Engineered DNA polymerase variants

JP2024539636A5Pending Publication Date: 2025-10-22CODEXIS INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024522281
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-10-15
Filing Date
2022-10-14
Publication Date
2025-10-22

AI Technical Summary

Technical Problem

There is a need for thermostable DNA polymerases with improved properties such as enhanced throughput and fidelity for applications in PCR, nucleic acid sequencing, and diagnostics.

Method used

Engineered DNA polymerase polypeptides with specific amino acid substitutions and modifications, achieving at least 75-99% sequence identity to reference sequences, exhibit increased activity, fidelity, and thermostability compared to existing DNA polymerases like Pfu, group B, and Taq.

Benefits of technology

The engineered DNA polymerases demonstrate improved polymerization activity, higher product yield, and enhanced replication fidelity under low DNA input conditions, suitable for high-throughput analysis and sequencing reactions.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present disclosure relates to engineered DNA polymerase polypeptides and compositions thereof, as well as polynucleotides encoding the engineered DNA polymerase polypeptides. The present disclosure also provides methods of using the engineered DNA polymerase polypeptides or compositions thereof for diagnostic and other purposes. The present disclosure relates to engineered DNA polymerase polypeptides and compositions thereof, as well as polynucleotides encoding the engineered DNA polymerase polypeptides. The present disclosure also provides methods of using the engineered DNA polymerase polypeptides and compositions thereof for diagnostic and other purposes.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit under 35 U.S.C. §119(e) of U.S. Provisional Application No. 63 / 256,492, filed October 15, 2021, which is incorporated by reference herein in its entirety.

[0002] Reference to a sequence listing, table or computer program The Sequence Listing submitted herewith via EFS-Web under filename CX9-218WO1_ST26.xml, created on October 14, 2022, and having a file size of 2.21 MB, is hereby incorporated by reference.

[0003] Technical Field The present disclosure provides engineered DNA polymerase polypeptides and compositions thereof, as well as polynucleotides encoding the engineered DNA polymerase polypeptides. The present disclosure also provides methods for the use of recombinant DNA polymerases or compositions thereof for diagnostics, molecular biology tools, and other purposes. [Background technology]

[0004] background DNA polymerase is an enzyme that synthesizes DNA from deoxyribonucleotides. Such enzymes are essential for DNA replication. There are various types of DNA polymerases that display different properties and are found in different types of organisms. Polymerases obtained from thermophilic organisms have found widespread and highly important applications in various in vitro methods, including but not limited to polymerase chain reaction (PCR), nucleic acid sequencing, and other diagnostic, molecular biological, and forensic applications. Although there are many commercially available thermostable DNA polymerases, such as Taq and Pfu DNA polymerase, there is still a need in the art for thermostable enzymes with improved properties, such as enhanced processivity and / or fidelity. Summary of the Invention [Means for solving the problem]

[0005] overview The present disclosure relates to engineered DNA polymerase polypeptides and compositions thereof, as well as polynucleotides encoding the engineered DNA polymerase polypeptides. The present disclosure also provides methods of using the engineered DNA polymerase polypeptides and compositions thereof for diagnostic and other purposes.

[0006] In one aspect, the disclosure provides an engineered DNA polymerase or functional fragment thereof comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:2, 8, 332, 462 or 606 or a reference sequence corresponding to SEQ ID NO:2, 8, 332, 462 or 606, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:2, 8, 332, 462 or 606 or a reference sequence corresponding to SEQ ID NO:2, 8, 332, 462 or 606.

[0007] In some embodiments, the engineered DNA polymerase or functional fragment thereof comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:2 or a reference sequence corresponding to SEQ ID NO:2, wherein the polypeptide sequence comprises one or more substitutions compared to the reference sequence corresponding to residues 12-850 of SEQ ID NO:2 or a reference sequence corresponding to SEQ ID NO:2.

[0008] In some embodiments, an engineered DNA polymerase or functional fragment thereof comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO:8, 332, 462 or 606, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:2, or a reference sequence corresponding to SEQ ID NO:2.

[0009] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises the amino acid positions 15, 16, 20, 21, 22, 40, 41, 52, 57, 58, 73, 85, 87, 88, 91, 102, 109, 132, 157, 177, 186, 200, 213, 217, 231, 232, 242, 243, 262, 263, 264, 265, 273, 299, 321, 322, 328, 384, 386, 401, 402, 403, 404, 406, 407, 440, 476, 480, 491, 495, 498, 503, 504, 506, 507, 508, 511, 514, 520, 521, 523, 524, 525, 526, 527, 528, 529, 530, 533, 534, 535, 536, 537, 538, 539 , 540, 542, 553, 554, 555, 556, 557, 558, 559, 560, 562, 563, 566, 570, 572, 581, 582, 584, 585, 586, 587, 589, 592, 593, 594, 595, 596, 597, 599, 601, 602, 603, 605, 607, 616, 665, 671, 674, 675, 677, 6 84, 688, 696, 704, 705, 706, 728, 735, 747, 748, 749, 750, 751, 753, 755, 756, 762, 763, 764, 766, 772, 773, 779, 793, 803, 814, 820, or 849 or a combination thereof, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0010] In some embodiments, the polypeptide sequence of an engineered DNA polymerase comprises at least one of the following substitutions: 15A / G / K / N, 16R, 20A / C, 21K / Q / S, 22K, 40A, 41F, 52R, 57T, 58N, 73A, 85E / P / R / S, 87N, 88T, 91K, 102V / M / S, 109P, 132Y, 157G, 177T, 186E, 200V, 213P, 217E, 231E, 232C, 242Q, 243L / S, 262L, 263A, 264T, 265I, 273M, 299N, 321G, 322N / S, 328I, 384Y, 386V, 401A / G / I, 402G / R, 403L / R, 404S / T, 406K / Q, 407R / W, 440G, 476I / N, 480E / V / W, 491G, 495E / M / S, 498D, 503I / V, 504M, 506P, 507K, 508H, 511M, 514F, 520 P, 521G / W / Y, 523A / K / V, 524G / K / Q, 525L / V, 526T, 527V / W, 528A / Q / R / W, 529 S, 530G / P / R / W, 533L / P / Q / V, 534H / W, 535K, 536R, 537G / L / W, 538A, 539L / R, 5 40H / V, 542G / M / T / W, 553F / K / N / R, 554E, 555H / K / M / W, 556F / M / P / W, 557G / H, 558R / S / V / Q, 559D / G / P, 560G / M, 562S, 563L, 566A, 570R, 572I, 581A, 582F, 584N, 585KR, 586M, 587Q, 587S, 589G / L / R / S / W, 592G / T / V, 593N, 594C / Q / T / V / W, 595A / P / R, 596L / R / W, 597E, 599G / S / T, 601M / P, 602V, 603G / V / W, 605E / A, 607N, 616A, 665V, 671E / R, 674T, 675L, 677M, 684V, 688I, 696H / V, 704P, 705W, 706E, 728K, 735G / L, 747T, 748Y, 749L / R / T, 750S / P, 751H, 753K / V, 755P, 756N / T, 762M / Q / V, 763G / Y, 764A / I / V, 766Y, 772I, 773R, 779I, 793G, 803C / R, 814E, 820A, or 849T or combinations thereof, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0011] In some embodiments, the polypeptide sequence of the engineered DNA polymerase polypeptide comprises at least a substitution at amino acid position 40, 85, 102, 132, 157, 177, 262, 263, 748, 521 or 750, or a combination thereof, where the amino acid positions are relative to the reference sequence of SEQ ID NO: 2. In some embodiments, the polypeptide sequence of the engineered DNA polymerase polypeptide comprises at least a substitution 40A, 85E, 102S, 132Y, 157G, 177T, 262L, 263A, 748Y, 521G or 750S, or a combination thereof. In some embodiments, the polypeptide sequence of the engineered DNA polymerase polypeptide comprises at least a substitution S40A, P85E, V102S, V132Y, S157G, R177T, I262L, S263A, H748Y, A521G or P750S, or a combination thereof.

[0012] In some embodiments, the polypeptide sequence of an engineered DNA polymerase polypeptide is selected from the group consisting of amino acid positions 213 / 503 / 508 / 584 / 748, 40 / 132 / 748, 40 / 132 / 157 / 262 / 263 / 748, 132, 40 / 132 / 503 / 748, 40 / 132 / 157 / 503 / 562, 40 / 132 / 213 / 748 / 814, 132 / 157 / 562 / 584, 132 / 584 / 748, 40 / 132 / 231 / 684 / 748, 40 / 132, 40 / 41 / 132 / 562 / 684 / 748, 41 / 213 / 231 / 503 / 650 / 674 / 748, 132 / 231 / 503 / 748, 40 / 132 / 157 / 503, 503 / 748 / 814, 40 / 132 / 231 / 503 / 674 / 748, 40 / 88 / 132 / 503 / 684 / 748, 132 / 157 / 213 / 674 / 748 / 814, 157 / 263 / 748, 40 / 748, 41 / 157 / 231 / 262 / 748 / 814, 40 / 213 / 503 / 562 / 584 / 748, 523 / 524, 40 / 132 / 503 / 514 / 650 / 674, 40 / 132 / 157 / 213 / 231, 4 1 / 213 / 520 / 814, 40 / 41 / 157 / 231 / 503, 40 / 157 / 503, 40 / 132 / 562 / 748, 132 / 748, 40 / 41 / 132 / 562 / 748, 88 / 213 / 503 / 584 / 684 / 748, 57 / 58 / 523 / 616 / 6 77, 40 / 213 / 231 / 503 / 514 / 562 / 748, 132 / 562, 213 / 503 / 650, 40 / 41 / 88 / 231 / 748 / 814, 41 / 213 / 262 / 562, 41 / 88 / 231 / 748, 213 / 263 / 748, 40 / 157 / 213, 157 / 520, 40 / 132 / 263 / 503 / 674 / 814, 40 / 41, 524 / 665 / 756, 58 / 186 / 217 / 523 / 524 / 677, 40 / 41 / 748, 132 / 514, 520, 41 / 213 / 503 / 562, 231 / 503 / 748 / 7 72, 503 / 562, 73 / 232 / 514 / 584 / 814, 58 / 507 / 616, 132 / 262 / 520 / 562 / 684 / 748, 88 / 562 / 814, 41 / 88 / 157 / 814, 88 / 157 / 213 / 674 / 684, 57 / 58 / 523 / 779,40 / 132 / 157 / 514 / 520 / 684, 40 / 41 / 213 / 684 / 772, 40 / 41 / 231 / 503 / 814, 88 / 213 / 503 / 584 / 814, 40 / 41 / 132 / 562 / 584, 41 / 88 / 213 / 231 / 503 / 650 / 748, 40 / 503, 40 / 132 / 213 / 231 / 520 / 562 / 650 / 814, 40 / 41 / 132 / 231 / 262 / 503 / 562 / 584 / 748 / 814, 57 / 58 / 264 / 265 / 524 / 688, 88 / 132 / 15 7 / 262 / 263 / 520 / 562, 88 / 132 / 157 / 262 / 503 / 514 / 562 / 650, 40 / 584 / 674 / 748, 40 / 41 / 132 / 263 / 503, 584 / 748, 40 / 213 / 674, 40 / 41 / 88T / 132 / 503 / 562 / 584 / 748, 88 / 213 / 514 / 562 / 748 / 814, 263 / 520 / 814, or 40 / 41 / 88 / 157, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0013] In some embodiments, the polypeptide sequence of an engineered DNA polymerase polypeptide comprises the amino acid sequence at amino acid positions 22 / 407, 328, 401, 402, 403, 404, 406, 407, 503, 504, 506, 521, 523, 524, 525, 526, 527, 528, 529, 530, 531, 533, 534, 535, 536, 537, 538, 539, 540, 542, 553, 554, 555, 556, 557, or 803, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0014] In some embodiments, the polypeptide sequence of the engineered DNA polymerase polypeptide is selected from the group consisting of amino acid positions 750 / 820, 21 / 52, 20 / 21 / 85 / 322 / 476 / 495, 20 / 85 / 200 / 322 / 476 / 495 / 750, 476 / 750, 20 / 476, 20 / 322 / 386, 85 / 322 / 476, 52 / 322 / 498 / 750, 20 / 322 / 476 / 820, 85 / 476 / 495 / 820, 21 / 85 / 322 / 820, 20 / 299 / 322 / 386 / 476 / 495 / 820, 20 / 322, 21 / 820 / 849, 476, 322 / 820, 21 / 322 / 386 / 820, 322 / 386 / 495, 85 / 386 / 495 / 750, 20 / 85 / 476 / 750, 20 / 386 / 476, 85 / 322 / 386 / 476 / 4 95, 20 / 495 / 820, 750, 21 / 322 / 495, 52 / 386 / 495 / 820, 21 / 322, 85 / 322 / 750 / 820, 20 / 52 / 85, 21 / 52 / 572, 20 / 85 / 495 / 849, 85 / 750, 21 / 495 / 820, 273 / 322 / 849, 495, 322 / 750 / 820, 52 / 476 / 495 / 566 / 750 / 849, 386 / 495, 4 and comprising at least a substitution or set of substitutions at: 95 / 820, 21 / 322 / 495 / 750 / 820, 21 / 85 / 322 / 386 / 495 / 820 / 849, 476 / 495 / 750, 386 / 849, 476 / 495, 85 / 476 / 849, 21 / 322 / 750, 20 / 85 / 566 / 820, or 386 / 750 / 849, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0015] In some embodiments, the polypeptide sequence of an engineered DNA polymerase polypeptide is selected from the group consisting of amino acid positions 299 / 386 / 566 / 820, 476 / 820 / 849, 21 / 322 / 476 / 495 / 820, 177, 21 / 495, 476 / 820, 20 / 52 / 299, 52 / 299, 322 / 820, 20 / 820, 20 / 299 / 386 / 476, 386 / 476 / 820, 476 / 495 / 820 , 386 / 476 / 495, 20 / 21 / 299 / 322 / 386, 322 / 386 / 495, 21 / 299 / 322 / 476 / 495 / 820, 21 / 299 / 386 / 820, 299 / 476 / 820, 20 / 21, 21 / 85 / 102 / 750, 705, 21 / 386 / 476 / 820, 820, 21 / 299 / 322, 20 / 21 / 322 / 386 / 820, 299, 21 / 299 / 386 / 476, 109, 322 / 495, 491, 52 / 820, 21 / 386 / 820, 20 / 21 / 495, 21 / 299 / 322 / 495 / 566 / 820, 20 / 21 / 299 / 495, 756, 386 / 820, 495, 511, 21 / 52 / 242 / 386 / 495 / 820, 299 / 476 / 495, 706, 21 / 299 / 386 / 476 / 495, 21 / 299 / 322 / 495, 21 / 476 / 849 , 299 / 322 / 476 / 820, 21 / 52 / 299 / 322 / 820, 20 / 21 / 566, 20 / 52, 322 / 386 / 495 / 566 / 820, 21 / 299, 21 / 299 / 386, 386 / 849, 52 / 476, 52 / 299 / 322 / 386 / 495, 440 or a combination thereof, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0016] In some embodiments, the polypeptide sequence of the engineered DNA polymerase polypeptide is selected from the group consisting of amino acid positions 22 / 40 / 132 / 157 / 262 / 263 / 407 / 748, 40 / 132 / 157 / 262 / 263 / 328 / 748, 40 / 132 / 157 / 262 / 263 / 401 / 748, 40 / 132 / 157 / 262 / 263 / 402 / 748, 40 / 132 / 157 / 262 / 263 / 403 / 748, 40 / 132 / 157 / 262 / 263 / 404 / 748, 40 / 132 / 157 / 262 / 263 / 406 / 748, 40 / 132 / 157 / 262 / 263 / 407 / 748, 40 / 132 / 157 / 262 / 263 / 328 / 748, 40 / 132 / 157 / 262 / 263 / 401 / 748, 40 / 132 / 157 / 262 / 263 / 402 / 748, 40 / 132 / 157 / 262 / 263 / 403 / 748, 40 / 132 / 157 / 262 / 263 / 404 / 748, 40 / 132 / 157 / 262 / 263 / 406 / 748, 7 / 262 / 263 / 407 / 748, 40 / 132 / 157 / 262 / 263 / 503 / 748, 40 / 132 / 157 / 262 / 263 / 504 / 748, 40 / 132 / 157 / 262 / 263 / 506 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 74 8, 40 / 132 / 157 / 262 / 263 / 523 / 748, 40 / 132 / 157 / 262 / 263 / 524 / 748, 40 / 132 / 157 / 262 / 263 / 525 / 748, 40 / 132 / 157 / 262 / 263 / 526 / 748, 40 / 132 / 157 / 262 / 263 / 527 / 748, 40 / 132 / 157 / 262 / 263 / 528 / 748, 40 / 132 / 157 / 262 / 263 / 529 / 748, 40 / 132 / 157 / 262 / 263 / 530 / 748, 40 / 132 / 157 / 262 / 263 / 531 / 748, 40 / 1 32 / 157 / 262 / 263 / 533 / 748, 40 / 132 / 157 / 262 / 263 / 534 / 748, 40 / 132 / 157 / 262 / 263 / 535 / 748, 40 / 132 / 157 / 262 / 263 / 536 / 748, 40 / 132 / 157 / 262 / 263 / 5 37 / 748, 40 / 132 / 157 / 262 / 263 / 538 / 748, 40 / 132 / 157 / 262 / 263 / 539 / 748, 40 / 132 / 157 / 262 / 263 / 540 / 748, 40 / 132 / 157 / 262 / 263 / 542 / 748, 40 / 132 / 15 7 / 262 / 263 / 54 / 748, 40 / 132 / 157 / 262 / 263 / 553 / 748, 40 / 132 / 157 / 262 / 263 / 554 / 748, 40 / 132 / 157 / 262 / 263 / 555 / 748, 40 / 132 / 157 / 262 / 263 / 556 / 748,40 / 132 / 157 / 262 / 263 / 557 / 748、40 / 132 / 157 / 262 / 263 / 558 / 748、40 / 132 / 157 / 262 / 263 / 559 / 748、40 / 132 / 157 / 262 / 263 / 560 / 748、40 / 132 / 157 / 262 / 263 / 563 / 748、40 / 132 / 157 / 262 / 263 / 581 / 748、40 / 132 / 157 / 262 / 263 / 582 / 748、40 / 132 / 157 / 262 / 263 / 585 / 748、40 / 132 / 157 / 262 / 263 / 586 / 748、40 / 132 / 157 / 262 / 263 / 587 / 748、40 / 132 / 157 / 262 / 263 / 589 / 748、40 / 132 / 157 / 262 / 263 / 592 / 748、40 / 132 / 157 / 262 / 263 / 593 / 748、40 / 132 / 157 / 262 / 263 / 594 / 748、40 / 132 / 157 / 262 / 263 / 595 / 748、40 / 132 / 157 / 262 / 263 / 596 / 748、40 / 132 / 157 / 262 / 263 / 597 / 748、40 / 132 / 157 / 262 / 263 / 598 / 748、40 / 132 / 157 / 262 / 263 / 599 / 748、40 / 132 / 157 / 262 / 263 / 601 / 748、40 / 132 / 157 / 262 / 263 / 602 / 748、40 / 132 / 157 / 262 / 263 / 603 / 748、40 / 132 / 157 / 262 / 263 / 605 / 748、40 / 132 / 157 / 262 / 263 / 607 / 748、40 / 132 / 157 / 262 / 263 / 696 / 748、40 / 132 / 157 / 262 / 263 / 747 / 748、40 / 132 / 157 / 262 / 263 / 748、40 / 132 / 157 / 262 / 263 / 748 / 749、40 / 132 / 157 / 262 / 263 / 748 / 751、40 / 132 / 157 / 262 / 263 / 748 / 762、40 / 132 / 157 / 262 / 263 / 748 / 763、40 / 132 / 157 / 262 / 263 / 748 / 764、40 / 132 / 157 / 262 / 263 / 748 / 766、40 / 132 / 157 / 262 / 263 / 748 / 773、40 / 132 / 157 / 262 / 263 / 748 / 803、40 / 132 / 157 / 605 / 262 / 263 / 748、40 / 132 / 157 / 262 / 263 / 403 / 521 / 748、or 40 / 132 / 157 / 262 / 263 / 403 / 553 / 748, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0017] In some embodiments, the polypeptide sequence of the engineered DNA polymerase polypeptide is selected from the group consisting of amino acid positions 40 / 132 / 157 / 262 / 263 / 403 / 404 / 521 / 524 / 542 / 555 / 748 / 762 / 764, 40 / 132 / 157 / 262 / 263 / 404 / 521 / 524 / 542 / 589 / 748 / 762 / 764, 40 / 132 / 157 / 262 / 263 / 521 / 524 / 542 / 581 / 748 / 762 / 764, 40 / 132 / 157 / 262 / 263 / 521 / 542 / 748 / 762 / 764, 40 / 132 / 157 / 262 / 263 / 521 / 542 / 748 / 762 / 764, 262 / 263 / 404 / 521 / 542 / 748 / 762, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 750 / 849, 40 / 132 / 157 / 262 / 263 / 521 / 524 / 581 / 748, 16 / 40 / 132 / 157 / 262 / 263 / 521 / 7 35 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 820, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 793, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 764, 40 / 132 / 157 / 262 / 263 / 521 / 74 8 / 755, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 753, 40 / 132 / 157 / 262 / 263 / 521 / 735 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 728, 40 / 132 / 157 / 262 / 263 / 521 / 704 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 675 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 671 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 570 / 748, 40 / 132 / 157 / 262 / 263 / 495 / 521 / 748, 40 / 132 / 157 / 262 / 263 / 480 / 521 / 748, 40 / 132 / 157 / 262 / 263 / 476 / 521 / 748, 40 / 132 / 157 / 262 / 263 / 384 / 521 / 748, 40 / 132 / 157 / 262 / 263 / 322 / 521 / 7 48, 40 / 132 / 157 / 262 / 263 / 321 / 521 / 748, 40 / 132 / 157 / 243 / 262 / 263 / 521 / 748, 15 / 40 / 132 / 157 / 262 / 263 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 521 / 748,40 / 91 / 132 / 157 / 262 / 263 / 521 / 748, 40 / 87 / 132 / 157 / 262 / 263 / 521 / 748, 40 / 85 / 132 / 157 / 262 / 263 / 521 / 748, 20 / 40 / 132 / 157 / 262 / 263 / 521 / 748, 21 / 40 / 132 / 157 / 262 / 263 / 521 / 748, or 40 / 52 / 132 / 157 / 262 / 263 / 521 / 748, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0018] In some embodiments, the polypeptide sequence of the engineered DNA polymerase polypeptide is selected from the group consisting of amino acid positions 40 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750, 21 / 40 / 52 / 102 / 132 / 157 / 262 / 263 / 521 / 748, 21 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748, 20 / 40 / 102 / 132 / 157 / 26 2 / 263 / 322 / 521 / 748, 20 / 40 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750, 40 / 102 / 132 / 157 / 262 / 263 / 386 / 49 5 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 476 / 495 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 820, 40 / 102 / 132 / 157 / 262 / 263 / 386 / 521 / 748 / 8 49, 20 / 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750, 40 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 820, 40 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750 / 820, 21 / 40 / 52 / 102 / 132 / 157 / 262 / 263 / 521 / 572 / 748, 20 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 521 / 748, 21 / 4 0 / 102 / 132 / 157 / 262 / 263 / 322 / 495 / 521 / 748, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 476 / 521 / 748, 20 / 40 / 102 / 132 / 157 / 262 / 263 / 386 / 476 / 521 / 748, 21 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 750, 21 / 40 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 820, 20 / 40 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 820,40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 849、21 / 40 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 820 / 849、40 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 495 / 521 / 748、40 / 102 / 132 / 157 / 262 / 263 / 273 / 322 / 521 / 748 / 849、40 / 102 / 132 / 157 / 262 / 263 / 476 / 495 / 521 / 748 / 750、40 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 750 / 820、40 / 102 / 132 / 157 / 262 / 263 / 386 / 521 / 748 / 750 / 849、21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 820、20 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750、20 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 849、20 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 566 / 748 / 820、40 / 52 / 102 / 132 / 157 / 262 / 263 / 322 / 498 / 521 / 748 / 750、21 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 521 / 748 / 820、40 / 52 / 102 / 132 / 157 / 262 / 263 / 386 / 495 / 521 / 748 / 820、20 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 476 / 521 / 748 / 820、40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 495 / 521 / 748 / 750、40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 495 / 521 / 748 / 820、40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 750 / 820、40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 476 / 495 / 521 / 748、21 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 495 / 521 / 748 / 750 / 820、20 / 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 476 / 495 / 521 / 748、20 / 40 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 386 / 476 / 495 / 521 / 748, 40 / 52 / 102 / 132 / 157 / 262 / 263 / 476 / 495 / 521 / 566 / 748 / 750 / 849, 20 / 40 / 85 / 102 / 132 / 157 / 262 / 200 / 263 / 322 / 476 / 495 / 521 / 748 / 750, or 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 495 / 521 / 748 / 820 / 849, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2. ,

[0019] In some embodiments, the polypeptide sequence of the engineered DNA polymerase polypeptide is at amino acid positions 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 521 / 566 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750 / 820 / 849, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 476 / 495 / 521 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 177 / 263 / 521 / 748 / 750 , 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750 / 820, 20 / 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 2 99 / 521 / 748 / 750, 52 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 750 / 820, 20 / 40 / 85 / 102 / 132 / 15 7 / 262 / 263 / 521 / 748 / 750 / 820, 20 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 476 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 476 / 521 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 495 / 521 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 476 / 495 / 521 / 748 / 750, 20 / 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 386 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 495 / 521 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 47 6 / 495 / 521 / 748 / 750 / 820, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 521 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 476 / 521 / 748 / 750 / 820,20 / 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750、21 / 40 / 102 / 132 / 157 / 262 / 263 / 521 / 748、40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 705 / 748 / 750、21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 476 / 521 / 748 / 750 / 820、40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750 / 820、21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 521 / 748 / 750、20 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 521 / 748 / 750 / 820、40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 521 / 748 / 750、21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 476 / 521 / 748 / 750、40 / 85 / 102 / 109 / 132 / 157 / 262 / 263 / 521 / 748 / 750、40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 495 / 521 / 748 / 750、40 / 85 / 102 / 132 / 157 / 262 / 263 / 491 / 521 / 748 / 750、40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750 / 820、21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 521 / 748 / 750 / 820、20 / 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 750、21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 495 / 521 / 566 / 748 / 750 / 820、20 / 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 495 / 521 / 748 / 750、40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750 / 756、40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 521 / 748 / 750 / 820、40 / 85 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 750、40 / 85 / 102 / 132 / 157 / 262 / 263 / 511 / 521 / 748 / 750、21 / 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 242 / 386 / 495 / 521 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 476 / 495 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 706 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 476 / 495 / 521 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 495 / 521 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750 / 849, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 476 / 521 / 748 / 750 / 820, 21 / 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 521 / 748 / 750 / 820, 20 / 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 566 / 748 / 750, 20 / 40 / 52 / / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 495 / 521 / 566 / 748 / 750 / 820, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 521 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 521 / 748 / 750, 40 / 85 / 102 / 132 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 521 / 748 / 750 / 849, 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750, 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 386 / 495 / 521 / 748 / 750, or 40 / 85 / 102 / 132 / 157 / 262 / 263 / 440 / 521 / 748 / 750, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0020] In some embodiments, an engineered DNA polymerase of the disclosure comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO: 8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO: 8, 332, 462 or 606.

[0021] In some embodiments, an engineered DNA polymerase of the disclosure comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO:8, 332, 462 or 606, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO:8, 332, 462 or 606.

[0022] In some embodiments, the polypeptide sequence of an engineered DNA polymerase having a reference sequence that includes residues 12-850 of SEQ ID NO: 8, 332, 462, or 606, or a sequence identity as described above to a reference sequence of SEQ ID NO: 8, 332, 462, or 606, is selected from the amino acid positions 15, 16, 20, 21, 22, 40, 41, 52, 57, 58, 73, 85, 87, 88, 91, 102, 109, 132, 157, 177, 180, 182, 184, 186, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 256, 258, 260, 262, 264, 266, 270, 272, 276, 278, 279, 280, 281, 282, 283 186, 200, 213, 217, 231, 232, 242, 243, 262, 263, 264, 265, 273, 299, 321, 322, 328, 384, 386, 401, 402, 403, 404, 406, 407, 440, 476, 480, 491, 495, 498, 503, 504, 506, 507, 508, 511, 514, 520, 521, 523, 524, 525, 526, 527, 528, 52 9, 530, 533, 534, 535, 536, 537, 538, 539, 540, 542, 553, 554, 555, 556, 557, 558, 559, 560, 562, 563, 566, 570, 572, 581, 582, 584, 585, 586, 587, 589, 592, 593, 594, 595, 596, 597, 599, 601, 602, 603, 605, 607, 616, 665, 671, 674, 675, 677, 684, 688, 696, 704, 705, 706, 728, 735, 747, 748, 749, 750, 751, 753, 755, 756, 762, 763, 764, 766, 772, 773, 779, 793, 803, 814, 820, or 849 or a combination thereof, where the amino acid positions are relative to the reference sequence of SEQ ID NO: 8, 332, 462 or 606.

[0023] In some embodiments, the polypeptide sequence of an engineered DNA polymerase comprises at least the amino acid residues 15A / G / K / N, 16R, 20A / C, 21K / Q / S, 22K, 40A, 41F, 52R, 57T, 58N, 73A, 85E / P / R / S, 87N, 88T, 91K, 102V / M / S, 109P, 132Y, 157G, 177T, 186E, 200V, 213P, 217E, 231E, 232C, 242Q, 243L / S, 262L, 263A, 264T, 265I, 273M, 299N, 321G, 322N / S, 328I, 384Y, 386V, 401A / G / I, 402G / R, 403L / R, 404S / T, 406K / Q, 407R / W, 440G, 476I / N, 480E / V / W, 491G, 495E / M / S, 498D, 503I / V, 504M, 5 06P, 507K, 508H, 511M, 514F, 520P, 521G / W / Y, 523A / K / V, 524G / K / Q, 525L / V, 526T, 527V / W, 528A / Q / R / W, 529S, 530 G / P / R / W, 533L / P / Q / V, 534H / W, 535K, 536R, 537G / L / W, 538A, 539L / R, 540H / V, 542G / M / T / W, 553F / K / N / R, 554E, 555 H / K / M / W, 556F / M / P / W, 557G / H, 558R / S / V / Q, 559D / G / P, 560G / M, 562S, 563L, 566A, 570R, 572I, 581A, 582F, 584N, 58 5KR, 586M, 587Q / S, 589G / L / R / S / W, 592G / T / V, 593N, 594C / Q / T / V / W, 595A / P / R, 596L / R / W, 597E, 599G / S / T, 601M / P , 602V, 603G / V / W, 605E / A, 607N, 616A, 665V, 671E / R, 674T, 675L, 677M, 684V, 688I, 696H / V, 704P, 705W, 706E, 728 K, 735G / L, 747T, 748Y, 749L / R / T, 750S / P, 751H, 753K / V, 755P, 756N / T, 762M / Q / V, 763G / Y, 764A / I / V, 766Y, 772I, 773R, 779I, 793G, 803C / R, 814E, 820A, or 849T or combinations thereof, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO: 8, 332, 462 or 606.

[0024] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least a substitution at amino acid position 40, 85, 102, 132, 157, 177, 262, 263, 521, 748, or 750, or a combination thereof.

[0025] In some embodiments, an engineered DNA polymerase of the disclosure comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:8 or a reference sequence corresponding to SEQ ID NO:8, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:8 or a reference sequence corresponding to SEQ ID NO:8.

[0026] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises the amino acid positions 22 / 407, 328, 401, 402, 403, 404, 406, 407, 503, 504, 506, 521, 523, 524, 525, 526, 527, 528, 529, 530, 531, 533, 534, 535, 536, 537, 538, 539, 540, 542, 553, 554, 555, 556, 557, 558, 559, 560, 563, 581, 582, 585, 586, 587, 589, 592, 592, 592, 593, 594, 595, 596, 597, 598, 599, 601, 602, 603, 605, 607, 696, 747, 749, 751, 762, 763, 764, 766, 773, or 803 or a combination thereof, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO:8.

[0027] In some embodiments, an engineered DNA polymerase of the disclosure comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:332 or a reference sequence corresponding to SEQ ID NO:332, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:332 or a reference sequence corresponding to SEQ ID NO:332.

[0028] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises the amino acid positions 15, 20, 21, 52, 85, 87, 91, 102, 243, 321, 322, 384, 404, 476, 480, 480, 495, 542, 570, 671, 675, 704, 728, 735, 753, 755, 762, 764, 793, 820, 16 / 735, 750 / 849, 524 / 581, 403 / 404 / 524 / 542 / 555 / 762 / 764, 404 / 524 / 542 / 589 / 762 / 764, 524 / 542 / 581 / 762 / 764, or 542 / 762 / 764, where the amino acid positions are relative to the reference sequence of SEQ ID NO:332.

[0029] In some embodiments, an engineered DNA polymerase of the disclosure comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:462 or a reference sequence corresponding to SEQ ID NO:462, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:462 or a reference sequence corresponding to SEQ ID NO:462.

[0030] In some embodiments, the polypeptide sequence of the engineered DNA polymerase is selected from the group consisting of amino acid positions 750 / 820, 21 / 52, 20 / 21 / 85 / 322 / 476 / 495, 20 / 85 / 200 / 322 / 476 / 495 / 750, 476 / 750, 20 / 476, 20 / 322 / 386, 85 / 322 / 476, 52 / 322 / 498 / 750, 20 / 322 / 476 / 820, 85 / 4 76 / 495 / 820, 21 / 85 / 322 / 820, 20 / 299 / 322 / 386 / 476 / 495 / 820, 20 / 322, 21 / 820 / 849, 476, 322 / 820, 21 / 322 / 386 / 820, 322 / 386 / 495, 85 / 386 / 495 / 750, 20 / 85 / 476 / 750, 20 / 386 / 476, 85 / 322 / 386 / 476 / 495, 20 / 495 / 820, 750, 21 / 322 / 495, 52 / 386 / 495 / 820, 21 / 322, 85 / 322 / 750 / 820, 20 / 52 / 85, 21 / 52 / 572, 20 / 85 / 495 / 849, 85 / 750, 21 / 495 / 820, 273 / 322 / 849, 495, 322 / 750 / 820, 52 / 476 / 495 / 566 / 750 / 849, 386 / 495, 495 / 820 , 21 / 322 / 495 / 750 / 820, 21 / 85 / 322 / 386 / 495 / 820 / 849, 476 / 495 / 750, 386 / 849, 476 / 495, 85 / 476 / 849, 21 / 322 / 750, 20 / 85 / 566 / 820, or 386 / 750 / 849, where the amino acid positions are relative to the reference sequence of SEQ ID NO:462.

[0031] In some embodiments, an engineered DNA polymerase of the disclosure comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:606 or a reference sequence corresponding to SEQ ID NO:606, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:606 or a reference sequence corresponding to SEQ ID NO:606.

[0032] In some embodiments, the polypeptide sequence of the engineered DNA polymerase is selected from the group consisting of amino acid positions 299 / 386 / 566 / 820, 476 / 820 / 849, 21 / 322 / 476 / 495 / 820, 177, 21 / 495, 476 / 820, 20 / 52 / 299, 52 / 299, 322 / 820, 20 / 820, 20 / 299 / 386 / 476, 386 / 476 / 820, 476 / 495 / 820, 386 / 476 / 495, 20 / 21 / 299 / 322 / 386, 322 / 386 / 495, 21 / 299 / 322 / 476 / 495 / 820, 21 / 299 / 386 / 820, 299 / 476 / 820, 20 / 21, 21 / 85 / 102 / 750, 705, 21 / 386 / 476 / 820, 820, 21 / 299 / 322, 20 / 21 / 322 / 386 / 820, 299, 21 / 299 / 386 / 476, 109, 322 / 495, 491, 52 / 820, 21 / 386 / 820, 20 / 21 / 495, 21 / 299 / 322 / 495 / 566 / 820, 20 / 21 / 299 / 495, 756, 386 / 820, 495, 511, 21 / 52 / 242 / 386 / 495 / 820, 299 / 476 / 495, 706, 21 / 299 / 386 / 476 / 495, 21 / 299 / 322 / 495, 21 / 476 / 849, 29 9 / 322 / 476 / 820, 21 / 52 / 299 / 322 / 820, 20 / 21 / 566, 20 / 52, 322 / 386 / 495 / 566 / 820, 21 / 299, 21 / 299 / 386, 386 / 849, 52 / 476, 52 / 299 / 322 / 386 / 495, 440 or a combination thereof, where the amino acid positions are relative to the reference sequence of SEQ ID NO: 606.

[0033] In some embodiments, the engineered DNA polymerase comprises a polypeptide sequence that includes a substitution or set of substitutions provided in Tables 4.1, 5.1, 6.1, 7.1 and 8.1, where the substitution or set of substitutions is compared to a reference sequence of SEQ ID NO: 2, 8, 332, 462 or 606.

[0034] In some embodiments, the DNA polymerase comprises a reference sequence that includes residues 12-850 of at least one engineered DNA polymerase variant set forth in Tables 4.1, 5.1, 6.1, 7.1, and 8.1, or a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence of at least one engineered variant set forth in Tables 4.1, 5.1, 6.1, 7.1, and 8.1.

[0035] In some embodiments, the engineered DNA polymerase comprises a polypeptide sequence comprising residues 12-850 of a sequence selected from the even-numbered sequences of SEQ ID NOs: 4-770, wherein the polypeptide optionally has 1, 2, 3, 4, 5, 6, 7, 8, 9 or up to 10 substitutions in the polypeptide sequence.

[0036] In some embodiments, the engineered DNA polymerase comprises a polypeptide sequence comprising a sequence selected from the even numbered sequences of SEQ ID NOs: 4-770, and the polypeptide optionally has 1, 2, 3, 4, 5, 6, 7, 8, 9 or up to 10 substitutions in the polypeptide sequence.

[0037] In some embodiments, the engineered DNA polymerase comprises a polypeptide sequence comprising a sequence comprising residues 12 to 850 of SEQ ID NO: 8, 332, 462, or 606, or a sequence comprising SEQ ID NO: 8, 332, 462, or 606.

[0038] In some embodiments, the engineered DNA polymerase has DNA polymerase activity. In some embodiments, the engineered DNA polymerase has at least one improved property compared to a reference DNA polymerase. In some embodiments, the engineered DNA polymerase exhibits increased activity or produces a higher product yield in a polymerase chain reaction compared to a reference DNA polymerase. In some embodiments, the engineered DNA polymerase exhibits increased fidelity compared to a reference DNA polymerase. In some embodiments, the engineered DNA polymerase exhibits increased thermostability compared to a reference DNA polymerase. In some embodiments, the engineered DNA polymerase exhibits increased processivity over a comparative control DNA polymerase. In some embodiments, the reference or comparative control DNA polymerase is a DNA polymerase having a sequence corresponding to residues 12-850 of SEQ ID NO: 2, 8, 332, 462 or 606; or a DNA polymerase having a sequence corresponding to SEQ ID NO: 2, 8, 332, 462 or 606. In some embodiments, the reference or control DNA polymerase is a DNA polymerase having a sequence corresponding to residues 12-850 of SEQ ID NO: 2; or a DNA polymerase having a sequence corresponding to SEQ ID NO: 2. In some embodiments, the reference or control DNA polymerase is a wild-type DNA polymerase selected from Pfu DNA polymerase from Pyrococcus furiosus, Group B DNA polymerase from Thermococcus sp. strain 2319x1, and Taq DNA polymerase from Thermus aquaticus.

[0039] In some further embodiments, the engineered DNA polymerase is purified. In some embodiments, the engineered DNA polymerase is provided in solution or immobilized on the surface of a substrate, such as a solid substrate or a membrane or particle.

[0040] In another aspect, the disclosure provides a recombinant polynucleotide encoding any of the engineered DNA polymerases disclosed herein. In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase or a functional fragment thereof comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:2, 8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO:2, 8, 332, 462 or 606, wherein the polypeptide sequence comprises one or more substitutions compared to the reference sequence corresponding to residues 12-850 of SEQ ID NO:2, 8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO:2, 8, 332, 462 or 606.

[0041] In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase or a functional fragment thereof comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:2 or a reference sequence corresponding to SEQ ID NO:2, as described above and herein, wherein the polypeptide sequence comprises one or more substitutions compared to the reference sequence corresponding to residues 12-850 of SEQ ID NO:2 or a reference sequence corresponding to SEQ ID NO:2.

[0042] In some embodiments, the recombinant polynucleotide comprises a reference polynucleotide sequence corresponding to nucleotide residues 34-2550 of SEQ ID NO: 1, 5, 21, 23, 25, 27, or 823, or a sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to SEQ ID NO: 1, 5, 21, 23, 25, 27, or 823, and the polynucleotide encodes an engineered DNA polymerase. In some embodiments, the recombinant polynucleotide comprises a sequence comprising nucleotide residues 34-2550 of SEQ ID NO: 1, 5, 21, 23, 25, 27, or 823. In some embodiments, the recombinant polynucleotide comprises a sequence comprising SEQ ID NO: 1, 5, 21, 23, 25, 27, or 823.

[0043] In some embodiments, the recombinant polynucleotide comprises a sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to nucleotide residues 34-2550 of an odd-numbered polynucleotide sequence selected from SEQ ID NOs: 3-769, and wherein the polynucleotide encodes an engineered DNA polymerase. In some embodiments, the recombinant polynucleotide comprises a sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to an odd-numbered polynucleotide sequence selected from SEQ ID NOs: 3-769, and the polynucleotide encodes an engineered DNA polymerase.

[0044] In some embodiments, the recombinant polynucleotide comprises a sequence comprising nucleotide residues 34-2550 of an odd-numbered polynucleotide sequence selected from SEQ ID NOs: 3-769. In some embodiments, the recombinant polynucleotide comprises a sequence comprising an odd-numbered polynucleotide sequence selected from SEQ ID NOs: 3-769.

[0045] In some embodiments, the polynucleotide sequence is codon optimized for expression in an organism, such as a bacterial cell or a mammalian cell. In some embodiments, the polynucleotide sequence is operably linked to a regulatory sequence.

[0046] In a further aspect, the present disclosure provides an expression vector comprising at least one polynucleotide sequence provided herein that encodes an engineered DNA polymerase. In some embodiments, the recombinant polynucleotide that encodes the engineered DNA polymerase is operable linked to a control sequence. In some embodiments, the control sequence comprises a promoter.

[0047] In a further aspect, the present disclosure also provides a host cell transformed by at least one recombinant polynucleotide or expression vector provided herein.In some embodiments, the host cell is a prokaryotic cell or a eukaryotic cell.In some embodiments, the host cell is a bacterial cell, a fungal cell or a mammalian cell.In some embodiments, the host cell is a bacterial cell, such as E. coli or B. subtilis.

