described herein, or a pharmaceutical composition thereof as described herein, to a subject in need of treatment of the disease. In some aspects, provided herein is a method of inhibiting tumor growth in a subject in need of tumor growth inhibition, comprising administering an activatable HBPC or HBPC thereof as described herein, or a pharmaceutical composition thereof as described herein, to a subject in need of tumor growth inhibition. In some aspects, the present disclosure relates to an activatable HBPC or HBPC thereof as described herein, or a pharmaceutical composition thereof as provided herein, for use as a medicament. Typically, the subject is a human, but non-human mammals, including transgenic animals, can also be treated.

[0150] The amount of activatable HBPC or a composition thereof effective to treat a condition will depend on the nature of the disease. The precise dose to be employed in the composition will also depend on the route of administration and the severity of the disease.

[0151] Non-limiting examples of diseases include cancer, rheumatoid arthritis, Crohn's disease, SLE, cardiovascular injury, ischemia, etc. For example, indications may include leukemia, including T-cell acute lymphoblastic leukemia (T-ALL), blastic diseases, including multiple myeloma, solid tumors such as lung, colorectal, prostate, pancreatic, breast, etc. (including triple-negative breast cancer). For example, indications may include bone disease or cancer metastasis, regardless of the origin of the primary tumor; breast cancer, including but not limited to ER / PR+ breast cancer, Her2+ breast cancer, triple negative breast cancer; colorectal cancer; endometrial cancer; gastric cancer; glioblastoma; head and neck cancer, e.g., head and neck squamous cell carcinoma; esophageal cancer; lung cancer, including but not limited to, non-small cell lung cancer; multiple myeloma ovarian cancer; pancreatic cancer; prostate cancer; sarcomas such as osteosarcoma; kidney cancer, including but not limited to, renal cell carcinoma; and / or skin cancer, including but not limited to, squamous cell carcinoma, basal cell carcinoma, or melanoma.

[0152] Polynucleotides In some aspects, provided herein are polynucleotides (referred to herein, correspondingly, as "first polynucleotides," "second polynucleotides," and "third polynucleotides") that comprise nucleotide sequences encoding the first, second, and / or third polypeptides of the activatable HBPC and HBPC constructs of the present disclosure. Suitable polynucleotides include any that encode the first, second, and / or third polypeptides, or portions thereof, described herein. An exemplary set of polynucleotide sequences encoding the first, second, and third polypeptides is provided below.

[0153] The polynucleotides of the present disclosure may be sequences optimized for optimal production from the host organism selected for expression, for example, by codon / RNA optimization, replacement with a heterologous signal sequence, and removal of mRNA destabilizing elements. Methods for generating an activatable HBPC or an optimized nucleic acid encoding the HBPC for recombinant expression by introducing codon changes (e.g., codon changes that code for the same amino acid due to the degeneracy of the genetic code) and / or removing inhibitory regions in the mRNA can be carried out by adapting the optimization methods described in, for example, U.S. Patent Nos. 5,965,726; 6,174,666; 6,291,664; 6,414,132; and 6,794,498, as appropriate.

[0154] Polynucleotides encoding the polypeptides or antigen-binding fragments thereof described herein, or domains thereof, can be generated from nucleic acid from a suitable source (e.g., a hybridoma) using methods well known in the art (e.g., PCR and other molecular cloning methods). For example, PCR amplification using synthetic primers hybridizable to the 3' and 5' ends of a known sequence can be performed using genomic DNA obtained from a hybridoma cell producing the antibody of interest. Using such PCR amplification methods, nucleic acid comprising sequences encoding the light and / or heavy chains of an antibody or antigen-binding fragment thereof can be obtained. Using such PCR amplification methods, nucleic acid comprising sequences encoding the variable light and / or variable heavy chain regions of an antibody or antigen-binding fragment thereof can be obtained. The amplified nucleic acid can be cloned into a vector for expression in a host cell and further cloned to generate, for example, chimeric and humanized antibodies or antigen-binding fragments thereof.

[0155] The polynucleotides provided herein can be RNA or DNA. DNA includes cDNA, genomic DNA, synthetic DNA, and DNA can be double-stranded or single-stranded. If single-stranded, DNA can be a coding strand or a non-coding (antisense) strand. In some embodiments, the polynucleotide is a cDNA or a DNA lacking one or more endogenous introns. In some embodiments, the polynucleotide is a non-naturally occurring polynucleotide. In some embodiments, the polynucleotide is recombinantly produced. In some embodiments, the polynucleotide is isolated. In some embodiments, the polynucleotide is substantially pure. In some embodiments, the polynucleotide is purified from natural components.

[0156] Vectors, host cells, and production methods Provided herein are one or more vectors comprising a polynucleotide encoding a first, second, and / or third polypeptide (corresponding to a first polynucleotide, a second polynucleotide, and a third polynucleotide, respectively) of the present disclosure. In some aspects, such vectors can be used to recombinantly produce an activatable HBPC (or HBPC) polypeptide from a host cell, as described in more detail herein below. In some aspects, the vector comprises the first, second, and / or third polynucleotide operably linked to one or more promoter sequences. In certain aspects, the present disclosure provides a plurality of vectors collectively comprising polynucleotides (i.e., the first, second, and third polynucleotides) encoding the first, second, and third polypeptides, the plurality including at least one vector comprising no more than two, or one, of the first, second, and third polynucleotides. In these aspects, the first, second, and third polynucleotide sequences in the plurality of vectors are typically operably linked to one or more promoter sequences.

[0157] Also provided herein are recombinant host cells comprising any of the above polynucleotides and / or vectors for recombinantly expressing the polynucleotides encoding the activatable HBPC or HBPC polypeptides of the present disclosure. A variety of host-expression vector systems can be utilized to express the polypeptides described herein (see, e.g., U.S. Patent No. 5,807,715). Such host-expression systems represent vehicles in which a coding sequence of interest can be produced and subsequently purified, but also represent cells that, when transformed or transfected with the appropriate nucleotide coding sequence, can express in situ the antibodies or antigen-binding fragments thereof described herein. Exemplary host cells suitable for use as recombinant expression hosts for the above polynucleotides include mammalian cell lines (e.g., COS (e.g., COS1 or COS), CHO, BHK, MDCK, HEK293, NS0, PER.C6, VERO, CRL7O3O, HsS78Bst, HeLa, and NIH 3T3, HEK-293T, HepG2, SP210, R1.1, BW, LM, BSC1, BSC40, YB / 20, BMT10 cells, etc.). Vectors used to construct recombinant mammalian host cells can include promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter). In some embodiments, the recombinant host cell is a CHO cell or an NS0 cell.

[0158] In some aspects, recombinant expression of a polypeptide described herein, e.g., a first, second, and / or third polypeptide, involves the construction of an expression vector comprising the first, second, and / or third polynucleotide. The vector(s) comprising the activatable HBPC or polynucleotide encoding the HBPC of the present disclosure can be readily generated by recombinant DNA technology using techniques well known in the art. Methods well known to those skilled in the art can be used to construct expression vectors comprising one or more polynucleotides encoding the polypeptides described herein, e.g., a first, second, and / or third polypeptide, and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Also provided are replicable vectors comprising a nucleotide sequence operably linked to a promoter. Such vectors can include, for example, nucleotide sequences encoding the constant regions of a polypeptide described herein, e.g., the first, second, and / or third polypeptide, as well as the variable regions of the polypeptides (see, e.g., International Publication Nos. WO 86 / 05807 and WO 89 / 01036, and U.S. Pat. No. 5,122,464), and the variable domains of the polypeptides can be cloned into such vectors for expression of the entire VH, the entire VL, or both the entire VH and VL.

[0159] The expression vector can be introduced into a cell (e.g., a host cell) by conventional techniques, and the resulting cell can then be cultured by conventional techniques to produce an activatable HBPC or HBPC as described herein. Accordingly, provided herein is a host cell comprising a polynucleotide encoding an HBPC as described herein operably linked to a promoter for expression of such sequence in the host cell. In some aspects, the host cell comprises a vector comprising one or more polynucleotides encoding an activatable HBPC or HBPC as described herein, or a domain thereof. In some aspects, the host cell comprises three different vectors, i.e., a first vector comprising a first polynucleotide encoding a first polypeptide as described herein, a second vector comprising a second polynucleotide encoding a second polypeptide as described herein, and a third vector comprising a third polynucleotide encoding a third polypeptide as described herein.

[0160] In some aspects, provided herein is a collection of vectors that collectively comprise polynucleotides encoding a first, second, and third polypeptide, each vector comprising only one or only two of the polynucleotides encoding the first, second, or third polypeptide. In certain aspects, provided herein is a single vector comprising polynucleotides encoding the first, second, and third polypeptides (i.e., the first, second, and third polynucleotides, respectively).

[0161] In some aspects, the disclosure provides a method of producing an activatable HBPC of the disclosure, the method comprising: (a) culturing a host cell comprising one or more polynucleotides encoding a polypeptide of the disclosure (e.g., a first polynucleotide, a second polynucleotide, and / or a third polynucleotide, and vector(s) comprising the foregoing polynucleotides) in a liquid medium under conditions sufficient to produce an activatable HBPC; and (b) recovering the activatable HBPC.

