Cellular engineering to improve cannabinoid production in microbial cells

JP2024538157A5Pending Publication Date: 2025-10-27CELLIBRE INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024522696
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-10-15
Filing Date
2022-10-17
Publication Date
2025-10-27

AI Technical Summary

Technical Problem

There is a need to increase the yield and purity of cannabinoids in microorganisms, as existing methods do not efficiently produce these compounds in sufficient quantities or with the desired specificity.

Method used

The use of engineered microbial cells with mutant farnesyl pyrophosphate synthase (FPPS) enzymes, such as ERG20.A28, to enhance the production of geranyl diphosphate (GPP) over farnesyl diphosphate (FPP), combined with overexpression of mevalonate pathway genes and acyl-CoA synthases, to improve cannabinoid biosynthesis.

Benefits of technology

This approach significantly increases the production of cannabinoids like CBGA and monoterpenes by altering the flux through the mevalonate pathway and enhancing the ratio of GPP to FPP, leading to higher yields and reduced unwanted by-products.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

Provided herein are enzymes, cells and methods for optimizing the production of cannabinoids in microorganisms.Some aspects of the present disclosure relate to a cell that produces an increased ratio of geranyl diphosphate (GPP) to farnesyl diphosphate (FPP) compared to control cells, wherein the cell expresses mutant farnesyl pyrophosphate synthase protein (FPPS).In some embodiments, the cell produces an increased level of GPP compared to control cells.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 63 / 256,398, filed October 15, 2021, the entire teachings of which are incorporated by reference herein. [Background technology]

[0002] 2. Background of the Invention The Cannabaceae family of plants produces many different cannabinoids (>120) in various relative amounts over a 7-10 week flowering period. Many of these cannabinoids have been and are currently being explored as therapeutic agents in chordates (e.g., mammals), and as a result, most have been approved for either medical and / or recreational use in the United States (>35 states). There remains a need for the production of cannabinoids in microorganisms to increase the yield and purity of the desired cannabinoids. Summary of the Invention [Means for solving the problem]

[0003] Summary of the Invention One aspect of the invention is to create chemicals or other biomolecules that are produced using enzymes that utilize GPP as a substrate. Such molecules include monoterpenes (e.g., geraniol, pinene, limonene, etc.) that are produced through the action of different synthases on GPP, or other molecules that undergo prenylation with GPP at some point during biosynthesis (e.g., cannabinoids [CBGA, CBGVA, THCA, etc.], or other chemicals and bioactive molecules [de Bruijn et al. Trends Biotechnol 2020,38(8), 917-934; Chen, X, et al., Pharm Biol. 2014, 52(5), 655-660]). One aspect of this technology results in strains with improved flux to GPP, resulting in increased production of the GPP precursor, DMAPP. Thus, molecules derived from prenylation with DMAPP can also be produced using this technology. Additionally, this technology can be used to prenylate proteins. Another aspect of the present invention is that it can be used to enhance the production of acyl-CoA (e.g., acetyl-CoA, malonyl-CoA, butyryl-CoA, and hexanoyl-CoA). Both GPP and acyl-CoA are important precursor molecules for cannabinoid biosynthesis.

[0004] Some aspects of the disclosure relate to a cell that produces an increased ratio of geranyl diphosphate (GPP) to farnesyl diphosphate (FPP) compared to a control cell, wherein the cell expresses a mutant farnesyl pyrophosphate synthase protein (FPPS). In some embodiments, the cell produces increased levels of GPP compared to a control cell.

[0005] In some embodiments, the mutant FPPS is a mutant ERG20 having at least one insertion, deletion, or substitution at a position selected from positions 88-90 of wild-type ERG20 (SEQ ID NO:1). In some embodiments, the mutant ERG20 is ERG20.A28 (e.g., SEQ ID NO:22) or a mutant ERG20 having at least about 90% homology to wild-type ERG20 (SEQ ID NO:1) and having at least one insertion, deletion, or substitution at a position selected from positions 88-90 of wild-type ERG20 (SEQ ID NO:1). In some embodiments, the mutant FPPS is a mutant ERG20 homolog or ortholog having an amino acid sequence at least about 90% homologous to the amino acid sequence of wild-type ERG20 (SEQ ID NO:1) and having at least one insertion, deletion, or substitution at an amino acid position equivalent to one or more amino acid positions 88-90 of wild-type ERG20 (SEQ ID NO:1).

[0006] In some embodiments, the cells have altered expression of mutant FPPS compared to expression of wild-type FPPS in control cells. In some embodiments, the cells have reduced or no expression of wild-type ERG20. In some embodiments, the cells express at least one of ERG20.A28 (e.g., SEQ ID NO:22), and ERG20WW (i.e., ERG20.F88W.N119W, e.g., SEQ ID NO:32), or ERG20WW fused at its N-terminus or C-terminus with a membrane-bound or soluble prenyltransferase, with or without a linker (e.g., MPT4.1, SEQ ID NO:47; MPT21.9, SEQ ID NO:48; APT73.81, SEQ ID NO:49, as described in co-owned U.S. Provisional Patent Application No. 63 / 188,648, which is incorporated herein by reference in its entirety). Exemplary membrane-bound prenyltransferases that can be fused to the ERG20 enzyme include proteins with prenyltransferase activity having an amino acid sequence that is at least 80%, at least 90%, at least 95%, at least 97%, or at least 99% identical to the amino acid sequences of SEQ ID NOs: 47, 48, and 53-75. Exemplary membrane aromatic soluble prenyltransferases that can be fused to the ERG20 enzyme include proteins with prenyltransferase activity having an amino acid sequence that is at least 80%, at least 90%, at least 95%, at least 97%, or at least 99% identical to the amino acid sequences of SEQ ID NOs: 49 and 76-78. In some embodiments, the ERG20 enzyme includes an amino acid sequence that is at least 90% identical to the amino acid sequence of SEQ ID NOs: 79-96 and can be fused to a membrane-bound or soluble prenyltransferase via a linker. In some embodiments, the ERG20.In other embodiments, the cells express a farnesyl pyrophosphate synthase protein (FPPS) that has a higher preference for GPP formation over FPP formation compared to ERG20.A28 and geranyl diphosphate synthase (GPPS, EC 2.5.1.1, i.e., AgGPPS_truncated (SEQ ID NO: 36) and CgGGPPS (SEQ ID NO: 37)) or a FPPS control.

[0007] In some embodiments, the cells have increased flux through the mevalonate (MVA) pathway compared to control cells. In some embodiments, the cells with increased flux through the MVA pathway overexpress one or more native MVA pathway genes and / or express one or more transgenic MVA pathway genes. In some embodiments, the transgenic MVA pathway genes are selected from feedback-insensitive Erg13 (HMG-CoA synthase, e.g., SEQ ID NO: 3 or 4), Erg12 (mevalonate kinase, e.g., SEQ ID NO: 5 or 6), mvaE (acetyl-CoA acetyltransferase / HMG-CoA reductase (NADPH), e.g., SEQ ID NO: 46), and NADH-dependent HMG-CoA reductase (e.g., UniProt numbers A9HWZ9 and A9BQX8). In some embodiments, the cells with increased flux through the MVA pathway express ERG20.A28.

[0008] In some embodiments, the cells overexpress mevalonate-5-phosphate decarboxylase (MPD, EC 4.1.1.99) and isopentenyl phosphokinase (IPK, EC 2.7.4.26).

[0009] In some embodiments, the cells overexpress an NADPH-dependent hydroxymethylglutaryl-CoA reductase.

[0010] In some embodiments, the cells express one or more transgenic genes selected from a limonene monoterpene synthase (e.g., PfLS (SEQ ID NO: 38) from Perilla frutescens), a myrcene monoterpene synthase (e.g., QiMyrS (SEQ ID NO: 39) from Quercus ilex), and a cineole monoterpene synthase (e.g., SfCinS1 (SEQ ID NO: 40) from Salvia ruticose). In some embodiments, the cells have increased production of one or more monoterpenes compared to a control cell.

[0011] In some embodiments, the cells have elevated levels of DMAPP or GPP compared to control cells. In some embodiments, the cells produce elevated amounts of one or more compounds prenylated with DMAPP as a donor compared to control cells. In some embodiments, the cells produce elevated amounts of compounds prenylated with DMAPP compared to control cells when expressing a DMAPP-selective prenyltransferase.

[0012] In some embodiments, the cells overexpress acetyl-CoA synthase (ACS, i.e., EC 6.2.1.1) or overexpress both ACS and acetyl-CoA carboxylase (ACC, i.e., EC 6.4.1.2) compared to control cells. ACS and ACC can be overexpressed native enzymes or homologs from heterologous systems. In some embodiments, the cells produce CBGA or THCA and have increased OA production and / or CBGA production compared to control cells. In some embodiments, the ACS is a mutant ACS with higher specificity than the corresponding wild-type ACS for converting hexanoic acid to hexanoyl-coA. In some embodiments, the ACS is selected from the group consisting of ACS1 (SEQ ID NO: 41), ACS1.1 (SEQ ID NO: 7), and an ACS with 90% homology to ACS1.1 (SEQ ID NO: 7). In some embodiments, the ACC is a mutant ACC with increased activity compared to wild-type ACC. In some embodiments, the ACC is selected from the group consisting of ACC1 (SEQ ID NO: 44), ACC1.1 (SEQ ID NO: 45), and an ACC having 90% homology to ACC1.1 (SEQ ID NO: 45).

[0013] In some embodiments, the cells overexpress pyruvate decarboxylase (PDC, ie, EC 4.1.1.1) and / or aldehyde dehydrogenase (ALD, ie, EC 1.2.1.3) relative to control cells.

[0014] In some embodiments, the cells overexpress one or more non-oxidative glycolytic genes (e.g., PTA (phosphotransacetylase, EC 2.3.1.8, e.g., SEQ ID NO: 42) and XPK (xylulose phosphoketolase, EC 4.1.2.9, e.g., SEQ ID NO: 43) and have increased cannabinoid production compared to control cells.

[0015] In some embodiments, the cells express transgenic acetylated aldehyde dehydrogenase (ADA, ie, EC 1.2.1.10) and have increased cannabinoid production compared to control cells.

[0016] In some embodiments, the cell is a yeast cell or a bacterial cell. In some embodiments, the yeast cell is a Yarrowia, Saccharomyces, or Pichia strain.

[0017] Some aspects of the present disclosure relate to a method for producing CBGA, CBGVA, or cannabinoids, monoterpenes, or monoterpenoids derived from CBGA or CBGVA, comprising culturing a cell as disclosed herein with a suitable carbon source under suitable conditions to produce the CBGA, monoterpene, or monoterpenoid. In some embodiments, the method further comprises isolating the CBGA, CBGVA, or cannabinoids, monoterpenes, or monoterpenoids derived from CBGA or CBGVA from the culture.

[0018] Some aspects of the disclosure relate to a mutant ERG20 having at least about 90% homology to wild-type ERG20 (SEQ ID NO:1) and comprising at least one insertion, deletion, or substitution at a position selected from positions 88-90 of wild-type ERG20 (SEQ ID NO:1). In some embodiments, the mutant ERG20 has a polypeptide sequence selected from the group consisting of SEQ ID NOs:8-31 or a sequence having at least 95% identity to a polypeptide sequence selected from the group consisting of SEQ ID NOs:8-31. In some embodiments, the mutant ERG20 preferentially produces GPP over FPP.

[0019] Some aspects of the present disclosure relate to a cell that overexpresses acetyl-CoA synthase (ACS) or overexpresses both ACS and acetyl-CoA carboxylase (ACC) compared to a control cell. In some embodiments, the cell produces CBGA, CBDA, CBCA or THCA, and has increased OA production and / or CBGA, CBDA, CBCA or THCA production compared to a control cell. In some embodiments, the ACS is a mutant ACS that has higher specificity than the corresponding wild-type ACS for converting hexanoic acid to hexanoyl-CoA. In some embodiments, the ACS is selected from the group consisting of ACS1 (SEQ ID NO: 41), ACS1.1 (SEQ ID NO: 7), or an ACS that has 90% homology to ACS1.1.

[0020] Some aspects of the present disclosure relate to cells that overexpress acetyl-CoA synthase (ACS) or overexpress both ACS and acetyl-CoA carboxylase (ACC) compared to control cells. In some embodiments, the cells produce CBGVA, CBDVA, CBCVA or THCVA and have increased DVA production and / or CBGVA, CBDVA, CBCVA or THCVA production compared to control cells.