[0048] In another aspect, the disclosure provides a method of producing an engineered DNA polymerase polypeptide in a host cell, comprising culturing a host cell provided herein under suitable culture conditions such that at least one engineered DNA polymerase is produced. In some embodiments, the method further comprises recovering the engineered DNA polymerase from the culture and / or the host cell. In some embodiments, the method further comprises purifying the engineered DNA polymerase.

[0049] In another aspect, the present disclosure provides a composition comprising at least one engineered DNA polymerase disclosed herein.In some embodiments, the composition comprises at least a buffer.In some embodiments, the composition further comprises one or more DNA polymerase substrates, such as nucleotide substrates and / or oligonucleotide primer substrates.In some embodiments, the composition further comprises a DNA template, such as target DNA.

[0050] In a further aspect, the present disclosure provides the use of an engineered DNA polymerase in a method for preparing a complementary DNA copy of a target DNA, in whole or in part. In some embodiments, the present disclosure provides a method for preparing a complementary DNA copy of a target DNA, in whole or in part, comprising contacting the target DNA with an engineered DNA polymerase described herein in the presence of a suitable substrate and under conditions suitable for DNA polymerase-mediated production of a DNA complementary to the target DNA.

[0051] In some embodiments, the engineered DNA polymerase is used to detect target DNA, and the method includes contacting a sample suspected of containing target DNA with an engineered DNA polymerase of the present disclosure in the presence of a suitable substrate under conditions suitable for DNA polymerase-mediated production of DNA complementary in whole or in part to the target DNA, and detecting the presence of the complementary DNA. In some embodiments, the sample is a biological sample. In some embodiments, detecting the complementary DNA is by amplifying the complementary DNA, such as by polymerase chain reaction (PCR) or LAMP. In some embodiments, the engineered DNA polymerase can be used with reverse transcriptase to detect target RNA, such as by RT-PCR.

[0052] In a further aspect, the present disclosure also provides a kit comprising at least one engineered DNA polymerase disclosed herein.In some embodiments, the kit can further comprise one or more of a buffer, a nucleotide substrate and / or an oligonucleotide primer substrate.In some embodiments, the kit further comprises a template DNA.In some embodiments, the kit can comprise a second DNA polymerase, for example, another thermostable DNA polymerase or a reverse transcriptase. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0053] Detailed Description The present disclosure provides engineered DNA polymerase polypeptides and compositions thereof, as well as polynucleotides encoding engineered DNA polymerase polypeptides.The present disclosure also provides methods for the use of engineered DNA polymerase polypeptides and compositions thereof for diagnostic and other purposes.In some embodiments, engineered DNA polymerase polypeptides provide enhanced polymerization activity, high replication fidelity and / or high processivity, particularly under conditions involving low DNA input concentrations, high throughput analysis and / or sequencing reaction conditions.

[0054] In some embodiments, the engineered DNA polymerases of the present disclosure find use in diagnostic and research applications using small amounts of DNA from samples, including cell-free DNA, circulating tumor DNA, DNA isolated from circulating tumor cells, circulating fetal DNA, virus-infected cells, fine needle aspirates, or DNA isolated from single cells isolated by FACS (fluorescence-activated cell sorting), laser capture microscopy, or microfluidic devices. However, it is not intended that the samples used in the present invention be limited to any particular sample type, as any suitable sample, including samples with low DNA concentrations, find use in the present invention. Abbreviations and Definitions

[0055] Unless otherwise defined, all technical and scientific terms used herein generally have the same meaning as commonly understood by those skilled in the art to which this invention belongs. In general, the nomenclature used herein and the laboratory procedures of cell culture, molecular genetics, microbiology, organic chemistry, analytical chemistry and nucleic acid chemistry described below are well known and commonly used in the art. Such techniques are well known and described in numerous texts and references well known to those skilled in the art. Standard techniques or modifications thereof are used for chemical synthesis and chemical analysis.

[0056] Any suitable method and material similar or equivalent to the methods and materials described herein will find use in the practice of the present invention, and some methods and materials are described herein.It should be understood that the present invention is not limited to the specific methodology, protocols and reagents described, since the methodology, protocols and reagents may vary according to the context in which they are used by those skilled in the art.Therefore, the terms defined immediately below are more fully explained by referring to this application as a whole.All patents, patent applications, papers and publications mentioned herein, both above and below, are hereby expressly incorporated by reference herein.

[0057] As used herein, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise.

[0058] As used herein, the term "comprising" and its cognates are used in their inclusive sense (i.e., equivalent to the term "including" and its corresponding cognates).

[0059] It should be further understood that where the description of an embodiment uses the term "comprising" and its cognates, the embodiment may also be described using the words "consisting essentially of" or "consisting of."

[0060] Numeric ranges are inclusive of the numbers defining the range. Thus, every numerical range disclosed herein is intended to include every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly written herein. Every maximum (or minimum) numerical limit disclosed herein is also intended to include every lower (or higher) numerical limit, as if such lower (or higher) numerical limit was expressly written herein.

[0061] As used herein, the term "about" refers to an acceptable error for a particular value. In some instances, "about" refers to within 0.05%, 0.5%, 1.0%, or 2.0% of a given value range. In some instances, "about" refers to within 1, 2, 3, or 4 standard deviations of a given value.

[0062] Moreover, the headings provided herein are not limitations of the various aspects or embodiments of the invention which can be had by reference to this application as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to this application as a whole. Nonetheless, to facilitate understanding of the invention, a number of terms are defined below.

[0063] Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively.

[0064] As used herein, "EC" numbers refer to the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology (NC-IUBMB) enzyme nomenclature. The IUBMB biochemical classification is a numerical classification system for enzymes based on the chemical reaction they catalyze.

[0065] As used herein, "ATCC" refers to the American Type Culture Collection, whose biorepository collection includes genes and strains.

[0066] As used herein, "NCBI" refers to the National Center for Biological Information and the sequence databases provided therein.

[0067] As used herein, the term "DNA" refers to deoxyribonucleic acid.

[0068] As used herein, the term "RNA" refers to ribonucleic acid.

[0069] As used herein, the terms "fusion protein" and "chimeric protein" and "chimera" refer to a hybrid protein created by the joining of two or more genes that originally encoded separate proteins. In some embodiments, the fusion protein is created by recombinant techniques (e.g., molecular biology techniques known in the art).

[0070] As used herein, the term "polymerase" refers to a class of enzymes that polymerize nucleoside triphosphates. Polymerases use a template nucleic acid strand to synthesize a complementary nucleic acid strand. The template strand and the synthesized nucleic acid strand can be either DNA or RNA, independently. Polymerases known in the art include, but are not limited to, DNA polymerases (e.g., E. coli DNA polI, T. aquaticus DNA polymerase (Taq), DNA-dependent RNA polymerase, and reverse transcriptase). As used herein, a polymerase is a polypeptide or protein that contains sufficient amino acids to perform the desired enzymatic functions of the polymerase. In some embodiments, the polymerase does not contain all of the amino acids found in the native enzyme, but only contains sufficient amino acids to enable the polymerase to perform the desired catalytic activities, including, but not limited to, 5'-3' polymerization, 5'-3' exonuclease, and 3'-5' exonuclease activities.

[0071] As used herein, the terms "DNA polymerase activity," "synthetic activity," and "polymerase activity" are used interchangeably herein and refer to the ability of an enzyme to synthesize new DNA strands by incorporation of deoxynucleoside triphosphates.

[0072] As used herein, the terms "duplex" and "ds" refer to a double-stranded nucleic acid (e.g., DNA) molecule composed of two single-stranded polynucleotides whose sequences are complementary (A pairs with T and C pairs with G), arranged in an antiparallel 5' to 3' orientation, and held together by hydrogen bonds between the nucleobases (i.e., adenine [A], guanine [G], cytosine [C], and thymine [T]).

[0073] As used herein, the terms "protein," "polypeptide," and "peptide" are used interchangeably to refer to a polymer of at least two amino acids covalently linked by amide bonds, regardless of length or post-translational modification (e.g., glycosylation or phosphorylation).

[0074] As used herein, the term "amino acid" may be referred to herein by either its commonly known three letter symbol or the one-letter symbol recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Similarly, nucleotides may be referred to by their commonly accepted single-letter codes. Abbreviations used for the genetically encoded amino acids are conventional and are as follows: alanine (Ala or A), arginine (Arg or R), asparagine (Asn or N), aspartic acid (Asp or D), cysteine ​​(Cys or C), glutamic acid (Glu or E), glutamine (Gln or Q), glycine (Gly or G), histidine (His or H), isoleucine (Ile or I), leucine (Leu or L), lysine (Lys or K), methionine (Met or M), phenylalanine (Phe or F), proline (Pro or P), serine (Ser or S), threonine (Thr or T), tryptophan (Trp or W), tyrosine (Tyr or Y), and valine (Val or V). When three-letter abbreviations are used, the amino acids are referred to as having an α-carbon (C α) may be in either the L- or D-configuration for the α-carbon. For example, "Ala" designates alanine without specifying the configuration for the α-carbon, while "D-Ala" and "L-Ala" designate D-alanine and L-alanine, respectively. When single-letter abbreviations are used, capital letters designate amino acids in the L-configuration for the α-carbon, and lower case letters designate amino acids in the D-configuration for the α-carbon. For example, "A" designates L-alanine and "a" designates D-alanine. When a polypeptide sequence is presented as a series of one-letter or three-letter abbreviations (or mixtures thereof), the sequence is presented in the amino (N) to carboxy (C) direction according to common convention.

[0075] The abbreviations used for the genetically coded nucleosides are conventional and are as follows: adenosine (A); guanosine (G); cytidine (C); thymidine (T); and uridine (U). Unless otherwise specified, the abbreviated nucleoside may be either a ribonucleoside or a 2'-deoxyribonucleoside. Nucleosides can be identified as either ribonucleosides or 2'-deoxyribonucleosides on an individual basis or on an aggregate basis. When a nucleic acid sequence is presented as a series of one-letter abbreviations, the sequence is presented in the 5' to 3' direction according to common convention, with no phosphate indicated.

[0076] As used herein, the terms "engineered," "recombinant," "non-naturally occurring," and "variant," when used with respect to a cell, polynucleotide, or polypeptide, refer to a material or a material that has been modified in a manner that would not otherwise occur in nature, or that corresponds to the natural or native form of the material, which is identical to the natural or native form, but which is produced or obtained from synthetic material and / or produced or obtained by manipulation using recombinant techniques.

[0077] As used herein, "wild-type" and "naturally occurring" refer to a form found in nature. For example, a wild-type polypeptide or polynucleotide sequence is a sequence that can be isolated from a natural source and is present in an organism that has not been intentionally modified by human manipulation.

[0078] As used herein, "coding sequence" refers to a portion of a nucleic acid (eg, a gene) that codes for the amino acid sequence of a protein.

[0079] As used herein, the term "percent (%) sequence identity" refers to a comparison between polynucleotides and polypeptides, and is determined by comparing two optimally aligned sequences over a comparison window, where the portion of the polynucleotide or polypeptide sequence in the comparison window may contain additions or deletions (i.e., gaps) compared to the reference sequence due to the optimal alignment of the two sequences. The percentage can be calculated by determining the number of positions where the same nucleic acid base or amino acid residue is in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. Alternatively, the percentage can be calculated by determining the number of positions where the same nucleic acid base or amino acid residue is in both sequences, or aligning the nucleic acid base or amino acid residue with gaps to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. Those skilled in the art are well aware that there are many established algorithms available for aligning two sequences. Optimal alignment of sequences for comparison can be accomplished, for example, by the Smith and Waterman local homology algorithm (Smith and Waterman, Adv. Appl. Math., 1981, 2:482), the Needleman and Wunsch homology alignment algorithm (Needleman and Wunsch, J. Mol. Biol., 1970, 48:443), the Pearson and Lipman similarity search method (Pearson and Lipman, Proc. Natl. Acad. Sci. USA, 1988, 85:2444), computerized implementations of these algorithms (e.g., GAP, BESTFIT, FASTA and TFASTA in the GCG Wisconsin software package), or by visual inspection, as known in the art.Examples of algorithms suitable for determining percent sequence identity and sequence similarity include, but are not limited to, the BLAST and BLAST 2.0 algorithms (see, e.g., Altschul et al., J. Mol. Biol., 1990, 215:403-410; and Altschul et al., Nucleic Acids Res., 1977, 3389-3402). Software for performing BLAST analysis is publicly available from the National Center for Biotechnology Information website. This algorithm involves first identifying high-scoring sequence pairs (HSPs) by identifying short words of length "W" in a query sequence that match or meet a certain positive threshold score "T" when aligned with words of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds to initiate searches to find longer HSPs that contain them. The word hits are then extended in both directions along each sequence for as far as possible to increase the cumulative alignment score. The cumulative score is calculated using, for nucleotide sequences, the parameters "M" (reward score for a pair of matching residues; always >0) and "N" (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is ​​used to calculate the cumulative score. Extension of the word hits in each direction is stopped when: the cumulative alignment score falls by an amount "X" from its maximum achieved value; the accumulation of one or more negatively scoring residue alignments causes the cumulative score to go to zero or below; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=-4, and a comparison of both strands.For amino acid sequences, the BLASTP program uses as defaults a word length (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see, e.g., Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA, 1989, 89:10915). Exemplary determinations of sequence alignment and percent sequence identity can employ the BESTFIT or GAP programs in the GCG Wisconsin software package (Accelrys, Madison WI) using the default parameters provided.

[0080] As used herein, a "reference sequence" refers to a defined sequence used as a basis for sequence comparison. A reference sequence can be a subset of a larger sequence, for example, a segment of a full-length gene or polypeptide sequence. In general, a reference sequence is at least 20 nucleotides or amino acid residues long, at least 25 residues long, at least 50 residues long, at least 100 residues long, or the entire length of a nucleic acid or polypeptide. Since two polynucleotides or polypeptides each can (1) contain sequences (i.e., portions of the complete sequence) that are similar between the two sequences, and (2) further contain sequences that diverge between the two sequences, sequence comparison between two (or more) polynucleotides or polypeptides is typically performed by comparing the sequences of the two polynucleotides or polypeptides over a "comparison window" to identify and compare local regions of sequence similarity. In some embodiments, a "reference sequence" can be based on a primary amino acid sequence, and the reference sequence is a sequence that can have one or more changes in the primary sequence. For example, the phrase "a reference sequence based on SEQ ID NO:2 having a valine at the residue corresponding to X200" (or "a reference sequence based on SEQ ID NO:2 having a valine at the residue corresponding to position 200") refers to a reference sequence in which the corresponding residue at position X200 in SEQ ID NO:2 (e.g., an alanine) has been changed to a valine.

[0081] As used herein, a "comparison window" refers to a conceptual segment of at least about 20 contiguous nucleotide positions or amino acid residues, where a sequence can be compared to a reference sequence of at least 20 contiguous nucleotides or amino acids, and the portion of the sequence in the comparison window can include 20 percent or less additions or deletions (i.e., gaps) compared to the reference sequence (which contains no additions or deletions) for optimal alignment of the two sequences. The comparison window can be longer than 20 contiguous residues, including windows of 30, 40, 50, 100 or more, as appropriate.

[0082] As used herein, "corresponding to," "with reference to," and "compared to," when used in the context of numbering a given amino acid or polynucleotide sequence, refer to the numbering of residues in a specified reference sequence when the given amino acid or polynucleotide sequence is compared to the reference sequence. In other words, the residue numbers or residue positions of a given polymer are specified with respect to the reference sequence, rather than the actual numerical positions of the residues in the given amino acid or polynucleotide sequence. For example, a given amino acid sequence, such as a sequence of an engineered DNA polymerase, can be aligned with a reference sequence by introducing gaps to optimize the residue match between the two sequences. In such cases, although gaps exist, the numbering of residues in a given amino acid or polynucleotide sequence is done with respect to the reference sequence to which it is aligned. In some embodiments, the sequence is tagged (e.g., with a histidine tag).

[0083] As used herein, a "mutation" refers to an alteration of a nucleic acid sequence. In some embodiments, a mutation results in a change in the encoded polypeptide sequence (i.e., compared to the original sequence without the mutation). In some embodiments, a mutation comprises a substitution such that a different amino acid is produced (e.g., replacement of an aspartic acid with a tryptophan). In some alternative embodiments, a mutation comprises an addition such that an amino acid is added to the original polypeptide sequence. In some further embodiments, a mutation comprises a deletion such that an amino acid is deleted from the original polypeptide sequence. Any number of mutations may be present in a given sequence.

[0084] As used herein, "amino acid difference" and "residue difference" refer to the difference in an amino acid residue at a position of a polypeptide sequence compared to an amino acid residue at a corresponding position in a reference sequence. The position of the amino acid difference is generally referred to herein as "Xn", where n refers to the corresponding position in the reference sequence on which the residue difference is based. For example, "residue difference at position X200 compared to SEQ ID NO:2" (or "residue difference at position 200 compared to SEQ ID NO:2") refers to the difference in the amino acid residue at the polypeptide position corresponding to position 200 of SEQ ID NO:2. Thus, if a reference polypeptide of SEQ ID NO:2 has an alanine at position 200, then "residue difference at position X200 compared to SEQ ID NO:2" refers to an amino acid substitution of any residue other than alanine at the polypeptide position corresponding to position 200 of SEQ ID NO:2. In many examples herein, a specific amino acid residue difference at a position is indicated as "XnY", where "Xn" designates the corresponding residue and position of the reference polypeptide (as described above), and "Y" is a single letter identifier of the amino acid found in the engineered polypeptide (i.e., the residue that differs in the reference polypeptide). In some examples (e.g., in the tables in the Examples), the disclosure also provides specific amino acid differences, designated by the conventional designation "AnB," where A is a single-letter identifier of the residue in the reference sequence, "n" is the number of the residue position in the reference sequence, and B is a single-letter identifier of the residue substitution in the sequence of the engineered polypeptide. In some examples, the polypeptides of the disclosure can include one or more amino acid residue differences compared to the reference sequence, as indicated by a list of designated positions, where the residue differences are present compared to the reference sequence. In some embodiments, when more than one amino acid can be used at a specific residue position of the polypeptide, the various amino acid residues that can be used are separated by " / " (e.g., X15A / X15G, X15A / G, or V15A / G or 15A / G). The disclosure includes engineered polypeptide sequences that include one or more amino acid differences, including either or both conservative and non-conservative amino acid substitutions, as well as insertions and deletions of amino acids in the sequence.

[0085] As used herein, the terms "amino acid substitution set" and "substitution set" refer to a group of amino acid substitutions in a polypeptide sequence. In some embodiments, a substitution set comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more amino acid substitutions. In some embodiments, a substitution set refers to a set of amino acid substitutions present in any of the variant DNA polymerase polypeptides listed in any of the tables in the examples. In these substitution sets, each substitution is separated by a semicolon (";"; e.g., V15G; L20A; F21K) or a slash (" / "; e.g., V15G / L20A / F21K or 15G / 20A / 21K). In some embodiments, a "substitution" comprises an amino acid deletion.

[0086] As used herein, "conservative amino acid substitution" refers to the replacement of a residue with a different residue that has a similar side chain, and thus typically involves the replacement of an amino acid in a polypeptide with an amino acid within the same or similar defined class of amino acids.As an example, but not by way of limitation, an amino acid with an aliphatic side chain can be replaced with another aliphatic amino acid (e.g., alanine, valine, leucine and isoleucine); an amino acid with a hydroxyl side chain can be replaced with another amino acid with a hydroxyl side chain (e.g., serine and threonine); an amino acid with an aromatic side chain can be replaced with another amino acid with an aromatic side chain (e.g., phenylalanine, tyrosine, tryptophan and histidine); an amino acid with a basic side chain can be replaced with another amino acid with a basic side chain (e.g., lysine and arginine); an amino acid with an acidic side chain can be replaced with another amino acid with an acidic side chain (e.g., aspartic acid or glutamic acid); a hydrophobic or hydrophilic amino acid can be replaced with another hydrophobic or hydrophilic amino acid, respectively.

[0087] As used herein, "non-conservative substitution" refers to the replacement of an amino acid in a polypeptide with an amino acid having significantly different side chain properties. Non-conservative substitutions can use amino acids between defined groups rather than within defined groups, and can affect (a) the structure of the peptide backbone in the area of ​​the substitution (e.g., proline for glycine); (b) charge or hydrophobicity; and / or (c) the bulk of the side chain. By way of example and not limitation, exemplary non-conservative substitutions include an acidic amino acid replaced with a basic or aliphatic amino acid; an aromatic amino acid replaced with a small amino acid; and a hydrophilic amino acid replaced with a hydrophobic amino acid.

[0088] As used herein, "deletion" refers to a modification to a polypeptide by removal of one or more amino acids from a reference polypeptide. Deletion can include removal of one or more amino acids, two or more amino acids, five or more amino acids, ten or more amino acids, fifteen or more amino acids, or twenty or more amino acids, up to 10% of the total number of amino acids that make up the reference enzyme, or up to 20% of the total number of amino acids, while retaining the enzymatic activity and / or improving properties of the engineered polymerase enzyme. Deletion can be directed to the internal and / or terminal parts of the polypeptide. In various embodiments, deletion can include a contiguous segment or can be non-contiguous. Deletion is indicated by "-" and can be present in the substitution set.

[0089] As used herein, "insertion" refers to a modification to a polypeptide by the addition of one or more amino acids from a reference polypeptide. Insertions can be made in the internal portion of a polypeptide or at the carboxy or amino terminus. Insertions, as used herein, include fusion proteins, as known in the art. Insertions can be contiguous segments of amino acids, or can be separated by one or more of the amino acids in a naturally occurring polypeptide.

[0090] As used herein, "functional fragment" and "biologically active fragment" are used interchangeably herein to refer to a polypeptide that has an amino-terminal and / or carboxy-terminal deletion(s) and / or an internal deletion, but where the remaining amino acid sequence is identical to the corresponding positions in the sequence to which it is being compared (e.g., a full-length engineered DNA polymerase of the invention) and retains substantially all of the activity of the full-length polypeptide.

[0091] As used herein, an "isolated polypeptide" refers to a polypeptide that is substantially separated from other contaminants (e.g., proteins, lipids, and polynucleotides) that naturally accompany it. The term encompasses a polypeptide that has been removed or purified from its naturally occurring environment or expression system (e.g., a host cell or in vitro synthesis). A recombinant DNA polymerase polypeptide may be present within a cell, in a cell culture medium, or prepared in various forms, such as a lysate or isolated preparation. Thus, in some embodiments, the recombinant DNA polymerase polypeptide provided herein is an isolated polypeptide.

[0092] As used herein, "substantially pure polypeptide" refers to a composition in which the polypeptide species is the predominant species present (i.e., more abundant than any other individual macromolecular species in the composition, on a molar or weight basis), and is generally a substantially purified composition when the species of interest constitutes at least about 50 percent of the macromolecular species present, on a molar or percent weight basis. Generally, a substantially pure DNA polymerase composition constitutes about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 95% or more, and about 98% or more of the total macromolecular species present in the composition, on a molar or percent weight basis. In some embodiments, the species of interest is purified to essential homogeneity (i.e., contaminant species cannot be detected in the composition by conventional detection methods), and the composition consists essentially of a single macromolecular species. Solvent species, small molecules (<500 Daltons), and elemental ion species are not considered macromolecular species. In some embodiments, an isolated recombinant DNA polymerase polypeptide is a substantially pure polypeptide composition.

[0093] As used herein, "improved enzymatic properties" refers to an engineered DNA polymerase polypeptide that exhibits an improvement in any enzymatic property compared to a reference DNA polymerase polypeptide, e.g., a wild-type DNA polymerase polypeptide (e.g., a wild-type DNA polymerase polypeptide sequence of residues 12-850 of SEQ ID NO:2) or another engineered DNA polymerase polypeptide. Improved properties include, but are not limited to, properties such as increased protein expression, increased thermal activity, increased thermostability, increased stability, increased enzymatic activity, increased substrate specificity and / or affinity, increased specific activity, increased resistance to substrate and / or end-product inhibition, increased chemical stability, improved chemical selectivity, improved solvent stability, increased resistance to acidic pH, increased resistance to proteolytic activity (i.e., reduced susceptibility to proteolysis), increased solubility, increased fidelity, increased processivity, and altered temperature profile.

[0094] As used herein, "increased enzymatic activity" and "enhanced catalytic activity" refer to improved properties of an engineered DNA polymerase polypeptide, which can be represented by an increase in specific activity (e.g., product produced / time / weight of protein) and / or an increase in percent conversion of substrate to product (e.g., percent conversion of starting amount of substrate to product in a specified period of time using a specified amount of DNA polymerase) compared to a reference DNA polymerase (e.g., a wild-type DNA polymerase and / or another engineered DNA polymerase). Exemplary methods for determining enzymatic activity are provided in the Examples. The K, changes which may result in increased enzymatic activity, m , V max or k cat Any property related to the enzymatic activity can be affected, including the classical enzymatic properties of the enzyme. The improvement in enzymatic activity can be as much as about 1.1-fold the enzymatic activity of the corresponding wild-type enzyme, up to 2-fold, 5-fold, 10-fold, 20-fold, 25-fold, 50-fold, 75-fold, 100-fold, 150-fold, 200-fold or more enzymatic activity of the naturally occurring DNA polymerase or another engineered DNA polymerase from which the DNA polymerase polypeptide is derived.

[0095] As used herein, the terms "proteolytic activity" and "proteolysis", which are used interchangeably herein, refer to the breakdown of proteins into smaller polypeptides or amino acids. Protein breakdown is generally the result of hydrolysis of peptide bonds by protease (proteinase) enzymes. Protease enzymes include, but are not limited to, pepsin, trypsin, chymotrypsin, elastase; carboxypeptidase A and B, and peptidases (e.g., aminopeptidase, dipeptidase, and enteropeptidase).

[0096] As used herein, the phrases "reduced susceptibility to proteolysis" and "reduced proteolytic susceptibility" are used interchangeably herein and mean that an engineered DNA polymerase polypeptide according to the invention has higher enzymatic activity in a standard assay (e.g., as disclosed in the Examples) compared to a reference DNA polymerase after treatment with one or more proteases.

[0097] As used herein, "conversion" refers to the enzymatic conversion (or biotransformation) of a substrate(s) to the corresponding product(s). "Percent conversion" refers to the percent of a substrate that is converted to a product under specified conditions in a given period of time. Thus, the "enzymatic activity" or "activity" of a DNA polymerase polypeptide can be expressed as the "percent conversion" of substrate to product in a particular period of time.

[0098] As used herein, "hybridization stringency" refers to hybridization conditions, such as washing conditions, in the hybridization of nucleic acids. Generally, hybridization reactions are performed under conditions of lower stringency, followed by washing of various but higher stringency. The term "moderately stringent hybridization" refers to conditions that allow the target DNA to bind to a complementary nucleic acid having about 60% identity to the target DNA, preferably about 75% identity, about 85% identity, and more than about 90% identity to the target polynucleotide. Exemplary moderately stringent conditions are conditions equivalent to hybridization in 50% formamide, 5x Denhart's solution, 5x SSPE, 0.2% SDS at 42°C, followed by washing in 0.2x SSPE, 0.2% SDS at 42°C. "High stringency hybridization" refers to a condition that is higher than the thermal melting temperature T determined under solution conditions of a defined polynucleotide sequence. mGenerally, high stringency conditions refer to conditions that are about 10°C or less from 0.018M NaCl at 65°C. In some embodiments, high stringency conditions refer to conditions that allow hybridization of only those nucleic acid sequences that form stable hybrids at 0.018M NaCl at 65°C (i.e., as contemplated herein, a hybrid is not stable under high stringency conditions unless it is stable at 0.018M NaCl at 65°C). For example, high stringency conditions can be provided by hybridization at 42°C in conditions equivalent to 50% formamide, 5x Denhart's solution, 5x SSPE, 0.2% SDS, followed by washing at 65°C in 0.1x SSPE and 0.1% SDS. Another high stringency condition includes hybridization at 5x SSC containing 0.1% (w:v) SDS at 65°C, and washing at 0.1x SSC containing 0.1% SDS at 65°C. Moderately stringent conditions, as well as other highly stringent hybridization conditions, are described in the references cited above.

[0099] As used herein, "codon-optimized" refers to the change of codons in a polynucleotide encoding a protein to those preferentially used in a particular organism, such that the encoded protein is more efficiently expressed in that organism. Although the genetic code is degenerate in that most amino acids are represented by a few codons, called "synonymous" or "synonymous" codons, it is well known that codon usage by a particular organism is non-random and biased toward certain codon triplets. This codon usage bias can be higher when referring to a given gene, genes of common function or ancestral origin, highly expressed proteins versus low copy number proteins, and assembled protein coding regions of an organism's genome. In some embodiments, a polynucleotide encoding a DNA polymerase is codon-optimized for optimal production from the host organism selected for expression.

[0100] As used herein, "control sequence" refers herein to include any component necessary or advantageous for the expression of the polynucleotide and / or polypeptide of the present disclosure. Each control sequence may be native or foreign to the nucleic acid sequence encoding the polypeptide. Such control sequences include, but are not limited to, a leader, a polyadenylation sequence, a propeptide sequence, a promoter sequence, a signal peptide sequence, an initiation sequence, and a transcription terminator. At a minimum, the control sequence includes a promoter, and a transcription and translation termination signal. In some embodiments, the control sequence is provided with a linker for the purpose of introducing a specific restriction site that facilitates ligation of the control sequence with the coding region of the nucleic acid sequence encoding the polypeptide.

[0101] As used herein, "operably linked" refers to a configuration in which a control sequence is suitably positioned relative to a polynucleotide of interest (i.e., in a functional relationship) such that the control sequence directs or regulates expression of the polynucleotide encoding a polypeptide of interest.

[0102] As used herein, "promoter sequence" refers to a nucleic acid sequence recognized by a host cell for expression of a polynucleotide of interest, such as a coding sequence. The promoter sequence contains transcriptional control sequences that mediate expression of the polynucleotide of interest. The promoter can be any nucleic acid sequence that exhibits transcriptional activity in a selected host cell, including mutant, truncated and hybrid promoters, and can be derived from a gene encoding an extracellular or intracellular polypeptide that is either homologous or heterologous to the host cell.

[0103] As used herein, "suitable reaction conditions" or "suitable conditions" refers to conditions in an enzyme conversion reaction solution (e.g., ranges of enzyme loading, substrate loading, temperature, pH, buffers, co-solvents, etc.) under which a DNA polymerase polypeptide of the disclosure can convert a substrate into a desired product compound. Exemplary "suitable reaction conditions" are provided herein (see Examples).

[0104] As used herein, "loading," as in "compound loading" or "enzyme loading," refers to the concentration or amount of a component in a reaction mixture at the start of the reaction. "Substrate," in the context of an enzymatic conversion reaction process, refers to a compound or molecule that is acted upon by a DNA polymerase polypeptide.

[0105] As used herein, "product" in the context of an enzymatic conversion process refers to a compound or molecule that results from the action of a DNA polymerase polypeptide on a template, e.g., substrate.

[0106] As used herein, "culturing" refers to growing a population of microbial cells under appropriate conditions using any suitable medium (e.g., liquid, gel, or solid).

[0107] Recombinant polypeptides (e.g., DNA polymerase variants) can be produced using any suitable method known in the art. For example, there are a wide variety of different mutagenesis techniques well known to those skilled in the art. In addition, mutagenesis kits are also available from many commercial molecular biology suppliers. Methods are available for making specific substitutions at defined amino acids (site-specific), specific or random mutations in localized regions of genes (position-specific), or random mutagenesis throughout genes (e.g., saturation mutagenesis). Many suitable methods for generating enzyme variants are known to those skilled in the art, including, but not limited to, site-specific mutagenesis of single-stranded or double-stranded DNA using PCR, cassette mutagenesis, gene synthesis, error-prone PCR, shuffling and chemical saturation mutagenesis, or any other suitable method known in the art. Non-limiting examples of methods used for DNA and protein engineering are provided in the following patents: U.S. Patent No. 6,117,679; U.S. Patent No. 6,420,175; U.S. Patent No. 6,376,246; U.S. Patent No. 6,586,182; U.S. Patent No. 7,747,391; U.S. Patent No. 7,747,393; U.S. Patent No. 7,783,428; and U.S. Patent No. 8,383,346. Once produced, variants can be screened for any desired properties (e.g., high or increased activity or low or reduced activity, increased thermal activity, increased thermal stability, and / or acidic pH stability, etc.). In some embodiments, "recombinant DNA polymerase polypeptides" (also referred to herein as "engineered DNA polymerase polypeptides," "engineered DNA polymerases," "variant DNA polymerases," and "DNA polymerase variants") find use.

[0108] As used herein, a "vector" is a DNA construct for introducing a DNA sequence into a cell. In some embodiments, the vector is an expression vector that is operably linked to a suitable control sequence that can cause the expression of the polypeptide encoded in the DNA sequence in a suitable host. In some embodiments, an "expression vector" has a promoter sequence operably linked to a DNA sequence (e.g., a transgene) to drive expression in a host cell, and in some embodiments, also includes a transcription terminator sequence.

[0109] As used herein, the term "expression" includes any step involved in the production of a polypeptide, including, but not limited to, transcription, post-transcriptional modification, translation, and post-translational modification. In some embodiments, the term also encompasses secretion of the polypeptide from the cell.

[0110] As used herein, the term "produce" refers to the production of a protein and / or other compound by a cell. It is intended that the term encompass any step involved in the production of a polypeptide, including, but not limited to, transcription, post-transcriptional modification, translation, and post-translational modification. In some embodiments, the term also encompasses the secretion of a polypeptide from a cell.

[0111] As used herein, an amino acid or nucleotide sequence (e.g., a promoter sequence, signal peptide, terminator sequence, etc.) is "heterologous" to another sequence to which it is operably linked if the two sequences are not associated in nature.

[0112] As used herein, the terms "host cell" and "host strain" refer to a suitable host for an expression vector comprising the DNA provided herein (e.g., a polynucleotide sequence encoding at least one DNA polymerase variant). In some embodiments, a host cell is a prokaryotic or eukaryotic cell that is transformed or transfected with a vector constructed using recombinant DNA techniques known in the art.

[0113] As used herein, the term "analog" refers to a polypeptide having more than 70% sequence identity but less than 100% sequence identity (e.g., more than 75%, 78%, 80%, 83%, 85%, 88%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity) with a reference polypeptide. In some embodiments, an analog comprises non-naturally occurring amino acid residues, including but not limited to homoarginine, ornithine, and norvaline, as well as naturally occurring amino acids. In some embodiments, an analog also comprises one or more D-amino acid residues, and non-peptide bonds between two or more amino acid residues.

[0114] As used herein, the term "effective amount" means an amount sufficient to produce a desired result. Those of ordinary skill in the art can determine the effective amount using routine experimentation.

[0115] The terms "isolated" and "purified" are used to refer to a molecule (e.g., an isolated nucleic acid, polypeptide, etc.) or other component that has been removed from at least one other component with which it is naturally associated. The term "purified" does not require absolute purity, but rather is intended as a relative definition.

[0116] As used herein, "cell-free DNA" refers to DNA that is freely circulating in the bloodstream and is not contained in or associated with cells. In some embodiments, cell-free DNA includes DNA originally obtained and released from normal somatic or germline cells, cancer cells, fetal cells, microbial cells, or viruses.

[0117] As used herein, "amplification" refers to nucleic acid replication. In some embodiments, the term refers to the replication of a specific template nucleic acid.

[0118] As used herein, "polymerase chain reaction" and "PCR" refer to the methods described in U.S. Patent Nos. 4,683,195 and 4,6884,202, which are hereby incorporated by reference. Such methods find use in increasing the concentration of a segment of a target sequence or the entire target sequence in a mixture or purified DNA, without requiring cloning or purification. A series of denaturation, annealing and extension constitutes a "cycle." The steps of denaturation, primer annealing and polymerase extension can be repeated many times (i.e., multiple cycles are used) to obtain a high concentration of amplified DNA. The process is well known in the art, and many variations have been developed over the years since the method was first described. PCR allows the synthesis of a single copy of a specific target sequence by hybridization with a labeled probe, incorporation of a biotinylated primer followed by avidin-enzyme conjugate detection, and binding to the amplified segment. 32 It can be amplified to detectable levels by several different methodologies, including but not limited to, incorporation of P-labeled deoxyribonucleotide triphosphates (e.g., dCTP or dATP). In addition to genomic DNA, any oligonucleotide sequence suitable for amplification can be copied using PCR with an appropriate set of primers. The PCR product can also serve as a template for amplification.

[0119] As used herein, "target" refers to a region of nucleic acid for the preparation of complementary DNA when used in reference to a method using DNA polymerase. "Target" is selected from other nucleic acids present in a method using DNA polymerase. In some embodiments, "segment" is a region of nucleic acid within a target sequence.

[0120] As used herein, "target DNA," when used in the context of a DNA polymerase, refers to a DNA, all or a portion thereof, that is the target for the preparation of a complementary DNA copy. The target DNA can be the entire DNA sequence, or a portion thereof, e.g., a segment of a DNA sequence.

[0121] As used herein, "target RNA" refers to an RNA, all or a portion thereof, that is the target for the preparation of a complementary DNA copy. The target RNA can be the entire RNA sequence, or a portion thereof, for example, a segment of the RNA sequence.

[0122] As used herein, "sample template" refers to nucleic acid originating from a sample that is analyzed for the presence of target nucleic acid. In contrast, "background template" refers to nucleic acid other than the sample template that may or may not be present in the sample. Background template may be accidentally included in the sample, which may be due to carryover contamination, or may be due to the presence of nucleic acid contaminants from which the target nucleic acid is purified. For example, in some embodiments, nucleic acid from organisms other than those to be detected may be present as background in the test sample. However, it is not intended that the present invention be limited to any particular nucleic acid sample or template.

[0123] As used herein, "amplifiable nucleic acid" is used in reference to a nucleic acid that can be amplified by any amplification method, including but not limited to PCR. In most embodiments, the amplifiable nucleic acid comprises a sample template.

[0124] As used herein, "PCR product," "PCR fragment," and "amplification product" refer to the resulting compounds obtained after two or more cycles of PCR amplification (or other amplification methods as indicated by the context), which typically include the steps of denaturation, annealing, and extension. The terms encompass situations where there has been amplification of one or more segments of one or more target sequences.

[0125] As used herein, "amplification reagents" and "PCR reagents" refer to the reagents needed for amplification (e.g., deoxyribonucleotide triphosphates, buffers, etc.) excluding primers, nucleic acid template, and amplification enzymes. Typically, amplification reagents, along with other reaction components, are placed and contained within a reaction vessel (e.g., test tube, microwell, etc.). It is not intended that the present invention be limited to any particular amplification reagents, as any suitable reagents will find use in the present invention.

[0126] As used herein, a "primer" refers to an oligonucleotide (i.e., a sequence of nucleotides), whether naturally occurring or produced synthetically, recombinantly, or by amplification, that can act as an initiation point for nucleic acid synthesis when placed under conditions that induce synthesis of a primer extension product complementary to the nucleic acid strand (i.e., in the presence of nucleotides and an inducing agent, e.g., DNA polymerase, and at a suitable temperature and pH). In most embodiments, primers are single-stranded, but in some embodiments, they are double-stranded. In some embodiments, the primer is of sufficient length to prime the synthesis of an extension product in the presence of a DNA polymerase. The exact length of the primer depends on many factors, as known to those of skill in the art.

[0127] As used herein, "probe" refers to an oligonucleotide (i.e., a sequence of nucleotides) capable of hybridizing to another oligonucleotide of interest, whether naturally occurring or produced synthetically, recombinantly, or by amplification. Probes find use in the detection, identification, and / or isolation of a particular gene sequence of interest. In some embodiments, the probe is labeled with a "reporter molecule" (also referred to as a "label") that aids in the detection of the probe in a suitable detection system (e.g., fluorescent, radioactive, luminescent, enzymatic, and other systems). It is not intended that the present invention be limited to any particular detection system or label. Primers, deoxyribonucleotides, and deoxyribonucleosides can contain labels. Indeed, it is not intended that the labeled compositions of the present invention be limited to any particular components. Illustrative labels include: 32 P, 35 and fluorescent molecules (e.g., fluorescent dyes, including but not limited to, green fluorescent protein).

[0128] As used herein, "fidelity" when used with reference to a polymerase is intended to refer to the accuracy of template-directed incorporation of complementary bases in a synthesized DNA strand compared to a template strand. Typically, fidelity is measured based on the frequency of incorporation of incorrect bases in a newly synthesized nucleic acid strand. Incorporation of incorrect bases can result in point mutations, insertions or deletions. Fidelity can be calculated according to any method known in the art (see, for example, Tindall and Kunkel, Biochem., 1988, 27:6008-6013; and Barnes, Gene,1992, 112:29-35). A polymerase or polymerase variant can exhibit either high fidelity or low fidelity. As used herein, "high fidelity" refers to a polymerase that has a frequency of correct base incorporation that exceeds a predetermined value. As used herein, the term "low fidelity" refers to a polymerase that has a frequency of correct base incorporation that is lower than a predetermined value. In some embodiments, the predetermined value is a desired frequency or fidelity of correct base incorporation of a known polymerase (i.e., a reference polymerase).

[0129] As used herein, "altered fidelity" refers to a fidelity of a polymerase variant that is different from that of the parent polymerase from which the polymerase variant is derived. In some embodiments, the altered fidelity is higher than that of the parent polymerase, while in some other embodiments, the altered fidelity is lower than that of the parent polymerase. The altered fidelity can be determined by assaying the parent and variant polymerases and comparing their activities using any suitable assay known in the art.

[0130] As used herein, the term "processivity" refers to the ability of a nucleic acid modifying enzyme, such as a DNA polymerase, to remain bound to a template or substrate and carry out multiple modification reactions. Processivity is generally measured by the number of catalytic events that occur per binding event.

[0131] As used herein, "altered processivity" refers to a processivity of a polymerase or variant thereof that differs from that of the parent polymerase from which the variant is derived. In some embodiments, the altered processivity is higher than that of the parent enzyme, while in some other embodiments, the altered processivity is lower than that of the parent enzyme. Altered processivity can be determined by assaying the parent and variant enzymes and comparing their activities using any suitable assay known in the art.

[0132] The term "subject" includes mammals, such as humans, non-human primates, farm animals, companion animals, and laboratory animals (e.g., rodents and lagamorphs). The term is intended to include males as well as females.

[0133] As used herein, the term "patient" means any subject being evaluated for, treated for, or experiencing a disease.

