USH2A pre-mRNA targeting snRNA and uses thereof

Abstract

The recognition domain is reverse complementary to the USH2A pre-mRNA sequence and provides a snRNA that targets USH2A pre-mRNA to splice skip exon 13 by binding to the USH2A pre-mRNA, which promotes exon 13 skipping more efficiently than AONs.

Description

[Technical field]

[0001] The present invention relates to the field of genetic engineering technology, and in particular to snRNA targeting USH2A pre-mRNA and uses thereof. [Background technology]

[0002] Usher syndrome, also known as deafness-retinitis pigmentosa syndrome, is a genetic disorder characterized by variable degrees of congenital sensorineural hearing loss and progressive vision loss due to retinitis pigmentosa (RP). Clinically, Usher syndrome can be classified into three types: 1. Type I Usher syndrome, patients suffer from congenital profound sensorineural hearing loss, loss of vestibular response, prepubertal retinitis pigmentosa, and then gradual blindness. Genes associated with this type include MYO7A, CDH23, USH1C, PCHD15, etc.; 2. Type II Usher syndrome, patients suffer from congenital moderate to severe sensorineural hearing loss, normal vestibular response, prepubertal retinitis pigmentosa, and gradual blindness. Genes associated with this type include SH2A, GPR98, WHRN, etc.; 3. Type III Usher syndrome, patients suffer from progressive sensorineural hearing loss, normal vestibular response, and late pubertal retinitis pigmentosa, and then gradual blindness. Genes associated with this type include CLRN1, etc. Among them, Usher syndrome type II accounts for more than 50% of Usher syndrome cases, and USH2A gene mutations are the most common cause of Usher syndrome type II, accounting for more than 50% of Usher syndrome patients. At the same time, mutations in the USH2A gene are also one of the important causes of nonsyndromic retinitis pigmentosa (NSRP).

[0003] USH2A is located at 1q41 and spans over 800 kb in the genome, encoding the large transmembrane protein Usherin, which is anchored to the plasma membrane of retinal photoreceptor cells and inner ear hair cells and is an essential component in the development and maintenance of cilia. In the retina, Usherin is an important part of the USH2 complex and is thought to play a role in stabilizing the outer segments of photoreceptors. There are two subtypes of USH2A, and the main subtype in retinal cells contains 72 exons and the coding region is approximately 15.6 kb in length. The extracellular portion of the Usherin protein contains many repeat domains, including 10 Laminin EGF-like (LE) domains and 35 Fibronectin type 3 (FN3) domains. Human USH2A exon 13 is 642 bp in length and encodes amino acids 723–936, which are 4 of the 10 LE domains of the Usherin protein.

[0004] Mutations in exon 13, exon 50, and intron 40 of the USH2A gene can cause Usher syndrome. To date, more than 1,000 pathogenic variants distributed throughout the USH2A gene have been identified, of which exon 13 is the most frequently mutated exon in the USH2A gene, accounting for approximately 35%. Mutations in exon 13 of the USH2A gene include c.2802T>G (p.Cys934Trp, the most frequent mutation in Chinese patients), c.2299delG (p.Glu767Serfs*21, the most frequent mutation in European and American patients), c.2276G>T (p.cys759phe, the most frequent mutation site causing nonsyndromic RP), c.2522C>A (p.S841Y), c.2242C>T (p.Gln748X), c.2541C>A (p.C8 47X), c.2761delC(Leu921fs) and c.2776C>T(p.R926C), c.2209C>T, c.2310delA, c.2391_2392deITG, c.2431A>T, c.2431_2432delAA , c.2440C>T, c.2525dup, c.2610C>A, c.2755C>T, c.2176T>C, c.2236C>G, c.2296T>C, c.2332G>T, c.2339G>T (PMID:31904091).

[0005] For exon 13 of the USH2A gene, there are generally three common methods in existing technologies. The first is to edit genomic DNA through the CRISPR / Cas system to directly delete exon 13 or destroy RNA splicing-related sites. However, the use of segment deletion is accompanied by risks such as chromosomal rearrangement, viral integration, and reverse reintegration, as well as a high probability of off-target when the CAS system is expressed for a long time or when the double cleavage induced by two gRNAs is performed based on a relatively large genome background. The second is to use a single base editor to change the key base of the above splicing-related site, which may also promote exon skipping. However, existing single base editors cannot be loaded via a single AAV vector, are limited by PAM, editing window, and base conversion type, and there may be no suitable gRNA near the splicing-related site. The third is to use antisense oligonucleotides (AONs, Antisense oligonucleotides) to target pre-mRNA splicing and promote exon skipping with higher efficiency. However, AON can promote the skipping of exon 13 while simultaneously promoting the simultaneous skipping of exon 12 and exon 13. In some AON treatments, double skipping may occur and single skipping may not occur. The total length of exon 12 is 196bp, which is not an integer multiple of 3. The deletion causes a frameshift mutation, and the USH2A protein after the double jump of splicing is inactivated. The AON effect does not last long, and the drug dosage is high; the efficiency of inducing splicing skipping is not high. Summary of the Invention

[0006] To solve the above problems, the present invention provides a snRNA targeting USH2A pre-mRNA, which can promote exon 13 skipping more efficiently than AONs.

[0007] To achieve the above-mentioned objectives, the present invention provides a snRNA that targets USH2A pre-mRNA, whose recognition domain is reverse complementary to the USH2A pre-mRNA sequence and that induces splicing skipping of exon 13 by binding to USH2A pre-mRNA.

[0008] After investigating and studying USH2A, the inventors found that since the length of the USH2A coding region is about 15.6 kb, it is difficult to directly deliver USH2A for treatment, because it is difficult for traditional gene therapy delivery methods (such as recombinant lentivirus, recombinant adeno-associated virus, etc.) to package such a large sequence. Exon 12 of mouse USH2A is homologous to exon 13 of human USH2A, both of which are 642 bp in length, and the removal of this exon did not cause subsequent frameshift mutations. At the same time, the inventors found that even after knocking out exon 12 of mouse USH2A, Usherin can still be correctly positioned and perform normal functions. Therefore, for human USH2A exon 13 containing pathogenic mutations, a series of measures can be used to induce jumps to perform treatment.

[0009] At the same time, small nuclear RNAs (snRNAs) exist in cells, which are the main components of the RNA spliceosome during post-transcriptional processing in eukaryotes and participate in the processing of pre-mRNAs by binding to snRNP proteins. Their length ranges from about 100 to 215 nucleotides in mammals and they are classified into seven categories, numbered U1 to U7 because they contain abundant U. However, U7-snRNP is not involved in splicing, but is a key factor in the unique 3'-end processing of replication-dependent histone (RDH) pre-mRNAs.

[0010] Thus, we can induce exon splicing skipping by replacing the non-canonical Sm-binding site in U7-snRNA with a consensus sequence derived from the major spliceosomal U-snRNP and changing the histone-binding sequence in the 5' region of U7-snRNA to the complementary sequence of the gene to be modified to target the exon.

[0011] Through target screening, the inventors have discovered 7 target regions and 21 target sites of U7-snRNP that induce splicing skipping, which can induce the splicing skipping effect of exon 13. At the same time, the recognition domain of U7-smOPT-snRNA and the splicing skipping-related site of USH2A pre-mRNA exon 13 are designed to be reverse complementary, thereby inducing U7-smOPT-snRNA to bind to the splicing skipping-related site of USH2A pre-mRNA exon 13, and further inducing splicing skipping of USH2A pre-mRNA exon 13 while retaining exon 12, thereby greatly reducing the possibility of unexpected splicing skipping, such as double jump of exons 12 and 13, greatly improving efficiency while ensuring safety.

[0012] In one embodiment thereof, the USH2A pre-mRNA sequence is selected from the USH2A exon 13, intron 12 or intron 13 region.

[0013] In one embodiment thereof, the USH2A pre-mRNA sequence is selected from USH2A exon 13 and the region extending 50 bp on either side thereof.

[0014] In one embodiment thereof, the USH2A pre-mRNA sequence is selected from USH2A exon 13 and the region extending 20 bp on either side.

[0015] In one embodiment thereof, the exon 13 comprises a wild-type exon 13 or a mutation-containing exon 13.