[0021] In some embodiments, the cell is a yeast cell or a bacterial cell. In some embodiments, the yeast cell is a Yarrowia, Saccharomyces, or Pichia strain.

[0022] Some aspects of the present disclosure relate to a mutant acetyl-CoA synthase (ACS) selected from ACS1.1 (SEQ ID NO:7) or an ACS having 90% homology to ACS1.1. In some embodiments, the mutant ACS has higher specificity for converting hexanoic acid to hexanoyl-coA than the corresponding wild-type ACS.

[0023] Some aspects of the disclosure relate to a cell (e.g., a yeast or bacterial cell, a Yarrowia strain cell, a Saccharomyces strain cell, or a Pichia strain cell) that overexpresses pyruvate decarboxylase (PDC) and / or aldehyde dehydrogenase (ALD) relative to a control cell.

[0024] Some aspects of the disclosure relate to a cell (e.g., a yeast or bacterial cell, a Yarrowia strain cell, a Saccharomyces strain cell, or a Pichia strain cell) that overexpresses one or more non-oxidative glycolytic genes (e.g., PTA (phosphotransacetylase, EC 2.3.1.8, e.g., SEQ ID NO: 42) or XPK (xylulose phosphoketolase, EC 4.1.2.9, e.g., SEQ ID NO: 43) and has increased cannabinoid production compared to a control cell.

[0025] Some aspects of the disclosure relate to cells (e.g., yeast or bacterial cells, Yarrowia strain cells, Saccharomyces strain cells, or Pichia strain cells) that overexpress a transgenic acetylated aldehyde dehydrogenase (ADA, EC 1.2.1.10) and have increased cannabinoid production compared to control cells.

[0026] All patents, patent applications, and other publications (e.g., scientific articles, books, websites, and databases) mentioned herein are incorporated by reference in their entirety. In the event of any discrepancy between this specification and any of the incorporated references, this specification (including any amendments thereto that may be based on the incorporated references) shall prevail. Unless otherwise indicated, the standard art-accepted meanings of terms are used herein. Various standard abbreviations are used herein.

[0027] The above-discussed and many other features and attendant advantages of the present invention will become better understood by reference to the following detailed description of the invention. [Brief description of the drawings]

[0028] BRIEF DESCRIPTION OF THE DRAWINGS The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0029] [Figure 1] Figure 1 shows the key enzymes for the biosynthesis of CBGA, CBGVA and derivatives. FPPS: farnesyl pyrophosphate synthase-Erg20, PT: prenyltransferase, ACC: acetyl-CoA carboxylase; PKS: polyketide synthase; PKC: polyketide cyclase; HCS: acyl-CoA synthase (including hexanoyl- and butyryl-); TS: terpene synthase. Enzymes of the MVA pathway: Erg10: acetyl-CoA acyltransferase; Erg13: hydroxymethyl-glutaryl-CoA synthase; HMGR: hydroxymethyl-glutaryl reductase; Erg12: mevalonate kinase; Erg8: mevalonate-5-phosphate kinase; Erg19: mevalonate diphosphate decarboxylase; MPD: phosphomevalonate decarboxylase; IPK: isopentyl phosphate kinase; IDI1: isopentyl diphosphate delta isomerase.

[0030] [Diagram 2] FIG. 2 shows the FARM region in ERG20 and a sequence alignment between ERG20 variants, where the A28 variant (2) is missing what are the amino acid positions equivalent to amino acid positions 88 and 90 of the reference sequence (1). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0031] Detailed Description of the Invention Some definitions

[0032] "Identity" or "homology" refers to the degree to which two or more nucleic acid or polypeptide sequences are the same. In some embodiments, the percent identity or homology between a sequence of interest and a second sequence over a window of evaluation, e.g., a length of interest, can be calculated by aligning the sequences, determining the number of residues (nucleotides or amino acids) in the window of evaluation that face identical residues, allowing for the introduction of gaps to maximize identity, dividing by the total number of residues in the sequence of interest or the second sequence (whichever is larger) that fall within the window, and multiplying by 100. When calculating the number of identical residues required to achieve a particular percent identity or homology, decimals will be rounded to the nearest whole number. Percent identity or homology can be calculated using various computer programs known in the art. For example, computer programs (e.g., BLAST2, BLASTN, BLASTP, Gapped BLAST, etc.) generate alignments and provide percent identity between sequences of interest. The algorithm of Karlin and Altschul (Karlin and Altschul, Proc. Natl. Acad. Sci. USA 87:22264-2268, 1990), modified as in Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90:5873-5877, 1993, is incorporated into the NBLAST and XBLAST programs of Altschul et al. (Altschul, et al., J. Mol. Biol. 215:403-410, 1990). To obtain gapped alignments for comparison purposes, Gapped BLAST is utilized as described in Altschul et al. (Altschul et al., Nucleic Acids Res. 25: 3389-3402, 1997). When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs may be used. PAM250 or BLOSUM62 matrices may be used.Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (NCBI). For these programs, see URL: ncbi.nlm.nih.gov See the website at http: / / www.ncbi.nlm.nih.gov / . In a specific embodiment, the percent identity or homology is calculated using BLAST2 with the default parameters as provided by NCBI.

[0033] The term "homolog" is intended to mean a nucleic acid sequence that has close sequence identity to the nucleic acid sequence of a described gene, where both nucleic acid sequences are determined to be derived from the same ancestral gene, such as through speciation, either through phylogenetic analysis or statistical analysis of alignment between sequences. When determining that two nucleic acid sequences are homologous through statistical analysis of alignment between sequences, widely known and online available tools (e.g., BLAST) can be utilized to make this determination. For purposes of this definition, a 1×10 -2 The alignment in BLAST that shows a lower expectation value (E value) is considered sufficient to determine that both nucleic acids are derived from the same ancestral gene. The term "homolog" can also be used to identify two amino acid sequences that have close sequence homology, structure and / or function and are similarly determined to be encoded and derived from the same ancestral gene. "Ortholog" is defined similarly to "homolog", with the difference being that nucleic acid sequences that have close sequence identity to the nucleic acid sequence of the described gene are both determined to be derived from the same ancestral gene through speciation.

[0034] The term "equivalent" when used to describe an amino acid position in a polypeptide sequence means an amino acid position in the polypeptide sequence that aligns with an amino acid position in the reference polypeptide sequence when the two sequences are aligned by sequence or structure alignment techniques known in the art. When the phrase "equivalent amino acid position" is used to describe the location of a deletion, it is clear to those skilled in the art that the equivalent amino acid that has already been deleted at the equivalent position can be identified by aligning the amino acids around the equivalent amino acid position with the amino acids around this position on the reference sequence, and specifically referring to the absence of the amino acid in the compared sequence at the equivalent amino acid position (see, for example, FIG. 2). Such methods for determining equivalent amino acid positions are equally applicable to wild-type proteins, mutant proteins, and their homologs and orthologs.

[0035] The terms "decreased", "reduced", "reduction", "decrease" and "inhibit" are all used herein to generally mean a statistically significant amount of reduction. However, for the avoidance of doubt, "reduced", "reduction" or "reduce" or "inhibit" means at least a 10% reduction when compared to a reference level, for example, at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% reduction, or up to and including a 100% reduction (i.e., a level of non-existence when compared to a reference sample), or any reduction between 10-100% when compared to a reference level.

[0036] The terms "increased," "increase," "enhance," or "activate" are all used herein to generally mean an increase by a statistically significant amount; for the avoidance of any doubt, the terms "increased," "increase," "enhance," or "activate" mean an increase of at least 10% compared to a reference level, for example, at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% increase, or up to and including a 100% increase, or any increase between 10-100% compared to a reference level, or at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold, or at least about 10-fold increase, or any increase between 2-fold and 10-fold or more than 10-fold compared to a reference level.

[0037] The term "statistically significant" or "significantly" refers to statistical significance and generally means that the concentration of the marker is less than or equal to 2 standard deviations (2SD) below normal. The term refers to statistical evidence that a difference exists. It is defined as the probability of making a decision to reject the null hypothesis when the null hypothesis is actually true. The decision is often made using a p-value.

[0038] the purpose

[0039] Applicants herein aim to improve the production of chemicals or other biomolecules produced using enzymes that utilize GPP or DMAPP as substrates [de Bruijn et al. Trends Biotechnol 2020,38(8), 917-934; Chen, X, et al., Pharm Biol. 2014, 52(5), 655-660]. Examples of such chemicals are terpenoids, where terpenoid synthases use GPP as a substrate. Some examples of terpenoid compounds that can be made from GPP are described in the literature, including geraniol, limonene, sabinene, pinene, etc. (Figure 1 and Table 1 in Zebec et al. (2016) Curr Opin Chem Biol, 34:37-43 and Figure 1 in Leferink, NHH et al. (2019) Sci Rep 9, 11936). Another example of a biomolecule obtained using GPP is the cannabinoids (e.g., CBGA, CBGVA and their derivatives).

[0040] Applicants herein also aim to improve the ratio of producing prenylated molecules, GPP to FPP - Applicants have clearly shown that ERG20.A28, in combination with expression of GPPS (i.e., ERG20WW) and inactivation of native ERG20, can dramatically reduce FCBGA production while improving CBGA production, which can increase the overall production of the desired molecule (e.g., CBGA or CBGVA) and / or reduce undesired by-products (e.g., FCBGA or FCBGVA) that can be difficult to separate during purification from the target molecule.

[0041] The applicant further aims to improve the yield and potency of compounds that require GPP as a prenyl donor. These include prenylation of OA, DVA and other olivetol derivatives with GPP, as well as prenylation of other compounds. Some examples are described in deBruijn WJC et al. (2020) Trends Biotechnol. 38(8), 917-934.

[0042] Finally, Applicants herein aim to improve the formation of acyl-CoA (e.g., acetyl-CoA, malonyl-CoA, butyryl-CoA, and hexanoyl-CoA), which is important for making GPP, OA and DVA, as well as all cannabinoids derived therefrom.

[0043] Cells expressing mutant farnesyl pyrophosphate synthase protein (FPPS)

[0044] Some aspects of the disclosure relate to cells that produce an increased ratio of geranyl diphosphate (GPP) to farnesyl diphosphate (FPP) compared to a control cell (e.g., having a wild-type farnesyl pyrophosphate synthase protein (FPPS)), in which the cell expresses a mutant FPPS. In some embodiments, the cell has elevated levels of GPP compared to the control cell.

[0045] In some embodiments, the ratio of GPP to FPP is increased by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more compared to a control cell having wild-type FPPS, in some embodiments, the ratio of GPP to FPP is increased by at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold or more compared to a control cell having wild-type FPPS. In some embodiments, the ratio of GPP to FPP is between 10:1 to 1:10; 4:1 to 1:4, 3:1 to 1:3, 2:1 to 1:2, 1.5:1 to 1:1.5, 1.4:1 to 1:1.4, 1.3:1 to 1:1.3, 1.2:1 to 1:1.2, or 1.1:1 to 1:1.1.

[0046] In some embodiments, the ratio of GPP to FPP is determined by measuring the ratio of CBGA to FCBGA produced by the cells.

[0047] In some embodiments, the cells have an elevated level of GPP compared to control cells. In some embodiments, the level of GPP compared to control cells with wild-type FPPS is increased by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more. In some embodiments, the level of GPP compared to control cells with wild-type FPPS is increased by at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold or more. In some embodiments, the mutant FPPS is a mutant ERG20 having at least one insertion, deletion, or substitution (i.e., amino acid modification) at a position selected from positions 88 to 90 of wild-type ERG20 (SEQ ID NO: 1). In some embodiments, the mutant FPPS is a mutant ERG20 having an insertion, deletion, or substitution (i.e., amino acid modification) at two positions selected from positions 88 to 90 of wild-type ERG20 (SEQ ID NO: 1). In some embodiments, the mutant FPPS is a mutant ERG20 having an insertion, deletion, or substitution (i.e., amino acid modification) at each of positions 88 to 90 of wild-type ERG20 (SEQ ID NO: 1).