[0134] As used herein, the term "sample" refers to a material or substance for reaction with DNA polymerase, such as to detect the presence of a target nucleic acid or to prepare a DNA copy of a target nucleic acid for sequencing or generation of a cDNA library. In some embodiments, the sample is a "biological sample", which refers to a sample of biological tissue or fluid. Such samples are typically derived from humans, but also include tissues isolated from non-human primates or rodents, such as mice and rats, and include sections of tissue, such as biopsy and autopsy samples, frozen sections taken for histological purposes, blood, plasma, serum, sputum, feces, tears, mucus, hair, skin, and the like. A "biological sample" also refers to a cell or cell population from an organism, or a content of tissue or fluid. In some embodiments, a biological sample has been removed from an animal, but the term "biological sample" can also refer to cells or tissues that are analyzed in vivo, i.e., without being removed from the animal. Typically, a "biological sample" contains cells from an animal or organism, but the term can also refer to non-cellular biological materials, such as the non-cellular fraction of blood, saliva, or urine. Numerous types of biological samples can be used with the enzymes, compositions, and methods of the present disclosure, including, but not limited to, tissue biopsy, blood sample, buccal scraping, saliva sample, or nipple secretion. As used herein, "tissue biopsy" refers to a quantity of tissue removed from an animal, preferably a human, for diagnostic analysis. In cancer patients, tissue can be removed from a tumor to allow for analysis of cells within the tumor. "Tissue biopsy" can refer to any type of biopsy, for example, needle biopsy, fine needle biopsy, surgical biopsy, etc. Engineered DNA polymerase polypeptides

[0135] The present disclosure provides DNA polymerase polypeptide variants engineered to have improved properties. In some embodiments, the engineered DNA polymerase polypeptide variants are useful in performing polymerase reactions, including preparing complementary DNA for a target DNA target / template. The engineered DNA polymerase variants find use in efficient creation of complementary DNA from a whole or partial DNA template, such as in sequencing (e.g., NGS sequencing), amplification (e.g., PCR), and diagnostic methods, such as for detecting target nucleic acids. Such engineered DNA polymerase variants can be used in solution as well as in immobilized embodiments. In some embodiments, the engineered DNA polymerase can be prepared and used as a non-fusion or fusion polypeptide.

[0136] In some embodiments herein, when a particular DNA polymerase variant (i.e., an engineered DNA polymerase polypeptide) is referred to by reference to a modification of a particular amino acid residue in the sequence of a wild-type or reference DNA polymerase polypeptide, it is understood that another DNA polymerase variant modified at the equivalent position(s) (as determined from an amino acid sequence alignment, if necessary, between the respective amino acid sequences) is encompassed herein. For example, for a substitution at a specified amino acid position(s) numbered with reference to SEQ ID NO: 2, the equivalent amino acid position(s) can be readily ascertained for another reference sequence, for example, a reference sequence including residues 12-850 of SEQ ID NO: 2, 8, 332, 462, or 606, or for example, a reference sequence of SEQ ID NO: 8, 332, 462, or 606.

[0137] In one aspect, the disclosure provides an engineered DNA polymerase or functional fragment thereof comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:2, 8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO:2, 8, 332, 462 or 606, wherein the polypeptide sequence comprises one or more substitutions compared to the reference sequence corresponding to residues 12-850 of SEQ ID NO:2, 8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO:2, 8, 332, 462 or 606.

[0138] In some embodiments, the engineered DNA polymerase or functional fragment thereof comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:2 or a reference sequence corresponding to SEQ ID NO:2, wherein the polypeptide sequence comprises one or more substitutions compared to the reference sequence corresponding to residues 12-850 of SEQ ID NO:2 or a reference sequence corresponding to SEQ ID NO:2.

[0139] In some embodiments, the engineered DNA polymerase, or functional fragment thereof, comprises a polypeptide sequence having at least 80% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:2 or a reference sequence corresponding to SEQ ID NO:2, wherein the polypeptide sequence comprises one or more substitutions compared to the reference sequence corresponding to residues 12-850 of SEQ ID NO:2 or a reference sequence corresponding to SEQ ID NO:2.

[0140] In some embodiments, an engineered DNA polymerase or functional fragment thereof comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO:8, 332, 462 or 606, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:2, or a reference sequence corresponding to SEQ ID NO:2.

[0141] In some embodiments, the engineered DNA polymerase or functional fragment thereof comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of an engineered DNA polymerase variant shown in Tables 4.1, 5.1, 6.1, 7.1 and 8.1 or a reference sequence corresponding to an engineered DNA polymerase variant shown in Tables 4.1, 5.1, 6.1, 7.1 and 8.1, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:2 or a reference sequence corresponding to SEQ ID NO:2.

[0142] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises the amino acid positions 15, 16, 20, 21, 22, 40, 41, 52, 57, 58, 73, 85, 87, 88, 91, 102, 109, 132, 157, 177, 186, 200, 213, 217, 231, 232, 242, 243, 262, 263, 264, 265, 273, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 3 , 321, 322, 328, 384, 386, 401, 402, 403, 404, 406, 407, 440, 476, 480, 491, 495, 498, 503, 504, 506, 507, 508, 511, 514, 520, 521, 523, 524, 525, 526, 527, 528, 529, 530, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549, 550, 551, 552, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 598 39, 540, 542, 553, 554, 555, 556, 557, 558, 559, 560, 562, 563, 566, 570, 572, 581, 582, 584, 585, 586, 587, 589, 592, 593, 594, 595, 596, 597, 599, 601, 602, 603, 605, 607, 616, 665, 671, 674, 675, 677 , 684, 688, 696, 704, 705, 706, 728, 735, 747, 748, 749, 750, 751, 753, 755, 756, 762, 763, 764, 766, 772, 773, 779, 793, 803, 814, 820, 849 or combinations thereof, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0143] In some embodiments, the polypeptide sequence of an engineered DNA polymerase comprises at least one of the following substitutions: 15A / G / K / N, 16R, 20A / C, 21K / Q / S, 22K, 40A, 41F, 52R, 57T, 58N, 73A, 85E / P / R / S, 87N, 88T, 91K, 102V / M / S, 109P, 132Y, 157G, 177T, 186E, 200V, 213P, 217E, 231E, 232C, 242Q, 243L / S, 262L, 263A, 264T, 265I, 273M, 299N, 321G, 322N / S, 328I, 384Y, 386V, 401 A / G / I, 402G / R, 403L / R, 404S / T, 406K / Q, 407R / W, 440G, 476I / N, 480E / V / W, 491G, 495E / M / S, 498D, 503I / V, 504M , 506P, 507K, 508H, 511M, 514F, 520P, 521G / W / Y, 523A / K / V, 524G / K / Q, 525L / V, 526T, 527V / W, 528A / Q / R / W, 529S , 530G / P / R / W, 533L / P / Q / V, 534H / W, 535K, 536R, 537G / L / W, 538A, 539L / R, 540H / V, 542G / M / T / W, 553F / K / N / R, 55 4E, 555H / K / M / W, 556F / M / P / W, 557G / H, 558R / S / V / Q, 559D / G / P, 560G / M, 562S, 563L, 566A, 570R, 572I, 581A, 582 F, 584N, 585KR, 586M, 587Q / S, 589G / L / R / S / W, 592G / T / V, 593N, 594C / Q / T / V / W, 595A / P / R, 596L / R / W, 597E, 599G / S / T, 601M / P, 602V, 603G / V / W, 605E / A, 607N, 616A, 665V, 671E / R, 674T, 675L, 677M, 684V, 688I, 696H / V, 704P, and 705W, 706E, 728K, 735G / L, 747T, 748Y, 749L / R / T, 750S / P, 751H, 753K / V, 755P, 756N / T, 762M / Q / V, 763G / Y, 764A / I / V, 766Y, 772I, 773R, 779I, 793G, 803C / R, 814E, 820A, 849T or combinations thereof, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0144] Additionally, the specific ingredients of the DNA scaffold Splices are mounted on V15A / G / K / N, Q16R and L20A / C、F21K / Q / S、Q22K、S40A、Y41F、S52R、V57T、H58N、E73A、P85E / P / R / S、P87N S88T, H91K, S102V / M / S, K109P, V132Y, S157G, R177T, Q186E, A200V, R213P A217E, D231E, R232C, P242Q, P243L / S, I262L, S263A, R264T, M265I, V273M T299N、E321G、R322N / S、V328I、R384Y、R386V、S401A / G / I、N402G / R、N403L / R, Q404S / T, A406K / Q, S407R / W, E440G, L476I / N, Q480E / V / W, A491G, R495E / M / S、G498D、L503I / V、N504M、R506P、D507K、Q508H、T511M、Y514F、A520P、A52 1G / W / Y、R523A / K / V、R524G / K / Q、T525L / V、A526T、K527V / W、T528A / Q / R / W、G5 29S、K530G / P / R / W、T533L / P / Q / V、S534H / W、A535K、S536R、V537G / L / W、L538 A、E539L / R、T540H / V、R542G / M / T / W、Q553F / K / N / R、Y554E、R555H / K / M / W、E55 6F / M / P / W、L557G / H、A558R / S / V / Q、K559D / G / P、L560G / M、G562S、T563L、D56 6A、K570R、V572I、T581A、R582F、H584N、Q585K / R、T586M、G587Q / S、A589G / L / R / S / W、R592G / T / V、L593N、S594C / Q / T / V / W、S595A / P / R、S596L / R / W、D597E、 N599G / S / T、Q601M / P、N602V、I603G / V / W、I605E / A、T607N、G616A、M665V、V67 1E / R、D674T、P675L、R677M、I684V、V688I、R696H / V、D704P、Y705W、G706E、R 728K、E735G / L、R747T、H748Y、V749L / R / T、P750S / P、E751H、L753K / V、K755P、A756N / T, A762M / Q / V, A763G / Y, E764A / I / V, V766Y, V772I, Q773R, L779I, P793G, H803C / R, R814E, R820A, A849T or combinations thereof, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0145] In some embodiments, the engineered DNA polymerase polypeptide sequence comprises at least a substitution at amino acid position 40, 85, 102, 132, 157, 177, 262, 263, 521, 748, or 750, or a combination thereof, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2. In some embodiments, the engineered DNA polymerase polypeptide sequence comprises at least a substitution at amino acid position 40. In some embodiments, the engineered DNA polymerase polypeptide sequence comprises at least a substitution at amino acid position 85. In some embodiments, the engineered DNA polymerase polypeptide sequence comprises at least a substitution at amino acid position 102. In some embodiments, the engineered DNA polymerase polypeptide sequence comprises at least a substitution at amino acid position 132. In some embodiments, the engineered DNA polymerase polypeptide sequence comprises at least a substitution at amino acid position 157. In some embodiments, the engineered DNA polymerase polypeptide sequence comprises at least a substitution at amino acid position 177. In some embodiments, the engineered DNA polymerase polypeptide sequence comprises at least a substitution at amino acid position 262. In some embodiments, the engineered DNA polymerase polypeptide sequence comprises at least a substitution at amino acid position 263. In some embodiments, the engineered DNA polymerase polypeptide sequence comprises at least a substitution at amino acid position 503. In some embodiments, the engineered DNA polymerase polypeptide sequence comprises at least a substitution at amino acid position 521. In some embodiments, the engineered DNA polymerase polypeptide sequence comprises at least a substitution at amino acid position 748. In some embodiments, the engineered DNA polymerase polypeptide sequence comprises at least a substitution at amino acid position 750.

[0146] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least a substitution at amino acid position 40, 132, 157, 262, 263, or 748. In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least a substitution at amino acid position 40, 132, 157, 262, 263, 503, and 748. In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least a substitution at amino acid position 40, 102, 132, 157, 262, 263, 521, or 748. In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least a substitution at amino acid position 40, 85, 102, 132, 157, 177, 262, 263, 521, 748, or 750.

[0147] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least the substitutions 40A, 85E / P / R / S, 102V / M / S, 132Y, 157G, 177T, 262L, 263A, 521G / W / Y, 748Y, or 750S / P or combinations thereof, where the amino acid positions are relative to the reference sequence of SEQ ID NO: 2. In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least the substitutions S40A, P85E / P / R / S, S102V / M / S, V132Y, S157G, R177T, I262L, S263A, A521G / W / Y, H748Y, or P750S or combinations thereof. In some embodiments, for engineered DNA polymerases that include one or more substitutions at amino acid positions 40, 85, 102, 132, 157, 262, 263, 521, 748, or 750, the substitutions can be selected from the above, e.g., 40A, 85E / P / R / S, 102V / M / S, 132Y, 157G, 177T, 262L, 263A, 521G / W / Y, 748Y, and / or 750S / P. In some embodiments, the polypeptide sequence of the engineered DNA polymerase includes at least the substitutions 40A, 85E, 102S, 132Y, 157G, 177T, 262L, 263A, 521G, 748Y, or 750S, or combinations thereof.

[0148] In some embodiments, the polypeptide sequence of the engineered DNA polymerase is selected from the group consisting of amino acid positions 213 / 503 / 508 / 584 / 748, 40 / 132 / 748, 40 / 132 / 157 / 262 / 263 / 748, 132, 40 / 132 / 503 / 748, 40 / 132 / 157 / 503 / 562, 40 / 132 / 213 / 748 / 814, 132 / 157 / 562 / 584, 132 / 584 / 748, 40 / 132 / 231 / 684 / 748, 40 / 132, 40 / 41 / 132 / 562 / 684 / 748, 41 / 213 / 231 / 503 / 650 / 67 4 / 748, 132 / 231 / 503 / 748, 40 / 132 / 157 / 503, 503 / 748 / 814, 40 / 132 / 231 / 503 / 674 / 748, 40 / 88 / 132 / 503 / 684 / 748, 132 / 157 / 213 / 674 / 748 / 814, 157 / 26 3 / 748, 40 / 748, 41 / 157 / 231 / 262 / 748 / 814, 40 / 213 / 503 / 562 / 584 / 748, 523 / 524, 40 / 132 / 503 / 514 / 650 / 674, 40 / 132 / 157 / 213 / 231, 41 / 213 / 520 / 814, 4 0 / 41 / 157 / 231 / 503, 40 / 157 / 503, 40 / 132 / 562 / 748, 132 / 748, 40 / 41 / 132 / 562 / 748, 88 / 213 / 503 / 584 / 684 / 748, 57 / 58 / 523 / 616 / 677, 40 / 213 / 231 / 503 / 514 / 562 / 748, 132 / 562, 213 / 503 / 650, 40 / 41 / 88 / 231 / 748 / 814, 41 / 213 / 262 / 562, 41 / 88 / 231 / 748, 213 / 263 / 748, 40 / 157 / 213, 157 / 520, 40 / 132 / 263 / 503 / 674 / 814, 40 / 41, 524 / 665 / 756, 58 / 186 / 217 / 523 / 524 / 677, 40 / 41 / 748, 132 / 514, 520, 41 / 213 / 503 / 562, 231 / 503 / 748 / 772, 503 / 562, 73 / 232 / 514 / 584 / 814, 58 / 507 / 616, 132 / 262 / 520 / 562 / 684 / 748, 88 / 562 / 814, 41 / 88 / 157 / 814, 88 / 157 / 213 / 674 / 684, 57 / 58 / 523 / 779, 40 / 132 / 157 / 514 / 520 / 684,40 / 41 / 213 / 684 / 772, 40 / 41 / 231 / 503 / 814, 88 / 213 / 503 / 584 / 814, 40 / 41 / 132 / 562 / 584, 41 / 88 / 213 / 231 / 503 / 650 / 748, 40 / 503, 40 / 132 / 213 / 231 / 520 / 562 / 650 / 814, 40 / 41 / 132 / 231 / 262 / 503 / 562 / 584 / 748 / 814, 57 / 58 / 264 / 265 / 524 / 688, 88 / 132 / 157 / 262 / 263 / 5 20 / 562, 88 / 132 / 157 / 262 / 503 / 514 / 562 / 650, 40 / 584 / 674 / 748, 40 / 41 / 132 / 263 / 503, 584 / 748, 40 / 213 / 674, 40 / 41 / 88T / 132 / 503 / 562 / 584 / 748, 88 / 213 / 514 / 562 / 748 / 814, 263 / 520 / 814, or 40 / 41 / 88 / 157, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0149] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions 213P / 503I / 508H / 584N / 748Y; 40A / 132Y / 748Y; 40A / 132Y / 157G / 262L / 263A / 748Y; 132Y; 40A / 132Y / 503I / 748Y; 40A / 132Y / 157G / 503I / 562S; 40A / 132Y / 213P / 748Y / 814E; 132Y / 157G / 562S / 584N; 132Y / 584N / 748Y; 40A / 132Y / 231E / 684V / 7 48Y;40A / 132Y;40A / 41F / 132Y / 562S / 684V / 748Y;41F / 213P / 231E / 503I / 6 50A / 674T / 748Y;132Y / 231E / 503I / 748Y;40A / 132Y / 157G / 503I;503I / 748 Y / 814E;40A / 132Y / 231E / 503I / 674T / 748Y;40A / 88T / 132Y / 503I / 684V / 74 8Y;132Y / 157G / 213P / 674T / 748Y / 814E;157G / 263A / 748Y;40A / 748Y;41F / 1 57G / 231E / 262L / 748Y / 814E;40A / 213P / 503I / 562S / 584N / 748Y;523K / 524 K;40A / 132Y / 503I / 514F / 650A / 674T;40A / 132Y / 157G / 213P / 231E;41F / 21 3P / 520P / 814E;40A / 41F / 157G / 231E / 503I;40A / 157G / 503I;40A / 132Y / 56 2S / 748Y;132Y / 748Y;40A / 41F / 132Y / 562S / 748Y;88T / 213P / 503I / 584N / 68 4V / 748Y;57T / 58N / 523K / 616A / 677M;40A / 213P / 231E / 503I / 514F / 562S / 7 48Y;132Y / 562S;213P / 503I / 650A;40A / 41F / 88T / 231E / 748Y / 814E;41F / 2 13P / 262L / 562S;41F / 88T / 231E / 748Y;213P / 263A / 748Y;40A / 157G / 213P; 157G / 520P;40A / 132Y / 263A / 503I / 674T / 814E;40A / 41F;524K / 665V / 756N;58N / 186E / 217E / R523K / R524K / R677M;S40A / Y41F / 748Y;132Y / 514F;520P;41F / 213P / 503I / 562S;231E / 503I / 748Y / 772I; 503I / 562S;73A / 232C / 514F / 584N / 814E;58N / 507K / 616A;132Y / 262L / 520P / 562S / 684V / 748Y;88T / 562S / 814E;41F / 88T / 1 57G / 814E;88T / 157G / 213P / 674T / 684V;57T / 58N / 523K / 779I;40A / 132Y / 157G / 514F / 520P / 684V;40A / 41F / 213P / 684V / 772 I;40A / 41F / 231E / 503I / 814E;88T / 213P / 503I / 584N / 814E;40A / 41F / 132Y / 562S / 584N;41F / 88T / 213P / 231E / 503I / 650A / 74 8Y;40A / 503I;40A / 132Y / 213P / 231E / 520P / 562S / 650A / 814E;40A / 41F / 132Y / 231E / 262L / 503I / 562S / 584N / 748Y / 814E;57 40A / 584N / 674T / 748Y; 40A / 41F / 132Y / 263A / 503I; 584N / 748Y; 40A / 213P / 674T; 40A / 41F / 88T / 132Y / 503I / 562S / 584N / 748Y; 88T / 213P / 514F / 562S / 748Y / 814E; 263A / 520P / 814E; 40A / 41F / 88T / 157G; or combinations thereof, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0150] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions R213P / L503I / Q508H / H584N / H748Y; S40A / V132Y / H748Y; S40A / V132Y / S157G / I262L / S263A / H748Y; V132Y; S40A / V132Y / L503I / H748Y; S40A / V132Y / S157G / L503I / G562S; S40A / V132Y / R213P / H748Y / R814E; V132Y / S157G / G562S / H584N; V13 2Y / H584N / H748Y;S40A / V132Y / D231E / I684V / H748Y;S40A / V132Y;S40A / Y 41F / V132Y / G562S / I684V / H748Y;Y41F / R213P / D231E / L503I / I650A / D674T / H748Y;V132Y / D231E / L503I / H748Y;S40A / V132Y / S157G / L503I;L503I / H7 48Y / R814E;S40A / V132Y / D231E / L503I / D674T / H748Y;S40A / S88T / V132Y / L 503I / I684V / H748Y;V132Y / S157G / R213P / D674T / H748Y / R814E;S157G / S2 63A / H748Y;S40A / H748Y;Y41F / S157G / D231E / I262L / H748Y / R814E;S40A / R 213P / L503I / G562S / H584N / H748Y;R523K / R524K;S40A / V132Y / L503I / Y51 4F / I650A / D674T;S40A / V132Y / S157G / R213P / D231E;Y41F / R213P / A520P / R 814E;S40A / Y41F / S157G / D231E / L503I;S40A / S157G / L503I;S40A / V132Y / G562S / H748Y;V132Y / H748Y;S40A / Y41F / V132Y / G562S / H748Y;S88T / R213P / L503I / H584N / I684V / H748Y;V57T / H58N / R523K / G616A / R677M;S40A / R213 P / D231E / L503I / Y514F / G562S / H748Y;V132Y / G562S;R213P / L503I / I650A;S40A / Y41F / S88T / D231E / H748Y / R814E;Y41F / R213P / I262L / G562S;Y41F / S88T / D231E / H748Y;R213P / S263A / H748Y;S40A / S157G / R213P;S157G / A520P;S40A / V132Y / S263A / L503I / D674T / R814E;S40A / Y41F;R524K / M665V / A756N;H58N / Q186E / A217E / R523K / R524K / R677M;S40A / Y41F / H748Y;V132Y / Y514F;A520P;Y41F / R213P / L503I / G562S;D231E / L503I / H748Y / V772I;L503I / G562S;E73A / R232C / Y514F / H584N / R814E;H58N / D507K / G616A;V132Y / I262L / A520P / G562S / I684V / H748Y;S88T / G562S / R814E;Y41F / S88T / S157G / R814E;S88T / S157G / R213P / D674T / I684V;V57T / H58N / R523K / L779I;S40A / V132Y / S157G / Y514F / A520P / I684V;S40A / Y41F / R213P / I684V / V772I;S40A / Y41F / D231E / L503I / R814E;S88T / R213P / L503I / H584N / R814E;S40A / Y41F / V132Y / G562S / H584N;Y41F / S88T / R213P / D231E / L503I / I650A / H748Y;S40A / L503I;S40A / V132Y / R213P / D231E / A520P / G562S / I650A / R814E;S40A / Y41F / V132Y / D231E / I262L / L503I / G562S / H584N / H748Y / R814E;V57T / H58N / R264T / M265I / R524K / V688I;S88T / V132Y / S157G / I262L / S263A / A520P / G562S;S88T / V132Y / S157G / I262L / L503I / Y514F / G562S / I650A;S40A / H584N / D674T / H748Y;S40A / Y41F / V132Y / S263A / L503I;H584N / H748Y;S40A / R213P / D674T;S40A / Y41F / S88T / V132Y / L503I / G562S / H584N / H748Y; S88T / R213P / Y514F / G562S / H748Y / R814E; S263A / A520P / R814E; S40A / Y41F / S88T / S157G; or combinations thereof, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0151] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises the amino acid positions 22 / 407, 328, 401, 402, 403, 404, 406, 407, 503, 504, 506, 521, 523, 524, 525, 526, 527, 528, 529, 530, 531, 533, 534, 535, 536, 537, 538, 539, 540, 542, 553, 554, 555, 556, 557, 558, 559, 560, 561, 562, 563, 564, 565, 566, 567, 568, 569, 570, 571, 572, 573, 574, 575, 576, 577, 578, 579, 580, 581, 582, 583, 584, 585, 586, 587, 588, 589, 590, 591, 592, 593, 594, 595, 596, 597, 598, 599, 598, 599, 599, 600, 601, 602, 603, 604, 605, 606, 607, 608, 609, 610, 611, 612, 613, 614, 615, 616, 617 9, 560, 563, 581, 582, 585, 586, 587, 589, 592, 592, 592, 593, 594, 595, 596, 597, 598, 599, 601, 602, 603, 605, 607, 696, 747, 749, 751, 762, 763, 764, 766, 773, 803 or a combination thereof, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0152] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least a substitution or set of substitutions 599S, 530G, 596L, 696H, 542W, 530R, 553F, 533V, 555M, 594V, 594W, 536R, 585K, 401G, 597E, 553K, 402R, 763Y, 762V, 605E, 530P, 506P, 589G, 558S, 553N, 559P, 751H, 552R, 551S, 552R, 553R, 553S ... 89S, 747T, 560M, 696V, 540V, 594C, 556W, 589R, 407W, 557H, 559G, 599T, 521Y, 605A, 559D, 534H, 592G, 533P, 529S , 524G, 749R, 766Y, 556P, 595P, 533Q, 603V, 537G, 589W, 598W, 22K / 407R, 555W, 539R, 531Q, 581A, 803R, 538A, 404T , 406Q, 537L, 595R, 534W, 404S, 592V, 521W, 603G, 401I, 595A, 762Q, 530W, 558V, 527W, 596W, 603W, 528W, 504M, 58 7Q, 587S, 523V, 521G, 558R, 558Q, 593N, 525V, 749L, 503V, 527V, 554E, 535K, 592T, 528A, 585R, 401A, 586M, 764I, 5 56M, 763G, 406K, 582F, 540H, 560G, 402G, 594Q, 539L, 602V, 523A, 749T, 542T, 764A, 523K, 607N, 525L, 403L, 526T, 528R, 599G, 537W, 803C, 556F, 557G, 601M, 596R, 563L, 601P, 773R, 553R, 542M, 594T, 533L, 328I, 555K, 542G, or 528Q or combinations thereof, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0153] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions N599S, K530G, S596L, R696H, R542W, K530R, Q553F, T533V, R555M, S594V, S594W, S536R, Q585K, S401G, D597E, Q553K, N402R, A763Y, A762V, I605E, K530P, R506P, A589G, A558S, Q553N, K559P, E751H, A589S, R747T, L560M, R6 96V, T540V, S594C, E556W, A589R, S407W, L557H, K559G, N599T, A521Y, I605A, K559D, S534H, R592G, T533P, G529S, R524G, V749R, V766Y, E556 P, S595P, T533Q, I603V, V537G, A589W, P598W, Q22K / S407R, R555W, E53 9R, R531Q, T581A, H803R, L538A, Q404T, A406Q, V537L, S595R, S534W, Q4 04S, R592V, A521W, I603G, S401I, S595A, A762Q, K530W, A558V, K527W, S596W, I603W, T528W, N504M, G587Q, G587S, R523V, A521G, A558R, A558 Q, L593N, T525V, V749L, L503V, K527V, Y554E, A535K, R592T, T528A, Q585R, S401A, T586M, E764I, E556M, A763G, A406K, R582F, T540H, L560G, N402G, S594Q, E539L, N602V, R523A, V749T, R542T, E764A, R523K, T607N, T525L, N403L, A526T, T528R, N599G, V537W, H803C, E556F, L557G, Q601M, S596R, T563L, Q601P, Q773R, Q553R, R542M, S594T, T533L, V328I, R555K, R542G, T528Q or combinations thereof, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0154] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises the amino acid positions 15, 20, 21, 52, 85, 87, 91, 102, 243, 321, 322, 384, 404, 476, 480, 480, 495, 542, 570, 671, 675, 704, 728, 735, 753, 755, 762, 764, 793, 820, and containing at least a substitution or set of substitutions at: 16 / 735, 750 / 849, 524 / 581, 403 / 404 / 524 / 542 / 555 / 762 / 764, 404 / 524 / 542 / 589 / 762 / 764, 524 / 542 / 581 / 762 / 764, 542 / 762 / 764, amino acid positions relative to the reference sequence of SEQ ID NO:2.

[0155] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions 404S, 542G, 762M, 524Q / 542G / 581A / 762M / 764V, 404S / 524Q / 542G / 589L / 762M / 764V, 764V, 403R / 404S / 524Q / 542G / 555H / 762M / 764V, 476N, 542G / 762M / 764V, 728K, 52R, 476I, 675L, 764M, 764Q, 764R, 764Q ... 50S / 849T, 102S, 21C, 755P, 21S, 321G, 20A, 21K, 87N, 20C, 16R / 735L, 21Q, 704P, 735G, 384Y, 480W, 102M, 793G, 322S, 322N, 570R, 480V, 753V, 753K, 524Q / 581A, 91K, 243L, 243S, 671E, 85S, 495M, 15A, 15N, 15K, 820A, 495E, 85E, 85R, 480E, 15G, or 671R, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0156] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions Q404S, R542G, A762M, R524Q / R542G / T581A / A762M / E764V, Q404S / R524Q / R542G / A589L / A762M / E764V, E764V, N403R / Q404S / R524Q / R542G / R555H / A762M / E764V, L476N, R542G / A762M / E764V, R728K, S52R, L476I, P675L, P750S / A8 49T, V102S, F21C, K755P, F21S, E321G, L20A, F21K, P87N, L20C, Q16R / E735L, F21Q, D704P, E735G, R384Y, Q480W, V102M, P793G, R322S, R322N, K570R, Q480V, L753V, L753K, R524Q / T581A, H91K, P243L, P243S, V671E, P85S, R495M, V15A, V15N, V15K, R820A, R495E, P85E, P85R, Q480E, V15G, or V671R, and the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0157] In some embodiments, the polypeptide sequence of the engineered DNA polymerase is selected from the group consisting of amino acid positions 750 / 820, 21 / 52, 20 / 21 / 85 / 322 / 476 / 495, 20 / 85 / 200 / 322 / 476 / 495 / 750, 476 / 750, 20C / 476, 20 / 322 / 386, 85 / 322 / 476, 52 / 322 / 498 / 750, 20 / 322 / 476 / 820, 85 / 476 / 495 / 820, 21 / 85 / 322 / 820, 20 / 299 / 322 / 386 / 476 / 495 / 820, 20 / 322, 21 / 820 / 849, 476, 322 / 820, 21 / 322 / 386 / 820, 322 / 386 / 495, 85 / 386 / 495 / 750, 20 / 85 / 476 / 750, 20 / 38 6 / 476, 85 / 322 / 386 / 476 / 495, 20 / 495 / 820, 750, 21 / 322 / 495, 52 / 386 / 495 / 820, 21 / 322, 85 / 322 / 750 / 820, 20 / 52 / 85, 21 / 52 / 572, 20 / 85 / 495 / 849, 85 / 750, 21 / 495 / 820, 273 / 322 / 849, 495, 322 / 750 / 820, 52 / 476 / 495 / 566 / 750 / 849, 386 / 495, 495 / 820, 21 / 322 / 495 / 750 / 820, 21 / 85 / 322 / 386 / 495 / 820 / 849, 476 / 495 / 750, 386 / 849, 476 / 495, 85 / 476 / 849, 21 / 322 / 750, 20 / 85 / 566 / 820, or 386 / 750 / 849, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0158] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions 750S / 820A, 21C / 52R, 20C / 21C / 85E / 322N / 476N / 495E, 20C / 85E / 200V / 322N / 476N / 495S / 750S, 476N / 750S, 20C / 476N, 20C / 322N / 386V, 85E / 322N / 476N, 52R / 322N / 498D / 750S ... N / 476N / 820A, 85E / 476N / 495E / 820A, 21C / 85E / 322N / 820A, 20C / 299N / 322N / 386V / 476N / 495E / 820A, 20C / 322N, 21C / 820A / 849T, 476N, 322N / 820A, 21C / 322N / 386V / 820A, 322N / 386V / 495E, 85E / 386V / 495E / 750S, 20C / 85E / 476N / 750S, 20C / 386V / 4 76N, 85E / 322N / 386V / 476N / 495S, 20C / 495E / 820A, 750S, 21C / 322N / 495E, 52R / 386V / 495S / 820A, 21C / 322N, 85E / 322N / 750 S / 820A, 20C / 52R / 85E, 21C / 52R / 572I, 20C / 85E / 495E / 849T, 85E / 750S, 21C / 495E / 820A, 273M / 322N / 849T, 495E, 322N / 750 S / 820A, 52R / 476N / 495E / 566A / 750S / 849T, 386V / 495E, 495S / 820A, 21C / 322N / 495E / 750S / 820A, 21C / 85E / 322N / 386V / 495S / 820A / 849T, 495S, 476N / 495E / 750S, 386V / 849T, 476N / 495E, 85E / 476N / 849T, 21C / 322N / 750S, 20C / 85E / 566A / 820A, or 386V / 750S / 849T, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0159] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions P750S / R820A, F21C / S52R, L20C / F21C / P85E / R322N / L476N / R495E, L20C / P85E / A200V / R322N / L476N / R495S / P750S, L476N / P750S, L20C / L476N, L20C / R322N / R386V, P85E / R322N / L476N, S52R / R322N / G498D / P750S, L20C / R322N / L476N / R820A, P85E / L476N / R495E / R820A, F21C / P85E / R322N / R820A, L20C / T29 9N / R322N / R386V / L476N / R495E / R820A, L20C / R322N, F21C / R820A / A849T, L476N, R322N / R820A, F21C / R322N / R386V / R820A, R322N / R386V / R495E, P 85E / R386V / R495E / P750S, L20C / P85E / L476N / P750S, L20C / R386V / L476N, P85E / R322N / R386V / L476N / R495S, L20C / R495E / R820A, P750S, F21C / R32 2N / R495E, S52R / R386V / R495S / R820A, F21C / R322N, P85E / R322N / P750S / R 820A, L20C / S52R / P85E, F21C / S52R / V572I, L20C / P85E / R495E / A849T, P8 5E / P750S, F21C / R495E / R820A, V273M / R322N / A849T, R495E, R322N / P750S / R820A, S52R / L476N / R495E / D566A / P750S / A849T, R386V / R495E, R495S / R820A, F21C / R322N / R495E / P750S / R820A, F21C / P85E / R322N / R386V / R495S / R820A / A849T, R495S, L476N / R495E / P750S, R386V / A849T, L476N / R495E, P85E / L476N / A849T, F21C / R322N / P750S, L20C / P85E / D566A / R820A, orR386V / P750S / A849T, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0160] In some embodiments, the polypeptide sequence of the engineered DNA polymerase is selected from the group consisting of amino acid positions 299 / 386 / 566 / 820, 476 / 820 / 849, 21 / 322 / 476 / 495 / 820, 177, 21 / 495, 476 / 820, 20 / 52 / 299, 52 / 299, 322 / 820, 20 / 820, 20 / 299 / 386 / 476, 386 / 476 / 820, 4 76 / 495 / 820, 386 / 476 / 495, 20 / 21 / 299 / 322 / 386, 322 / 386 / 495, 21 / 299 / 322 / 476 / 495 / 820, 21 / 299 / 386 / 820, 299 / 476 / 820, 20 / 21, 21 / 85 / 102 / 750, 705, 21 / 386 / 476 / 820, 820, 21 / 299 / 322, 20 / 21 / 322 / 3 86 / 820, 299, 21 / 299 / 386 / 476, 109, 322 / 495, 491, 52 / 820, 21 / 386 / 820, 20 / 21 / 495, 21 / 299 / 322 / 495 / 566 / 820, 20 / 21 / 299 / 495, 756, 386 / 820, 495, 511, 21 / 52 / 242 / 386 / 495 / 820, 299 / 476 / 495, 706, 21 299 / 386 / 476 / 495, 21 / 299 / 322 / 495, 21 / 476 / 849, 299 / 322 / 476 / 820, 21 / 52 / 299 / 322 / 820, 20 / 21 / 566, 20 / 52, 322 / 386 / 495 / 566 / 820, 21 / 299, 21 / 299 / 386, 386 / 849, 52 / 476, 52 / 299 / 322 / 386 / 495, or 440, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0161] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions 299N / 386V / 566A / 820A, 476N / 820A / 849T, 21C / 322N / 476N / 495E / 820A, 177T, 21C / 495E, 476N / 820A, 20C / 52R / 299N, 52R / 299N, 322N / 820A, 20C / 820A, 20C / 299N / 386V / 476N, 386V / 476N / 820A, 476 N / 495E / 820A, 386V / 476N / 495E, 20C / 21C / 299N / 322N / 386V, 322N / 386V / 495E, 21C / 299N / 322N / 476N / 495E / 820A, 21C / 299N / 386 V / 820A, 299N / 476N / 820A, 20C / 21C, 21C / 85P / 102V / 750P, 705W, 21C / 386V / 476N / 820A, 820A, 21C / 299N / 322N, 20C / 21C / 322N / 38 6V / 820A, 299N, 21C / 299N / 386V / 476N, 109P, 322N / 495E, 491G, 52R / 820A, 21C / 386V / 820A, 20C / 21C / 495E, 21C / T99N / 322N / 495 E / 566A / 820A, 20C / 21C / 299N / 495E, 756T, 386V / 820A, 495E, 511M, 21C / 52R / 242Q / 386V / 495E / 820A, 299N / 476N / 495E, 706E, 21C / 299N / 386V / 476N / 495E, 21C / 299N / 322N / 495E, 21C / 476N / 849T, 299N / 322N / 476N / 820A, 21C / 52R / 299N / 322N / 820A, 20C / 21C / 566A, 20C / 52R, 322N / 386V / 495E / 566A / 820A, 21C / 299N, 21C / 299N / 386V, 386V / 849T, 52R / 476N, 52R / 299N / 322N / 386V / 495E, or 440G, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0162] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions T299N / R386V / D566A / R820A, L476N / R820A / A849T, F21C / R322N / L476N / R495E / R820A, R177T, F21C / R495E, L476N / R820A, L20C / S52R / T299N, S52R / T299N, R322N / R820A, L20C / R820A, L20C / T299N / R386V / L476N, R386V / L476N / R820A, L476 N / R495E / R820A, R386V / L476N / R495E, L20C / F21C / T299N / R322N / R386V, R 322N / R386V / R495E, F21C / T299N / R322N / L476N / R495E / R820A, F21C / T299 N / R386V / R820A, T299N / L476N / R820A, L20C / F21C, F21C / E85P / S102V / S75 0P, Y705W, F21C / R386V / L476N / R820A, R820A, F21C / T299N / R322N, L20C / F2 1C / R322N / R386V / R820A, T299N, F21C / T299N / R386V / L476N, K109P, R322N / R495E, A491G, S52R / R820A, F21C / R386V / R820A, L20C / F21C / R495E, F21C / T299N / R322N / R495E / D566A / R820A, L20C / F21C / T299N / R495E, A756T, R3 86V / R820A, R495E, T511M, F21C / S52R / P242Q / R386V / R495E / R820A, T299N / L476N / R495E, G706E, F21C / T299N / R386V / L476N / R495E, F21C / T299N / R32 2N / R495E, F21C / L476N / A849T, T299N / R322N / L476N / R820A, F21C / S52R / T2 99N / R322N / R820A, L20C / F21C / D566A, L20C / S52R, R322N / R386V / R495E / D 566A / R820A, F21C / T299N, F21C / T299N / R386V, R386V / A849T, S52R / L476N,S52R / T299N / R322N / R386V / R495E, or E440G, and the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0163] In some embodiments, the polypeptide sequence of the engineered DNA polymerase is selected from the group consisting of amino acid positions 22 / 40 / 132 / 157 / 262 / 263 / 407 / 748, 40 / 132 / 157 / 262 / 263 / 328 / 748, 40 / 132 / 157 / 262 / 263 / 401 / 748, 40 / 132 / 157 / 262 / 263 / 402 / 748, 40 / 132 / 157 / 262 / 263 / 403 / 748, 40 / 132 / 157 / 262 / 263 / 404 / 748, 40 / 132 / 157 / 262 / 263 / 406 / 748, ...407 / 748, 40 / 132 / 157 / 262 / 263 / 407 / 748, 40 / 132 / / 263 / 407 / 748, 40 / 132 / 157 / 262 / 263 / 503 / 748, 40 / 132 / 157 / 262 / 263 / 504 / 748, 40 / 132 / 157 / 262 / 263 / 506 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 748, 40 / 132 / 157 / 262 / 263 / 523 / 748, 40 / 132 / 157 / 262 / 263 / 524 / 748, 40 / 132 / 157 / 262 / 263 / 525 / 748, 40 / 132 / 157 / 262 / 263 / 526 / 748, 40 / 132 / 157 / 262 / 263 / 526 / 748, 40 / 132 / 157 / 262 / 263 / 527 / 748, 40 / 132 / 157 / 262 / 263 / 528 / 748, 40 / 132 / 157 / 262 / 263 / 529 / 748, 40 / 132 / 157 / 262 / 263 / 530 / 748, 40 / 132 / 157 / 262 / 263 / 531 / 748, 40 / 132 / 157 / 262 / 263 / 533 / 748, 40 / 132 / 157 / 262 / 263 / 534 / 748, 40 / 132 / 157 / 262 / 263 / 535 / 748, 40 / 132 / 157 / 262 / 263 / 536 / 748, 40 / 132 / 157 / 262 / 263 / 537 / 748, 40 / 132 / 157 / 262 / 263 / 538 / 748, 40 / 132 / 157 / 262 / 263 / 539 / 748, 40 / 132 / 157 / 262 / 263 / 540 / 748, 40 / 132 / 157 / 262 / 263 / 542 / 748, 40 / 132 / 157 / 262 / 263 / 54 / 748, 40 / 132 / 157 / 262 / 263 / 553 / 748, 40 / 132 / 157 / 262 / 263 / 554 / 748, 40 / 132 / 157 / 262 / 263 / 555 / 748, 40 / 132 / 157 / 262 / 263 / 556 / 748,40 / 132 / 157 / 262 / 263 / 557 / 748、40 / 132 / 157 / 262 / 263 / 558 / 748、40 / 132 / 157 / 262 / 263 / 559 / 748、40 / 132 / 157 / 262 / 263 / 560 / 748、40 / 132 / 157 / 262 / 263 / 563 / 748、40 / 132 / 157 / 262 / 263 / 581 / 748、40 / 132 / 157 / 262 / 263 / 582 / 748、40 / 132 / 157 / 262 / 263 / 585 / 748、40 / 132 / 157 / 262 / 263 / 586 / 748、40 / 132 / 157 / 262 / 263 / 587 / 748、40 / 132 / 157 / 262 / 263 / 589 / 748、40 / 132 / 157 / 262 / 263 / 592 / 748、40 / 132 / 157 / 262 / 263 / 593 / 748、40 / 132 / 157 / 262 / 263 / 594 / 748、40 / 132 / 157 / 262 / 263 / 595 / 748、40 / 132 / 157 / 262 / 263 / 596 / 748、40 / 132 / 157 / 262 / 263 / 597 / 748、40 / 132 / 157 / 262 / 263 / 598 / 748、40 / 132 / 157 / 262 / 263 / 599 / 748、40 / 132 / 157 / 262 / 263 / 601 / 748、40 / 132 / 157 / 262 / 263 / 602 / 748、40 / 132 / 157 / 262 / 263 / 603 / 748、40 / 132 / 157 / 262 / 263 / 605 / 748、40 / 132 / 157 / 262 / 263 / 607 / 748、40 / 132 / 157 / 262 / 263 / 696 / 748、40 / 132 / 157 / 262 / 263 / 747 / 748、40 / 132 / 157 / 262 / 263 / 748、40 / 132 / 157 / 262 / 263 / 748 / 749、40 / 132 / 157 / 262 / 263 / 748 / 751、40 / 132 / 157 / 262 / 263 / 748 / 762、40 / 132 / 157 / 262 / 263 / 748 / 763、40 / 132 / 157 / 262 / 263 / 748 / 764、40 / 132 / 157 / 262 / 263 / 748 / 766、40 / 132 / 157 / 262 / 263 / 748 / 773、40 / 132 / 157 / 262 / 263 / 748 / 803、40 / 132 / 157 / 605 / 262 / 263 / 748、40 / 132 / 157 / 262 / 263 / 403 / 521 / 748、or 40 / 132 / 157 / 262 / 263 / 403 / 553 / 748, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0164] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one of the substitution sets 40A / 132Y / 157G / 262L / 263A / 599S / 748Y, 40A / 132Y / 157G / 262L / 263A / 530G / 748Y, 40A / 132Y / 157G / 262L / 263A / 596L / 748Y, 40A / 132Y / 157G / 262L / 263A / 696H / 748Y, 40A / 132Y / 157G / 262L / 263A / 542W / 748Y, 40A / 132Y / 157G / 262L / 263A / 530R / 748 Y, 40A / 132Y / 157G / 262L / 263A / 553F / 748Y, 40A / 132Y / 157G / 262L / 263A / 53 3V / 748Y, 40A / 132Y / 157G / 262L / 263A / 555M / 748Y, 40A / 132Y / 157G / 262L / 2 63A / 594V / 748Y, 40A / 132Y / 157G / 262L / 263A / 594W / 748Y, 40A / 132Y / 157G / 262L / 263A / 536R / 748Y, 40A / 132Y / 157G / 262L / 263A / 585K / 748Y, 40A / 132Y / 157G / 262L / 263A / 401G / 748Y, 40A / 132Y / 157G / 262L / 263A / 597E / 748Y, 4 0A / 132Y / 157G / 262L / 263A / 553K / 748Y, 40A / 132Y / 157G / 262L / 263A / 402R / 748Y, 40A / 132Y / 157G / 262L / 263A / 748Y / 763Y, 40A / 132Y / 157G / 262L / 263A / 748Y / 762V, 40A / 132Y / 157G / 262L / 263A / 605E / 748Y, 40A / 132Y / 157G / 262 L / 263A / 530P / 748Y, 40A / 132Y / 157G / 262L / 263A / 506P / 748Y, 40A / 132Y / 15 7G / 262L / 263A / 589G / 748Y, 40A / 132Y / 157G / 262L / 263A / 558S / 748Y, 40A / 1 32Y / 157G / 262L / 263A / 553N / 748Y, 40A / 132Y / 157G / 262L / 263748Y, 40A / 13 2Y / 157G / 262L / 263A / 748Y / 751H, 40A / 132Y / 157G / 262L / 263A / 589S / 748Y,<h2 style=";text-align:left;direction:ltr">40A / 132Y / 157G / 262L / 263A / 747T / 748Y、40A / 132Y / 157G / 262L / 263A / 560 M / 748Y、40A / 132Y / 157G / 262L / 263A / 696V / 748Y、40A / 132Y / 157G / 262L / 26 3A / 540V / 748Y、40A / 132Y / 157G / 262L / 263A / 594C / 748Y、40A / 132Y / 157G / 262L / 263A / 556W / 748Y、40A / 132Y / 157G / 262L / 263A / 589R / 748Y、40A / 132Y / 157G / 262L / 263A / 407W / 748Y、40A / 132Y / 157G / 262L / 263A / 557H / 748Y、40A / 132Y / 157G / 262L / 263A / 559G / 748Y、40A / 132Y / 157G / 262L / 263A / 599T / 74 8Y、40A / 132Y / 157G / 262L / 263A / 521Y / 748Y、40A / 132Y / 157G / 605A / 262L / 2 63A / 748Y、40A / 132Y / 157G / 262L / 263A / 559D / 748Y、40A / 132Y / 157G / 262L / 263A / 534H / 748Y、40A / 132Y / 157G / 262L / 263A / 592G / 748Y、40A / 132Y / 157G / 262L / 263A / 533P / 748Y、40A / 132Y / 157G / 262L / 263A / 529S / 748Y、40A / 13 2Y / 157G / 262L / 263A / 524G / 748Y、40A / 132Y / 157G / 262L / 263A / 748Y / 749R、40A / 132Y / 157G / 262L / 263A / 748Y / 766Y、40A / 132Y / 157G / 262L / 263A / 556P / 748Y、40A / 132Y / 157G / 262L / 263A / 595P / 748Y、40A / 132Y / 157G / 262L / 263 A / 533Q / 748Y、40A / 132Y / 157G / 262L / 263A / 603V / 748Y、40A / 132Y / 157G / 26 2L / 263A / 537G / 748Y、40A / 132Y / 157G / 262L / 263A / 589W / 748Y、40A / 132Y / 157G / 262L / 263A / 598W / 748Y、22K / 40A / 132Y / 157G / 262L / 263A / 407R / 748Y、40A / 132Y / 157G / 262L / 263A / 555W / 748Y、40A / 132Y / 157G / 262L / 263A / 539R / 748Y、40A / 132Y / 157G / 262L / 263A / 531Q / 748Y、40A / 132Y / 157G / 262L / 263A / 581A / 748Y、40A / 132Y / 157G / 262L / 263A / 748Y / 803R、40A / 132Y / 157G / 262L / 263A / 538A / 748Y、40A / 132Y / 157G / 262L / 263A / 404T / 748Y、40A / 132Y / 157G / 262L / 263A / 406Q / 748Y、40A / 132Y / 157G / 262L / 263A / 537L / 748Y、40A / 132Y / 157G / 262L / 263A / 595R / 748Y、40A / 132Y / 157G / 262L / 263A / 534W / 748Y、40A / 132Y / 157G / 262L / 263A / 404S / 748Y、40A / 132Y / 157G / 262L / 263A / 592V / 748Y、40A / 132Y / 157G / 262L / 263A / 521W / 748Y、40A / 132Y / 157G / 262L / 263A / 603G / 748Y、40A / 132Y / 157G / 262L / 263A / 401I / 748Y、40A / 132Y / 157G / 262L / 263A / 595A / 748Y、40A / 132Y / 157G / 262L / 263A / 748Y / 762Q、40A / 132Y / 157G / 262L / S263A / 530W / 748Y、40A / 132Y / 157G / 262L / 263A / 558V / 748Y、40A / 132Y / 157G / 262L / 263A / 527W / 748Y、40A / 132Y / 157G / 262L / S263A / 596W / 748Y、40A / 132Y / 157G / 262L / 263A / 603W / 748Y、40A / 132Y / 157G / 262L / 263A / 528W / 748Y、40A / 132Y / 157G / 262L / 263A / 504M / 748Y、40A / 132Y / 157G / 262L / 263A / 587Q / 748Y、40A / 132Y / 157G / 262L / 263A / 523V / 748Y、40A / 132Y / 157G / 262L / 263A / 521G / 748Y、40A / 132Y / 157G / 262L / 263A / 558R / 748Y、<h2 style=";text-align:left;direction:ltr">40A / 132Y / 157G / 262L / 263A / 593N / 748Y、40A / 132Y / 157GI262L / 263A / 525V / 748Y、40A / 132Y / 157G / 262L / 263A / 748Y / 749L、40A / 132Y / 157G / 262L / 26 3A / 503V / 748Y、40A / 132Y / 157G / 262L / 263A / 527V / 748Y、40A / 132Y / 157G / 262L / 263A / 554E / 748Y、40A / 132Y / 157G / 262L / 263A / 535K / 748Y、40A / 132Y / 157G / 262L / 263A / 592T / 748Y、40A / 132Y / 157G / 262L / 263A / 528A / 748Y、40A / 132Y / 157G / 262L / 263A / 585R / 748Y、40A / 132Y / 157G / 262L / 263A / 401A / 748Y、40A / 132Y / 157G / 262L / 263A / 586M / 748Y、40A / 132Y / 157G / 262L / 263A / 748Y / 764I、40A / 132Y / 157G / 262L / 263A / 556M / 748Y、40A / 132Y / 157G / 262 L / 263A / 748Y / 763G、40A / 132Y / 157G / 262L / 263A / 406K / 748Y、40A / 132Y / 157G / 262L / 263A / 582F / 748Y、40A / 132Y / 157G / 262L / 263A / 540H / 748Y、40A / 132Y / 157G / 262L / 263A / 560G / 748Y、40A / 132Y / 157G / 262L / 263A / 402G / 74 8Y、40A / 132Y / 157G / 262L / 263A / 594Q / 748Y、40A / 132Y / 157G / 262L / 263A / 5 39L / 748Y, 40A / 132Y / 157G / 262L / 263A / 602V / 748Y, 40A / 132Y / 157G / 262L / 263A / 523A / 748Y, 40A / 132Y / 157G / 262L / 263A / 748Y / 749T, 40A / 132Y / 157 G / 262L / 263A / 542T / 748Y、40A / 132Y / 157G / 262L / 263A / 748Y / 764A、40A / 13 2Y / 157G / 262L / 263A / 523K / 748Y、40A / 132Y / 157G / 262L / 263A / 607N / 748Y、40A / 132Y / 157G / 262L / 263A / 525L / 748Y, 40A / 132Y / 157G / 262L / 263A / 403L / 748Y, 40A / 132Y / 157G / 262L / 26 3A / 526T / 748Y, 40A / 132Y / 157G / 262L / 263A / 528R / 748Y, 40A / 132Y / 157G / 262L / 263A / 599G / 748Y, 40A / 132Y / 157G / 262L / 263A / 537W / 748Y, 40A / 132Y / 157G / 262L / 263A / 748Y / 803C, 40A / 132Y / 157G / 262L / 263A / 556F / 7 48Y, 40A / 132Y / 157G / 262L / 263A / 557G / 748Y, 40A / 132Y / 157G / 262L / 263A / 601M / 748Y, 40A / 132Y / 157G / 262L / 263A / 596R / 748Y, 40A / 132Y / 157G / 262L / 263A / 563L / 748Y, 40A / 132Y / 157G / 262L / 263A / 601P / 748Y, 40A / 1 32Y / 157G / 262L / 263A / 748Y / 773R, 40A / 132Y / 157G / 262L / 263A / 553R / 748Y, 40A / 132Y / 157G / 262L / 263A / 542 M / 748Y, 40A / 132Y / 157G / 262L / 263A / 594T / 748Y, 40A / 132Y / 157G / 262L / 263A / 533L / 748Y, 40A / 132Y / 157G / 2 62L / 263A / 328I / 748Y, 40A / 132Y / 157G / 262L / 263A / 555K / 748Y, 40A / 132Y / 157G / 262L / 263A / 542G / 748Y, or 40A / 132Y / 157G / 262L / 263A / 528Q / 748Y, 40A / 132Y / 157G / 262L / 263A / 587S / 748Y, 40A / 132Y / 157G / 262L / 263A / 558Q / 748Y, 40A / 132Y / 157G / 262L / 263A / 403R / 521A / 748Y, 40A / 132Y / 157G / 262L / 263A / 748Y / 762M, 40A / 132Y / 157G / 262L / 263A / 748Y / 764V, or 40A / 132Y / 157G / 262L / 263A / 403R / 553K / 748Y, the amino acid positions being:This is compared to the reference sequence of SEQ ID NO:2.