[0016] In one embodiment thereof, the mutation comprises at least one of the following mutation sites: c.2242C>T, c.2276G>T, c.2299delG, c.2522C>A, c.2541C>A, c.2761delC, c.2776C>T, c.2802T>G, c.2209C>T, c.2310delA, c.2391_2392deITG, c.2431A>T, c.2431_2432delAA, c.2440C>T, c.2525dup, c.2610C>A, c.2755C>T, c.2176T>C, c.2236C>G, c.2296T>C, and c.2332G>T.

[0017] In one embodiment thereof, the genomic location (corresponding to NCBI database GRch38 version) region corresponding to the USH2A pre-mRNA sequence is selected from Chr1:216247142-216247185, Chr1:216247130-216247161, Chr1:216246616-216246649, Chr1:216247213-216247246, Chr1:216247204-216247232, Chr1:216247187-216247220, and Chr1:216247169-216247202.

[0018] In one embodiment thereof, the USH2A pre-mRNA sequence is selected from the sequences shown in SEQ ID NOs: 1-7.

[0019] In one embodiment thereof, the genomic location corresponding to the USH2A pre-mRNA sequence is Chr1:216247223-216247246, Chr1:216247218-216247241, Chr1:216247213-216247236, Chr1:216247209-216247232, Chr1:216247204-21 6247227, Chr1:216247197-216247220, Chr1:216247191-216247214, Chr1:216247 187-216247210, Chr1:216247179-216247202, Chr1:216247174-216247197, Chr1:2 16247169-216247192, Chr1:216247162-216247185, Chr1:216247155-216247178, Chr1:216247147-216247168, Chr1:216247147-216247173, Chr1:216247142-21624 7165, Chr1:216247138-216247161, Chr1:216247130-216247153, Chr1:216246626-216246649, Chr1:216246622-216246645, and Chr1:216246616-216246639.

[0020] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of at least 16 bp of the USH2A pre-mRNA sequence.

[0021] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of at least 17 bp of the USH2A pre-mRNA sequence.

[0022] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of at least 18 bp of the USH2A pre-mRNA sequence.

[0023] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of at least 19 bp of the USH2A pre-mRNA sequence.

[0024] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of at least 20 bp of the USH2A pre-mRNA sequence.

[0025] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of at least 21 bp of the USH2A pre-mRNA sequence.

[0026] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of at least 22 bp of the USH2A pre-mRNA sequence.

[0027] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of at least 23 bp of the USH2A pre-mRNA sequence.

[0028] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of at least 24 bp of the USH2A pre-mRNA sequence.

[0029] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of 18 bp to 40 bp of the USH2A pre-mRNA sequence.

[0030] In one embodiment thereof, the snRNA recognition domain is reverse complementary to a contiguous sequence of 20 bp to 27 bp of the USH2A pre-mRNA sequence.

[0031] In one embodiment thereof, the snRNA recognition domain is selected from the sequences shown in SEQ ID NOs: 8 to 28.

[0032] In one embodiment thereof, the genomic location corresponding to the USH2A pre-mRNA sequence is selected from Chr1:216247213-216247236, Chr1:216247209-216247232, Chr1:216247204-216247227, Chr1:216247197-216247220, Chr1:216247191-216247214, Chr1:216247187-216247210, Chr1:216247179-216247202, Chr1:216247174-216247197, and Chr1:216247169-216247192.

[0033] In one embodiment thereof, the snRNA recognition domain is selected from the sequences shown in SEQ ID NOs: 10 to 28.

[0034] In one embodiment thereof, the genomic location corresponding to the USH2A pre-mRNA sequence is Chr1:216247162-216247185, Chr1:216247155-216247178, Chr1:216247147-216247168, Chr1:216247147-216247173, Chr1:216247142-216 247165, Chr1:216247138-216247161, Chr1:216247130-216247153, Chr1:216246626-216246649, Chr1:216246622-216246645, and Chr1:216246616-216246639.

[0035] In one embodiment thereof, the snRNA recognition domain is selected from the sequences shown in SEQ ID NOs: 19 to 28.

[0036] In one embodiment thereof, the genomic location corresponding to the USH2A pre-mRNA sequence is Chr1:216247213-216247236, Chr1:216247209-216247232, Chr1:216247204-216247227, Chr1:216247197-216247220, Chr1:216247191-216247214, Chr1:216247187-216247210, Chr1:216247179-216247202, Chr1:2 16247174-216247197, Chr1:216247169-216247192, Chr1:216247162-216247185, Chr1:216247155-216247178, Chr1:216247147-216247168, Chr1:216247147-216247173, Chr1:216247142-216247165, and Chr1:216247130-216247153.

[0037] In one embodiment thereof, the snRNA recognition domain is selected from the sequences shown in SEQ ID NOs: 10 to 23 and SEQ ID NO: 25.

[0038] In one embodiment thereof, the genomic location corresponding to the USH2A pre-mRNA sequence is Chr1:216247213-216247236, Chr1:216247209-216247232, Chr1:216247204-216247227, Chr1:216247197-216247220, Chr1:216247191-216247214, Chr1:216247187-216247210, Chr1:216247179 ... 216247173, Chr1:216247142-216247165, and Chr1:216247130-216247153.

[0039] In one embodiment thereof, the snRNA recognition domain is selected from the sequences shown in SEQ ID NOs: 10 to 19, 21 to 23, and 25.

[0040] In one embodiment thereof, the genomic location corresponding to the USH2A pre-mRNA sequence is selected from Chr1:216247218-216247241, Chr1:216247187-216247210, Chr1:216247147-216247168, Chr1:216247147-216247173, Chr1:216247142-216247165, and Chr1:216247130-216247153.

[0041] In one embodiment thereof, the snRNA recognition domain is selected from the sequence shown in SEQ ID NO: 9, the sequence shown in SEQ ID NO: 15, the sequence shown in SEQ ID NO: 21, the sequence shown in SEQ ID NO: 22, the sequence shown in SEQ ID NO: 23, and the sequence shown in SEQ ID NO: 25.

[0042] In one embodiment thereof, the snRNA recognition domain is selected from the sequence shown in SEQ ID NO: 15, the sequence shown in SEQ ID NO: 21, the sequence shown in SEQ ID NO: 22, and the sequence shown in SEQ ID NO: 23.

[0043] In one embodiment thereof, the snRNA is U1-snRNA or U7-snRNA.

[0044] In one embodiment thereof, the U7-snRNA is chemically synthesized.

[0045] In one embodiment thereof, at least one nucleotide of the chemically synthesized U7-snRNA is chemically modified.

[0046] In one embodiment thereof, the chemical modification comprises at least one of a 2'-O-alkyl modification, a 2'-O-methoxy modification, or a 2'-O-methoxyethyl modification.

[0047] In one embodiment thereof, the 2'-O-alkyl modification is a 2'-O-methyl modification.

[0048] In one embodiment thereof, at least one nucleotide of the chemically synthesized U7-snRNA is linked via a phosphate bond, the phosphate bond comprising at least one of a phosphorothioate bond, a phosphorodithioate bond, an alkyl phosphate bond, an amidophosphate bond, a boranophosphate bond, or a chiral phosphorus bond.

[0049] In one embodiment thereof, 6 to 80 nucleotides on both sides of the chemically synthesized U7-snRNA are all chemically modified and linked by the phosphate ester bond.

[0050] In one embodiment thereof, 1 to 10 nucleotides on both sides of the chemically synthesized U7-snRNA are all chemically modified and linked by the phosphate ester bond.

[0051] In one embodiment thereof, 3 to 40 bases on both sides of the chemically synthesized U7-snRNA are all chemically modified and linked by the phosphate ester bond.

[0052] In one embodiment thereof, all nucleotides of the chemically synthesized U7-snRNA are linked via phosphorothioate bonds and are all 2'-O-methoxy modified.

[0053] In one embodiment thereof, the three nucleotides on either side of the chemically synthesized U7-snRNA are linked via phosphorothioate bonds and modified with 2'-O-methoxy.

[0054] In one embodiment thereof, the first nucleotide at the 5' end of the chemically synthesized U7-snRNA is adenylic acid.

[0055] In one embodiment thereof, the first nucleotide at the 5' end of the chemically synthesized U7-snRNA recognition domain is adenylic acid.

[0056] In one embodiment thereof, there are 0 to 5 mismatched nucleotides in the reverse complementary pair between the recognition domain of the chemically synthesized U7-snRNA and the target site.