[0162] In certain aspects, provided herein is a method of producing an activatable HBPC of the present disclosure, comprising expressing the first, second, and third polypeptides in a host cell. More specifically, provided herein is a method of producing an activatable HBPC, comprising: (a) culturing a host cell comprising one or more polynucleotides encoding a polypeptide of the present disclosure in a liquid medium under conditions sufficient to produce an activatable HBPC; and (b) recovering the activatable HBPC. In another aspect, the method further comprises purifying a bioharvest (cell-free expression product) of the activatable HBPC or other in-process composition, comprising subjecting the aqueous composition comprising the activatable HBPC to a unit operation, such as, for example, affinity chromatography, size exclusion chromatography, ion exchange chromatography, ceramic hydroxyapatite chromatography, etc. In certain aspects, the unit operation is ceramic hydroxyapatite chromatography.

[0163] In a further aspect, provided herein is a method of producing an HBPC of the present disclosure, the method comprising expressing the first, second, and third polypeptides in a host cell. More specifically, provided herein is a method of producing an HBPC of the present disclosure, the method comprising: (a) culturing a host cell comprising one or more polynucleotides encoding a polypeptide of the present disclosure in a liquid medium under conditions sufficient to produce HBPC; and (b) recovering the HBPC. In another aspect, the method further comprises purifying a bioharvest (cell-free expression product) of HBPC or other in-process composition, comprising subjecting the aqueous composition comprising activatable HBPC to a unit operation, such as, for example, affinity chromatography, size exclusion chromatography, ion exchange chromatography, ceramic hydroxyapatite chromatography, etc. In a particular aspect, the unit operation is ceramic hydroxyapatite chromatography.

[0164] composition In some embodiments, the activatable HBPC of the present disclosure or the HBPC thereof can be utilized in a pharmaceutical composition useful for any of the therapeutic applications disclosed herein. In certain embodiments, the pharmaceutical composition comprises a therapeutically effective amount of one or more activatable HBPCs together with a pharma- ceutically acceptable diluent or carrier. In other embodiments, the pharmaceutical composition comprises a therapeutically effective amount of one or more activatable HBPCs and a pharma- ceutically acceptable diluent, carrier, solubilizer, emulsifier, preservative, and / or adjuvant. Acceptable formulation materials are non-toxic to recipients at the doses and concentrations used. The pharmaceutical composition can be formulated as a liquid, frozen, or lyophilized composition.

[0165] In certain embodiments, pharmaceutical compositions may include formulation substances to modify, maintain or preserve, for example, the pH, osmolality, viscosity, clarity, color, isotonicity, odor, sterility, stability, dissolution or release rate, adsorption or penetration of the composition. Suitable formulation materials include, but are not limited to, amino acids; antimicrobial agents; antioxidants; buffers; bulking agents; chelating agents; complexing agents; fillers; carbohydrates such as monosaccharides or disaccharides; proteins; colorants, flavors and diluents; emulsifiers; hydrophilic polymers; low molecular weight polypeptides; salt-forming counterions (such as sodium); preservatives; solvents (such as glycerin, propylene glycol, polyethylene glycol); sugar alcohols; suspending agents; surfactants or wetting agents; stability enhancing agents; isotonicity agents; delivery vehicles; and / or pharmaceutical adjuvants. Additional details and options for suitable drugs that can be incorporated into pharmaceutical compositions are described, for example, in Remington's Pharmaceutical Sciences, 22 nd Edition,(Loyd V.Allen,ed.)Pharmaceutical Press(2013);Ansel et al.,Pharmaceutical Dosage Forms and Drug Delivery Systems,7 th ed., Lippencott Williams and Wilkins (2004); and Kibbe et al., Handbook of Pharmaceutical Excipients, 3rd ed., Pharmaceutical Press (2000).

[0166] The components of the pharmaceutical composition are selected depending on, for example, the intended route of administration, the delivery format, and the desired dosage. nd Edition, (Loyd V. Allen, ed.) Pharmaceutical Press (2013). The composition is selected to affect the physical state, stability, in vivo release rate, and in vivo clearance rate of the disclosed antigen binding protein. The primary vehicle or carrier in a pharmaceutical composition can be either aqueous or non-aqueous in nature. For example, a suitable vehicle or carrier can be water for injection or saline. In certain aspects, the antigen binding protein composition can be prepared for storage by mixing the selected composition having the desired purity with optional formulation agents in the form of a lyophilized cake or aqueous solution. Furthermore, in certain aspects, the antigen binding protein can be formulated as a lyophilizate using appropriate excipients.

[0167] In certain formulations, the concentration of activatable HBPC is at least 2 mg / ml, 5 mg / ml, 10 mg / ml, 20 mg / ml, 30 mg / ml, 40 mg / ml, 50 mg / ml, 60 mg / ml, 70 mg / ml, 80 mg / ml, 90 mg / ml, 100 mg / ml, 110 mg / ml, 120 mg / ml, 130 mg / ml, 140 mg / ml, or 150 mg / ml. In other formulations, the activatable HBPC has a concentration of 10-20 mg / ml, 20-40 mg / ml, 40-60 mg / ml, 60-80 mg / ml, or 80-100 mg / ml.

[0168] Some compositions include a buffering agent or pH adjuster. Exemplary buffers include, but are not limited to, organic acid salts (such as salts of citric acid, acetic acid, ascorbic acid, gluconic acid, carbonic acid, tartaric acid, succinic acid, or phthalic acid); Tris; phosphate buffers; and, in some cases, amino acids, as described below. In certain embodiments, a buffering agent is used to maintain the composition at physiological pH or a slightly lower pH, typically within a pH range of about 5 to about 8. Some compositions have a pH of about 5 to 6, 6 to 7, or 7 to 8. In other embodiments, the pH is 5.5 to 6.5, 6.5 to 7.5, or 7.5 to 8.5.

[0169] In some compositions, free amino acids or proteins are used as bulking agents, stabilizers, and / or antioxidants. As an example, lysine, proline, serine, and alanine can be used to stabilize proteins in the formulation. Glycine is useful in lyophilization to ensure the correct cake structure and properties. Arginine can be useful in inhibiting protein aggregation in both liquid and lyophilized formulations. Methionine is useful as an antioxidant. Glutamine and asparagine are included in some embodiments. Amino acids are included in some formulations due to their buffering capacity. Such amino acids include, for example, alanine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, aspartame, and the like. Certain formulations also include protein excipients such as serum albumin (e.g., human serum albumin (HSA) and recombinant human albumin (rHA)), gelatin, casein, and the like.

[0170] Some compositions include polyols. Polyols include sugars (e.g., mannitol, sucrose, trehalose, and sorbitol), and polyhydric alcohols, such as glycerol and propylene glycol, and polyethylene glycol (PEG) and related substances. Polyols are cosmotropic. They are useful stabilizers in both liquid and lyophilized formulations to protect proteins from physical and chemical degradation processes. Polyols are also useful for adjusting the tonicity of the formulation.

[0171] Certain compositions contain mannitol as a stabilizer. It is usually used together with a cryoprotectant such as sucrose. Sorbitol and sucrose are useful as stabilizers to adjust tonicity and to protect against freeze-thaw stress during transportation and preparation of bulk products during manufacturing process. PEG is useful for stabilizing proteins and as a cryoprotectant and can be used in this regard in the present disclosure.

[0172] Some formulations may include sugars such as monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides; derivatized sugars such as alditols, aldonic acids, esterified sugars; polysaccharides or sugar polymers. For example, suitable carbohydrate excipients include, for example, monosaccharides such as fructose, maltose, galactose, glucose, D-mannose, sorbose, etc.; disaccharides such as lactose, sucrose, trehalose, cellobiose, etc.; polysaccharides such as raffinose, melezitose, maltodextrin, dextran, starch, etc.; and alditols such as mannitol, xylitol, maltitol, lactitol, xylitol, sorbitol (glucitol), myo-inositol, etc.

[0173] Surfactants may be included in certain formulations. Surfactants are typically used to prevent, minimize, or reduce protein adsorption to surfaces and subsequent aggregation at air-liquid, solid-liquid, and liquid-liquid interfaces, and to control protein conformational stability. Suitable surfactants include, for example, polysorbate 20, polysorbate 80, other fatty acid esters of sorbitan esters, Triton surfactants, lecithin, tyloxapol, and poloxamer 188.

[0174] In some embodiments, one or more antioxidants are included in the pharmaceutical composition.Antioxidant excipients can be used to prevent oxidative degradation of proteins.In this regard, reducing agents, oxygen / free radical scavengers, and chelating agents are useful antioxidants.Antioxidants are typically water-soluble and maintain their activity throughout the shelf life of the product.EDTA is also a useful antioxidant.

[0175] Certain preparations contain metal ions, which are protein cofactors and necessary for the formation of protein coordination complexes. Metal ions can inhibit some processes that break down proteins. For example, magnesium ions (10-120 mM) can be used to inhibit the isomerization of aspartate to isoaspartate.

[0176] Tonicity enhancing agents may also be included in certain formulations. Examples of such agents include alkali metal halides, preferably sodium or potassium chloride, mannitol, and sorbitol.

[0177] A particular formulation may contain one or more preservatives. Preservatives are necessary when developing multi-dose parenteral formulations that are to be drawn from the same container multiple times. Their primary function is to inhibit microbial growth and ensure sterility of the product throughout the drug's shelf life or use. Suitable preservatives include phenol, m-cresol, p-cresol, o-cresol, chlorocresol, benzyl alcohol, phenylmercuric nitrite, phenoxyethanol, phenyl alcohol, formaldehyde, chlorobutanol, magnesium chloride (e.g., hexahydrate), alkylparabens (methyl, ethyl, propyl, butyl, etc.), benzalkonium chloride, benzethonium chloride, sodium dehydroacetate, thimerosal, benzoic acid, salicylic acid, chlorhexidine, or mixtures thereof in aqueous diluents.

