Modified bacteria with antitumor activity

Abstract

The present invention relates to a modified bacterium with antitumor activity, which comprises an essential gene expression cassette under the control of an obligate hypoxia-inducible promoter and is deficient in at least one gene or its functional expression product involved in or controlling an endogenous antioxidant stress response pathway. The present invention also relates to a pharmaceutical composition comprising the modified bacterium and its antitumor use.

Description

[Technical field]

[0001] The present invention relates to modified bacteria having antitumor activity, pharmaceutical compositions containing the modified bacteria, and antitumor uses thereof.

[0002] [background] Cancer has become one of the most important diseases threatening human life and health, but all existing treatment methods (radiotherapy, chemotherapy, surgery, and targeted drugs) have shortcomings, and there is an urgent need to develop new treatment approaches. Conventional bacterial tumor therapy, represented by Coli's toxin, has a history of 150 years, but is known for its unstable efficacy and safety concerns. Although the development of genetic engineering technology has made remarkable progress in reducing the toxicity of bacterial strains, a series of clinical trials have also demonstrated that attenuated engineered bacteria for human tumor therapy are safe, but their efficacy is limited, i.e., they cannot combine safety and therapeutic efficacy, and therefore cannot meet the needs of clinical tumor therapy. Further optimization of tumor therapy is essential.

[0003] [Summary of the Invention] According to the present invention, an obligately anaerobic bacterium is constructed by a synthetic biology genetic circuit, which exhibits therapeutic effects against tumors after being administered to an animal or human body, and can be excreted by normal tissues and organs in a short time, thereby reducing the toxic and side effects caused to the animal or human body due to the long-term retention of the bacterium in vivo, and thus providing more reliable anti-tumor ability and safety.

[0004] In one embodiment, the invention provides a modified bacterium, wherein the bacterium comprises a hypoxia regulated essential gene expression cassette comprising an essential bacterial gene under the control of a strictly hypoxia inducible promoter, wherein the bacterium is deficient in at least one gene, or a functional expression product thereof, required for survival within macrophages compared to an unmodified starting strain.

[0005] In one embodiment, the invention provides a modified bacterium, wherein the bacterium comprises a hypoxia-regulated essential gene expression cassette comprising an essential bacterial gene under the control of an obligate hypoxia-inducible promoter, and wherein the bacterium is defective in at least one gene, or a functional expression product thereof, involved in or regulating an endogenous antioxidant stress response pathway compared to an unmodified starting strain.

[0006] In one embodiment, the invention provides a modified bacterium, wherein the bacterium comprises a hypoxia-regulated essential gene expression cassette comprising an essential bacterial gene under the control of an obligate hypoxia-inducible promoter and a pH-regulated expression cassette comprising a gene encoding a bacterial hemolysin protein under the control of a promoter that is active under acidic pH conditions, and wherein the bacterium is deficient in at least one gene, or a functional expression product thereof, involved in or regulating an endogenous antioxidant stress response pathway compared to an unmodified starting strain.

[0007] In one embodiment, the invention provides a modified bacterium, wherein the bacterium comprises a hypoxia-regulated essential gene expression cassette comprising an essential bacterial gene under the control of an obligate hypoxia-inducible promoter and a pH-regulated expression cassette comprising a gene encoding a bacterial hemolysin protein under the control of a promoter that is active under acidic pH conditions, wherein the bacterium expresses wild-type lipopolysaccharide (LPS) and is deficient in at least one gene, or a functional expression product thereof, required for survival within macrophages compared to the unmodified starting strain.

[0008] In one embodiment, the invention provides a modified bacterium of Salmonella typhimurium, wherein the bacterium comprises a hypoxia-regulated essential gene expression cassette comprising an essential gene of the bacterium under the control of an obligate hypoxia-inducible promoter and a pH-regulated expression cassette comprising a gene encoding a hemolysin protein from the bacterium under the control of a promoter that is active under acidic pH conditions, and wherein the bacterium is defective in at least one gene, or a functional expression product thereof, involved in or regulating an endogenous antioxidant stress response pathway compared to an unmodified starting strain.

[0009] In one embodiment, the invention provides a modified bacterium of Salmonella typhimurium, wherein the bacterium comprises a hypoxia-regulated essential gene expression cassette comprising an essential gene of the bacterium under the control of an obligate hypoxia-inducible promoter and a pH-regulated expression cassette comprising a gene encoding a hemolysin protein from the bacterium under the control of a promoter that is active under acidic pH conditions, and wherein the bacterium expresses wild-type lipopolysaccharide (LPS) and is deficient in at least one gene, or a functional expression product thereof, required for survival within macrophages compared to an unmodified starting strain.

[0010] In one embodiment, the invention provides a pharmaceutical composition comprising the bacteria of any one of the preceding embodiments. In one embodiment, the pharmaceutical composition is used to treat malignant tumors.

[0011] In one embodiment, the present invention provides a method for treating a malignant tumor, comprising administering to a subject having a malignant tumor a pharmaceutical composition described in any one of the preceding embodiments.

[0012] In one embodiment, the invention provides for the use of the bacterium according to any one of the preceding embodiments in the treatment of malignant tumors. [Brief description of the drawings]

[0013] [Figure 1]FIG. 1 shows an outline of the construction scheme of the DB-ZW1 strain. [Diagram 2] Figure 2 shows the growth characteristics of DB-ZW1 and DB-ZW2 strains in various cells. In particular, Figure 2A shows the transcription levels of the dapE gene in anaerobic and aerobic conditions for DB-ZW1 and DB-ZW2 strains; Figure 2B shows the growth of DB-ZW1 and DB-ZW2 strains under aerobic conditions; Figure 2C shows the doubling time of DB-ZW1 strain under aerobic conditions (with the addition of DAP) and under anaerobic conditions. [Diagram 3] FIG. 1 shows the proliferation of DB-ZW1 and DB-ZW3 strains in Raw264.7 mouse macrophages or MB49 mouse bladder cancer cells. [Figure 4] 4A shows the distribution of strains DB-ZW1, 2, 3, 4, 5, and wild-type SL7207 in normal tissues and tumors; FIG. 4A shows the content of strains DB-ZW1, 2, 3, 4, 5, and wild-type SL7207 in normal tissues; FIG. 4B shows the content of strains DB-ZW1, 2, 3, 4, 5, and wild-type SL7207 in tumors. [Diagram 5] FIG. 1 shows the distribution of strains DB-ZW1, DB-ZW1(ΔmsbB), DB-ZW1(Δlpp), and DB-ZW1(ΔfliC) in normal tissues and tumors. [Figure 6]FIG. 1 shows the antitumor effect of strains DB-ZW1, DB-ZW1(ΔmsbB), DB-ZW1(Δlpp) and DB-ZW1(ΔfliC) in mice. In particular, FIG. 6A shows the effect of strains DB-ZW1, DB-ZW1(ΔmsbB), DB-ZW1(Δlpp), DB-ZW1(ΔfliC), and wild-type SL7207 on the tumor volume of MB49 bladder tumor-bearing mice; FIG. 6B shows the effect of strains DB-ZW1, DB-ZW1(ΔmsbB), DB-ZW1(Δlpp), DB-ZW1(ΔfliC), and wild-type SL7207 on the body weight of MB49 bladder tumor-bearing mice; FIG. 6C shows the effect of strains DB-ZW1, DB-ZW1(ΔmsbB), DB-ZW1(Δlpp), and DB-ZW1(ΔfliC), and wild-type SL7207 on the survival rate of MB49 bladder tumor-bearing mice; FIG. 6D shows the various response patterns of DB-ZW1 to the treatment of MB49 mouse bladder cancer. [Figure 7] 7A and 7B show the distribution of DB-ZW1 in tumors and various organs over time, in particular, FIG. 7A shows the density of DB-ZW1 in tumors and various organs over time; FIG. 7B shows the density of DB-ZW1 in various normal organs over time. [Figure 8] 8 shows the antitumor effect of DB-ZW1 on bladder cancer, melanoma, and in situ colon cancer. In particular, Figures 8A-C illustrate the effect of DB-ZW1 on the tumor volume of subcutaneous bladder cancer, in situ melanoma, and subcutaneous in situ colon cancer, respectively; Figure 8D illustrates the effect of DB-ZW1 on the tumor number of in situ colon cancer. [Figure 9] The content of DB-ZW1 variant DB-ZW1-ΔfliC in tumors and normal organs is shown. [Figure 10]10A-10B show activation of memory CD8+ T cells by DB-ZW1. In particular, FIG. 10A illustrates the effect of DB-ZW1 on memory CD8+ T cell content in the draining lymph nodes of mice; FIG. 10B illustrates the effect of DB-ZW1 on memory CD8+ T cell content in the draining lymph nodes of mice inoculated with B16-OVA melanoma cells. [Figure 11] Figure 11 shows the tumor memory of DB-ZW1 anti-tumor effect.In particular, Figure 11A illustrates that DB-ZW1 cured melanoma mice do not develop tumors even after another subcutaneous inoculation of 1x106 B16 melanoma cells;Figure 11B illustrates that DB-ZW1 cured melanoma mice have lower lung weights compared to melanoma-primary mice;Figure 11C illustrates that DB-ZW1 cured melanoma mice also develop tumors after another subcutaneous inoculation of 1x106 MB49 bladder cancer cells, just like the mice that are first subcutaneously injected with MB49 bladder cancer cells. [Figure 12] 12A shows the activation of IFNγ+CD8+T cells by DB-ZW1. In particular, FIG. 12A illustrates the effect of DB-ZW1 and its variants DB-ZW1-ΔmsbB and DB-ZW1-Δlppon on the amount of IFNγ+CD8+T cells in the tumor microenvironment when MB49 bladder cancer cells were subcutaneously inoculated into mice; FIG. 12B illustrates the killing effect of CD8+T cells isolated from tumors of tumor-bearing mice treated with DB-ZW1 on MB49 and B16 cells. [Figure 13] FIG. 1 shows the effect of DB-ZW1 treatment on the percentage of TRM cells among CD8+ T cells and the percentage of IFNγ+ TRM cells among TRM cells in tumor-draining lymph nodes and tumors in mice bearing bladder cancer. [Figure 14]FIG. 1 shows in vitro activation of CD8+ T cells by anti-CD3 antibodies, DB-ZW1, DB-ZW1-ΔmsbB, and DB-ZW1-Δlpp. [Figure 15] FIG. 1 shows the effects of DB-ZW1, DB-ZW1-ΔmsbB, and DB-ZW1-Δlppon on serum IL-10 levels in subcutaneous tumor-bearing mice with bladder cancer. [Figure 16] 16A-16C show the role of cytokine IL-10 during tumor treatment with DB-ZW1. In particular, FIG. 16A shows the inhibitory effect of anti-IL-10 antibody on IFNγ+CD8+ T cells induced by DB-ZW1 at the tumor site; FIG. 16B illustrates the inhibitory effect of anti-IL-10 antibody on DB-ZW1-induced tumor volume reduction. [Figure 17] FIG. 1 shows IL-10 production in primary macrophages induced by DB-ZW1. [Figure 18] FIG. 1 shows the effect of DB-ZW1 on the distribution of neutrophils, T cells, and macrophages within the tumor. [Figure 19] 19A and 19B illustrate the effects of anti-IL-10 and anti-CSF1R antibodies, respectively, on neutrophil ring structures in DB-ZW1-treated tumors. [Figure 20] Figure 20 shows the effect of different DB-ZW1 administration modes on antitumor capacity. In particular, Figure 20A illustrates the effect of intratumoral or intravenous injection of DB-ZW1 on bacterial distribution in tumor and normal tissues; Figure 20B illustrates the effect of intratumoral or intravenous injection of DB-ZW1 on tumor volume. [Figure 21] FIG. 1 shows the effect of inactivated DB-ZW1 on antitumor potential. [Figure 22] FIG. 1 shows the effect of various administered doses of DB-ZW1 on tumor volume in mice bearing subcutaneous MB49 bladder tumors. [Figure 23]FIG. 1 shows schematic diagrams of preferred fragments PsseA-hlyA-loxp-KnaR-loxp (SEQ ID NO: 1) (A), Pssbp1-dapE-Cm (SEQ ID NO: 2) (B), PdapE-dapE-loxp-KnaR-loxp (SEQ ID NO: 4) (C), and PhtrA-htrA-loxp-aadA-loxp (SEQ ID NO: 5) (D) used in the examples, where "numbers a to b" represent start and stop nucleotides (nt) and number major elements within the fragments within the sequences.

[0014] [Detailed Description of the Invention] definition In the present invention, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art unless otherwise defined.In addition, the terms related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology, and laboratory procedures used herein are also terms and routine steps widely used in the corresponding fields.At the same time, in order to better understand the present invention, the definitions and explanations of related terms are provided below.

[0015] By "hypoxia-regulated essential gene expression cassette" herein is meant a stretch of DNA capable of promoting expression of an essential gene under hypoxic conditions, which contains an essential gene under the control of a hypoxia-inducible promoter and may, if necessary, further contain other control elements required for expression of the essential gene.

[0016] As used herein, "essential gene" refers to a gene that is critical for bacterial growth and / or survival, and in the absence of such a gene or its functional expression product, the bacterium cannot survive, divide, and / or grow normally. A representative example of a deficiency of an essential gene or its functional expression product is a nutritionally deficient strain that cannot survive, divide, and / or grow normally under in vitro culture conditions or in an in vivo environment in the absence of a particular exogenous nutritional supplement. Essential genes usually occur as a single copy on the bacterial chromosome.

[0017] As used herein, an "obligate hypoxia-inducible promoter" refers to a promoter that has the ability to initiate transcription of a specific gene under anaerobic conditions, but is substantially incapable of activating and producing the transcript under aerobic conditions.

[0018] An "obligate hypoxia-inducible promoter" as used herein can be identified by the following experiment: An expression strain containing an essential gene (e.g., dapA / dapE) under the control of the promoter to be tested is constructed, streaked onto a Luria-Bertani (abbreviated as LB) plate in an anaerobic incubator, and incubated anaerobically at 37°C for 24 hours. Under anaerobic conditions, a single clone is selected and resuspended in 20 μL of LB liquid medium. 20 μL of the monoclonal resuspension solution is added equally to the following four liquid tubes A, B, C, and D (i.e., 5 μL is added to each tube): A. 2 mL of LB liquid medium, B. 2 mL of LB liquid medium, C. 2 mL of LB liquid medium + DAP; D. 2 mL of LB liquid medium + DAP.

[0019] Tubes A and C are incubated statically in an anaerobic incubator at 37° C. for 24 hours, and tubes B and D are incubated in an aerobic shaker at 37° C. for 24 hours. Bacteria are able to grow in tubes A, C, and D, but not in tube B (OD 600 is less than 0.05), the promoter is considered to be an obligate hypoxia-inducible promoter. Exemplary obligate hypoxia-inducible promoters that can be used in the present invention are shown in Table 1.

[0020] [Table 1]

[0021] As used herein, "genes involved in or regulating the endogenous antioxidant stress response pathway" refers to genes involved in the resistance of bacteria (e.g., intracellular bacteria, such as Salmonella) to the killing effects of reactive oxygen species (ROS) in vivo or in vitro.

[0022] As used herein, a "gene required for survival in macrophages" refers to a gene involved in maintaining or enhancing the survival rate of intracellular bacteria in macrophages. The function of such gene products is associated with resistance to the killing effect of macrophages on microorganisms, and thus deficiency of such genes or their functional expression products may reduce the survival rate of bacteria (e.g., intracellular bacteria such as Salmonella) in macrophages.

[0023] As used herein, "functional expression products" include RNA, proteins, and the like.

[0024] As used herein, "facultative anaerobic bacteria" refers to bacteria that can survive under both aerobic and anaerobic conditions.

[0025] As used herein, a "pH-regulated expression cassette" refers to a group of gene expression elements in which expression of the corresponding gene(s) is regulated by environmental pH.

[0026] As used herein, a "promoter active under acidic pH conditions" refers to a promoter that can be activated under acidic pH conditions and control the expression of the corresponding gene(s). In some embodiments, the promoter active under acidic pH conditions of the present invention can be activated or still have promoter activity at a pH lower than 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6, or 5.5. In some embodiments, the promoter active under acidic pH conditions also has promoter activity at neutral pH (e.g., pH 7.0 to 7.4).

[0027] "Polypeptide", "peptide", and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of the corresponding naturally occurring amino acid(s), as well as to naturally occurring amino acid polymers. The terms "polypeptide", "peptide", "amino acid sequence", and "protein" can also include modified forms, including, but not limited to, glycosylation, lipid ligation, sulfation, gamma-carboxylation of glutamic acid residues, and ADP-ribosylation.

[0028] As used herein, "polynucleotide" refers to a macromolecule formed by linking multiple nucleotides via phosphodiester bonds, where the nucleotides include ribonucleotides and deoxyribonucleotides. The sequence of the polynucleotide of the present invention may be subject to codon optimization for different host cells (e.g., Escherichia coli, etc.), which may improve the expression of the polypeptide. Methods of codon optimization are known in the art.