[0048] The amino acid modification may be an amino acid substitution, an amino acid deletion, and / or an amino acid insertion. The amino acid substitution may be a conservative amino acid substitution or a non-conservative amino acid substitution. A conservative substitution (also referred to as a conservative mutation, conservative substitution, or conservative variation) is an amino acid replacement in a protein that changes a given amino acid to a different amino acid with similar biological properties (e.g., charge, hydrophobicity, and size). As used herein, "conservative variation" refers to the replacement of an amino acid residue with another biologically similar residue. Examples of conservative variations include the replacement of one hydrophobic residue (e.g., isoleucine, valine, leucine, or methionine) with another; or the replacement of one polar residue with another (e.g., arginine with lysine, glutamic acid with aspartic acid, or glutamic acid with asparagine, etc.). Other illustrative examples of conservative substitutions include changes such as alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartic acid to glutamic acid; cysteine ​​to serine; glutamine to asparagine; glutamic acid to aspartic acid; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine, glutamine, or glutamic acid; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine, or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; valine to isoleucine or leucine.

[0049] In some embodiments, the mutant ERG20 comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, 99.9%, or 100% identity to ERG20.A28 (e.g., SEQ ID NO: 22).

[0050] In some embodiments, the mutant ERG20 is ERG20.A28 (e.g., SEQ ID NO:22), or a mutant ERG20 having at least about 90% homology to wild-type ERG20 (SEQ ID NO:1) and containing at least one insertion, deletion, or substitution at a position selected from positions 88-90 of wild-type ERG20 (SEQ ID NO:1). In some embodiments, the mutant FPPS is a mutant ERG20 homolog or ortholog having an amino acid sequence at least about 90% homologous to the amino acid sequence of wild-type ERG20 (SEQ ID NO:1) and containing at least one insertion, deletion, or substitution at an amino acid position equivalent to one or more of amino acid positions 88-90 of wild-type ERG20 (SEQ ID NO:1).

[0051] In some embodiments, the mutant ERG20 has a polypeptide sequence selected from the group consisting of SEQ ID NOs: 8-31, or a sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 99.95% identity to a polypeptide sequence selected from the group consisting of SEQ ID NOs: 8-31. In some embodiments, the mutant ERG20 is any mutant ERG20 disclosed herein.

[0052] In some embodiments, the cells have altered expression of the mutant FPPS compared to expression of wild-type FPPS in control cells. In some embodiments, expression of mutant FPPS is reduced by about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or less compared to expression of wild-type FPPS in control cells. In some embodiments, expression of mutant FPPS is reduced by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more compared to expression of wild-type FPPS in control cells.

[0053] In some embodiments, the cells have reduced or no expression of wild-type FPPS (e.g., Erg20). In some embodiments, expression of wild-type FPPS is reduced by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more compared to control cell expression of wild-type FPPS.

[0054] In some embodiments, the FPPS or mutant FPPS is operably linked to a truncated promoter or a promoter that contains one or more insertions, deletions or substitutions (i.e., mutant promoter). The term "promoter" as used herein refers to an expression control sequence that contains a recognition site for a polynucleotide (DNA or RNA) to which an RNA polymerase binds. In some embodiments, the truncated or mutant promoter reduces the expression of FPPS or mutant FPPS in the cell. In some embodiments, the expression using the truncated or mutant promoter is reduced by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more compared to control cell expression using a wild-type promoter. In some embodiments, the promoter is truncated to about 750bp.

[0055] In some embodiments, the cells express at least one of ERG20.A28 (e.g., SEQ ID NO: 22), and ERG20WW (i.e., ERG20.F88W.N119W), or a soluble or membrane-bound prenyltransferase (including ERG20WW-MPT4.1, ERG20WW-MPT21.9, and ERG20WW-APT73.81) (e.g., a soluble or membrane-bound prenyltransferase as described in co-owned U.S. Provisional Patent Application No. 63 / 188,648, which is incorporated by reference in its entirety), a GPP synthase (EC 2.5.1.1), or ERG20WW fused to a farnesyl pyrophosphate synthase protein (FPPS) that has a higher preference for GPP formation over FPP formation compared to a FPPS control. Exemplary membrane-bound prenyltransferases that can be fused to the ERG20 enzyme include proteins with prenyltransferase activity having an amino acid sequence that includes at least 80%, at least 90%, at least 95%, at least 97%, or at least 99% identity to the amino acid sequences of SEQ ID NOs: 47, 48, and 53-75. Exemplary membrane aromatic soluble prenyltransferases that can be fused to the ERG20 enzyme include proteins with prenyltransferase activity having an amino acid sequence that includes at least 80%, at least 90%, at least 95%, at least 97%, or at least 99% identity to the amino acid sequences of SEQ ID NOs: 49 and 76-78. In some embodiments, the ERG20 enzyme can be fused to a membrane-bound or soluble prenyltransferase that includes amino acids that have at least 90% identity to the amino acid sequences of SEQ ID NOs: 79-96 via a linker.In some embodiments, the cells express at least one of ERG20.A28 (e.g., SEQ ID NO: 22), and ERG20WW (i.e., ERG20.F88W.N119W), or a soluble or membrane-bound prenyltransferase (including ERG20WW-MPT4.1, ERG20WW-MPT21.9, ERG20WW-APT73.81) (e.g., as described in commonly owned U.S. Provisional Patent Application No. 63 / 188,648, which is incorporated by reference in its entirety), GPP synthase (EC 2.5.1.1), or ERG20WW fused to a farnesyl pyrophosphate synthase protein (FPPS) that has a higher preference for GGPP formation over FFPP formation compared to a FPPS control. In some embodiments, the cells do not express native ERG20.

[0056] In some embodiments, the cells have increased flux through the mevalonate (MVA) pathway compared to control cells, hi some embodiments, the flux is increased by at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more compared to flux in control cells.

[0057] In some embodiments, cells with increased flux through the MVA pathway overexpress one or more native MVA pathway genes and / or express one or more transgenic MVA pathway genes. In some embodiments, cells with increased flux through the MVA pathway overexpress one or more native MVA pathway genes and / or express one or more transgenic MVA pathway genes by at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more, compared to control cells. In some embodiments, cells with increased flux through the MVA pathway also express ERG20.A28.

[0058] In some embodiments, the transgenic MVA pathway genes are selected from feedback-insensitive Erg13 (HMG-CoA synthase, e.g., SEQ ID NO: 3 or 4), Erg12 (mevalonate kinase, e.g., SEQ ID NO: 5 or 6), mvaE (acetyl-CoA acetyltransferase / HMG-CoA reductase (NADPH, e.g., SEQ ID NO: 46), and NADH-dependent HMG-CoA reductase (e.g., UniProt Nos. A9HWZ9 and A9BQX8). In some embodiments, the feedback-insensitive Erg13 is at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%, 101%, 102%, 103%, 104%, 105%, 106%, 107%, 108%, 109%, 110%, 111%, 112%, 113%, 114%, 115%, 116%, 117%, 118%, 119%, 120%, 121%, 122%, 123%, 124%, 125%, 126%, 127%, 128%, 129%, 130%, 131%, 132%, 133%, 134%, 135%, 136%, 137%, 138%, 139%, 140%, 141%, 142%, 143%, 144%, 145%, 146%, 147%, 148%, 149%, 150%, 151%, 152%, 153%, 154%, 155%, 156%, 1 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 99.95% identity to SEQ ID NO:5 or 6. In some embodiments, the mvaE has at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 99.95% identity to SEQ ID NO:46.

[0059] In some embodiments, the cells overexpress mevalonate-5-phosphate decarboxylase (MPD, EC 4.1.1.99) and isopentenyl phosphokinase (IPK, EC 2.7.4.26). In some embodiments, the cells express at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more, mevalonate-5-phosphate decarboxylase (MPD, EC 4.1.1.99) and isopentenyl phosphokinase (IPK, EC 2.7.4.26) compared to control wild-type cells.

[0060] In some embodiments, the cell overexpresses NADPH-dependent hydroxymethylglutaryl-CoA reductase. In some embodiments, the cell expresses at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more NADPH-dependent hydroxymethylglutaryl-CoA reductase compared to control wild-type cells. In some embodiments, the NADPH-dependent hydroxymethylglutaryl-CoA reductase is a transgenic NADPH-dependent hydroxymethylglutaryl-CoA reductase.

[0061] In some embodiments, the cells express one or more transgenic genes selected from a limonene monoterpene synthase (e.g., PfLS from Perilla frutescens), a myrcene monoterpene synthase (e.g., QiMyrS from Quercus ilex), and a cineole monoterpene synthase (e.g., SfCinS1 from Salvia ruticose). In some embodiments, the cells have increased production of one or more monoterpenes compared to control wild-type cells. In some embodiments, the cells produce at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more monoterpenes compared to control wild-type cells.

[0062] In some embodiments, the cells have elevated levels of DMAPP or GPP compared to control cells. In some embodiments, the cells have at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more DMAPP or GPP compared to control wild-type cells. In some embodiments, the cells produce elevated amounts of one or more compounds prenylated with DMAPP as a donor compared to controls. In some embodiments, the cells produce at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more one or more compounds prenylated with DMAPP as a donor compared to control wild-type cells.

[0063] In some embodiments, the cells overexpress acetyl-CoA synthase (ACS) or overexpress both ACS and acetyl-CoA carboxylase (ACC) compared to control cells. In some embodiments, the cells express ACS at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more compared to control wild-type cells. In some embodiments, the cells express ACS and ACC at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more compared to control wild-type cells.

[0064] In some embodiments, the cells produce more cannabinoids compared to control wild-type cells. In some embodiments, the cells produce CBGA, CBGVA, THCA or THCVA and have increased OA or DVA production and / or CBGA or CBGVA production compared to control cells. In some embodiments, the cells produce at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold or more OA or DVA compared to control wild-type cells. In some embodiments, the cells produce at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold or more CBGA or CBGVA compared to control wild-type cells.

[0065] In some embodiments, the ACS is a mutant ACS with higher specificity than the corresponding wild-type ACS for converting hexanoic acid to hexanoyl-CoA. In some embodiments, the mutant ACS has about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold or higher specificity than the corresponding wild-type ACS for converting hexanoic acid to hexanoyl-CoA. In some embodiments, the ACS is selected from the group consisting of ACS1 (SEQ ID NO: 041), ACS1.1 (SEQ ID NO: 7), and an ACS with 90% homology to ACS1.1. In some embodiments, the mutant ACS has at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 99.95% identity to SEQ ID NO:7.

[0066] In some embodiments, the cells overexpress pyruvate decarboxylase (PDC) and / or aldehyde dehydrogenase (ALD) relative to control cells, hi some embodiments, the cells produce at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more, pyruvate decarboxylase (PDC) and / or aldehyde dehydrogenase (ALD) relative to control wild-type cells.

[0067] In some embodiments, the cells overexpress one or more non-oxidative glycolysis genes (e.g., PTA (phosphotransacetylase, EC 2.3.1.8, e.g., SEQ ID NO: 42) or XPK (xylulose phosphoketolase, EC 4.1.2.9, e.g., SEQ ID NO: 43) and have increased cannabinoid production compared to a control cell. In some embodiments, cells overexpressing one or more non-oxidative glycolysis genes produce at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more cannabinoids compared to a control wild-type cell.

[0068] In some embodiments, the cells express a transgenic acetylated aldehyde dehydrogenase (ADA, EC 1.2.1.10) and have increased cannabinoid production compared to control cells. In some embodiments, the cells expressing the transgenic acetylated aldehyde dehydrogenase produce at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more cannabinoids compared to control wild-type cells.