[0178] A pharmaceutical composition is formulated to be compatible with its intended route of administration, examples of which include intravenous (IV), intradermal, inhalation, transdermal, topical, transmucosal, and rectal administration.

[0179] Formulation components suitable for parenteral administration (e.g., intradermal, subcutaneous, intraocular, intraperitoneal, intramuscular) include a sterile diluent such as water for injection, saline, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methylparabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as EDTA; buffers such as acetates, citrates, or phosphates, and agents for adjusting tonicity such as sodium chloride or dextrose.

[0180] For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). The carrier must be stable under the conditions of manufacture and must be preserved against microorganisms. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof.

[0181] Further guidance regarding appropriate formulations depending on the mode of delivery can be found, for example, in Remington's Pharmaceutical Sciences, 22 nd Edition, (Loyd V. Allen, ed.) Pharmaceutical Press (2013).

[0182] The pharmaceutical preparation can be sterile. Sterility can be achieved by any suitable method, for example, filtration through a sterile filtration membrane. If the composition is lyophilized, sterile filtration can be performed prior to or after lyophilization and reconstitution.

[0183] As demonstrated in Examples 7 and 8, the activatable HBPCs described herein appear to be relatively resistant to aggregation, even at relatively high concentrations. Thus, in another aspect, provided herein is a composition comprising any of the activatable HBPCs described herein and water, wherein the activatable HBPC is present at a concentration of at least 1 mg / mL, and wherein the composition comprises at least 95% monomeric activatable HBPC, or at least about 96% monomeric activatable HBPC, or at least about 97% monomeric activatable HBPC, or at least about 98% monomeric activatable HBPC, or at least about 99% monomeric activatable HBPC. As used herein, the term "monomeric activatable HBPC" refers to the non-aggregated form of activatable HBPC. In certain of these embodiments, the composition comprises at least about 2 mg / ml and at least 95% monomeric activatable HBPC, or at least about 96% monomeric activatable HBPC, or at least about 97% monomeric activatable HBPC, or at least about 98% monomeric activatable HBPC, or at least about 99% monomeric activatable HBPC. In some embodiments, the composition comprises at least about 3 mg / ml and at least 95% monomeric activatable HBPC, or at least about 96% monomeric activatable HBPC, or at least about 97% monomeric activatable HBPC, or at least about 98% monomeric activatable HBPC, or at least about 99% monomeric activatable HBPC. In some embodiments, the composition comprises at least about 4 mg / ml and at least 95% monomeric activatable HBPC, or at least about 96% monomeric activatable HBPC, or at least about 97% monomeric activatable HBPC, or at least about 98% monomeric activatable HBPC, or at least about 99% monomeric activatable HBPC.The percentage of monomeric activatable HBPC can be readily determined, for example, by size exclusion (SE)-HPLC, as shown in Example 7, where the percent of monomeric activatable HBPC is determined as the percentage of the peak area corresponding to monomeric activatable HBPC, based on the total peak area. EXAMPLES

[0184] The examples in this Examples section are offered by way of illustration and not by way of limitation.

[0185] Example 1: Construction and expression of an activatable heteromultimeric bispecific polypeptide Two exemplary activatable heteromultimeric bispecific polypeptide complexes (HBPCs), Complex-57 and Complex-67, were prepared, having the structures shown in Figure 1. Each of these activatable HBPC constructs had the three polypeptides shown in Figure 1. The scFv in each case was anti-CD3ε, and the second targeting domain in each case (i.e., VH2 and VL2) targets EGFR. The EGFR targeting domain of each construct was the same, but the CD3ε targeting domain was different. The components of construct complex-67 are listed in Tables 5A-5C, and the components of construct complex-57 are listed in Tables 6A-6C. TIFF2024538141000008.tif165159

[0186] The amino acid and polynucleotide sequences encoding complex-67 are provided below. Components of the polypeptide sequence are shown as follows: the spacer sequence is in brackets, the mask sequence is underlined, the linker is in bold, the substrate (i.e., the cleavable moiety) is in italics, and the CD3 binder is italicized and underlined. First Polypeptide TIFF2024538141000009.tif91159 (SEQ ID NO: 30), optionally with a C-terminal lysine (i.e., SEQ ID NO: 137).

[0187] In some embodiments, the first polypeptide has the amino acid sequence of SEQ ID NO: 120 (without the spacer but with a C-terminal lysine) or the amino acid sequence of SEQ ID NO: 120 without the C-terminal lysine.

[0188] In the second polypeptide shown below, the spacer sequence is in brackets, the mask sequence is underlined, the linker is in bold, and the substrate (ie, cleavable moiety) is in italics. Second Polypeptide TIFF2024538141000010.tif35159 (sequence number 31).

[0189] In the third polypeptide shown below, the hinge region is in bold and underlined, and the remainder of the sequence is Fc2. Third Polypeptide TIFF2024538141000011.tif28164 (SEQ ID NO: 32), optionally with a C-terminal lysine (SEQ ID NO: 36). nucleic acid Polynucleotide encoding the first polypeptide (SEQ ID NO:112)

[0190] In a variation of this exemplary polynucleotide, the codon encoding the C-terminal lysine may be absent (ie, SEQ ID NO:139). A polynucleotide encoding a second polypeptide (SEQ ID NO:113) CAAGGCCAGTCTGGCCAAGGTCTTAGTTGTGAAGGTTGGGCGATGAATAGAGAACAATGTCGAGCCGGAGGTGGCTCGAGCGGCGGCTCTATCTCTTCCGGACTGCTGTCCGGCAGATCCGACCAGCACGGCGGAGGATCCCAAATCCTGCTGACACAGTCTCCTGTCATACTGAGTGTCTCCCCCGGCGAGAGA GTCTCTTTCTCATGTCGGCCAGTCAGTCTATTGGGACTAACATACACTGGTACCAGCAACGCACCAACGGAAGCCCGCGCCTGCTGATTAAATATGCGAGCGAAAGCATTAGCGGCATTCCGAGCCGCTTTAGCGGCAGCGGCAGCGGCACCGATTTTACCCTGAGCATTAACAGCGTGGAAAGCGAAGATATTG CGGATTATTATTGCCAGCAGACAACAACTGGCCGACCACCTTTGGCGCGGGCACCAAACTGGAACTGAAACGTACGGTGGCTGCACCATCTGTCTTCATCTTCCCGCCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGAGAGGCCAAAGTACAGTGGAA GGTGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCAGGACAGCAAGGACAGCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACACAAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAGAGTGT

[0191] The second polypeptide of complex-67 is also encoded by a polynucleotide having the sequence of SEQ ID NO:115. Polynucleotide encoding the third polypeptide (SEQ ID NO:114) GATAAGACCCACACCTGTCCTCCATGTCCTGCTCCAGAACTGCTCGGCGGACCTTCCGTGTTCCTGTTTCCTCCAAAGCCTAAGGACACCCTGATCAGCAGAACCCCTGAAGTGACCTGCGTGGTGGTGGATGTGTCCCACGAGGATCCCGAAGTGAAGTTCAATTG GTACGTGGACGGCGTGGAAGTGCACAACGCCAAGACAAAGCCCTGCGAGGAACAGTACGGCAGCACCTACAGATGCGTGTCCGTGCTGACAGTGCTGCACCAGGATTGGCTGAACGGCAAAGAGTACAAGTGCAAGGTGTCCAACAAGGCCCTGCCTGCTCCTATCGAGA AAACCATCAGCAAGGCCAAGGGCCAGCCTAGAGAACCCCAGGTGTACACACTGCCTCCAAGCCGGGAAGAGATGACCAAGAACCAGGTGTCCCTGACCTGCCTGGTCAAGGGCTTCTACCCTTCCGATATCGCCGTGGAATGGGAGAGCAATGGACAGCCCGAGAACAAC TACGACACCACACCTCCAGTGCTGGACAGCGACGGCTCATTCTTCCTGTACAGCGACCTGACCGTGGACAAGAGCAGATGGCAGCAGGGCAACGTGTTCAGCTGCAGCGTGATGCACGAGGCCCTGCACAACCACTACACCCAGAAGTCCCTGAGCCTGTCTCCTGGCAAA

[0192] In a variation of this exemplary polynucleotide, the codon encoding the C-terminal lysine may be absent (ie, SEQ ID NO:141).