[0029] "Sequence identity" between two polypeptide sequences or two polynucleotide sequences refers to the percentage of identical amino acids or identical nucleotides between the sequences. Methods for assessing the level of sequence identity between polypeptide sequences or polynucleotide sequences are known in the art. Sequence identity can be assessed using various known sequence analysis software. For example, sequence identity can be assessed by the EMBL-EBI online alignment tool (https: / / www.ebi.ac.uk / Tools / psa / ). Sequence identity between two sequences can be assessed via the Needleman-Wunsch algorithm using default parameters.

[0030] As used herein, the term "viable bacteria" refers to a strain that is viable and characterized by an active nutritional metabolism and has the ability to carry out its own biological functions. Viable bacteria may include the bacterial biomass produced in the metabolic processes of the strain.

[0031] The term "gram-negative bacteria" as used herein refers to bacteria that do not retain the initial basic dye stain (e.g., crystal violet) that is part of the procedure known as Gram staining. In an exemplary Gram stain, cells are first fixed to a slide by heat and stained with a basic dye (e.g., crystal violet), which is taken up by both Gram-negative and Gram-positive bacteria. The slide is then treated with a mordant (e.g., Gram iodine), which binds the basic dye (e.g., crystal violet) and traps the basic dye within the cells. The cells are then washed with acetone or alcohol and then counterstained with a second dye of a different color (e.g., safranin). Gram-positive organisms retain the initial violet stain, while Gram-negative organisms are decolorized by the organic wash solvent and therefore exhibit a counterstain. Exemplary Gram-negative bacteria include Escherichia spp., Shigella spp., Salmonella spp., Campylobacter spp., Neisseria spp., Haemophilus spp., Aeromonas spp., Francisella spp., Yersinia spp., Klebsiella spp., Bordetella spp., Legionella spp., Corynebacteria spp., Citrobacter spp., and the like. spp., Chlamydia spp., Brucella spp., Pseudomonas spp., Helicobacter spp., and Vibrio spp.

[0032] As used herein, the term "malignant solid tumor" refers to an abnormal mass of tissue, usually not containing cysts or liquid areas. Solid tumors can be benign (non-cancerous) or malignant (cancerous). Different types of malignant solid tumors are named for the type of cells that form them. Examples of malignant solid tumors are sarcoma, carcinoma, and lymphoma. Leukemias (cancers of the blood) do not usually form malignant solid tumors (as defined by the NIH National Cancer Institute). Malignant solid tumors include, but are not limited to, clusters of abnormal cells that may originate from different tissue types, such as liver, colon, colorectum, skin, breast, pancreas, cervix, uterine body, bladder, gallbladder, kidney, larynx, lip, oral cavity, esophagus, ovary, prostate, stomach, testis, thyroid, or lung, and thus malignant solid tumors include malignant solid liver tumors, colon tumors, colorectal tumors, skin tumors, breast tumors, pancreatic tumors, cervical tumors, uterine body tumors, bladder tumors, gallbladder tumors, kidney tumors, laryngeal tumors, lip tumors, oral cavity tumors, esophageal tumors, ovarian tumors, prostate tumors, stomach tumors, testicular tumors, thyroid tumors, or lung tumors.

[0033] For purposes of treatment herein, the term "subject" is preferably a subject in need of treatment for a target pathological condition, such as a tumor. For purposes of prevention, the subject is preferably a subject at risk of or susceptible to developing a target pathological condition. The term "subject" includes organisms, such as prokaryotes and eukaryotes. Examples of subjects include mammals, such as humans, dogs, cows, horses, pigs, sheep, goats, cats, mice, rabbits, rats, and the like, and genetically modified non-human animals. In some preferred embodiments, the subject is a human.

[0034] As used herein, "treatment" is an approach to obtain beneficial or desired clinical results. For purposes of the present invention, beneficial or desired clinical results include, but are not limited to, one or more of: reducing (or destroying) the proliferation of neoplastic or cancerous cells, inhibiting the metastasis of neoplastic cells, shrinking or reducing the size of a tumor, remission of a malignant tumor, reducing symptoms caused by a malignant tumor, improving the quality of life of a person suffering from a malignant tumor, reducing the dosage of other pharmaceutical agents required to treat a malignant tumor, slowing the progression of a malignant tumor, curing a malignant tumor, and / or increasing the survival time of a patient with a malignant tumor.

[0035] As used herein, an "effective amount" or "effective dose" of a bacterium, medicament, or pharmaceutical composition is an amount sufficient to affect any one or more beneficial or desired results. In the case of prophylactic applications, beneficial or desired results include eliminating or reducing the risk, reducing the severity, or delaying the onset of a disease (including biochemical, histological, and / or behavioral symptoms of the disease, its complications and intermediate pathological phenotypes manifested during the development of the disease). In the case of therapeutic applications, beneficial or desired results include reducing one or more symptoms of a disease, such as a tumor, reducing the dose of other pharmaceuticals required to treat the disease, enhancing the effect of another pharmaceutical, and / or delaying the progression of cancer in a patient. For example, an "effective amount" preferably inhibits cell proliferation or tumor growth by at least about 10%, preferably at least about 20%, more preferably at least about 30%, more preferably at least about 40%, more preferably at least about 50%, more preferably at least about 60%, more preferably at least about 70%, and more preferably at least about 80%, compared to an untreated subject. The ability of a compound to inhibit tumor growth can be evaluated in an animal model system that is predictive of efficacy in human tumors. Alternatively, this property of a composition can be evaluated by examining the ability of the compound to inhibit such inhibition in vitro by assays known to those skilled in the art. A therapeutically effective amount of a therapeutic compound can reduce tumor size or otherwise improve symptoms in a subject. Those skilled in the art can determine such amounts based on factors such as the size of the subject, the severity of the subject's symptoms, and the particular composition or route of administration selected.

[0036] As used herein, "pharmaceutical acceptable carrier" includes any material that, when combined with an active ingredient, allows the ingredient to retain biological activity and is non-reactive with the subject's immune system, including, but not limited to, disintegrants, adhesives, fillers, buffers, tonicity agents, stabilizers, antioxidants, surfactants, or lubricants. Preferably, the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal, or epidermal administration (e.g., by injection or infusion). Depending on the route of administration, the bacteria of the present invention may be coated in a material to protect the compound from the action of acids and other natural conditions that may inactivate the bacteria. Pharmaceutically acceptable carriers include normal saline solutions, PBS buffers, sterile aqueous solutions or dispersions, and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The use of such media and agents for pharmaceutical active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, its use in the pharmaceutical compositions of the present invention is contemplated.

[0037] Modified bacteria The invention provides modified bacteria, wherein the bacteria comprises a hypoxia-regulated essential gene expression cassette compared to an unmodified starting strain. In one embodiment, the essential gene expression cassette comprises a bacterial essential gene under the control of an obligate hypoxia-inducible promoter. In one embodiment, the bacteria is deficient in at least one gene or functional expression product thereof that is involved in or controls an endogenous antioxidant stress response pathway. In one embodiment, the bacteria is deficient in at least one gene or functional expression product thereof that is required for survival in macrophages. In one embodiment, the bacteria express wild-type lipopolysaccharide (LPS).

[0038] In one embodiment, the obligate hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr. Preferably, the obligate hypoxia-inducible promoter is the ssbp1 promoter.

[0039] In one embodiment, the expression product of the essential gene is involved in the synthesis of 2,6-diaminopimelic acid (DAP) in the bacterium. In one embodiment, when cultured under aerobic conditions, the growth of the bacterium stands on additional DAP or its analogues added to the medium. In one embodiment, the essential gene is selected from dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof. Preferably, the essential gene is selected from dapA and dapE. Preferably, dapE comprises a nucleotide sequence having at least 81%, preferably at least 82%, more preferably at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or most preferably at least 99% sequence identity to SEQ ID NO:27. Preferably, the nucleotide sequence of dapE comprises SEQ ID NO: 27. Preferably, the nucleotide sequence of dapE consists of SEQ ID NO:27.

[0040] In one embodiment, the gene involved in or regulating the endogenous antioxidant stress response pathway is an HtrA serine protease family gene. In one embodiment, the functional expression product of the gene involved in or regulating the endogenous antioxidant stress response pathway is a protein related to the HtrA serine protease family. In one embodiment, the bacterium is deficient in the activity of HtrA serine protease. In one embodiment, the gene involved in or regulating the endogenous antioxidant stress response pathway is htrA. In one embodiment, the bacterium is deficient in htrA. Preferably, htrA comprises a nucleotide sequence having at least 81%, preferably at least 82%, more preferably at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or most preferably at least 99% sequence identity to SEQ ID NO: 28. Preferably, the nucleotide sequence of htrA comprises SEQ ID NO: 28. Preferably, the nucleotide sequence of htrA consists of SEQ ID NO: 28.

[0041] In one embodiment, the essential gene is a gene that naturally occurs in the bacterial chromosome.In one embodiment, the native promoter of the essential gene is functionally replaced with an obligate hypoxia-inducible promoter.As a result, the expression of the essential gene in the bacterium is completely under the control of the obligate hypoxia-inducible promoter.

[0042] In one embodiment, the essential gene expression cassette is exogenous. In one embodiment, the essential gene naturally present in the bacterial chromosome is deleted or functionally inactivated. As a result, the expression of the essential gene in the bacterium is entirely under the control of an obligate hypoxia-inducible promoter. In one embodiment, the exogenous essential gene expression cassette is integrated into the bacterial chromosome. In one embodiment, the exogenous essential gene expression cassette is external to the bacterial chromosome. In one embodiment, the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium.

[0043] In one embodiment, the modified bacterium further comprises a pH-regulated expression cassette. In one embodiment, the modified bacterium comprises a hypoxia-regulated essential gene expression cassette and a pH-regulated expression cassette, compared to the unmodified starting strain. In one embodiment, the pH-regulated expression cassette comprises a gene encoding a hemolysin protein from the bacterium under the control of a promoter active under acidic pH conditions. According to some embodiments of the invention, the promoter active under acidic pH conditions is active at a pH in the range of about pH 4.0 to 7.0. In some embodiments, the promoter active under acidic pH conditions is also active at pH 6.0±1. In some embodiments, the promoter active under acidic pH conditions is active at a pH value lower than 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6, or 5.5, or between any two of such values. In one embodiment, the promoter active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM, and ssaR. In one embodiment, the promoter active under acidic pH conditions is sseA. In one embodiment, the bacterial hemolysin protein is a Gram-negative bacterial hemolysin protein. In one embodiment, the gene encoding the Gram-negative bacterial hemolysin protein is hlyA or hlyE. In one embodiment, hlyA or hlyE is derived from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli. Preferably, hlyA comprises a nucleotide sequence having >81%, preferably >82%, more preferably >83%, >84%, >85%, >86%, >87%, >88%, >89%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, or most preferably >99% sequence identity to SEQ ID NO: 29. Preferably, the nucleotide sequence of hlyA comprises SEQ ID NO: 29. Preferably, the nucleotide sequence of htrA consists of SEQ ID NO: 29.

[0044] In one embodiment, the unmodified starting strain is a facultative anaerobic bacterium. In one embodiment, the bacterium is a bacterium of the family Enterobacteriaceae. Preferably, the bacterium is from the genera Escherichia coli, Salmonella, Shigella, Klebsiella, Yersinia, Citrobacter, Enterobacter sp., Serratia sp., Proteus sp., Morganella sp., Providencia sp., Hafnia sp., and Pantoea sp. Preferably, the bacterium is Escherichia coli (E. coli), Enterobacter blattae (E. blattae), Enterobacter fergusonii (E. fergusonii), Enterobacter hermannii (E. hermannii), Enterobacter vulneris (E. vulneris), Salmonella enterica (S. enterica), Salmonella bongori (S. bongori), Salmonella typhi (S. typhi), Salmonella choleraesuis (S. choleraesuis), Salmonella typhimurium (S. typhimurium), Shigella dysenteriae (S. flexneri), Shigella boydii (S. boydii), Shigella sonnei (S. sonnei). , Klebsiella pneumoniae, Klebsiella oxytoca, Y. pestis, Y. enterocolitica, Y. pseudotuberculosis, Y. aldovae, Y. bercovieri, Y. frederiksenii, Y. intermedia, Y. kristersenii, Y. mollaretti, Y. rohdei, Y. ruckeri, Citrobacter freundei (C.freundii, Citrobacter koseri, Citrobacter braakii, Enterobacter aerogenes, Enterobacter cloacae, Enterobacter gergoviae, Enterobacter sakazakii, Enterobacter taylorae, Enterobacter amnigenus, Enterobacter intermedius ntermedius, E. asburiae, E. cancerogenus, E. dissolvens, E. nimipressuralis, S. marcescens, S. entomophila, S. ficaria, S. fonticola, Serratia S.grimesii, S.liquefaciens, S.odorifera, S.plymuthica, S.proteamaculans, S.rubidaea, S.ureilytica, Proteus mirabilis, Proteus vulgaris, Proteus mixophagaciens (P. myxofaciens), Proteus penneri, Proteus hauseri, Morganella morganii, P. alcalifaciens, P. rustigianii, P. stuartii, P. rettgeri, P. heimbochae, Hafnia alvei, H.alvei, and Pantoea agglomerans. Preferably, the bacterium is a Salmonella typhimurium bacterium. Preferably, the starting strain is Salmonella typhimurium SL7207.

[0045] In one embodiment, the bacteria, when administered to a subject with a tumor, can survive and grow in tumor tissue, but are quickly eliminated in normal tissue. In one embodiment, the bacteria, when administered to a subject with a malignant tumor, can induce an anti-tumor specific immune response. In one embodiment, the bacteria, when administered to a subject with a malignant tumor, can induce an anti-tumor immune memory.

[0046] In one embodiment, the bacterium does not express wild-type flagellin, hi one embodiment, the modified bacterium is defective in the fliC gene.

[0047] In one embodiment, the survival level of the bacteria in the macrophages is in the range of about 50% to about 30% of the survival level of the unmodified starting strain. In one embodiment, the survival level of the bacteria in the macrophages is in the range of about 30% to about 10% of the survival level of the unmodified starting strain. Preferably, the survival level of the bacteria in the macrophages is in the range of about 10% to about 1% of the survival level of the unmodified starting strain.

[0048] Pharmaceutical Compositions The invention provides a pharmaceutical composition comprising an effective amount of the modified bacterium of the invention. In one embodiment, the modified bacterium is a viable bacterium.

[0049] In one embodiment, the pharmaceutical composition is used to treat a malignant tumor. In one embodiment, the pharmaceutical composition is used to induce an anti-tumor specific immune response in a subject with a malignant tumor. In one embodiment, the pharmaceutical composition is used to induce anti-tumor immune memory in a subject with a malignant tumor. In one embodiment, the pharmaceutical composition is used to prevent or treat metastasis or recurrence of a malignant tumor. In one embodiment, the pharmaceutical composition is used to treat a malignant tumor that is resistant to or has failed previous anti-tumor therapy.

[0050] In one embodiment, the malignant tumor is a malignant tumor of nervous system, respiratory system, digestive system, urinary system, reproductive system, hematopoietic system, lymphatic system, endocrine system, or mucosal skin origin. In some embodiments, the malignant tumor is a sarcoma or cancer. In one embodiment, the malignant tumor is a solid tumor. In one embodiment, the malignant tumor is selected from the group consisting of glioma, neuroblastoma, retinoblastoma, nasopharyngeal carcinoma, oral cancer, tongue cancer, laryngeal cancer, head and neck cancer, melanoma, bronchial cancer, lung cancer, pleural cancer, esophageal cancer, gastric cancer, hepatocellular carcinoma, pancreatic cancer, bile duct cancer, colorectal cancer, rectal cancer, renal cell carcinoma, bladder cancer, prostate cancer, suprarenoma, thyroid cancer, parathyroid cancer, pituitary tumor, Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, cervical cancer, ovarian cancer, endometrial cancer, breast cancer, bone cancer, and osteosarcoma.

[0051] In one embodiment, the pharmaceutical composition further comprises a pharma- ceutically acceptable carrier.

[0052] Treatment Methods and Uses The present invention provides a method for treating a malignant tumor, comprising the step of administering an effective amount of the modified bacterium of the present invention or the pharmaceutical composition of the present invention to a subject having a malignant tumor.

[0053] The present invention provides a method for inducing an anti-tumor specific immune response in a subject having a malignant tumor, the method comprising the step of administering an effective amount of the modified bacterium of the present invention or the pharmaceutical composition of the present invention to the subject having a malignant tumor.

[0054] The present invention provides a method for inducing anti-tumor immune memory in a subject having a malignant tumor, the method comprising the step of administering an effective amount of the modified bacterium of the present invention or the pharmaceutical composition of the present invention to the subject having a malignant tumor.

[0055] The present invention provides a method for preventing or treating metastasis or recurrence of a malignant tumor, the method comprising the step of administering an effective amount of a modified bacterium of the present invention or a pharmaceutical composition of the present invention to a subject having a malignant tumor.