[0069] In some embodiments, cannabinoids may include, but are not limited to, the following: cannabichromene (CBC) type (e.g., cannabichromene acid), cannabigerol (CBG) type (e.g., cannabigerolic acid), cannabidiol (CBD) type (e.g., cannabidiolic acid), Δ 9 -trans-Tetrahydrocannabinol (Δ 9 -THC) type (e.g., Δ 9 -tetrahydrocannabinolic acid), Δ 8 -trans-Tetrahydrocannabinol (Δ 8 -THC type, cannabicyclol (CBL) type, cannabielsoin (CBE) type, cannabinol (CBN) type, cannabinodiol (CBND) type, cannabiditriol (CBT) type, cannabigerolic acid (CBGA), cannabigerolic acid monomethyl ether (CBGAM), cannabigerol (CBG), cannabigerol monomethyl ether (CBGM), cannabigerovaric acid (CBGVA), cannabigerovarin (CBGV), cannabichromene acid (CBCA), cannabichromene (CBC), cannabichromevaric acid (cannabichromevarinic acid)(CBCVA), cannabichromevalin (CBCV), cannabidiolic acid (CBDA), cannabidiol (CBD), cannabidiol monomethyl ether (CBDM), cannabidiol-C4 (CBD-C4), cannabidivarinic acid (CBDVA), cannabidivarin (CBDV), cannabidiorcol (CBD-C1), Δ 9 -Tetrahydrocannabinolic acid A (THCA-A), Δ 9 -Tetrahydrocannabinolic acid B (THCA-B), Δ 9 -Tetrahydrocannabinol (THC), Δ 9 -Tetrahydrocannabinolic acid-C4 (THCA-C4), Δ 9 -Tetrahydrocannabinol-C4 (THC-C4), Δ 9 -Tetrahydrocannabivarinic acid (THCVA), Δ 9 -Tetrahydrocannabivarin (THCV), Δ9 -Tetrahydrocannabiorcolic acid (THCA-C1), Δ 9 -Tetrahydrocannabidiol (THC-C1), Δ 7 -cis-iso-tetrahydrocannabidivarin, Δ 8 -Tetrahydrocannabinolic acid (Δ 8 -THCA), Δ 8 -Tetrahydrocannabinol (Δ 8 -THC), cannabicyclolor acid (CBLA), cannabicyclol (CBL), cannabicyclovaline (CBLV), cannabielsoic acid A (CBEA-A), cannabielsoic acid B (CBEA-B), cannabielsoin (CBE), cannabielsoic acid, cannabicitranic acid acid), cannabinolic acid (CBNA), cannabinol (CBN), cannabinol methyl ether (CBNM), cannabinol-C4 (CBN-C4), cannabivarin (CBV), cannabinol-C2 (CNB-C2), cannabiolkol (CBN-C1), cannabinodiol (CBND), cannabinodivarin (CBVD), cannabidiol (CBT), 10-ethoxy-9-hydroxy-Δ-6a-tetrahydrocannabinol, 8,9-dihydroxyl-Δ-6a-tetrahydrocannabinol, cannabitriolvarin (CBT) VE), dehydrocannabifuran (DCBF), cannabifuran (CBF), cannabichromanone (CBCN), cannabicitran (CBT), 10-oxo-Δ-6a-tetrahydrocannabinol (OTHC), Δ-9-cis-tetrahydrocannabinol (cis-THC), 3,4,5,6-tetrahydro-7-hydroxy-α-α-2-trimethyl-9-n-propyl-2,6-methano-2H-1-benzoxine-5-methanol (OH-iso-HHCV), cannabilipsol (CBR), and trihydroxy-Δ-9-tetrahydrocannabinol (triOH-THC).

[0070] In some embodiments, the cell is a yeast cell, an algae cell, or a bacterial cell (e.g., Escherichia coli). In some embodiments, the yeast is an oleaginous yeast. In some embodiments, the yeast cell is a cell of a Yarrowia strain (e.g., a Yarrowia lipolytica strain), a Saccharomyces strain, or a Pichia strain.

[0071] Some aspects of the disclosure relate to a method of producing CBGA, CBGVA, or a cannabinoid, monoterpene (e.g., limonene, myrcene, cineole, etc. - see Zebec Z et al., Curr Opin Chem Biol 2016, 34, 37-43), or monoterpenoid derived from CBGA or CBGVA, comprising culturing a cell as disclosed herein with a suitable carbon source under suitable conditions to produce the CBGA, monoterpene, or monoterpenoid. In some embodiments, the method further comprises isolating the CBGA, monoterpene, or monoterpenoid from the culture.

[0072] Mutant ERG20

[0073] Some aspects of the disclosure relate to a mutant ERG20 (e.g., having farnesyl pyrophosphate synthase activity) that has at least about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 99.95% homology or identity to wild-type ERG20 (SEQ ID NO:1) and includes at least one insertion, deletion, or substitution at a position selected from positions 88-90 of wild-type ERG20 (SEQ ID NO:1). In some embodiments, the mutant ERG20 has at least about 90% homology or identity to wild-type ERG20 (SEQ ID NO:1) and includes at least one insertion, deletion, or substitution at a position selected from positions 88-90 of wild-type ERG20 (SEQ ID NO:1). In some embodiments, the mutant FPPS is a mutant ERG20 homolog or ortholog having an amino acid sequence at least about 90% identical to the amino acid sequence of wild-type ERG20 (SEQ ID NO:1) and includes at least one insertion, deletion, or substitution at an amino acid position equivalent to one or more amino acid positions 88-90 of wild-type ERG20 (SEQ ID NO:1). In some embodiments, the mutant ERG20 has a polypeptide sequence selected from the group consisting of SEQ ID NOs:8-31 or a sequence having at least 95% identity to a polypeptide sequence selected from the group consisting of SEQ ID NOs:8-31. In some embodiments, the mutant ERG20 has a polypeptide sequence having at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 99.95% identity to a polypeptide sequence selected from the group consisting of SEQ ID NOs:8-31.

[0074] In some embodiments, the ERG20 comprises a substitution, deletion, or insertion at position 189 of SEQ ID NO: 1. In some embodiments, the ERG20 does not comprise a substitution, deletion, or insertion at positions 88 and 119 of SEQ ID NO: 1. In some embodiments, the ERG20 does not consist of ERG20 of SEQ ID NO: 1 with a substitution, deletion, or insertion at positions 88 and 119.

[0075] In some embodiments, the mutant ERG20 preferentially produces GPP over FPP. In some embodiments, the mutant ERG20 preferentially produces GPP over FPP by about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more. In some embodiments, production of GPP is increased by about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more, compared to production of GPP in control cells.

[0076] In some embodiments, the mutant ERG20 has increased or decreased farnesyl pyrophosphate synthase activity compared to wild-type ERG20 (e.g., SEQ ID NO:1). In some embodiments, the activity of the mutant ERG20 is at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more than the activity of wild-type ERG20. In some embodiments, the activity of the mutant ERG20 is at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or less than the activity of wild-type ERG20.

[0077] Cells overexpressing ACS or both ACS and ACC

[0078] Some aspects of the disclosure relate to cells that overexpress acetyl-CoA synthase (ACS, EC 6.2.1.1) or overexpress both ACS and acetyl-CoA carboxylase (ACC, EC 6.4.1.2) compared to control cells. In some embodiments, the cells overexpress acetyl-CoA synthase (ACS) or overexpress both ACS and acetyl-CoA carboxylase (ACC) compared to control cells. In some embodiments, the cells express at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more ACS compared to control wild-type cells. In some embodiments, the cells express at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more, ACS and ACC compared to control wild-type cells.

[0079] In some embodiments, the cells produce CBGA, CBDA, CBCA or THCA and have increased OA production and / or CBGA production compared to control cells. In some embodiments, the cells produce at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more OA compared to control wild-type cells. In some embodiments, the cells produce at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more CBGA compared to control wild-type cells.

[0080] In some embodiments, the cells produce CBGVA, CBDVA, CBCVA or THCVA and have increased DVA production and / or CBGVA production compared to control cells. In some embodiments, the cells produce at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more DVA compared to control cells. In some embodiments, the cells produce at least about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more CBGVA compared to control cells.

[0081] In some embodiments, the ACS is a mutant ACS with higher specificity than the corresponding wild-type ACS for converting hexanoic acid to hexanoyl-CoA. In some embodiments, the mutant ACS has about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold or higher specificity than the corresponding wild-type ACS for converting hexanoic acid to hexanoyl-CoA. In some embodiments, the ACS is selected from the group consisting of ACS1 (SEQ ID NO: 41), ACS1.1 (SEQ ID NO: 7), and an ACS with 90% homology to ACS1.1. In some embodiments, the mutant ACS has at least 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 99.95% identity to ACS1.1 (SEQ ID NO:7).

[0082] In some embodiments, the cell is a yeast cell or a bacterial cell. In some embodiments, the yeast cell is a Yarrowia, Saccharomyces, or Pichia strain.

[0083] Mutant ACS

[0084] Some aspects of the present disclosure relate to a mutant acetyl-CoA synthase (ACS) (e.g., having acetyl-CoA synthase activity) selected from ACS1.1 (SEQ ID NO: 7) or an ACS having 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, or 99.95% identity or homology with ACS1.1. In some embodiments, the mutant ACS has at least about 90% homology with ACS1.1.

[0085] In some embodiments, the mutant ACS has a higher specificity for converting hexanoic acid to hexanoyl-CoA than the corresponding wild-type ACS, hi some embodiments, the mutant ACS has a specificity for converting hexanoic acid to hexanoyl-CoA that is about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or higher than the corresponding wild-type ACS.

[0086] Cells overexpressing pDC and ALD

[0087] Some aspects of the disclosure relate to cells (e.g., yeast or bacterial cells, Yarrowia, Saccharomyces, or Pichia strain cells) that express or overexpress pyruvate decarboxylase (PDC) and / or aldehyde dehydrogenase (ALD) relative to a control cell. In some embodiments, the cells express about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more pyruvate decarboxylase (PDC) and / or aldehyde dehydrogenase (ALD) relative to a control cell.

[0088] Cells overexpressing nonoxidative glycolysis genes

[0089] Some aspects of the disclosure relate to cells (e.g., yeast or bacterial cells, Yarrowia, Saccharomyces, or Pichia strain cells) that express or overexpress one or more non-oxidative glycolysis genes, such as PTA (phosphotransacetylase, EC 2.3.1.8, e.g., SEQ ID NO: 42) or XPK (xylulose phosphoketolase, EC 4.1.2.9, e.g., SEQ ID NO: 43) and have increased cannabinoid production compared to control cells. In some embodiments, the cells express about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more of one or more non-oxidative glycolysis genes compared to control cells.

[0090] ADA-overexpressing cells

[0091] Some aspects of the disclosure relate to cells (e.g., yeast or bacterial cells, Yarrowia, Saccharomyces, or Pichia strain cells) that express or overexpress a transgenic acetylated aldehyde dehydrogenase (ADA, EC 1.2.1.10) and have increased cannabinoid production compared to a control cell. In some embodiments, the cells express about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more of the transgenic acetylated aldehyde dehydrogenase compared to the expression of the acetylated aldehyde dehydrogenase in the control cell.

[0092] Cells overexpressing various genes for cannabinoid production

[0093] Some aspects of the disclosure relate to cells (e.g., yeast or bacterial cells, Yarrowia, Saccharomyces, or Pichia strain cells) that express or overexpress one or more of a polyketide synthase, polyketide cyclase, and prenyltransferase. In some embodiments, the cells express about 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 5-fold, 10-fold, or more of a transgenic polyketide synthase, polyketide cyclase, or prenyltransferase dehydrogenase compared to their expression in a control cell. ***************

[0094] Specific examples of certain aspects of the invention disclosed herein are set forth below in the Examples.

[0095] Those skilled in the art will readily appreciate that the present invention is fully adapted to carry out the objects and obtain the objects and advantages mentioned, as well as those inherent therein. The detailed description and examples herein are representative and illustrative of certain embodiments, and are not intended as limitations on the scope of the present invention. Modifications therein and other uses will occur to those skilled in the art. These modifications are encompassed within the spirit of the present invention. It will be readily apparent to those skilled in the art that various substitutions and modifications can be made to the invention disclosed herein without departing from the scope and spirit of the invention.