[0193] Additional exemplary activatable HBPCs of the disclosure are described herein and include a first polypeptide having the amino acid sequence of SEQ ID NO:38 (encoded by the polynucleotide sequence of SEQ ID NO:142 (there is no terminal lysine in the purified protein, whether or not present in the gene) or SEQ ID NO:143); a second polypeptide having the amino acid sequence of SEQ ID NO:31 (encoded by the polynucleotide sequence of SEQ ID NO:113 or SEQ ID NO:115); and a third polypeptide having the amino acid sequence of SEQ ID NO:32 (encoded by the polynucleotide sequence of SEQ ID NO:114 (there is no terminal lysine in the purified protein, whether or not present in the gene) or SEQ ID NO:141). TIFF2024538141000012.tif166159

[0194] Construction of a control activatable anti-EGFR, anti-CD3 heteromultimeric bispecific polypeptide A control activatable bispecific antibody construct, referred to herein as "CI106", was prepared as described in International Patent Application Publication No. WO2019 / 075405, incorporated herein by reference. CI106 is an activatable dual-arm bivalent bispecific antibody construct composed of four polypeptides corresponding to two identical heavy chains (two first polypeptides) and identical light chains (two second polypeptides), each heavy and light chain forming an arm of the bispecific antibody construct. The bispecific antibody is "bivalent" in that it has two of each type of binding domain (i.e., two EGFR binding domains and two CD3 binding domains). The amino acid sequence of the light chain is identical to that of the second polypeptide of complex-67 and complex-57. The heavy chain of CI106 and the first polypeptide of complex-67 have identical spacer, cleavable moiety, anti-EGFR VH, and cleavable moiety components. The heavy chain of CI106 and the first polypeptide of complex-57 have the same spacer, anti-CD3 MM / MM1, cleavable moiety, anti-CD3 VL / VH (and the same anti-CD3 scFv), and anti-EGFR VH components. In CI106, all four targeting domains (two anti-CD3 binding domains and two anti-EGFR binding domains) were masked. The components of CI106 are shown in Tables 7A-7B. TIFF2024538141000013.tif127159

[0195] Example 2. EGFR of activatable anti-EGFR, anti-CD3 heteromultimeric bispecific polypeptides + HT-29 cells and CD3ε + Binding to Jurkat cells To confirm that the described anti-EGFR and anti-CD3 masking peptides are able to inhibit the binding of activatable heteromultimeric bispecific polypeptide complexes to EGFR and CD3, flow cytometry-based binding assays were performed.

[0196] HT-29-luc2 (Perkin Elmer, Inc., Waltham, MA (formerly Caliper Life Sciences, Inc.) and Jurkat (clone E6-1, ATCC, TIB-152) cells were cultured in RPMI-1640 + glutamax (Life Technologies, catalog 10438-026) supplemented with 10% heat-inactivated fetal bovine serum (HI-FBS, Life Technologies, catalog 10438-026). Technologies, catalog 72400-047). The "activated" molecule was produced as activatable HBPC that was proteolytically cleaved to generate the activated form. Activatable HBPC was also produced that did not subsequently undergo proteolytic cleavage prior to the experiment. The following polypeptide complexes were tested: activated CI106 (a bivalent double-arm bispecific construct), activated complex-57 (HBPC), and activated-complex-67 (HBPC), and activatable (masked) HBPC complex-57, (masked) HBPC complex-67, and the doubly masked bivalent double-arm bispecific construct CI106. As described in Example 1, one combination of CD3 binder (anti-CD3 scFv v16) and mask (MM H20GG) was utilized in CI106 and complex-57, and a different combination of CD3 binder (anti-CD3 scFv I2C) and mask (ML15) was utilized in complex-67.

[0197] HT29-luc2 cells were detached with Versene™ (Life Technologies, catalog 15040-066), washed, and seeded at approximately 150,000 cells / well in 96-well plates and resuspended in 50 μL of activated or activatable (masked) HBPC. Jurkat cells were counted and seeded as described for HT29-luc2 cells. Titrations of activated (unmasked) HBPC or activatable (masked) HBPC started at the concentrations shown in Figures 2A and 2B and were serially diluted 3-fold in FACS stain buffer + 2% FBS (BD Pharmingen, catalog 554656). Cells were incubated with shaking for approximately 1 hour at 4°C, harvested, and washed 2x 200 μL with FACS stain buffer. Cells were resuspended in 50 μL of Alexa Fluor 488-conjugated anti-human IgG Fc (10 μg / ml, Jackson ImmunoResearch) and incubated for approximately 1 h at 4° C. with shaking. Cells were harvested, washed, and resuspended in a final volume of 200 μL of FACS staining buffer containing 2.5 μg / mL of 7-AAD (BD Biosciences, catalog 559925). Cells stained with secondary antibody only were used as negative controls. Data were acquired on an Attune NxT flow cytometer, and median fluorescence intensity (MFI) of live cells was calculated using FlowJo® V10 (Treestar). Background-subtracted MFI data was graphed in GraphPad Prism using curve-fit analysis.

[0198] As shown in Figures 2A-2B, activatable HBPC, complex-57 and complex-67, as well as CI106 (masked) showed reduced binding to both EGFR and CD3 targets compared to activated (unmasked) complex-57, activated (unmasked) complex-67, and activated (unmasked) CI106. The reduced binding is represented by a rightward shift in the binding curves. The EGFR masking efficiency in this cell binding experiment was 105 for complex-57, 338 for complex-67, and 594 for CI106.

[0199] Example 3. Biological activity of activatable and activated HBPC A cytotoxicity assay was used to assay the biological activity of activatable (masked) and activated (unmasked) HBPC. Human PBMCs were purchased from Stemcell Technologies (Vancouver, Canada) and co-cultured with the EGFR-expressing cancer cell line HT29-luc2 (Perkin Elmer, Inc., Waltham, MA (formerly Caliper Life Sciences, Inc)) at a 5:1 E(CD3+):T ratio in RPMI-1640+glutamax supplemented with 5% heat-inactivated human serum (Sigma, Cat. H3667). Activated (unmasked) CI106 (control), activated (unmasked) complex-57 (HBPC), activated (unmasked) complex-67 (HBPC), and titrations of CI106 (control), complex-57 (activatable HBPC), and complex-67 (activatable HBPC) were tested. After 48 hours, cytotoxicity was assessed using the ONE-Glo™ Luciferase Assay System (Promega, Madison, WI Catalog E6130). Luminescence was measured on an Infinite® M200 Pro (Tecan Trading AG, Switzerland). Percentage of cytotoxicity was calculated and plotted in GraphPad PRISM using curve-fit analysis. Potency of activated molecules was compared by calculating EC50 ratio. Masking efficiency was calculated as the ratio of EC50 between intact and activated of each molecule.

[0200] As shown in Figures 3A and 3B, activatable (masked) HBPC has a shifted dose-response curve compared to activated (unmasked) HBPC.

[0201] In this assay, the data in Figure 3A show a masking efficiency of 29,650 for CI106 and a masking efficiency of 1,034 for conjugate-57. The data in Figure 3B show a masking efficiency of 26,537 for CI106 and a masking efficiency of 7,141 for conjugate-67. Based on multiple experiments using this assay, conjugate-57 generally showed a 10-42 fold reduced potency compared to conjugate-67.

[0202] Example 4. HBPC induced regression of established HT29 tumors in mice In this example, activatable (masked) HBPC complex-67 and control CI106 were analyzed for their ability to induce regression or reduce the growth of established HT29 xenograft tumors in human PBMC-engrafted NSG mice.

[0203] The human colon cancer cell line HT29-luc2 (Perkin Elmer, Inc., Waltham, MA) was cultured according to established procedures. Purified and frozen human PBMCs were obtained from Hemacare, Inc. (Van Nuys, CA). NSG (NOD.Cg-Prkdcscid Il2rg tm1Wjl / SzJ) mice were obtained from The Jackson Laboratories (Bar Harbor, ME).

[0204] On day 0, 2 × 10 cells were cultured in 100 μL of RPMI + Glutamax serum-free medium. 6 HT29-luc2 cells were inoculated subcutaneously into the right flank of each mouse. Previously frozen PBMCs from a single donor were inoculated 1:1 with CD3 + T cells were administered intraperitoneally on day 3 at a ratio of T cells to tumor cells. 3 When tumor volume reached 100 mg / kg / day (approximately day 12), mice were randomly assigned to treatment groups and administered intravenously according to Table 8. Tumor volumes and body weights were measured twice weekly. Dose levels of conjugate-67 were adjusted to account for the molecular weight difference between CI106 and conjugate-67. TIFF2024538141000014.tif84159

[0205] As shown in Figure 4, which shows a plot of tumor volume versus days after the first treatment dose (day 0), there is a dose-dependent effect of conjugate-67 on the growth of HT29-luc2 xenograft tumors. Conjugate-67 showed more potent antitumor activity than the control, CI106, at comparable doses (1 mg / kg CI106 and 0.6 mg / kg conjugate-67) (p=0.0099, RMAN OVA with Dunnett's).

[0206] Example 5. Tumor regression of established HCT116 tumors in mice following treatment with activatable HBPC Activated (unmasked) HBPC act-complex-67 and activatable (masked) HBPC complex-67 were analyzed for their ability to induce regression or reduce the growth of established HCT116 xenograft tumors in human T cell engrafted NSG mice. Human colon cancer cell line HCT116 (ATCC) was cultured in RPMI+Glutamax+10%FBS according to established procedures. Tumor models were performed as described in Example 4. Mice were dosed according to Table 9. TIFF2024538141000015.tif67159

[0207] Tumor regression was demonstrated for both molecules at all doses tested, as shown in FIG. 5, which shows a plot of tumor volume versus days after the first treatment administration (study day 0).

[0208] Example 6: Evaluation of Percent Monomer after Purification by Ceramic Hydroxyapatite Chromatography (CHT) The doubly masked CI106 control and the activatable (masked) HBPC complex-67 were purified using a ceramic hydroxyapatite chromatography column to compare the amount of dimerization at high concentrations during purification, which was assessed by analyzing the percentage of monomer at each step of the purification process.

[0209] Samples were loaded onto a CHT Type I, 40 μm bead column (Biorad catalog: 157-0040 and #157-0041) loaded with 20 g / L resin. The column was washed with 10 mM NaPO4, 100 mM histidine buffer pH 6.5 as equilibration buffer, then eluted in 2 mL fractions with 10 mM NaPO4, 100 mM histidine, 200 mM lysine-HCl buffer pH 6.5 for CI106 and 10 mM NaPO4, 100 mM histidine, 100 mM lysine-HCl buffer pH 6.5 for Complex-67. CI106 was collected in 2 mL fractions, and then 5 fractions were pooled to form the eluate. For CI106, peak collection started at approximately 25 mAU and stopped at approximately 300 mAU. Complex-67 was collected in one tube with peak collection starting at 100 mAU and ending at 500 mAU. This was followed by a strip buffer step of 500 mM NaPO4 at pH 7.0. Protein concentration of each fraction was quantified by UV absorbance at a wavelength of 280 nm. Percent monomer in each fraction was determined by SE-HPLC (analytical scale size exclusion chromatography) based on total peak area.