[0165] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions S40A / V132Y / S157G / I262L / S263A / N599S / H748Y, S40A / V132Y / S157G / I262L / S263A / K530G / H748Y, S40A / V132Y / S157G / I262L / S263A / S596L / H748Y, S40A / V132Y / S157G / I262L / S263A / R696H / H748Y, S40A / V132Y / S157G / I262L / S263A / R542W / H748Y, S40A / V132Y / S157G / I262L / S263A / K530R / H748Y, S40A / V132Y / S15 7G / I262L / S263A / Q553F / H748Y, S40A / V132Y / S157G / I262L / S263A / T533V / H748Y, S40A / V132Y / S157G / I262L / S263A / R555M / H748Y, S40A / V132Y / S157 G / I262L / S263A / S594V / H748Y, S40A / V132Y / S157G / I262L / S263A / S594W / H 748Y, S40A / V132Y / S157G / I262L / S263A / S536R / H748Y, S40A / V132Y / S157G / I262L / S263A / Q585K / H748Y, S40A / V132Y / S157G / I262L / S263A / S401G / H7 48Y, S40A / V132Y / S157G / I262L / S263A / D597E / H748Y, S40A / V132Y / S157G / I262L / S263A / Q553K / H748Y, S40A / V132Y / S157G / I262L / S263A / N402R / H74 8Y, S40A / V132Y / S157G / I262L / S263A / H748Y / A763Y, S40A / V132Y / S157G / I 262L / S263A / H748Y / A762V, S40A / V132Y / S157G / I262L / S263A / I605E / H748 Y, S40A / V132Y / S157G / I262L / S263A / K530P / H748Y, S40A / V132Y / S157G / I2 62L / S263A / R506P / H748Y, S40A / V132Y / S157G / I262L / S263A / A589G / H748Y,<h2 style=";text-align:left;direction:ltr">S40A / V132Y / S157G / I262L / S263A / A558S / H748Y、S40A / V132Y / S157G / I262L / S263A / Q553N / H748Y、S40A / V132Y / S157G / I262L / S263A / K559P / H748Y、 S40A / V132Y / S157G / I262L / S263A / H748Y / E751H、S40A / V132Y / S157G / I262L / S263A / A589S / H748Y、S40A / V132Y / S157G / I262L / S263A / R747T / H748Y、 S40A / V132Y / S157G / I262L / S263A / L560M / H748Y、S40A / V132Y / S157G / I26 2L / S263A / R696V / H748Y、S40A / V132Y / S157G / I262L / S263A / T540V / H748Y、 S40A / V132Y / S157G / I262L / S263A / S594C / H748Y、S40A / V132Y / S157G / I262L / S263A / E556W / H748Y、S40A / V132Y / S157G / I262L / S263A / A589R / H748Y、 S40A / V132Y / S157G / I262L / S263A / S407W / H748Y、S40A / V132Y / S157G / I262L / S263A / L557H / H748Y、S40A / V132Y / S157G / I262L / S263A / K559G / H748Y、 S40A / V132Y / S157G / I262L / S263A / N599T / H748Y、S40A / V132Y / S157G / I262L / S263A / A521Y / H748Y、S40A / V132Y / S157G / I605A / I262L / S263A / H748Y、 S40A / V132Y / S157G / I262L / S263A / K559D / H748Y、S40A / V132Y / S157G / I262L / S263A / S534H / H748Y、S40A / V132Y / S157G / I262L / S263A / R592G / H748Y、 S40A / V132Y / S157G / I262L / S263A / T533P / H748Y、S40A / V132Y / S157G / I262L / S263A / G529S / H748Y、S40A / V132Y / S157G / I262L / S263A / R524G / H748Y、<h2 style=";text-align:left;direction:ltr">S40A / V132Y / S157G / I262L / S263A / H748Y / V749R、S40A / V132Y / S157G / I262L / S263A / H748Y / V766Y、S40A / V132Y / S157G / I262L / S263A / E556P / H748Y、 S40A / V132Y / S157G / I262L / S263A / S595P / H748Y、S40A / V132Y / S157G / I262 L / S263A / T533Q / H748Y、S40A / V132Y / S157G / I262L / S263A / I603V / H748Y、S 40A / V132Y / S157G / I262L / S263A / V537G / H748Y、S40A / V132Y / S157G / I262 L / S263A / A589W / H748Y、S40A / V132Y / S157G / I262L / S263A / P598W / H748Y、Q 22K / S40A / V132Y / S157G / I262L / S263A / S407R / H748Y、S40A / V132Y / S157G / I262L / S263A / R555W / H748Y、S40A / V132Y / S157G / I262L / S263A / E539R / H74 8Y、S40A / V132Y / S157G / I262L / S263A / R531Q / H748Y、S40A / V132Y / S157G / I262L / S263A / T581A / H748Y、S40A / V132Y / S157G / I262L / S263A / H748Y / H80 3R、S40A / V132Y / S157G / I262L / S263A / L538A / H748Y、S40A / V132Y / S157G / I262L / S263A / Q404T / H748Y、S40A / V132Y / S157G / I262L / S263A / A406Q / H748 Y、S40A / V132Y / S157G / I262L / S263A / V537L / H748Y、S40A / V132Y / S157G / I262L / S263A / S595R / H748Y、S40A / V132Y / S157G / I262L / S263A / S534W / H748Y 、S40A / V132Y / S157G / I262L / S263A / Q404S / H748Y、S40A / V132Y / S157G / I26 2L / S263A / R592V / H748Y、S40A / V132Y / S157G / I262L / S263A / A521W / H748Y、<h2 style=";text-align:left;direction:ltr">S40A / V132Y / S157G / I262L / S263A / I603G / H748Y、S40A / V132Y / S157G / I26 2L / S263A / S401I / H748Y、S40A / V132Y / S157G / I262L / S263A / S595A / H748Y、 S40A / V132Y / S157G / I262L / S263A / H748Y / A762Q、S40A / V132Y / S157G / I262L / S263A / K530W / H748Y、S40A / V132Y / S157G / I262L / S263A / A558V / H748Y、 S40A / V132Y / S157G / I262L / S263A / K527W / H748Y、S40A / V132Y / S157G / I26 2L / S263A / S596W / H748Y、S40A / V132Y / S157G / I262L / S263A / I603W / H748Y、 S40A / V132Y / S157G / I262L / S263A / T528W / H748Y、S40A / V132Y / S157G / I262L / S263A / N504M / H748Y、S40A / V132Y / S157G / I262L / S263A / G587Q / H748Y、 S40A / V132Y / S157G / I262L / S263A / R523V / H748Y、S40A / V132Y / S157G / I262L / S263A / A521G / H748Y、S40A / V132Y / S157G / I262L / S263A / A558R / H748Y、 S40A / V132Y / S157G / I262L / S263A / L593N / H748Y、S40A / V132Y / S157G / I262L / S263A / T525V / H748Y、S40A / V132Y / S157G / I262L / S263A / H748Y / V749L、 S40A / V132Y / S157G / I262L / S263A / L503V / H748Y、S40A / V132Y / S157G / I262L / S263A / K527V / H748Y、S40A / V132Y / S157G / I262L / S263A / Y554E / H748Y、 S40A / V132Y / S157G / I262L / S263A / A535K / H748Y、S40A / V132Y / S157G / I262L / S263A / R592T / H748Y、S40A / V132Y / S157G / I262L / S263A / T528A / H748Y、<h2 style=";text-align:left;direction:ltr">S40A / V132Y / S157G / I262L / S263A / Q585R / H748Y、S40A / V132Y / S157G / I26 2L / S263A / S401A / H748Y、S40A / V132Y / S157G / I262L / S263A / T586M / H748Y、 S40A / V132Y / S157G / I262L / S263A / H748Y / E764I、S40A / V132Y / S157G / I262L / S263A / E556M / H748Y、S40A / V132Y / S157G / I262L / S263A / H748Y / A763G、 S40A / V132Y / S157G / I262L / S263A / A406K / H748Y、S40A / V132Y / S157G / I262L / S263A / R582F / H748Y、S40A / V132Y / S157G / I262L / S263A / T540H / H748Y、 S40A / V132Y / S157G / I262L / S263A / L560G / H748Y、S40A / V132Y / S157G / I26 2L / S263A / N402G / H748Y、S40A / V132Y / S157G / I262L / S263A / S594Q / H748Y、 S40A / V132Y / S157G / I262L / S263A / E539L / H748Y、S40A / V132Y / S157G / I262L / S263A / N602V / H748Y、S40A / V132Y / S157G / I262L / S263A / R523A / H748Y、 S40A / V132Y / S157G / I262L / S263A / H748Y / V749T、S40A / V132Y / S157G / I262L / S263A / R542T / H748Y、S40A / V132Y / S157G / I262L / S263A / H748Y / E764A、 S40A / V132Y / S157G / I262L / S263A / R523K / H748Y、S40A / V132Y / S157G / I262L / S263A / T607N / H748Y、S40A / V132Y / S157G / I262L / S263A / T525L / H748Y、 S40A / V132Y / S157G / I262L / S263A / N403L / H748Y、S40A / V132Y / S157G / I262L / S263A / A526T / H748Y、S40A / V132Y / S157G / I262L / S263A / T528R / H748Y、S40A / V132Y / S157G / I262L / S263A / N599G / H748Y、S40A / V132Y / S157G / I262L / S263A / V537W / H748Y、S40A / V132Y / S157G / I262L / S263A / H748Y / H803C、S40A / V132Y / S157G / I262L / S263A / E556F / H748Y、S40A / V132Y / S157G / I262L、 / S263A / L557G / H748Y, S40A / V132Y / S157G / I262L / S263A / Q601M / H748Y, S40A / V132Y / S157G / I262L / S263A / S596R / H748Y, S40A / V132Y / S157G / I262L / S263A / T563L / H748Y, S40A / V132Y / S157G / I262L / S263A / Q601P / H748Y, S40A / V132Y / S157G / I262L / S263A / H748Y / Q773R, S40A / V132Y / S157G / I262L / S263A / Q553R / H748Y, S40A / V132Y / S157G / I262L / S263A / R542M / H748Y, S40A / V132Y / S157G / I262L / S263A / S594T / H748Y, S40A / V132Y / S157G / I262L / S263A / T533L / H748Y, S40A / V132Y / S157G / I262L / S263A / V328I / H748Y, S40A / V132Y / S157G / I262L / S263A / R555K / H748Y, S40A / V132Y / S157G / I262L / S263A / R542G / H748Y, S40A / V132Y / S157G / I262L / S263A / T528Q / H748Y, S40A / V132Y / S157G / I262L / S263A / G587S / H748Y, S40A / V132Y / S157G / I262L / S263A / A558Q / H748Y , S40A / V132Y / S157G / I262L / S263A / N403R / G521A / H748Y, S40A / V132Y / S157G / I262L / S263A / H748Y / A762M, S40A / V132Y / S157G / I262L / S263A / H748Y / E764V, or S40A / V132Y / S157G / I262L / S263A / N403R / Q553K / H748Y, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0166] In some embodiments, the polypeptide sequence of the engineered DNA polymerase is selected from the group consisting of amino acid positions 40 / 132 / 157 / 262 / 263 / 403 / 404 / 521 / 524 / 542 / 555 / 748 / 762 / 764, 40 / 132 / 157 / 262 / 263 / 404 / 521 / 524 / 542 / 589 / 748 / 762 / 764, 40 / 132 / 157 / 262 / 263 / 521 / 524 / 542 / 581 / 748 / 762 / 764, 40 / 132 / 157 / 262 / 263 / 521 / 542 / 748 / 762 / 764, 40 / 132 / 157 / 262 / 263 / 521 / 542 / 748 / 762 / 764, 263 / 404 / 521 / 542 / 748 / 762, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 750 / 849, 40 / 132 / 157 / 262 / 263 / 521 / 524 / 581 / 748, 16 / 40 / 132 / 157 / 262 / 263 / 521 / 735 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 820, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 793, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 764, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 7 55, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 753, 40 / 132 / 157 / 262 / 263 / 521 / 735 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 728, 40 / 132 / 157 / 262 / 263 / 521 / 704 / 7 48, 40 / 132 / 157 / 262 / 263 / 521 / 675 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 671 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 570 / 748, 40 / 132 / 157 / 262 / 263 / 495 / 521 / 74 8, 40 / 132 / 157 / 262 / 263 / 480 / 521 / 748, 40 / 132 / 157 / 262 / 263 / 476 / 521 / 748, 40 / 132 / 157 / 262 / 263 / 384 / 521 / 748, 40 / 132 / 157 / 262 / 263 / 322 / 521 / 74 8, 40 / 132 / 157 / 262 / 263 / 321 / 521 / 748, 40 / 132 / 157 / 243 / 262 / 263 / 521 / 748, 15 / 40 / 132 / 157 / 262 / 263 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 521 / 748,40 / 91 / 132 / 157 / 262 / 263 / 521 / 748, 40 / 87 / 132 / 157 / 262 / 263 / 521 / 748, 40 / 85 / 132 / 157 / 262 / 263 / 521 / 748, 20 / 40 / 132 / 157 / 262 / 263 / 521 / 748, 21 / 40 / 132 / 157 / 262 / 263 / 521 / 748, or 40 / 52 / 132 / 157 / 262 / 263 / 521 / 748, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0167] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one of the substitution sets 40A / 132Y / 157G / 262L / 263A / 404S / 521G / 542G / 748Y / 762M, 40A / 132Y / 157G / 262L / 263A / 521G / 524Q / 542G / 581A / 748Y / 762M / 764V, 40A / 132Y / 157G / 262L / 263A / 404S / 521G / 524Q / 542G / 589L / 748Y / 762M / 764V, 40A / 132Y / 157G / 262L / 263A / 521G / 748Y / 764V, 40A / 132Y / 157G / 262L / 263A / 403R / 404S / 521G / 524Q / 542G / 555H / 74 8Y / 762M / 764V, 40A / 132Y / 157G / 262L / 263A / 476N / 521G / 748Y, 40A / 132Y / 15 7G / 262L / 263A / 521G / 542G / 748Y / 762M / 764V, 40A / 132Y / 157G / 262L / 263A / 521G / 748Y / 728K, 40A / 52R / 132Y / 157G / 262L / 263A / 521G / 748Y, 40A / 132Y / 1 57G / 262L / 263A / 476I / 521G / 748Y, 40A / 132Y / 157G / 262L / 263A / 521G / 675L / 748Y, 40A / 132Y / 157G / 262L / 263A / 521G / 748Y / 750S / 849T, 40A / 102S / 132Y / 157G / 262L / 263A / 521G / 748Y, 21C / 40A / 132Y / 157G / 262L / 263A / 521G / 748 Y, 40A / 132Y / 157G / 262L / 263A / 521G / 748Y / 755P, 21S / 40A / 132Y / 157G / 262L / 263A / 521G / 748Y, 40A / 132Y / 157G / 262L / 263A / 321G / 521G / 748Y, 20A / 40A / 132Y / 157G / 262L / 263A / 521G / 748Y, 21K / 40A / 132Y / 157G / 262L / 263A / 521G / 748Y, 40A / 87N / 132Y / 157G / 262L / 263A / 521G / 748Y, 20C / 40A / 132Y / 157G / 262L / 263A / 521G / 748Y, 16R / 40A / 132Y / 157G / 262L / 263A / 521G / 735L / 748Y,21Q / 40A / 132Y / 157G / 262L / 263A / 521G / 748Y、40A / 132Y / 157G / 262L / 263A / 521G / 704P / 748Y、40A / 132Y / 157G / 262L / 263A / 521G / 735G / 748Y、40A / 132Y / 157G / 262L / 263A / 384Y / 521G / 748Y、40A / 132Y / 157G / 262L / 263A / 480W / 521G / 748Y、40A / V102M / 132Y / 157G / 262L / 263A / 521G / 748Y、40A / 132Y / 157G / 262L / 263A / 521G / 748Y / 793G、40A / 132Y / 157G / 262L / 263A / 322S / 521G / 748Y、40A / 132Y / 157G / 262L / 263A / 322N / 521G / 748Y、40A / 132Y / 157G / 262L / 263A / 521G / 570R / 748Y、40A / 132Y / 157G / 262L / 263A / 480V / 521G / 748Y、40A / 132Y / 157G / 262L / 263A / 521G / 748Y / 753V、40A / 132Y / 157G / 262L / 263A / 521G / 748Y / 753K、40A / 132Y / 157G / 262L / 263A / 521G / R524Q / 581A / 748Y、40A / 91K / 132Y / 157G / 262L / 263A / 521G / 748Y、40A / 132Y / 157G / 243L / 262L / 263A / 521G / 748Y、40A / 132Y / 157G / 243S / 262L / 263A / 521G / 748Y、40A / 132Y / 157G / 262L / 263A / 521G / 671E / 748Y、40A / 85S / 132Y / 157G / 262L / 263A / 521G / 748Y、40A / 132Y / 157G / 262L / 263A / 495M / 521G / 748Y、15A / 40A / 132Y / 157G / 262L / 263A / 521G / 748Y、15N / 40A / 132Y / 157G / 262L / 263A / 521G / 748Y、15K / 40A / 132Y / 157G / 262L / 263A / 521G / 748Y、40A / 132Y / 157G / 262L / 263A / 521G / 748Y / 820A、40A / 132Y / 157G / 262L / 263A / 495E / 521G / 748Y / 、40A / 85E / 132Y / 157G / 262L / 263A / 521G / 748Y, 40A / 85R / 132Y / 157G / 262L / 263A / 521G / 748Y, 40A / 132Y / 157G / 262L / 263A / 480E / 521G / 748Y, 15G / 40A / 132Y / 157G / 262L / 263A / 521G / 748Y, or 40A / 132Y / 157G / 262L / 263A / 521G / 671R / 748Y, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0168] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one of the substitution sets S40A / V132Y / S157G / I262L / S263A / Q404S / A521G / R542G / H748Y / A762M, S40A / V132Y / S157G / I262L / S263A / A521G / R524Q / R542G / T581A / H748Y / A762M / E764V, S40A / V132Y / S157G / I262L / S263A / Q404S / A521G / R524Q / R542G / A589L / H748Y / A762M / E764V, A762M / E764V, S40A / V132Y / S157G / I262L / S263A / A521G / H748Y / E764V, S 40A / V132Y / S157G / I262L / S263A / N403R / Q404S / A521G / R524Q / R542G / R5 55H / H748Y / A762M / E764V, S40A / V132Y / S157G / I262L / S263A / L476N / A52 1G / H748Y, S40A / V132Y / S157G / I262L / S263A / A521G / R542G / H748Y / A762 M / E764V, S40A / V132Y / S157G / I262L / S263A / A521G / H748Y / R728K, S40A / S52R / V132Y / S157G / I262L / S263A / A521G / H748Y, S40A / V132Y / S157G / I2 62L / S263A / L476I / A521G / H748Y, S40A / V132Y / S157G / I262L / S263A / A52 1G / P675L / H748Y, S40A / V132Y / S157G / I262L / S263A / A521G / H748Y / P750 S / A849T, S40A / V102S / V132Y / S157G / I262L / S263A / A521G / H748Y, F21C / S40A / V132Y / S157G / I262L / S263A / A521G / H748Y, S40A / V132Y / S157G / I2 62L / S263A / A521G / H748Y / K755P, F21S / S40A / V132Y / S157G / I262L / S263 A / A521G / H748Y, S40A / V132Y / S157G / I262L / S263A / E321G / A521G / H748Y,<h2 style=";text-align:left;direction:ltr">L20A / S40A / V132Y / S157G / I262L / S263A / A521G / H748Y、F21K / S40A / V132Y / S157G / I262L / S263A / A521G / H748Y、S40A / P87N / V132Y / S157G / I262L / S263 A / A521G / H748Y、L20C / S40A / V132Y / S157G / I262L / S263A / A521G / H748Y、Q1 6R / S40A / V132Y / S157G / I262L / S263A / A521G / E735L / H748Y、F21Q / S40A / V1 32Y / S157G / I262L / S263A / A521G / H748Y、S40A / V132Y / S157G / I262L / S263A / A521G / D704P / H748Y、S40A / V132Y / S157G / I262L / S263A / A521G / E735G / H7 48Y、S40A / V132Y / S157G / I262L / S263A / R384Y / A521G / H748Y、S40A / V132Y / S157G / I262L / S263A / Q480W / A521G / H748Y、S40A / V102M / V132Y / S157G / I26 2L / S263A / A521G / H748Y、S40A / V132Y / S157G / I262L / S263A / A521G / H748Y / P793G、S40A / V132Y / S157G / I262L / S263A / R322S / A521G / H748Y、S40A / V132 Y / S157G / I262L / S263A / R322N / A521G / H748Y、S40A / V132Y / S157G / I262L / S263A / A521G / K570R / H748Y、S40A / V132Y / S157G / I262L / S263A / Q480V / A521 G / H748Y、S40A / V132Y / S157G / I262L / S263A / A521G / H748Y / L753V、S40A / V1 32Y / S157G / I262L / S263A / A521G / H748Y / L753K、S40A / V132Y / S157G / I262L / S263A / A521G / R524Q / T581A / H748Y、S40A / H91K / V132Y / S157G / I262L / S263A / A521G / H748Y、S40A / V132Y / S157G / P243L / I262L / S263A / A521G / H748Y、S40A / V132Y / S157G / P243S / I262L / S263A / A521G / H748Y, S40A / V132Y / S157G / I262L / S263A / A521G / V67 1E / H748Y, S40A / P85S / V132Y / S157G / I262L / S263A / A521G / H748Y, S40A / V132Y / S157G / I262L / S263A / R 495M / A521G / H748Y, V15A / S40A / V132Y / S157G / I262L / S263A / A521G / H748Y, V15N / S40A / V132Y / S157G / I262L / S263A / A521G / H748Y, V15K / S40A / V132Y / S157G / I262L / S263A / A521G / H748Y, S40A / V132Y / S157G / I262L / S263A / A521G / H748Y / R820A, S40A / V132Y / S157G / I262L / S263A / A521G / H748Y / R495E, S40A / P8 5E / V132Y / S157G / I262L / S263A / A521G / H748Y, S40A / P85R / V132Y / S157G / I262L / S263A / A521G / H748Y, S40A / V132Y / S157G / I262L / S263A / Q480E / A521G / H748Y, V15G / S40A / V132Y / S157G / I262L / S263A / A521G / H748Y, S40A / V132Y / S157G / I262L / S263A / A521G / V671R / H748Y, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0169] In some embodiments, the polypeptide sequence of the engineered DNA polymerase is selected from the group consisting of amino acid positions 40 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750, 21 / 40 / 52 / 102 / 132 / 157 / 262 / 263 / 521 / 748, 21 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748, 20 / 40 / 102 / 132 / 157 / 262 / 26 3 / 322 / 521 / 748, 20 / 40 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750, 40 / 102 / 132 / 157 / 262 / 263 / 386 / 495 / 52 1 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 476 / 495 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 820, 40 / 102 / 132 / 157 / 262 / 263 / 386 / 521 / 748 / 849, 20 / 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750, 40 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 820, 40 / 10 2 / 132 / 157 / 262 / 263 / 521 / 748 / 750 / 820, 21 / 40 / 52 / 102 / 132 / 157 / 262 / 263 / 521 / 572 / 748, 20 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 521 / 748, 21 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 495 / 521 / 748, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 476 / 521 / 748, 20 / 40 / 102 / 132 / 157 / 262 / 263 / 386 / 476 / 521 / 748, 21 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 750, 21 / 40 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 820, 20 / 40 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 820,40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 849、21 / 40 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 820 / 849、40 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 495 / 521 / 748、40 / 102 / 132 / 157 / 262 / 263 / 273 / 322 / 521 / 748 / 849、40 / 102 / 132 / 157 / 262 / 263 / 476 / 495 / 521 / 748 / 750、40 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 750 / 820、40 / 102 / 132 / 157 / 262 / 263 / 386 / 521 / 748 / 750 / 849、21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 820、20 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750、20 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 849、20 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 566 / 748 / 820、40 / 52 / 102 / 132 / 157 / 262 / 263 / 322 / 498 / 521 / 748 / 750、21 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 521 / 748 / 820、40 / 52 / 102 / 132 / 157 / 262 / 263 / 386 / 495 / 521 / 748 / 820、20 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 476 / 521 / 748 / 820、40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 495 / 521 / 748 / 750、40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 495 / 521 / 748 / 820、40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 750 / 820、40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 476 / 495 / 521 / 748、21 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 495 / 521 / 748 / 750 / 820、20 / 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 476 / 495 / 521 / 748、20 / 40 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 386 / 476 / 495 / 521 / 748, 40 / 52 / 102 / 132 / 157 / 262 / 263 / 476 / 495 / 521 / 566 / 748 / 750 / 849, 20 / 40 / 85 / 102 / 132 / 157 / 262 / 200 / 263 / 322 / 476 / 495 / 521 / 748 / 750, or 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 495 / 521 / 748 / 820 / 849, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0170] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one of the substitution sets 40A / 102S / 132Y / 157G / 262L / 263A / 521G / 748Y / 750S / 820A, 21C / 40A / 52R / 102S / 132Y / 157G / 262L / 263A / 521G / 748Y, 20C / 21C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 322N / 476N / 495E / 521G / 748Y, 20C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 322N / 476N / 495E / 521G / 748Y, 20C / 40A / 85E / 102S / 132Y / 157G / 262L / 200V / / 263A / 322N / 476N / 495S / 521G / 748Y / 750S, 40A / 102S / 132Y / 157G / 262L / 2 63A / 476N / 521G / 748Y / 750S, 20C / 40A / 102S / 132Y / 157G / 262L / 263A / 476N / 521G / 748Y, 20C / 40A / 102S / 132Y / 157G / 262L / 263A / 322N / 386V / 521G / 74 8Y, 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 322N / 476N / 521G / 748Y, 40A / 5 2R / 102S / 132Y / 157G / 262L / 263A / 322N / 498D / 521G / 748Y / 750S, 20C / 40A / 102S / 132Y / 157G / 262L / 263A / 322N / 476N / 521G / 748Y / 820A, 40A / 85E / 102 S / 132Y / 157G / 262L / 263A / 476N / 495E / 521G / 748Y / 820A, 21C / 40A / 85E / 10 2S / 132Y / 157G / 262L / 263A / 322N / 521G / 748Y / 820A, 20C / 40A / 102S / 132Y / 157G / 262L / 263A / 299N / 322N / 386V / 476N / 495E / 521G / 748Y, 20C / 40A / 102 S / 132Y / 157G / 262L / 263A / 322N / 521G / 748Y, 21C / 40A / 102S / 132Y / 157G / 2 62L / 263A / 521G / 748Y / 820A / 849T, 40A / 102S / 132Y / 157G / 262L / 263A / 476 N / 521G / 748Y, 40A / 102S / 132Y / 157G / 262L / 263A / 322N / 521G / 748Y / 820A,21C / 40A / 102S / 132Y / 157G / 262L / 263A / 322N / 386V / 521G / 748Y / 820A、40A / 102S / 132Y / 157G / 262L / 263A / 322N / 386V / 495E / 521G / 748Y、40A / 85E / 102S / 132Y / 157G / 262L / 263A / 386V / 495E / 521G / 748Y / 750S、20C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 476N / 521G / 748Y / 750S、20C / 40A / 102S / 132Y / 157G / 262L / 263A / 386V / 476N / 521G / 748Y、40A / 85E / 102S / 132Y / 157G / 262L / 263A / 322N / 386V / 476N / 495S / 521G / 748Y、20C / 40A / 102S / 132Y / 157G / 262L / 263A / 495E / 521G / 748Y / 820A、40A / 102S / 132Y / 157G / 262L / 263A / 521G / 748Y / 750S、21C / 40A / 102S / 132Y / 157G / 262L / 263A / 322N / 495E / 521G / 748Y、40A / 52R / 102S / 132Y / 157G / 262L / 263A / 386V / 495S / 521G / 748Y / 820A、21C / 40A / 102S / 132Y / 157G / 262L / 263A / 322N / 521G / 748Y、40A / 85E / 102S / 132Y / 157G / 262L / 263A / 322N / 521G / 748Y / 750S / 820A、20C / 40A / 52R / 85E / 102S / 132Y / 157G / 262L / 263A / 521G / 748Y 、21C / 40A / 52R / 102S / 132Y / 157G / 262L / 263A / 521G / 572I / 748Y、20C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 495E / 521G / 748Y / 849T、40A / 85E / 102S / 132Y / 157G / 262L / 263A / 521G / 748Y / 750S、21C / 40A / 102S / 132Y / 157G / 262L / 263A / 495E / 521G / 748Y / 820A、40A / 102S / 132Y / 157G / 262L / 263A / 273M / 322N / 521G / 748Y / 849T、40A / 102S / 132Y / 157G / 262L / 263A / 495E / 521G / 748Y, 40A / 102S / 132Y / 157G / 262L / 263A / 322N / 521G / 748Y / 750S / 820A, 40A / 52R / 102S / 132Y / 157G / 262L / 263A / 476N / 495E / 521G / 566A / 748Y / 750S / 849T, 40A / 102S / 132Y / 157G / 262L / 263A / 386V / 495E / 521G / 7 48Y, 40A / 102S / 132Y / 157G / 262L / 263A / 495S / 521G / 748Y / 820A, 21C / 40A / 102S / 132Y / 157G / 262L / 263A / 322N / 495E / 521G / 748Y / 750S / 820A, 21C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 322N / 386V / 495S / 521G / 748Y / 820A / 849T, 40A / 102S / 132Y / 157G / 262L / 263A / 495S / 521G / 748Y, 40A / 102S / 132Y / 157G / 262L / 263A / 476N / 495E / 521G / 748Y / 750S, 40A / 102S / 132Y / 157G / 262L / 263A / 38 6V / 521G / 748Y / 849T, 40A / 102S / 132Y / 157G / 262L / 263A / 476N / 495E / 521G / 748Y, 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 476N / 5 21G / 748Y / 849T, 21C / 40A / 102S / 132Y / 157G / 262L / 263A / 322N / 521G / 748Y / 750S, 20C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 521G / 566A / 748Y / 820A, or 40A / 102S / 132Y / 157G / 262L / 263A / 386V / 521G / 748Y / 750S / 849T, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0171] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one of the substitution sets S40A / V102S / V132Y / S157G / I262L / S263A / A521G / H748Y / P750S / R820A, F21C / S40A / S52R / V102S / V132Y / S157G / I262L / S263A / A521G / H748Y, L20C / F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R322N / L476N / R495E / A521G / H748Y, L20C / S4 0A / P85E / V102S / V132Y / S157G / I262L / A200V / S263A / R322N / L476N / R495S / A521G / H748Y / P750S, S40A / V102S / V132Y / S157G / I262L / S263A / L476N / A52 1G / H748Y / P750S, L20C / S40A / V102S / V132Y / S157G / I262L / S263A / L476N / A 521G / H748Y, L20C / S40A / V102S / V132Y / S157G / I262L / S263A / R322N / R386V / A521G / H748Y, S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R322N / L47 6N / A521G / H748Y, S40A / S52R / V102S / V132Y / S157G / I262L / S263A / R322N / G 498D / A521G / H748Y / P750S, L20C / S40A / V102S / V132Y / S157G / I262L / S263A / R322N / L476N / A521G / H748Y / R820A, S40A / P85E / V102S / V132Y / S157G / I26 2L / S263A / L476N / R495E / A521G / H748Y / R820A, F21C / S40A / P85E / V102S / V1 32Y / S157G / I262L / S263A / R322N / A521G / H748Y / R820A, L20C / S40A / V102S / V132Y / S157G / I262L / S263A / T299N / R322N / R386V / L476N / R495E / A521G / H7 48Y, L20C / S40A / V102S / V132Y / S157G / I262L / S263A / R322N / A521G / H748Y,F21C / S40A / V102S / V132Y / S157G / I262L / S263A / A521G / H748Y / R820A / A849T、S40A / V102S / V132Y / S157G / I262L / S263A / L476N / A521G / H748Y、S40A / V102S / V132Y / S157G / I262L / S263A / R322N / A521G / H748Y / R820A、F21C / S40A / V102S / V132Y / S157G / I262L / S263A / R322N / R386V / A521G / H748Y / R820A、S40A / V102S / V132Y / S157G / I262L / S263A / R322N / R386V / R495E / A521G / H748Y、S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R386V / R495E / A521G / H748Y / P750S、L20C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / L476N / A521G / H748Y / P750S、L20C / S40A / V102S / V132Y / S157G / I262L / S263A / R386V / L476N / A521G / H748Y、S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R322N / R386V / L476N / R495S / A521G / H748Y、L20C / S40A / V102S / V132Y / S157G / I262L / S263A / R495E / A521G / H748Y / R820A、S40A / V102S / V132Y / S157G / I262L / S263A / A521G / H748Y / P750S、F21C / S40A / V102S / V132Y / S157G / I262L / S263A / R322N / R495E / A521G / H748Y、S40A / S52R / V102S / V132Y / S157G / I262L / S263A / R386V / R495S / A521G / H748Y / R820A、F21C / S40A / V102S / V132Y / S157G / I262L / S263A / R322N / A521G / H748Y、S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R322N / A521G / H748Y / P750S / R820A、L20C / S40A / S52R / P85E / V102S / V132Y / S157G / I262L / S263A / A521G / H748Y 、F21C / S40A / S52R / V102S / V132Y / S157G / I262L / S263A / A521G / V572I / H748Y、L20C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R495E / A521G / H748Y / A849T、S40A / P85E / V102S / V132Y / S157G / I262L / S263A / A521G / H748Y / P750S、F21C / S40A / V102S / V132Y / S157G / I262L / S263A / R495E / A521G / H748Y / R820A、S40A / V102S / V132Y / S157G / I262L / S263A / V273M / R322N / A521G / H748Y / A849T、S40A / V102S / V132Y / S157G / I262L / S263A / R495E / A521G / H748Y、S40A / V102S / V132Y / S157G / I262L / S263A / R322N / A521G / H748Y / P750S / R820A、S40A / S52R / V102S / V132Y / S157G / I262L / S263A / L476N / R495E / A521G / D566A / H748Y / P750S / A849T、S40A / V102S / V132Y / S157G / I262L / S263A / R386V / R495E / A521G / H748Y、S40A / V102S / V132Y / S157G / I262L / S263A / R495S / A521G / H748Y / R820A、F21C / S40A / V102S / V132Y / S157G / I262L / S263A / R322N / R495E / A521G / H748Y / P750S / R820A、F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R322N / R386V / R495S / A521G / H748Y / R820A / A849T、S40A / V102S / V132Y / S157G / I262L / S263A / R495S / A521G / H748Y、S40A / V102S / V132Y / S157G / I262L / S263A / L476N / R495E / A521G / H748Y / P750S、S40A / V102S / V132Y / S157G / I262L / S263A / R386V / A521G / H748Y / A849T, S40A / V102S / V132Y / S157G / I262L / S263A / L476N / R4 95E / A521G / H748Y, S40A / P85E / V102S / V132Y / S157G / I262L / S263A / L476N / A521G / H748Y / A849T, F21C / S40A / V102S / V132Y / S 157G / I262L / S263A / R322N / A521G / H748Y / P750S, L20C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / A521G / D566A / H748Y / R820A, S40A / V102S / V132Y / S157G / I262L / S263A / R386V / A521G / H748Y / P750S / A849T, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0172] In some embodiments, the polypeptide sequence of the engineered DNA polymerase is at amino acid positions 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 521 / 566 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750 / 820 / 849, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 476 / 495 / 521 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 177 / 263 / 521 / 748 / 750, 21 / 4 0 / 85 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750 / 820, 20 / 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 5 21 / 748 / 750, 52 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748Y / 750S / 820, 20 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750 / 820, 20 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 476 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 476 / 521 / 748 / 750 / 8 20, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 495 / 521 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 476 / 495 / 521 / 748 / 750, 20 / 21 / 40 / 85 / 102 / 132 / 1 57 / 262 / 263 / 299 / 322 / 386 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 495 / 521 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 47 6 / 495 / 521 / 748 / 750 / 820, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 521 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 476 / 521 / 748 / 750 / 820,20 / 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750、21 / 40 / 102 / 132 / 157 / 262 / 263 / 521 / 748、40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 705 / 748 / 750、21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 476 / 521 / 748 / 750 / 820、40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750 / 820、21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 521 / 748 / 750、20 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 521 / 748 / 750 / 820、40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 521 / 748 / 750、21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 476 / 521 / 748 / 750、40 / 85 / 102 / 109 / 132 / 157 / 262 / 263 / 521 / 748 / 750、40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 495 / 521 / 748 / 750、40 / 85 / 102 / 132 / 157 / 262 / 263 / 491 / 521 / 748 / 750、40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750 / 820、21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 521 / 748 / 750 / 820、20 / 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 750、21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 495 / 521 / 566 / 748 / 750 / 820、20 / 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 495 / 521 / 748 / 750、40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750 / 756、40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 521 / 748 / 750 / 820、40 / 85 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 750、40 / 85 / 102 / 132 / 157 / 262 / 263 / 511 / 521 / 748 / 750、21 / 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 242 / 386 / 495 / 521 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 476 / 495 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 706 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 476 / 495 / 521 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 495 / 521 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750 / 849, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 476 / 521 / 748 / 750 / 820, 21 / 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 521 / 748 / 750 / 820, 20 / 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 566 / 748 / 750, 20 / 40 / 52 / / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 495 / 521 / 566 / 748 / 750 / 820, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 521 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 521 / 748 / 750, 40 / 85 / 102 / 132 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 521 / 748 / 750 / 849, 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750, 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 386 / 495 / 521 / 748 / 750, or 40 / 85 / 102 / 132 / 157 / 262 / 263 / 440 / 521 / 748 / 750, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0173] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 299N / 386V / 521G / 566A / 748Y / 750S / 820A, 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 476N / 521G / 748Y / 750S / 820A / 849T, 21C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 322N / 476N / 495E / 521G / 748Y / 750S / 820A / 849T, 0S / 820A, 40A / 85E / 102S / 132Y / 157G / 262L / 177T / 263A / 521G / 748Y / 750S, 21C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 495E / 521G / 748Y / 750S, 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 476N / 521G / 748Y / 750S / 820A, 20C / 40A / 52R / 85E / 102S / 132Y / 157G / 262L / 263A / 299N / 521G / 748Y / 750S, 52R / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 299N / 521G / 748Y / 750S, 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 322N / 521G / 748Y / 750S / 820A, 20C / 40A / 85E / 102 S / 132Y / 157G / 262L / 263A / 521G / 748Y / 750S / 820A, 20C / 40A / 85E / 102S / 13 2Y / 157G / 262L / 263A / 299N / 386V / 476N / 521G / 748Y / 750S, 40A / 85E / 102S / 1 32Y / 157G / 262L / 263A / 386V / 476N / 521G / 748Y / 750S / 820A, 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 476N / 495E / 521G / 748Y / 750S / 820A, 40A / 85E / 102 S / 132Y / 157G / 262L / 263A / 386V / 476N / 495E / 521G / 748Y / 750S, 20C / 21C / 4 0A / 85E / 102S / 132Y / 157G / 262L / 263A / 299N / 322N / 386V / 521G / 748Y / 750S,40A / 85E / 102S / 132Y / 157G / 262L / 263A / 322N / 386V / 495E / 521G / 748Y / 750S、21C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 299N / 322N / 476N / 495E / 521G / 748Y / 750S / 820A、21C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 299N / 386V / 521G / 748Y / 750S / 820A、40A / 85E / 102S / 132Y / 157G / 262L / 263A / 299N / 476N / 521G / 748Y / 750S / 820A、20C / 21C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 521G / 748Y / 750S、21C / 40A / 102S / 132Y / 157G / 262L / 263A / 521G / 748Y、40A / 85E / 102S / 132Y / 157G / 262L / 263A / 521G / 705W / 748Y / 750S、21C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 386V / 476N / 521G / 748Y / 750S / 820A、40A / 85E / 102S / 132Y / 157G / 262L / 263A / 521G / 748Y / 750S / 820A、21C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 299N / 322N / 521G / 748Y / 750S、20C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 322N / 386V / 521G / 748Y / 750S / 820A、40A / 85E / 102S / 132Y / 157G / 262L / 263A / 299N / 521G / 748Y / 750S、21C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 299N / 386V / 476N / 521G / 748Y / 750S、40A / 85E / 102S / 109P / 132Y / 157G / 262L / 263A / 521G / 748Y / 750S、40A / 85E / 102S / 132Y / 157G / 262L / 263A / 322N / 495E / 521G / 748Y / 750S、40A / 85E / 102S / 132Y / 157G / 262L / 263A / 491G / 521G / 748Y / 750S、40A / 52R / 85E / 102S / 132Y / 157G / 262L / 263A / 521G / 748Y / 750S / 820A、21C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 386V / 521G / 748Y / 750S / 820A、20C / 21C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 495E / 521G / 748Y / 750S、21C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 299N / 322N / 495E / 521G / 566A / 748Y / 750S / 820A、20C / 21C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 299N / 495E / 521G / 748Y / 750S、40A / 85E / 102S / 132Y / 157G / 262L / 263A / 521G / 748Y / 750S / 756T、40A / 85E / 102S / 132Y / 157G / 262L / 263A / 386V / 521G / 748Y / 750S / 820A、40A / 85E / 102S / 132Y / 157G / 262L / 263A / 495E / 521G / 748Y / 750S、40A / 85E / 102S / 132Y / 157G / 262L / 263A / 511M / 521G / 748Y / 750S、21C / 40A / 52R / 85E / 102S / 132Y / 157G / 262L / 263A / 242Q / 386V / 495E / 521G / 748Y / 750S / 820A、40A / 85E / 102S / 132Y / 157G / 262L / 263A / 299N / 476N / 495E / 521G / 748Y / 750S、40A / 85E / 102S / 132Y / 157G / 262L / 263A / 521G / 706E / 748Y / 750S、21C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 299N / 386V / 476N / 495E / 521G / 748Y / 750S、21C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 299N / 322N / 495E / 521G / 748Y / 750S、21C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 476N / 521G / 748Y / 750S / 849T、40A / 85E / 102S / 132Y / 157G / 262L / 263A / 299N / 322N / 476N / 521G / 748Y / 750S / 820A、21C / 40A / 52R / 85E / 102S / 132Y / 157G / 262L / 263A / 299N / 322N / 521G / 748Y / 750S / 820A, 20C / 21C / 40 A / 85E / 102S / 132Y / 157G / 262L / 263A / 521G / 566A / 748Y / 750S, 20C / 40A / 52R / 85E / 102S / 132Y / 157G / 262L / 263A / 521G / 748Y / 750S, 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 322N / 386V / 495E / 521G / 566A / 748Y / 750S / 820A, 21C / 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 299N / 521G / 748Y / 750S, 21C / 40A / 8 5E / 102S / 132Y / 157G / 262L / 263A / 299N / 386V / 521G / 748Y / 750S, 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 386V / 521G / 748Y / 750S / 849T, 40A / 52R / 85E / 102S / 132Y / 157G / 262L / 263A / 476N / 521G / 748Y / 750S, 40A / 52R / 85E / 102S / 132Y / 157G / 262L / 263A / 299N / 322N / 386V / 495E / 521G / 748Y / 750S, or 40A / 85E / 102S / 132Y / 157G / 262L / 263A / 440G / 521G / 748Y / 750S, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0174] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions S40A / P85E / V102S / V132Y / S157G / I262L / S263A / T299N / R386V / A521G / D566A / H748Y / P750S / R820A, S40A / P85E / V102S / V132Y / S157G / I262L / S263A / L476N / A521G / H748Y / P750S / R820A / A849T, F21C / S4 0A / P85E / V102S / V132Y / S157G / I262L / S263A / R322N / L476N / R495E / A521G / H748Y / P750S / R820A, S40A / P85E / V102S / V132Y / S157G / I262L / R177T / S263A / A521G / H748Y / P750S, F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R495E / A521G / H748Y / P750S, S4 0A / P85E / V102S / V132Y / S157G / I262L / S263A / L476N / A521G / H748Y / P750S / R820A, L20C / S40A / S52R / P85E / V102S / V132Y / S157G / I 262L / S263A / T299N / A521G / H748Y / P750S, S52R / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / T299N / A521G / H748Y / P750S, S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R322N / A521G / H748Y / P750S / R820A, L20C / S40A / P85E / V102S / V132Y / S157G / I262L / S2 63A / A521G / H748Y / P750S / R820A, L20C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / T299N / R386V / L476N / A521G / H748Y / P750S , S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R386V / L476N / A521G / H748Y / P750S / R820A,S40A / P85E / V102S / V132Y / S157G / I262L / S263A / L476N / R495E / A521G / H748Y / P750S / R820A、S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R386V / L476N / R495E / A521G / H748Y / P750S、L20C / F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / T299N / R322N / R386V / A521G / H748Y / P750S、S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R322N / R386V / R495E / A521G / H748Y / P750S、F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / T299N / R322N / L476N / R495E / A521G / H748Y / P750S / R820A、F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / T299N / R386V / A521G / H748Y / P750S / R820A、S40A / P85E / V102S / V132Y / S157G / I262L / S263A / T299N / L476N / A521G / H748Y / P750S / R820A、L20C / F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / A521G / H748Y / P750S、F21C / S40A / V102S / V132Y / S157G / I262L / S263A / A521G / H748Y、S40A / P85E / V102S / V132Y / S157G / I262L / S263A / A521G / Y705W / H748Y / P750S、F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R386V / L476N / A521G / H748Y / P750S / R820A、S40A / P85E / V102S / V132Y / S157G / I262L / S263A / A521G / H748Y / P750S / R820A、F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / T299N / R322N / A521G / H748Y / P750S、L20C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R322N / R386V / A521G / H748Y / P750S / R820A、S40A / P85E / V102S / V132Y / S157G / I262L / S263A / T299N / A521G / H748Y / P750S、F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / T299N / R386V / L476N / A521G / H748Y / P750S、S40A / P85E / V102S / K109P / V132Y / S157G / I262L / S263A / A521G / H748Y / P750S、S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R322N / R495E / A521G / H748Y / P750S、S40A / P85E / V102S / V132Y / S157G / I262L / S263A / A491G / A521G / H748Y / P750S、S40A / S52R / P85E / V102S / V132Y / S157G / I262L / S263A / A521G / H748Y / P750S / R820A、F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R386V / A521G / H748Y / P750S / R820A、L20C / F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R495E / A521G / H748Y / P750S、F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / T299N / R322N / R495E / A521G / D566A / H748Y / P750S / R820A、L20C / F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / T299N / R495E / A521G / H748Y / P750S、S40A / P85E / V102S / V132Y / S157G / I262L / S263A / A521G / H748Y / P750S / A756T、S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R386V / A521G / H748Y / P750S / R820A、S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R495E / A521G / H748Y / P750S、S40A / P85E / V102S / V132Y / S157G / I262L / S263A / T511M / A521G / H748Y / P750S、F21C / S40A / S52R / P85E / V102S / V132Y / S157G / I262L / S263A / P242Q / R386V / R495E / A521G / H748Y / P750S / R820A;S40A / P85E / V102S / V132Y / S157G / I262L / S263A / T299N / L476N / R495E / A521G / H748Y / P750S、S40A / P85E / V102S / V132Y / S157G / I262L / S263A / A521G / G706E / H748Y / P750S、F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / T299N / R386V / L476N / R495E / A521G / H748Y / P750S、F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / T299N / R322N / R495E / A521G / H748Y / P750S、F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / L476N / A521G / H748Y / P750S / A849T、S40A / P85E / V102S / V132Y / S157G / I262L / S263A / T299N / R322N / L476N / A521G / H748Y / P750S / R820A、F21C / S40A / S52R / P85E / V102S / V132Y / S157G / I262L / S263A / T299N / R322N / A521G / H748Y / P750S / R820A、L20C / F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / A521G / D566A / H748Y / P750S、L20C / S40A / S52R / P85E / V102S / V132Y / S157G / I262L / S263A / A521G / H748Y / P750S、S40A / P85E / V102S / V132Y / S157G / I262L / S263A / R322N / R386V / R495E / A521G / D566A / H748Y / P750S / R820A、F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / T299N / A521G / H748Y / P750S, F21C / S40A / P85E / V102S / V132Y / S157G / I262L / S263A / T2 99N / R386V / A521G / H748Y / P750S, S40A / P85E / V102S / V132Y / S157G / I2 62L / S263A / R386V / A521G / H748Y / P750S / A849T, S40A / S52R / P85E / V102 S / V132Y / S157G / I262L / S263A / L476N / A521G / H748Y / P750S, S40A / S52R / P85E / V102S / V132Y / S157G / I262L / S263A / T299N / R322N / R386V / R495E / A521G / H748Y / P750S, or S40A / P85E / V102S / V132Y / S157G / I262L / S263A / 440 / A521G / H748Y / P750S, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0175] In some embodiments, an engineered DNA polymerase or fragment thereof comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO: 8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO: 8, 332, 462 or 606.