[0056] The present invention provides a method for preventing or treating metastasis or recurrence of a malignant tumor, the method comprising the step of administering an effective amount of the modified bacterium of the present invention or the pharmaceutical composition of the present invention to a subject having a malignant tumor or at high risk for metastasis or recurrence of a malignant tumor.

[0057] The present invention provides a method for treating a malignant tumor that is resistant or unsuccessful to previous anti-tumor therapies, comprising the step of administering an effective amount of the modified bacterium of the present invention or the pharmaceutical composition of the present invention to a subject having a malignant tumor that is resistant or unsuccessful to previous anti-tumor therapies.

[0058] The invention provides the use of the modified bacterium of the invention in the manufacture of a medicament for use in treating malignant tumors.

[0059] The present invention provides the use of the modified bacterium of the present invention in the manufacture of a medicament for inducing an anti-tumor specific immune response in a subject with a malignant tumor.

[0060] The present invention provides the use of the modified bacterium of the present invention in the manufacture of a medicament for inducing anti-tumor immune memory in a subject with a malignant tumor.

[0061] The present invention provides use of the modified bacterium of the present invention in the manufacture of a medicament for preventing or treating metastasis or recurrence of a malignant tumor.

[0062] The invention provides the use of the modified bacteria of the invention in the manufacture of a medicament for treating malignant tumors that are resistant to or have been unsuccessful in previous anti-tumor therapies.

[0063] In one embodiment, the modified bacterium is a viable bacterium.

[0064] In one embodiment, the malignant tumor is a malignant tumor of nervous system, respiratory system, digestive system, urinary system, reproductive system, hematopoietic system, lymphatic system, endocrine system, or mucosal skin origin. In some embodiments, the malignant tumor is a sarcoma or cancer. In one embodiment, the malignant tumor is a solid tumor. In one embodiment, the malignant tumor is selected from the group consisting of glioma, neuroblastoma, retinoblastoma, nasopharyngeal carcinoma, oral cancer, tongue cancer, laryngeal cancer, head and neck cancer, melanoma, bronchial cancer, lung cancer, pleural cancer, esophageal cancer, gastric cancer, hepatocellular carcinoma, pancreatic cancer, bile duct cancer, colorectal cancer, rectal cancer, renal cell carcinoma, bladder cancer, prostate cancer, spralenoma, thyroid cancer, parathyroid cancer, pituitary tumor, Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, cervical cancer, ovarian cancer, endometrial cancer, breast cancer, bone cancer, and osteosarcoma.

[0065] In one embodiment, the bacterium, medicament, or pharmaceutical composition of the present invention is administered by each of the following routes: intravenous, intratumoral, intramuscular, subcutaneous, intraperitoneal, transcerebral, gastrointestinal, body surface, oral mucosa, nasal, rectal, or vaginal. In one embodiment, the bacterium, medicament, or pharmaceutical composition of the present invention may be formulated in a form that is administered by each of the following routes: intravenous, intratumoral, intramuscular, subcutaneous, intraperitoneal, transcerebral, gastrointestinal, body surface, oral mucosa, nasal, rectal, or vaginal.

[0066] In one embodiment, the dosage form of the medicament or pharmaceutical composition of the invention can be, for example, in the form of a solution, emulsion, lyophilized preparation, or suspension; for oral administration the dosage form can be in the form of a tablet or capsule; for intranasal administration the dosage form can be in the form of a powder, drops, or aerosol; for administration to a body surface the dosage form can be in the form of an aqueous solution, suspension, ointment, cream, or gel; and for rectal or vaginal administration the dosage form can be a suppository, enema delivered as part of an endoscopic or colonoscopic procedure. In one embodiment, the medicament or pharmaceutical composition is formulated in the form of a solution, emulsion, lyophilized preparation, or suspension; for oral administration, the medicament or pharmaceutical composition may be formulated in the form of a tablet or capsule; for intranasal administration, the medicament or pharmaceutical composition may be formulated in the form of a powder, nasal drops, or aerosol; for body surface administration, the medicament or pharmaceutical composition may be formulated in the form of an aqueous solution, suspension, ointment, cream, or gel; for rectal or vaginal administration, the medicament or pharmaceutical composition may be formulated as a suppository, enema, delivered as part of an endoscopic or colonoscopic procedure. For methods known in the art for preparing dosage forms, see, for example, "Remington's Pharmaceutical Sciences" (20th Edition), edited by A. Gennaro (2000, Mack Publishing Company, Inc. Easton, PA).

[0067] In some embodiments, the bacteria, medicaments, or pharmaceutical compositions of the invention are capable of expressing a medicament for a period of time ranging between any two of the listed values, e.g., 1 minute to 10 minutes, 1 minute to 30 minutes, 1 minute to 1 hour, 1 minute to 2 hours, 1 minute to 4 hours, 1 minute to 12 hours, 1 minute to 18 hours, 1 minute to 1 day, 10 minutes to 30 minutes, 10 minutes to 1 hour, 10 minutes to 2 hours, 10 minutes to 4 hours, 10 minutes to 12 hours, 10 minutes to 18 hours, 10 minutes to 1 day, 30 minutes to 1 hour, 30 minutes to 2 hours, 30 minutes to 4 hours, 30 minutes to 12 hours, 30 minutes to 18 hours, 30 minutes to 1 day, 30 minutes to 2 days, 1 hour to 2 hours, 1 hour to 4 hours, 1 hour to 12 hours, 1 hour to 18 hours, 1 hour to 1 day, 4 hours to 12 hours, 4 hours to 18 hours, 4 hours to 1 day, 1 hour to 2 days, 1 hour to 3 days, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 2 hours, 3 hours The bacterium, medicament, or pharmaceutical composition may be administered at various intervals, including, but not limited to, once every week, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, or 10 days. In some embodiments, the bacterium, medicament, or pharmaceutical composition is administered once every week, once every 2 weeks, once every 3 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 15 weeks, once every 20 weeks, once every 25 weeks, or once every 26 weeks.In some embodiments, the bacteria, medicaments, or pharmaceutical compositions of the invention are capable of withstanding a range between any two of the listed values, e.g., 1 minute to 10 minutes, 1 minute to 30 minutes, 1 minute to 1 hour, 1 minute to 2 hours, 1 minute to 4 hours, 1 minute to 12 hours, 1 minute to 18 hours, 1 minute to 1 day, 10 minutes to 30 minutes, 10 minutes to 1 hour, 10 minutes to 2 hours, 10 minutes to 4 hours, 10 minutes to 12 hours, 1 0 min - 18 hrs, 10 min - 1 day, 30 min - 1 hr, 30 min - 2 hrs, 30 min - 4 hrs, 30 min - 12 hrs, 30 min - 18 hrs, 30 min - 1 day, 30 min - 2 days, 1 hr - 2 hrs, 1 hr - 4 hrs, 1 hr - 12 hrs, 1 hr - 18 hrs, 1 hr - 1 day, 4 hrs - 12 hrs, 4 hrs - 18 hrs, 4 hrs - 1 day, 1 hr - 2 days, 1 hr - 3 days, 1 hr - 4 days, 1 hour to 5 days, 1 hour to 7 days, 1 hour to 10 days, 2 hours to 3 days, 2 hours to 4 days, 2 hours to 5 days, 2 hours to 7 days, 2 hours to 10 days, or 5 days to 10 days, including 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 15 minutes, 20 minutes, 25 minutes, 30 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 5 days, 1 hour to 5 days, 1 hour to 7 days, 1 hour to 10 days, 2 hours to 3 days, 2 hours to 4 days, 2 hours to 5 days, 2 hours to 7 days, 2 hours to 10 days, or 5 days to 10 days The bacterium, medicament, or pharmaceutical composition may be formulated to be administered at various intervals, including, but not limited to, once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, once every 15 weeks, once every 20 weeks, once every 25 weeks, or once every 26 weeks. The dosing regimen may depend on the pharmacokinetic decay pattern expected to be achieved by the practitioner. The progress of therapy can be monitored by conventional techniques and assays. Dosage regimens can vary over time.

[0068] In some embodiments, the effective amount of bacteria in a medicament or pharmaceutical composition is a range between any two of the listed values, e.g., 10 4 ~10 8cfu, 10 4 ~10 9 cfu, 10 4 ~10 10 cfu, 10 4 ~10 11 cfu, 10 4 ~10 12 cfu, 10 4 ~10 12 cfu, 10 5 ~10 8 cfu, 10 5 ~10 9 cfu, 10 5 ~10 10 cfu, 10 5 ~10 11 cfu, 10 5 ~10 12 cfu, 10 5 ~10 12 cfu, 10 6 ~10 8 cfu, 10 6 ~10 9 cfu, 10 6 ~10 10 cfu, 10 6 ~10 11 cfu, 10 6 ~10 12 cfu, 10 6 ~10 12 cfu, 10 7 ~10 8 cfu, 10 7 ~10 9 cfu, 10 7 ~10 10 cfu, 10 7 ~10 11 cfu, 10 7 ~10 12 cfu, 10 7 ~10 12 cfu, 10 8 ~10 9 cfu, 10 8 ~10 10 cfu, 10 8 ~10 11 cfu, 10 8 ~10 12 cfu, or 10 8 ~10 12 cfu, etc., including at least about 104 Colony forming units (cfu), e.g., at least about 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , or 10 13 Contains cfu.

[0069] In some embodiments, the volume of an effective dose of the bacteria, medicament, or pharmaceutical composition of the invention is less than or equal to about 3 mL, about 2.5 mL, about 2 mL, about 1.5 mL, about 1 mL, about 0.75 mL, about 0.5 mL, about 0.25 mL, or about 0.1 mL. In some embodiments, the volume of an effective dose of the bacteria, medicament, or pharmaceutical composition is about 20 mL, about 19 mL, about 18 mL, about 17 mL, about 16 mL, about 15 mL, about 14 mL, about 13 mL, about 12 mL, about 11 mL, about 10 mL, about 9 mL, about 8 mL, about 7 mL, about 6 mL, about 5 mL, about 4 mL, about 3 mL, about 2 mL, or about 1 mL. Alternatively, the volume of an effective dose of the bacteria, medicament, or pharmaceutical composition is about 20.5 mL, about 19.5 mL, about 18.5 mL, about 17.5 mL, about 16.5 mL, about 15.5 mL, about 14.5 mL, about 13.5 mL, about 12.5 mL, about 11.5 mL, about 10.5 mL, about 9.5 mL, about 8.5 mL, about 7.5 mL, about 6.5 mL, about 5.5 mL, about 4.5 mL, about 3.5 mL, about 2.5 mL, about 1.5 mL, or about 0.5 mL. In some embodiments, the volume of an effective dose of the bacteria, medicament, or pharmaceutical composition is about 200 mL, about 190 mL, about 180 mL, about 170 mL, about 160 mL, about 150 mL, about 140 mL, about 130 mL, about 120 mL, about 110 mL, about 100 mL, about 90 mL, about 80 mL, about 70 mL, about 60 mL, about 50 mL, about 40 mL, or about 30 mL, as well as ranges between any two of the listed numbers, e.g., 100 mL to 110 mL, 100 mL to 120 mL, 90 mL to 120 mL, 90 mL to 130 mL. Alternatively, the volume of an effective dose of the bacteria, medicament, or pharmaceutical composition is about 205 mL, about 195 mL, about 185 mL, about 175 mL, about 165 mL, about 155 mL, about 145 mL, about 135 mL, about 125 mL, about 115 mL, about 105 mL, about 95 mL, about 85 mL, about 75 mL, about 65 mL, about 55 mL, about 45 mL, about 35 mL, or about 25 mL, as well as ranges between any two of the listed numbers, for example, 105 mL to 115 mL, 105 mL to 125 mL, 95 mL to 125 mL, 95 mL to 135 mL.Alternatively, the volume of an effective dose of the bacteria, medicament, or pharmaceutical composition is about 900 microliters, about 800 microliters, about 700 microliters, about 600 microliters, about 500 microliters, about 400 microliters, about 300 microliters, about 200 microliters, or about 100 microliters, optionally about 950 microliters, about 850 microliters, about 750 microliters, about 650 microliters, about 550 microliters, about 450 microliters, about 350 microliters, about 250 microliters, about 150 microliters, or about 50 microliters. In some embodiments, the volume of an effective dose of the bacteria, medicament, or pharmaceutical composition is less than or equal to about 2.0 mL.

[0070] For example, the concentration of the bacteria of the present invention in a medicament or pharmaceutical composition can range between any two of the listed values, e.g., 10 3 ~10 8 cfu / mL, 10 3 ~10 9 cfu / mL, 10 3 ~10 10 cfu / mL, 10 3 ~10 11 cfu / mL, 10 3 ~10 12 cfu / mL, 10 3 ~10 13 cfu / mL, 10 4 ~10 8 cfu / mL, 10 4 ~10 9 cfu / mL, 10 4 ~10 10 cfu / mL, 10 4 ~10 11 cfu / mL, 10 4 ~10 12 cfu / mL, 10 4 ~10 13 cfu / mL, 10 5 ~10 8 cfu / mL, 10 5 ~10 9 cfu / mL, 10 5 ~10 10cfu / mL, 10 5 ~10 11 cfu / mL, 10 5 ~10 12 cfu / mL, 10 5 ~10 13 cfu / mL, 10 6 ~10 8 cfu / mL, 10 6 ~10 9 cfu / mL, 10 6 ~10 10 cfu / mL, 10 6 ~10 11 cfu / mL, 10 6 ~10 12 cfu / mL, 10 6 ~10 13 cfu / mL, 10 7 ~10 8 cfu / mL, 10 7 ~10 9 cfu / mL, 10 7 ~10 10 cfu / mL, 10 7 ~10 11 cfu / mL, 10 7 ~10 12 cfu / mL, 10 7 ~10 13 cfu / mL, 10 8 ~10 9 cfu / mL, 10 8 ~10 10 cfu / mL, 10 8 ~10 11 cfu / mL, 10 8 ~10 12 cfu / mL, or 10 8 ~10 13 cfu / mL containing at least about 10 3 、10 4 、10 5 、10 6 、10 7 、10 8 、10 9 、10 10 、10 11 、10 12 、or 10 13For example, the concentration of the bacteria of the present invention in a medicament or pharmaceutical composition can be in the range between any two of the listed values, for example 10 3 ~10 8 cfu / g, 10 3 ~10 9 cfu / g, 10 3 ~10 10 cfu / g, 10 3 ~10 11 cfu / g, 10 3 ~10 12 cfu / g, 10 3 ~10 13 cfu / g, 10 4 ~10 8 cfu / g, 10 4 ~10 9 cfu / g, 10 4 ~10 10 cfu / g, 10 4 ~10 11 cfu / g, 10 4 ~10 12 cfu / g, 10 4 ~10 13 cfu / g, 10 5 ~10 8 cfu / g, 10 5 ~10 9 cfu / g, 10 5 ~10 10 cfu / g, 10 5 ~10 11 cfu / g, 10 5 ~10 12 cfu / g, 10 5 ~10 13 cfu / g, 10 6 ~10 8 cfu / g, 10 6 ~10 9 cfu / g, 10 6 ~10 10 cfu / g, 10 6 ~10 11 cfu / g, 10 6 ~10 12 cfu / g, 10 6 ~10 13 cfu / g, 10 7 ~10 8 cfu / g, 107 ~10 9 cfu / g, 10 7 ~10 10 cfu / g, 10 7 ~10 11 cfu / g, 10 7 ~10 12 cfu / g, 10 7 ~10 13 cfu / g, 10 8 ~10 9 cfu / g, 10 8 ~10 10 cfu / g, 10 8 ~10 11 cfu / g, 10 8 ~10 12 cfu / g, or 10 8 ~10 13 At least about 10 cfu / g 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , or 10 13 cfu / g.

[0071] The dosage ranges described herein are merely exemplary and do not limit the dosage range that may be selected by a physician. The amount of active compound (e.g., the bacterium of the present invention) in the pharmaceutical composition of the present invention may vary based on several factors, such as disease state, age, sex, and individual weight, including the presence or absence of malignancy, the type and severity of the malignancy being treated, the activity or viability of the bacterium, medicament, or pharmaceutical composition, the route of administration, the duration of treatment, the medicament used in combination with the bacterium, medicament, or pharmaceutical composition, if any, the dietary habits and general health of the subject, and similar factors well known in the art. The dosage regimen may be adjusted to achieve an optimal therapeutic response. For example, a single dose may be administered, or several divided doses may be administered chronically, or the dose may be proportionally increased or decreased as indicated by the exigencies of the therapeutic situation.

[0072] The bacteria, medicaments, or pharmaceutical compositions of the invention may be manufactured by methods well known in the art, such as, inter alia, growing the microorganisms in a fermenter followed by concentration and washing by centrifugation, filtration or dialysis, conventional granulation, mixing, dissolving, encapsulation, freeze drying, or emulsification processes. The bacteria, medicaments, or pharmaceutical compositions of the invention may be manufactured in a variety of forms, including granules, precipitates, or particulates, powders, including lyophilized, rotary dried, or spray dried powders, amorphous powders, injectables, emulsions, elixirs, suspensions, or solutions. The formulations may optionally contain stabilizers, pH modifiers, surfactants, bioavailability modifiers, and combinations thereof.