[0210] In the binding stage of chromatography, proteins bind to the top of the column first and then move down the column after the top is full. This results in a high concentration of molecules on the column. CI106 and Complex-67 multimers bind to the column with stronger affinity than monomers, so a strong buffer is required to completely remove them from the column. Thus, if the column is eluted with a weak buffer and then stripped with a stronger buffer, the eluate will have a lower percentage of dimers (higher percentage of monomers) than the strip. As shown in Table 10, the Complex-67 (activatable HBPC) run increased the percent of monomers in the eluate by 7.6%, resulting in higher molecular weight material remaining on the column until the strip step, which resulted in a 77% recovery in the eluate. In comparison, the CI106 run, despite more dimeric material (only 30.6% was monomeric) remaining on the column until the strip, reduced the percent of monomers in the eluate by 5.4% to 65.0%, resulting in a recovery of 81% in the eluate. TIFF2024538141000016.tif32159

[0211] These results suggest that complex-67 does not undergo further dimerization when at high concentration on the column, resulting in the removal of nearly all high molecular weight species in the eluate (98.5% monomer), compared to only 65% ​​for CI106. In the case of CI106, there are more high molecular weight species in the eluate pool than in the original load. However, CI106 could not be purified by this chromatographic method, or by any of the evaluated bind / elute chromatographic methods, because dimerization occurs when CI106 is exposed to high concentrations on the column.

[0212] The improved behavior of complex-67 allows for the purification of highly monomeric complex-67 by CHT type 1 chromatography.

[0213] Example 7: Evaluation of concentration-dependent dimerization by concentration in a centrifugal concentrator Protein A and SEC purified preparations of Complex-67 (activatable HBPC), Complex-57 (activatable HBPC), and the CI106 control were compared for percent monomer after centrifugal concentration and overnight incubation at the highest concentration.

[0214] Conjugate-67, Conjugate-57, and CI106 were purified with Protein A and SEC, then prepared in low pH buffer (10 mM acetate, 100 mM lysine, pH 6). Samples were diluted 1:15 in PBS (753-45-01) and concentrated at each concentration by centrifugation at 14,000 RPM for 2 minutes using Pierce™ Protein Concentrators PES 10K MWCO 0.5ml (Thermo Fisher catalog number 88513). The highest concentration sample was stored overnight and the percent monomer was evaluated. The resulting concentrations and percent monomer amounts are shown in Table 11 and Figure 6. TIFF2024538141000017.tif54159

[0215] Figure 6 and Table 11 show that as the concentration increases, Conjugate-67 maintains a high monomer percentage (98%-99%) and exhibits very low aggregation in solution. This is in contrast to CI106, which shows significant concentration-dependent dimerization as the concentration increases. Conjugate-57 showed little concentration-dependent dimerization and maintained a stable monomer percentage as the concentration increased. Conjugate-67 also maintained its monomer percentage during overnight incubation at the highest concentration, demonstrating the stability of the monomer percentage at higher concentrations.

[0216] Example 8: Comparison of alternative similar structures Sets of activatable bispecific constructs were prepared, one targeting CD3 and a tumor associated antigen, antigen A, and another targeting CD3 and a tumor associated antigen, antigen B. Neither antigen A nor antigen B was EGFR. Each set included an activatable HBPC of the present disclosure and another activatable doubly masked monovalent bispecific construct with the same components as the activatable HBPC (i.e., the same anti-CD3 scFv, the same anti-tumor associated antigen VH and VL sequences, the same anti-CD3 masking moiety, and the same anti-tumor associated antigen masking moiety) in structural configurations, termed alternative (format) 1 and alternative (format) 2, which differ not only from each other but also from the structure of the activatable HBPC of the present disclosure. The properties of each construct in each set were characterized as described in Examples 9 and 10.

[0217] Example 9: Comparison of double masked monovalent and bispecific formats The biological activity and masking efficiency of the anti-CD3, anti-Antigen A bispecific constructs described in Example 8 (i.e., the activatable HBPC format of the present disclosure, Alternative (Format) 1, and Alternative (Format) 2) were determined using a cytotoxicity assay. Ovcar-8 cells were co-cultured with human T cells at a ratio of 1:10 and treated with a dilution series of the molecules in Tables 12, 13, and 14. After 48 hours, cytotoxicity was assessed using Cell Titer Glo (Promega) according to the manufacturer's instructions. Masking efficiency was calculated as the EC50 of the intact versus activated version of each molecule. 50The masking efficiency was calculated as the ratio of the anti-CD3 scFv, the anti-CD3 masking moiety, the anti-tumor associated antigen VH and VL, the anti-tumor associated antigen masking moiety, and the two cleavable moieties. The amino acid sequences of the anti-CD3 scFv, the anti-CD3 masking moiety, the anti-tumor associated antigen VH and VL, the anti-tumor associated antigen masking moiety, and the two cleavable moieties were the same between the three different formats (i.e., the activatable HBPC of the present disclosure, Alternative 1, and Alternative 2). The masking efficiencies of the activatable HBPC, Alternative 1, and Alternative 2 molecules, as well as the corresponding unmasked control molecules, are shown in Table 12 (anti-antigen A masking moiety ML21 and anti-CD3 masking moiety ML15), Table 13 (anti-antigen A masking moiety ML24 and anti-CD3 masking moiety ML15), and Table 14 (anti-antigen A masking moiety ML34 and anti-CD3 masking moiety ML15). As shown below, the activatable HBPC showed the highest masking efficiency in each case. Because the components are the same in each format type, the results suggest that the increased masking efficiency of the activatable HBPC is due to the specific arrangement of components in the activatable HBPC format compared to Alternative (Format) 1 and Alternative (Format) 2. TIFF2024538141000018.tif112159TIFF2024538141000019.tif84159TIFF2024538141000020.tif61159

[0218] In Table 13, activatable HBPC showed a 15-fold increase in masking efficiency compared to alternative 2 and a 2-4-fold increase in masking efficiency compared to alternative 1. In Table 13, HBPC showed a masking efficiency of 6460-8274, whereas the ME of alternative 2 was 112. In Table 13, activatable HBPC showed a 68-fold increase in masking efficiency compared to alternative 2 and a 10-fold increase in masking efficiency compared to alternative 1. In Table 14, the masking efficiency of HBPC was 2491, whereas the ME of alternative 1 and alternative was 248. In Table 15, complex-463 was prepared in alternative 1 and alternative 2 and two assays of complex-463 in alternative 1 were performed. HBPC showed a masking efficiency in the range of 1500-2100 ME, with HBPC showing an approximately 6-10-fold increase in ME compared to alternative 1 and an approximately 47-fold increase in ME compared to alternative 2.

[0219] These results suggest that the improved masking efficiency is likely due to the specific structural arrangement of the activatable HBPCs of the present disclosure.

[0220] Example 10: Cytotoxicity of Activatable HBPC and Surrogate Bispecific Molecules in CHO Cell Lines Masking efficiency and cytotoxicity were determined for activatable HBPC, surrogate 1, and surrogate 2 molecules targeting CD3 and antigen B, respectively. CHO cells expressing antigen B were co-cultured with human PBMCs at a ratio of 1:10 and treated with a dilution series of the molecules in Table 15. After 48 hours of incubation, cytotoxicity was determined using Cytotox Glo (Promega) according to the manufacturer's instructions. Masking efficiency was calculated as the EC50 of each molecule between intact and activated. 50 The results are shown in Table 15. TIFF2024538141000021.tif75159

[0221] Activatable HBPC gave the best results. Figure 7 shows cytotoxicity as a percentage of cell lysis for masked activatable HBPC (complex-39), unmasked activatable HBPC control (complex-342), Alternative (Format) 2 activatable polypeptide (complex-231), and unmasked Alternative (Format) 2 control (complex-164).

[0222] This result suggests that the arrangement of components in the particular structures of the activatable HBPCs described herein appears to correlate with higher masking efficiency compared to that of activatable monovalent bispecific constructs having the same components arranged in alternative formats.

[0223] The degree of masking efficiency observed with activatable anti-CD3, anti-antigen A HBPC and activatable anti-CD3, anti-antigen B HBPC is consistent with that observed with conjugate-67 and conjugate-57. These beneficial results appear to be independent of the specific targeting domain / amino acid sequence used.

[0224] Example 11: Safety and efficacy of the activatable anti-EGFR, anti-CD3 TCB construct CI107 In this study, the safety and efficacy of CI107, an anti-EGFR, anti-CD3 TCB construct with the same structural format as the CI106 control (above), was evaluated in preclinical models to assess its therapeutic potential for the treatment of EGFR-expressing tumors. CI107 was prepared as described in International Patent Application Publication No. WO2019 / 075405, incorporated herein by reference. The CI107 TCB construct is also referred to in this example as a "T cell-binding bispecific antibody" or "TCB."

[0225] method animal research All animal studies were conducted in accordance with the regulations of the Institutional Animal Care and Use Committee governing the facility in which the respective study was conducted. Mouse xenograft studies were performed by CytomX Therapeutics, Inc. (CytomX) and cynomolgus monkey studies were performed by Altasciences (Everett, WA). All animal experiments were performed in accordance with regulations set forth in the USDA Animal Welfare Act and the Guide for the Care and Use of Laboratory Animals.