[0176] In some embodiments, an engineered DNA polymerase or fragment thereof comprises a reference sequence corresponding to residues 12-850 of SEQ ID NO: 8, 332, 462 or 606, or a polypeptide sequence having at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to SEQ ID NO: 8, 332, 462 or 606, provided that the polypeptide sequence does not comprise a sequence corresponding to residues 12-850 of SEQ ID NO:2.

[0177] In some embodiments, the engineered DNA polymerase comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO: 8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO: 8, 332, 462 or 606, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO: 8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO: 8, 332, 462 or 606.

[0178] In some embodiments, the engineered DNA polymerase comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:332, 462 or 606, or a reference sequence corresponding to SEQ ID NO:332, 462 or 606, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:8, or a reference sequence corresponding to SEQ ID NO:8.

[0179] In some embodiments, the engineered DNA polymerase comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:462 or 606, or a reference sequence corresponding to SEQ ID NO:462 or 606, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:332, or a reference sequence corresponding to SEQ ID NO:332.

[0180] In some of the foregoing embodiments, the polypeptide sequence of the engineered DNA polymerase comprises the amino acid sequence at amino acid positions 15, 16, 20, 21, 22, 40, 41, 52, 57, 58, 73, 85, 87, 88, 91, 102, 109, 132, 157, 177, 186, 200, 213, 217, 231, 232, 242, 243, 262, 263, 264, 265, 273, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 21, 322, 328, 384, 386, 401, 402, 403, 404, 406, 407, 440, 476, 480, 491, 495, 498, 503, 504, 506, 507, 508, 511, 514, 520, 521, 523, 524, 525, 526, 527, 528, 529, 530, 533, 534, 535, 536, 537, 538, 539, 540, 542, 553, 554, 555, 556, 557, 558, 559, 560, 562, 563, 566, 570, 572, 581, 582, 584, 585, 586, 587, 589, 592, 593, 594, 595, 596, 597, 599, 601, 602, 603, 605, 607, 616, 665, 671, 674, 675, 677, 684, 688, 696 , 704, 705, 706, 728, 735, 747, 748, 749, 750, 751, 753, 755, 756, 762, 763, 764, 766, 772, 773, 779, 793, 803, 814, 820, or 849 or a combination thereof, where the amino acid positions are relative to the reference sequence of SEQ ID NO: 8, 332, 462 or 606.

[0181] In some of the foregoing embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least the amino acid residues 15A / G / K / N, 16R, 20A / C, 21K / Q / S, 22K, 40A, 41F, 52R, 57T, 58N, 73A, 85E / P / R / S, 87N, 88T, 91K, 102V / M / S, 109P, 132Y, 157G, 177T, 186E, 200V, 213P, 217E, 231E, 232C, 242Q, 243L / S, 262L, 263A, 264T, 265I, 273M, 299N, 321G, 322N / S, 328I, 384Y, 386V, 401A / G / I, 402G / R, 403L / R, 404S / T, 406K / Q, 407R / W, 440G, 476I / N, 480E / V / W, 491G, 495E / M / S, 498D, 503I / V, 504M, 5 06P, 507K, 508H, 511M, 514F, 520P, 521G / W / Y, 523A / K / V, 524G / K / Q, 525L / V, 526T, 527V / W, 528A / Q / R / W, 529S, 530 G / P / R / W, 533L / P / Q / V, 534H / W, 535K, 536R, 537G / L / W, 538A, 539L / R, 540H / V, 542G / M / T / W, 553F / K / N / R, 554E, 555 H / K / M / W, 556F / M / P / W, 557G / H, 558R / S / V / Q, 559D / G / P, 560G / M, 562S, 563L, 566A, 570R, 572I, 581A, 582F, 584N, 58 5KR, 586M, 587Q / S, 589G / L / R / S / W, 592G / T / V, 593N, 594C / Q / T / V / W, 595A / P / R, 596L / R / W, 597E, 599G / S / T, 601M / P , 602V, 603G / V / W, 605E / A, 607N, 616A, 665V, 671E / R, 674T, 675L, 677M, 684V, 688I, 696H / V, 704P, 705W, 706E, 728 K, 735G / L, 747T, 748Y, 749L / R / T, 750S / P, 751H, 753K / V, 755P, 756N / T, 762M / Q / V, 763G / Y, 764A / I / V, 766Y, 772I, 773R, 779I, 793G, 803C / R, 814E, 820A, or 849T or combinations thereof, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO: 8, 332, 462 or 606.

[0182] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least a substitution at amino acid position 40, 85, 102, 132, 157, 177, 262, 263, 521, 748 or 750, or a combination thereof, wherein the amino acid positions are relative to a reference sequence of SEQ ID NO: 8, 332, 462 or 606.

[0183] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least amino acid residues 40A, 85E, 102S, 132Y, 177T, 157G, 262L, 263A, 521G, 748Y, or 750S, or a combination thereof, where the amino acid positions are relative to the reference sequence of SEQ ID NO: 8, 332, 462, or 606.

[0184] In some embodiments, the engineered DNA polymerase comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:8 or a reference sequence corresponding to SEQ ID NO:8, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:8 or a reference sequence corresponding to SEQ ID NO:8.

[0185] In some embodiments, the polypeptide sequence of an engineered DNA polymerase comprises the amino acid positions 22 / 407, 328, 401, 402, 403, 404, 406, 407, 503, 504, 506, 521, 523, 524, 525, 526, 527, 528, 529, 530, 531, 533, 534, 535, 536, 537, 538, 539, 540, 542, 553, 554, 555, 556, 557, 558, 559 , 560, 563, 581, 582, 585, 586, 587, 589, 592, 592, 592, 593, 594, 595, 596, 597, 598, 599, 601, 602, 603, 605, 607, 696, 747, 749, 751, 762, 763, 764, 766, 773, 803, or 403 / 553, where the amino acid positions are relative to the reference sequence of SEQ ID NO:8.

[0186] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions 599S, 530G, 596L, 696H, 542W, 530R, 553F, 533V, 555M, 594V, 594W, 536R, 585K, 401G, 597E, 553K, 402R, 763Y, 762V, 605E, 530P, 506P, 589G, 558S, 553N, 559P, 751H, 589S, 747T, 560 M, 696V, 540V, 594C, 556W, 589R, 407W, 557H, 559G, 599T, 521Y, 605A, 559D, 534H, 592G, 533P, 529S, 524G, 749R, 766Y, 55 6P, 595P, 533Q, 603V, 537G, 589W, 598W, 22K / 407R, 555W, 539R, 531Q, 581A, 803R, 538A, 404T, 406Q, 537L, 595R, 534W, 40 4S, 592V, 521W, 603G, 401I, 595A, 762Q, 530W, 558V, 527W, 596W, 603W, 528W, 504M, 587Q, 587S, 523V, 521G, 558R, 558Q, 5 93N, 525V, 749L, 503V, 527V, 554E, 535K, 592T, 528A, 585R, 401A, 586M, 764I, 556M, 763G, 406K, 582F, 540H, 560G, 402G, 594Q, 539L, 602V, 523A, 749T, 542T, 764A, 523K, 607N, 525L, 403L, 526T, 528R, 599G, 537W, 803C, 556F, 557G, 601M, 596R, 563L, 601P, 773R, 553R, 542M, 594T, 533L, 328I, 555K, 542G, 528Q, or 403R / 553K, where the amino acid positions are relative to the reference sequence of SEQ ID NO:8.

[0187] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions N599S, K530G, S596L, R696H, R542W, K530R, Q553F, T533V, R555M, S594V, S594W, S536R, Q585K, S401G, D597E, Q553K, N402R, A763Y, A762V, I605E, K530P, R506P, A589G, A558S, Q553N, K559P, E751H, A589S, R747T, L560M, R69 6V, T540V, S594C, E556W, A589R, S407W, L557H, K559G, N599T, A521Y, I 605A, K559D, S534H, R592G, T533P, G529S, R524G, V749R, V766Y, E556P, S595P, T533Q, I603V, V537G, A589W, P598W, Q22K / S407R, R555W, E539R , R531Q, T581A, H803R, L538A, Q404T, A406Q, V537L, S595R, S534W, Q404 S, R592V, A521W, I603G, S401I, S595A, A762Q, K530W, A558V, K527W, S5 96W, I603W, T528W, N504M, G587Q, G587S, R523V, A521G, A558R, A558Q, L 593N, T525V, V749L, L503V, K527V, Y554E, A535K, R592T, T528A, Q585R , S401A, T586M, E764I, E556M, A763G, A406K, R582F, T540H, L560G, N402 G, S594Q, E539L, N602V, R523A, V749T, R542T, E764A, R523K, T607N, T525L, N403L, A526T, T528R, N599G, V537W, H803C, E556F, L557G, Q601M, S596R, T563L, Q601P, Q773R, Q553R, R542M, S594T, T533L, V328I, R555K, R542G, T528Q, or N403R / Q553K, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO:8.

[0188] In some embodiments, the engineered DNA polymerase comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:332 or a reference sequence corresponding to SEQ ID NO:332, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:332 or a reference sequence corresponding to SEQ ID NO:332.

[0189] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises the amino acid positions 15, 20, 21, 52, 85, 87, 91, 102, 243, 321, 322, 384, 404, 476, 480, 480, 495, 542, 570, 671, 675, 704, 728, 735, 753, 755, 762, 764, 793, 820, 1 6 / 735, 750 / 849, 524 / 581, 403 / 404 / 524 / 542 / 555 / 762 / 764, 404 / 524 / 542 / 589 / 762 / 764, 524 / 542 / 581 / 762 / 764, 542 / 762 / 764, amino acid positions relative to the reference sequence of SEQ ID NO: 332.

[0190] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions 404S, 542G, 762M, 524Q / 542G / 581A / 762M / 764V, 404S / 524Q / 542G / 589L / 762M / 764V, 764V, 403R / 404S / 524Q / 542G / 555H / 762M / 764V, 476N, 542G / 762M / 764V, 728K, 52R, 476I, 675L, 750S / 849T, 102S, 21C, 750S / 849T ... and including 55P, 21S, 321G, 20A, 21K, 87N, 20C, 16R / 735L, 21Q, 704P, 735G, 384Y, 480W, 102M, 793G, 322S, 322N, 570R, 480V, 753V, 753K, 524Q / 581A, 91K, 243L, 243S, 671E, 85S, 495M, 15A, 15N, 15K, 820A, 495E, 85E, 85R, 480E, 15G, or 671R, where the amino acid positions are relative to the reference sequence of SEQ ID NO: 332.

[0191] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions Q404S, R542G, A762M, R524Q / R542G / T581A / A762M / E764V, Q404S / R524Q / R542G / A589L / A762M / E764V, E764V, N403R / Q404S / R524Q / R542G / R555H / A762M / E764V, L476N, R542G / A762M / E764V, R728K, S52R, L476I, P675L, P750S / A849T, V102S, F21C, K755 P, F21S, E321G, L20A, F21K, P87N, L20C, Q16R / E735L, F21Q, D704P, E735G, R384Y, Q480W, V102M, P793G, R322S, R322N, K570R, Q480V, L753V, L753K, R524Q / T581A, H91K, P243L, P243S, V671E, P85S, R495M, V15A, V15N, V15K, R820A, R495E, P85E, P85R, Q480E, V15G, or V671R, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO: 332.

[0192] In some embodiments, the engineered DNA polymerase comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:462 or a reference sequence corresponding to SEQ ID NO:462, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:462 or a reference sequence corresponding to SEQ ID NO:462.

[0193] In some embodiments, the polypeptide sequence of the engineered DNA polymerase is selected from the group consisting of amino acid positions 750 / 820, 21 / 52, 20 / 21 / 85 / 322 / 476 / 495, 20 / 85 / 200 / 322 / 476 / 495 / 750, 476 / 750, 20 / 476, 20 / 322 / 386, 85 / 322 / 476, 52 / 322 / 498 / 750, 20 / 322 / 476 / 820, 85 / 476 / 495 / 820, 21 / 85 / 322 / 820, 20 / 299 / 322 / 386 / 476 / 495 / 820, 20 / 322, 21 / 820 / 849, 476, 322 / 820, 21 / 322 / 386 / 820, 322 / 386 / 495, 85 / 386 / 495 / 750, 20 / 85 / 476 / 750, 20 / 386 / 476, 85 / 322 / 386 / 476 / 495, 20 / 495 / 820 , 750, 21 / 322 / 495, 52 / 386 / 495 / 820, 21 / 322, 85 / 322 / 750 / 820, 20 / 52 / 85, 21 / 52 / 572, 20 / 85 / 495 / 849, 85 / 750, 21 / 495 / 820, 273 / 322 / 849, 495, 322 / 750 / 820, 52 / 476 / 495 / 566 / 750 / 849, 386 / 495, 495 / 820, 21 / 3 and comprising at least a substitution or set of substitutions in: 22 / 495 / 750 / 820, 21 / 85 / 322 / 386 / 495 / 820 / 849, 476 / 495 / 750, 386 / 849, 476 / 495, 85 / 476 / 849, 21 / 322 / 750, 20 / 85 / 566 / 820, 386 / 750 / 849 or a combination thereof, where the amino acid positions are relative to the reference sequence of SEQ ID NO:462.

[0194] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions 750S / 820A, 21C / 52R, 20C / 21C / 85E / 322N / 476N / 495E, 20C / 85E / 200V / 322N / 476N / 495S / 750S, 476N / 750S, 20C / 476N, 20C / 322N / 386V, 85E / 322N / 476N, 52R / 322N / 498D / 750S, 20C / 322N / 476N / 820A, 85E / 476N / 495E / 820A, 21C / 85E / 322N / 820A, 20C / 299N / 322N / 386V / 476N / 495E / 820A, 20C / 322N, 21C / 820A / 849T, 476N, 322N / 820 A, 21C / 322N / 386V / 820A, 322N / 386V / 495E, 85E / 386V / 495E / 750S, 20C / 85E / 476N / 750S, 20C / 386V / 476N, 85E / 322N / 386V / 476N / 4 95S, 20C / 495E / 820A, 750S, 21C / 322N / 495E, 52R / 386V / 495S / 820A, 21C / 322N, 85E / 322N / 750S / 820A, 20C / 52R / 85E, 21C / 52R / 572 I, 20C / 85E / 495E / 849T, 85E / 750S, 21C / 495E / 820A, 273M / 322N / 849T, 495E, 322N / 750S / 820A, 52R / 476N / 495E / 566A / 750S / 849T, 386V / 495E, 495S / 820A, 21C / 322N / 495E / 750S / 820A, 21C / 85E / 322N / 386V / 495S / 820A / 849T, 495S, 476N / 495E / 750S, 386V / 849T, 476N / 495E, 85E / 476N / 849T, 21C / 322N / 750S, 20C / 85E / 566A / 820A, or 386V / 750S / 849T, where the amino acid positions are relative to the reference sequence of SEQ ID NO:462.

[0195] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions P750S / R820A, F21C / S52R, L20C / F21C / P85E / R322N / L476N / R495E, L20C / P85E / A200V / R322N / L476N / R495S / P750S, L476N / P750S, L20C / L476N, L20C / R322N / R386V, P85E / R322N / L476N, S52R / R322N / G498D / P750S, L20C / R322N / L476N / R820A, P 85E / L476N / R495E / R820A, F21C / P85E / R322N / R820A, L20C / T299N / R322N / R 386V / L476N / R495E / R820A, L20C / R322N, F21C / R820A / A849T, L476N, R322N / R820A, F21C / R322N / R386V / R820A, R322N / R386V / R495E, P85E / R386V / R49 5E / P750S, L20C / P85E / L476N / P750S, L20C / R386V / L476N, P85E / R322N / R386 V / L476N / R495S, L20C / R495E / R820A, P750S, F21C / R322N / R495E, S52R / R38 6V / R495S / R820A, F21C / R322N, P85E / R322N / P750S / R820A, L20C / S52R / P85 E, F21C / S52R / V572I, L20C / P85E / R495E / A849T, P85E / P750S, F21C / R495E / R820A, V273M / R322N / A849T, R495E, R322N / P750S / R820A, S52R / L476N / R495 E / D566A / P750S / A849T, R386V / R495E, R495S / R820A, F21C / R322N / R495E / P750S / R820A, F21C / P85E / R322N / R386V / R495S / R820A / A849T, R495S, L476N / R495E / P750S, R386V / A849T, L476N / R495E, P85E / L476N / A849T, F21C / R322N / P750S, L20C / P85E / D566A / R820A, or R386V / P750S / A849T,This is compared to the reference sequence of SEQ ID NO: 462.

[0196] In some embodiments, the engineered DNA polymerase comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:606 or a reference sequence corresponding to SEQ ID NO:606, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:606 or a reference sequence corresponding to SEQ ID NO:606.

[0197] In some embodiments, the polypeptide sequence of the engineered DNA polymerase is selected from the group consisting of amino acid positions 299 / 386 / 566 / 820, 476 / 820 / 849, 21 / 322 / 476 / 495 / 820, 177, 21 / 495, 476 / 820, 20 / 52 / 299, 52 / 299, 322 / 820, 20 / 820, 20 / 299 / 386 / 476, 386 / 476 / 820, 476 / 495 / 820, 38 6 / 476 / 495, 20 / 21 / 299 / 322 / 386, 322 / 386 / 495, 21 / 299 / 322 / 476 / 495 / 820, 21 / 299 / 386 / 820, 299 / 476 / 820, 20 / 21, 21 / 85 / 102 / 750, 705, 21 / 386 / 476 / 820, 820, 21 / 299 / 322, 20 / 21 / 322 / 386 / 820, 299, 21 / 299 / 386 / 476, 109, 322 / 495, 491, 52 / 820, 21 / 386 / 820, 20 / 21 / 495, 21 / 299 / 322 / 495 / 566 / 820, 20 / 21 / 299 / 495, 756, 386 / 820, 495, 511, 21 / 52 / 242 / 386 / 495 / 820, 299 / 476 / 495, 706, 21 / 299 / 386 / 476 / 495, 21 / 299 / 322 / 495, 21 / 476 / 8 49, 299 / 322 / 476 / 820, 21 / 52 / 299 / 322 / 820, 20 / 21 / 566, 20 / 52, 322 / 386 / 495 / 566 / 820, 21 / 299, 21 / 299 / 386, 386 / 849, 52 / 476, 52 / 299 / 322 / 386 / 495, or 440 amino acid positions relative to the reference sequence of SEQ ID NO:606.

[0198] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions 299N / 386V / 566A / 820A, 476N / 820A / 849T, 21C / 322N / 476N / 495E / 820A, 177T, 21C / 495E, 476N / 820A, 20C / 52R / 299N, 52R / 299N, 322N / 820A, 20C / 820A, 20C / 299N / 386V / 476N, 386V / 476N / 820A, 476N / 495E / 820A A、386V / 476N / 495E、20C / 21C / 299N / 322N / 386V、322N / 386V / 495E、21C / 299N / 322N / 476N / 495E / 820A、21C / 299N / 386V / 820A、299N / 47 6N / 820A, 20C / 21C, 21C / 85P / 102V / 750P, 705W, 21C / 386V / 476N / 820A, 820A, 21C / 299N / 322N, 20C / 21C / 322N / 386V / 820A, 299N, 21C / 29 9N / 386V / 476N, 109P, 322N / 495E, 491G, 52R / 820A, 21C / 386V / 820A, 20C / 21C / 495E, 21C / T99N / 322N / 495E / 566A / 820A, 20C / 21C / 299N / 495E, 756T, 386V / 820A, 495E, 511M, 21C / 52R / 242Q / 386V / 495E / 820A, 299N / 476N / 495E, 706E, 21C / 299N / 386V / 476N / 495E, 21C / 299N / 322N / 495E, 21C / 476N / 849T, 299N / 322N / 476N / 820A, 21C / 52R / 299N / 322N / 820A, 20C / 21C / 566A, 20C / 52R, 322N / 386V / 495E / 566A / 820A, 21C / 299N, 21C / 299N / 386V, 386V / 849T, 52R / 476N, 52R / 299N / 322N / 386V / 495E, or 440G, where the amino acid positions are relative to the reference sequence of SEQ ID NO: 606.

[0199] In some embodiments, the polypeptide sequence of the engineered DNA polymerase comprises at least one substitution or set of substitutions T299N / R386V / D566A / R820A, L476N / R820A / A849T, F21C / R322N / L476N / R495E / R820A, R177T, F21C / R495E, L476N / R820A, L20C / S52R / T299N, S52R / T299N, R322N / R820A, L20C / R820A, L20C / T299N / R386V / L476N, R386V / L476N / R820A, L476 N / R495E / R820A, R386V / L476N / R495E, L20C / F21C / T299N / R322N / R386V, R 322N / R386V / R495E, F21C / T299N / R322N / L476N / R495E / R820A, F21C / T299 N / R386V / R820A, T299N / L476N / R820A, L20C / F21C, F21C / E85P / S102V / S75 0P, Y705W, F21C / R386V / L476N / R820A, R820A, F21C / T299N / R322N, L20C / F2 1C / R322N / R386V / R820A, T299N, F21C / T299N / R386V / L476N, K109P, R322N / R495E, A491G, S52R / R820A, F21C / R386V / R820A, L20C / F21C / R495E, F21C / T299N / R322N / R495E / D566A / R820A, L20C / F21C / T299N / R495E, A756T, R3 86V / R820A, R495E, T511M, F21C / S52R / P242Q / R386V / R495E / R820A, T299N / L476N / R495E, G706E, F21C / T299N / R386V / L476N / R495E, F21C / T299N / R32 2N / R495E, F21C / L476N / A849T, T299N / R322N / L476N / R820A, F21C / S52R / T2 99N / R322N / R820A, L20C / F21C / D566A, L20C / S52R, R322N / R386V / R495E / D 566A / R820A, F21C / T299N, F21C / T299N / R386V, R386V / A849T, S52R / L476N,S52R / T299N / R322N / R386V / R495E, or E440G, where the amino acid positions are relative to the reference sequence of SEQ ID NO: 606.

[0200] In some embodiments, the engineered DNA polymerase comprises a polypeptide sequence comprising a substitution at at least one amino acid position provided in Tables 4.1, 5.1, 6.1, 7.1 and 8.1, wherein the substitution is relative to a reference sequence corresponding to residues 12-850 of SEQ ID NO:2, 8, 332, 462 or 606 or a reference sequence corresponding to SEQ ID NO:2, 8, 332, 462 or 606.

[0201] In some embodiments, the engineered DNA polymerase comprises a polypeptide sequence comprising at least one substitution as provided in Tables 4.1, 5.1, 6.1, 7.1, and 8.1, where the substitution is relative to a reference sequence comprising residues 12-850 of SEQ ID NO:2, 8, 332, 462, or 606, or a reference sequence of SEQ ID NO:2, 8, 332, 462, or 606.

[0202] In some embodiments, the engineered DNA polymerase comprises a polypeptide sequence that includes at least a substitution or set of substitutions provided in Tables 4.1, 5.1, 6.1, 7.1 and 8.1, where the substitution or set of substitutions is compared to a reference sequence including residues 12-850 of SEQ ID NO:2, 8, 332, 462 or 606, or a reference sequence of SEQ ID NO:2, 8, 332, 462 or 606.

[0203] In some embodiments, the engineered DNA polymerase comprises a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of an even-numbered SEQ ID NO: set forth in Tables 4.1, 5.1, 6.1, 7.1, and 8.1 or a reference sequence of an even-numbered SEQ ID NO: set forth in Tables 4.1, 5.1, 6.1, 7.1, and 8.1. In some embodiments, the engineered DNA polymerase comprises a polypeptide sequence that includes residues 12 to 850 of an even-numbered SEQ ID NO: set forth in Tables 4.1, 5.1, 6.1, 7.1, and 8.1, or a polypeptide sequence that includes an even-numbered SEQ ID NO: set forth in Tables 4.1, 5.1, 6.1, 7.1, and 8.1.

[0204] In some embodiments, the engineered DNA polymerase is selected from the group consisting of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178 8, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200 , 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 3 26, 328, 330, 332, 334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, ​​384, 386, 38 8, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 440, 442, 444, 446, 448, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450 , 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512,514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 565, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 59 6, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692, 694, 696, 698, 700, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748, 750, 752, 754, 756, 758, 76 The polypeptide sequences include those having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12 to 850 of 0, 7762, 764, 766, 768, or 770.

[0205] In some embodiments, the engineered DNA polymerase is selected from the group consisting of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178 8, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200 , 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 3 26, 328, 330, 332, 334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, ​​384, 386, 38 8, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 440, 442, 444, 446, 448, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450 , 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512,514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 565, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 6 66, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692, 694, 696, 698, 700, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730, 732, 734, 736, 738, 74 The polypeptides include a polypeptide sequence or fragment thereof comprising residues 12 to 850 of 0, 742, 744, 746, 748, 750, 752, 754, 756, 758, 760, 7762, 764, 766, 768, or 770, and optionally have 1, 2, 3, 4, 5, 6, 7, 8, 9 or up to 10 substitutions in the polypeptide sequence.

[0206] In some embodiments, the engineered DNA polymerase is selected from the group consisting of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178 8, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200 , 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 3 26, 328, 330, 332, 334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, ​​384, 386, 38 8, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 440, 442, 444, 446, 448, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450 , 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512,514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 565, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594 , 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 676 , 678, 680, 682, 684, 686, 688, 690, 692, 694, 696, 698, 700, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748, 750, 752, 754, 75 6, 758, 760, 7762, 764, 766, 768, or 770.

[0207] In some embodiments, the engineered DNA polymerase is selected from the group consisting of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178 8, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200 , 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 3 26, 328, 330, 332, 334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, ​​384, 386, 38 8, 390, 392, 394, 396, 398, 400, 402, 404, 406, 408, 440, 442, 444, 446, 448, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450 , 452, 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512,514, 516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 565, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 58 8, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 6 64, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692, 694, 696, 698, 700, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730, 732, 734, 736 , 738, 740, 742, 744, 746, 748, 750, 752, 754, 756, 758, 760, 7762, 764, 766, 768, or 770, or a fragment thereof, wherein the polypeptide optionally has 1, 2, 3, 4, 5, 6, 7, 8, 9 or up to 10 substitutions in the polypeptide sequence.

[0208] In some embodiments, the engineered DNA polymerase polypeptide has one, two, three, four or up to five substitutions in the polypeptide sequence. In some embodiments, the engineered DNA polymerase polypeptide has one, two, three or four substitutions in the polypeptide sequence. In some embodiments, the substitutions include non-conservative or conservative substitutions. In some embodiments, the substitutions include conservative substitutions. In some embodiments, the substitutions include non-conservative substitutions. In some embodiments, guidance regarding non-conservative and conservative substitutions is provided by the variants disclosed herein, including in the examples.