[0073] In one embodiment, the bacteria, medicament, or pharmaceutical composition of the present invention may be administered alone or in combination with other compounds or compositions in the presence of a carrier. In one embodiment, the bacteria, medicament, or pharmaceutical composition may be administered in combination with other malignant tumor therapies, including but not limited to radiation therapy, chemotherapy, and surgery. The bacteria, medicament, or pharmaceutical composition may be used as an adjuvant in such therapy. Thus, another aspect of the embodiment relates to the bacteria, medicament, or pharmaceutical composition for use as an adjuvant in malignant tumor therapies selected from radiation therapy and chemotherapy.

[0074] Exemplary embodiments Embodiment A Embodiment A1: A modified bacterium, wherein the bacterium comprises a hypoxia-regulated essential gene expression cassette comprising an essential bacterial gene under the control of an obligate hypoxia-inducible promoter, and wherein the bacterium is deficient in at least one gene or its functional expression product involved in or regulating an endogenous antioxidant stress response pathway compared to an unmodified starting strain.

[0075] Embodiment A2: The modified bacterium of embodiment A1, wherein the obligate hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.

[0076] Embodiment A3: The modified bacterium of embodiment A1, wherein the obligate hypoxia-inducible promoter is the ssbp1 promoter.

[0077] Embodiment A4: The modified bacterium of any one of the preceding embodiments A, wherein the expression product of the essential gene is involved in the synthesis of 2,6-diaminopimelic acid (DAP) in the bacterium and, when cultured under aerobic conditions, the growth of the bacterium is dependent on additional DAP or an analog thereof being added to the medium.

[0078] Embodiment A5: The modified bacterium of embodiment A4, wherein the essential genes are selected from dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.

[0079] Embodiment A6: The modified bacterium according to embodiment A4, wherein the essential genes are selected from dapA and dapE.

[0080] Embodiment A7: The modified bacterium of any one of the preceding embodiments A, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is an HtrA serine protease family gene.

[0081] Embodiment A8: The modified bacterium of any one of the preceding embodiments A, wherein the functional expression product of a gene involved in or regulating an endogenous antioxidant stress response pathway is a protein related to the HtrA serine protease family.

[0082] Embodiment A9: The modified bacterium of any one of the preceding embodiments A, wherein the bacterium is defective in activity of HtrA serine protease.

[0083] Embodiment A10: The modified bacterium of any one of the preceding embodiments A, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is htrA.

[0084] Embodiment A11: The modified bacterium of any one of the preceding embodiments A, wherein the bacterium is defective with respect to htrA.

[0085] Embodiment A12: The modified bacterium according to any one of embodiments A1 to A11, wherein the essential gene is a gene naturally occurring in the bacterial chromosome and the native promoter of the essential gene is functionally replaced with an obligate hypoxia-inducible promoter, whereby expression of the essential gene in the bacterium is entirely under the control of the obligate hypoxia-inducible promoter.

[0086] Embodiment A13: The modified bacterium according to any one of embodiments A1 to A11, wherein the essential gene expression cassette is exogenous and an essential gene naturally occurring in the bacterial chromosome has been deleted or functionally inactivated, whereby expression of the essential gene in the bacterium is entirely under the control of an obligate hypoxia-inducible promoter.

[0087] Embodiment A14: A modified bacterium according to embodiment A13, wherein the exogenous essential gene expression cassette is integrated into the bacterial chromosome.

[0088] Embodiment A15: A modified bacterium according to embodiment A13, wherein the exogenous essential gene expression cassette is outside the bacterial chromosome.

[0089] Embodiment A16: A modified bacterium according to embodiment A15, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium.

[0090] Embodiment A17: The modified bacterium of any one of the preceding embodiments A, further comprising a pH-regulated expression cassette, the pH-regulated expression cassette comprising a gene encoding a bacterial hemolysin protein under the control of a promoter that is active under acidic pH conditions.

[0091] Embodiment A18: The modified bacterium according to embodiment A17, wherein the hemolysin protein of bacterial origin is a hemolysin protein of a gram-negative bacterium.

[0092] Embodiment A19: The modified bacterium according to embodiment A18, wherein the gene encoding a hemolysin protein of a Gram-negative bacterium is hlyA or hlyE.

[0093] Embodiment A20: The modified bacterium of embodiment A19, wherein hlyA or hlyE is derived from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.

[0094] Embodiment A21: A modified bacterium according to any one of embodiments A17 to A20, wherein the promoter active under acidic pH conditions is active at a pH lower than 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6, or 5.5.

[0095] Embodiment A22: The modified bacterium according to any one of embodiments A17 to A21, wherein the promoter that is active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.

[0096] Embodiment A23: The modified bacterium according to any one of embodiments A17 to A21, wherein the promoter that is active under acidic pH conditions is sseA.

[0097] Embodiment A24: The modified bacterium of any one of the preceding embodiments A, wherein the unmodified starting strain is a facultative anaerobic bacterium.

[0098] Embodiment A25: The modified bacterium of any one of the preceding embodiments A, wherein the bacterium is a bacterium of the family Enterobacteriaceae.

[0099] Embodiment A26: The modified bacterium of any one of the preceding embodiments A, wherein the bacterium is a bacterium of the genera Escherichia, Salmonella, Shigella, Klebsiella, Yersinia, Citrobacter, Enterobacter, Serratia, Proteus, Morganella, Providencia, Hafnia, and Pantoea.

[0100] Embodiment A27: The bacterium is selected from the group consisting of Escherichia coli, Enterobacter buratae, Enterobacter fergussonii, Enterobacter hermannii, Enterobacter valneris, Salmonella enterica, Salmonella bongori, Salmonella typhi, Salmonella choleraesuis, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella boydii, Shigella zonei, Klebsiella pneumoniae, Klebsiella oxytoca, Yersinia pestis, Yersinia enterocolitica, Yersinia pseudotuberculosis, Yersinia aldovae. , Yersinia bercovellii, Yersinia fredericsenii, Yersinia intermedia, Yersinia cristelloniai, Yersinia molarettii, Yersinia rhodei, Yersinia ruckeri, Citrobacter freundii, Citrobacter koseri, Citrobacter braachii, Enterobacter aerogenes, Enterobacter cloacae, Enterobacter gergoviae, Enterobacter sakazakii, Enterobacter tyrolae, Enterobacter amniogenes (Enterobacter intermedius, Enterobacter asbriae, Enterobacter cancellogenus, Enterobacter dissolvens, Enterobacter nimipressularis, Serratia marcescens, Serratia entomophila, Serratia ficaria, Serratia fonticola, Serratia grimecii, Serratia liquefaciens, Serratia odorifera, Serratia primutica, Serratia proteamaculans, Serratia rubidaea, Serratia ureilistica , Proteus mirabilis, Proteus vulgaris, Proteus mixophaga, Proteus pennelli, Proteus hauseri, Morganella morganii, Providencia alcalifaciens, Providencia rustigianii, Providencia stuartii, Providencia rettgeri, Providencia heimbaccae, Hafnia alvei, and Pantoea agglomerans.

[0101] Embodiment A28: The modified bacterium of any one of the preceding embodiments A, wherein the bacterium is a Salmonella typhimurium bacterium.

[0102] Embodiment A29: The modified bacterium according to embodiment A28, wherein the starting strain is Salmonella typhimurium SL7207.

[0103] Embodiment A30: The modified bacterium of any one of the preceding embodiments A, wherein the bacterium expresses wild-type lipopolysaccharide (LPS).

[0104] Embodiment A31: The modified bacterium of any one of the preceding embodiments A, wherein the bacterium, when administered to a subject having a tumor, has the ability to survive and grow in tumor tissue and is rapidly eliminated in normal tissue.

[0105] Embodiment A32: The modified bacterium of any one of the preceding embodiments A, wherein the bacterium has the ability to inhibit the growth of a malignant tumor when administered to a subject having a malignant tumor.

[0106] Embodiment A33: The modified bacterium of any one of the preceding embodiments A, wherein the bacterium has the ability to induce an anti-tumor specific immune response when administered to a subject having a malignant tumor.

[0107] Embodiment A34: The modified bacterium of any one of the preceding embodiments A, wherein the bacterium has the ability to induce anti-tumor immune memory when administered to a subject having a malignant tumor.

[0108] Embodiment A35: The modified bacterium of any one of the preceding embodiments A, which does not express wild-type flagellin.

[0109] Embodiment A36: A modified bacterium of any one of the preceding embodiments A, which is defective in the fliC gene.

[0110] Embodiment A37: The modified bacterium of any one of the preceding embodiments A, wherein the survival level of the bacterium within the macrophage ranges from about 50% to about 30% of the survival level of the unmodified starting strain.

[0111] Embodiment A38: The modified bacterium according to any one of embodiments A1 to A36, wherein the survival level of the bacterium within the macrophage is in the range of about 30% to about 10% of the survival level of the unmodified starting strain.

[0112] Embodiment A39: The modified bacterium according to any one of embodiments A1 to A36, wherein the survival level of the bacterium within the macrophage is in the range of about 10% to about 1% of the survival level of the unmodified starting strain.

[0113] Embodiment B Embodiment B1: A modified bacterium, wherein the bacterium comprises a hypoxia-regulated essential gene expression cassette comprising an essential bacterial gene under the control of an obligate hypoxia-inducible promoter and a pH-regulated expression cassette comprising a gene encoding a hemolysin protein from the bacterium under the control of a promoter that is active under acidic pH conditions, and wherein the bacterium is deficient in at least one gene or its functional expression product involved in or regulating an endogenous antioxidant stress response pathway compared to the unmodified starting strain.

[0114] Embodiment B2: The modified bacterium of embodiment B1, wherein the obligate hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.

[0115] Embodiment B3: The modified bacterium of embodiment B1, wherein the obligate hypoxia-inducible promoter is the ssbp1 promoter.

[0116] Embodiment B4: The modified bacterium of any one of the preceding embodiments B, wherein the expression product of the essential gene is involved in the synthesis of 2,6-diaminopimelic acid (DAP) in the bacterium and, when cultured under aerobic conditions, the growth of the bacterium is dependent on additional DAP or an analog thereof being added to the medium.

[0117] Embodiment B5: The modified bacterium of embodiment B4, wherein the essential genes are selected from dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.

[0118] Embodiment B6: The modified bacterium according to embodiment B4, wherein the essential genes are selected from dapA and dapE.

[0119] Embodiment B7: The modified bacterium of any one of the preceding embodiments B, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is a HtrA serine protease family gene.

[0120] Embodiment B8: The modified bacterium of any one of the preceding embodiments A, wherein the functional expression product of a gene involved in or regulating an endogenous antioxidant stress response pathway is a protein related to the HtrA serine protease family.

[0121] Embodiment B9: The modified bacterium of any one of the preceding embodiments B, wherein the bacterium is defective in activity of HtrA serine protease.

[0122] Embodiment B10: The modified bacterium of any one of the preceding embodiments B, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is htrA.

[0123] Embodiment B11: The modified bacterium of any one of the preceding embodiments B, wherein the bacterium is defective with respect to htrA.

[0124] Embodiment B12: The modified bacterium according to any one of embodiments B1 to B11, wherein the essential gene is a gene naturally occurring in the bacterial chromosome and the native promoter of the essential gene is functionally replaced with an obligate hypoxia-inducible promoter, whereby expression of the essential gene in the bacterium is entirely under the control of the obligate hypoxia-inducible promoter.

[0125] Embodiment B13: The modified bacterium according to any one of embodiments B1 to B11, wherein the essential gene expression cassette is exogenous and an essential gene naturally occurring in the bacterial chromosome has been deleted or functionally inactivated, whereby expression of the essential gene in the bacterium is entirely under the control of an obligate hypoxia-inducible promoter.

[0126] Embodiment B14: A modified bacterium according to embodiment B13, wherein the exogenous essential gene expression cassette is integrated into the bacterial chromosome.

[0127] Embodiment B15: A modified bacterium according to embodiment B13, wherein the exogenous essential gene expression cassette is outside the bacterial chromosome.

[0128] Embodiment B16: A modified bacterium according to embodiment B15, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium.

[0129] Embodiment B17: The modified bacterium of any one of the preceding embodiments B, wherein the bacterially derived hemolysin protein is a gram-negative bacterial hemolysin protein.

[0130] Embodiment B18: The modified bacterium according to embodiment B17, wherein the gene encoding a hemolysin protein of a Gram-negative bacterium is hlyA or hlyE.

[0131] Embodiment B19: The modified bacterium of embodiment B18, wherein hlyA or hlyE is derived from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.

[0132] Embodiment B20: The modified bacterium of any one of the preceding embodiments B, wherein the promoter that is active under acidic pH conditions is active at a pH lower than 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6, or 5.5.

[0133] Embodiment B21: The modified bacterium of any one of the preceding embodiments B, wherein the promoter that is active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.

[0134] Embodiment B22: The modified bacterium of any one of the preceding embodiments B, wherein the promoter that is active under acidic pH conditions is sseA.

[0135] Embodiment B23: The modified bacterium of any one of the preceding embodiments B, wherein the unmodified starting strain is a facultative anaerobic bacterium.

[0136] Embodiment B24: The modified bacterium of any one of the preceding embodiments B, wherein the bacterium is a bacterium of the family Enterobacteriaceae.

[0137] Embodiment B25: The modified bacterium of any one of embodiments B, wherein the bacterium is a bacterium of the genera Escherichia, Salmonella, Shigella, Klebsiella, Yersinia, Citrobacter, Enterobacter, Serratia, Proteus, Morganella, Providencia, Hafnia, and Pantoea.

[0138] Embodiment B26: The bacterium is selected from the group consisting of Escherichia coli, Enterobacter buratae, Enterobacter fergussonii, Enterobacter hermannii, Enterobacter vulneris, Salmonella enterica, Salmonella bongori, Salmonella typhi, Salmonella choleraesuis, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella boydii, Shigella zonei, Klebsiella pneumoniae, Klebsiella oxytoca, Yersinia pestis, Yersinia enterocolitica, Yersinia pseudotuberculosis, Yersinia aldova. E, Yersinia bercovellii, Yersinia fredericsenii, Yersinia intermedia, Yersinia cristelloniai, Yersinia molarettii, Yersinia rhodei, Yersinia ruckeri, Citrobacter freundii, Citrobacter koseri, Citrobacter braachii, Enterobacter aerogenes, Enterobacter cloacae, Enterobacter gergoviae, Enterobacter sakazakii, Enterobacter tyrolae, Enterobacter amnii genus, Enterobacter intermedius, Enterobacter asbriae, Enterobacter cancellogenus, Enterobacter dissolvens, Enterobacter nimipressularis, Serratia marcescens, Serratia entomophila, Serratia ficaria, Serratia fonticola, Serratia grimecii, Serratia liquefaciens, Serratia odorifera, Serratia primutica, Serratia proteamaculans, Serratia rubidaea, Serratia urei The modified bacterium of any one of embodiments B, wherein the bacterium is selected from the group consisting of Proteus lytica, Proteus mirabilis, Proteus vulgaris, Proteus mixophagaciens, Proteus pennellii, Proteus hauseri, Morganella morganii, Providencia alcalifaciens, Providencia rustigianii, Providencia stuartii, Providencia rettgeri, Providencia heimbaccae, Hafnia alvei, and Pantoea agglomerans.

[0139] Embodiment B27: The modified bacterium of any one of the preceding embodiments B, wherein the bacterium is a Salmonella typhimurium bacterium.

[0140] Embodiment B28: The modified bacterium according to embodiment B27, wherein the starting strain is Salmonella typhimurium SL7207.

[0141] Embodiment B29: The modified bacterium of any one of the preceding embodiments B, wherein the bacterium expresses wild-type lipopolysaccharide (LPS).

[0142] Embodiment B30: The modified bacterium of any one of the preceding embodiments B, wherein the bacterium, when administered to a subject having a tumor, has the ability to survive and grow in tumor tissue and is rapidly eliminated in normal tissue.

[0143] Embodiment B31: The modified bacterium of any one of the preceding embodiments B, wherein the bacterium has the ability to inhibit the growth of a malignant tumor when administered to a subject having a malignant tumor.

[0144] Embodiment B32: The modified bacterium of any one of the preceding embodiments B, wherein the bacterium has the ability to induce an anti-tumor specific immune response when administered to a subject having a malignant tumor.

[0145] Embodiment B33: The modified bacterium of any one of the preceding embodiments B, wherein the bacterium has the ability to induce anti-tumor immune memory when administered to a subject with a malignant tumor.

[0146] Embodiment B34: The modified bacterium of any one of the preceding embodiments A, which does not express wild-type flagellin.

[0147] Embodiment B35: The modified bacterium of any one of the preceding embodiments B, which is defective in the fliC gene.