[0226] material All TCBs and other constructs described in this study, including CI107, CI128, CI020, CI011, CI040, CI048, and CI104, were produced by CytomX Therapeutics, Inc. (see WO2016 / 014974 and WO2019 / 075405). CI107, CI128, CI020, CI011, CI040, and CI104 have the same structural format as CI106. CI048 corresponds to the activated CI011. Activated TCBs were produced by in vitro treatment with urokinase-type plasminogen activator (uPA) followed by SEC purification (Desnoyers 2013). HT29-Luc2 cells were obtained from Caliper Life Sciences (Hopkinton, MA), HCT116 and Jurkat cells were obtained from the American Type Culture Collection (ATCC). Human peripheral blood mononuclear cells (PBMCs) were obtained as cryopreserved vials of cells from individual donors from HemaCare Corporation (Northridge, CA), AllCells (Alameda, CA), or STEMCELL Technologies (Seattle, WA). NOD.Cg-Prkcdscid Il2rg tm1Wjl / SzJ (NSG) mice were obtained from Jackson Laboratories (Sacramento, CA).

[0227] Cell binding assay HT29 and Jurkat cells were maintained in complete medium. HT29 cells were harvested using Versene™ cell dissociation buffer. Cells were centrifuged at 250 × g for 5–10 min and resuspended in FACS buffer (BD Pharminogen) containing 2% FBS. Cells were plated at 150,000 / well in V-bottom 96-well plates and treated with complex-07 or in vitro protease-activated CI104 at various concentrations (starting with 1.5 μM CI107 for both HT29 and Jurkat cells, 0.05 μM activated CI104 for HT29 cells, and 0.5 μM activated CI104 for Jurkat cells) obtained by three-fold serial dilution in FACS buffer. Cells were incubated for 1 h at 4 °C, washed twice with FACS buffer, and resuspended in 10 μg / ml Alexa Fluor 647 anti-human Fc secondary antibody. Cells were then incubated for 30–60 min at 4°C protected from light, washed twice with FACS buffer, resuspended in FACS buffer containing 7-AAD, and analyzed on a MACSQuant flow cytometer (Miltenyi Biotech). Mean fluorescence intensity data were corrected for secondary antibody background signal, graphed in Graphpad Prism, and EC50 values ​​were calculated.

[0228] Cytotoxicity assay HCT116-Luc2 or HT29-Luc2 were seeded at 10,000 cells / well in RPMI+5% human serum in 96-well white flat-bottom tissue culture treated plates (Costar #3917). Human PBMCs were freshly thawed, washed twice with RPMI+5% human serum, and 100,000 PBMCs were added to wells containing HCT116-Luc2 or HT29-Luc2 in RPMI+5% human serum. Protease-activated TCB or CI107 was then added to the wells at various concentrations obtained by 3-fold serial dilutions. Control wells contained untreated target cells + effector cells, target cells only, effector cells only, or media only. Plates were then incubated at 37°C, 5% CO2 for approximately 48 hours. Cell viability was measured using the ONE-Glo Luciferase Assay System (Promega, #E6120) and a Tecan plate reader. Percent cytotoxicity was calculated as follows: (1-(experimental RLU / mean untreated RLU)) x 100.

[0229] In vitro T cell activation and cytokine analysis T cell activation was measured by induction of CD69 expression in PBMCs cocultured with HT29-Luc2 or HCT116-Luc2 cells. HT29-Luc2 or HCT116-Luc2 cells were plated at 10,000 cells / well in U-bottom non-adherent plates. Human PBMCs were freshly thawed, washed twice with RPMI containing serum, and 100,000 PBMCs / well were added to plates containing tumor cells. Duplicate plates containing PBMCs only were seeded for flow cytometry compensation controls. Three-fold serial dilutions of CI107, activated CI107, or CI128 were prepared in medium and added to the plated cells. Cells were incubated at 37 °C, 5% CO2 for 16 h. Plates were centrifuged at 250 × g for 10–15 min in preparation for flow cytometry analysis. For cytokine analysis, the supernatant was removed, Fc block (Human TruStain FcX, BioLegend) was added to each well, and the plate was incubated for 10 min. An antibody cocktail containing anti-CD45-FITC (BioLegend), anti-CD3-Pacific Blue (BioLegend), anti-CD8a-APC (BioLegend), and anti-CD69-PE-Cy7 (BioLegend), or appropriate compensation controls, was added to the wells, and the plate was incubated with shaking for 30–60 min at 4 °C protected from light. Plates were then washed with FACS buffer and resuspended in FACS buffer containing 7-AAD. Fluorescence was measured using an Attune flow cytometer, and 15,000 events representing PBMCs were collected.

[0230] For cytokine analysis, the Meso Scale Discovery U-PLEX plate assay (Meso Scale Diagnostics, Rockville, MA) was used. To assess the levels of MCP-1, TNF-α, IL-6, IL-2, and IFN-γ, U-PLEX plates were prepared according to the manufacturer's protocol. Supernatant samples collected from HT29-Luc2 or HCT116-Luc2 cells co-cultured with PBMCs and treated with masked (activatable) CI107, activated (also referred to herein as "act-") CI107, or CI128 were diluted, added to the plates, and processed according to the manufacturer's instructions.

[0231] In vivo efficacy testing For in vivo experiments, the effect of TCB on tumor growth was measured in mice bearing HT29-Luc2 or HCT116 tumors and engrafted with human T cells obtained by intraperitoneal (IP) injection of human PBMCs. On day 0, 2 million HT29-Luc2 or HCT116 cells were injected subcutaneously into the flank of female NSG mice in 100 μl of serum-free RPMI. Frozen PBMCs from a single donor were freshly thawed and administered on day 3 by intraperitoneal injection in 100–200 μL of RPMI+Glutamax, serum-free medium. PBMCs were previously characterized for the percentage of CD3+ T cells, and the number of PBMCs used for in vivo administration was based on a 1:1 CD3+ T cell to tumor cell ratio. Tumor measurements at approximately day 12 were used to randomize mice before intravenous (IV) administration of TCB, control samples, or vehicle. Animals were dosed with test samples weekly for three weeks, and tumor volumes and body weights were recorded twice weekly. Activated TCB CI104 was used for in vivo studies. The CI104 construct differs from CI107 only in the cleavable linker used to tether the CD3 mask to the scFv. Upon in vitro protease activation to completely remove the mask, activated CI104 is identical to activated CI107 and can be used to assess the activity of activated CI107. Subsequent in vitro cytotoxicity studies verified that the activity of activated CI104 is the same as that of activated CI107.

[0232] Non-human primate safety studies Male cynomolgus monkeys received a slow IV bolus injection of the test sample once on day 1 or once on days 1 and 15, depending on the test sample. Clinical observations were performed twice daily after administration of the test sample. Blood samples were collected at various time points after administration for analysis of cytokine release, serum chemistry, hematology, and toxicokinetics. Cytokine analysis was performed on serum samples using a Life Technologies Monkey Magnetic 29-Plex Panel Kit (Thermo Fisher Scientific, Waltham, MA). For toxicokinetic analysis, samples were processed to plasma and stored at -60 to -86 °C before sending for analysis by AIT Bioscience (Indianapolis IN) or CytomX. Plasma concentrations of test samples were measured by ELISA using anti-idiotypic capture antibodies and anti-human IgG (Fc) capture antibodies. Toxicokinetic analysis was performed by Northwest PK Solutions using noncompartmental analysis utilizing Phoenix WinNonlin v6.4 (Certara, Princeton, NJ).

[0233] result CI107 was designed as a doubly masked (activatable) dual-arm bivalent bispecific molecule containing an anti-EGFR domain and an anti-CD3 domain. CI107 was generated using a cetuximab-derived antibody with an anti-CD3ε scFv from SP34 fused to the N-terminus of the heavy chain. CI107 has a human IgG1 Fc domain with mutations that abrogate Fc function. To generate CI107, a masking peptide specific for the anti-EGFR antibody component was fused to the N-terminus of the light chain using a protease-cleavable substrate linker flanked by flexible Gly-Ser-rich peptide linkers as previously described (Desnoyers 2013). A masking peptide specific for the anti-CD3 component was similarly added to the scFv using a protease-cleavable substrate linker. CI107 impaired Fc effector function and minimized cross-linking to cells expressing FcγR. This design aims to maximize target binding and activity in the protease-rich tumor microenvironment while minimizing binding and activity in normal tissues. All comparative TCBs used throughout this example contain EGFR and CD3 binding domains, masks, and linker peptides with varying degrees of cleavability. CI011 and CI040 are first generation versions of CI104 and CI107. CI104 and CI107 molecules contain optimized CD3 scFv, next generation cleavable linkers, and additional Fc silencing mutations. CI104 and CI107 have the same mask, as well as EGFR and CD3 binding domains, but different CD3 protease linkers. However, after protease activation, the activated TCBs are identical. CI128 was used as a non-targeting control where the EGFR binder was replaced with an irrelevant antibody (anti-RSV).

[0234] Masking impairs binding to EGFR on the cell surface. To assess whether masking of the EGFR-binding domain impairs binding to cell surface-expressed EGFR, binding of CI107 and a comparative activated TCB construct (i.e., act-TCB) to EGFR-expressing HT29 and HCT116 cells was measured.