[0209] In some embodiments, the engineered DNA polymerase comprises a polypeptide sequence comprising residues 12-850 of SEQ ID NO: 2, 8, 332, 462 or 606, where the polypeptide sequence optionally has 1, 2, 3, 4, 5, 6, 7, 8, 9 or up to 10 substitutions in the polypeptide sequence. In some embodiments, the engineered DNA polymerase comprises a polypeptide sequence comprising SEQ ID NO: 2, 8, 332, 462 or 606, where the polypeptide sequence optionally has 1, 2, 3, 4, 5, 6, 7, 8, 9 or up to 10 substitutions in the polypeptide sequence. In some embodiments, the engineered DNA polymerase comprises 1, 2, 3, 4, up to 5 substitutions in the polypeptide sequence. In some embodiments, the engineered DNA polymerase comprises 1, 2, 3, or 4 substitutions in the polypeptide sequence.

[0210] It is clear that the description herein, including the examples and tables, provides structural information that correlates specific amino acid sequence features with functional activity / properties of engineered DNA polymerase polypeptides. This structure-function correlation information is provided in the form of specific amino acid residue differences compared to the reference engineered polypeptides of SEQ ID NO: 2, 8, 332, 462 or 606, and is associated with experimentally determined activity data for exemplary engineered DNA polymerase polypeptides. Such information provides guidance and information regarding substitutions to be made in the preparation of engineered DNA polymerase variants.

[0211] In some embodiments, the engineered DNA polymerases of the present disclosure have DNA polymerase activity. In some embodiments, the engineered DNA polymerase has at least one improved property compared to a reference or control DNA polymerase. In some embodiments, the engineered DNA polymerase has one or more improved properties selected from increased activity; increased DNA product yield; increased thermostability; increased processivity; increased fidelity; increased DNA template sensitivity, and increased product yield in a PCR reaction compared to a reference or control DNA polymerase. In some embodiments, the reference or control DNA polymerase has a sequence corresponding to residues 12-850 of SEQ ID NO: 2, 8, 332, 462, or 606, or a sequence corresponding to SEQ ID NO: 2, 8, 332, 462, or 606. In some embodiments, the reference DNA polymerase has a sequence corresponding to residues 12-850 of SEQ ID NO: 2, or a sequence corresponding to SEQ ID NO: 2. In some embodiments, the reference or comparator DNA polymerase is a wild-type DNA polymerase selected from Pfu DNA polymerase from Pyrococcus furiosus, Group B DNA polymerase from Thermococcus sp. strain 2319x1, and Taq DNA polymerase from Thermus aquaticus.

[0212] In some embodiments, the engineered DNA polymerase polypeptides described herein are isolated compositions. In some embodiments, the engineered DNA polymerase polypeptides are purified compositions, as further discussed herein.

[0213] In some embodiments, the present disclosure further provides functional or biologically active fragments of the engineered DNA polymerase polypeptides described herein. Thus, for any and all embodiments herein of engineered DNA polymerases, functional or biologically active fragments of the engineered DNA polymerases are hereby provided. In some embodiments, the functional or biologically active fragments of the engineered DNA polymerases comprise at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the activity of the DNA polymerase polypeptide (i.e., parent DNA polymerase) from which it is derived.

[0214] In some embodiments, the functional or biologically active fragment comprises at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% of the parent sequence of the DNA polymerase. In some embodiments, the functional fragment is truncated by less than 5, less than 10, less than 15, less than 10, less than 25, less than 30, less than 35, less than 40, less than 45, and less than 50 amino acids.

[0215] In some embodiments, a functional fragment of an engineered DNA polymerase herein comprises at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the parent sequence of the engineered DNA polymerase. In some embodiments, the functional fragment is truncated by less than 5, less than 10, less than 15, less than 10, less than 25, less than 30, less than 35, less than 40, less than 45, less than 50, less than 55, less than 60, less than 65, or less than 70 amino acids.

[0216] In some embodiments, a functional or biologically active fragment of an engineered DNA polymerase polypeptide described herein comprises at least a substitution or set of substitutions in the amino acid sequence of an engineered DNA polymerase described herein. Thus, in some embodiments, a functional or biologically active fragment of an engineered DNA polymerase displays enhanced or improved properties relative to the substitution or set of substitutions in the parent engineered DNA polymerase. Polynucleotides encoding engineered polypeptides, expression vectors and host cells

[0217] In another aspect, the present disclosure provides a recombinant polynucleotide encoding the engineered DNA polymerase polypeptide described herein. In some embodiments, the recombinant polynucleotide is operably linked to one or more heterologous regulatory sequences that control gene expression to create a DNA polymerase capable of expressing a polypeptide. In some embodiments, an expression construct containing at least one heterologous polynucleotide encoding an engineered DNA polymerase polypeptide(s) is introduced into a suitable host cell to express the corresponding DNA polymerase polypeptide(s).

[0218] As will be apparent to those skilled in the art, the availability of protein sequences and knowledge of the codons corresponding to various amino acids provide a description of any polynucleotide that can code for a subject polypeptide. The degeneracy of the genetic code, in which the same amino acid is coded for by alternative or synonymous codons, allows for an extremely large number of nucleic acids to be generated, all of which code for the engineered DNA polymerase polypeptides of the present disclosure. Thus, the present disclosure provides methods and compositions for the production of any and all possible variations of engineered DNA polymerase polynucleotides that can be generated that code for the engineered DNA polymerase polypeptides described herein by selecting combinations based on possible codon choices, and all such variations of recombinant polynucleotides should be considered specifically disclosed for any of the polypeptides described herein, including the amino acid sequences presented in the Examples (e.g., Tables 4.1, 5.1, 6.1, 7.1 and 8.1) and in the Sequence Listing.

[0219] In some embodiments, codons are preferably optimized for use by the selected host cell for protein production.For example, the preferred codons used in bacteria are typically used for expression in bacteria, and the preferred codons used in mammalian cells are typically used for expression in mammalian cells.As a result, the codon-optimized polynucleotide encoding the engineered DNA polymerase polypeptide contains preferred codons at about 40%, 50%, 60%, 70%, 80%, 90% or more than 90% of the codon positions in the full-length coding region.

[0220] In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase comprising a polypeptide acids sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:2, 8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO:2, 8, 332, 462 or 606, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:2, 8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO:2, 8, 332, 462 or 606.

[0221] In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase comprising a polypeptide acid sequence having at least at least 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:2 or a reference sequence corresponding to SEQ ID NO:2, wherein the polypeptide sequence comprises one or more substitutions as described herein compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:2 or a reference sequence corresponding to SEQ ID NO:2.

[0222] As described above, in some embodiments, the recombinant polynucleotide comprises an amino acid sequence at amino acid positions 15, 16, 20, 21, 22, 40, 41, 52, 57, 58, 73, 85, 87, 88, 91, 102, 109, 132, 157, 177, 186, 200, 213, 217, 231, 232, 242, 243, 262, 263, 264, 265, 273, 299, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, ​​383, 384, 385, 386, 387, 28, 384, 386, 401, 402, 403, 404, 406, 407, 440, 476, 480, 491, 495, 498, 503, 504, 506, 507, 508, 511, 514, 520, 521, 523, 524, 525, 526, 527, 528, 529, 530, 533, 534, 535, 536, 537, 538, 539, 540, 542, 553, 554 , 555, 556, 557, 558, 559, 560, 562, 563, 566, 570, 572, 581, 582, 584, 585, 586, 587, 589, 592, 593, 594, 595, 596, 597, 599, 601, 602, 603, 605, 607, 616, 665, 671, 674, 675, 677, 684, 688, 696, 704, 705, 706, 707, 709, 710, 711, 712, 713, 714, 715, 716, 717, 718, 719, 720, 721, 722, 723, 724, 725, 726, 727, 728, 729, 730, 731, 732, 733, 734, 735, 736, 737, 738, 739, 740, 741, 742, 743, 744, 745, 746, 747, 748, 749, 750, 751, 752, 753, 754, 755, 756, 757, 758, 759, 760, 761, 762, 763, 764, 765, 766, 767 28, 735, 747, 748, 749, 750, 751, 753, 755, 756, 762, 763, 764, 766, 772, 773, 779, 793, 803, 814, 820, or 849, or a combination thereof, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0223] In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase polypeptide comprising a polypeptide acid sequence that includes at least a substitution at amino acid position 40, 85, 102, 132, 157, 177, 262, 263, 503, 521, 748, or 750, or a combination thereof, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0224] In some embodiments, the recombinant polynucleotide is selected from the group consisting of amino acid positions 213 / 503 / 508 / 584 / 748, 40 / 132 / 748, 40 / 132 / 157 / 262 / 263 / 748, 132, 40 / 132 / 503 / 748, 40 / 132 / 157 / 503 / 562, 40 / 132 / 213 / 748 / 814, 132 / 157 / 562 / 584, 132 / 584 / 748, 40 / 132 / D231E / I684V / H748Y, 40 / 132, 40 / 41 / 132 / 562 / 684 / 748, 41 / 213 / 231 / 503 / 650 / 674 / 748 , 132 / 231 / 503 / 748, 40 / 132Y / S157G / L503I, 503 / 748 / 814, 40 / 132 / 231 / 50 3 / 674 / 748, 40 / 88 / 132 / 503 / 684 / 748, 132 / 157 / 213 / 674 / 748 / 814, 157 / 26 3 / 748, 40 / 748, 41 / 157 / 231 / 262 / 748 / 814, 40 / 213 / 503 / 562 / 584 / 748, 523 / 524, 40 / 132 / 503 / 514 / 650 / 674, 40 / 132 / 157 / 213 / 231, 41 / 213 / 520 / 814, 4 0 / 41 / 157 / 231 / 503, 40 / 157 / 503, 40 / 132 / 562 / 748, 132 / 748, 40 / 41 / 132 / 562 / 748, 88 / 213 / 503 / 584 / 684 / 748, 57 / 58 / 523 / 616 / 677, 40 / 213 / 231 / 503 / 514 / 562 / 748, 132 / 562, 213 / 503 / 650, 40 / 41 / 88 / 231 / 748 / 814, 41 / 213 / 262 / 562, 41 / 88 / 231 / 748, 213 / 263 / 748, 40 / 157 / 213, 157 / 520, 40 / 132 / 263 / 503 / 674 / 814, 40 / 41, 524 / 665 / 756, 58 / 186 / 217 / 523 / 524 / 677, 40 / 41 / 748, 132 / 514, 520, 41 / 213 / 503 / 562, 231 / 503 / 748 / 772, 503 / 562, 73 / 232 / 514 / 584 / 814, 58 / 507 / 616, 132 / 262 / 520 / 562 / 684 / 748, 88 / 562 / 814, 41 / 88 / 157 / 814, 88 / 157 / 213 / 674 / 684, 57 / 58 / 523 / 779, 40 / 132 / 157 / 514 / 520 / 684,40 / 41 / 213 / 684 / 772, 40 / 41 / 231 / 503 / 814, 88 / 213 / 503 / 584 / 814, 40 / 41 / 132 / 562 / 584, 41 / 88 / 213 / 231 / 503 / 650 / 748, 40 / 503, 40 / 132 / 213 / 231 / 520 / 562 / 650 / 814, 40 / 41 / 132 / 231 / 262 / 503 / 562 / 584 / 748 / 814, 57 / 58 / 264 / 265 / 524 / 688, 88 / 132 / 157 / 262 / 263 / 520 / 562, 88 / 132 / 157 / 2 In some embodiments, the polypeptides encode engineered DNA polymerase polypeptides that include a polypeptide acid sequence that includes at least a substitution or set of substitutions in 62 / 503 / 514 / 562 / 650, 40 / 584 / 674 / 748, 40 / 41 / 132 / 263 / 503, 584 / 748, 40 / 213 / 674, 40 / 41 / 88T / 132 / 503 / 562 / 584 / 748, 88 / 213 / 514 / 562 / 748 / 814, 263 / 520 / 814, or 40 / 41 / 88 / 157, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0225] In some embodiments, the recombinant polynucleotide comprises a sequence similar to that at amino acid position 22 / 407, 328, 401, 402, 403, 404, 406, 407, 503, 504, 506, 521, 523, 524, 525, 526, 527, 528, 529, 530, 531, 533, 534, 535, 536, 537, 538, 539, 540, 542, 553, 554, 555, 556, 557, 558, 559, 560, 563, 581, 582, 585, 586 , 587, 589, 592, 592, 592, 593, 594, 595, 596, 597, 598, 599, 601, 602, 603, 605, 607, 696, 747, 749, 751, 762, 763, 764, 766, 773, 803, or a combination thereof, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0226] In some embodiments, the recombinant polynucleotide comprises a nucleotide sequence at amino acid positions 15, 20, 21, 52, 85, 87, 91, 102, 243, 321, 322, 384, 404, 476, 480, 480, 495, 542, 570, 671, 675, 704, 728, 735, 753, 755, 762, 764, 793, 820, 16 / 735, 750 / 849, 524 / 581, 403 The present invention also encodes an engineered DNA polymerase polypeptide comprising a polypeptide acid sequence that includes at least a substitution or set of substitutions in 404 / 524 / 542 / 555 / 762 / 764, 404 / 524 / 542 / 589 / 762 / 764, 524 / 542 / 581 / 762 / 764, or 542 / 762 / 764, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0227] In some embodiments, the recombinant polynucleotide comprises an amino acid sequence at amino acid positions 750 / 820, 21 / 52, 20 / 21 / 85 / 322 / 476 / 495, 20 / 85 / 200 / 322 / 476 / 495 / 750, 476 / 750, 20C / 476, 20 / 322 / 386, 85 / 322 / 476, 52 / 322 / 498 / 750, 20 / 322 / 476 / 820, 85 / 476 / 495 / 820, 21 / 85 / 32 2 / 820, 20 / 299 / 322 / 386 / 476 / 495 / 820, 20 / 322, 21 / 820 / 849, 476, 322 / 820, 21 / 322 / 386 / 820, 322 / 386 / 495, 85 / 386 / 495 / 750, 20 / 85 / 476 / 750, 20 / 386 / 476, 85 / 322 / 386 / 476 / 495, 20 / 495 / 820, 750, 21 / 322 / 495, 52 / 386 / 495 / 820, 21 / 322, 85 / 322 / 750 / 820, 20 / 52 / 85, 21 / 52 / 572, 20 / 85 / 495 / 849, 85 / 750, 21 / 495 / 820, 273 / 322 / 849, 495, 322 / 750 / 820, 52 / 476 / 495 / 566 / 750 / 849, 386 / 495, 495 / 820, 21 / 322 / 495 / 750 / 820, 21 / 85 / 322 / 386 / The present invention encodes an engineered DNA polymerase polypeptide comprising a polypeptide acid sequence that includes at least a substitution or set of substitutions in 495 / 820 / 849, 476 / 495 / 750, 386 / 849, 476 / 495, 85 / 476 / 849, 21 / 322 / 750, 20 / 85 / 566 / 820, 386 / 750 / 849 or a combination thereof, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0228] In some embodiments, the recombinant polynucleotide comprises an amino acid sequence at amino acid positions 299 / 386 / 566 / 820, 476 / 820 / 849, 21 / 322 / 476 / 495 / 820, 177, 21 / 495, 476 / 820, 20 / 52 / 299, 52 / 299, 322 / 820, 20 / 820, 20 / 299 / 386 / 476, 386 / 476 / 820, 476 / 495 / 820, 386 / 476 / 495, 20 / 21 / 29 9 / 322 / 386, 322 / 386 / 495, 21 / 299 / 322 / 476 / 495 / 820, 21 / 299 / 386 / 820, 299 / 476 / 820, 20 / 21, 21 / 85 / 102 / 750, 705, 21 / 386 / 476 / 820, 820, 21 / 299 / 322, 20 / 21 / 322 / 386 / 820, 299, 21 / 299 / 386 / 476, 109, 322 / 495, 491, 52 / 820, 21 / 386 / 820, 20 / 21 / 495, 21 / 299 / 322 / 495 / 566 / 820, 20 / 21 / 299 / 495, 756, 386 / 820, 495, 511, 21 / 52 / 242 / 386 / 495 / 820, 299 / 476 / 495, 706, 21 / 299 / 386 / 476 / 495, 21 / 299 / 322 / 495, 21 / 476 / 849, 299 / 322 / 476 / 820, 21 / 52 / 299 or 440, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0229] In some embodiments, the recombinant polynucleotide comprises an amino acid sequence at amino acid positions 22 / 40 / 132 / 157 / 262 / 263 / 407 / 748, 40 / 132 / 157 / 262 / 263 / 328 / 748, 40 / 132 / 157 / 262 / 263 / 401 / 748, 40 / 132 / 157 / 262 / 263 / 402 / 748, 40 / 132 / 157 / 262 / 263 / 403 / 748, 40 / 132 / 157 / 262 / 263 / 404 / 748, 40 / 132 / 157 / 262 / 263 / 406 / 748, 40 / 132 / 157 / 262 / 263 / 407 / 748, 40 / 132 / 157 / 262 / 263 / 503 / 748, 40 / 132 / 157 / 262 / 263 / 504 / 748, 40 / 132 / 157 / 262 / 263 / 506 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 748, 40 / 132 / 157 / 262 / 263 / 523 / 748, 40 / 132 / 157 / 262 / 263 / 524 / 748, 40 / 132 / 157 / 262 / 263 / 525 / 748, 40 / 132 / 157 / 262 / 263 / 526 / 748, 40 / 132 / 157 / 262 / 263 / 527 / 7 48, 40 / 132 / 157 / 262 / 263 / 528 / 748, 40 / 132 / 157 / 262 / 263 / 529 / 748, 40 / 132 / 157 / 262 / 263 / 530 / 748, 40 / 132 / 157 / 262 / 263 / 531 / 748, 40 / 132 / 157 / 262 / 263 / 533 / 748, 40 / 132 / 157 / 262 / 263 / 534 / 748, 40 / 132 / 157 / 262 / 263 / 535 / 748, 40 / 132 / 157 / 262 / 263 / 536 / 748, 40 / 132 / 157 / 262 / 263 / 537 / 74 8, 40 / 132 / 157 / 262 / 263 / 538 / 748, 40 / 132 / 157 / 262 / 263 / 539 / 748, 40 / 132 / 157 / 262 / 263 / 540 / 748, 40 / 132 / 157 / 262 / 263 / 542 / 748, 40 / 132 / 157 / 262 / 263 / 54 / 748, 40 / 132 / 157 / 262 / 263 / 553 / 748, 40 / 132 / 157 / 262 / 263 / 554 / 748, 40 / 132 / 157 / 262 / 263 / 555 / 748, 40 / 132 / 157 / 262 / 263 / 556 / 748,40 / 132 / 157 / 262 / 263 / 557 / 748、40 / 132 / 157 / 262 / 263 / 558 / 748、40 / 132 / 157 / 262 / 263 / 559 / 748、40 / 132 / 157 / 262 / 263 / 560 / 748、40 / 132 / 157 / 262 / 263 / 563 / 748、40 / 132 / 157 / 262 / 263 / 581 / 748、40 / 132 / 157 / 262 / 263 / 582 / 748、40 / 132 / 157 / 262 / 263 / 585 / 748、40 / 132 / 157 / 262 / 263 / 586 / 748、40 / 132 / 157 / 262 / 263 / 587 / 748、40 / 132 / 157 / 262 / 263 / 589 / 748、40 / 132 / 157 / 262 / 263 / 592 / 748、40 / 132 / 157 / 262 / 263 / 593 / 748、40 / 132 / 157 / 262 / 263 / 594 / 748、40 / 132 / 157 / 262 / 263 / 595 / 748、40 / 132 / 157 / 262 / 263 / 596 / 748、40 / 132 / 157 / 262 / 263 / 597 / 748、40 / 132 / 157 / 262 / 263 / 598 / 748、40 / 132 / 157 / 262 / 263 / 599 / 748、40 / 132 / 157 / 262 / 263 / 601 / 748、40 / 132 / 157 / 262 / 263 / 602 / 748、40 / 132 / 157 / 262 / 263 / 603 / 748、40 / 132 / 157 / 262 / 263 / 605 / 748、40 / 132 / 157 / 262 / 263 / 607 / 748、40 / 132 / 157 / 262 / 263 / 696 / 748、40 / 132 / 157 / 262 / 263 / 747 / 748、40 / 132 / 157 / 262 / 263 / 748、40 / 132 / 157 / 262 / 263 / 748 / 749、40 / 132 / 157 / 262 / 263 / 748 / 751、40 / 132 / 157 / 262 / 263 / 748 / 762、40 / 132 / 157 / 262 / 263 / 748 / 763、40 / 132 / 157 / 262 / 263 / 748 / 764、40 / 132 / 157 / 262 / 263 / 748 / 766、40 / 132 / 157 / 262 / 263 / 748 / 773、40 / 132 / 157 / 262 / 263 / 748 / 803、40 / 132 / 157 / 605 / 262 / 263 / 748、40 / 132 / 157 / 262 / 263 / 403 / 521 / 748、or 40 / 132 / 157 / 262 / 263 / 403 / 553 / 748, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0230] In some embodiments, the recombinant polynucleotide is selected from the group consisting of amino acid positions 40 / 132 / 157 / 262 / 263 / 403 / 404 / 521 / 524 / 542 / 555 / 748 / 762 / 764, 40 / 132 / 157 / 262 / 263 / 404 / 521 / 524 / 542 / 589 / 748 / 762 / 764, 40 / 132 / 157 / 262 / 263 / 521 / 524 / 542 / 581 / 748 / 762 / 764, 40 / 132 / 157 / 262 / 263 / 521 / 542 / 748 / 762 / 764, 40 / 132 / 157 / 262 / 263 / 404 / 5 21 / 542 / 748 / 762, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 750 / 849, 40 / 132 / 157 / 262 / 263 / 521 / 524 / 581 / 748, 16 / 40 / 132 / 157 / 262 / 263 / 521 / 735 / 748, 40 / 1 32 / 157 / 262 / 263 / 521 / 748 / 820, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 793, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 764, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 755, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 753, 40 / 132 / 157 / 262 / 263 / 521 / 735 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 728, 40 / 132 / 157 / 262 / 263 / 521 / 704 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 675 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 671 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 570 / 748, 40 / 132 / 157 / 262 / 263 / 495 / 521 / 748, 4 0 / 132 / 157 / 262 / 263 / 480 / 521 / 748, 40 / 132 / 157 / 262 / 263 / 476 / 521 / 748, 40 / 132 / 157 / 262 / 263 / 384 / 521 / 748, 40 / 132 / 157 / 262 / 263 / 322 / 521 / 748, 40 / 132 / 157 / 262 / 263 / 321 / 521 / 748, 40 / 132 / 157 / 243 / 262 / 263 / 521 / 748, 15 / 40 / 132 / 157 / 262 / 263 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 521 / 748,and encoding an engineered DNA polymerase polypeptide that includes a substitution or set of substitutions at 40 / 91 / 132 / 157 / 262 / 263 / 521 / 748, 40 / 87 / 132 / 157 / 262 / 263 / 521 / 748, 40 / 85 / 132 / 157 / 262 / 263 / 521 / 748, 20 / 40 / 132 / 157 / 262 / 263 / 521 / 748, 21 / 40 / 132 / 157 / 262 / 263 / 521 / 748, or 40 / 52 / 132 / 157 / 262 / 263 / 521 / 748, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0231] In some embodiments, the recombinant polynucleotide is selected from the group consisting of amino acid positions 40 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750, 21 / 40 / 52 / 102 / 132 / 157 / 262 / 263 / 521 / 748, 21 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748, 20 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 748, 20 / 40 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750, 40 / 102 / 132 / 157 / 262 / 263 / 386 / 495 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 476 / 495 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 820, 40 / 102 / 132 / 157 / 262 / 263 / 386 / 521 / 748 / 849, 20 / 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750, 40 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 820, 40 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750 / 820, 21 / 40 / 52 / 102 / 132 / 157 / 262 / 263 / 521 / 572 / 748, 20 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 521 / 748, 21 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 495 / 521 / 748, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 476 / 521 / 748, 20 / 40 / 102 / 132 / 157 / 262 / 263 / 386 / 476 / 521 / 748, 21 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 750, 21 / 40 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 820, 20 / 40 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 820,40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 849、21 / 40 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 820 / 849、40 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 495 / 521 / 748、40 / 102 / 132 / 157 / 262 / 263 / 273 / 322 / 521 / 748 / 849、40 / 102 / 132 / 157 / 262 / 263 / 476 / 495 / 521 / 748 / 750、40 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 750 / 820、40 / 102 / 132 / 157 / 262 / 263 / 386 / 521 / 748 / 750 / 849、21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 820、20 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750、20 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 849、20 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 566 / 748 / 820、40 / 52 / 102 / 132 / 157 / 262 / 263 / 322 / 498 / 521 / 748 / 750、21 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 521 / 748 / 820、40 / 52 / 102 / 132 / 157 / 262 / 263 / 386 / 495 / 521 / 748 / 820、20 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 476 / 521 / 748 / 820、40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 495 / 521 / 748 / 750、40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 495 / 521 / 748 / 820、40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 750 / 820、40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 476 / 495S / 521 / 748、21 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 495 / 521 / 748 / 750 / 820、20 / 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 476 / 495 / 521 / 748、20 / 40 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 386 / 476 / 495 / 521 / 748, 40 / 52 / 102 / 132 / 157 / 262 / 263 / 476 / 495 / 521 / 566 / 748 / 750 / 849, 20 / 40 / 85 / 102 / 132 / 157 / 262 / 200 / 263 / 322 / 4 76 / 495S / 521 / 748 / 750, or 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 495 / 521 / 748 / 820 / 849, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0232] In some embodiments, the recombinant polynucleotide is selected from the group consisting of amino acid positions 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 521 / 566 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750 / 820 / 849, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 476 / 495 / 521 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 177 / 263 / 521 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750 / 820, 20 / 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 521 / 748 / 7 50, 52 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748Y / 750S / 820, 20 / 40 / 85 / 102 / 132 / 157 / 262 / 26 3 / 521 / 748 / 750 / 820, 20 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 476 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 476 / 521 / 748 / 750 / 820, 4 0 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 495 / 521 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 476 / 495 / 521 / 748 / 750, 20 / 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 386 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 495 / 521 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 476 / 495 / 521 / 748 / 750 / 820, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 521 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 476 / 521 / 748 / 750 / 820,20 / 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750、21 / 40 / 102 / 132 / 157 / 262 / 263 / 521 / 748、40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 705 / 748 / 750、21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 476 / 521 / 748 / 750 / 820、40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750 / 820、21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 521 / 748 / 750、20 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 521 / 748 / 750 / 820、40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 521 / 748 / 750、21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 476 / 521 / 748 / 750、40 / 85 / 102 / 109 / 132 / 157 / 262 / 263 / 521 / 748 / 750、40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 495 / 521 / 748 / 750、40 / 85 / 102 / 132 / 157 / 262 / 263 / 491 / 521 / 748 / 750、40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750 / 820、21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 521 / 748 / 750 / 820、20 / 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 750、21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 495 / 521 / 566 / 748 / 750 / 820、20 / 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 495 / 521 / 748 / 750、40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750 / 756、40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 521 / 748 / 750 / 820、40 / 85 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 750、40 / 85 / 102 / 132 / 157 / 262 / 263 / 511 / 521 / 748 / 750、21 / 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 242 / 386 / 495 / 521 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 476 / 495 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 706 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 476 / 495 / 521 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 2 62 / 263 / 299 / 322 / 495 / 521 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750 / 849, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 476 / 521 / 748 / 750 / 820, 21 / 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 521 / 748 / 750 / 820, 20 / 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 566 / 74 8 / 750, 20 / 40 / 52 / / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 495 / 521 / 566 / 748 / 750 / 820, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 521 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 38 6 / 521 / 748 / 750 / 849, 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750, 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 386 / 495 / 521 / 748 / 750, or 40 / 85 / 102 / 132 / 157 / 262 / 263 / 440 / 521 / 748 / 750, where the amino acid positions are relative to the reference sequence of SEQ ID NO:2.

[0233] In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO:8, 332, 462 or 606.

[0234] In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO:8, 332, 462 or 606, wherein the polypeptide sequence comprises one or more substitutions compared to the reference sequence corresponding to residues 12-850 of SEQ ID NO:8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO:8, 332, 462 or 606.

[0235] In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO:8, 332, 462 or 606, wherein the polypeptide sequence comprises one or more substitutions compared to the reference sequence corresponding to residues 12-850 of SEQ ID NO:8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO:8, 332, 462 or 606, with the proviso that the polypeptide sequence does not comprise a sequence comprising residues 12-850 of SEQ ID NO:2.

[0236] In some embodiments, the recombinant polynucleotide comprises a sequence identical to that at amino acid positions 15, 16, 20, 21, 22, 40, 41, 52, 57, 58, 73, 85, 87, 88, 91, 102, 109, 132, 157, 177, 186, 200, 213, 217, 231, 232, 242, 243, 262, 263, 264, 265, 273, 299, 321, 322, 328, 384, 386, 401, 402, 403, 404, 406, 407, 440, 476, 480, 491, 495, 498, 503, 504, 506, 507, 508, 511, 514, 520, 521, 523, 524, 525, 526, 527, 528, 529, 530, 533, 534, 535, 536, 537, 538, 539, 540, 542, 553, 554, 555, 556, 557 , 558, 559, 560, 562, 563, 566, 570, 572, 581, 582, 584, 585, 586, 587, 589, 592, 593, 594, 595, 596, 597, 599, 601, 602, 603, 605, 607, 616, 665, 671, 674, 675, 677, 684, 688, 696, 704, 705, 706, 728, 735, 747, 7 and wherein the amino acid positions are relative to the reference sequence of SEQ ID NO: 8, 332, 462 or 606.

[0237] In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase comprising a polypeptide sequence that includes at least a substitution at amino acid position 40, 85, 102, 132, 157, 177, 262, 263, 521, 748, or 750, or a combination thereof.

[0238] In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:8 or a reference sequence corresponding to SEQ ID NO:8, wherein the polypeptide sequence comprises one or more substitutions compared to the reference sequence corresponding to residues 12-850 of SEQ ID NO:8 or a reference sequence corresponding to SEQ ID NO:8.

[0239] In some embodiments, the recombinant polynucleotide comprises a sequence similar to that at amino acid positions 22 / 407, 328, 401, 402, 403, 404, 406, 407, 503, 504, 506, 521, 523, 524, 525, 526, 527, 528, 529, 530, 531, 533, 534, 535, 536, 537, 538, 539, 540, 542, 553, 554, 555, 556, 557, 558, 559, 560, 563, 581, 582, 585, or 403 / 553, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO:8.

[0240] In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:332 or a reference sequence corresponding to SEQ ID NO:332, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:332 or a reference sequence corresponding to SEQ ID NO:332.

[0241] In some embodiments, the recombinant polynucleotide comprises a nucleotide sequence at amino acid positions 15, 20, 21, 52, 85, 87, 91, 102, 243, 321, 322, 384, 404, 476, 480, 480, 495, 542, 570, 671, 675, 704, 728, 735, 753, 755, 762, 764, 793, 820, 16 / 735, 750 / 849, 524 / 581, The present invention encodes an engineered DNA polymerase comprising a polypeptide sequence that includes at least a substitution or set of substitutions in 403 / 404 / 524 / 542 / 555 / 762 / 764, 404 / 524 / 542 / 589 / 762 / 764, 524 / 542 / 581 / 762 / 764, or 542 / 762 / 764, where the amino acid positions are relative to the reference sequence of SEQ ID NO:332.

[0242] In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:462 or a reference sequence corresponding to SEQ ID NO:462, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:462 or a reference sequence corresponding to SEQ ID NO:462.

[0243] In some embodiments, the recombinant polynucleotide comprises an amino acid sequence selected from the group consisting of 750 / 820, 21 / 52, 20 / 21 / 85 / 322 / 476 / 495, 20 / 85 / 200 / 322 / 476 / 495 / 750, 476 / 750, 20 / 476, 20 / 322 / 386, 85 / 322 / 476, 52 / 322 / 498 / 750, 20 / 322 / 476 / 820, 85 / 476 / 495 / 820, 21 / 8 5 / 322 / 820, 20 / 299 / 322 / 386 / 476 / 495 / 820, 20 / 322, 21 / 820 / 849, 476, 322 / 820, 21 / 322 / 386 / 820, 322 / 386 / 495, 85 / 386 / 495 / 750, 20 / 85 / 476 / 750, 20 / 386 / 476, 85 / 322 / 386 / 476 / 495, 20 / 495 / 820, 750, 21 / 322 / 495, 52 / 386 / 495 / 820, 21 / 322, 85 / 322 / 750 / 820, 20 / 52 / 85, 21 / 52 / 572, 20 / 85 / 495 / 849, 85 / 750, 21 / 495 / 820, 273 / 322 / 849, 495, 322 / 750 / 820, 52 / 476 / 495 / 566 / 750 / 849, 386 / 495, 495 / 820, 21 / 322 / 495 / 750 / 820, 21 / 85 or 386 / 750 / 849, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO:462.

[0244] In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:606 or a reference sequence corresponding to SEQ ID NO:606, wherein the polypeptide sequence comprises one or more substitutions compared to a reference sequence corresponding to residues 12-850 of SEQ ID NO:606 or a reference sequence corresponding to SEQ ID NO:606.

[0245] The recombinant polynucleotides are selected from the group consisting of the amino acid positions 299 / 386 / 566 / 820, 476 / 820 / 849, 21 / 322 / 476 / 495 / 820, 177, 21 / 495, 476 / 820, 20 / 52 / 299, 52 / 299, 322 / 820, 20 / 820, 20 / 299 / 386 / 476, 386 / 476 / 820, 476 / 495 / 820, 386 / 476 / 495, 20 / 21 / 299 / 322 / 38 6, 322 / 386 / 495, 21 / 299 / 322 / 476 / 495 / 820, 21 / 299 / 386 / 820, 299 / 476 / 820, 20 / 21, 21 / 85 / 102 / 750, 705, 21 / 386 / 476 / 820, 820, 21 / 299 / 322, 20 / 21 / 322 / 386 / 820, 299, 21 / 299 / 386 / 476, 109, 322 / 495, 491, 52 / 820, 21 / 386 / 820, 20 / 21 / 495, 21 / 299 / 322 / 495 / 566 / 820, 20 / 21 / 299 / 495, 756, 386 / 820, 495, 511, 21 / 52 / 242 / 386 / 495 / 820, 299 / 476 / 495, 706, 21 / 299 / 386 / 476 / 495, 21 / 299 / 322 / 495, 21 / 476 / 849, 299 / 322 / 476 / 820, 21 / 52 / 299 / 322 / In some embodiments, the amino acid positions are relative to the reference sequence of SEQ ID NO:606.

[0246] In some embodiments, for each of the foregoing embodiments, the specific amino acid substitutions described herein for a substitution or set of substitutions can be used for the encoded reverse transcriptase polypeptide.

[0247] In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase comprising a polypeptide sequence comprising at least a substitution at least one amino acid position as provided in Tables 4.1, 5.1, 6.1, 7.1 and 8.1, wherein the substitution is compared to SEQ ID NO:2, 8, 332, 462 or 606.

[0248] In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase comprising a polypeptide sequence that includes at least one substitution as provided in Tables 4.1, 5.1, 6.1, 7.1 and 8.1, wherein the substitution is compared to SEQ ID NO:2, 8, 332, 462 or 606.

[0249] In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase that includes at least a substitution or set of substitutions provided in Tables 4.1, 5.1, 6.1, 7.1 and 8.1 for each variant, where the substitution or set of substitutions is relative to SEQ ID NO: 2, 8, 332, 462 or 606.

[0250] In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase comprising a polypeptide sequence having at least 75%, 80%, 85%, 86%, 887%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a sequence comprising residues 12-850 of the even-numbered SEQ ID NOs: as set forth in Tables 4.1, 5.1, 6.1, 7.1, and 8.1. In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase comprising a polypeptide sequence that comprises at least 75%, 80%, 85%, 86%, 887%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a sequence of an even-numbered SEQ ID NO: shown in Tables 4.1, 5.1, 6.1, 7.1 and 8.1. In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase comprising a polypeptide sequence that comprises residues 12-850 of an even-numbered SEQ ID NO: shown in Tables 4.1, 5.1, 6.1, 7.1 and 8.1. In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase comprising a polypeptide sequence that comprises an even-numbered SEQ ID NO: shown in Tables 4.1, 5.1, 6.1, 7.1 and 8.1.

[0251] In some embodiments, the recombinant polynucleotide is selected from the group consisting of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 14 0, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202 , 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 3 28, 330, 332, 334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, ​​384, 386, 388, 39 0, 392, 394, 396, 398, 400, 402, 404, 406, 408, 440, 442, 444, 446, 448, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452 , 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514,516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 565, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 5 94, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 67 2, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692, 694, 696, 698, 700, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748 or 770, or a fragment thereof, wherein the polypeptide sequence optionally has 1, 2, 3, 4, 5, 6, 7, 8, 9 or up to 10 substitutions in the polypeptide sequence.

[0252] In some embodiments, the recombinant polynucleotide is selected from the group consisting of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 14 0, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202 , 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 270, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 3 28, 330, 332, 334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, ​​384, 386, 388, 39 0, 392, 394, 396, 398, 400, 402, 404, 406, 408, 440, 442, 444, 446, 448, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452 , 454, 456, 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514,516, 518, 520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 565, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 59 2, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 6 70, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692, 694, 696, 698, 700, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748, 750, 752, 754, 756, 758, 760, 762, 764, 766, 768, or 770, or a fragment thereof, wherein the polypeptide sequence optionally has 1, 2, 3, 4, 5, 6, 7, 8, 9, or up to 10 substitutions in the polypeptide sequence.

[0253] In some embodiments, the encoded engineered DNA polymerase polypeptide comprises 1, 2, 3, 4, up to 5 substitutions in the polypeptide sequence. In some embodiments, the engineered DNA polymerase comprises 1, 2, 3, or 4 substitutions in the polypeptide sequence. In some embodiments, the substitutions comprise non-conservative or conservative substitutions. In some embodiments, the substitutions comprise conservative substitutions. In some embodiments, the substitutions comprise non-conservative substitutions. In some embodiments, guidance regarding non-conservative and conservative substitutions is provided by the variants disclosed herein.

[0254] In some embodiments, the recombinant polynucleotide encodes an engineered DNA polymerase polypeptide comprising a polypeptide sequence comprising residues 12-850 of SEQ ID NO:8, 332, 462 or 606, or a polypeptide sequence comprising SEQ ID NO:8, 332, 462 or 606, optionally with 1, 2, 3, 4, 5, 6, 7, 8, 9 or up to 10 substitutions in the polypeptide sequence. In some embodiments, the encoded DNA polymerase comprises 1, 2, 3, 4, up to 5 substitutions in the polypeptide sequence. In some embodiments, the encoded DNA polymerase comprises 1, 2, 3, or 4 substitutions in the polypeptide sequence.

[0255] In some embodiments, the recombinant polynucleotide comprises a polynucleotide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference polynucleotide sequence comprising nucleotide residues 34-2550 of SEQ ID NO:1 or a reference polynucleotide sequence of SEQ ID NO:1, wherein the recombinant polynucleotide encodes an engineered DNA polymerase or a functional fragment thereof, and wherein the polypeptide sequence of the engineered DNA polymerase comprises one or more substitutions at one or more amino acid positions compared to a reference sequence comprising residues 12-850 of SEQ ID NO:2 or a reference sequence of SEQ ID NO:2.

[0256] In some embodiments, the recombinant polynucleotide comprises a reference polynucleotide sequence that includes nucleotide residues 34 to 2550 of SEQ ID NO: 7, 331, 461 or 605, or a polynucleotide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference polynucleotide sequence of SEQ ID NO: 7, 331, 461 or 605, wherein the recombinant polynucleotide encodes an engineered DNA polymerase or a functional fragment thereof.

[0257] In some embodiments, the recombinant polynucleotide is selected from the group consisting of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139 , 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 2 65, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 3 27, 329, 331, 333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 38 9, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451 , 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511, 513,515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 60 1, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 641, 643, 645, 647, 649, 651, 656, 655, 657, 659, 661, 663, 665, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697, A polynucleotide corresponding to nucleotide residues 34 to 2550 of 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729, 731, 733, 735, 737, 739, 741, 743, 745, 747, 749, 751, 753, 755, 757, 759, 761, 763, 765, 767, or 769. The polynucleotides include a polynucleotide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a sequence of the engineered DNA polymerase, as described herein, wherein the polynucleotide encodes an engineered DNA polymerase.

[0258] In some embodiments, the recombinant polynucleotide is selected from the group consisting of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139 , 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 2 65, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 3 27, 329, 331, 333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 38 9, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451 , 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511, 513,515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 577, 579 , 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 641, 643, 645 , 647, 649, 651, 656, 655, 657, 659, 661, 663, 665, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697, 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721 , 723, 725, 727, 729, 731, 733, 735, 737, 739, 741, 743, 745, 747, 749, 751, 753, 755, 757, 759, 761, 763, 765, 767, or 769.

[0259] In some embodiments, the recombinant polynucleotide is selected from the group consisting of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139 , 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 2 65, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 3 27, 329, 331, 333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 38 9, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451 , 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511, 513,515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 59 7, 599, 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 641, 643, 645, 647, 649, 651, 656, 655, 657, 659, 661, 663, 665, 677, 679, 681, 683, 685, 687, 689, 6 91, 693, 695, 697, 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729, 731, 733, 735, 737, 739, 741, 743, 745, 747, 749, 751, 753, 755, 757, 759, 761, 763, 765, 767, or 769 The recombinant polynucleotide comprises a polynucleotide sequence having at least 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a recombinant polynucleotide sequence, wherein the recombinant polynucleotide encodes an engineered DNA polymerase as described herein.

[0260] In some embodiments, the recombinant polynucleotide is selected from the group consisting of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139 , 141, 143, 145, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 207, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 2 65, 267, 269, 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 3 27, 329, 331, 333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 38 9, 391, 393, 395, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451 , 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511, 513,515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 5 77, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599, 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639 , 641, 643, 645, 647, 649, 651, 656, 655, 657, 659, 661, 663, 665, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697, 699, 701, 703, 705, 707, 709, 711, 7 13, 715, 717, 719, 721, 723, 725, 727, 729, 731, 733, 735, 737, 739, 741, 743, 745, 747, 749, 751, 753, 755, 757, 759, 761, 763, 765, 767, or 769.

[0261] In some embodiments, the recombinant polynucleotide encodes a DNA polymerase and hybridizes under highly stringent conditions to a reference polynucleotide sequence described herein encoding an engineered DNA polymerase. In some embodiments, the reference sequence corresponds to residues 34-2550 of SEQ ID NO: 1, 7, 331, 461 or 605, or to a sequence corresponding to SEQ ID NO: 1, 7, 331, 461 or 605, or to a complement thereof, or to a polynucleotide sequence encoding any of the other engineered DNA polymerases provided herein. In some embodiments, the polynucleotide encodes a DNA polymerase and hybridizes under highly stringent conditions to a reference polynucleotide comprising a sequence corresponding to residues 34-2550 of the odd-numbered sequences of SEQ ID NO: 1-769, or to a reference polynucleotide comprising a sequence corresponding to the odd-numbered sequences of SEQ ID NO: 1-769.