[0148] Embodiment B36: The modified bacterium of any one of the preceding embodiments B, wherein the survival level of the bacterium within the macrophage ranges from about 50% to about 30% of the survival level of the unmodified starting strain.

[0149] Embodiment B37: The modified bacterium according to any one of embodiments B1 to B35, wherein the survival level of the bacterium within the macrophage is in the range of about 30% to about 10% of the survival level of the unmodified starting strain.

[0150] Embodiment B38: The modified bacterium according to any one of embodiments B1 to B35, wherein the survival level of the bacterium within the macrophage is in the range of about 10% to about 1% of the survival level of the unmodified starting strain.

[0151] Embodiment C Embodiment C1: A modified bacterium of Salmonella typhimurium, wherein the bacterium comprises a hypoxia-regulated essential gene expression cassette comprising an essential gene of the bacterium under the control of an obligate hypoxia-inducible promoter and a pH-regulated expression cassette comprising a gene encoding a hemolysin protein from the bacterium under the control of a promoter that is active under acidic pH conditions, and wherein the bacterium is deficient in at least one gene or its functional expression product involved in or regulating an endogenous antioxidant stress response pathway compared to the unmodified starting strain.

[0152] Embodiment C2: The modified bacterium of embodiment C1, wherein the obligate hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.

[0153] Embodiment C3: The modified bacterium of embodiment C1, wherein the obligate hypoxia-inducible promoter is the ssbp1 promoter.

[0154] Embodiment C4: The modified bacterium of any one of the preceding embodiments C, wherein the expression product of the essential gene is involved in the synthesis of 2,6-diaminopimelic acid (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on additional DAP or an analog thereof being added to the medium.

[0155] Embodiment C5: The modified bacterium of embodiment C4, wherein the essential genes are selected from dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.

[0156] Embodiment C6: The modified bacterium of embodiment C4, wherein the essential genes are selected from dapA and dapE.

[0157] Embodiment C7: The modified bacterium of any one of the preceding embodiments C, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is an HtrA serine protease family gene.

[0158] Embodiment C8: The modified bacterium of any one of the preceding embodiments C, wherein the functional expression product of a gene involved in or regulating an endogenous antioxidant stress response pathway is a protein related to the HtrA serine protease family.

[0159] Embodiment C9: The modified bacterium of any one of the preceding embodiments C, wherein the bacterium is defective in the activity of HtrA serine protease.

[0160] Embodiment C10: The modified bacterium of any one of the preceding embodiments C, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is htrA.

[0161] Embodiment C11: The modified bacterium of any one of the preceding embodiments C, wherein the bacterium is defective with respect to htrA.

[0162] Embodiment C12: A modified bacterium according to any one of embodiments C1 to C11, wherein the essential gene is a gene naturally occurring in the bacterial chromosome and the native promoter of the essential gene is functionally replaced with an obligate hypoxia-inducible promoter, whereby expression of the essential gene in the bacterium is entirely under the control of the obligate hypoxia-inducible promoter.

[0163] Embodiment C13: The modified bacterium according to any one of embodiments C1 to C11, wherein the essential gene expression cassette is exogenous and an essential gene naturally occurring in the bacterial chromosome has been deleted or functionally inactivated, whereby expression of the essential gene in the bacterium is entirely under the control of an obligate hypoxia-inducible promoter.

[0164] Embodiment C14: A modified bacterium according to embodiment C13, wherein the exogenous essential gene expression cassette is integrated into the bacterial chromosome.

[0165] Embodiment C15: The modified bacterium of embodiment C13, wherein the exogenous essential gene expression cassette is outside the bacterial chromosome.

[0166] Embodiment C16: A modified bacterium according to embodiment C15, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium.

[0167] Embodiment C17: The modified bacterium of any one of the preceding embodiments C, wherein the bacterially derived hemolysin protein is a hemolysin protein of a Gram-negative bacterium.

[0168] Embodiment C18: The modified bacterium according to embodiment C17, wherein the gene encoding a hemolysin protein of a Gram-negative bacterium is hlyA or hlyE.

[0169] Embodiment C19: The modified bacterium of embodiment C18, wherein hlyA or hlyE is derived from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.

[0170] Embodiment C20: The modified bacterium of any one of the preceding embodiments C, wherein the promoter that is active under acidic pH conditions is active at a pH lower than 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6, or 5.5.

[0171] Embodiment C21: The modified bacterium of any one of the preceding embodiments C, wherein the promoter that is active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.

[0172] Embodiment C22: The modified bacterium of any one of the preceding embodiments C, wherein the promoter that is active under acidic pH conditions is sseA.

[0173] Embodiment C23: The modified bacterium of any one of the preceding embodiments C, wherein the unmodified starting strain is a facultative anaerobic bacterium.

[0174] Embodiment C24: The modified bacterium of any one of the preceding embodiments C, wherein the starting strain is Salmonella typhimurium SL7207.

[0175] Embodiment C25: The modified bacterium of any one of embodiments C1 to C24, wherein the bacterium expresses wild-type lipopolysaccharide (LPS).

[0176] Embodiment C26: The modified bacterium of any one of the preceding embodiments C, wherein the bacterium, when administered to a subject having a tumor, has the ability to survive and grow in tumor tissue but is rapidly eliminated in normal tissue.

[0177] Embodiment C27: The modified bacterium of any one of the preceding embodiments C, wherein the bacterium has the ability to inhibit the growth of a malignant tumor when administered to a subject having a malignant tumor.

[0178] Embodiment C28: The modified bacterium of any one of the preceding embodiments C, wherein the bacterium has the ability to induce an anti-tumor specific immune response when administered to a subject having a malignant tumor.

[0179] Embodiment C29: The modified bacterium of any one of the preceding embodiments C, wherein the bacterium has the ability to induce anti-tumor immune memory when administered to a subject having a malignant tumor.

[0180] Embodiment C30: The modified bacterium of any one of the preceding embodiments C, which does not express wild-type flagellin.

[0181] Embodiment C31: A modified bacterium of any one of the preceding embodiments C, which is defective in the fliC gene.

[0182] Embodiment C32: The modified bacterium of any one of the preceding embodiments C, wherein the survival level of the bacterium within the macrophage ranges from about 50% to about 30% of the survival level of the unmodified starting strain.

[0183] Embodiment C33: A modified bacterium according to any one of embodiments C1 to C31, wherein the survival level of the bacterium within the macrophage is in the range of about 30% to about 10% of the survival level of the unmodified starting strain.

[0184] Embodiment C34: A modified bacterium according to any one of embodiments C1 to C31, wherein the survival level of the bacterium within the macrophage is in the range of about 10% to about 1% of the survival level of the unmodified starting strain.

[0185] Embodiment D Embodiment D1: A modified bacterium, wherein the bacterium comprises a hypoxia regulated essential gene expression cassette comprising an essential bacterial gene under the control of an obligate hypoxia inducible promoter, and wherein the bacterium is deficient in at least one gene or its functional expression product required for survival in macrophages compared to an unmodified starting strain.

[0186] Embodiment D2: The modified bacterium of embodiment D1, wherein the obligate hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.

[0187] Embodiment D3: The modified bacterium of embodiment D1, wherein the obligate hypoxia-inducible promoter is the ssbp1 promoter.

[0188] Embodiment D4: The modified bacterium of any one of the preceding embodiments D, wherein the expression product of the essential gene is involved in the synthesis of 2,6-diaminopimelic acid (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on additional DAP or an analog thereof being added to the medium.

[0189] Embodiment D5: The modified bacterium of embodiment D4, wherein the essential genes are selected from dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.

[0190] Embodiment D6: The modified bacterium according to embodiment D4, wherein the essential genes are selected from dapA and dapE.

[0191] Embodiment D7: The modified bacterium of any one of the preceding embodiments D, wherein the gene required for survival in macrophages is an STM3120, STM3119, slyA, sifA, SPI-2, phoP, or htrA gene.

[0192] Embodiment D8: The modified bacterium of any one of the preceding embodiments D, wherein the functional expression product of the gene required for survival in macrophages is a protein related to the HtrA serine protease family.

[0193] Embodiment D9: The modified bacterium of any one of the preceding embodiments D, wherein the bacterium is defective in activity of HtrA serine protease.

[0194] Embodiment D10: The modified bacterium of any one of the preceding embodiments D, wherein the gene required for survival in macrophages is htrA.

[0195] Embodiment D11: The modified bacterium of any one of the preceding embodiments D, wherein the bacterium is defective with respect to htrA.

[0196] Embodiment D12: A modified bacterium according to any one of embodiments D1 to D11, wherein the essential gene is a gene naturally occurring in the bacterial chromosome and the native promoter of the essential gene is functionally replaced with an obligate hypoxia-inducible promoter, whereby expression of the essential gene in the bacterium is entirely under the control of the obligate hypoxia-inducible promoter.

[0197] Embodiment D13: The modified bacterium according to any one of embodiments D1 to D11, wherein the essential gene expression cassette is exogenous and an essential gene naturally occurring in the bacterial chromosome has been deleted or functionally inactivated, whereby expression of the essential gene in the bacterium is entirely under the control of an obligate hypoxia-inducible promoter.

[0198] Embodiment D14: A modified bacterium according to embodiment D13, wherein the exogenous essential gene expression cassette is integrated into the bacterial chromosome.

[0199] Embodiment D15: A modified bacterium according to embodiment D13, wherein the exogenous essential gene expression cassette is outside the bacterial chromosome.

[0200] Embodiment D16: A modified bacterium according to embodiment D15, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium.

[0201] Embodiment D17: The modified bacterium of any one of the preceding embodiments D, further comprising a pH-regulated expression cassette, the pH-regulated expression cassette comprising a gene encoding a bacterial hemolysin protein under the control of a promoter that is active under acidic pH conditions.

[0202] Embodiment D18: The modified bacterium according to embodiment D17, wherein the hemolysin protein of bacterial origin is a hemolysin protein of a gram-negative bacterium.

[0203] Embodiment D19: The modified bacterium according to embodiment D18, wherein the gene encoding a hemolysin protein of a Gram-negative bacterium is hlyA or hlyE.

[0204] Embodiment D20: The modified bacterium of embodiment D19, wherein hlyA or hlyE is derived from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.

[0205] Embodiment D21: A modified bacterium according to any one of embodiments D17 to D20, wherein the promoter active under acidic pH conditions is active at a pH lower than 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6, or 5.5.

[0206] Embodiment D22: The modified bacterium of any one of embodiments D17 to D21, wherein the promoter active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.

[0207] Embodiment D23: The modified bacterium of any one of embodiments D17 to D21, wherein the promoter that is active under acidic pH conditions is sseA.

[0208] Embodiment D24: The modified bacterium of any one of the preceding embodiments D, wherein the unmodified starting strain is a facultative anaerobic bacterium.

[0209] Embodiment D25: The modified bacterium of any one of the preceding embodiments D, wherein the bacterium is a bacterium of the family Enterobacteriaceae.

[0210] Embodiment D26: The modified bacterium of any one of the preceding embodiments D, wherein the bacterium is a bacterium of the genera Escherichia, Salmonella, Shigella, Klebsiella, Yersinia, Citrobacter, Enterobacter, Serratia, Proteus, Morganella, Providencia, Hafnia, and Pantoea.

[0211] Embodiment D27: The bacterium is selected from the group consisting of Escherichia coli, Enterobacter buratae, Enterobacter fergussonii, Enterobacter hermannii, Enterobacter valneris, Salmonella enterica, Salmonella bongori, Salmonella typhi, Salmonella choleraesuis, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella boydii, Shigella zonei, Klebsiella pneumoniae, Klebsiella oxytoca, Yersinia pestis, Yersinia enterocolitica, Yersinia pseudotuberculosis, Yersinia ardovae (Yersinia pestis), Yersinia pestis, Yersinia ardovae (Yersinia ardovae), Yersinia pestis, Yersinia ardovae (Yersinia ardovae), Yersinia versicolor (Yersinia versicolor ... Nia Bercovieri, Yersinia fredericsenii, Yersinia intermedia, Yersinia cristelloniai, Yersinia molerretti, Yersinia rhodei, Yersinia ruckeri, Citrobacter freundii, Citrobacter koseri, Citrobacter braachii, Enterobacter aerogenes, Enterobacter cloacae, Enterobacter gergoviae, Enterobacter sakazakii, Enterobacter tyrolae, Enterobacter amnigenus, Enterobacter Serratia intermedius, Enterobacter asbriae, Enterobacter cancellogenus, Enterobacter dissolvens, Enterobacter nimipress ularis, Serratia marcescens, Serratia entomophila, Serratia ficaria, Serratia fonticola, Serratia grimecii, Serratia liquefaciens, Serratia odorifera, Serratia primutica, Serratia proteamaculans, Serratia rubidaea, Serratia ureilichia, Proteus mirabilis The modified bacterium of any one of the preceding embodiments, wherein the bacterium is selected from the group consisting of Proteus vulgaris, Proteus mixophaga, Proteus pennelli, Proteus hauseri, Morganella morganii, Providencia alcalifaciens, Providencia rustigianii, Providencia stuartii, Providencia rettgeri, Providencia heimbaccae, Hafnia alvei, and Pantoea agglomerans.

[0212] Embodiment D28: The modified bacterium of any one of the preceding embodiments D, wherein the bacterium is a Salmonella typhimurium bacterium.

[0213] Embodiment D29: The modified bacterium according to embodiment D28, wherein the starting strain is Salmonella typhimurium SL7207.

[0214] Embodiment D30: The modified bacterium of any one of the preceding embodiments D, wherein the bacterium expresses wild-type lipopolysaccharide (LPS).

[0215] Embodiment D31: A modified bacterium of any one of the preceding embodiments D, wherein the bacterium, when administered to a subject having a tumor, has the ability to survive and grow in tumor tissue and is rapidly eliminated in normal tissue.

[0216] Embodiment D32: The modified bacterium of any one of the preceding embodiments D, wherein the bacterium has the ability to inhibit the growth of a malignant tumor when administered to a subject having a malignant tumor.

[0217] Embodiment D33: The modified bacterium of any one of the preceding embodiments D, wherein the bacterium has the ability to induce an anti-tumor specific immune response when administered to a subject having a malignant tumor.

[0218] Embodiment D34: The modified bacterium of any one of the preceding embodiments D, wherein the bacterium has the ability to induce anti-tumor immune memory when administered to a subject having a malignant tumor.

[0219] Embodiment D35: The modified bacterium of any one of the preceding embodiments D, which does not express wild-type flagellin.

[0220] Embodiment D36: The modified bacterium of any one of the preceding embodiments D, wherein the bacterium is defective in the fliC gene.

[0221] Embodiment D37: The modified bacterium of any one of the preceding embodiments D, wherein the survival level of the bacterium within the macrophage ranges from about 50% to about 30% of the survival level of the unmodified starting strain.

[0222] Embodiment D38: A modified bacterium according to any one of embodiments D1 to D36, wherein the survival level of the bacterium within the macrophage is in the range of about 30% to about 10% of the survival level of the unmodified starting strain.

[0223] Embodiment D39: A modified bacterium according to any one of embodiments D1 to D36, wherein the survival level of the bacterium within the macrophage is in the range of about 10% to about 1% of the survival level of the unmodified starting strain.

[0224] Embodiment E Embodiment E1: A modified bacterium, wherein the bacterium comprises a hypoxia-regulated essential gene expression cassette comprising an essential bacterial gene under the control of an obligate hypoxia-inducible promoter and a pH-regulated expression cassette comprising a gene encoding a hemolysin protein from the bacterium under the control of a promoter that is active under acidic pH conditions, wherein the bacterium expresses wild-type lipopolysaccharide (LPS) and is deficient in at least one gene or its functional expression product required for survival in macrophages compared to an unmodified starting strain.

[0225] Embodiment E2: The modified bacterium of embodiment E1, wherein the obligate hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.

[0226] Embodiment E3: The modified bacterium of embodiment E1, wherein the obligate hypoxia-inducible promoter is the ssbp1 promoter.

[0227] Embodiment E4: The modified bacterium of any one of the preceding embodiments E, wherein the expression product of the essential gene is involved in the synthesis of 2,6-diaminopimelic acid (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on additional DAP or an analog thereof being added to the medium.

[0228] Embodiment E5: The modified bacterium of embodiment E4, wherein the essential genes are selected from dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.

[0229] Embodiment E6: The modified bacterium of embodiment E4, wherein the essential genes are selected from dapA and dapE.

[0230] Embodiment E7: The modified bacterium of any one of the preceding embodiments E, wherein the gene required for survival in macrophages is an STM3120, STM3119, slyA, sifA, SPI-2, phoP, or htrA gene.

[0231] Embodiment E8: The modified bacterium of any one of the preceding embodiments E, wherein the functional expression product of the gene required for survival in macrophages is a protein related to the HtrA serine protease family.

[0232] Embodiment E9: The modified bacterium of any one of the preceding embodiments E, wherein the bacterium is defective in activity of HtrA serine protease.