[0235] Target cells were incubated with increasing concentrations of CI107 or comparative activated constructs, and binding was assessed by flow cytometry. As shown in Figures 8A and 8B, the presence of the EGFR mask in CI107 substantially weakened binding to EGFR expressed on the cell surface compared to the activated TCB CI107. The activated TCB construct bound to HT29 cells with a calculated Kd of 0.17 nM, while the Kd of binding for CI107 was 91.28 nM, a >500-fold reduction in binding compared to the activated TCB. Similar results were obtained using HCT116 cells. Binding of CI128, a non-targeting control TCB that contains the same anti-CD3 module as CI107 but lacks EGFR targeting, was also assessed. This control did not bind to HT29 or HCT116 cells (see Figures 8A and 8B).

[0236] Masking impairs binding to CD3 on the lymphocyte surface. To determine whether masking the anti-CD3 binding domain impairs CI107 binding to CD3 on lymphocytes, binding of CI107 and activated CI107 (i.e., activated TCB) to Jurkat cells was measured. As shown in Figure 8C, activated TCB bound to Jurkat cells with a Kd of 0.62 nM. However, no binding of CI107 was detected and the Kd could not be calculated. The activated control CI128 bound to Jurkat cells with a similar affinity as activated TCB.

[0237] Taken together, these data indicate that double masking of the anti-EGFR- and anti-CD3-binding domains in CI107 attenuates binding to cells expressing EGFR or CD3.

[0238] Masking attenuates cytotoxicity and T cell activation in PBMC cocultures. To address whether targeting EGFR with CI107 results in antitumor cell effects, in vitro cytotoxicity assays were performed. Luciferase-expressing HT29 or HCT116 cells were cocultured with human PBMCs and incubated with increasing concentrations of CI107, activated TCB, or nontargeting control CI128. After 48 h of culture, the viability of HCT116-Luc2 or HT29-Luc2 cells was measured by luciferase assay. As shown in Figure 9A, treatment with control CI128 caused minimal cytotoxicity against HCT116-Luc2 cells cocultured with PBMCs, demonstrating that engagement of both EGFR and CD3 is required for cytotoxic activity. In contrast, both masked CI107 and activated CI107 (i.e., act-TCB) exhibited cytotoxic effects against HCT116-Luc2 cells. However, activated TCB produced cytotoxicity at much lower concentrations compared to the masked form, with EC50 values ​​of 0.44 pM and 7297 pM, respectively. Similar results were observed in HT29-Luc2 cells, with EC50 values ​​of 0.25 pM for activated TCB versus 3678 pM for CI107 (Figure 9B). Thus, dual masking of the anti-EGFR and anti-CD3 domains of CI107 reduced the cytotoxic activity mediated by PBMCs by approximately 15,000-fold in the absence of protease activation.

[0239] Treatment with CI107 induces CD69 expression, a marker of T cell activation. To determine whether CI107 results in T cell activation, we measured CD69 levels in PBMCs co-cultured with HCT116-Luc2 or HT29-Luc2 cells after treatment with masked CI107, activated CI107 (i.e., act-TCB), and control CI128. CD69 serves as a marker of T cell activation. Following TCR / CD3 engagement, CD69 expression is rapidly induced on the surface of T lymphocytes and acts as a costimulatory molecule for T cell activation and proliferation. Human PBMCs co-cultured with HCT116-Luc2 or HT29-Luc2 cells were treated with increasing concentrations of CI107, activated TCB (i.e., activated CI107), or control CI128 for 16 h, and CD69 expression levels were measured by flow cytometry. As shown in Figure 9C, CI107 induced CD69 expression on CD8+ T cells cocultured with HCT116-Luc2 cells with an EC50 of 14178 pM. In contrast, treatment with activated CI107 induced CD69 with an EC50 of 7.65 pM, reflecting a ~18,000-fold shift in the T cell activation curve compared to CI107. T cell activation was not observed with the non-EGFR-targeting control CI128, indicating that CD3 engagement alone is not sufficient for T cell activation. Similarly, treatment of PBMCs from the same donor cocultured with HT29-Luc2 cells induced CD69 with an EC50 value of 65971 pM for masked CI107 versus 8.75 pM for activated TCB, reflecting a ~7500-fold difference in CD69 induction potential (Figure 9D).

[0240] Treatment with CI107 results in the release of cytokines. To further evaluate T cell activation in PBMCs co-cultured with EGFR-expressing cancer cells upon treatment with TCB, cytokine release was assessed following treatment with CI107, activated TCB (i.e., activated CI107), or control CI128. Levels of IFN-γ, IL-2, IL-6, MCP-1, and TNF-α were measured 16 h after treatment with increasing concentrations of TCB. As shown in Figures 10A-10E, treatment with CI107 at concentrations ranging from 104 pM resulted in the release of each of the measured cytokines. In contrast, activated TCB caused cytokine release when treated at concentrations ranging from 1 to 100 pM. These results were largely consistent between different PBMC donor cells and cancer cell lines (HCT116-Luc2 vs. HT29-Luc2).

[0241] Taken together, these data indicate that dual masking of the EGFR- and CD3-binding domains of CI107 attenuates T cell activation in the absence of protease activation.

[0242] Susceptibility of TCB to protease cleavage correlates with antitumor efficacy and intratumoral T cells in vivo. The antitumor efficacy of TCB was evaluated in vivo. Immunocompromised mice bearing HT29-Luc2 tumors and engrafted with human PBMCs were treated once weekly for 3 weeks with 0.3 mg / kg TCB containing linkers with different protease sensitivities (CI011, CI040), a non-cleavable linker (CI020), or the unmasked bispecific therapeutic CI048. CI020 is expected to have minimal antitumor activity due to the non-cleavable linker, whereas unmasked CI048 is expected to have the greatest efficacy. Both CI011 and CI040 contain EGFR and CD3 masks and have different protease sensitivities due to different linker peptides. The protease sensitivity of CI040 is greater than that of CI011.

[0243] As shown in Figure 11A, treatment with unmasked TCB CI048 resulted in tumor regression within one week of treatment initiation. Similarly, treatment with masked CI011 and CI040 also resulted in tumor regression or growth arrest. The regression seen with CI040 correlates with the higher cleavability of the linker of this molecule compared to CI011. In contrast, treatment with CI020, which contains a non-cleavable linker, had no effect on tumor growth, indicating that protease cleavability is required for the antitumor activity of TCB in vivo.

[0244] To determine whether the antitumor effects mediated by the tested TCBs correlated with the presence of T cells within the tumor, tumors were harvested 1 week after animals were administered a dose of 1 mg / kg of masked or activated TCB, and immunohistochemistry for CD3 was performed. As shown in Figure 11B, minimal numbers of T cells were observed in tumor tissue following treatment with vehicle or non-cleavable CI020. In contrast, increased numbers of T cells were observed following treatment with TCB CI040 or the in vitro protease-activated TCB CI048. Again, the more protease-sensitive TCB (CI040) increased the number of T cells within the tumor.

[0245] Taken together, these data suggest that TCB may mediate intratumoral T cell and in vivo antitumor effects that correlate with the susceptibility of the EGFR and CD3 binding domain masks to protease cleavage.

[0246] Treatment with CI107 induces dose-dependent regression of established xenograft tumors. The effect of CI107 on in vivo tumor growth was evaluated. NSG mice were subcutaneously implanted with HT29 cells, followed by IP injection of PBMCs, and the PBMCs were allowed to engraft for approximately 11 days. The animals were then treated with vehicle, 0.5 mg / kg CI107, or 1.5 mg / kg CI107 once a week for 3 weeks. As shown in Figure 12A, treatment with 0.5 mg / kg CI107 resulted in tumor growth arrest, and 1.5 mg / kg CI107 resulted in tumor regression approximately one week after treatment initiation.

[0247] The in vivo efficacy of CI107 was also evaluated in HCT116 tumors. After tumor and PBMC engraftment, animals were treated with vehicle, 0.3 mg / kg CI107, 1 mg / kg CI107, or 0.3 mg / kg activated TCB. As shown in Figure 12B, 0.3 mg / kg CI107 delayed HCT116 tumor growth, while 1 mg / kg CI107 and 0.3 mg activated TCB caused similar levels of tumor regression and growth arrest during the treatment period.

[0248] These data demonstrate that CI107 induces dose-dependent tumor growth inhibition and regression in HT29 and HCT116 xenograft tumors, and that the antitumor activity of a three-fold higher dose of CI107 is comparable to that of activated TCB.

[0249] Masked CI107 has improved safety compared to activated CI107 in cynomolgus monkeys. The preclinical tolerability of CI107 was evaluated in a study in cynomolgus monkeys. Animals were administered a single dose of 0.06 mg / kg or 0.18 mg / kg activated CI107 (i.e., act-TCB) and 0.6 mg / kg, 2.0 mg / kg, 4.0 mg / kg, or 6.0 mg / kg CI107, and animals were followed for clinical observations. Animals treated with 0.18 mg / kg activated TCB experienced severe clinical effects including vomiting, anorexia, pale appearance, slouching posture, and thin appearance, with adverse effects noted as early as 2 hours and up to 10 days after dosing. Animals treated with 0.06 mg / kg activated TCB experienced moderate and transient clinical effects including vomiting and slouching posture on the first day after dosing. These effects resolved rapidly, and 0.06 mg / kg was defined as the maximum tolerated dose (MTD) of activated TCB. In contrast, animals treated with 2.0 mg / kg CI107 experienced only transient and mild clinical effects (vomiting on day 2), and animals treated with 0.6 mg / kg CI107 did not experience any adverse effects. Animals treated with 4.0 mg / kg CI107 experienced moderate clinical effects (including vomiting at 4, 8, and 24 hours after dosing and anorexia on day 2). Animals treated with 6.0 mg / kg CI107 were found dead on day 2. Clinical signs noted prior to death included a hunched posture after dosing, pale appearance, vomiting, and liquid stools. Therefore, 4.0 mg / kg was considered the MTD for CI107. Overall, masked CI107 achieved a greater than 60-fold improvement in tolerability compared to activated TCB.