[0262] In some embodiments, a polynucleotide capable of hybridizing under highly stringent conditions encodes a DNA polymerase comprising an amino acid sequence having one or more residue differences compared to SEQ ID NOs: 2, 8, 332, 462 or 606 at a residue position selected from any of the positions set forth in Tables 4.1, 5.1, 6.1, 7.1 and 8.1. In some embodiments, polynucleotides that hybridize under highly stringent conditions include polynucleotides having at least 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 34-2550 of SEQ ID NO:1, 7, 331, 461 or 605, or a reference sequence corresponding to SEQ ID NO:1, 7, 331, 461 or 605. In some additional embodiments, polynucleotides that hybridize under highly stringent conditions include sequences having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to at least one polynucleotide reference sequence corresponding to residues 34-2550 of the polynucleotide sequences provided in Tables 4.1, 5.1, 6.1, 7.1, and 8.1, or corresponding to the polynucleotide sequences provided in Tables 4.1, 5.1, 6.1, 7.1, and 8.1.

[0263] In some embodiments, the isolated polynucleotide encoding any of the engineered DNA polymerase polypeptides herein is engineered in various ways to facilitate the expression of the DNA polymerase polypeptide. In some embodiments, the polynucleotide encoding the DNA polymerase polypeptide comprises an expression vector in which one or more control sequences are present to regulate the expression of the DNA polymerase polynucleotide and / or polypeptide. Manipulation of the isolated polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector used. Techniques for modifying polynucleotides and nucleic acid sequences using recombinant DNA methods are well known in the art.

[0264] In some embodiments, the control sequences include, inter alia, a promoter, a leader sequence, a polyadenylation sequence, a propeptide sequence, a signal peptide sequence, and a transcription terminator. In some embodiments, a suitable promoter is selected based on the host cell choice. For bacterial host cells, suitable promoters for directing transcription of the nucleic acid constructs of the disclosure include those derived from the E. coli lac operon, Streptomyces coelicolor agarase gene (dagA), Bacillus subtilis levansucrase gene (sacB), Bacillus licheniformis alpha-amylase gene (amyL), Bacillus stearothermophilus maltogenic amylase gene (amyM), Bacillus amyloliquefaciens alpha-amylase gene (amyQ), Bacillus licheniformis penicillinase gene (penP), Bacillus subtilis xylA and xylB genes, and prokaryotic beta-lactamase genes (e.g., Villa-Kamaroff et al., Proc. Natl Acad. Sci. USA, 1978, 75:3727-3731), as well as the tac promoter (see, e.g., DeBoer et al., Proc. Natl Acad. Sci. USA, 1983, 80: 21-25).Exemplary promoters for filamentous fungal host cells include promoters obtained from the genes for Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid-stable alpha-amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans acetamidase, and Fusarium oxysporum trypsin-like protease (see, e.g., WO 96 / 00787), as well as the NA2-tpi promoter (Aspergillus niger neutral alpha-amylase and Aspergillus oryzae triosephosphate isomerase gene promoters), as well as mutants, truncations and hybrid promoters thereof. Exemplary yeast cell promoters can be from the genes of Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH2 / GAP) and Saccharomyces cerevisiae 3-phosphoglycerate kinase. Other useful promoters for yeast host cells are known in the art (see, for example, Romanos et al., Yeast, 1992, 8:423-488).

[0265] In some embodiments, the control sequence is also a suitable transcription terminator sequence (i.e., a sequence recognized by a host cell to terminate transcription). In some embodiments, the terminator sequence is operably linked to the 3' end of the nucleic acid sequence encoding the DNA polymerase polypeptide. Any suitable terminator that is functional in the selected host cell finds use in the present invention. For bacterial expression, the transcription terminator can be a Rho-dependent terminator that relies on Rho transcription factors, or a Rho-independent or endogenous terminator that does not require transcription factors. Exemplary bacterial transcription terminators are described in Peters et al., J Mol Biol., 2011, 412(5):793-813. Exemplary transcription terminators for filamentous fungal host cells can be obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Aspergillus niger alpha-glucosidase, and Fusarium oxysporum trypsin-like protease. Exemplary terminators for yeast host cells can be obtained from the genes for Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are known in the art (see, for example, Romanos et al., supra).

[0266] In some embodiments, the control sequence is also a suitable leader sequence (i.e., a nontranslated region of an mRNA important for translation by the host cell). In some embodiments, the leader sequence is operably linked to the 5' end of the nucleic acid sequence encoding the DNA polymerase polypeptide. Any suitable leader sequence that is functional in a selected host cell finds use in the present invention. Exemplary leaders for filamentous fungal host cells are obtained from the Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase genes. Suitable leaders for yeast host cells are obtained from the Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH2 / GAP) genes.

[0267] In some embodiments, the control sequence is also a polyadenylation sequence (i.e., a sequence operably linked to the 3' end of a nucleic acid sequence, which, upon transcription, is recognized by a host cell as a signal for adding polyadenosine residues to the transcribed mRNA). Any suitable polyadenylation sequence that is functional in a chosen host cell finds use in the present invention. Exemplary polyadenylation sequences for filamentous fungal host cells include, but are not limited to, the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Fusarium oxysporum trypsin-like protease, and Aspergillus niger alpha-glucosidase. Useful polyadenylation sequences for yeast host cells are known (see, e.g., Guo and Sherman, Mol. Cell. Biol., 1995, 15:5983-5990).

[0268] In some embodiments, the control sequence comprises a 3' untranslated nucleic acid region and a polyadenylation tail nucleic acid sequence, which is a sequence operably linked to the 3' end of a protein-coding nucleic acid sequence that mediates binding to proteins involved in mRNA transport and translation and mRNA half-life. Any polyadenylation sequence and 3' UTR that is functional in a selected host cell can be used in the present invention. Exemplary polyadenylation sequences for filamentous fungal host cells include, but are not limited to, those derived from the genes of Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Fusarium oxysporum trypsin-like protease and Aspergillus niger alpha-glucosidase.

[0269] In some embodiments, the control sequence is also a signal peptide (i.e., a coding region that encodes an amino acid sequence linked to the amino terminus of a polypeptide that directs the encoded polypeptide into the secretory pathway of a cell). In some embodiments, the 5' end of the coding sequence of the nucleic acid sequence inherently contains a signal peptide coding region that is naturally linked in translation reading frame with the segment of the coding region that encodes the secreted polypeptide. Alternatively, in some embodiments, the 5' end of the coding sequence contains a signal peptide coding region that is foreign to the coding sequence. Any suitable signal peptide coding region that directs the expressed polypeptide into the secretory pathway of a chosen host cell finds use for expression of the engineered polypeptide(s). Useful signal peptide coding regions for bacterial host cells include, but are not limited to, those obtained from the genes for Bacillus NCIB 11837 maltogenic amylase, Bacillus stearothermophilus alpha-amylase, Bacillus licheniformis subtilisin, Bacillus licheniformis beta-lactamase, Bacillus stearothermophilus neutral protease (nprT, nprS, nprM) and Bacillus subtilis prsA. Additional signal peptides are known in the art (see, e.g., Simonen and Palva, Microbiol. Rev., 1993, 57:109-137). In some embodiments, effective signal peptide coding regions for filamentous fungal host cells include, but are not limited to, signal peptide coding regions obtained from the genes for Aspergillus oryzae TAKA amylase, Aspergillus niger neutral amylase, Aspergillus niger glucoamylase, Rhizomucor miehei aspartic proteinase, Humicola insolens cellulase, and Humicola lanuginosa lipase.Useful signal peptides for yeast host cells include, but are not limited to, those derived from the Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase genes.

[0270] In some embodiments, the control sequence is also a propeptide coding region that codes for an amino acid sequence located at the amino terminus of a polypeptide. The resulting polypeptide is referred to as a "proenzyme," "propolypeptide," or "zymogen." A propolypeptide can be converted to a mature active polypeptide by catalytic or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding region can be obtained from any suitable source, including, but not limited to, the genes of Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Saccharomyces cerevisiae alpha-factor, Rhizomucor miehei aspartic proteinase, and Myceliophthora thermophila lactase (see, e.g., WO 95 / 33836). When both the signal peptide and propeptide regions are present at the amino terminus of a polypeptide, the propeptide region is located next to the amino terminus of the polypeptide, and the signal peptide region is located next to the amino terminus of the propeptide region.

[0271] In some embodiments, regulatory sequences are also utilized. Such sequences facilitate the regulation of the expression of the polypeptide relative to the growth of the host cell. An example of a regulatory system is a system that causes the expression of a gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. In prokaryotic host cells, suitable regulatory sequences include, but are not limited to, the lac, tac, and trp operator systems. In yeast host cells, suitable regulatory systems include, but are not limited to, the ADH2 system or the GAL1 system. In filamentous fungi, suitable regulatory sequences include, but are not limited to, the TAKA alpha-amylase promoter, the Aspergillus niger glucoamylase promoter, and the Aspergillus oryzae glucoamylase promoter.

[0272] In another aspect, the disclosure provides a recombinant expression vector that includes a polynucleotide encoding an engineered DNA polymerase polypeptide and, depending on the type of host into which it will be introduced, one or more expression control regions, e.g., promoters and terminators, origins of replication, etc. In some embodiments, the various nucleic acids and control sequences described herein are joined together (i.e., operably linked) to produce a recombinant expression vector that includes one or more convenient restriction sites to allow for the insertion or replacement of a nucleic acid sequence encoding a DNA polymerase polypeptide at such sites. Alternatively, in some embodiments, the nucleic acid sequences of the invention are expressed by inserting the nucleic acid sequence or a nucleic acid construct that includes the sequence into an appropriate vector for expression. In some embodiments involving the creation of an expression vector, the coding sequence is placed in the vector such that the coding sequence is operably linked to the appropriate control sequences for expression.

[0273] Recombinant expression vector can be any suitable vector (e.g., plasmid or virus) that can be easily subjected to recombinant DNA procedures and can result in the expression of DNA polymerase polynucleotide sequence.Vector selection typically depends on the compatibility of the vector with the host cell into which the vector will be introduced.Vector can be linear or closed circular plasmid.

[0274] In some embodiments, the expression vector is an autonomously replicating vector (i.e., a vector that exists as an extrachromosomal entity whose replication is independent of chromosomal replication, such as a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome). The vector can contain any means for ensuring self-replication. In some alternative embodiments, the vector is a vector that, when introduced into a host cell, integrates into the genome and replicates together with the chromosome(s) into which it is integrated. Furthermore, in some embodiments, a single vector or plasmid, or two or more vectors or plasmids, and / or transposons, that together contain the total DNA to be introduced into the genome of the host cell, are utilized.

[0275] In some embodiments, the expression vector contains one or more selectable markers that allow for easy selection of transformed cells. A "selectable marker" is a gene whose product provides biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, etc. Examples of bacterial selectable markers include, but are not limited to, the dal genes from Bacillus subtilis or Bacillus licheniformis, or markers that confer antibiotic resistance, such as ampicillin, kanamycin, chloramphenicol, or tetracycline resistance. Suitable markers for yeast host cells include, but are not limited to, ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3. Selectable markers for use in filamentous fungal host cells include, but are not limited to, amdS (acetamidase; e.g., from A. nidulans or A. orzyae), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase; e.g., from S. hygroscopicus), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase; e.g., from A. nidulans or A. orzyae), sC (sulfate adenyltransferase) and trpC (anthranilate synthase), and equivalents thereof.

[0276] In another aspect, the present invention provides a host cell comprising at least one polynucleotide encoding at least one engineered DNA polymerase polypeptide of the present invention, the polynucleotide(s) being operably linked to one or more control sequences for the expression of the engineered DNA polymerase enzyme(s) in the host cell. Host cells suitable for use in expressing the polypeptides encoded by the expression vectors of the present invention are well known in the art and include, but are not limited to, bacterial cells, such as E. coli, Vibrio fluvialis, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells (e.g., Saccharomyces cerevisiae or Pichia pastoris (ATCC Accession No. 201178)); insect cells, such as Drosophila S2 and Spodoptera Sf9 cells; animal cells, such as CHO, COS, BHK, 293 and Bowes melanoma cells; and plant cells. Exemplary host cells also include various Escherichia coli strains (eg, W3110 (ΔfhuA) and BL21).

[0277] Thus, in another aspect, the disclosure provides a method of producing an engineered DNA polymerase polypeptide, comprising culturing a host cell capable of expressing a polynucleotide encoding the engineered DNA polymerase polypeptide under conditions suitable for expression of the polypeptide. In some embodiments, the method further comprises isolating and / or purifying the DNA polymerase polypeptide described herein. In some embodiments, the host cell is a bacterial cell, e.g., E. coli or B subtilis.

[0278] Suitable culture medium and growth conditions for host cells are well known in the art.It is contemplated that any suitable method for introducing polynucleotide for expressing DNA polymerase polypeptide into cell will find use in the present invention.Suitable techniques include, but are not limited to, electroporation, particle bombardment, liposome-mediated transfection, calcium chloride transfection and protoplast fusion.

[0279] The engineered DNA polymerase polypeptide having the properties disclosed herein can be obtained by subjecting a polynucleotide encoding a naturally occurring or engineered DNA polymerase polypeptide to any suitable mutagenesis and / or directed evolution method known in the art and / or described herein.Exemplary directed evolution techniques are mutagenesis and / or DNA shuffling (see, for example, Stemmer, Proc. Natl. Acad. Sci. USA, 1994, 91:10747-10751; WO95 / 22625; WO97 / 0078; WO97 / 35966; WO98 / 27230; WO00 / 42651; WO01 / 75767 and U.S. Patent No. 6,537,746). Other directed evolution procedures that can be used include, inter alia, the staggered extension process (StEP), in vitro recombination (see, e.g., Zhao et al., Nat. Biotechnol., 1998, 16:258-261), mutagenic PCR (see, e.g., Caldwell et al., PCR Methods Appl., 1994, 3:S136-S140), and cassette mutagenesis (see, e.g., Black et al., Proc. Natl. Acad. Sci. USA, 1996, 93:3525-3529).

[0280] For example, mutagenesis and directed evolution methods can be readily applied to polynucleotides encoding DNA polymerases to generate libraries of variants that can be expressed, screened, and assayed. Any suitable mutagenesis and directed evolution method finds use in the present invention and is well known in the art (e.g., U.S. Patents 5,605,793, 5,811,238, 5,830,721, 5,834,252, 5,837,458, 5,928,905, 6,096,548, 6,117,679, 6,132,970, 6,165,793, 6,180,406, 6,251,674, 6,265,201, 6,277,638, 6,287,8 61, 6,287,862, 6,291,242, 6,297,053, 6,303,344, 6,309,883, 6,319,713, 6,319,714, 6,323,030, 6,326,204, 6,335,160, 6,335,198, 6,344,356, 6,352,859, 6,355,484, 6,358,740, 6,358,742, 6,365,377, 6,365,408, 6,368,861, 6,372,497, 6,337,186, 6,376,246, 6, 379,964, 6,387,702, 6,391,552, 6,391,640, 6,395,547, 6,406,855, 6,406,910, 6,413,745, 6,413,774, 6,420,175, 6,423,542, 6,426,224, 6,436,675, 6,444,468, 6,455,253, 6,479,652, 6,482,647, 6,483,011, 6,484,105, 6,489,146, 6,500,617, 6,500,639, 6,506,6 02, 6,506,603, 6,518,065, 6,519,065, 6,521,453, 6,528,311, 6,537,746, 6,573,098, 6,576,467, 6,579,678, 6,586,182, 6,602,986, 6,605,430, 6,613,514, 6,653,072, 6,686,515, 6,703,240, 6,716,631, 6,825,001, 6,902,922, 6,917,882, 6,946,296, 6,961,664, 6,995,017, 7,024,312, 7,058,515, 7,105,297, 7,148,054, 7,220,566, 7,288,375, 7,384,387, 7,421,347, 7,430,477, 7,462,469, 7,534,564, 7,620,50 0, 7,620,502, 7,629,170, 7,702,464, 7,747,391, 7,747,393, 7,751,986, 7,776,598, 7,783,428, 7,795,030, 7,853,410, 7,868,138, 7,783,428, 7,87 Nos. 3,477, 7,873,499, 7,904,249, 7,957,912, 7,981,614, 8,014,961, 8,029,988, 8,048,674, 8,058,001, 8,076,138, 8,108,150, 8,170,806, 8,224,580, 8,377,681, 8,383,346, 8,457,903, 8,504,498, 8,589,085, 8,762,066, 8,768,871, 9,593,326, 9,665,694, 9,684,771 and any related PCT and non-US counterparts; et al., Anal. Biochem., 1997, 254(2):157-78;Dale et al., Meth. Mol. Biol., 1996, 57:369-74;Smith, Ann. Rev. Genet., 1985, 19:423-462;Botstein et al., Science, 1985, 229:1193-1201;Carter, Biochem. J., 1986, 237:1-7;Kramer et al., Cell, 1984, 38:879-887;Wells et al., Gene, 1985, 34:315-323;Minshull et al., Curr. Op. Chem. Biol., 1999, 3:284-290;Christians et al. Nat. Biotechnol., 1999, 17:259-264;Crameri et al., Nature, 1998, 391:288-291;Crameri, et al., Nat. Biotechnol., 1997,15:436-438;Zhang et al., Proc. Nat. Acad. Sci. USA, 1997, 94:4504-4509;Crameri et al., Nat. Biotechnol., 1996, 14:315-319;Stemmer, Nature, 1994, 370:389-391;Stemmer, Proc. Nat. Acad. Sci. USA, 1994, 91:10747-10751; EP3049973; WO95 / 22625; WO97 / 0078; WO97 / 35966; WO98 / 27230; WO00 / 42651; WO01 / 75767; WO2009 / 152336; and WO2015 / 048573).

[0281] In some embodiments, the protein variants obtained after the mutagenesis treatment are screened by subjecting the enzyme preparation to a defined temperature (or other assay conditions) and measuring the amount of enzyme activity remaining after heat treatment or other suitable assay conditions. Clones containing polynucleotides encoding DNA polymerase polypeptides are then isolated from the gene, sequenced to identify nucleotide sequence changes (if any), and used to express the enzyme in a host cell. Measurement of enzyme activity from an expression library can be performed using any suitable method known in the art (e.g., standard biochemical techniques, e.g., HPLC analysis).

[0282] For engineered polypeptides of known sequence, polynucleotides encoding the enzymes can be prepared by standard solid-phase methods according to known synthesis methods. In some embodiments, fragments of up to about 100 bases can be synthesized individually and then joined (e.g., by enzymatic or chemical ligation methods, or polymerase-mediated methods) to form any desired continuous sequence. For example, the polynucleotides and oligonucleotides disclosed herein can be prepared by chemical synthesis using the classical phosphoramidite method (see, e.g., Beaucage et al., Tet. Lett., 1981, 22:1859-69; and Matthes et al., EMBO J., 1984, 3:801-05), as typically performed in automated synthesis methods. According to the phosphoramidite method, oligonucleotides are synthesized (e.g., purified, annealed, ligated, and cloned into a suitable vector in an automated DNA synthesizer).

[0283] Thus, in some embodiments, a method for preparing an engineered DNA polymerase polypeptide can include (a) synthesizing a polynucleotide encoding a polypeptide comprising an amino acid sequence selected from the amino acid sequences of any of the variants described herein, and (b) expressing the DNA polymerase polypeptide encoded by the polynucleotide. In some embodiments of the method, the amino acid sequence encoded by the polynucleotide can have one or several (e.g., up to 3, 4, 5, or up to 10) amino acid residue deletions, insertions, and / or substitutions, as appropriate. In some embodiments, the amino acid sequence has 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 1-15, 1-20, 1-21, 1-22, 1-23, 1-24, 1-25, 1-30, 1-35, 1-40, 1-45, or 1-50 amino acid residue deletions, insertions, and / or substitutions, as appropriate. In some embodiments, the amino acid sequence optionally has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 30, 35, 40, 45, or 50 amino acid residue deletions, insertions, and / or substitutions. In some embodiments, the amino acid sequence optionally has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 18, 20, 21, 22, 23, 24, or 25 amino acid residue deletions, insertions, and / or substitutions. In some embodiments, the substitutions are conservative or non-conservative substitutions.

[0284] The expressed engineered DNA polymerase polypeptides can be evaluated for any desired improved property or combination of properties (e.g., activity, selectivity, fidelity, stability, thermostability, tolerance to various pH levels, protease susceptibility, etc.) using any suitable assay known in the art, including but not limited to the assays and conditions described herein.

[0285] In some embodiments, any of the engineered DNA polymerase polypeptides expressed in the host cells are recovered from the cells and / or culture medium using any one or more of well-known techniques for protein purification, including, inter alia, lysozyme treatment, sonication, filtration, salting out, ultracentrifugation and chromatography.

[0286] Chromatographic techniques for the isolation of DNA polymerase polypeptides include, among others, reverse phase chromatography, high performance liquid chromatography, ion exchange chromatography, hydrophobic interaction chromatography, size exclusion chromatography, gel electrophoresis and affinity chromatography. Conditions for purifying a particular enzyme depend, in part, on factors such as net charge, hydrophobicity, hydrophilicity, molecular weight, molecular shape, etc., and will be apparent to one of skill in the art. In some embodiments, affinity techniques can be used to isolate improved DNA polymerase enzymes. For affinity chromatography purification, any antibody that specifically binds to the DNA polymerase polypeptide of interest can find use. For the production of antibodies, various host animals, including but not limited to rabbits, mice, rats, etc., are immunized by injection with the DNA polymerase polypeptide or a fragment thereof. In some embodiments, the DNA polymerase polypeptide or fragment is attached to a suitable carrier, e.g., BSA, by a side chain functional group or a linker attached to a side chain functional group.

[0287] In some embodiments, the isolated or purified engineered DNA polymerase polypeptides are combined with other components and compounds to provide compositions and formulations comprising the engineered DNA polymerase polypeptides suitable for different applications and uses (e.g., diagnostic methods and compositions). In some embodiments, the compositions comprise at least one engineered DNA polymerase of the present disclosure. In some embodiments, the compositions further comprise a buffer. In some embodiments, the compositions further comprise a substrate, e.g., a nucleotide substrate (e.g., dNTP, dNTP analog, and / or modified dNTP), and / or at least one primer, e.g., complementary to a target nucleic acid. In some embodiments, the compositions further comprise a target DNA template.

[0288] In some embodiments, the composition may further comprise a DNA polymerase other than the engineered DNA polymerase (e.g., a second DNA polymerase). In some embodiments, the second DNA polymerase is a second thermostable DNA polymerase, such as Taq or Pfu polymerase, or a reverse transcriptase, such as one useful in RT-PCR binding reactions. In some embodiments, the composition comprises a probe or indicator, such as a nucleic acid binding dye (e.g., SYBR® Green), for detecting and / or quantifying the amount of product formed, for example, in a qRT-PCR reaction. Uses of Engineered DNA Polymerase Polypeptides and Kits

[0289] In another aspect, the disclosure provides the use of engineered DNA polymerases for diagnostic and molecular biology purposes, such as for detecting the presence of a target nucleic acid and for direct / indirect sequencing of nucleic acids.

[0290] In some embodiments, the engineered DNA polymerase is used in preparing a complementary DNA of a target DNA. In some embodiments, the method of preparing a complementary DNA of a target DNA comprises contacting the target DNA with the engineered DNA polymerase described herein in the presence of a substrate sufficient for producing the complementary DNA under reaction conditions suitable for producing a complementary DNA to all or a portion of the target DNA (i.e., in whole or in part). As discussed herein and known in the art, the substrate comprises nucleotides (e.g., dNTPs) for DNA polymerase activity, and / or oligonucleotide primers. The primers can be directed to specific sequences of the target nucleic acid or random primers, such as for generating a DNA library.

[0291] In some embodiments, the target DNA is any DNA suitable as a template for an engineered DNA polymerase, including but not limited to genomic DNA, mitochondrial DNA, cell-free DNA (e.g., obtained from blood / serum), bacterial DNA, fungal DNA or viral DNA.

[0292] In some embodiments, the engineered DNA polymerase is useful in diagnostic applications, for example, to detect the presence of target nucleic acids, including RNA and DNA. In some embodiments, a method for detecting the presence of target DNA comprises reacting a sample suspected of containing target DNA with the engineered DNA polymerase described herein in the presence of a substrate under conditions suitable for DNA polymerase-mediated production of DNA that is complementary to all or part of the target DNA (i.e., fully or partially), and detecting the presence of complementary DNA. In some embodiments, the target RNA can be detected by using reverse transcriptase to produce a corresponding target DNA that is complementary to the target RNA.

[0293] In some embodiments, the sample may be any material or substance suspected of containing the target nucleic acid. In some embodiments, the sample is a biological sample, such as biopsy and autopsy samples, frozen sections taken for histological purposes, blood, plasma, serum, sputum, feces, tears, mucus, hair, skin, etc. In some embodiments, the biological sample is a cell or a virus, such as a cell or a virus derived from a bacterial culture, a viral culture, or a cell culture. In some embodiments, the sample is an environmental sample, such as from water, sewage, a surface, air, filtrate, etc.

[0294] In some embodiments for detecting target DNA, the detection of complementary DNA products can be achieved by methods known in the art. In some embodiments, complementary DNA is detected by amplifying complementary DNA, such as by polymerase chain reaction (PCR) or isothermal amplification. In some embodiments, suitable isothermal amplification is by loop-mediated isothermal amplification (LAMP). In some embodiments for detecting the presence of target RNA, the reverse transcriptase reaction is performed separately from the DNA polymerase amplification reaction. In some embodiments, when the amplification is by PCR, the reverse transcriptase reaction and the PCR are one-step RT-PCR (i.e., performed simultaneously in a single reaction). In some embodiments, when the amplification is by PCR, the reverse transcriptase reaction and the PCR are two-step RT-PCR (i.e., performed separately).

[0295] In some embodiments, the engineered DNA polymerase is used to sequence nucleic acids. Various methods for sequencing DNA, particularly NGS sequencing methods, are well known in the art.

[0296] In a further aspect, the present disclosure provides a kit comprising at least one engineered DNA polymerase disclosed herein. In some embodiments, the kit further comprises one or more of a buffer, a nucleotide substrate and / or an oligonucleotide primer. In some embodiments, the kit further comprises multiple (e.g., two or more) oligonucleotide primers, for example, for different parts of a target nucleic acid. In some embodiments, the kit further comprises a template DNA or a target DNA. In some embodiments, the kit comprises a second DNA polymerase, for example, Taq or Pfu DNA polymerase, or a reverse transcriptase, for example, for a coupled RT-PCR reaction. EXAMPLES

[0297] The following examples, including the experiments and results achieved, are provided for illustrative purposes only and are not to be construed as limiting the invention.

[0298] In the experimental disclosure which follows, the following abbreviations apply: ppm (parts per million); M (molar); mM (millimolar), uM and μM (micromolar); nM (nanomolar); mol (mole); gm and g (grams); mg (milligrams); ug and μg (micrograms); L and l (liters); ml and mL (milliliters); cm (centimeters); mm (millimeters); um and μm (micrometers); sec. (seconds); min(s) (minutes); h(s) and hr(s) (hours); Ω (ohms); μf (microfarads); U (units); MW (molecular weight); rpm (revolutions per minute); rcf (relative centrifugal force); psi and PSI (pounds per square inch); °C (degrees Celsius); RT and rt (room temperature); NGS (next generation sequencing); ds (double stranded); ss (single stranded); CDS (coding sequence); DNA (deoxyribonucleic acid); RNA (ribonucleic acid); E. coli W3110 (a commonly used laboratory E. coli strain, Coli available from the Genetic Stock Center [CGSC], New Haven, CT); HTP (high throughput); HPLC (high pressure liquid chromatography); MCYP (microcyp); ddH2O (double distilled water); PBS (phosphate buffered saline); BSA (bovine serum albumin); DTT (dithiothreitol); CAM (chloramphenicol); CAT (chloramphenicol acetyltransferase); IPTG (isopropyl β-D-1-thiogalactopyranoside); GFP (green fluorescent protein); eGFP (enhanced GFP); DsRed (red fluorescent protein isolated from Discosoma sp.); FIOPC (fold improvement over positive control); LB (Luria-Bertani); SPRI (solid phase reversible immobilization); Sigma-Aldrich (Sigma-Aldrich, St. Louis, MO); Perkin Elmer (Perkin Elmer, Inc, Waltham, MA); Harvard Apparatus (Harvard Apparatus, Holliston, MA);Millipore(Millipore, Corp., Billerica MA);Covaris(Covaris, Inc., Woburn, MA);MagBio(MagBio Genomics, Inc., Gaithersburg, MD);Qiagen(Qiagen Inc., Germantown, MD);Illumina(Illumina, Inc., San Diego, CA);BD Biosciences(BD Biosciences, San Jose, CA);Difco(Difco Laboratories, BD Diagnostic Systems, Detroit, MI);Kuhner(Adolf Kuhner, AG, Basel, Switzerland); Zymo (Zymo Research, Irvine, CA); Agilent (Agilent Technologies, Inc., Santa Clara, CA); Thermo Scientific (part of Thermo Fisher Scientific, Waltham, MA); GE Healthcare (GE Healthcare Bio-Sciences, Piscataway, NJ); and Bio-Rad (Bio-Rad Laboratories, Hercules, CA). . Example 1 E. coli expression host containing the recombinant polymerase gene

[0299] The initial polymerase enzyme used to produce the variants of the present disclosure was SEQ ID NO:2 cloned into the expression vector pCK110900 (see FIG. 3 of US Patent Application Publication No. 2006 / 0195947), operably linked to the lac promoter under the control of the lacl repressor. The expression vector also contains a P15a origin of replication and a chloramphenicol resistance gene. The resulting plasmid was transformed into E. coli W3110 using standard methods known in the art. Transformants were isolated by subjecting the cells to chloramphenicol selection, as known in the art (see, for example, US Patent No. 8,383,346 and WO2010 / 144103). Example 2 Preparation of HTP polymerase-containing wet cell pellet

[0300] E. coli cells containing the recombinant polymerase-encoding gene from a monoclonal colony were inoculated into 180 μl of LB containing 1% glucose and 30 μg / mL chloramphenicol (CAM) in the wells of a 96-well shallow-well microtiter plate. The plates were sealed with an O2-permeable seal and the cultures were grown overnight at 30°C, 200 rpm and 85% humidity. Then, 10 μl of each of the cell cultures was transferred to wells of a 96-well deep-well plate containing 390 mL TB and 30 μg / mL CAM. The deep-well plate was sealed with an O2-permeable seal and grown at 30°C, 250 rpm and 85% humidity until OD 600 The cells were incubated until the β-actin concentration reached 0.6-0.8. The cell cultures were then induced with IPTG to a final concentration of 1 mM and incubated overnight under the same conditions as originally used. The cells were then pelleted using centrifugation at 4,000 rpm for 10 min. The supernatant was discarded and the pellet was frozen at -80 °C before lysis. Example 3 Preparation of HTP polymerase-containing cell lysate

[0301] First, 300 μl of buffer containing 50 mM Tris-HCl pH 7.5 and 20 mM sodium chloride was added to the cell paste in each well produced as described in Example 2. The cells were resuspended by shaking on a benchtop shaker. The resuspended cells were transferred to a 96-well hard shell plate and lysed at 80°C for 60 minutes in a thermocycler. The plate was then centrifuged for 30 minutes at 4,000 rpm and 40°C. The cleared supernatant was used in biocatalysis to determine its activity, DNA sensitivity and thermostability level. Example 4 Improvement in PCR amplification activity over SEQ ID NO:2

[0302] SEQ ID NO:2 was selected as the parent enzyme after screening for wild-type enzyme polymerase activity in a PCR assay using a beta-lactam fragment in a pCK vector (pCK-beta-lactamase) and primers SeqF1 (CCAATACGCAAACCGCCTC) (SEQ ID NO:771) and SeqR1 (CAACGGTGGTATATCCAGTGA) (SEQ ID NO:772). A library of engineered genes was produced using well-established techniques (e.g., saturation mutagenesis, recombination of previously identified beneficial mutations). Polypeptides encoded by each gene were produced in a HTP as described in Example 2, and soluble lysates were generated as described in Example 3. Each variant was screened in a 20 μL reaction containing 5 ng / uL pCK-beta-lactamase, 500 nM SeqF1 and SeqR1 primers, 0.2 mM dNTPs, Pfu buffer (20 mM Tris-HCl (pH 8.8 at 25° C.), 10 mM (NH4)2SO4, 10 mM KCl, 0.1% (v / v) Triton® X-100, 0.1 mg / mL BSA.), and 5% HTP lysate by volume. PCR cycling was performed in an Eppendorf Master Nexus Thermal Cycler (95° C. for 2 min, 30 cycles of 95° C. for 30 s, 55° C. for 30 s, 68° C. for 1 min).

[0303] Activity relative to SEQ ID NO:2 (fold improvement in activity over parent, FIOP) was calculated as product concentration (ng / ul) relative to SEQ ID NO:2 and is shown in Table 4.1. [Table 4-1-1] [Table 4-1-2] [Table 4-1-3] Example 5 Improvement in qPCR enzyme activity over SEQ ID NO:8

[0304] DNA polymerase variant SEQ ID NO:8 was selected as the parent enzyme for this round of directed evolution. A library of engineered genes was produced using well-established techniques (e.g., saturation mutagenesis, recombination of previously identified beneficial mutations). Polypeptides encoded by each gene were produced in HTP as described in Example 2, and soluble lysates were generated as described in Example 3. Each variant was screened in a 20 μL reaction containing 1 ng / uL SARS-CoV2 DNA fragment containing the nucleocapsid gene (IDT catalog #>CAT_10006625_2019-nCoV_N_Positive Control), 500 nM N1 primer, 125 nM probe (CDC EUA Assay, catalog #2019-nCoVEUA-01), 0.2 mM dNTPs, RT buffer (10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2), 12.5% ​​HTP lysate by volume, and qPCR cycling (95°C for 2 min, 45 cycles of 95°C for 3 s, 55°C for 30 s) in a CFX384 Touch real-time PCR detection system (BioRad).

[0305] The increased activity compared to the reference polypeptide of SEQ ID NO:8 (activity FIOP) was calculated as the inverse of the Ct value produced by the variant compared to the Ct value (critical threshold) of SEQ ID NO:8 and is shown in Table 5.1. [Table 5-1-1] [Table 5-1-2] [Table 5-1-3] [Table 5-1-4] [Table 5-1-5] [Table 5-1-6] Example 6 Improvements in DNA activity and stability over SEQ ID NO:332

[0306] DNA polymerase variant SEQ ID NO: 332 was selected as the parent enzyme for this round of directed evolution. A library of engineered genes was produced using well-established techniques (e.g., saturation mutagenesis, recombination of previously identified beneficial mutations). Polypeptides encoded by each gene were produced in HTP as described in Example 2, and soluble lysates were generated as described in Example 3. Each variant was screened in a 20 μL reaction containing 1 ng / uL SARS-CoV2 DNA fragment containing the nucleocapsid gene transcript (IDT catalog #>CAT_10006625_2019-nCoV_N_Positive Control), 500 nM N1 primer, 125 nM probe (CDC EUA Assay, catalog #2019-nCoVEUA-01), 0.2 mM dNTPs, RT buffer (10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2), and 6% HTP lysate by volume. qPCR was performed by incubating at 62.5 °C for 30 min in a CFX384 Touch real-time PCR detection system (BioRad) followed by cycling (95 °C for 2 min, 95 °C for 3 s, 55 °C for 30 s for 45 cycles).

[0307] Enzyme activity relative to SEQ ID NO:332 (activity FIOP) was calculated as the reciprocal of the Ct value produced by the variant above the reciprocal of the Ct value (critical threshold) of SEQ ID NO:332 and is shown in Table 6.1. [Table 6-1-1] [Table 6-1-2] [Table 6-1-3] Example 7 Improvements in stability and activity over SEQ ID NO:462

[0308] DNA polymerase variant SEQ ID NO: 462 was selected as the parent enzyme for this round of directed evolution. A library of engineered genes was produced using well-established techniques (e.g., saturation mutagenesis, recombination of previously identified beneficial mutations). Polypeptides encoded by each gene were produced in HTP as described in Example 2, and soluble lysates were generated as described in Example 3. Each variant was screened in a 20 μL reaction consisting of 0.2 ng / uL SARS-CoV2 DNA fragment containing the nucleocapsid gene transcript (IDT catalog #>CAT_10006625_2019-nCoV_N_Positive Control), 500 nM N1 primer, 125 nM probe (CDC EUA Assay, catalog #2019-nCoVEUA-01), 0.2 mM dNTPs, RT buffer (10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2), and 6% HTP lysate by volume. qPCR was performed by incubation at 62.5 °C for 30 min in a CFX384 Touch real-time PCR detection system (BioRad) followed by qPCR cycling (95 °C for 2 min, 95 °C for 3 s, 55 °C for 30 s for 45 cycles).

[0309] Polymerase stability and activity relative to SEQ ID NO:462 (processivity FIOP) was calculated as the reciprocal of the Ct value produced by the variant above the reciprocal of the Ct value of SEQ ID NO:462 (critical threshold) and is shown in Table 7.1. [Table 7-1-1] [Table 7-1-2] [Table 7-1-3] [Table 7-1-4] Example 8 Improvements in activity and sensitivity over SEQ ID NO:606

[0310] SEQ ID NO:606 was selected as the parent enzyme for this round of directed evolution. A library of engineered genes was produced using well-established techniques (e.g., saturation mutagenesis, recombination of previously identified beneficial mutations). Polypeptides encoded by each gene were produced in HTP as described in Example 2, and soluble lysates were generated as described in Example 3. Each variant was screened in a 20 μL reaction consisting of 0.125 ng / uL SARS-CoV2 DNA fragment containing the nucleocapsid gene (IDT catalog #>CAT_10006625_2019-nCoV_N_Positive Control), 500 nM N1 primer, 125 nM probe (CDC EUA Assay, catalog #2019-nCoVEUA-01), 0.2 mM dNTPs, RT buffer (10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2), 1.5% HTP lysate by volume, and qPCR was performed by incubating at 62.5 °C for 30 min in a CFX384 Touch real-time PCR detection system (BioRad) followed by qPCR cycling (95 °C for 2 min, 95 °C for 3 s, 55 °C for 30 s for 45 cycles).

[0311] Polymerase stability and activity (processivity FIOP) relative to SEQ ID NO:606 was calculated as the reciprocal of the Ct value produced by the variant above the reciprocal of the Ct value (critical threshold) of SEQ ID NO:606 and is shown in Table 8.1. [Table 8-1-1] [Table 8-1-2] [Table 8-1-3] [Table 8-1-4]

[0312] Although the invention has been described with reference to specific embodiments, various modifications may be made and equivalents may be substituted to adapt a particular situation, material, composition of matter, process, process step or steps, to achieve the benefits of the invention without departing from the scope of the appended claims.

[0313] For all purposes, any and all publications and patent documents cited in this disclosure are incorporated herein by reference as if each such publication or document was specifically and individually indicated to be incorporated herein by reference. Citation of publications and patent documents is not intended as an indication that any such document is pertinent prior art, nor does it constitute an admission as to the contents or date thereof.

Claims

1. 1. An engineered DNA polymerase or functional fragment thereof comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:2, 8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO:2, 8, 332, 462 or 606, wherein said polypeptide sequence comprises one or more substitutions compared to said reference sequence corresponding to residues 12-850 of SEQ ID NO:2, 8, 332, 462 or 606, or said reference sequence corresponding to SEQ ID NO:2, 8, 332, 462 or 606.

2. 2. The engineered DNA polymerase of claim 1, comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the reference sequence corresponding to residues 12-850 of SEQ ID NO:2 or the reference sequence corresponding to SEQ ID NO:2, wherein the polypeptide sequence comprises one or more substitutions compared to the reference sequence corresponding to residues 12-850 of SEQ ID NO:2 or the reference sequence corresponding to SEQ ID NO:

2.

3. 2. The engineered DNA polymerase of Claim 1, comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the reference sequence corresponding to residues 12-850 of SEQ ID NO:2 or the reference sequence corresponding to SEQ ID NO:2, wherein the polypeptide sequence comprises one or more substitutions compared to the reference sequence corresponding to residues 12-850 of SEQ ID NO:2 or the reference sequence corresponding to SEQ ID NO:

2.

4. 10. The polypeptide sequence of claim 1, wherein the amino acid sequence at amino acid positions 15, 16, 20, 21, 22, 40, 41, 52, 57, 58, 73, 85, 87, 88, 91, 102, 109, 132, 157, 177, 186, 200, 213, 217, 231, 232, 242, 243, 262, 263, 264, 265, 273, 299, 321, 322, 328, 384, 386, 401, 402, 403, 404, 406, 407, 440, 476, 480, 491, 495, 498, 503, 504, 506, 507, 508, 511, 514, 520, 521, 523, 524, 525, 526, 527, 528, 529, 530, 533, 534, 535, 536, 537, 538, 539, 540, 542, 553, 554, 555, 556, 557, 558, 559, 560, 562, 563, 566, 570, 572, 581, 582, 584, 585, 586, 587, 589, 592, 593, 594, 595, 596, 597, 599, 601, 602, 603, 605, 607, 616, 665, 671, 674, 675, 677, 684, 688, 696, 704, 705, 706, 728 735, 747, 748, 749, 750, 751, 753, 755, 756, 762, 763, 764, 766, 772, 773, 779, 793, 803, 814, 820, or 849 or a combination thereof, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO:

2.

5. The polypeptide sequence may comprise at least one of the following substitutions: 15A / G / K / N, 16R, 20A / C, 21K / Q / S, 22K, 40A, 41F, 52R, 57T, 58N, 73A, 85E / P / R / S, 87N, 88T, 91K, 102V / M / S, 109P, 132Y, 157G, 177T, 186E, 200V, 213P, 217E, 231E, 232C, 242Q, 243L / S, 262L, 263A, 264T, 265I, 273M, 299N, 321G, 322N / S, 328I, 384Y, 386V, 401 A / G / I, 402G / R, 403L / R, 404S / T, 406K / Q, 407R / W, 440G, 476I / N, 480E / V / W, 491G, 495E / M / S, 498D, 503I / V, 504M, 50 6P, 507K, 508H, 511M, 514F, 520P, 521G / W / Y, 523A / K / V, 524G / K / Q, 525L / V, 526T, 527V / W, 528A / Q / R / W, 529S, 530G / P / R / W, 533L / P / Q / V, 534H / W, 535K, 536R, 537G / L / W, 538A, 539L / R, 540H / V, 542G / M / T / W, 553F / K / N / R, 554E, 555H / K / M / W, 556F / M / P / W, 557G / H, 558R / S / V / Q, 559D / G / P, 560G / M, 562S, 563L, 566A, 570R, 572I, 581A, 582F, 584N, 585KR , 586M, 587Q / S, 589G / L / R / S / W, 592G / T / V, 593N, 594C / Q / T / V / W, 595A / P / R, 596L / R / W, 597E, 599G / S / T, 601M / P, 602 V, 603G / V / W, 605E / A, 607N, 616A, 665V, 671E / R, 674T, 675L, 677M, 684V, 688I, 696H / V, 704P, 705W, 706E, 728K, 735 3. The engineered DNA polymerase of claim 2, wherein the amino acid positions are relative to SEQ ID NO:

2.