[0096] The articles "a" and "an" as used in the specification and claims should be understood to include plural references unless clearly indicated to the contrary. A claim or description including "or" between one or more members of a group is considered to be satisfied if one, more than one, or all of the members of the group are present in, used in, or otherwise relevant to a given product or process, unless indicated to the contrary or otherwise clear from the context. The invention includes embodiments in which exactly one member of the group is present in, used in, or otherwise relevant to a given product or process. The invention also includes embodiments in which more than one, or all of the members of the group are present in, used in, or otherwise relevant to a given product or process. Furthermore, it should be understood that the present invention provides all variations, combinations, and permutations of one or more limitations, elements, clauses, descriptive terms, etc. from one or more of the enumerated claims that are introduced into another claim that is dependent on the same base claim (or any other claim, if relevant), unless otherwise indicated or unless a contradiction or inconsistency would arise to one of ordinary skill in the art. It is contemplated that all embodiments described herein are applicable to all different aspects of the invention, where appropriate. It is also contemplated that any of the above embodiments or aspects may be freely combined with one or more other such embodiments or aspects, where appropriate. When elements are presented as a list, for example, in a Markush group or similar format, it should be understood that each subgroup of elements is also disclosed and any element may be removed from the group. In general, when the invention or aspects of the invention are referred to as including certain elements, features, etc., it should be understood that a particular embodiment of the invention or aspect of the invention consists of or consists essentially of such elements, features, etc. For the sake of simplicity, those embodiments have not in every instance been specifically set forth in too much language herein.It should also be understood that any embodiment or aspect of the invention may be explicitly excluded from the claims, regardless of whether the specific exclusion is set forth herein. For example, any one or more nucleic acids, polypeptides, cells, species or types of organisms, disorders, subjects, or combinations thereof may be excluded.

[0097] Where a claim or description is directed to a composition of matter (e.g., a nucleic acid, a polypeptide, or a cell), it should be understood that methods of making or using the composition according to any of the methods disclosed herein, as well as methods of using the composition for any of the purposes disclosed herein, are aspects of the invention unless otherwise indicated or it would be obvious to one of ordinary skill in the art that a contradiction or inconsistency would arise. Where a claim or description is directed to, for example, a method, it should be understood that methods of making compositions useful for carrying out said method, as well as products produced according to said method, are aspects of the invention unless otherwise indicated or it would be obvious to one of ordinary skill in the art that a contradiction or inconsistency would arise.

[0098] When a range is stated herein, the invention includes embodiments in which both endpoints are included, in which both endpoints are excluded, and in which one endpoint is included and the other is excluded. Unless otherwise indicated, it should be assumed that both endpoints are included. Furthermore, unless otherwise indicated or otherwise clear from the context and the understanding of one of ordinary skill in the art, it should be understood that values ​​expressed as ranges may assume any specific value or subrange within the stated range, up to 1 / 10 of the unit of the lower limit of said range, in different embodiments of the invention, unless the context clearly indicates otherwise. When a series of numerical ranges is stated herein, it is also understood that the invention includes embodiments that are similarly related to the range defined by any intervening value or any two values ​​in that series, and that the lowest value may be taken as the minimum and the highest value may be taken as the maximum. Many values, as used herein, include values ​​expressed as percentages. For any embodiment of the invention in which a numerical value is preceded by "about" or "approximately," the invention includes embodiments in which that exact value is stated. For any embodiment of the invention where a numerical value is not preceded by "about" or "approximately," the invention includes embodiments where the value is preceded by "about." "Approximately" or "about" generally includes numbers that fall within 1%, or in some embodiments within 5% of the number, or in some embodiments within 10% in either direction (greater or less than the number), unless otherwise stated or otherwise clear from the context (except where such number would unacceptably exceed 100% of the possible value). Unless clearly indicated to the contrary, in any method claimed herein that includes more than one act, the order of the acts of the method is not necessarily limited to the order in which the acts of the method are described, but it should be understood that the invention encompasses embodiments in which the order is so limited. It should also be understood that any product or composition described herein may be considered to be "isolated," unless otherwise stated or otherwise clear from the context. EXAMPLES

[0099] Working Example Introduction and Overview of Examples

[0100] The ERG20 protein is a (2E,6E)-farnesyl diphosphate synthase with both dimethylallyltransferase and geranyltransferase activities that provide the cells with FPP and GPP, molecules important for a variety of essential and non-essential cellular functions. Most ERG20 proteins preferentially produce FPP over GPP. However, certain ERG20 mutants, such as ERG20.F88W.N119W, are specific for making GPP but likely cannot be the only ERG20 in the cells, because they do not provide sufficient levels of FPP for the cells to perform certain essential functions, such as ergosterol biosynthesis. Co-expression of the ERG20.F88W.N119W allele and wild-type (WT) ERG20 allows growth and improves GPP formation, but still produces significant FPP.

[0101] A novel ERG20 mutant, referred to herein as ERG20.A28, was identified. When co-expressed with ERG20.F88W.N119W in Yarrowia lipolytica, it no longer requires expression of WT ERG20 for growth. Interestingly, such strains expressing ERG20.A28 and ERG20.F88W.N119W and lacking WT ERG20 significantly improved GPP production. The ERG20.A28 allele has the F88L mutation, as well as deletions of L89 and V90. Applicants have shown that in CBGA-producing strains, the combination of 1.) overexpression of ERG20.F88W.N119W, 2.) expression of ERG20 A28, and 3.) inactivation of native ERG20 results in substantially more CBGA being produced while simultaneously reducing FCBGA. This demonstrates the utility of the present invention.

[0102] Overexpression of ERG20.F88W.N119W can be replaced with other GPP synthases, particularly those that are highly specific for GPP or GGPP (GPPS, EC 2.5.1.1., e.g., AgGPPS_truncated (SEQ ID NO: 36) or CgGGPPS (SEQ ID NO: 37)).

[0103] In addition to OA derivatives, the present invention is expected to improve the prenylation of various compounds and natural products with GPP. Some examples of natural compounds that are prenylated with GPP are described in deBruijn WJC et al. (2020) Trends Biotechnol. 38(8), 917-934.

[0104] Because the present invention results in increased GPP levels, there will likewise be higher production of the GPP precursor, DMAPP, resulting in strains with improved ability to produce compounds that are prenylated with DMAPP (see de Bruijn et al. Trends Biotechnol 2020,38(8), 917-934).

[0105] Acyl-COA formation is important for making cannabinoids

[0106] Applicants have shown that overexpression of native acetyl-CoA synthase (ACS) alone and in combination with acetyl-CoA carboxylase (ACC) improves both OA and CBGA production in cells engineered to produce CBGA or THCA.

[0107] Applicants have shown that native ACS1 can convert acetate to acetyl-coA and hexanoic acid to hexanoyl-coA for improved cannabinoid production.

[0108] Applicants have developed an ACS variant, referred to herein as ACS1.1, that is more specific for converting hexanoic acid to hexanoyl-CoA.

[0109] Applicants have shown in studies that overexpression of native pyruvate decarboxylase (PDC) and aldehyde dehydrogenase (ALD) further improved both OA and CBGA production in cells engineered to produce cannabinoids in cells overexpressing ACC and ACS.

[0110] Applicants are in the process of testing alternative methods to generate acetyl-CoA (eg, nonoxidative glycolysis and acetylated aldehyde dehydrogenase).

[0111] The enzymes and strains engineered in this disclosure are the basis for constructing industrial processes for making products that utilize GPP and acyl-CoA during biosynthesis.In addition to cannabinoids, the present invention can be used to produce monoterpenes and other molecules that are biosynthesized using enzymes that use GPP as substrate.Monoterpenes have a variety of applications across drugs, flavors, fragrances, biofuels, and cleaning agents.To investigate the use of these enzymes and strains for monoterpene production, monoterpene synthase genes for the production of limonene, myrcene, and cineole are expressed in these strains, and the production of these compounds is evaluated.

[0112] The present invention provides a novel approach to increase the flux to GPP and increase the production of GPP relative to FPP. Moreover, it does so in a manner that does not result in cells being auxotrophic (e.g., cells lacking ERG20 can be maintained by supplementing the medium with ergosterol or similar molecules). This is useful for producing molecules that are biosynthesized with enzymes that utilize GPP as a substrate. Finally, it provides a novel method to improve the cellular production of acyl-CoA, a useful molecule for the cellular production of cannabinoids. The following paragraphs support the importance of these benefits.

[0113] GPP (geranyl pyrophosphate) and FPP (farnesyl pyrophosphate) are prenyl compounds produced in cells by farnesyl pyrophosphate synthetase (FPPS), which in certain organisms is called ERG20. ERG20 is a bifunctional enzyme that first catalyzes the condensation of dimethylallyl pyrophosphate (DMAPP) and isopentenyl pyrophosphate (IPP) to produce geranyl pyrophosphate (GPP), and subsequently condenses GPP and IPP to produce farnesyl pyrophosphate (FPP) (Figure 1). Mutations in this enzyme (e.g., F96W / N127W in S.cerevisiae ERG20 (similar to F88W / N119W in Yl.Erg20) significantly reduced this second step (GPP to FPP), and as a result, the mutant enzyme was identified to produce primarily GPP (Ignea C, et al. ACS Synth Biol. 2014, 3, 298-306). Furthermore, the copy number of ERG20 was halved by deleting one copy in diploid yeast. This manipulation significantly improved GPP-derived sabinene production in S.cerevisiae (Ignea C, et al. ACS Synth Biol. 2014, 3, 298-306). However, wild-type ERG20 is maintained in these cells to allow FPP production, since FPP is essential for cell viability. FPP is essential for cell viability, since it is the precursor of ergosterol, an important cell membrane component.

[0114] To minimize the production of FCBGA, the production of FPP needs to be reduced while maintaining sufficient FPP for cell viability. In the strain of the present disclosure, a mutant form of ERG20 (designated ERG20WW, preferably containing F88W and N119W mutations that generate GPP) is expressed. To test whether this mutant ERG20 can still generate sufficient FPP for cell viability and reduce FPP production, applicants attempted to disrupt native ERG20 using CRISPR / CAS9. This attempt did not produce clones with complete inactivation of native ERG20 (marker gene integrated into coding sequence); however, some clones showed reduced production of FCBGA. Interestingly, these clones also had increased CBGA production.

[0115] In one clone, SB565.A28, the ERG20 gene was amplified and sequenced. The results showed a 6-base in-frame deletion at the CRISPR / CAS9 cleavage site. This deletion results in an F88L mutation, as well as deletions of L89 and V90. Applicant speculates that this mutation results in ERG20 with reduced activity. The genome was also sequenced using MinION (Oxford Nanopore Technologies) to confirm the presence of the deletion and the absence of wild-type sequence in ERG20. Applicant refers to this ERG20 allele as ERG20.A28.

[0116] In the second clone, SB565.B32, the genome was sequenced again using MinION (Oxford Nanopore Technologies) and it was found that the wild-type gene was still present, but the promoter had been shortened to approximately 750 bp, presumably resulting in a significant reduction in expression and therefore overall activity, resulting in reduced FPP production.

[0117] To test the effect of the ERG20.A28 allele, this mutant version of ERG20 expressed from the approx. 750 bp ERG20 promoter was introduced into Yarrowia expressing ERG20WW and the ERG20WW-tMPT4 fusion (which has been shown to improve prenyltransferase activity and selectivity and is described in co-owned U.S. Provisional Patent Application No. 63 / 188,648, which is incorporated by reference in its entirety). The endogenous ERG20 was then disrupted and the resulting strains were examined for CBGA and FCBGA production from OA. These engineered clones produced a significant increase in CBGA and a decrease in FCBGA.

[0118] In addition to the production of CBGA and other cannabinoids, GPP can be used for the production of various monoterpenes / monoterpenoids (see Zebec Z et al., Curr Opin Chem Biol 2016, 34, 37-43). These compounds may have a variety of applications ranging from drugs, flavors, fragrances, biofuels, and cleaning agents. This strain carrying the ERG20.A28 allele can be used as a host strain for the production of these monoterpene / monoterpenoid compounds. To investigate this possibility, the monoterpene synthase genes for limonene, myrcene, and cineole are introduced into a base strain carrying the ERG20.A28 allele (disrupting the native ERG20 and overexpressing the ERG20WW allele) and the production of these compounds is evaluated.

[0119] In addition to the ERG20.A28 allele, alternative mutations in ERG20 may reduce its activity in producing FPP (possibly in part by producing GPP). A mutation in S. cerevisiae ERG20 at K197 (K189 in Yl.ERG20) may also result in a mutation with reduced activity (DOI 10.1002 / bit.23129). Characterization of these alternative mutants and their combination with the ERG20.A28 allele may be of interest.

[0120] This region, immediately upstream of the FARM region in ERG20, is well conserved in other FPPS proteins. It is well conserved in S. cerevisiae (Sc) ERG20. A similar mutation in S. cerevisiae, in concert with overexpression of the ScERG20WW allele and inactivation of wild-type ScERG20, can also result in increased flux to GPP.