[0057] In one embodiment thereof, there are 0 to 1 mismatched nucleotides in the reverse complementary pair between the recognition domain of the chemically synthesized U7-snRNA and the target site.

[0058] In one embodiment thereof, the sequence length of the chemically synthesized U7-snRNA recognition domain is ≧16 bp.

[0059] In one embodiment thereof, the sequence length of the chemically synthesized U7-snRNA recognition domain is 18 bp to 40 bp.

[0060] In one embodiment thereof, the sequence length of the chemically synthesized U7-snRNA recognition domain is 20 bp to 27 bp.

[0061] In one embodiment thereof, the chemically synthesized U7-snRNA continues to extend the length of the recognition domain sequence through reverse complementation along the 5' and / or 3' ends of the target sequence.

[0062] In one embodiment thereof, the length of the extended recognition domain sequence is ≦40 bp.

[0063] In one embodiment thereof, the snRNA comprises an sm sequence.

[0064] In one embodiment thereof, the sm sequence is a smOPT sequence, and the smOPT sequence is as set forth in SEQ ID NO:31.

[0065] In one embodiment thereof, the snRNA comprises a recognition domain, a smOPT sequence, and a U1-snRNA scaffold or a U7-snRNA scaffold sequence; preferably, the U7-snRNA scaffold sequence is as set forth in SEQ ID NO:49.

[0066] In one embodiment thereof, the snRNA further comprises a motif that recruits a splicing control protein.

[0067] In one embodiment thereof, a free tail is introduced at the 5' end of the U7-snRNA, and the sequence of the free tail includes a motif that recruits a splicing control protein.

[0068] In one embodiment thereof, the splicing regulatory protein comprises at least one of hnRNPA1, SRSF1, RBM4, DAZAP1, or SR.

[0069] In one embodiment thereof, the free tail sequence comprises at least one hnRNPA1 binding motif.

[0070] In one embodiment thereof, the free tail sequence comprises two hnRNPA1 binding motifs.

[0071] The present invention also includes nucleotide sequences encoding said snRNAs. nucleic acid to provide.

[0072] The present invention also relates to a method for the preparation of a nucleic acid sequence comprising the snRNA and / or the nucleic acid A gene expression cassette comprising:

[0073] The present invention also includes the snRNA, nucleic acid and / or a vector comprising a gene expression cassette.

[0074] In one embodiment thereof, the vector comprises a vector backbone and the snRNA, the vector backbone comprises a promoter, a smOPT sequence, and an snRNA gene-specific 3' cassette, and the promoter is connected to the smOPT sequence via a Type IIs restriction endonuclease recognition site.

[0075] In one embodiment thereof, the vector is selected from pUC57, pAAV-CMV, a lentivirus, or a transposon.

[0076] In one embodiment thereof, the snRNA gene-specific 3' cassette is a gene fragment extending from the 3' end of the snRNA gene by 28 to 131 bp.

[0077] In one embodiment thereof, the snRNA gene-specific 3' cassette is a gene fragment extending 106 bp from the 3' end of the snRNA gene.

[0078] The present invention also includes the snRNA, nucleic acid and / or a viral particle comprising said vector.

[0079] In one embodiment thereof, the viral particle is an AAV virus.

[0080] In one embodiment thereof, the capsid protein of the AAV virus is naturally occurring, a variant based on a naturally occurring capsid protein.

[0081] In one embodiment thereof, the AAV viral capsid protein is derived from an animal or a plant.

[0082] In one embodiment thereof, the AAV viral capsid protein is selected from AAV1, AAV2, AAV3, AAV5, AAV6, AAV7, AAV8, AAV9, AAVrh8, AAVrh10, or AAVrh43.

[0083] In one embodiment thereof, the mutant AAV virus based on a naturally occurring capsid protein is an AAV virus based on directed evolution or rational modification of the amino acid / peptide sequencme of the naturally occurring capsid protein.

[0084] In one embodiment thereof, the mutant AAV virus is selected from AAV2.5, AAV2i8, AAV-TT, AAV9.HR, or CAM130.

[0085] In one embodiment thereof, when the AAV virus is an AAV ITR, the serotype corresponds to the serotype of the Rep gene.

[0086] The present invention also includes the snRNA, nucleic acid and providing a cell comprising said vector and / or comprising said viral particle.

[0087] The present invention also includes the snRNA, nucleic acid and / or a pharmaceutical composition comprising said vector and / or comprising said viral particle.

[0088] The present invention also relates to a method for producing a USH2A gene comprising the steps of: nucleic acid the vector, the gene expression cassette, the viral particle, the cell, and / or the pharmaceutical composition, and a method for obtaining a Usherin protein lacking an expression product of exon 13 is provided.

[0089] In one embodiment thereof, the method is used in scientific research.

[0090] The present invention also provides the use of the method in preparing a mature USH2A mRNA lacking exon 13 by splicing skipping of exon 13 in USH2A pre-mRNA, obtaining an Usherin protein lacking exon 13, and / or inhibiting the expression and function of USH2A pre-mRNA exon 13.

[0091] The present invention also relates to a method for the preparation of a medicament for preventing and / or treating an eye disease and / or an ear disease, comprising administering to said subject an effective amount of said snRNA, nucleic acid The present invention also provides uses of said vector, said gene expression cassette, said viral particle or said cell.

[0092] In one embodiment, the eye disease is deafness-retinitis pigmentosa syndrome or non-syndromic retinitis pigmentosa.

[0093] Compared with the prior art, the present invention has the following beneficial effects:

[0094] The snRNA targeting USH2A pre-mRNA of the present invention selects USH2A exon 13 as the target region and induces splicing skipping of exon 13, thereby treating eye and ear diseases caused by USH2A protein dysfunction, such as missense, frameshift, stop codon, nonsense, and synonymous mutations in USH2A exon 13. At the same time, the U7-snRNA targeting USH2A of the present invention is not involved in splicing using U7-snRNP, but is an important factor in the specific 3'-end processing of replication-dependent histone (RDH) pre-mRNA. The modified U7-snRNA replaces the non-canonical Sm-binding site of U7-snRNA with a consensus sequence derived from the main spliceosomal U-snRNP, and changes the histone-binding sequence in the 5' region of U7-snRNA to the complementary sequence of the gene to be modified, through a unique mechanism of action. In combination with snRNA targeting USH2A pre-mRNA, it induces splicing skipping of USH2A pre-mRNA exon 13 and retains exon 12, greatly reducing the probability of unexpected splicing skipping, such as double skipping of exons 12 and 13, and greatly improving the efficiency of single skipping of exon 13 while ensuring safety. [Brief description of the drawings]