6. 3. The engineered DNA polymerase of claim 2, wherein the polypeptide sequence comprises at least a substitution at amino acid position 40, 85, 102, 132, 157, 177, 262, 263, 503, 521, 748, or 750, or a combination thereof, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO:

2.

7. 7. The engineered DNA polymerase of claim 6, wherein the polypeptide sequence comprises at least the substitutions 40A, 85E, 102S, 132Y, 157G, 177T, 262L, 263A, 521G, 748Y, or 750S, or a combination thereof, and the amino acid positions are relative to the reference sequence of SEQ ID NO:

2.

8. The polypeptide sequence is selected from the group consisting of amino acid positions 213 / 503 / 508 / 584 / 748, 40 / 132 / 748, 40 / 132 / 157 / 262 / 263 / 748, 132, 40 / 132 / 503 / 748, 40 / 132 / 157 / 503 / 562, 40 / 132 / 213 / 748 / 814, 132 / 157 / 562 / 584, 132 / 584 / 748, 40 / 132 / 231 / 684 / 748, 40 / 132, 40 / 41 / 132 / 562 / 684 / 748, 41 / 213 / 231 / 503 / 650 / 674 / 748, 132 / 231 / 503 / 748 , 40 / 132 / 157 / 503, 503 / 748 / 814, 40 / 132 / 231 / 503 / 674 / 748, 40 / 88 / 132 / 503 / 684 / 748, 132 / 157 / 213 / 674 / 748 / 814, 157 / 263 / 748, 40 / 748, 41 / 157 / 2 31 / 262 / 748 / 814, 40 / 213 / 503 / 562 / 584 / 748, 523 / 524, 40 / 132 / 503 / 514 / 650 / 674, 40 / 132 / 157 / 213 / 231, 41 / 213 / 520 / 814, 40 / 41 / 157 / 231 / 503, 40 / 157 / 503, 40 / 132 / 562 / 748, 132 / 748, 40 / 41 / 132 / 562 / 748, 88 / 213 / 503 / 584 / 684 / 748, 57 / 58 / 523 / 616 / 677, 40 / 213 / 231 / 503 / 514 / 562 / 748, 132 / 562 , 213 / 503 / 650, 40 / 41 / 88 / 231 / 748 / 814, 41 / 213 / 262 / 562, 41 / 88 / 231 / 748, 213 / 263 / 748, 40 / 157 / 213, 157 / 520, 40 / 132 / 263 / 503 / 674 / 814, 40 / 41, 5 24 / 665 / 756, 58 / 186 / 217 / 523 / 524 / 677, 40 / 41 / 748, 132 / 514, 520, 41 / 213 / 503 / 562, 231 / 503 / 748 / 772, 503 / 562, 73 / 232 / 514 / 584 / 814, 58 / 507 / 616 , 132 / 262 / 520 / 562 / 684 / 748, 88 / 562 / 814, 41 / 88 / 157 / 814, 88 / 157 / 213 / 674 / 684, 57 / 58 / 523 / 779, 40 / 132 / 157 / 514 / 520 / 684, 40 / 41 / 213 / 684 / 772,40 / 41 / 231 / 503 / 814, 88 / 213 / 503 / 584 / 814, 40 / 41 / 132 / 562 / 584, 41 / 88 / 213 / 231 / 503 / 650 / 748, 40 / 503, 40 / 132 / 213 / 231 / 520 / 562 / 650 / 814, 40 / 41 / 132 / 231 / 262 / 503 / 562 / 584 / 748 / 814, 57 / 58 / 264 / 265 / 524 / 688, 88 / 132 / 157 / 262 / 263 / 520 / 562, 88 / 132 / 157 / 262 3. The engineered DNA polymerase of claim 2, comprising at least a substitution or set of substitutions at the following amino acid positions relative to the reference sequence of SEQ ID NO:2:

9. 5. The polypeptide sequence of claim 1, wherein the amino acid sequence at amino acid positions 22 / 407, 328, 401, 402, 403, 404, 406, 407, 503, 504, 506, 521, 523, 524, 525, 526, 527, 528, 529, 530, 531, 533, 534, 535, 536, 537, 538, 539, 540, 542, 553, 554, 555, 556, 557, 558, 559, 560, 563, 581, 582, 3. The engineered DNA polymerase of claim 2, comprising a substitution or set of substitutions at least at 585, 586, 587, 589, 592, 593, 594, 595, 596, 597, 598, 599, 601, 602, 603, 605, 607, 696, 747, 749, 751, 762, 763, 764, 766, 773, or 803, wherein said amino acid positions are relative to the reference sequence of SEQ ID NO:

2.

10. 16 / 735, 750 / 849, 524 / 581, 403 / 595, 542 / 602, 570 / 671, 675, 704, 728, 735, 753, 755, 762, 764, 793, 820, 821, 835, 849, 850 / 879, 861 / 881, 875 / 902, 876 / 910, 876 / 920, 875 / 930, 876 / 940, 876 / 950, 875 / 961, 876 / 970, 875 / 981, 876 / 990, 881 / 995, 890 / 902, 904 / 910, 910 / 921, 910 / 931, 921 / 942, 921 / 951, 921 / 952, 921 / 962, 921 / 973, 921 / 982, 921 / 995, 921 / 931, 921 / 943, 921 / 952, 921 / 953, 921 / 962, 921 / 973, 921 / 982, 921 / 995, 921 / 931, 921 / 943, 921 / 953, 921 / 954, 921 / 931, 921 / 944, 921 / 932, 921 / 945, 921 / 955, 921 / 956, 921 / 962, 921 / 9 3. The engineered DNA polymerase of claim 2, comprising at least a substitution or set of substitutions at 404 / 524 / 542 / 555 / 762 / 764, 404 / 524 / 542 / 589 / 762 / 764, 524 / 542 / 581 / 762 / 764, 542 / 762 / 764, said amino acid positions relative to said reference sequence of SEQ ID NO:

2.

11. The polypeptide sequence is selected from the group consisting of amino acid positions 750 / 820, 21 / 52, 20 / 21 / 85 / 322 / 476 / 495, 20 / 85 / 200 / 322 / 476 / 495 / 750, 476 / 750, 20C / 476, 20 / 322 / 386, 85 / 322 / 476, 52 / 322 / 498 / 750, 20 / 322 / 476 / 820, 85 / 476 / 495 / 820, 21 / 85 / 322 / 82 0, 20 / 299 / 322 / 386 / 476 / 495 / 820, 20 / 322, 21 / 820 / 849, 476, 322 / 820, 21 / 322 / 386 / 820, 322 / 386 / 495, 85 / 386 / 495 / 750, 20 / 85 / 476 / 750, 20 / 386 / 476, 85 / 322 / 386 / 476 / 495, 20 / 495 / 820, 750, 21 / 322 / 495, 52 / 3 86 / 495 / 820, 21 / 322, 85 / 322 / 750 / 820, 20 / 52 / 85, 21 / 52 / 572, 20 / 85 / 495 / 849, 85 / 750, 21 / 495 / 820, 273 / 322 / 849, 495, 322 / 750 / 820, 52 / 476 / 495 / 566 / 750 / 849, 386 / 495, 495 / 820, 21 / 322 / 495 / 750 / 820, 21 / 8 3. The engineered DNA polymerase of claim 2, comprising at least a substitution or set of substitutions at 5 / 322 / 386 / 495 / 820 / 849, 476 / 495 / 750, 386 / 849, 476 / 495, 85 / 476 / 849, 21 / 322 / 750, 20 / 85 / 566 / 820, or 386 / 750 / 849, said amino acid positions relative to the reference sequence of SEQ ID NO:

2.

12. The polypeptide sequence is selected from the group consisting of amino acid positions 299 / 386 / 566 / 820, 476 / 820 / 849, 21 / 322 / 476 / 495 / 820, 177, 21 / 495, 476 / 820, 20 / 52 / 299, 52 / 299, 322 / 820, 20 / 820, 20 / 299 / 386 / 476, 386 / 476 / 820, 476 / 495 / 820, 386 / 476 / 495, 20 / 21 / 299 / 322 / 386, 322 / 386 / 495, 21 / 299 / 322 / 476 / 495 / 820, 21 / 299 / 386 / 820, 299 / 476 / 820, 20 / 21, 21 / 85 / 102 / 750, 705, 21 / 386 / 476 / 820, 820, 21 / 299 / 322, 20 / 21 / 322 / 386 / 820, 299, 21 / 299 / 386 / 476, 109, 322 / 495, 491, 52 / 820 , 21 / 386 / 820, 20 / 21 / 495, 21 / 299 / 322 / 495 / 566 / 820, 20 / 21 / 299 / 495, 756, 386 / 820, 495, 511, 21 / 52 / 242 / 386 / 495 / 820, 299 / 476 / 495, 706, 21 / 299 / 386 / 476 / 495, 21 / 299 / 322 / 495, 21 / 476 / 849, 299 / 322 / 476 / 820, 21 3. The engineered DNA polymerase of claim 2, wherein the engineered DNA polymerase comprises a substitution or set of substitutions at amino acid positions 20 / 21 / 566, 20 / 52, 322 / 386 / 495 / 566 / 820, 21 / 299, 21 / 299 / 386, 386 / 849, 52 / 476, 52 / 299 / 322 / 386 / 495, or 440, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO:

2.

13. The polypeptide sequence is selected from the group consisting of amino acid positions 22 / 40 / 132 / 157 / 262 / 263 / 407 / 748, 40 / 132 / 157 / 262 / 263 / 328 / 748, 40 / 132 / 157 / 262 / 263 / 401 / 748, 40 / 132 / 157 / 262 / 263 / 402 / 748, 40 / 132 / 157 / 262 / 263 / 403 / 748, 40 / 132 / 157 / 262 / 263 / 404 / 748, 40 / 132 / 157 / 262 / 263 / 406 / 748, 40 / 132 / 157 / 262 / 263 / 407 / 748, 40 / 132 / 157 / 262 / 263 / 407 / 748, 262 / 263 / 503 / 748, 40 / 132 / 157 / 262 / 263 / 504 / 748, 40 / 132 / 157 / 262 / 263 / 506 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 748, 40 / 132 / 157 / 262 / 263 / 523 / 748, 40 / 132 / 157 / 262 / 263 / 524 / 748, 40 / 132 / 157 / 262 / 263 / 525 / 748, 40 / 132 / 157 / 262 / 263 / 526 / 748, 40 / 132 / 157 / 262 / 263 / 527 / 748, 40 / 132 / 157 / 262 / 2 63 / 528 / 748, 40 / 132 / 157 / 262 / 263 / 529 / 748, 40 / 132 / 157 / 262 / 263 / 530 / 748, 40 / 132 / 157 / 262 / 263 / 531 / 748, 40 / 132 / 157 / 262 / 263 / 533 / 748, 40 / 13 2 / 157 / 262 / 263 / 534 / 748, 40 / 132 / 157 / 262 / 263 / 535 / 748, 40 / 132 / 157 / 262 / 263 / 536 / 748, 40 / 132 / 157 / 262 / 263 / 537 / 748, 40 / 132 / 157 / 262 / 263 / 53 8 / 748, 40 / 132 / 157 / 262 / 263 / 539 / 748, 40 / 132 / 157 / 262 / 263 / 540 / 748, 40 / 132 / 157 / 262 / 263 / 542 / 748, 40 / 132 / 157 / 262 / 263 / 54G / 748, 40 / 132 / 157 / 262 / 263 / 553 / 748, 40 / 132 / 157 / 262 / 263 / 554 / 748, 40 / 132 / 157 / 262 / 263 / 555 / 748, 40 / 132 / 157 / 262 / 263 / 556 / 748, 40 / 132 / 157 / 262 / 263 / 557 / 748,40/132/157/262/263/558/748、40/132/157/262/263/559/748、40/132/157/262/263/560/748、40/132/157/262/263/563/748、40/132/157/262/263/581/748、40/132/157/262/263/582/748、40/132/157/262/263/585/748、40/132/157/262/263/586/748、40/132/157/262/263/587/748、40/132/157/262/263/589/748、40/132/157/262/263/592/748、40/132/157/262/263/593/748、40/132/157/262/263/594/748、40/132/157/262/263/595/748、40/132/157/262/263/596/748、40/132/157/262/263/597/748、40/132/157/262/263/598/748、40/132/157/262/263/599/748、40/132/157/262/263/601/748、40/132/157/262/263/602/748、40/132/157/262/263/603/748、40/132/157/262/263/605/748、40/132/157/262/263/607/748、40/132/157/262/263/696/748、40/132/157/262/263/747/748、40/132/157/262/263/748、40/132/157/262/263/748/749、40/132/157/262/263/748/751、40/132/157/262/263/748/762、40/132/157/262/263/748/763、40/132/157/262/263/748/764、40/132/157/262/263/748/766、40/132/157/262/263/748/773、40/132/157/262/263/748/803、40/132/157/605/262/263/748、40/132/157/262/263/403/521/748、or 40 / 132 / 157 / 262 / 263 / 403 / 553 / 748, wherein said amino acid positions are relative to said reference sequence of SEQ ID NO:

2.

14. The polypeptide sequence is selected from the group consisting of amino acid positions 40 / 132 / 157 / 262 / 263 / 403 / 404 / 521 / 524 / 542 / 555 / 748 / 762 / 764, 40 / 132 / 157 / 262 / 263 / 404 / 521 / 524 / 542 / 589 / 748 / 762 / 764, 40 / 132 / 157 / 262 / 263 / 521 / 524 / 542 / 581 / 748 / 762 / 764, 40 / 132 / 157 / 262 / 263 / 521 / 542 / 748 / 762 / 764, 40 / 132 / 157 / 262 / 263 / 404 / 521 / 542 / 748 / 762 / 764 8 / 762, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 750 / 849, 40 / 132 / 157 / 262 / 263 / 521 / 524 / 581 / 748, 16 / 40 / 132 / 157 / 262 / 263 / 521 / 735 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 820, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 793, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 764, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 755, 40 / 132 / 15 7 / 262 / 263 / 521 / 748 / 753, 40 / 132 / 157 / 262 / 263 / 521 / 735 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 748 / 728, 40 / 132 / 157 / 262 / 263 / 521 / 704 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 675 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 671 / 748, 40 / 132 / 157 / 262 / 263 / 521 / 570 / 748, 40 / 132 / 157 / 262 / 263 / 495 / 521 / 748, 40 / 1 32 / 157 / 262 / 263 / 480 / 521 / 748, 40 / 132 / 157 / 262 / 263 / 476 / 521 / 748, 40 / 132 / 157 / 262 / 263 / 384 / 521 / 748, 40 / 132 / 157 / 262 / 263 / 322 / 521 / 748, 40 / 132 / 157 / 262 / 263 / 321 / 521 / 748, 40 / 132 / 157 / 243 / 262 / 263 / 521 / 748, 15 / 40 / 132 / 157 / 262 / 263 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 521 / 748,3. The engineered DNA polymerase of claim 2, comprising at least a substitution or set of substitutions at 40 / 91 / 132 / 157 / 262 / 263 / 521 / 748, 40 / 87 / 132 / 157 / 262 / 263 / 521 / 748, 40 / 85 / 132 / 157 / 262 / 263 / 521 / 748, 20 / 40 / 132 / 157 / 262 / 263 / 521 / 748, 21 / 40 / 132 / 157 / 262 / 263 / 521 / 748, or 40 / 52 / 132 / 157 / 262 / 263 / 521 / 748, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO:

2.

15. The polypeptide sequence is selected from the group consisting of amino acid positions 40 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750, 21 / 40 / 52 / 102 / 132 / 157 / 262 / 263 / 521 / 748, 21 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748, 20 ... 0 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750, 40 / 102 / 132 / 157 / 262 / 263 / 386 / 495 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 476 / 495 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 820, 40 / 102 / 132 / 157 / 262 / 263 / 386 / 521 / 748 / 849, 20 / 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748, 40 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750, 40 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 820, 40 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750 / 820, 21 / 40 / 52 / 102 / 132 / 157 / 262 / 263 / 521 / 572 / 748, 20 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 521 / 748, 21 / 40 / 102 / 13 2 / 157 / 262 / 263 / 322 / 495 / 521 / 748, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 476 / 521 / 748, 20 / 40 / 102 / 132 / 157 / 262 / 263 / 386 / 476 / 521 / 748, 21 / 40 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 750, 21 / 40 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 820, 20 / 40 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 820,40/85/102/132/157/262/263/476/521/748/849、21/40/102/132/157/262/263/521/748/820/849、40/102/132/157/262/263/322/386/495/521/748、40/102/132/157/262/263/273/322/521/748/849、40/102/132/157/262/263/476/495/521/748/750、40/102/132/157/262/263/322/521/748/750/820、40/102/132/157/262/263/386/521/748/750/849、21/40/85/102/132/157/262/263/322/521/748/820、20/40/85/102/132/157/262/263/476/521/748/750、20/40/85/102/132/157/262/263/495/521/748/849、20/40/85/102/132/157/262/263/521/566/748/820、40/52/102/132/157/262/263/322/498/521/748/750、21/40/102/132/157/262/263/322/386/521/748/820、40/52/102/132/157/262/263/386/495/521/748/820、20/40/102/132/157/262/263/322/476/521/748/820、40/85/102/132/157/262/263/386/495/521/748/750、40/85/102/132/157/262/263/476/495/521/748/820、40/85/102/132/157/262/263/322/521/748/750/820、40/85/102/132/157/262/263/322/386/476/495/521/748、21/40/102/132/157/262/263/322/495/521/748/750/820、20/21/40/85/102/132/157/262/263/322/476/495/521/748、20 / 40 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 386 / 476 / 495 / 521 / 748, 40 / 52 / 102 / 132 / 157 / 262 / 263 / 476 / 495 / 521 / 566 / 748 / 750 / 849, 20 / 40 / 85 / 102 / 132 / 157 / 262 / 200 / 263 / 322 / 476 / 495 / 521 / 748 / 750, or 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 495 / 521 / 748 / 820 / 849, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO:

2.

16. The polypeptide sequence is selected from the group consisting of amino acid positions 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 521 / 566 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750 / 820, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 476 / 495 / 521 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 177 / 263 / 521 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 495 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750 / 820, 20 / 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 521 / 748 / 750, 52 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 521 / 748 / 750 / 820, 20 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750 / 820, 20 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 476 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 476 / 521 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 495 / 521 / 748 / 750, 20 / 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 386 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 495 / 521 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 476 / 495 / 521 / 748 / 750 / 820, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 521 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 476 / 521 / 748 / 750 / 820,20/21/40/85/102/132/157/262/263/521/748/750、21/40/102/132/157/262/263/521/748、40/85/102/132/157/262/263/521/705/748/750、21/40/85/102/132/157/262/263/386/476/521/748/750/820、40/85/102/132/157/262/263/521/748/750/820、21/40/85/102/132/157/262/263/299/322/521/748/750、20/40/85/102/132/157/262/263/322/386/521/748/750/820、40/85/102/132/157/262/263/299/521/748/750、21/40/85/102/132/157/262/263/299/386/476/521/748/750、40/85/102/109/132/157/262/263/521/748/750、40/85/102/132/157/262/263/322/495/521/748/750、40/85/102/132/157/262/263/491/521/748/750、40/52/85/102/132/157/262/263/521/748/750/820、21/40/85/102/132/157/262/263/386/521/748/750/820、20/21/40/85/102/132/157/262/263/495/521/748/750、21/40/85/102/132/157/262/263/299/322/495/521/566/748/750/820、20/21/40/85/102/132/157/262/263/299/495/521/748/750、40/85/102/132/157/262/263/521/748/750/756、40/85/102/132/157/262/263/386/521/748/750/820、40/85/102/132/157/262/263/495/521/748/750、40/85/102/132/157/262/263/511/521/748/750、21 / 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 242 / 386 / 495 / 521 / 748 / 750 / 820, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 476 / 495 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 706 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 476 / 495 / 521 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 495 / 521 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750 / 849, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 476 / 521 / 748 / 750 / 820, 21 / 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 521 / 748 / 750 / 820, 20 / 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 566 / 748 / 7 50, 20 / 40 / 52 / / 85 / 102 / 132 / 157 / 262 / 263 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 322 / 386 / 495 / 521 / 566 / 748 / 750 / 820, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 521 / 748 / 750, 21 / 40 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 386 / 521 / 748 / 750, 40 / 85 / 102 / 132 / 157 / 262 / 263 / 386 / 521 3. The engineered DNA polymerase of claim 2, wherein the engineered DNA polymerase comprises at least a substitution or set of substitutions at amino acid positions 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 476 / 521 / 748 / 750, 40 / 52 / 85 / 102 / 132 / 157 / 262 / 263 / 299 / 322 / 386 / 495 / 521 / 748 / 750, or 40 / 85 / 102 / 132 / 157 / 262 / 263 / 440 / 521 / 748 / 750, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO:

2.

17. 10. The engineered DNA polymerase of claim 1, comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO: 8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO: 8, 332, 462 or 606.

18. 2. The engineered DNA polymerase of Claim 1, comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO: 8, 332, 462 or 606, or a reference sequence corresponding to SEQ ID NO: 8, 332, 462 or 606, wherein the polypeptide sequence comprises one or more substitutions compared to the reference sequence corresponding to residues 12-850 of SEQ ID NO: 8, 332, 462 or 606, or the reference sequence corresponding to SEQ ID NO: 8, 332, 462 or 606.

19. 200, 213, 217, 231, 232, 242, 243, 262, 263, 264, 265, 273, 299, 321, 322, 328, 384, 386, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439, 440, 441, 442, 443, 444, 445, 446, 447, 448, 449, 450, 451, 452, 453, 454, 455, 456, 457, 458, 459, 460, 461, 462, 463, 464, 465, 466, 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 403, 404, 406, 407, 440, 476, 480, 491, 495, 498, 503, 504, 506, 507, 508, 511, 514, 520, 521, 523, 524, 525, 526, 527, 528, 529, 530, 533, 534, 535, 536, 537, 538, 539, 540, 542, 553, 554, 555, 556, 557, 558 , 559, 560, 562, 563, 566, 570, 572, 581, 582, 584, 585, 586, 587, 589, 592, 593, 594, 595, 596, 597, 599, 601, 602, 603, 605, 607, 616, 665, 671, 674, 675, 677, 684, 688, 696, 704, 705, 706, 728, 735, 747, 74 19. The engineered DNA polymerase of claim 18, comprising a substitution at least at amino acid positions 8, 749, 750, 751, 753, 755, 756, 762, 763, 764, 766, 772, 773, 779, 793, 803, 814, 820, or 849 or a combination thereof, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO: 8, 332, 462, or 606.

20. The polypeptide sequence comprises at least the amino acid residues 15A / G / K / N, 16R, 20A / C, 21K / Q / S, 22K, 40A, 41F, 52R, 57T, 58N, 73A, 85E / P / R / S, 87N, 88T, 91K, 102V / M / S, 109P, 132Y, 157G, 177T, 186E, 200V, 213P, 217E, 231E, 232C, 242Q, 243L / S, 262L, 263A, 264T, 265I, 273M, 299N, 321G, 322N / S, 328I, 384Y, 386V, 401A / G / I, 402G / R, 403L / R, 404S / T, 406K / Q, 407R / W, 440G, 476I / N, 480E / V / W, 491G, 495E / M / S, 498D, 503I / V, 504M, 506P , 507K, 508H, 511M, 514F, 520P, 521G / W / Y, 523A / K / V, 524G / K / Q, 525L / V, 526T, 527V / W, 528A / Q / R / W, 529S, 530G / P / R / W , 533L / P / Q / V, 534H / W, 535K, 536R, 537G / L / W, 538A, 539L / R, 540H / V, 542G / M / T / W, 553F / K / N / R, 554E, 555H / K / M / W, 556 F / M / P / W, 557G / H, 558R / S / V / Q, 559D / G / P, 560G / M, 562S, 563L, 566A, 570R, 572I, 581A, 582F, 584N, 585KR, 586M, 587Q / S, 589G / L / R / S / W, 592G / T / V, 593N, 594C / Q / T / V / W, 595A / P / R, 596L / R / W, 597E, 599G / S / T, 601M / P, 602V, 603G / V / W, 60 5E / A, 607N, 616A, 665V, 671E / R, 674T, 675L, 677M, 684V, 688I, 696H / V, 704P, 705W, 706E, 728K, 735G / L, 747T, 748Y, 74 19. The engineered DNA polymerase of Claim 18, comprising 9L / R / T, 750S / P, 751H, 753K / V, 755P, 756N / T, 762M / Q / V, 763G / Y, 764A / I / V, 766Y, 772I, 773R, 779I, 793G, 803C / R, 814E, 820A, or 849T or a combination thereof, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO: 8, 332, 462, or 606.

21. 20. The engineered DNA polymerase of Claim 18, wherein the polypeptide sequence comprises a substitution at least at amino acid position 40, 85, 102, 132, 157, 177, 262, 263, 521, 748, or 750, or a combination thereof.

22. 20. The engineered DNA polymerase of Claim 18, wherein the polypeptide sequence comprises at least amino acid residues 40A, 85E, 102S, 132Y, 157G, 177T, 262L, 263A, 521G, 748Y, or 750S, or a combination thereof.

23. 19. The engineered DNA polymerase of Claim 18, comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:8 or a reference sequence corresponding to SEQ ID NO:8, wherein the polypeptide sequence comprises one or more substitutions compared to the reference sequence corresponding to residues 12-850 of SEQ ID NO:8 or the reference sequence corresponding to SEQ ID NO:

8.

24. 5. The polypeptide sequence of claim 1, wherein the amino acid sequence at amino acid positions 22 / 407, 328, 401, 402, 403, 404, 406, 407, 503, 504, 506, 521, 523, 524, 525, 526, 527, 528, 529, 530, 531, 533, 534, 535, 536, 537, 538, 539, 540, 542, 553, 554, 555, 556, 557, 558, 559, 560, 563, 581, 582, 585, 586, 19. The engineered DNA polymerase of claim 18, comprising at least a substitution or set of substitutions at 587, 589, 592, 593, 594, 595, 596, 597, 598, 599, 601, 602, 603, 605, 607, 696, 747, 749, 751, 762, 763, 764, 766, 773, 803, 403 / 553 or a combination thereof, wherein said amino acid positions are relative to the reference sequence of SEQ ID NO:

8.

25. 19. The engineered DNA polymerase of Claim 18, comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:332, or a reference sequence corresponding to SEQ ID NO:332, wherein the polypeptide sequence comprises one or more substitutions compared to the reference sequence corresponding to residues 12-850 of SEQ ID NO:332, or the reference sequence corresponding to SEQ ID NO:

332.

26. 1. The polypeptide sequence of claim 1, wherein the amino acid residues at amino acid positions 15, 20, 21, 52, 85, 87, 91, 102, 243, 321, 322, 384, 404, 476, 480, 495, 542, 570, 671, 675, 704, 728, 735, 753, 755, 762, 764, 793, 820, 16 / 735, 750 / 849, 524 / 581, 403 / 404 19. The engineered DNA polymerase of claim 18, wherein the engineered DNA polymerase comprises at least a substitution or set of substitutions at: 404 / 524 / 542 / 555 / 762 / 764, 404 / 524 / 542 / 589 / 762 / 764, 524 / 542 / 581 / 762 / 764, or 542 / 762 / 764, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO:

332.

27. 19. The engineered DNA polymerase of Claim 18, comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:462 or a reference sequence corresponding to SEQ ID NO:462, wherein the polypeptide sequence comprises one or more substitutions compared to the reference sequence corresponding to residues 12-850 of SEQ ID NO:462 or the reference sequence corresponding to SEQ ID NO:

462.

28. the polypeptide sequence is selected from the group consisting of amino acid positions 750 / 820, 21 / 52, 20 / 21 / 85 / 322 / 476 / 495, 20 / 85 / 200 / 322 / 476 / 495 / 750, 476 / 750, 20 / 476, 20 / 322 / 386, 85 / 322 / 476, 52 / 322 / 498 / 750, 20 / 322 / 476 / 820, 85 / 476 / 495 / 820, 21 / 85 / 322 / 820, 20 / 299 / 322 / 386 / 476 / 495 / 820, 20 / 322, 21 / 820 / 849, 476, 322 / 820, 21 / 322 / 386 / 820, 322 / 386 / 495, 85 / 386 / 495 / 750, 20 / 85 / 476 / 750, 20 / 386 / 476, 85 / 322 / 386 / 476 / 495, 20 / 495 / 820, 750, 21 / 322 / 495, 52 / 386 / 495 / 820, 21 / 322, 85 / 322 / 750 / 820, 20 / 52 / 85, 21 / 52 / 572, 20 / 85 / 495 / 849, 85 / 750, 21 / 495 / 820, 273 / 322 / 849, 495, 322 / 750 / 820, 52 / 476 / 495 / 566 / 750 / 849, 386 / 495, 495 / 820, 21 / 322 / 495 / 750 / 820, 21 / 85 / 3 19. The engineered DNA polymerase of Claim 18, comprising at least a substitution or set of substitutions at 22 / 386 / 495 / 820 / 849, 476 / 495 / 750, 386 / 849, 476 / 495, 85 / 476 / 849, 21 / 322 / 750, 20 / 85 / 566 / 820, or 386 / 750 / 849, wherein said amino acid positions are relative to the reference sequence of SEQ ID NO:

462.

29. 19. The engineered DNA polymerase of Claim 18, comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference sequence corresponding to residues 12-850 of SEQ ID NO:606, or a reference sequence corresponding to SEQ ID NO:606, wherein the polypeptide sequence comprises one or more substitutions compared to the reference sequence corresponding to residues 12-850 of SEQ ID NO:606, or the reference sequence corresponding to SEQ ID NO:

606.

30. The polypeptide sequence is selected from the group consisting of amino acid positions 299 / 386 / 566 / 820, 476 / 820 / 849, 21 / 322 / 476 / 495 / 820, 177, 21 / 495, 476 / 820, 20 / 52 / 299, 52 / 299, 322 / 820, 20 / 820, 20 / 299 / 386 / 476, 386 / 476 / 820, 476 / 495 / 820, 386 / 476 / 495, 20 / 21 / 299 / 322 / 38 6, 322 / 386 / 495, 21 / 299 / 322 / 476 / 495 / 820, 21 / 299 / 386 / 820, 299 / 476 / 820, 20 / 21, 21 / 85 / 102 / 750, 705, 21 / 386 / 476 / 820, 820, 21 / 299 / 322, 20 / 21 / 322 / 386 / 820, 299, 21 / 299 / 386 / 476, 109, 322 / 495, 491, 52 / 820, 21 / 386 / 820, 20 / 21 / 495, 21 / 299 / 322 / 495 / 566 / 820, 20 / 21 / 299 / 495, 756, 386 / 820, 495, 511, 21 / 52 / 242 / 386 / 495 / 820, 299 / 476 / 495, 706, 21 / 299 / 386 / 476 / 495, 21 / 299 / 322 / 495, 21 / 476 / 849, 299 / 322 / 476 / 820, 21 / 52 / 299 / 322 19. The engineered DNA polymerase of claim 18, wherein the engineered DNA polymerase comprises at least a substitution or set of substitutions in: 20 / 21 / 566, 20 / 52, 322 / 386 / 495 / 566 / 820, 21 / 299, 21 / 299 / 386, 386 / 849, 52 / 476, 52 / 299 / 322 / 386 / 495, 440, or a combination thereof, wherein the amino acid positions are relative to the reference sequence of SEQ ID NO:

606.

31. 2. The engineered DNA polymerase of claim 1, wherein the DNA polymerase comprises a polypeptide sequence comprising a substitution or set of substitutions provided in Tables 4.1, 5.1, 6.1, 7.1 and 8.1, wherein the substitution or set of substitutions is compared to the reference sequence of SEQ ID NO: 2, 8, 332, 462 or 606.

32. 10. The engineered DNA polymerase of claim 1, comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a sequence comprising residues 12-850 of an engineered DNA polymerase variant shown in Tables 4.1, 5.1, 6.1, 7.1 and 8.

1.

33. 2. The engineered DNA polymerase of claim 1, comprising a polypeptide sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the sequence of an engineered DNA polymerase variant shown in Tables 4.1, 5.1, 6.1, 7.1 and 8.

1.

34. the DNA polymerase is selected from the group consisting of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, and 144 , 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 2 70, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 3 32, 334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, ​​384, 386, 388, 390, 392, 39 4, 396, 398, 400, 402, 404, 406, 408, 440, 442, 444, 446, 448, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456 , 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518,520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 565, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692, 694, 696, 698, 700, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 2. The engineered DNA polymerase of claim 1, comprising a polypeptide sequence comprising residues 12-850 of 746, 748, 750, 752, 754, 756, 758, 760, 762, 764, 766, 768, or 770, wherein the polypeptide sequence optionally has 1, 2, 3, 4, 5, 6, 7, 8, 9, or up to 10 substitutions.

35. the DNA polymerase is selected from the group consisting of SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, and 144 , 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 202, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248, 250, 252, 254, 256, 258, 260, 262, 264, 266, 268, 2 70, 272, 274, 276, 278, 280, 282, 284, 286, 288, 290, 292, 294, 296, 298, 300, 302, 304, 306, 308, 310, 312, 314, 316, 318, 320, 322, 324, 326, 328, 330, 3 32, 334, 336, 338, 340, 342, 344, 346, 348, 350, 352, 354, 356, 358, 360, 362, 364, 366, 368, 370, 372, 374, 376, 378, 380, 382, ​​384, 386, 388, 390, 392, 39 4, 396, 398, 400, 402, 404, 406, 408, 440, 442, 444, 446, 448, 420, 422, 424, 426, 428, 430, 432, 434, 436, 438, 440, 442, 444, 446, 448, 450, 452, 454, 456 , 458, 460, 462, 464, 466, 468, 470, 472, 474, 476, 478, 480, 482, 484, 486, 488, 490, 492, 494, 496, 498, 500, 502, 504, 506, 508, 510, 512, 514, 516, 518,520, 522, 524, 526, 528, 530, 532, 534, 536, 538, 540, 542, 544, 546, 548, 550, 552, 554, 556, 558, 560, 565, 564, 566, 568, 570, 572, 574, 576, 578, 580, 582, 584, 586, 588, 590, 592, 594, 596, 598, 600, 602, 604, 606, 608, 610, 612, 614, 616, 618, 620, 622, 624, 626, 628, 630, 632, 634, 636, 638, 640, 642, 644, 646, 648, 650, 652, 654, 656, 658, 660, 662, 664, 666, 668, 670, 672, 674, 676, 678, 680, 682, 684, 686, 688, 690, 692, 694, 696, 698, 700, 700, 702, 704, 706, 708, 710, 712, 714, 716, 718, 720, 722, 724, 726, 728, 730, 732, 734, 736, 738, 740, 742, 744, 746, 748, 750, 752, 754, 756, 758, 760, 762, 764, 766, 768, or 770, wherein the polypeptide optionally has 1, 2, 3, 4, 5, 6, 7, 8, 9, or up to 10 substitutions in the polypeptide sequence.

36. 35. The engineered DNA polymerase of claim 34, wherein the polypeptide has 1, 2, 3, 4, up to 5 substitutions in the polypeptide sequence.

37. 35. The engineered DNA polymerase of claim 34, wherein the substitution comprises a conservative substitution.

38. 2. The engineered DNA polymerase of claim 1, wherein the polypeptide sequence comprises a sequence comprising residues 12 to 850 of SEQ ID NO: 8, 332, 462, or 606, or a sequence comprising SEQ ID NO: 8, 332, 462, or 606.

39. 10. The engineered DNA polymerase of claim 1, which is a fusion protein.

40. 10. The engineered DNA polymerase of claim 1, which has DNA polymerase activity.

41. 10. The engineered DNA polymerase of claim 1, having at least one improved property compared to a reference DNA polymerase.

42. 42. The engineered DNA polymerase of claim 41, having at least one improved property selected from increased activity, increased stability, increased thermostability, increased processivity, increased fidelity, and increased product yield in PCR reactions compared to the reference DNA polymerase.

43. 42. The engineered DNA polymerase of Claim 41, wherein the reference DNA polymerase has the sequence corresponding to residues 12 to 850 of SEQ ID NO: 8, 332, 462 or 606, or the sequence corresponding to SEQ ID NO: 2, 8, 332, 462 or 606.

44. 10. The engineered DNA polymerase of claim 1, which is purified.

45. A recombinant polynucleotide encoding the engineered DNA polymerase of claim 1.

46. 46. ​​The recombinant polynucleotide of Claim 45, comprising a reference polynucleotide sequence corresponding to nucleotide residues 34 to 2550 of SEQ ID NO: 1, 7, 331, 461 or 605, or a sequence having at least 75%, 80%, 81%, 82%, 83%, 84%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to a reference polynucleotide sequence corresponding to SEQ ID NO: 1, 7, 331, 461 or 605, wherein the recombinant polynucleotide encodes an engineered DNA polymerase or a functional fragment thereof.

47. 46. ​​The recombinant polynucleotide of claim 45, wherein the polynucleotide sequence is codon optimized.

48. 47. The recombinant polynucleotide of claim 46, wherein the polynucleotide sequence comprises nucleotide residues 34 to 2550 of, or comprises, SEQ ID NO: 7, 331, 461 or 605.

49. The polynucleotide sequences are selected from the group consisting of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 1 45, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 20 7, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269 , 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391, 393, 3 95, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 45 7, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511, 513, 515, 517, 519,521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 577, 579, 581, 583, 58 5, 587, 589, 591, 593, 595, 597, 599, 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 641, 643, 645, 647, 649, 6 46. ​​The recombinant polynucleotide of claim 45, comprising nucleotide residues 34 to 2550 of: 51, 656, 655, 657, 659, 661, 663, 665, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697, 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729, 731, 733, 735, 737, 739, 741, 743, 745, 747, 749, 751, 753, 755, 757, 759, 761, 763, 765, 767, or 769.

50. The polynucleotide sequences are selected from the group consisting of SEQ ID NOs: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93, 95, 97, 99, 101, 103, 105, 107, 109, 111, 113, 115, 117, 119, 121, 123, 125, 127, 129, 131, 133, 135, 137, 139, 141, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 1 45, 147, 149, 151, 153, 155, 157, 159, 161, 163, 165, 167, 169, 171, 173, 175, 177, 179, 181, 183, 185, 187, 189, 191, 193, 195, 197, 199, 201, 203, 205, 20 7, 209, 211, 213, 215, 217, 219, 221, 223, 225, 227, 229, 231, 233, 235, 237, 239, 241, 243, 245, 247, 249, 251, 253, 255, 257, 259, 261, 263, 265, 267, 269 , 271, 273, 275, 277, 279, 281, 283, 285, 287, 289, 291, 293, 295, 297, 299, 301, 303, 305, 307, 309, 311, 313, 315, 317, 319, 321, 323, 325, 327, 329, 331, 333, 335, 337, 339, 341, 343, 345, 347, 349, 351, 353, 355, 357, 359, 361, 363, 365, 367, 369, 371, 373, 375, 377, 379, 381, 383, 385, 387, 389, 391, 393, 3 95, 397, 399, 401, 403, 405, 407, 409, 411, 413, 415, 417, 419, 421, 423, 425, 427, 429, 431, 433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 45 7, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 495, 497, 499, 501, 503, 505, 507, 509, 511, 513, 515, 517, 519,521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 577, 579, 581, 58 3, 585, 587, 589, 591, 593, 595, 597, 599, 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 641, 643, 645, 6 47, 649, 651, 656, 655, 657, 659, 661, 663, 665, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697, 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729, 731, 733, 735, 737, 739, 741, 743, 745, 747, 749, 751, 753, 755, 757, 759, 761, 763, 765, 767, or 769.

51. An expression vector comprising at least one polynucleotide according to any one of claims 45 to 50.

52. 52. The expression vector of claim 51, wherein the polynucleotide is operably linked to a regulatory sequence.

53. 52. The expression vector of claim 51, wherein the control sequence comprises a promoter.

54. A host cell transformed with a recombinant polynucleotide according to any one of claims 45 to 50 or an expression vector comprising at least one polynucleotide according to any one of claims 45 to 50.

55. 55. A method for producing an engineered DNA polymerase polypeptide in a host cell, comprising culturing the host cell of claim 54 under suitable culture conditions such that at least one engineered DNA polymerase is produced.

56. 56. The method of claim 55, further comprising recovering the at least one engineered DNA polymerase from the culture and / or host cell.

57. 56. The method of Claim 55, further comprising the step of purifying said at least one engineered DNA polymerase.

58. 45. A composition comprising at least one engineered DNA polymerase according to any one of claims 1 to 44.

59. 60. The composition of claim 58, further comprising one or more of a buffer, a nucleotide substrate, and / or an oligonucleotide primer substrate.

60. 45. A method of preparing a complementary DNA to a target DNA, the method comprising contacting the target DNA with the engineered DNA polymerase of any one of claims 1 to 44 in the presence of a substrate under conditions suitable for producing a complementary DNA to all or part of the target DNA.

61. 45. A method for detecting the presence of a target DNA, comprising contacting a sample suspected of containing target DNA with the engineered DNA polymerase of any one of claims 1 to 44 in the presence of a substrate under conditions suitable for DNA polymerase-mediated production of DNA complementary to all or part of the target DNA, and detecting the presence of the complementary DNA.

62. 62. The method of claim 61, wherein the complementary DNA is detected by amplifying the complementary DNA.

63. 63. The method of claim 62, wherein said amplifying is by polymerase chain reaction (PCR) or isothermal amplification.

64. 64. The method of claim 63, wherein the isothermal amplification is by loop-mediated isothermal amplification (LAMP).

65. 45. A method for amplifying a target DNA, comprising contacting the target DNA with a DNA polymerase according to any one of claims 1 to 44 in the presence of a substrate under conditions suitable for amplification of the target DNA.

66. 66. The method of claim 65, wherein the conditions are for a polymerase chain reaction.

67. 66. The method of claim 65, wherein the conditions are for LAMP.

68. 45. A method for sequencing a target DNA, comprising contacting the target DNA with the DNA polymerase of any one of claims 1 to 44 under conditions suitable for DNA polymerase-mediated extension of a DNA complementary to the target DNA in the presence of a substrate suitable for sequencing, and determining the sequence of the target DNA.

69. A kit comprising at least one engineered DNA polymerase according to any one of claims 1 to 44.

70. 70. The kit of claim 69, further comprising one or more of a buffer, a nucleotide substrate and / or an oligonucleotide primer substrate.

71. 70. The kit of claim 69, further comprising a second DNA polymerase.