[0233] Embodiment E10: The modified bacterium of any one of the preceding embodiments E, wherein the gene required for survival in macrophages is htrA.

[0234] Embodiment E11: The modified bacterium of any one of the preceding embodiments E, wherein the bacterium is defective with respect to htrA.

[0235] Embodiment E12: The modified bacterium according to any one of embodiments E1 to E11, wherein the essential gene is a gene naturally occurring in the bacterial chromosome and the native promoter of the essential gene is functionally replaced with an obligate hypoxia-inducible promoter, whereby expression of the essential gene in the bacterium is entirely under the control of the obligate hypoxia-inducible promoter.

[0236] Embodiment E13: The modified bacterium according to any one of embodiments E1 to E11, wherein the essential gene expression cassette is exogenous and an essential gene naturally occurring in the bacterial chromosome has been deleted or functionally inactivated, whereby expression of the essential gene in the bacterium is entirely under the control of an obligate hypoxia-inducible promoter.

[0237] Embodiment E14: The modified bacterium of embodiment E13, wherein the exogenous essential gene expression cassette is integrated into the bacterial chromosome.

[0238] Embodiment E15: The modified bacterium of embodiment E13, wherein the exogenous essential gene expression cassette is outside the bacterial chromosome.

[0239] Embodiment E16: The modified bacterium according to embodiment E15, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium.

[0240] Embodiment E17: The modified bacterium of any one of the preceding embodiments E, wherein the bacterially derived hemolysin protein is a gram-negative bacterial hemolysin protein.

[0241] Embodiment E18: The modified bacterium of embodiment E17, wherein the gene encoding a hemolysin protein of a Gram-negative bacterium is hlyA or hlyE.

[0242] Embodiment E19: The modified bacterium of embodiment E18, wherein hlyA or hlyE is derived from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.

[0243] Embodiment E20: The modified bacterium of any one of the preceding embodiments E, wherein the promoter that is active under acidic pH conditions is active at a pH lower than 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6, or 5.5.

[0244] Embodiment E21: The modified bacterium of any one of embodiments E, wherein the promoter that is active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.

[0245] Embodiment E22: The modified bacterium of any one of embodiments E, wherein the promoter that is active under acidic pH conditions is sseA.

[0246] Embodiment E23: The modified bacterium of any one of embodiments E, wherein the unmodified starting strain is a facultative anaerobic bacterium.

[0247] Embodiment E24: The modified bacterium of any one of embodiments E, wherein the bacterium is a bacterium of the family Enterobacteriaceae.

[0248] Embodiment E25: The modified bacterium of any one of embodiments E, wherein the bacterium is a bacterium of the genera Escherichia, Salmonella, Shigella, Klebsiella, Yersinia, Citrobacter, Enterobacter, Serratia, Proteus, Morganella, Providencia, Hafnia, and Pantoea.

[0249] Embodiment E26: The bacterium is selected from the group consisting of Escherichia coli, Enterobacter buratae, Enterobacter fergussonii, Enterobacter hermannii, Enterobacter valneris, Salmonella enterica, Salmonella bongori, Salmonella typhi, Salmonella choleraesuis, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella boydii, Shigella zonei, Klebsiella pneumoniae, Klebsiella oxytoca, Yersinia pestis, Yersinia enterocolitica, Yersinia pseudotuberculosis, Yersinia aldovae. , Yersinia bercovellii, Yersinia fredericsenii, Yersinia intermedia, Yersinia cristelloniai, Yersinia molarettii, Yersinia rhodei, Yersinia ruckeri, Citrobacter freundii, Citrobacter koseri, Citrobacter braachii, Enterobacter aerogenes, Enterobacter cloacae, Enterobacter gergoviae, Enterobacter sakazakii, Enterobacter tyrolae, Enterobacter amniogenes Enterobacter intermedius, Enterobacter asbriae, Enterobacter cancellogenus, Enterobacter dissolvens, Enterobacter nimipress ularis, Serratia marcescens, Serratia entomophila, Serratia ficaria, Serratia fonticola, Serratia grimecii, Serratia liquefaciens, Serratia odorifera, Serratia primutica, Serratia proteamaculans, Serratia rubidaea, Serratia ureilistica , Proteus mirabilis, Proteus vulgaris, Proteus mixophaga, Proteus pennelli, Proteus hauseri, Morganella morganii, Providencia alcalifaciens, Providencia rustigianii, Providencia stuartii, Providencia rettgeri, Providencia heimbaccae, Hafnia alvei, and Pantoea agglomerans.

[0250] Embodiment E27: The modified bacterium of any one of the preceding embodiments E, wherein the bacterium is a Salmonella typhimurium bacterium.

[0251] Embodiment E28: The modified bacterium according to embodiment E27, wherein the starting strain is Salmonella typhimurium SL7207.

[0252] Embodiment E29: The modified bacterium of any one of the preceding embodiments E, wherein the bacterium, when administered to a subject having a tumor, has the ability to survive and grow in tumor tissue and is rapidly eliminated in normal tissue.

[0253] Embodiment E30: The modified bacterium of any one of the preceding embodiments E, wherein the bacterium has the ability to inhibit the growth of a malignant tumor when administered to a subject having a malignant tumor.

[0254] Embodiment E31: The modified bacterium of any one of the preceding embodiments E, wherein the bacterium has the ability to induce an anti-tumor specific immune response when administered to a subject having a malignant tumor.

[0255] Embodiment E32: The modified bacterium of any one of the preceding embodiments E, wherein the bacterium has the ability to induce anti-tumor immune memory when administered to a subject having a malignant tumor.

[0256] Embodiment E33: The modified bacterium of any one of the preceding embodiments E, which does not express wild-type flagellin.

[0257] Embodiment E34: The modified bacterium of any one of the preceding embodiments E, wherein the bacterium is defective in the fliC gene.

[0258] Embodiment E35: The modified bacterium of any one of the preceding embodiments E, wherein the survival level of the bacterium within the macrophage ranges from about 50% to about 30% of the survival level of the unmodified starting strain.

[0259] Embodiment E36: ​​The modified bacterium of any one of embodiments E1 to E34, wherein the survival level of the bacterium within the macrophage is in the range of about 30% to about 10% of the survival level of the unmodified starting strain.

[0260] Embodiment E37: The modified bacterium of any one of embodiments E1 to E34, wherein the survival level of the bacterium within the macrophage is in the range of about 10% to about 1% of the survival level of the unmodified starting strain.

[0261] Embodiment F Embodiment F1: A modified bacterium of Salmonella typhimurium, wherein the bacterium comprises a hypoxia-regulated essential gene expression cassette comprising an essential bacterial gene under the control of an obligate hypoxia-inducible promoter and a pH-regulated expression cassette comprising a gene encoding a hemolysin protein from the bacterium under the control of a promoter that is active under acidic pH conditions, and wherein the bacterium expresses wild-type lipopolysaccharide (LPS) and is deficient in at least one gene or functional expression product required for survival within macrophages compared to the unmodified starting strain.

[0262] Embodiment F2: The modified bacterium of embodiment F1, wherein the obligate hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.

[0263] Embodiment F3: The modified bacterium of embodiment F1, wherein the obligate hypoxia-inducible promoter is the ssbp1 promoter.

[0264] Embodiment F4: The modified bacterium of any one of the preceding embodiments F, wherein the expression product of the essential gene is involved in the synthesis of 2,6-diaminopimelic acid (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on additional DAP or an analog thereof being added to the medium.

[0265] Embodiment F5: The modified bacterium of embodiment F4, wherein the essential genes are selected from dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.

[0266] Embodiment F6: The modified bacterium of embodiment F4, wherein the essential genes are selected from dapA and dapE.

[0267] Embodiment F7: The modified bacterium of any one of the preceding embodiments F, wherein the gene required for survival in macrophages is an STM3120, STM3119, slyA, sifA, SPI-2, phoP, or htrA gene.

[0268] Embodiment F8: The modified bacterium of any one of the preceding embodiments F, wherein the gene required for survival in macrophages is a gene involved in or regulating the endogenous antioxidant stress response pathway.

[0269] Embodiment F9: The modified bacterium of embodiment F8, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is a HtrA serine protease family gene.

[0270] Embodiment F10: The modified bacterium according to embodiment F9, wherein the functional expression product of a gene involved in or regulating the endogenous antioxidant stress response pathway is a protein related to the HtrA serine protease family.

[0271] Embodiment F11: The modified bacterium of embodiment F9, wherein the bacterium is defective in the activity of HtrA serine protease.

[0272] Embodiment F12: The modified bacterium according to embodiment F9, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is htrA.

[0273] Embodiment F13: The modified bacterium of embodiment F9, wherein the bacterium is defective with respect to htrA.

[0274] Embodiment F14: The modified bacterium according to any one of embodiments F1 to F13, wherein the essential gene is a gene naturally occurring in the bacterial chromosome and the native promoter of the essential gene is functionally replaced with an obligate hypoxia-inducible promoter, whereby expression of the essential gene in the bacterium is entirely under the control of the obligate hypoxia-inducible promoter.

[0275] Embodiment F15: The modified bacterium according to any one of embodiments F1 to F13, wherein the essential gene expression cassette is exogenous and an essential gene naturally occurring in the bacterial chromosome has been deleted or functionally inactivated, whereby expression of the essential gene in the bacterium is entirely under the control of an obligate hypoxia-inducible promoter.

[0276] Embodiment F16: A modified bacterium according to embodiment F15, wherein the exogenous essential gene expression cassette is integrated into the bacterial chromosome.

[0277] Embodiment F17: A modified bacterium according to embodiment F15, wherein the exogenous essential gene expression cassette is outside the bacterial chromosome.

[0278] Embodiment F18: A modified bacterium according to embodiment F17, wherein the exogenous essential gene expression cassette is present in a plasmid carried by the bacterium.

[0279] Embodiment F19: The modified bacterium of any one of the preceding embodiments F, wherein the bacterially derived hemolysin protein is a hemolysin protein of a Gram-negative bacterium.

[0280] Embodiment F20: The modified bacterium according to embodiment F19, wherein the gene encoding a hemolysin protein of a Gram-negative bacterium is hlyA or hlyE.

[0281] Embodiment F21: The modified bacterium of embodiment F20, wherein hlyA or hlyE is derived from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.

[0282] Embodiment F22: The modified bacterium of any one of the preceding embodiments F, wherein the promoter that is active under acidic pH conditions is active at a pH lower than 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6, or 5.5.

[0283] Embodiment F23: The modified bacterium of any one of the preceding embodiments F, wherein the promoter that is active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.

[0284] Embodiment F24: The modified bacterium of any one of the preceding embodiments F, wherein the promoter that is active under acidic pH conditions is sseA.

[0285] Embodiment F25: The modified bacterium of any one of the preceding embodiments F, wherein the starting strain is Salmonella typhimurium SL7207.

[0286] Embodiment F26: The modified bacterium of any one of the preceding embodiments F, wherein the bacterium, when administered to a subject having a tumor, has the ability to survive and grow in tumor tissue and is rapidly eliminated in normal tissue.

[0287] Embodiment F27: The modified bacterium of any one of the preceding embodiments F, wherein the bacterium has the ability to inhibit the growth of a malignant tumor when administered to a subject having a malignant tumor.

[0288] Embodiment F28: The modified bacterium of any one of the preceding embodiments F, wherein the bacterium has the ability to induce an anti-tumor specific immune response when administered to a subject having a malignant tumor.

[0289] Embodiment F29: The modified bacterium of any one of the preceding embodiments F, wherein the bacterium has the ability to induce anti-tumor immune memory when administered to a subject having a malignant tumor.

[0290] Embodiment F30: The modified bacterium of any one of the preceding embodiments F, which does not express wild-type flagellin.

[0291] Embodiment F31: A modified bacterium of any one of the preceding embodiments F, which is defective in the fliC gene.

[0292] Embodiment F32: The modified bacterium of any one of the preceding embodiments F, wherein the survival level of the bacterium within the macrophage ranges from about 50% to about 30% of the survival level of the unmodified starting strain.

[0293] Embodiment F33: The modified bacterium according to any one of embodiments F1 to F31, wherein the survival level of the bacterium within the macrophage is in the range of about 30% to about 10% of the survival level of the unmodified starting strain.

[0294] Embodiment F34: The modified bacterium according to any one of embodiments F1 to F31, wherein the survival level of the bacterium within the macrophage is in the range of about 10% to about 1% of the survival level of the unmodified starting strain.

[0295] Embodiment K Embodiment K1: A pharmaceutical composition comprising an effective amount of a modified bacterium of any one of the preceding Embodiments A, B, C, D, E, or F.

[0296] Embodiment K2: The pharmaceutical composition according to embodiment K1 for use in treating a malignant tumor.

[0297] Embodiment K3: A pharmaceutical composition according to embodiment K1 for use in inducing an anti-tumor specific immune response in a subject with a malignant tumor.

[0298] Embodiment K4: A pharmaceutical composition according to embodiment K1 for use in inducing anti-tumor immune memory in a subject with a malignant tumor.

[0299] Embodiment K5: A pharmaceutical composition according to embodiment K1 for use in preventing or treating metastasis or recurrence of a malignant tumor.

[0300] Embodiment K6: The pharmaceutical composition according to embodiment K1, for use in treating malignant tumors that are resistant or have failed previous antitumor therapies.

[0301] Embodiment K7: The pharmaceutical composition of embodiments K1 to K6, wherein the modified bacterium is a live bacterium.

[0302] Embodiment L Embodiment L1: A method for treating a malignant tumor, comprising administering to a subject suffering from a malignant tumor an effective amount of a modified bacterium of any one of the preceding embodiments A, B, C, D, E, or F, or a pharmaceutical composition of any one of the preceding embodiments G.

[0303] Embodiment L2: A method for inducing an anti-tumor specific immune response in a subject having a malignant tumor, comprising administering to the subject an effective amount of a modified bacterium described in any one of the preceding embodiments A, B, C, D, E, or F, or a pharmaceutical composition described in any one of the preceding embodiments G.

[0304] Embodiment L3: A method for inducing anti-tumor immune memory in a subject having a malignant tumor, comprising administering to the subject an effective amount of a modified bacterium of any one of the preceding embodiments A, B, C, D, E, or F, or a pharmaceutical composition of any one of the preceding embodiments G.

[0305] Embodiment L4: A method for preventing or treating metastasis or recurrence of a malignant tumor, comprising administering to a subject having a malignant tumor an effective amount of a modified bacterium described in any one of the preceding embodiments A, B, C, D, E, or F, or a pharmaceutical composition described in any one of the preceding embodiments G.

[0306] Embodiment L5: A method for preventing or treating metastasis or recurrence of a malignant tumor, comprising administering an effective amount of a modified bacterium described in any one of the preceding embodiments A, B, C, D, E, or F, or a pharmaceutical composition described in any one of the preceding embodiments G, to a subject having or at high risk of metastasis or recurrence of a malignant tumor.

[0307] Embodiment L6: A method for treating a malignant tumor that is resistant or unsuccessful to a previous anti-tumor therapy, comprising administering an effective amount of a modified bacterium of any one of the preceding embodiments A, B, C, D, E, or F, or a pharmaceutical composition of any one of the preceding embodiments G, to a subject having a malignant tumor that is resistant or unsuccessful to a previous anti-tumor therapy.

[0308] Embodiment L7: The method of embodiments L1-L6, wherein the modified bacterium is a live bacterium.

[0309] Embodiment M Embodiment M1: Use of a modified bacterium of any one of the preceding embodiments A, B, C, D, E, or F in the manufacture of a medicament for treating a malignant tumor.

[0310] Embodiment M2: Use of a modified bacterium described in any one of the preceding embodiments A, B, C, D, E, or F in the manufacture of a medicament for inducing an anti-tumor specific immune response in a subject having a malignant tumor.

[0311] Embodiment M3: Use of a modified bacterium of any one of the preceding embodiments A, B, C, D, E, or F in the manufacture of a medicament for inducing anti-tumor immune memory in a subject having a malignant tumor.

[0312] Embodiment M4: Use of a modified bacterium of any one of the preceding embodiments A, B, C, D, E, or F in the manufacture of a medicament for preventing or treating metastasis or recurrence of a malignant tumor.

[0313] Embodiment M5: Use of a modified bacterium of any one of the preceding embodiments A, B, C, D, E, or F in the manufacture of a medicament for treating a malignancy that is resistant to or has failed previous anti-tumor therapy.

[0314] Embodiment M7: The use according to embodiments M1 to M5, wherein the modified bacterium is a live bacterium.

[0315] Embodiment N Embodiment N1: The pharmaceutical composition according to any one of embodiments K, the method according to any one of embodiments L, or the use according to any one of embodiments M, wherein the malignant tumor is a malignant tumor originating from the nervous system, respiratory system, digestive system, urinary system, reproductive system, hematopoietic system, lymphatic system, endocrine system, or skin and mucous membranes.

[0316] Embodiment N2: The pharmaceutical composition of any one of embodiments K, the method of any one of embodiments L, or the use of any one of embodiments M, wherein the malignant tumor is a sarcoma or cancer.