[0095] [Figure 1] Schematic diagram of the structure and function of U7-snRNA. [Diagram 2] 1 is a map of the pUC57-U7 snRNA backbone vector. [Diagram 3] 1 is a plasmid map of the reporter vector pCMV-EGFPleft-Exon13c.2802T>G-EGFPright. [Figure 4] 1 is a plasmid map of the reporter vector pCMV-EGFPleft-Exon13c.2299delG-EGFPright. [Diagram 5] FIG. 1 is a schematic diagram of the location of U7-snRNA targeting target region 1 on the genome. [Figure 6]13 is a graph showing the results of the cell ratio in which splicing skipping of USH2A pre-mRNA exon 13 was induced by U7-snRNA targeting target region 1 in reporter vector cells. [Figure 7] FIG. 13 is a histogram of the mean FITC intensity of GFP-positive cells induced by U7-snRNA targeting target region 1 (splicing skipping of USH2A pre-mRNA exon 13). [Figure 8] FIG. 1 is a schematic diagram of the location of U7-snRNA targeting target region 2 on the genome. [Figure 9] 13 is a graph showing the results of the cell ratio in which splicing skipping of USH2A pre-mRNA exon 13 was induced by U7-snRNA targeting target region 2 in reporter vector cells. [Figure 10] A histogram of the average FITC intensity of GFP-positive cells induced by U7-snRNA targeting target region 2 (splicing skipping of USH2A pre-mRNA exon 13). [Figure 11] FIG. 1 is a schematic diagram of the location of U7-snRNA targeting target region 3 on the genome. [Figure 12] 13 is a graph showing the results of the cell ratio in which splicing skipping of USH2A pre-mRNA exon 13 was induced by U7-snRNA targeting target region 3 in reporter vector cells. [Figure 13] A histogram of the average FITC intensity of GFP-positive cells induced by U7-snRNA targeting target region 3 (splicing skipping of USH2A pre-mRNA exon 13). [Figure 14] FIG. 1 is a schematic diagram of the location of U7-snRNA targeting target region 4 on the genome. [Figure 15] 13 is a graph showing the results of the cell ratio in which splicing skipping of USH2A pre-mRNA exon 13 was induced by U7-snRNA targeting target region 4 in reporter vector cells. [Figure 16] FIG. 1 is a schematic diagram of the location of U7-snRNA targeting target region 5 on the genome. [Figure 17] 13 is a graph showing the results of the cell ratio in which splicing skipping of USH2A pre-mRNA exon 13 was induced by U7-snRNA targeting target region 5 in reporter vector cells. [Figure 18] FIG. 1 is a schematic diagram of the location of U7-snRNA targeting target region 6 on the genome. [Figure 19] 13 is a graph showing the results of the cell ratio in which splicing skipping of USH2A pre-mRNA exon 13 was induced by U7-snRNA targeting target region 6 in reporter vector cells. [Figure 20] FIG. 1 is a schematic diagram of the location of U7-snRNA targeting target region 7 on the genome. [Figure 21] 13 is a graph showing the results of the cell ratio in which splicing skipping of USH2A pre-mRNA exon 13 was induced by U7-snRNA targeting target region 7 in reporter vector cells. [Figure 22] 13 is a graph showing the results of the average FITC intensity of cells in which USH2A pre-mRNA exon 13 splicing skipping was induced by U7 snRNA targeting different regions in reporter gene cells. [Figure 23] 1 is a graph showing experimental results showing that the efficiency of USH2A pre-mRNA exon 13 splicing skipping induced by U7-snRNA was significantly superior to that of AON1. [Figure 24] 1 is a graph showing the results of detecting the splicing skipping efficiency of USH2A pre-mRNA exon 13 induced by chemically synthesized U7 snRNA in WERI cells. [Diagram 25] FIG. 1 is a schematic diagram of the structure of U7-hnRNP A1-snRNA. [Figure 26]1 is a graph showing the results of splicing skipping efficiency of USH2A pre-mRNA exon 13 induced by U7-hnRNP A1-snRNA. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0096] In order to facilitate understanding of the present invention, the present invention will now be described in more detail with reference to the accompanying drawings. Preferred embodiments of the present invention are shown in the drawings. However, the present invention may be embodied in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a complete understanding of the present disclosure.

[0097] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present invention belongs. The terms used in the present specification in describing the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. As used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items. When a sequence is said to be "selected" from another sequence, it can be directly another sequence or a sequence fragment of another sequence; when a genomic mapping region is "selected" from another genomic mapping region, the corresponding sequence can be a sequence directly corresponding to another genomic mapping region, or a sequence fragment in a sequence corresponding to another genomic mapping region; said sequence includes DNA or RNA.

[0098] Definition: The snRNAs according to the invention are major components of the RNA spliceosome in post-transcriptional processing in eukaryotes and are involved in the processing of pre-mRNA by binding to snRNP proteins.

[0099] Material Suppliers: AAVpro(R) Helper Free System(AAV5) Kit (TAKARA, Code No.:6650)

[0100] The reagents, materials, and equipment used in the examples are all commercially available unless otherwise defined; the experimental methods are conventional in the art unless otherwise defined.

[0101] Example 1 U7-snRNA system design and vector construction.

[0102] 1. Synthesis of U7-snRNA expression vector backbone. Wild-type U7-snRNA contains a stem-loop structure (scaffold), a U7-specific Sm sequence (AAUUUGUCUAG :SEQ ID NO:61 ), and a recognition domain (complementary to the histone pre-mRNA).

[0103] In the present embodiment, the U7-snRNA is prepared by replacing the U7-specific sm sequence AATTTGTCTAG (SEQ ID NO: 30) with an optimized consensus sm sequence on the NCBI mouse wild-type U7-snRNA gene sequence (NCBI reference sequence: NR_024201.3), i.e., smOPT:AATTTTTGGAG (SEQ ID NO: 31), and as shown in FIG. 1, the original recognition domain at the 5' end of the smOPT sequence was replaced with a recognition domain that is reverse complementary to the USH2A pre-mRNA specific target site, and the original stem-loop structure sequence of U7 was maintained at the 3' end of the smOPT sequence. The U7-snRNA recognition domain sequence that targets and induces USH2A pre-mRNA exon 13 is reverse-complementarily paired with a target sequence selected from intron 12-exon 13-intron 13 of USH2A pre-mRNA.

[0104] Specific operation process: First, a pUC57 vector containing a gene sequence, i.e., U7-snRNA gene expression cassette backbone (5'-mouse U7 promoter-smOPT sequence-U7 snRNA scaffold-snRNA gene specific 3' cassette-3') was synthesized by total gene synthesis (as shown in FIG. 2). Here, two Type IIs restriction endonuclease recognition sites were added between the U7 promoter and smOPT to facilitate subsequent cleavage, replacement and insertion of other recognition domain sequences. The snRNA gene specific 3' cassette contains the gtctacaatgaaa (SEQ ID NO: 32) sequence after the 3' end of the U7-snRNA gene in the mouse genome (GenBank: X54748.1), and is involved in the processing of pre-snRNA, preferably a sequence connected to the 3' end of the U7 snRNA gene, preferably a gene fragment with a sequence length of 28 to 131 bp, more preferably a sequence length of 106 bp.

[0105] 2. We constructed U7-snRNA vectors targeting different sites in and near USH2A exon 13.

[0106] In this example, 21 target sites were set for each of the seven target regions of USH2A pre-mRNA, and the seven target regions of USH2A pre-mRNA are as shown below.

[0107] Exon 13 region 1 (SEQ ID NO:1) (Chr1:216247142-216247185): CGAAGCUUUAAUGAUGUUGGAUGUGAGCCCUGCCAGUGUAACCU; Exon 13 region 2 (SEQ ID NO:2) (Chr1:216247130-216247161):GAGCCCUGCCAGUGUAACCUCCAUGGCUCAGU; Exon 13 region 3 (SEQ ID NO:3) (Chr1:216246616-216246649):AAUCAGUGGCCAGUGCCUGUGUGUGCCUAAUCGU; Exon 13 region 4 (SEQ ID NO:4) (Chr1:216247213-216247246): UAAAUAUUUUAUCUUUAGGGCUUAGGUGUGAU; Exon 13 region 5 (SEQ ID NO:5) (Chr1:216247204-216247232): CUUUAGGGCUUAGGUGUGAUCAUUGCAAU; Exon 13 region 6 (SEQ ID NO:6) (Chr1:216247187-216247220): GGUGUGAUCAUUGCAAUUUUGGAUUUAAAUUUCU; Exon 13 region 7 (SEQ ID NO:7) (Chr1:216247169-216247202): UUGGAUUUAAAUUUCUCCGAAGCUUUAAUGAUGU.

[0108] The 21 target locations are as shown in the table below.

[0109] [Table 1]

[0110] Example 2 Chemical synthesis and modification of U7-snRNA. Similar to oligonucleotides, U7-snRNA can be directly chemically synthesized to generate RNA containing the recognition domain, smOPT, and U7-snRNA scaffold. In vitro synthesized U7-snRNA can be specifically modified to resist nuclease degradation or to increase affinity for the target sequence.

[0111] In this example, U7-snRNA was chemically synthesized and the three bases at its 5'-end and 3'-end were modified with 2'-methoxy (2'-OME) and sulfo, respectively, to enhance nuclease resistance. Taking snRNA#16 and snRNA#15 as examples, the sequences and modifications of the chemically synthesized snRNAs are as follows (* represents a phosphorothioate backbone, m represents a 2'-methoxy modification, the underlined portion represents the recognition domain that is reverse-complementary to the target sequence, and italics represent the smOPT sequence).

[0112] Chemically synthesized and modified U7-snRNA#16: [ka] (SEQ ID NO:64)

[0113] The above modified sequence is the sequence shown in SEQ ID NO:33 to which phosphorothioate backbone modification and methoxy modification have been added to the first three bases at the 5'-end and 3'-end.