[0121] Reducing the FPP selectivity of Saccharomyces Erg20 has been achieved by mutating two different amino acids, F96 and N127 (Ignea C, et al. ACS Synth Biol. 2014, 3, 298-306). It has been shown that the equivalent positions in Yarrowia are conserved (F88 and N119) and that their mutagenesis also improves the production of linalool (a monoterpene derived from GPP) formation (Cao X, et al. Bior Tech 2017, 245, 1641-1644). In the current study, applicants have found that the F88L mutation and deletion of L89 and V90 creates an enzyme that applicants believe has reduced activity and only produces enough FPP to support growth. Since this region of the protein is clearly important for the activity and selectivity of the enzyme, further mutagenesis at these positions may further improve GPP production in our strain. See, for example, Figure 2.

[0122] Overexpression of native ACC and ACS should increase flux to acetyl-CoA and malonyl-CoA, which may improve CBGA titer by increasing flux to OA and / or GPP. Consistent with this, applicant has shown that overexpression of ACC and ACS improves both OA and CBGA titer in cultures containing cells supplemented with hexanoic acid. Although ACC and ACS overexpression have been used to improve the production of various compounds derived from acetyl-CoA and malonyl-CoA, with mixed results, applicant has not seen any report that clearly shows improved cannabinoid production based on overexpression of ACS and / or ACC.

[0123] Another aspect of the present invention is to increase the flux to GPP using the mevalonate pathway (MVA) in the above strains (expressing ERG20.A28 and ERG20.F88W.N119W and lacking WT ERG20) or other Yarrowia or yeast strains. A detailed description of the biosynthetic pathway to all common cannabinoids is shown in Figure 1. Since all cells biosynthesize GPP, the optimized cells are modified to upregulate this pathway. Various examples of engineered microbial strains (E. coli, yeast, Yarrowia, etc.) with upregulated mevalonate pathway (MVA) have been published (AA Malico, MA Calzini, AK Gayen, GJ Williams J Ind Microbiol Biotechnol 2020, 47, 675-702). Although most of the enzymes in the MVA pathway have been altered, i.e., overexpressed, mutated, or replaced with enzymes from other organisms, it is noteworthy that although there is no universal solution to equally upregulate GPP or FPP biosynthesis that can be applied to all cells and resulting products, some general principles for its upregulation have been identified (Y. Zu, KLJ Prather, G. Stephanopoulos Curr Opin Biotechnol, 2020, 66, 1-8).

[0124] To increase the flux into the MVA pathway, all or a partial set of MVA pathway enzymes are overexpressed. These enzymes include native Yarrowia enzymes as well as selected heterologous genes with reduced or absent substrate / product regulation and inhibition. For example, hydroxymethylglutaryl-CoA synthase (Erg13; EC 2.3.3.10) is inhibited by substrate (acetoacetyl-CoA) product (HMG-CoA) and various acyl-CoAs (including hexanoyl-CoA) in most organisms, including yeast (Middleton, B.; Biochem. J. 1972, 126, 35-47). Similarly, mevalonate kinase (Erg12, EC 2.7.1.36) is inhibited by GPP and FPP (Fu, Z et al. Biochemistry, 2008, 47, 3715-3724). Feedback-insensitive enzymes for both of these steps have been identified. A mutant ERG13 (BjErg13_mut) from Brassica juncea with high activity and reduced product inhibition has been described (Nagegowda DA et al. Biochem J, 2004, 383, 517-527), while a highly active mutant (EfErg13_mut) from Enterococcus faecalis is also used (Steussy, CN et al. Biochemistry, 2006, 45, 14407-14414). Regarding Erg12, enzymes without any inhibition have been described from various methanogenic archaea including Methanosarcina mazei (Erg12_Q8PW39) and Methanosaeta concili (Erg12_F4BZB3).

[0125] Certain enzymes of the MVA pathway can catalyze both the forward and reverse reactions, and as a result, overexpression does not improve flux unless a strong "pull" is present in the pathway. Such an enzyme is phosphomevalonate kinase (Erg8, EC 2.7.4.2). To improve flux, either of the next enzymes in the pathway, mevalonate pyrophosphate decarboxylase or Erg19, is overexpressed, or an alternative pathway that bypasses this step is introduced using mevalonate phosphate decarboxylase (MPD EC 4.1.1.99) and isopentenyl phosphate kinase (IPK EC 2.7.4.26) (Figure 1). Finally, the native NADPH-dependent hydroxymethylglutaryl-CoA reductase (HMGR) needs to be overexpressed, since this enzyme has been shown to be one of the main bottlenecks of the MVA pathway in both yeast and Yarrowia. In addition, NADH-dependent HMGRs are also overexpressed. Some examples of expressed NADH-dependent HMGRs include, but are not limited to, UniProt numbers A9HWZ9 and A9BQX8.

[0126] Technical Description, Details and Supporting Data

[0127] Example 1: Identification of ERG20 variants with improved CBGA / FCBGA ratio and improved CBGA titer (OA>CBGA)

[0128] To improve the CBGA / FCBGA ratio in CBGA-producing strains, applicants attempted to further reduce FPP production by disrupting the native ERG20 gene. Applicants speculated that such a disruption could be performed in a strain overexpressing the ERG20WW allele (a mutation that results in an enzyme that mainly produces GPP), because this allele could produce enough FPP to maintain cell growth. Thus, disruption of native ERG20 was attempted in SB491, a strain expressing ERG20WW and ERG20WW-MPT4 fusions. The ERG20 gene was targeted using CRISPR / CAS9 with the gRNA targeting sequence GCAGGCGTTTTTCCTCGTGT (SEQ ID NO: 2) and a DNA fragment with homology arms and split hph markers. 288 transformants were screened by junction PCR, and 32 clones that appeared positive for at least one of the 5' or 3' junctions were screened for CBGA production from OA. Clones were inoculated in 500 μL YNBD (2% dextrose) + 0.5% CAA + 100 mM MES (pH 6.5) in deep well 96 well plates and incubated at 30° C. in a high speed shaker for 24 hours. 2 μL of this preculture was used to inoculate 500 μL YNBD (6% dextrose) + 0.5% CAA + 100 mM MES (pH 6.5) + 3 mM OA in deep well 96 well plates and incubated at 30° C. in a high speed shaker for 48 hours. The cultures were quenched with 500 μL ethanol containing internal standards and analyzed by LC. The production of CBGA, FCBGA and the CBGA / FCBGA ratio are shown in Table 1. Of these, two clones, A28 and B32, were superior. In both cases, the CBGA / FCBGA ratio is significantly improved. As can be seen, this improvement is due to both increased CBGA titer and decreased FCBGA titer.

[0129] Table 1: CBGA and FCBGA titers of selected SB565 clones fed with OA. [Table 1-1] [Table 1-2]

[0130] Molecular diagnostics of these clones via qPCR, Sanger sequencing of PCR products, and ONT (Oxford Nanopore Technologies) sequencing identified that the A28 clone does not have wild-type ERG20 sequence, but the ERG20 gene has a 6-base (TCCTCG) deletion at the gRNA cleavage site. This deletion affects three codons (relative to FLV at positions 88-90) resulting in one codon encoding Leu. Applicants refer to this allele of ERG20 as ERG20.A28 (SEQ ID NO: 22). A similar diagnostic set of clone B32 showed that this clone has wild-type ERG20 coding sequence, except for a shortened approximately 750 bp promoter. The results herein clearly show that reducing native Erg20 activity in Yarrowia, preferably together with expression of a GPP-expressing synthase (such as ERG20WW), increases both GPP flux as measured by increased titer of CBGA and the GPP to FPP ratio as measured by the product CBGA / FCBA ratio.

[0131] Example 2: Disruption of native ERG20 in OA→CBGA strains expressing the ERG20.A28 allele results in improved CBGA / FCBGA ratios and improved CBGA titers (OA→CBGA)

[0132] To confirm that the improved CBGA / FCBGA ratio and increased titer of CBGA are due to the 6-base deletion in ERG20.A28, this allele was first cloned behind the 750bp ERG20 promoter and introduced into SB491 (a strain that contains ERG20WW and ERG20WW-MPT4 and can convert OA to CBGA) to generate strain SB748. The native wild-type ERG20 was then disrupted to generate SB751. Eleven clones of SB491, SB748, and SB751 were examined for the production of CBGA and FCBGA from OA as described in Example 1. The results are shown in Table 2. As can be seen, this genetic engineering resulted in an improved CBGA / FCBGA ratio and a significant increase in CBGA titer.

[0133] Table 2: [Table 2]

[0134] Example 3: Disruption of native ERG20 in a hexanoate / butyrate → CBGA / CBGVA strain expressing the ERG20.A28 allele results in an improved CBG(V)A / FCBG(V)A ratio and improved CBG(V)A titer

[0135] To investigate the effect of the ERG20.A28 allele on the production of CBGA / CBGVA from hexanoic acid / butyric acid in combination with overexpression of ERG20WW under the 750bp ERG20 promoter and disruption of the native ERG20 gene, these engineering steps were introduced into a CBG(V)A producing strain, SB1268 (expressing HCS2, PKS1, PKC1.1, ERG20ww, ERG20-PKC1.1-MPT4). First, the ERG20.A28 allele was introduced under the 750bp ERG20 promoter, and then the native ERG20 was disrupted. The resulting strain, SB1554, was compared to SB1268 in small-scale fermentations using either hexanoic acid or butyric acid as feed. These strains were inoculated into 500 μL YNBD (6% dextrose) + 1% CAA + 100 mM MES (pH 6.5) in deep well 96 well plates and incubated for 24 hours on a high speed shaker at 30° C. 2 μL of this preculture was used to inoculate 500 μL YNBD (6% dextrose) + 1% CAA + 100 mM MES (pH 6.5) + 2.5 mM hexanoic acid or butyric acid in deep well 96 well plates and incubated for 24 hours on a high speed shaker at 30° C. 25 μL of a 100 mM hexanoic acid solution in 100 mM MES (6.5) or 25 μL of a 100 mM butyric acid solution in 100 mM MES (6.5) was added and the plates were returned to the high speed shaker for another 24 hours. The culture was quenched with 500 μL ethanol containing an internal standard and analyzed by LC. The results from hexanoic acid feeding are shown in Table 3A. As can be seen, this genetic engineering resulted in increased CBGA titer and improved CBGA / FCBGA ratio. The results from butyric acid feeding are shown in Table 3B. As can be seen, this genetic engineering resulted in significant improvement of CBGVA titer. In this experiment, FCBGA was not detected, so the CBGVA / FCBGVA ratio was not evaluated.

[0136] Table 3A: CBGA and FCBGA, and CBGA / FCBGA ratios for hexanoic acid-fed fermentations of SB1268 and its A28 derivatives, SB155. Results are reported in μM. [Table 3A]

[0137] Table 3B: CBGVA and FCBGVA for butyrate-fed fermentations of SB1268 and its A28 derivative, SB1554. Results are reported in μM. [Table 3B] *FCBGVA was not detected (nd).

[0138] Example 4: Altering ERG20.A28 Expression by Modulating Promoter Length

[0139] To evaluate whether the expression level of ERG20.A28 has an effect on improved CBG(V)A titer and CBG(V)A / FCBG(V)A ratio, a set of plasmids is constructed with different lengths of ERG20 promoter. These expression cassettes are introduced into SB491 to generate strains expressing ERG20.A28. Native ERG20 is disrupted in these strains, and the resulting strains are evaluated for CBG(V)A production based on OA / DVA feeding.

[0140] Example 5: Further improving MVA pathway flux by overexpression of pathway genes

[0141] To determine whether further upregulation of the MVA pathway would benefit CBG(V)A production, plasmids for expression of genes for upregulated MVA pathway flux (HMG1 (SEQ ID NO: 50), tHMG1 (amino acids 2-495 deleted, SEQ ID NO: 51), Enterococcus faecalis mvaE or IDI1 (SEQ ID NO: 52)) were introduced into SB1085 (expressing HCS2, ERG20WW, ERG20WW-MPT4, ERG20.A28, disrupted for ERG20; derived from SB751). The resulting strains were assayed for production of CBGVA on DVA feeding. Clones were inoculated into 500 μL YNBD (2% dextrose) + 1% CAA + 100 mM MES (pH 6.5) in deep well 96 well plates and incubated at 30° C. in a high speed shaker for 24 hours. 2 μL of this preculture was used to inoculate 500 μL YNBD (6% dextrose) + 1% CAA + 100 mM MES (pH 6.5) + 2 mM DVA in a deep well 96-well plate and incubated at 30° C. in a high speed shaker for 48 hours. The culture was quenched with 500 μL ethanol containing an internal standard and analyzed by LC. As shown in Table 4, the addition of HMG1, tHMG1, mvaE, or IDI1 significantly improved CBGVA production.