[0250] Cytokine levels were also examined after treatment with activated or masked CI107. As shown in FIG. 13, levels of IL-6 (13A) and IFN-γ (13B) were elevated 8 hours after administration in animals treated with activated TCB. In contrast, minimal changes in IL-6 or IFN-γ were observed after treatment with 0.6 mg / kg or 2.0 mg / kg CI107. Increased levels of these cytokines were only seen after treatment with 4.0 mg / kg CI107. Consistent with clinical observations, CI107 shifts the dose response of cytokine release by more than 60-fold.

[0251] Analysis of serum chemistry also demonstrated differences between activated TCB and CI107. As shown in Figure 13C, treatment with activated TCB resulted in a dose-dependent increase in aspartate aminotransferase (AST), a marker of hepatocellular injury, 48 hours after administration. In contrast, no changes in AST were observed after treatment with CI107 at any tolerated dose level, demonstrating improved tolerability with this masked TCB.

[0252] To address whether masking of the EGFR and CD3 binding domains affects pharmacokinetics, we measured plasma concentrations of activated TCB (i.e., activated CI107) and masked CI107 after dosing. As shown in Figure 13D, activated TCB was rapidly cleared from the circulation within 24 hours after dosing. In contrast, CI107 was maintained in plasma for up to 7 days after dosing, suggesting that masking may increase exposure compared to activated TCB. The AUC(0-7) after a single dose of 0.06 mg / kg activated TCB was 0.04 day*nM (n=1), whereas the AUC(0-7) after a single dose of 2 mg / kg CI107 was 331.7 day*nM (mean of n=3). This represents a greater than 8,000-fold increase in tolerable exposure.

[0253] This indicates that the improved tolerability and pharmacokinetics observed with masked CI107 are consistent with the expected attenuation of binding to EGFR and CD3 in the normal tissue environment. TIFF2024538141000022.tif227159TIFF2024538141000023.tif241159TIFF2024538 141000024.tif241159TIFF2024538141000025.tif241159TIFF2024538141000026.t if239159TIFF2024538141000027.tif241159TIFF2024538141000028.tif242159TIF F2024538141000029.tif240159TIFF2024538141000030.tif242159TIFF20245381410 00031.tif241159TIFF2024538141000032.tif240159TIFF2024538141000033.tif24 2159TIFF2024538141000034.tif240159TIFF2024538141000035.tif241159TIFF202 4538141000036.tif240159TIFF2024538141000037.tif241159TIFF20245381410000 38.tif241159TIFF2024538141000039.tif242159TIFF2024538141000040.tif140159

[0254] The present disclosure is not intended to be limited in scope by the aspects described herein. Indeed, various modifications of the present disclosure in addition to those described will become apparent to those skilled in the art from the foregoing description and the accompanying drawings. Such modifications are intended to fall within the scope of the appended claims.

[0255] All references (e.g., publications or patents or patent applications) cited in this specification are incorporated by reference in their entirety herein to the same extent as if each individual reference (e.g., publication or patent or patent application) was specifically and individually indicated to be incorporated by reference in its entirety for all purposes.

[0256] Certain aspects are within the scope of the following claims.

Claims

1. 1. An activatable heteromultimeric bispecific polypeptide complex (HBPC), comprising: (a) a first polypeptide comprising: (i) a single-chain variable fragment (scFv) comprising a first heavy chain variable domain (VH1) and a first light chain variable domain (VL1), wherein the VH1 and the VL1 together form a first targeting domain that specifically binds to a first target; (ii) a first masking moiety (MM1); (iii) a first cleavable moiety (CM1); (iv) a second heavy chain variable domain (VH2); and (v) a first monomeric Fc domain (Fc1); (b) a second polypeptide comprising (i) a second light chain variable domain (VL2), wherein the VH2 and the VL2 together form a second targeting domain that specifically binds to a second target, (ii) a second masking moiety (MM2), and (iii) a second cleavable moiety (CM2); (c) a third polypeptide comprising (i) a second monomeric Fc domain (Fc2) and (ii) no immunoglobulin variable domain; Including, MM1 is a peptide that prevents binding of the first targeting domain to the first target, and MM2 is a peptide that prevents binding of the second targeting domain to the second target. Activatable heteromultimeric bispecific polypeptide complexes (HBPCs). (a) the first target is a T cell antigen polypeptide and the second target is a cancer cell surface antigen; or (b) the first target is a cancer cell surface antigen and the second target is a T cell antigen polypeptide; 10. The activatable bispecific polypeptide complex of claim 1, With respect to (a) and (b), the T cell antigen polypeptide may be the epsilon chain of CD3. Activatable bispecific polypeptide complexes. (a) the first polypeptide further comprises a heavy chain CH1 domain between a cancer cell surface antigen targeting domain VH2 and the monomeric Fc domain; (b) the first polypeptide further comprises an immunoglobulin hinge region (HR1) between the CH1 domain and the first monomeric Fc domain; and / or (c) the first polypeptide is MM1-CM1-scFv-VH2-CH1-HR1-Fc1 wherein each "-" is independently a direct or indirect linkage; The activatable bispecific polypeptide complex of claim 1 .

4. 2. The activatable bispecific polypeptide complex of claim 1 , wherein the second polypeptide further comprises a light chain constant domain CL1, The second polypeptide may comprise the amino- to carboxy-terminal structural arrangement MM2-CM2-VL2-CL1, where each "-" is independently a direct or indirect linkage; Activatable bispecific polypeptide complexes.

5. 2. The activatable bispecific polypeptide complex of claim 1 , wherein the third polypeptide further comprises an immunoglobulin hinge region (HR2), The third polypeptide may comprise the amino- to carboxy-terminal structural arrangement HR2-Fc2. Activatable bispecific polypeptide complexes.

6. 2. The activatable bispecific polypeptide complex of claim 1, wherein the first polypeptide, the second polypeptide, and / or the third polypeptide comprises one or more linkers: The one or more linkers may be any of the following: (a) Between MM1 and CM1; (b) between MM2 and CM2; (c) between the heavy and light chain variable domains of an scFv; (d) between the heavy chain variable domain and the CH1 domain; (e) between the CH1 domain and the hinge region; (f) between the hinge region and the Fc domain; (g) between CM2 and the light chain variable domain; (h) between the light chain variable domain and CL; (i) between the CH1 domain and the second Fc domain; (j) between the CH1 domain and the hinge region; and / or (k) between the hinge region and the second Fc domain; and The linker(s) may comprise from about 1 amino acid to about 20 amino acids; Activatable bispecific polypeptide complexes.

7. MM1 is linked to CM1 via a linker L1; and / or MM2 is linked to CM2 via linker L2; 10. The activatable bispecific polypeptide complex of claim 1, MM2 may be linked to the VL via a linker L3, and CM2 may be linked to the scFv via a linker L4. Activatable bispecific polypeptide complexes.

8. (a) the amino acid sequence of CM1 and the amino acid sequence of CM2 are identical; (b) the amino acid sequence of CM1 differs from the amino acid sequence of CM2; (c) CM1 and CM2 each contain substrates for proteases present in the tumor microenvironment; (d) CM1 and CM2 each independently contain a substrate for the same protease; (e) CM1 and CM2 contain substrates for different proteases; (f) CM1 and CM2 each independently comprise a substrate for a protease selected from the group of proteases shown in Table 3; (g) at least one of CM1 and CM1 comprises a substrate for a protease selected from the group consisting of a serine protease or a matrix metallopeptidase (MMP); or (h) CM1 and / or CM2 comprise the amino acid sequence of SEQ ID NO:2, SEQ ID NO:14, SEQ ID NOs:73-111, or SEQ ID NOs:156-159; The activatable bispecific polypeptide complex of claim 1 .

9. The activatable bispecific polypeptide complex of claim 1, wherein the MM1 and / or the MM2 comprises from about 5 amino acids to about 40 amino acids.

10. A pharmaceutical composition comprising the activatable bispecific polypeptide complex of any one of claims 1 to 9 and a pharmaceutically acceptable carrier.

11. A composition comprising water and an activatable bispecific polypeptide complex according to any one of claims 1 to 9, may contain 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or up to 99% water; composition.

12. A kit comprising an activatable bispecific polypeptide complex according to any one of claims 1 to 9.

13. 10. A nucleic acid comprising a nucleotide sequence encoding the first polypeptide, the second polypeptide, and / or the third polypeptide of the activatable bispecific polypeptide complex of any one of claims 1 to 9.

14. A vector comprising the nucleic acid of claim 13.

15. A host cell comprising: (i) a nucleic acid according to claim 13; or (ii) a vector comprising the nucleic acid of claim 13; A host cell comprising:

16. 1. A method for producing an activatable bispecific polypeptide complex, comprising: (a) culturing the host cell of claim 15 in a liquid medium under conditions sufficient to produce the activatable HBPCs; (b) recovering the activatable HBPCs; A method comprising:

17. 10. A composition for use in a method of treating a disease in a subject, the composition comprising an activatable bispecific polypeptide complex of any one of claims 1 to 9, wherein the subject may be a human.

18. 18. The composition of claim 17, wherein the disease is cancer.

Images