[0114] Chemically synthesized and modified U7-snRNA#15: [ka] (SEQ ID NO:65)

[0115] The above modified sequence is the sequence shown in SEQ ID NO:34 to which phosphorothioate backbone modification and methoxy modification have been added to the first three bases at the 5'-end and 3'-end.

[0116] Example 3 We constructed a reporter vector to quantitatively evaluate the splicing skipping efficiency of USH2A exon 13.

[0117] R.G. left -USH2A EXON13 mut -RG rightThe sequence (AgeI and EcoRI enzyme cleavage sites were added at the 5' and 3' ends, respectively) was obtained by total gene synthesis, and the synthetic sequence was inserted between the AgeI and EcoRI restriction sites of the pX601 vector by performing restriction endonuclease AgeI and EcoRI digestion, electrophoresis, gel recovery and ligation on the pX601 plasmid (Addgene, 61591), replacing the SaCas9 gene sequence of the original vector to obtain a reporter vector. Further, through transformation of E. coli competent cells, single cloning, PCR, and sequence verification, a purified reporter vector plasmid was obtained and stored at -20 ° C for later use.

[0118] The reporter vector structure is: pCMV-RG left -USH2A EXON13 mut -RG right where RG stands for reporter gene, and RG left represents the first half of the 5' end of the reporter gene without reporting function, and RG right RG represents the latter half of the 3' end of the reporter gene without reporting function. left and R.G. right The tandem expression of the reporter gene ensures that the reporter gene functions normally. In the embodiment, the reporter gene is the green fluorescent gene EGFP, and the vector structure is pCMV-EGFP. left -Exon13 mut -EGFP right It was. EXON13 mutrepresents exon 13 of USH2A containing a pathogenic mutation and its upstream and downstream intron sequences (the upstream intron sequence is a gene sequence consisting of a tandem linkage between the 5'-terminal 204 bp and the 3'-terminal 490 bp of intron 12 of the human USH2A gene; the downstream intron sequence is a gene sequence consisting of a tandem linkage between the 5'-terminal 703 bp and the 3'-terminal 216 bp of intron 13 of human USH2A). The pathogenic mutation in USH2A exon 13 may include c.2802T>G, c.2299delG, c.2276G>T, c.2522C>A, c.2242C>T, c.2541C>A, c.2761delC or c.2776C>T, and the pathogenic mutation in USH2A exon 13 described in the embodiments of the present invention is c.2802T>G, c.2299delG, i.e., the resulting vector structure is pCMV-EGFP, respectively. left -Exon13 c.2802T>G -EGFP right (Report vector map is shown in Figure 3 ), pCMV-EGFP left -Exon13 c.2299delG -EGFP right (Report vector map is shown in Figure 4) and EGFP left The sequence is as shown in SEQ ID NO:35, and EGFP right The sequence is as shown in SEQ ID NO:36.

[0119] Example 4 Detection of splicing skipping effect of USH2A exon 13 mediated by U7-snRNA targeting target region 1.

[0120] Detection method: 293T cells were seeded in a 24-well plate at a given amount so that the cell confluence reached about 80% after 24 hours. Lipofectamine2000 was used to detect pCMV-EGFP. left -Exon13 c.2802T>G -EGFP rightand pUC57-U7-snRNA plasmids targeting USH2A pre-mRNA were co-transfected into 293T cells (vector mass ratio was 100ng:400ng), and 293T cells transfected with reporter plasmid alone and co-transfected with reporter plasmid and pUC57-U7-con were used as two negative controls, respectively, and 293T cells without any plasmid transfected were used as blank controls. After transfection, the cells were subsequently cultured for 4–72 h and digested into single cells using trypsin, and then flow cytometry was used to detect the GFP-positive rates of different U7-snRNA groups (i.e., the cell ratio in which splice jumping of USH2A pre-mRNA exon 13 was induced) and the average FITC intensity of GFP-positive cells (i.e., the average level of splicing skipping of USH2A pre-mRNA exon 13 in GFP cells), and the genomic location of U7-snRNA targeting target region 1 (corresponding to the 5' end to the 3' end of the genome from left to right in the figure) was as shown in Figure 5 .

[0121] Experimental results: As shown in Figure 6 and the table below, all U7-snRNAs targeting target region 1 can induce splicing skipping of USH2A exon 13 in reporter gene cells. Existing AONs targeting region 1 cannot induce splicing skipping of exon 13, but snRNAs targeting region 1 can effectively induce splicing skipping of exon 13.

[0122] [Table 2]

[0123] Example 5 Detection of the splicing skipping effect of USH2A exon 13 mediated by U7-snRNA targeting target region 2.

[0124] Detection method: Same as in Example 4. The position of U7-snRNA targeting target region 2 on the genome (from left to right in the figure, corresponding to the 5' end to the 3' end of the genome) is as shown in Figure 8.

[0125] Experimental results: As shown in Figure 9 and the table below, all U7-snRNAs targeting target region 2 can induce splicing skipping of USH2A exon 13 in reporter gene cells. Existing AONs targeting region 2 are less effective at inducing splicing skipping of exon 13, but snRNAs targeting region 2 can effectively induce splicing skipping of exon 13.

[0126] [Table 3]

[0127] Example 6 Detection of splicing skipping effect of USH2A exon 13 mediated by U7-snRNA targeting target region 3.

[0128] Detection method: Same as in Example 4. The position of U7-snRNA targeting target region 3 on the genome (from left to right in the figure, corresponding to the 5' end to the 3' end of the genome) is as shown in Figure 11.

[0129] Experimental results: As shown in Figure 12 and the table below, all U7-snRNAs targeting target region 3 can induce splicing skipping of USH2A exon 13 in reporter gene cells. Existing AONs targeting region 3 are less effective at inducing splicing skipping of exon 13, but snRNAs targeting region 3 can effectively induce splicing skipping of exon 13.

[0130] [Table 4]

[0131] Combining the analyses of Examples 4, 5, and 6, we found that target regions 1, 2, and 3 in the prior art target the insensitive region of AON, i.e., targeting the region cannot or barely induces splicing skipping of exon 13, while snRNA targeting the region can significantly induce splicing skipping of exon 13. Thus, although snRNA and AON can both induce splicing skipping, their mechanisms of action are different, and the target site sensitivity (applicable target sites within the target region) is also different.

[0132] At the same time, as shown in Figures 7, 10, 13 and the table below, the percentage of cells (GFP%) in which splicing skipping was induced targeting the same region is close, but there are differences in the mRNA and protein levels (average FITC intensity) obtained by splicing skipping in the same cells with snRNAs targeting different targets in the same region. Furthermore, the mRNA and protein levels obtained by inducing splicing skipping in the same cells with target region 1 and target region 2 are superior to those of target region 3.

[0133] [Table 5]

[0134] Example 7 Detected the splicing skipping effect of USH2A exon 13 mediated by U7-snRNA and snRNA#24 targeting target region 4.

[0135] Detection method: Same as in Example 4. The position of U7-snRNA targeting region 4 on the genome (from left to right in the figure, corresponding to the 5' end to the 3' end of the genome) is as shown in FIG.

[0136] Experimental Results: As shown in FIG. 15 and the table below, all U7-snRNAs targeting target region 4 can induce splicing skipping of USH2A exon 13 in reporter gene cells.

[0137] [Table 6]

[0138] Example 8 Detection of splicing skipping effect of USH2A exon 13 mediated by U7-snRNA targeting target region 5.

[0139] Detection method: The same as in Example 4. The position of the U7-snRNA target region 5 on the genome (from left to right in the figure, corresponding to the 5' end to the 3' end of the genome) is as shown in FIG.

[0140] Experimental Results: As shown in FIG. 17 and the table below, all U7-snRNAs targeting target region 5 can induce splicing skipping of USH2A exon 13 in reporter gene cells.

[0141] [Table 7]

[0142] Example 9 Detection of splicing skipping effect of USH2A exon 13 mediated by U7-snRNA targeting target region 6.

[0143] Detection method: The same as in Example 4. The position of the U7-snRNA target region 6 on the genome (from left to right in the figure, corresponding to the 5' end to the 3' end of the genome) is as shown in FIG.

[0144] Experimental Results: As shown in FIG. 19 and the table below, all U7-snRNAs targeting target region 6 can induce splicing skipping of USH2A exon 13 in reporter gene cells.