[0317] Embodiment N3: The pharmaceutical composition of any one of embodiments K, the method of any one of embodiments L, or the use of any one of embodiments M, wherein the malignant tumor is a solid tumor.

[0318] Embodiment N4: The pharmaceutical composition of any one of embodiments K, the method of any one of embodiments L, or the use of any one of embodiments M, wherein the malignant tumor is selected from the group consisting of glioma, neuroblastoma, retinoblastoma, nasopharyngeal carcinoma, oral cancer, tongue cancer, laryngeal cancer, head and neck cancer, melanoma, bronchial cancer, lung cancer, pleural cancer, esophageal cancer, gastric cancer, hepatocellular carcinoma, pancreatic cancer, bile duct cancer, colorectal cancer, rectal cancer, renal cell carcinoma, bladder cancer, prostate cancer, spralenoma, thyroid cancer, parathyroid cancer, pituitary tumor, Hodgkin's disease, non-Hodgkin's lymphoma, multiple myeloma, cervical cancer, ovarian cancer, endometrial cancer, breast cancer, bone cancer, and osteosarcoma.

[0319] Embodiment N5: A pharmaceutical composition according to any one of embodiments K, a method according to any one of embodiments L, or a use according to any one of embodiments M, wherein the bacterium, medicament, or pharmaceutical composition of the invention is administered by intravenous, intratumoral, intramuscular, subcutaneous, intraperitoneal, intracerebral, gastrointestinal, body surface, oral mucosa, nasal, rectal, or vaginal route.

[0320] [Example] The embodiments described below are used as examples to illustrate certain specific features and / or embodiments of the present invention, and should not be construed as limiting the present invention to the specific features or embodiments described.

[0321] Example 1: Construction of different variant strains of Salmonella typhimurium SL7207 1.1 The desired fragment was obtained by PCR amplification using the PsseA-hlyA-loxp-KnaR-loxp plasmid (SEQ ID NO: 9) and the Pssbp1-dapE-Cm plasmid (SEQ ID NO: 10) as templates. For PsseA-hlyA-loxp-KnaR-loxp the following primer sequences were used: forward primer TTCACAGAAAAGTGTTGCCCCCTTCCATGGCGGAAGGGGGACAAAGGTGAATTTGTCCTACTCAGGAGAGAGCGTTCA (SEQ ID NO: 11) and reverse primer TCTGACGTACACAGCAATTTTGCGTTACCTGTTAATCGAGATTGAAACACCGAAGAAAGGCCCACCCG (SEQ ID NO: 12), and for Pssbp1-dapE-Cm the following primer sequences were used: forward primer TTGGTTTCAGTGAATCCCGTTATCAGCAGTTTTTTGATGAGGTGTAGTCTATTTGTCCTACTCAGGAGAGCG (SEQ ID NO: 13) and reverse primer CAATATTTTGCCAGCCAGTCCATGCTTATTTCCTCTTACCGGAACGCTCACGAAGAAAGGCCCACCCG (SEQ ID NO: 14), with an annealing temperature of 55°C. Desired fragment 1 was PsseA-hlyA-loxp-KnaR-loxp (SEQ ID NO:1) and desired fragment 2 was Pssbp1-dapE-Cm (SEQ ID NO:2).

[0322] 1.2 The pSim6 plasmid (BioVector NTCC Inc.: 3574840) containing λ phage Red recombinase was introduced into the facultative anaerobic Salmonella strain SL7207 (NCBI: ASM1320710v1) to prepare the pSim6 plasmid-containing SL7207 strain electrocompetent cell SL7207 (pSim6).

[0323] 1.3 The desired fragment 1 was introduced into SL7207 (pSim6) competent cells by electroporation (E=18KV / cm). The λ-red homologous recombination method was used to replace the dapE gene (controlling the synthesis of diaminopimelic acid, essential for cell wall synthesis) in the SL7207 genome with the desired fragment 1. In particular, the pSim6 plasmid-containing target strain was cultivated at 30°C; recombinase expression was carried out at 42°C for 15 minutes; and the homologous recombination process was completed by adding 50bp-containing homologous arms to the PCR primers under the influence of the homologous recombinase, away from the upstream and downstream of the target locus, respectively, to obtain the strain SL7207 (ΔdapE::PsseA-hlyA-KnaR).

[0324] 1.4 The Cre plasmid (Gene Bridges: A112) containing the P1 phage Cre recombinase was introduced into the recombinant strain SL7207 (ΔdapE::PsseA-hlyA-KnaR) to remove the kanamycin resistance, thereby obtaining the strain SL7207 (ΔdapE::PsseA-hlyA).

[0325] 1.5 The pSim6 plasmid was introduced into strain SL7207(ΔdapE::PsseA-hlyA) to prepare SL7207(ΔdapE::PsseA-hlyA)(pSim6) electrocompetent cells.

[0326] 1.6 The desired fragment 2 was introduced into SL7207(ΔdapE::PsseA-hlyA)(pSim6) electrocompetent cells by electroporation (E=18KV / cm). Using λ-red homologous recombination, the htrA gene (encoding serine protease) (ΔdapE::PsseA-hlyA) in the SL7207 genome was replaced with the desired fragment 2 to obtain strain DB-ZW1, which was a SL7207 strain lacking the htrA gene and containing the hlyA gene under the control of PsseA and the dapE gene under the control of the obligate hypoxia-inducible promoter Pssbp1 (ΔdapE::PsseA-hlyA; ΔhtrA::Pssbp1-dapE-Cm).

[0327] 1.7 Preparation of PdapE-dapE-loxp-KnaR-loxp PCR product using forward primer CAATATTTTGCCAGCCAGTCCATGCTTATTTCCTCTTACCGGAACGCTCAATTTGTCCTACTCAG (SEQ ID NO: 15) and reverse primer TTGGTTTCAGTGAATCCCGTTATCAGCAGTTTTTTGATGAGGTGTAGTCTCGAAGAAAGGCCCACCCG (SEQ ID NO: 16) at annealing temperature of 60° C. The PdapE-dapE-loxp-KnaR-loxp PCR product (SEQ ID NO: 4) was transferred into DB-ZW1(pSim6) competent cells by electroporation (E=18KV / cm) using λ-red homologous recombination method to replace Pssbp1-dapE fragment to obtain DB-ZW2 strain. The DB-ZW2 strain was an SL7207 strain lacking the htrA gene and containing the hlyA gene under the control of the promoter PsseA and the dapE gene under the control of its native promoter PdapE.

[0328] 1.8 Preparation of loxp-KnaR-loxp PCR product using forward primer ATGAAAAAAATAATGCTAGTTTTTATTACACTTATATTAGTTAGTCTACCGCCGATCATATTCAATAACCC (SEQ ID NO: 17) and reverse primer TTATTCGATTGGATTATCTACTTTATTACTATATTTCGGATAAAGCGTGGCTAGTGAACCTCTTCGAGGG (SEQ ID NO: 18) at annealing temperature of 55° C. The loxp-KnaR-loxp PCR product (SEQ ID NO: 3) was transferred into DB-ZW1 (pSim6) competent cells by electroporation (E=18KV / cm) using λ-red homologous recombination method to replace the hlyA gene. As a result, DB-ZW3 strain was obtained, which is a SL7207 strain lacking the htrA gene and containing the dapE gene under the control of the obligate hypoxia-inducible promoter Pssbp1 but without the hlyA gene.

[0329] 1.9 Preparation of PhtrA-htrA-loxp-aadA-loxp PCR product using forward primer GATAATGTATTCACAGGTTGCTCCGGGCTTGAAAAAGTTAAATGACATCCATTTGTCCTACTCAGGAGAGC (SEQ ID NO: 19) and reverse primer AAAAGGAACTTTTTACCTTTTCGCCTTCCCGTTTCGTTCAACTTAGTATACGAAGAAAGGCCCACCC (SEQ ID NO: 20) at annealing temperature of 55° C. PhtrA-htrA-loxp-aadA-loxp PCR product (SEQ ID NO: 5) was transferred into DB-ZW1(pSim6) and DB-ZW3(pSim6) competent cells by electroporation (E=18KV / cm) using λ-red homologous recombination method, and attB site was inserted to construct strains DB-ZW4 and DB-ZW5, respectively. Specifically, DB-ZW4 was a SL7207 strain containing the htrA gene under the control of the native promoter, the hlyA gene under the control of the promoter PsseA, and the dapE gene under the control of the promoter Pssbp1; DB-ZW5 was a SL7207 strain containing the htrA gene under the control of the native promoter, the dapE gene under the control of the promoter Pssbp1, but without the hlyA gene. The strain construction scheme is shown in Figure 1. The successful construction of DB-ZW2, DB-ZW3, DB-ZW4, and DB-ZW5 strains was confirmed by PCR electrophoresis.

[0330] Example 2: Growth characteristics of DB-ZW1 and DB-ZW2 strains in different cells DB-ZW1 and DB-ZW2 were cultured in LB broth at 37°C under anaerobic and aerobic conditions, respectively, and grown to an OD of 0.2. 600When grown to 100°C, the bacteria were collected by centrifugation at 5000 rpm and washed with PBS. RNA was then extracted using Qiagen RNA extraction kit (74106), and after reverse transcription, the expression of dapE in each strain was measured using RT-qPCR. Compared with strain DB-ZW2 carrying the native promoter, strain DB-ZW1 was able to transcribe and express the dapE gene more under anaerobic conditions, while the transcription and expression of the dapE gene in strain DB-ZW1 was significantly reduced under aerobic conditions (Figure 2A). Meanwhile, the growth of strain DB-ZW1 harboring the anaerobic gene circuit and strain DB-ZW2 lacking the anaerobic gene circuit was observed under aerobic conditions. DB-ZW1 and DB-ZW2 were cultured in LB broth at 37°C under aerobic conditions, respectively, where the medium of DB-ZW1 was supplemented with 50 μg / mL DAP. An OD of 0.2 was observed. 600 When cultured for 1 h, both bacteria were collected by centrifugation at 5000 rpm, washed with PBS, and then a suitable amount of the bacterial solution was taken and added to a 2 cm glass-bottomed Petri dish, and pressed with an agarose gel pad for observation under a microscope. After about 6 h of incubation, all the bacterial cells of DB-ZW1 strain were lysed and the bacteria were killed, while DB-ZW2 strain, which lacks the anaerobic gene circuit, was found to be able to survive and grow under aerobic conditions (Figure 2B). In addition, the doubling time of DB-ZW1 strain was further measured to be approximately 38 min in aerobic environment with DAP added and in anaerobic environment (Figure 2C). The above results suggested that the anaerobic gene circuit could control the growth of the strains under different oxygen conditions.

[0331] In addition, 2.5×10 6RAW264.7 mouse macrophages (ATCC number: TIB-71) or MB49 mouse bladder cancer cells (Merck SCC148) were added to each well of a 6-well plate for cell culture, which was then cultured in complete medium (DMEM base medium + 10% fetal bovine serum + double antibody) in a 5% CO2 incubator at 37°C to allow the cells to adhere. The cells from two wells were counted, and DB-ZW1 and DB-ZW3 strains (after counting, the bacteria were resuspended in DMEM medium containing 50 μg / mL DAP) were added using an infection ratio of 50:1 based on the number of cells, respectively, and co-cultured for 15 minutes or 1 hour to allow the bacteria to enter the cells. After that, the cells were washed with PBS and cultured with DMEM base medium containing 100 μg / mL gentamicin and 50 μg / mL DAP for 1 hour. The supernatant was removed, and the cells were washed with PBS. After harvesting the cells, their membranes were then disrupted and the number of viable bacteria in the cells was determined by plating.By using macrophages and tumor cells, we verified that the DB-ZW1 strain harboring the pH-regulated gene circuit PsseA-hlyA was more rapidly excreted by the mouse macrophage cell line RAW264.7, while it showed good growth in the mouse bladder cancer cell line MB49 (Figure 3).

[0332] Example 3: In vivo distribution of different variant strains 3.1 C57BL / 6 mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., weighing approximately 18 g and maintained in a specific pathogen-free (SPF) environment) were inoculated with 1 × 10 6 A subcutaneous tumor model of mouse bladder cancer was established by subcutaneous inoculation of MB49 mouse bladder cancer cells. 14–18 days after inoculation, the tumor volume was approximately 100 mm 3 The experiment was carried out at.

[0333] 3.2 Tumor-bearing mice were divided into seven groups (each consisting of three mice): PBS group, DB-ZW1 group, DB-ZW2 group, DB-ZW3 group, DB-ZW4 group, DB-ZW5 group, and SL7207 group. The latter six groups of tumor-bearing mice were administered 1×10 7 CFU of bacteria (volume 125 μL) were injected via the tail vein. The quantitative distribution of the above strains in normal tissues and organs of tumor-bearing mice was examined, respectively. It was found that on day 14 after injection, compared with the strains in the other groups, only the DB-ZW1 strain could be rapidly excreted in normal tissues (Figure 4A), while rapidly aggregated in tumors (Figure 4B). Loss of the anaerobic-regulated gene circuit Pssbp1-dapE or the pH-regulated gene circuit PsseA-hlyA, or containing the htrA gene, slowed down the excretion of the DB-ZW1 strain in normal tissues.

[0334] Example 4: Construction of DB-ZW1 variant strains 4.1 The desired fragments 3, 4 and 5 were isolated from pBSK plasmid (Addgene: #67504) as a template, in particular the following: msbB-HR-loxp-KnaR-loxp (SEQ ID NO: 6, forward primer: AGGTAGTACAGGTTTGTCAGCATAAAGCCTCTCTTACGAGAGGCTTTATGCCGATCATATTCAATAACCC (SEQ ID NO: 21); reverse primer: TCGCTACACTATTCACAATTCCTTTTCGCGTCAGCAGACCCTGGAAAAGCCTAGTGAACCTCTTCGAGGG (SEQ ID NO: 22); annealing temperature: 55° C.); lpp-H It was obtained by PCR amplification by using R-loxp-KnaR-loxp (SEQ ID NO: 7, forward primer: CGGACAAAAAAATGGCGCACGATGTGCGCCATTTTATATTGTGCGTCAAAGCCGATCATATTCAATAACCC (SEQ ID NO: 23); reverse primer: AATACTTGTAACGCTACATGGAGATTAACTCAATCTAGAGGGTATTAATACTAGTGAACCTCTTCGAGGG (SEQ ID NO: 24); annealing temperature: 55°C); and fliC-HR-loxp-KnaR-loxp (SEQ ID NO: 8, forward primer: GCTTTCGCTGCCTTGATTGTGTACCAC GTGTCGGTGAATCAATCGCCGGAGCCGATCATATTCAATAACCC (SEQ ID NO: 25); reverse primer: ACGGTGAGAAACCGTGGGCAACAGCCCAATAACATCAAGTTGTAATTGATCTAGTGAACCTCTTCGAGGG (SEQ ID NO: 26); annealing temperature: 55°C).

[0335] 4.2 To prepare electrocompetent cells of DB-ZW1 strain, the pSim6 plasmid was transferred into DB-ZW1 strain by electroporation.

[0336] 4.3 To prepare DB-ZW1(pSim6) electrocompetent cells, the DB-ZW1(pSim6) bacterial solution cultured to log phase was washed twice with pre-chilled deionized water, then washed once with the same volume of 10% glycerol, and finally resuspended in 10% glycerol, and electrocompetent cells (100 μL) were prepared from the log phase bacterial solution (5 mL each).

[0337] 4.4 The desired fragments 3, 4, and 5 were respectively introduced into DB-ZW1(pSim6) electrocompetent cells. The msbB gene (encoding lipid acyltransferase, gene ID: 1253410), lpp gene (encoding lipoprotein, gene ID: 1252895), and fliC gene (encoding flagellin, gene ID: 1253480) in the DB-ZW1 genome were respectively replaced with the desired fragments 3, 4, and 5 by λ-red homologous recombination technique to obtain strains DB-ZW1(ΔmsbB), DB-ZW1(Δlpp), and DB-ZW1(ΔfliC). Strains DB-ZW1(ΔmsbB), DB-ZW1(Δlpp), and DB-ZW1(ΔfliC) were successfully constructed as confirmed by PCR electrophoresis.

[0338] Example 5: Anticancer effect of DB-ZW1 variant strain C57BL / 6 mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., weighing approximately 18 g and maintained in an SPF environment) were inoculated with 1 × 10 6 A subcutaneous tumor model of mouse bladder cancer was established by subcutaneous inoculation of MB49 mouse bladder cancer cells. 14–18 days after inoculation, the tumor volume was approximately 100 mm 3 The experiment was carried out at.

[0339] The mice were divided into six groups (each consisting of five mice): PBS, DB-ZW1, DB-ZW1(ΔmsbB), DB-ZW1(Δlpp), DB-ZW1(ΔfliC), and SL7207 groups, and the latter five groups of tumor-bearing mice were injected with 1 × 10 7 CFU of bacteria (125 μL) were inoculated via tail vein injection. The distribution of the strains in normal tissues and tumors of tumor-bearing mice, changes in tumor volume, and weight changes and survival rates of mice were detected.