[0142] Table 4: CBGVA production from DVA in SB1085 transformed with HMG1, tHMGR1, mvaE or IDI1. Results are reported in μM. [Table 4-1] [Table 4-2]

[0143] Example 6: Mutagenesis of Erg20 and further testing

[0144] Mutant libraries are prepared as shown in Table 5. These libraries are screened for improved GPP formation in Yarrowia. Selected mutants are expressed in purified E. coli and their activity is identified.

[0145] Table 5: Mutant libraries to screen for improved GPP formation. [Table 5]

[0146] Example 7: Monoterpene (limonene) production in strains expressing the ERG20.A28 allele, disrupted for native ERG20, and overexpressing the ERG20WW allele

[0147] To investigate whether the increased flux to GPP could be used to increase the production of monoterpenes (a diverse set of compounds derived from GPP that have applications in the pharmaceutical, cosmetic, agricultural and food industries), as a proof of concept, the monoterpene synthase for limonene (PfLS from Perilla frutescens) was introduced into SB809 (a strain expressing ERG20.A28, disrupted for ERG20, and overexpressing ERG20WW) and SB491 (a wild-type ERG20 control), resulting in strains SB1027 and SB1030, respectively. Monoterpene production was examined in these strains.

[0148] The strain transformed with the expression cassette for PfLS and the untransformed parent strain were examined for limonene production by culturing in YPD (8%) + 100 mM MES (pH 6.5) + 10% dodecane overlay for 72 hours. Samples were prepared by mixing with an equal volume of heptane containing methyl nonadecanoate (CAS 1731-94-8) as an internal standard. The samples were analyzed by GC-FID. The results are shown in the table below. As can be seen from the results shown in Table 6, the A28 engineered strain was able to produce about four times the amount of limonene compared to the ERG20 wild type strain.

[0149] Table 6: Limonene production in strain A28 [Table 6]

[0150] Example 8: Expression of ACS1 and ACC1 improves cannabinoid production

[0151] pCL-SE-0709 expresses the ACS1 and ACC1 genes, respectively, from the UAS1B(4x) pTEF1 intron promoter. This vector was linearized and transformed into SB-691, a strain that can produce CBGA upon supplementation with hexanoic acid. Clones from this transformation expressing ACS1 and ACC1 (SB888_01-07) produced more OA and CBGA compared to the parent strain when supplemented with hexanoic acid (Table 7).

[0152] Table 7: OA and CBGA produced by overexpression of ACS1 and ACC1 [Table 7]

[0153] Example 9: ACS1.0 can activate hexanoic acid

[0154] Since overexpression of ACS1.0 improves OA and CBGA production from hexanoic acid feeding (Table 7), we suspected that ACS1.0 may have the ability to activate hexanoic acid to hexanoyl-CoA. To evaluate whether ACS1.0 has this hexanoyl-CoA synthase activity, ACS1.0 was introduced into strain sCL137, which does not have HCS but has PKS1 and PKC1.1 for OA and OL production, to generate SB999. HCS2 was also introduced to generate SB998 as a control. Each clone was assayed for OA and OL production with hexanoic acid feeding as described in Example 3. The results (Table 8) show that, like HCS (SB998), ACS1.0 can increase OA and OL production in SB999 compared to sCL137. This indicates that ACS1.0 can activate hexanoic acid.

[0155] Table 8: OA, OL, and OA+OL in strains transfected with ACS1.0 to activate hexanoic acid to hexanoyl-CoA. [Table 8]

[0156] Example 10: ACS1.1 shows improved specificity for hexanoic acid

[0157] Since overexpression of ACS1.0 shows the ability to activate hexanoic acid to hexanoyl-CoA, we investigated whether the introduction of the homologous mutation found in HCS2 would improve the specificity of ACS for hexanoic acid. This mutant, ACS1.1, was introduced into strain sCL137, which does not have HCS but has PKS1 and PKC1.1 for OA and OL production, to generate SB1000. SB998 (HCS2), SB999 (ACS1.0) and the parent strain, sCL137, were used as controls. Each clone was assayed for OA and OL production by hexanoic acid feeding as described in Example 3. The results (Table 9) show that ACS1.1 (SB1000) can increase OA and OL production, similar to HCS (SB998) and with higher titers compared to ACS1.0 (SB999). These results indicate that ACS1.1 can activate hexanoic acid with improved activity compared to ACS1.0.

[0158] Table 9: OA, OL and OA+OL in strains transfected with ACS1.1 to activate hexanoic acid to hexanoyl-CoA. [Table 9]

[0159] Example 11: Overexpression of PDC5 and ALD5 improves cannabinoid production

[0160] The PDC5 and ALD5 genes are cloned into a vector that provides their expression from the UAS1B(4x)pTEF1intron promoter. The vector is linearized and transformed into SB-691, a strain that can produce CBGA with supplementation of hexanoic acid. Clones from this transformation that express ALD5 and PDC5 are screened for OA and CBGA production compared to the parent strain when supplemented with hexanoic acid. The combination of PDC5 and ALD5 increases the flux from pyruvate to acetate, which is a substrate that can be converted to acetyl-CoA to produce cannabinoids.

[0161] Example 12: Expression of non-oxidative glycolysis genes improves cannabinoid production

[0162] Acetyl-CoA formation is increased to produce cannabinoids by rewiring carbon central metabolism and increasing flux through the pentose phosphate pathway (PPP). Phosphofructokinase (Pfk) is deleted to block glycolysis, and heterologous phosphoketolase (Xpk) and phosphotransacetylase (Pta) are expressed to convert the PPP intermediate xylulose-5-P to acetyl-CoA. These deletions and overexpressions are performed in strains such as SB-691, a strain that can produce CBGA with hexanoic acid supplementation. Clones are screened for OA and CBGA production compared to the parent strain when supplemented with hexanoic acid.

[0163] Example 13: Expression of acetylated aldehyde dehydrogenase improves cannabinoid production

[0164] The acylated aldehyde dehydrogenase coding genes are cloned into a vector that provides their expression from the UAS1B(4x)pTEF1intron promoter. The vector is linearized and transformed into SB-691, which is a strain that can produce CBGA by supplementing with hexanoic acid. The clones from this transformation that express acylated aldehyde dehydrogenase are screened for OA and CBGA production compared to the parent strain when supplemented with hexanoic acid. The acylated aldehyde dehydrogenase increases the flux to hexanoyl-CoA, which is a substrate that can be used to make cannabinoids.

[0165] Table 10: List of strains: [Table 10-1] [Table 10-2]

[0166] Table 11: List of plasmids: [Table 11]

[0167] Analysis method:

[0168] Cannabinoids

[0169] Cannabinoids and their intermediates were analyzed by LC-MS under the following conditions:

[0170] Method requirements: Column: 2.1×50mm Cosmocore PBr (Nacalai USA, Inc.) Mobile phase: A; 0.1% formic acid in water, B; 0.1% formic acid in acetonitrile Flow rate: 0.45mL / min Temperature: 50℃ Injection volume: 1μL Gradient: 20% B at 0 min, 70% B at 2.3 min, 89% B at 4.2 min, 20% B at 4.3 min, 20% B at 6 min Detection: UV DAD and QToF MS at 275nm

[0171] Monoterpenes Terpenes (e.g., limonene, myrcene, and eucalyptol) were analyzed by GC-FID under the following conditions: Column: DB-FastFAME (Agilent G3903-63011) Mobile phase: Helium Flow rate: 1.5mL / min Temperature profile: 110-180°C at 40°C / min, 180-220°C at 10°C / min, 220-250°C at 30°C / min Injection volume: 2 μL with a 50:1 split Detection: FID at 250℃

[0172] array:

[0173] Yl.ERG20 (WT) (SEQ ID NO: 1)

[0174] [ka]

[0175] > gRNA (SEQ ID NO:2)

[0176] GCAGGCGTTTTTCCTCGTGT

[0177] >BjErg13_mut (SEQ ID NO:3)

[0178] [ka] [ka]

[0179] >EfErg13_mut (SEQ ID NO: 4)

[0180] [ka]

[0181] >Erg12_Q8PW39 (SEQ ID NO:5)

[0182] [ka]

[0183] >Erg12_F4BZB3 (SEQ ID NO: 6)

[0184] [ka]

[0185] >ACS1.1 (SEQ ID NO:7)

[0186] [ka] [ka]

[0187] >Yl.ERG20.ΔF (SEQ ID NO:8)

[0188] [ka]

[0189] >Yl.ERG20.ΔL (SEQ ID NO: 9)

[0190] [ka]

[0191] >Yl.ERG20.ΔV (SEQ ID NO:10)

[0192] [ka]

[0193] >Yl.ERG20.ΔFLV (SEQ ID NO: 11)

[0194] [ka]

[0195] >Yl.ERG20.FLV>A (SEQ ID NO: 12)

[0196] [ka]

[0197] >Yl.ERG20.FLV>R (SEQ ID NO: 13)

[0198] [ka]

[0199] >Yl.ERG20.FLV>N (SEQ ID NO: 14)

[0200] [ka]

[0201] >Yl.ERG20.FLV>D (SEQ ID NO: 15)

[0202] [ka]

[0203] >Yl.ERG20.FLV>C (SEQ ID NO: 16)

[0204] [ka]

[0205] >Yl.ERG20.FLV>Q (SEQ ID NO: 17)

[0206] [ka]

[0207] >Yl.ERG20.FLV>E (SEQ ID NO: 18)

[0208] [ka]

[0209] >Yl.ERG20.FLV>G (SEQ ID NO: 19)

[0210] [ka] [ka]

[0211] >Yl.ERG20.FLV>H (SEQ ID NO: 20)

[0212] [ka]

[0213] >Yl.ERG20.FLV>I (SEQ ID NO:21)

[0214] [ka]

[0215] >Yl.ERG20.FLV>L (i.e., Yl.ERG20.A28) (SEQ ID NO:22)

[0216] [ka]

[0217] >Yl.ERG20.FLV>K (SEQ ID NO:23)

[0218] [ka] [ka]

[0219] >Yl.ERG20.FLV>M (SEQ ID NO:24)

[0220] [ka]

[0221] >Yl.ERG20.FLV>F (SEQ ID NO:25)

[0222] [ka]

[0223] >Yl.ERG20.FLV>P (SEQ ID NO:26)

[0224] [ka]

[0225] >Yl.ERG20.FLV>S (SEQ ID NO:27)

[0226] [ka] [ka]

[0227] >Yl.ERG20.FLV>T (SEQ ID NO:28)

[0228] [ka]

[0229] >Yl.ERG20.FLV>W (SEQ ID NO:29)

[0230] [ka]

[0231] >Yl.ERG20.FLV>Y (SEQ ID NO:30)

[0232] [ka]

[0233] >Yl.ERG20.FLV>V (SEQ ID NO:31)

[0234] [ka]

[0235] >GPS1.1 (sequence number 32)

[0236] [ka]

[0237] >GPS1.1-L11-MPT4.1 (SEQ ID NO: 33)

[0238] [ka]

[0239] >GPS1.1-L11-MPT21.9 (SEQ ID NO:34)

[0240] [ka] [ka]

[0241] >GPS1.1-L13-APT73.81 (SEQ ID NO:35)

[0242] [ka]

[0243] >AgGPPS2_truncated (SEQ ID NO:36)

[0244] [ka]

[0245] >CgGPPS2 (SEQ ID NO:37)

[0246] [ka] [ka]

[0247] > PfLS from Perilla frutescens (SEQ ID NO:38)

[0248] [ka]

[0249] > QiMyrS from Quercus ilex (SEQ ID NO: 39)

[0250] [ka]

[0251] > SfCinS1 from Salvia fruticosa (SEQ ID NO: 40).

[0252] [ka] [ka]

[0253] > ACS1 (SEQ ID NO:41).