[0145] [Table 8]

[0146] Example 10 Detection of splicing skipping effect of USH2A exon 13 mediated by U7-snRNA targeting target region 7.

[0147] Detection method: Same as in Example 4. The position of U7-snRNA targeting target region 7 on the genome (from left to right in the figure, corresponding to the 5' end to the 3' end of the genome) is as shown in Figure 20.

[0148] Experimental Results: As shown in FIG. 21 and the table below, all U7-snRNAs targeting target region 7 can induce splicing skipping of USH2A exon 13 in reporter gene cells.

[0149] [Table 9]

[0150] Example 11 Detection of splicing skipping effect of USH2A exon 13 mediated by U7-snRNA.

[0151] Verification method: Same as in Example 4.

[0152] Experimental Results: The average FITC intensity of GFP-positive cells induced by U7-snRNA in different regions is shown in FIG. 22 and the table below.

[0153] [Table 10]

[0154] Although the GFP% (proportion of cells in which splice skipping was induced) targeting the same region is similar, snRNAs targeting different targets within the same region have different protein levels (average FITC intensity) compared to the mRNAs resulting from splice skipping in the same cells.

[0155] Targeting region 2 not only resulted in a higher percentage of cells in which splice skipping was induced (GFP%), but also resulted in higher levels of mRNA and protein (mean FITC intensity) upon induction of splice skipping in the same cells.

[0156] However, in the conventional technology, the target site #2 and its adjacent sites #1 and #3, which have a high efficiency of inducing splicing skipping by AON, had low levels of mRNA and protein obtained by inducing splicing skipping in the same cells in the snRNA system. The AON efficiency of the existing technology targeting region 3 is higher than region 2, but the efficiency of targeting region 2 in the snRNA system was higher than region 3. Therefore, although both snRNA and AON can induce splicing skipping, the mechanism of action of both is different, and the sensitivity of the target site is also different. Combined with the analysis of the results of Example 12, since the efficiency of snRNA#24 is close to that of snRNA#2 and AON1, ​​it can be inferred that the effects of snRNA#3 to #11 are all superior to snRNA#2 and snRNA#24, and superior to AON1.

[0157] Example 12 Confirmation that the splicing skipping efficiency of USH2A exon 13 mediated by U7-snRNA is significantly superior to AON.

[0158] Detection method: 293T cells were seeded in a 24-well plate at a predetermined amount so that the cell confluence reached about 80% after 24 hours. pCMV-EGFP was transfected using Lipofectamine2000.left -Exon13 c.2802T>G -EGFP right and pUC57-U7-snRNA plasmids of different targets were co-transfected into 293T cells (vector mass ratio was 100ng:400ng). 293T cells transfected with reporter plasmid alone, co-transfected with reporter plasmid and pUC57-U7 Scramble were used as two negative controls, respectively, and transfected with reporter plasmid and 10 pmol of antisense oligonucleotide AON1 (5′-MA*MG*MC*MU*MU*MC*MG*MG*MA*MG*MA*MA*MA*MA*MU*MU*MU*MA*MA*MA*MU*MC*-3′, “M” indicates 2′-O-methoxy modification, and “*” indicates phosphorothioate. SEQ ID NO:62 ) were used as positive controls, and 293T cells not transfected with any plasmid were used as blank controls. The transfected cells were cultured for 48–72 h and digested into single cells using trypsin, after which a flow cytometer was used to detect the GFP-positive rates and average FITC intensity of various snRNAs.

[0159] Experimental Results: As shown in FIG. 23 and the table below, snRNA#8 and snRNA#18 screened by the present invention are both superior to AON1, ​​and snRNA#2 has an efficiency similar to AON1.

[0160] [Table 11]

[0161] Example 13 Induction of splicing skipping of USH2A exon 13 in WERI cells by chemically synthesized U7-snRNA.

[0162] Human host cells were cultured in a 24-well plate at 6 x 10 5The human retinal neuronal cells selected in this example were WERI-Rb-1 cells (a retinal neuronal cell line).

[0163] WERI cells were transfected with 100 pmol of in vitro synthesized U7-snRNA#1, snRNA#4, snRNA#8, snRNA#10, and snRNA#14, respectively, using Lipofectamine2000, and the same amount (100 pmol) of antisense oligonucleotide AON1 (5′-MA*MG*MC*MU*MU*MC*MG*MG*MA*MG*MA*MA*MA*MA*MU*MU*MU*MA*MA*MA*MU*MC*-3′, where “M” indicates 2′-O-methoxy modification and “*” indicates phosphorothioate). SEQ ID NO:62 ) and AON2 (5′-MU*MG*MA*MU*MC*MA*MC*MA*MC*MC*MU*MA*MA*MG*MC*MC*MC*MU*MA*MA*MA*-3′, where “M” indicates 2′-O-methoxy modification and “*” indicates phosphorothioate. SEQ ID NO:63 ) was transfected as a control group, 1 μg of EGFP plasmid was transfected as a negative control, and WERI cells without any plasmid were used as a blank control. The transfected cells were then cultured for 72 hours, after which the RNA of each experimental group cells was extracted and reverse transcribed to obtain cDNA, and RT-PCR experiments were performed using primers AGCCTTTCCGCCAAGGTGATC (SEQ ID NO: 37) and CACAACGTTGCCCAGCAATGG (SEQ ID NO: 38) to detect the presence of exon 13 in mature USH2A mRNA, and the electrophoretic results are shown in Figure 24.

[0164] Experimental results: In WERI cells endogenously expressing Usherin protein, the induction effect of chemically synthesized U7-snRNA on USH2A pre-mRNA exon 13 splicing skipping was compared with the AON technology scheme. RT-PCR test data and analysis results showed that the AON single-hop band was weaker than snRNA, and there was even a significant double-hop band below the AON single-hop band, thereby indicating that the chemically synthesized U7-snRNA experimental group 1 and U7-snRNA experimental group 2 were significantly superior to the AON1 and AON2 technology schemes in inducing exon 13 single splicing skipping. In addition, further quantitative analysis of rt-PCR electrophoresis bands was performed using ImageJ software to analyze the ratio of exon 12 and exon 13 double-skipped USH2A mRNA to the total jumped USH2A mRNA (total of exon 13 single-skipped and exon 12 and exon 13 double-skipped USH2A mRNA), and the results show that the ratio of double splicing skipping induced by U7-snRNA in exon 12 and exon 13 is very low, lower than that of AON1 and AON2. Therefore, it can be seen that U7-snRNA significantly improves the efficiency of exon 13 single-splicing skipping and at the same time ensures lower double-hop by-products of USH2A mRNA.

[0165] Furthermore, the target site of U7-snRNA#14 is close to the AON site where the probability of double splicing skipping in exon 12 and exon 13 is extremely high in the conventional technology, but the probability of double splicing skipping occurring after U7-snRNA#14 treatment is very low. Furthermore, it can be seen that U7-snRNA can significantly reduce the probability of double jumping in exon 12 and exon 13 while inducing splicing skipping of exon 13.

[0166] Example 14 Detection of the splicing skipping effect of U7-snRNA linked to the hnRNP A1 binding motif.

[0167] 1, Construction of U7-snRNA linked to hnRNP A1 binding motif. According to the pretranscriptional DNA sequence corresponding to the gRNA sequence in the table, the corresponding Oligo DNA was synthesized. The sense strand of the Oligo DNA is the reverse complementary sequence of the target sequence (DNA sequence corresponding to the recognition domain sequence), with CCGCAATATGATAGGGACTTAGGGTG (SEQ ID NO: 39) added to the 5', and the antisense strand is the target sequence with AATT added to the 5' and CACCCTAAGTCCCTATCATATT (SEQ ID NO: 40) added to the 3'. For example, the recognition domain sequence of snRNA#14 is ACACUGGCAGGGCUCACAUCCA (SEQ ID NO: 41), and the synthesized Oligo DNA sense strand is [ka] (SEQ ID NO: 42), and the antisense strand is [ka] (SEQ ID NO: 43), where the underline indicates the DNA double-stranded sequence corresponding to the recognition domain sequence, and the bold italics indicates the DNA double-stranded sequence corresponding to the binding motif "UAGGGU" of the hnRNP A1 protein.

[0168] The synthesized Oligo DNA sense strand and antisense strand were mixed with an annealing reaction system (total reaction volume 20 μl: Oligo-F (100 μM) 2 μl + Oligo-R (100 μM) 2 μl + 10 × NEB Cutter smart buffer 2 μl + deionized water 16 μl), incubated at 95 ° C for 5 minutes, cooled on ice, and annealed to form a double-stranded DNA with sticky ends. After diluting 100 times, 1 μl was taken, digested with 10 ng of BsaI, and the recovered linearized pUC57-U7-snRNA backbone plasmid was ligated. Furthermore, a U7-snRNA vector containing an hnRNP A1 binding motif to induce splicing skipping of USH2A exon 13 was obtained by transformation of E. coli competent cells, single cloning, PCR and sequence confirmation, and the vector was named pUC57-U7-hnRNP A1-snRNA#. The plasmid was purified and stored at -20°C for future use.

[0169] U7-hnRNP A1-snRNA can also be chemically synthesized and modified according to the methods described in Examples 2 and 4. Taking snRNA#14 as an example, the sequence and modifications of the chemically synthesized U7-hnRNP A1-snRNA are as follows (* indicates phosphorothioate backbone, m indicates 2'-methoxy modification, underline indicates recognition domain reverse-complementary to the target sequence, italics indicates smOPT sequence, and bold indicates hnRNP A1 protein-binding motif): [ka] (SEQ ID NO:66) The schematic structure of U7-hnRNP A1-snRNA is shown in FIG.

[0170] The above modified sequence is the sequence shown in SEQ ID NO:44 to which phosphorothioate backbone modification and methoxy modification have been added to the first three bases at the 5'-end and 3'-end.

[0171] 2, we tested the efficiency of U7-snRNA linked to an hnRNP A1-binding motif to induce splicing skipping of USH2A exon 13 in reporter gene cells.

[0172] Detection method: 293T cells were seeded in a 24-well plate at a predetermined amount so that the cell confluence reached about 80% after 24 hours. pCMV-EGFP was transfected using Lipofectamine2000. left -Exon13 c.2802T>G -EGFP right pUC57-U7-hnRNP A1-snRNA plasmid and pUC57-U7-snRNA plasmid were co-transfected into 293T cells (vector mass ratio was 100ng:400ng), and 293T cells transfected with reporter plasmid alone and co-transfected with reporter plasmid and pUC57-U7 Scramble were used as two negative controls, respectively, and 293T cells not transfected with any plasmid were used as blank controls. The transfected cells were subsequently cultured for 48-72 hours and digested into single cells using trypsin, after which a flow cytometer was used to detect the splicing skipping efficiency induced by various snRNA groups.

[0173] Experimental results: As shown in Figure 26 and the table below, introduction of the hnRNP A1 binding motif into the 5' end of U7-snRNA could significantly improve the effect of inducing splicing skipping of USH2A pre-mRNA exon 13, not only increasing the proportion of cells (GFP+) with splicing skipping of exon 13, but also increasing the level (average FITC intensity) of mRNA with splicing-skipped exons in each cell.

[0174] [Table 12]

[0175] In this embodiment, a free tail is introduced at the 5' end of U7-snRNA, and the free tail sequence contains the binding motif "UAGGGU" of hnRNP A1 protein. The free tail sequence is preferably "UAUGAUAGGGACUUAGGGUG" (sequence number 45), which can recruit hnRNP A1 protein to promote splicing skipping of USH2A exon 13, without increasing the double skipping of exon 12 and exon 13, without affecting other target specificities, and without inducing or increasing the target off-target effect.

[0176] Example 15 Construction and viral packaging of AAV-U7-snRNA-associated plasmid vectors targeted to induce splicing skipping of USH2A pre-mRNA exon 13.

[0177] In this embodiment, the U7-snRNA gene that targets and induces the splicing skipping of exon 13 of USH2A pre-mRNA was inserted to replace the central gene sequence of the two ITR domains of the pAAV-CMV vector, and the pAAV-U7-snRNA vector, an AAV packaging plasmid, was constructed. The serotype pRC plasmid (containing the AAV2 Rep gene and the respective Cap genes of each serotype) and pHelper plasmid (vector plasmid containing the adenovirus E2A, E4, and VA genes) were co-transfected into host cells and packaged to obtain the AAV-U7-snRNA virus that targets the splicing skipping of USH2A pre-mRNA exon 13. The specific operation process is as follows:

[0178] First, the gene sequence--U7-snRNA gene expression cassette backbone (without recognition domain): 5'-mouse U7 promoter-smOPT sequence-U7-snRNA scaffold-snRNA gene specific 3' cassette-3' was synthesized by total gene synthesis, where two Type IIs restriction endonuclease recognition sites were added between the U7 promoter and smOPT to facilitate subsequent cleavage, replacement and insertion of other recognition domain sequences. The total gene synthetic sequence was inserted and replaced between the two AAV2-ITR domains of the pAAV-CMV plasmid to obtain the pAAV-U7-snRNA backbone vector.

[0179] U7-snRNA gene expression cassette backbone (without recognition domain) (SEQ ID NO:46): AAGCTTAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCATAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAATATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGTGATTCACATATCAGTGGAGGGGTGTGGAAATGGCACCTTGATCTCACCCTCATCGAAAGTG GAGTTGATGTCCTTCCCTGGCTCGCTACAGACGCACTTCCGCAGAGACCAATGTGGGTCTCGAATTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAAACCCCTCCCAATTTCACTGGTCTACAATGAAAGCAAAACAGTTCTCTTCCCCGCTCCCCGGTGTGAGAGGGGCTTTGATCCTTCTCTGGTTTCCTAGGAAACGCGTATGTGCGGCCGC.

[0180] According to the methods described in Examples 1 and 6, the corresponding Oligo DNA sense strand and antisense strand were synthesized according to the pretranscriptional DNA sequence corresponding to the snRNA recognition domain sequence in Table 1, and sticky ends similar to those cleaved by Type IIs restriction endonuclease recognition sites were added to both ends. The recognition domain double-stranded DNA with sticky ends was formed by annealing, and T4 ligase was ligated with the linearized pAAV-U7-snRNA backbone plasmid digested with the corresponding Type IIs restriction endonuclease to form pAAV-U7-snRNA plasmids that target a specific site in USH2A pre-mRNA exon 13 to induce splicing skipping, and were named according to the snRNA number corresponding to the recognition domain sequence, such as pAAV-U7-snRNA#3, pAAV-U7-snRNA#14, and pAAV-U7-snRNA#16.

[0181] After inserting the target gene (U7-snRNA gene expression cassette targeting the induction of splicing skipping of USH2A pre-mRNA exon 13) and replacing the gene sequence between the AAV2-ITR domains of the pAAV-CMV plasmid, a pAAV-U7-snRNA plasmid vector was obtained. Following the instructions and standard cell manipulation procedures, the AAV-U7-snRNA virus targeting splicing skipping of USH2A pre-mRNA exon 13 was packaged and obtained.

[0182] 24 hours before transfection, HEK293 / 293T cells were seeded in 100 mm cell culture dishes, the medium was DMEM medium containing 10% FBS, and transfection was performed when the confluence reached 80%-90%. 3 hours before transfection, the old medium was discarded and replaced with new medium. At the time of transfection, pAAV-U7-snRNA plasmid, pRC plasmid, pHelper plasmid, and PEI (polyethyleneimine) transfection reagent were simultaneously prepared according to the system in the table below and added dropwise to the culture dish. After adding the PEI transfection mixture, the culture dish was gently shaken to uniformly disperse the transfection reagent, and the medium was cultured in a 37 °C, 5% CO2 incubator.

[0183] [Table 13]

[0184] 24 hours after transfection, the medium was replaced with fresh DMEM medium with 2% FBS. 48-72 hours after transfection, the cells containing AAV virus were collected, washed, centrifuged, and the cell pellet was collected and vortexed to loosen the cell pellet. Then, according to the kit's instructions, 0.5 mL of AAV Extraction Solution A was added to the cell pellet and vortexed for 15 seconds to completely suspend the cell pellet. After leaving it at room temperature for 5 minutes, it was vortexed for 15 seconds. It was centrifuged at 2000-14000g at 4°C for 10 minutes to remove cell debris. The supernatant was collected in a new sterile centrifuge tube, 50 μL of AAV Extraction Solution B was added, and mixed uniformly using a pipette to obtain AAV-U7-snRNA virus solutions with different recognition domains. A portion was taken to detect the virus titer using qPCR, and stored at 80°C for later use.