[0254] [ka]

[0255] >PTA (SEQ ID NO:42)

[0256] [ka]

[0257] >XPK (SEQ ID NO:43)

[0258] [ka] [ka]

[0259] >ACC1 (SEQ ID NO:44)

[0260] [ka] [ka]

[0261] >ACC1.1 (SEQ ID NO:45)

[0262] [ka] [ka]

[0263] >mvaE (SEQ ID NO:46)

[0264] [ka]

[0265] MPT4.1 (SEQ ID NO:47)

[0266] [ka]

[0267] MPT21.9 (SEQ ID NO:48)

[0268] [ka]

[0269] APT 73.81 (SEQ ID NO:49)

[0270] [ka] [ka]

[0271] HMG1 (SEQ ID NO:50)

[0272] [ka]

[0273] tHMG1 (SEQ ID NO:51)

[0274] [ka] [ka]

[0275] IDI1 (SEQ ID NO:52)

[0276] [ka]

[0277] MPT21.1 (SEQ ID NO:53)

[0278] [ka]

[0279] MPT21.2 (SEQ ID NO:54)

[0280] [ka]

[0281] MPT21.3 (SEQ ID NO:55)

[0282] [ka]

[0283] MPT21.4 (SEQ ID NO:56)

[0284] [ka] [ka]

[0285] MPT21.5 (SEQ ID NO:57)

[0286] [ka]

[0287] MPT21.6 (SEQ ID NO:58)

[0288] [ka]

[0289] MPT21.7 (SEQ ID NO:59)

[0290] [ka]

[0291] MPT21.8 (SEQ ID NO:60)

[0292] [ka]

[0293] MPT21.10 (SEQ ID NO:61)

[0294] [ka]

[0295] MPT21.11 (SEQ ID NO:62)

[0296] [ka]

[0297] MPT21.12 (SEQ ID NO:63)

[0298] [ka]

[0299] MPT21.13 (SEQ ID NO:64)

[0300] [ka]

[0301] MPT21.14 (SEQ ID NO:65)

[0302] [ka]

[0303] MPT21.15 (SEQ ID NO:66)

[0304] [ka]

[0305] MPT21.16 (SEQ ID NO:67)

[0306] [ka]

[0307] MPT21.17 (SEQ ID NO:68)

[0308] [ka]

[0309] MPT21.18 (SEQ ID NO:69)

[0310] [ka]

[0311] MPT21.19 (SEQ ID NO: 70)

[0312] [ka]

[0313] MPT21.20 (SEQ ID NO:71)

[0314] [ka]

[0315] MPT21.22 (SEQ ID NO:72)

[0316] [ka] [ka]

[0317] MPT21 (SEQ ID NO:73)

[0318] [ka]

[0319] MPT26 (SEQ ID NO:74)

[0320] [ka]

[0321] MPT31 (SEQ ID NO:75)

[0322] [ka]

[0323] APT73.74 (SEQ ID NO:76)

[0324] [ka]

[0325] APT73.77 (SEQ ID NO:77)

[0326] [ka] [ka]

[0327] APT89.38 (SEQ ID NO:78)

[0328] [ka]

[0329] F1 (SEQ ID NO:79)

[0330] GGGGSGGGGSAEAAAKAEAAAKAGGGGSGGGGS

[0331] F2 (SEQ ID NO:80)

[0332] GGAEAAAKEAAAKAGGSGGGSGGGGSGGS

[0333] F3 (SEQ ID NO:81)

[0334] GGAEAAAKEAAAKAAEAAAAKEAAAKAGGGSPGPGPGGGS

[0335] F4 (SEQ ID NO:82)

[0336] GSSSSSSGSSSSSSGSSSSSSGSSSSGSSSSSSG

[0337] F5 (SEQ ID NO:83)

[0338] GGGGSGGGGSGGGGS

[0339] F6 (SEQ ID NO:84)

[0340] GGEAAAKEAAAKEAAAKGG

[0341] F7 (SEQ ID NO:85)

[0342] GGAEAAAKEAAAKAPAPAPAG

[0343] F8 (SEQ ID NO:86)

[0344] GTPTPTPTG

[0345] F9 (SEQ ID NO:87)

[0346] GGGGSGGGGSGGGGSGGGGSGGGGSGGGGS

[0347] F10 (SEQ ID NO:88)

[0348] GGAEAAAKEAAAKAAEAAAAKEAAAKAAEAAAAKEAAAKAAEAAAAKEAAAKAGG

[0349] F11 (SEQ ID NO:89)

[0350] GGAEAAAKEAAAKAGGSGGGSGGGGSGGSGGGGSGGGGS

[0351] F12 (SEQ ID NO:90)

[0352] GGGGSGGGGS

[0353] F13 (SEQ ID NO:91)

[0354] GGSGSAGSAAGSGEFGG

[0355] F14 (SEQ ID NO:92)

[0356] GGAEAAAKEAAAKAPAPAPAEAAAKEAAAKAGG

[0357] F15 (SEQ ID NO:93)

[0358] GGSGGAEAAAKEAAAKAGGSGG

[0359] F16 (SEQ ID NO:94)

[0360] GGGSGGGSGGGSGGGGS

[0361] F17 (SEQ ID NO:95)

[0362] GGGGS

[0363] F18 (SEQ ID NO:96)

[0364] GGGGSLEDPAVWEAGKVVAKGVGTADITATTSNGLIASSEEADNAATS

Claims

1. 1. A cell that produces an increased ratio of GPP to FPP compared to a control cell, wherein said cell expresses a mutant farnesyl pyrophosphate synthase protein (FPPS), wherein said mutant FPPS is a mutant ERG20 or a mutant ERG20 homolog having at least one deletion, substitution, or insertion at a position selected from positions corresponding to positions 88-90 of wild-type ERG20 (SEQ ID NO:1), and wherein said mutant ERG20 or said mutant ERG20 homolog does not contain a phenylalanine to tryptophan substitution at a position corresponding to position 88 of wild-type ERG20 (SEQ ID NO:1).

2. 2. The cell of claim 1, wherein the mutant FPPS is a mutant ERG20 or a mutant ERG20 homolog having an amino acid sequence that is at least 90% identical to the amino acid sequence of ERG20.A28 (SEQ ID NO: 22) or wild-type ERG20 (SEQ ID NO: 1).

3. The cell of claim 1 or 2, wherein the cell has altered expression of the mutant FPPS compared to expression of wild-type FPPS in control cells, and / or the cell has reduced expression of wild-type ERG20 or no expression of wild-type ERG20.

4. 4. The cell of claim 3, wherein the cell expresses at least one of ERG20.A28, and a farnesyl pyrophosphate synthase protein (FPPS) that has a higher preference for GPP formation over FPP formation compared to ERG20WW (i.e., ERG20.F88W.N119W), ERG20WW-MPT4.1, ERG20WW-MPT21.9, ERG20WW-APT73.81, or an FPPS control.

5. 2. The cell of claim 1, wherein the cell has increased flux through the MVA pathway compared to a control cell, and the cell overexpresses one or more native MVA pathway genes and / or expresses one or more transgenic MVA pathway genes selected from the group consisting of feedback-insensitive HMG-CoA synthase Erg13, mevalonate kinase Erg12, and NADH-dependent HMG-CoA reductase.

6. 2. The cell of claim 1, wherein the cell overexpresses mevalonate-5-phosphate decarboxylase (MPD), isopentenyl phosphokinase (IPK), and / or NADPH-dependent hydroxymethylglutaryl-CoA reductase.

7. 2. The cell of claim 1, wherein the cell expresses one or more transgenic genes selected from limonene monoterpene synthase, myrcene monoterpene synthase, and cineole monoterpene synthase, and the cell has increased production of one or more monoterpenes compared to a control cell.

8. The cell of claim 1, wherein the cell has elevated levels of DMAPP or GPP compared to control cells, and / or the cell produces elevated amounts of one or more compounds prenylated with DMAPP as a donor compared to controls.

9. 2. The cell of claim 1, wherein the cell overexpresses acetyl-CoA synthase (ACS) or overexpresses both ACS and acetyl-CoA carboxylase (ACC) relative to a control cell, and optionally the ACS is a mutant ACS with higher specificity than a corresponding wild-type ACS for converting hexanoic acid to hexanoyl-CoA, and / or the ACC is a mutant ACC with higher activity relative to a wild-type ACC.

10. 2. The cell of claim 1, wherein the cell produces CBGA, THCA, CBGVA, THCVA and / or FCBGA and has increased CBGA, THCA, CBGVA and / or THCVA production and / or reduced FCBGA production compared to control cells.

11. The cell described in claim 9, wherein the ACS is selected from the group consisting of ACS1 (sequence number 41), ACS1.1 (sequence number 7), or an ACS having an amino acid sequence that is at least 90% identical to the amino acid sequence of ACS1.1, and the ACC is selected from the group consisting of ACC1 (sequence number 44), ACC1.1 (sequence number 45), or an ACC having an amino acid sequence that is at least 90% identical to the amino acid sequence of ACC1.

1.

12. 10. The cell of claim 1, wherein the cell is a yeast cell or a bacterial cell, optionally wherein the yeast cell is a Yarrowia, Saccharomyces, or Pichia strain.

13. 10. A method of producing CBGA, CBGVA, THCA, THCVA, or another cannabinoid, monoterpene, or monoterpenoid derived from CBGA or CBGVA, the method comprising culturing the cell of claim 1 with a suitable carbon source under suitable conditions to produce the CBGA, CBGVA, THCA, THCVA, or another cannabinoid, monoterpene, or monoterpenoid derived from CBGA or CBGVA, and optionally isolating the CBGA, CBGVA, THCA, THCVA, CBGA, or CBGVA-derived cannabinoid, monoterpene, or monoterpenoid from the culture.

14. 1. A mutant ERG20 or mutant ERG20 homolog having an amino acid sequence having at least about 90% identity to the amino acid sequence of wild-type ERG20 (SEQ ID NO: 1), and comprising at least one insertion, deletion, or substitution at an amino acid position selected from amino acid positions 88-90 of wild-type ERG20 (SEQ ID NO: 1), wherein said mutant ERG20 or said mutant ERG20 homolog does not contain a phenylalanine to tryptophan substitution at a position corresponding to position 88 of wild-type ERG20 (SEQ ID NO: 1).

15. 15. The mutant ERG20 or mutant ERG20 homolog of claim 14, wherein the mutant ERG20 has a polypeptide sequence selected from the group consisting of SEQ ID NOs: 8-31, or an amino acid sequence having at least 95% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 8-31.

16. A cell that overexpresses acetyl-CoA synthase (ACS) or overexpresses both ACS and acetyl-CoA carboxylase (ACC) relative to a control cell, wherein the ACS is a mutant ACS that has higher specificity than a corresponding wild-type ACS for converting hexanoic acid to hexanoyl-CoA, and / or the ACC is a mutant ACC that has higher activity relative to a wild-type ACC, and optionally the cell is a yeast cell or a bacterial cell.

17. The cell described in claim 16, wherein the ACC is selected from the group consisting of ACC1 (SEQ ID NO: 44), ACC1.1 (SEQ ID NO: 45), or an ACC having an amino acid sequence that is at least 90% identical to the amino acid sequence of ACC1.1, and / or the ACS is selected from the group consisting of ACS1 (SEQ ID NO: 41), ACS1.1 (SEQ ID NO: 7), or an ACS having an amino acid sequence that is at least 90% identical to the amino acid sequence of ACS1.

1.

18. A mutant acetyl-CoA synthase (ACS) selected from ACS1.1 (SEQ ID NO:7) or an ACS having an amino acid sequence having at least 90% identity to the amino acid sequence of ACS1.1, wherein the mutant acetyl-CoA synthase (ACS) has higher specificity for converting hexanoic acid to hexanoyl-CoA than the corresponding wild-type ACS.

19. A mutant acetyl-CoA carboxylase (ACC) selected from ACC1.1 (SEQ ID NO: 45) or an ACC having an amino acid sequence that is 90% homologous to the amino acid sequence of ACC1.1, wherein the mutant acetyl-CoA carboxylase (ACC) has higher activity than the corresponding wild-type ACC.

20. A cell that overexpresses pyruvate decarboxylase (PDC), aldehyde dehydrogenase (ALD) and / or one or more non-oxidative glycolysis genes compared to a control cell, optionally wherein the cell is a yeast cell or a bacterial cell, and optionally wherein the cell has increased cannabinoid production compared to a control cell.