[0185] Since the AAV2-ITR domain of the pAAV-U7-snRNA plasmid and the inserted target gene fragment must be less than 4.7 kb, the expression level of U7-snRNA can be increased while ensuring the same number of AAV viral particles by inserting multiple U7-snRNA gene expression cassettes (5'-mouse U7 promoter recognition domain-smOPT sequence, snRNA gene-specific 3' cassette-3'), and the length of the gene sequence is about 450 bp. Preferably, the pAAV-U7-snRNA plasmid holds 1-10 U7-snRNA gene expression cassettes, and the multiple U7-snRNA gene expression cassettes in the pAAV-U7-snRNA plasmid may have the same recognition domain.

[0186] The technical features of the above-described embodiments may be combined in any manner, and for the sake of simplicity, we have not described all possible combinations of the technical features of the above-described embodiments, but as long as there are no contradictions in the combinations of these technical features, they should be considered to be within the scope of this specification.

[0187] The above examples only represent some embodiments of the present invention, and the description is relatively specific and detailed, but should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art can make some modifications and improvements without departing from the concept of the present invention, all of which belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention should be determined by the attached claims.

Claims

1. An snRNA that targets USH2A pre-mRNA, comprising a recognition domain that is reverse-complementary to the USH2A pre-mRNA sequence, and that causes splicing skipping of exon 13 by binding to USH2A pre-mRNA.

2. The snRNA of claim 1, wherein the USH2A pre-mRNA sequence is selected from the USH2A exon 13, intron 12 or intron 13 region.

3. The snRNA of claim 2, characterized in that the genomic location region corresponding to the USH2A pre-mRNA sequence is selected from Chr1: 216247142-216247185, Chr1: 216247130-216247161, Chr1: 216246616-216246649, Chr1: 216247213-216247246, Chr1: 216247204-216247232, Chr1: 216247187-216247220 and Chr1: 216247169-216247202.

4. The snRNA according to claim 3, wherein the USH2A pre-mRNA sequence is selected from the sequences shown in SEQ ID NOs: 1 to 7.

5. The snRNA according to any one of claims 1 to 4, characterized in that the snRNA recognition domain is reverse complementary to a contiguous sequence of at least 16 bp in the USH2A pre-mRNA sequence, preferably reverse complementary to a contiguous sequence of at least 20 bp, more preferably reverse complementary to a contiguous sequence of 20 bp to 27 bp.

6. The genomic location regions corresponding to the USH2A pre-mRNA sequence are Chr1: 216247223-216247246, Chr1: 216247218-216247241, Chr1: 216247213-216247236, Chr1: 216247209-216247232, Chr1: 216247204- 216247227, Chr1:216247197-216247220, Chr1:216247191-216247214, Chr1:2162 47187-216247210, Chr1:216247179-216247202, Chr1:216247174-216247197, Chr1 :216247169-216247192, Chr1:216247162-216247185, Chr1:216247155-21624717 8, Chr1:216247147-216247168, Chr1:216247147-216247173, Chr1:216247142-216 247165, Chr1: 216247138-216247161, Chr1: 216247130-216247153, Chr1: 216246626-216246649, Chr1: 216246622-216246645, and Chr1: 216246616-216246639; Preferably, Chr1: 216247213-216247236, Chr1: 216247209-216247232, Chr1: 216247204-216247227, Chr1: 216247197-216247220, Chr1: 216247191-216247214, Chr1: 216247187-216247210, Chr1: 216247179-216247202, Chr1: 216247174-216247197, and Chr1: 216247169-216247192; or Preferably, Chr1: 216247162-216247185, Chr1: 216247155-216247178, Chr1: 216247147-216247168, Chr1: 216247147-216247173, Chr1: 216247142-216247165 , Chr1: 216247138-216247161, Chr1: 216247130-216247153, Chr1: 216246626-216246649, Chr1: 216246622-216246645, and Chr1: 216246616-216246639; More preferably, Chr1: 216247213-216247236, Chr1: 216247209-216247232, Chr1: 216247204-216247227, Chr1: 216247197-216247220, Chr1: 216247191-216247214, Chr1: 216247187-216247210, Chr1: 216247179-216247202, Chr1: 216247 174-216247197, Chr1: 216247169-216247192, Chr1: 216247162-216247185, Chr1: 216247155-216247178, Chr1: 216247147-216247168, Chr1: 216247147-216247173, Chr1: 216247142-216247165, and Chr1: 216247130-216247153; More preferably, Chr1: 216247213-216247236, Chr1: 216247209-216247232, Chr1: 216247204-216247227, Chr1: 216247197-216247220, Chr1: 216247191-216247214, Chr1: 216247187-216247210, Chr1: 216247179-21624720 2, Chr1: 216247174-216247197, Chr1: 216247169-216247192, Chr1: 216247162-216247185, Chr1: 216247147-216247168, Chr1: 216247147-216247173, Chr1: 216247142-216247165, and Chr1: 216247130-216247153; Or, The snRNA of claim 1, characterized in that the genomic location region corresponding to the USH2A pre-mRNA sequence is selected from Chr1: 216247218-216247241, Chr1: 216247187-216247210, Chr1: 216247147-216247168, Chr1: 216247147-216247173, Chr1: 216247142-216247165, and Chr1: 216247130-216247153.

7. The snRNA recognition domain is selected from the sequences shown in SEQ ID NOs: 8 to 28, preferably the sequences shown in SEQ ID NOs: 10 to 18 or 19 to 28, more preferably the sequences shown in SEQ ID NOs: 10 to 23 or 25, and even more preferably the sequences shown in SEQ ID NOs: 10 to 19, 21 to 23 or 25; Or, The snRNA according to claim 1, characterized in that the recognition domain of the snRNA is selected from the sequences shown in SEQ ID NO: 9, SEQ ID NO: 15, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 or SEQ ID NO: 25; preferably the sequence shown in SEQ ID NO: 15, SEQ ID NO: 21, SEQ ID NO: 22 or SEQ ID NO:

23.

8. The snRNA according to any one of claims 1 to 7, characterized in that the snRNA is U1-snRNA or U7-snRNA.

9. The snRNA according to claim 8, characterized in that the snRNA comprises an sm sequence, the sm sequence being preferably an smOPT sequence, and the smOPT sequence being more preferably as shown in SEQ ID NO:

31.

10. The snRNA according to claim 9, characterized in that the snRNA comprises a recognition domain, a smOPT sequence, and a U1-snRNA scaffold or a U7-snRNA scaffold sequence; preferably, the U7-snRNA scaffold sequence is as set forth in SEQ ID NO:

49.

11. The snRNA of claim 10, further comprising a motif for recruiting a splicing regulatory protein, preferably comprising at least one of hnRNPA1, SRSF1, RBM4, DAZAP1 or SR.

12. A nucleotide sequence encoding an snRNA according to any one of claims 1 to 11.

13. A vector, characterized in that it comprises the snRNA according to any one of claims 1 to 10 and / or the nucleotide according to claim 11.

14. A viral particle, characterized in that it comprises an snRNA according to any one of claims 1 to 11, a nucleotide according to claim 12 and / or a vector according to claim 13.

15. A cell, characterized in that it comprises an snRNA according to any one of claims 1 to 11, a nucleotide according to claim 12, a vector according to claim 13 and / or a viral particle according to claim 14.

16. A pharmaceutical composition comprising the snRNA according to any one of claims 1 to 11, the nucleotide according to claim 12, the vector according to claim 13, the viral particle according to claim 14, and / or the cell according to claim 15.

17. A method for obtaining a Usherin protein lacking an exon 13 expression product, comprising contacting a pre-mRNA of the USH2A gene with the snRNA described in any one of claims 1 to 11, the nucleotide described in claim 12, the vector described in claim 13, the viral particle described in claim 14, the cell described in claim 15, and / or the pharmaceutical composition described in claim 16.

18. Use of the snRNA according to any one of claims 1 to 11, the nucleotide according to claim 12, the vector according to claim 13, the viral particle according to claim 14, the cell according to claim 15, the pharmaceutical composition according to claim 16 and / or the method according to claim 17 in the preparation of a medicament for preventing and / or treating an eye disease and / or an ear disease.

Images