[0340] 5.1 Bacterial distribution in tumor-bearing mice: 14 days after injection of strains DB-ZW1, DB-ZW1(ΔmsbB), DB-ZW1(Δlpp), and DB-ZW1(ΔfliC), all bacteria in normal tissues were virtually completely eliminated, whereas the number of bacteria in the tumor was 1 × 10 8 CFU / g was reached (Figure 5).

[0341] 5.2 Changes in tumor volume: Compared with the control group treated with PBS injection, the DB-ZW1 strain significantly reduced the tumor volume and significantly increased the survival rate of mice, but the therapeutic effects of DB-ZW1-ΔmsbB and DB-ZW1-Δlpp were significantly lower than that of DB-ZW1, while the therapeutic effect of flagellin-deficient DB-ZW1-ΔfliC was comparable to that of DB-ZW1 (Figure 6A), and the SL7207 group showed a significant reduction in tumor volume before death.

[0342] 5.3 Mouse body weight change: The body weight changes of the DB-ZW1 and DB-ZW1-ΔfliC mice showed a similar tendency, with a transient decrease followed by stabilization and rebound. The weight loss of the DB-ZW1-ΔmsbB and DB-ZW1-Δlpp groups was smaller than that of the DB-ZW1 and DB-ZW1-ΔfliC groups (Figure 6B), and the weight loss of the SL7207 group was significant and continuous.

[0343] 5.4 Mouse survival rate: SL7207 group died consecutively within 7 days after injection. Mice in PBS, DB-ZW1-ΔmsbB, and DB-ZW1-Δlpp groups died consecutively during 12 days after injection (Note: animals in the three groups were killed for ethical reasons due to excessive tumor size). In DB-ZW1 and DB-ZW1-ΔfliC groups, no mice died during the experimental cycle (Figure 6C).

[0344] 5.5 Statistically, when treated with MB49 bladder cancer in mice, DB-ZW1 achieved a partial response rate of 60% (n=42) and a complete response rate of 36%, suggesting that it had a good therapeutic effect on MB49 (Figure 6D).

[0345] The above results demonstrated that DB-ZW1 and DB-ZW1-ΔfliC were effective in treating bladder cancer in mice and improving their survival rate, suggesting that lipopolysaccharide (LPS) in DB-ZW1 plays an important role in tumor treatment. During the entire observation cycle (35 days), only the DB-ZW1 and DB-ZW1-ΔfliC groups achieved 100% mouse survival rate after treatment, suggesting that the strains DB-ZW1 and DB-ZW1-ΔfliC had good safety.

[0346] Example 6: Antitumor effects of DB-ZW1 on multiple tumor models 6.1 Tumor model construction C57BL / 6 mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., weighing approximately 18 g and maintained in an SPF environment) were inoculated with 1 × 10 6 A subcutaneous tumor model of mouse bladder cancer / melanoma was established by subcutaneous inoculation of MB49 mouse bladder cancer cells / B16 melanoma cells (ATCC: CRL-6475). 14–18 days after inoculation, the tumor volume was approximately 100 mm. 3The experiment was carried out at the time of the first batch of mice. The in situ colon cancer model was induced by DSS / AOM: a single intraperitoneal injection of 10 mg / kg AOM was followed by 7 days of water containing 2.5% DSS after 1 week, and then 14 days of normal drinking water, which constituted one cycle of DSS treatment. The DSS treatment was repeated for another 3 cycles to obtain a mouse model bearing colorectal cancer.

[0347] 6.2 Distribution changes of DB-ZW1 in tumors and different organs 1×10 7 CFU of DB-ZW1 (125 μL) was injected into MB49 bladder tumor-bearing mice (3 mice / group) via the tail vein. Approximately 90% of DB-ZW1 in the mice was observed to be present in the tumor 1 day post-injection (1 dpi). The intratumoral DB-ZW1 density increased 100-fold (10 8 CFU / g) and remained at a high level for the next 2 weeks. In contrast, the density of DB-ZW1 in normal tissues increased to 10 2 There was a steady decline to less than CFU / g (Fig. 7A).

[0348] To further clarify whether DB-ZW1 preferentially grows in tumors, the number of bacteria distributed in different organs was increased by 1 × 10 7 The CFU of DB-ZW1 bacteria (125 μL) was determined 24 h after injection into MB49 bladder tumor-bearing mice (3 mice / group) via the tail vein (Figure 7B). The results showed that DB-ZW1 rapidly spread within the mice within 30 min after injection, and most of the DB-ZW1 cells (approximately 99.9%) were distributed in the liver, spleen, and blood. The number of DB-ZW1 cells was significantly decreased within 4 h after injection, and the total number of DB-ZW1 cells was decreased by approximately 90%. Thereafter, DB-ZW1 in the tumor was detected approximately 0.7 h after injection. -1 DB-ZW1 cells grew exponentially with a growth rate of 0.01% and reached saturation within 3 days. In contrast, the numbers of DB-ZW1 cells in normal organs all steadily declined. This special tumor growth profile of DB-ZW1 was important in ensuring the validity of the findings described below.

[0349] 6.3 Antitumor effects of DB-ZW1 against bladder cancer, melanoma, and colon DB-ZW1 was used to treat subcutaneous bladder cancer, in situ melanoma, and subcutaneous and in situ colon cancer in mice. 7 CFU of DB-ZW1 (125 μL) was injected into tumor-bearing mice (5 mice / group) via the tail vein. As shown in Figure 8A-C, DB-ZW1 significantly reduced tumor size. In addition, using DB-ZW1 to treat mice with in situ colon cancer also significantly reduced the number of tumors in the colon of the mice (Figure 8D).

[0350] Example 7: Rapid DB-ZW1 proliferation in tumors correlates with its anaerobic cycle To verify whether the bacterial tumor-targeted colonization is associated with its motility, the amastigotone DB-ZW1-ΔfliC variant constructed in Example 2 was used, with DB-ZW1 used as a control.

[0351] 7.1 Tumor model construction C57BL / 6 mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., weighing approximately 18 g and maintained in an SPF environment) were inoculated with 1 × 10 6 A subcutaneous tumor model of mouse bladder cancer was established by subcutaneous inoculation of MB49 mouse bladder cancer cells. 14–18 days after inoculation, the tumor volume was approximately 100 mm 3 The experiment was carried out at.

[0352] 7.2 Tumor-targeted colonization of DB-ZW1 and variant DB-ZW1-ΔfliC 10 7CFU of DB-ZW1 and variant DB-ZW1-ΔfliC were injected into MB49 tumor-bearing mice (3 mice / group) via the tail vein. 14 days after injection, individual tissue organs (heart, liver, spleen, kidney, blood, tumor) were harvested, weighed, ground, diluted in PBS, and applied to LB plates. After placing in a 37°C incubator for 16-18 hours, the number of clones on each plate was counted. Although the motility of DB-ZW1-ΔfliC was very weak, it was still demonstrated to be capable of colonizing tumors (Figure 9). This result revealed that the tumor targeting effect of DB-ZW1 is not due to bacterial motility, but is closely associated with bacterial colonization and rapid proliferation in tumors.

[0353] Example 8: Memory CD8 + Ability of DB-ZW1 to specifically activate T cells 8.1 Tumor model construction C57BL / 6 mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., weighing approximately 18 g and maintained in an SPF environment) were inoculated with 1 × 10 6 A subcutaneous tumor model of mouse bladder cancer was established by subcutaneous inoculation of MB49 mouse bladder cancer cells. 14–18 days after inoculation, the tumor volume was approximately 100 mm 3 The experiment was carried out at.

[0354] 8.2 Memory CD8 by DB-ZW1 + T cell activation Mice were dissected and tumor-draining lymph nodes were harvested. After grinding, single cell suspensions were prepared by filtration through a 40 μm mesh filter. Next, memory CD8 + The amount of T cells was detected by antibody staining and flow analysis. +The levels of T cells were found to be significantly increased in the draining lymph nodes of mice treated with DB-ZW1 compared to mice in the PBS control group (Figure 10A). 6 Inoculation of B16-OVA melanoma cells elicited memory CD8 + T cells were increased, and such increase was found to be tumor antigen-specific (Figure 10B). 6 No tumor recurrence was observed in melanoma mice cured with DB-ZW1 after separate subcutaneous inoculation with 1 × 10 B16-OVA melanoma cells (Figure 11A). 6 Melanoma mice subcutaneously inoculated with MB49 bladder cancer cells developed tumors in a manner similar to that of mice that received initial subcutaneous injection of tumor cells (Figure 11C).The above results demonstrated that the antitumor effect of DB-ZW1 is characterized by tumor memory.

[0355] 8.3 Inhibition of metastatic tumors by DB-ZW1 1×10 6 The cell suspension (125 μL) containing B16 cells was used to inoculate DB-ZW1 cured melanoma mice via tail vein injection, and tumor metastasis formation in the mouse lungs was detected 18 days later. It was found that the body weight of mice whose lungs were cured with DB-ZW1 was significantly reduced compared to mice with initially induced melanoma ( FIG. 11B ).

[0356] Example 9: Memory CD8 with DB-ZW1 + Activation of antitumor T cell activity 9.1 Tumor model construction C57BL / 6 mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., weighing approximately 18 g and maintained in an SPF environment) were inoculated with 1 × 10 6A subcutaneous tumor model of mouse bladder cancer was established by subcutaneous inoculation of MB49 mouse bladder cancer cells. 14–18 days after inoculation, the tumor volume was approximately 100 mm 3 The experiment was carried out at.

[0357] 9.2 IFNγ by DB-ZW1 + CD8 + T cell activation Mice (3 mice / group) subcutaneously inoculated with MB49 bladder cancer cells were treated with DB-ZW1 and variants DB-ZW1-ΔmsbB and DB-ZW1-Δlpp, respectively. IFNγ levels in the tumor microenvironment of each group were increased. + CD8 + Detecting T cell content and IFNγ infiltrating into the tumor microenvironment of mice in the DB-ZW1-treated group + CD8 + The number of T cells was significantly higher than that in the PBS control group and the variants DB-ZW1-ΔmsbB and DB-ZW1-Δlpp treated groups (FIG. 12A).

[0358] CD8 + In vitro co-culture experiments were performed with T cells and the bladder cancer cell line MB49 and melanoma cell line B16. + T cells were isolated from tumors of tumor-bearing mice treated with DB-ZW1, and then co-cultured with MB49 or B16 tumor cells at a 5:1 ratio for 5 hours in a CO2 incubator at 37°C. The killing effect on target cells was determined by measuring lactate dehydrogenase (LDH) release in the supernatant collected from each co-culture well. The results showed that the isolated CD8 + T cells were found to be significantly more effective at killing MB49 cells than at killing B16 cells (Figure 12B). + T cells were found to have a stronger killing effect on specifically treated tumor cells. This result suggested that DB-ZW1 suppressed intratumoral IFNγ production. + CD8 +These results suggest that the antitumor effect is mediated by specific activation of T cells.

[0359] Example 10: Activation of intratumor tissue-resident memory T cells (TRM cells) by DB-ZW1 10.1 Tumor model construction C57BL / 6 mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., weighing approximately 18 g and maintained in an SPF environment) were inoculated with 1 × 10 6 A subcutaneous tumor model of mouse bladder cancer was established by subcutaneous inoculation of MB49 mouse bladder cancer cells. 14–18 days after inoculation, the tumor volume was approximately 100 mm 3 The experiment was carried out at.

[0360] 10.2 Activation of TRM cells by DB-ZW1 CD62L-CD69 in the tumor microenvironment before and after treatment with DB-ZW1 + , CD62L-CD69 + CD103 + , or CD62L-CD69 + CD103 - Each CD8 + The content of T cells was detected, in this case CD62L-CD69 + CD8 + T cells were TRM cells. CD8 + Proportion of TRM cells among T cells and IFNγ among TRM cells + The percentage of cells was found to be significantly higher than that of the control group treated with PBS (Figure 13).

[0361] These results suggested that DB-ZW1 may exert its antitumor effect by specifically activating TRM cells within tumors.

[0362] Example 11: DB-ZW1 stimulates IL-10 production in macrophages through CD8 + T cell activation 11.1 Tumor model construction C57BL / 6 mice (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., weighing approximately 18 g and maintained in an SPF environment) were inoculated with 1 × 10 6 A subcutaneous tumor model of mouse bladder cancer was established by subcutaneous inoculation of MB49 mouse bladder cancer cells. 14–18 days after inoculation, the tumor volume was approximately 100 mm 3 The experiment was carried out at.

[0363] 11.2 IL-10-induced CD8 + Activation of antitumor T cell activity Isolated intratumoral CD8 + When T cells were stimulated in vitro with anti-CD3 antibody and DB-ZW1, DB-ZW1-ΔmsbB, and DB-ZW1-Δlpp, respectively, DB-ZW1, DB-ZW1-ΔmsbB, and DB-ZW1-Δlpp all suppressed CD8 + It was found that DB-ZW1, DB-ZW1-ΔmsbB, and DB-ZW1-Δlpp could not effectively stimulate the activation of T cells (Figure 14). Mouse subendothelial bladder cancer was further treated with DB-ZW1, DB-ZW1-ΔmsbB, and DB-ZW1-Δlpp, respectively, and the levels of various inflammatory factors in serum were detected. The content of IL-10 in the DB-ZW1-treated group was found to be significantly higher than that in the other groups (Figure 15), suggesting that IL-10 may play an important role in the treatment of tumors by DB-ZW1.

[0364] To demonstrate the role of cytokine IL-10 in treating tumors with DB-ZW1, anti-IL-10 (BioXCell: #BE0049), a neutralizing antibody of IL-10, and DB-ZW1 were used to treat MB49-induced bladder cancer mice. Seven days after treatment, anti-IL-10 antibody significantly reduced DB-ZW1-induced IFNγ expression at the tumor site compared to the PBS control group.+ CD8 + DB-ZW1 significantly inhibited the increase in the percentage (%) of T cells in the IL-10-positive mice (Figure 16A). On the other hand, by measuring the tumor volume, DB-ZW1 significantly reduced the tumor volume compared to the PBS control group, but anti-IL-10 antibody significantly inhibited the reduction in tumor volume induced by DB-ZW1 (Figure 16B).

[0365] 11.3 IL-10 production in primary macrophages induced by DB-ZW1 Primary macrophages were obtained by flow sorting of mouse bone marrow cells, and the primary macrophages cultured in vitro were stimulated with DB-ZW1. After stimulation, total RNA was extracted with TRIzol reagent. After obtaining cDNA by reverse transcription, the transcript level of IL-10 was detected by qPCR, and the relative expression amount of the gene was calculated using the standard curve method and normalized to the expression level of Actb. It was found that DB-ZW1 significantly induced IL-10 expression in primary macrophages (Figure 17).

[0366] These results suggested that macrophages stimulated by DB-ZW1 produced IL-10, and the subsequently activated CD8+ T cells exerted an antitumor effect.

[0367] Example 12: Remodeling of the intratumoral immune environment by DB-ZW1 Tumors from MB49 bladder cancer mice treated with DB-ZW1 injection were sampled and subjected to cryosectioning and fluorescent immunostaining. After tumors were harvested, they were immersed in 4% paraformaldehyde tissue fixation solution for 5 h to fix, then transferred to 30% sucrose for 12 h to dehydrate. The tumors were then embedded in OCT embedding medium and frozen in a refrigerator at -20°C. The frozen samples were serially sectioned at a thickness of 10 mm using a freezing microtome and stored at -80°C. After fixation in acetone for 10 min, the sections were air-dried and returned to room temperature, then stained with the corresponding antibodies, and finally covered with a drop of DAPI-containing anti-fluorescent mounting medium, covered with a cover slip, and sealed with nail polish. The sections were observed and photographed under a fluorescent microscope. Most of DB-ZW1 was found to be localized in the center of the tumor section, and neutrophils were found to aggregate and form a ring around DB-ZW1 (Figure 18). It was also found that T cells and macrophages in the tumor changed from a chaotic distribution to an orderly arrangement from the outside to the inside after treatment with DB-ZW1 (Figure 18). Furthermore, the formation of the neutrophil ring structure was closely related to the level of IL-10 in the TME, and the distinct ring structure of neutrophils was completely abolished when the corresponding anti-IL-10 antibody was used (Figure 19A, Figure 19B), and the spatial distribution of neutrophils and the remaining DB-ZW1 cells was found to be uniform and overlapped throughout the tumor section with a significant decrease in DB-ZW1 density.

[0368] In order to deplete tumor-infiltrating macrophages, anti-CSF1R antibody (50 mg / kg, BioXCell, BE0213) was injected via the tail vein 3 days before bacterial treatment and every 2–3 days until the end of the experiment, and it was found that the neutrophil ring structure disappeared (Figure 19C) and DB-ZW1 density in the tumor was also reduced. This suggested that macrophages can protect bacteria from neutrophil phagocytosis. These results suggest that DB-ZW1 can remodel the intratumoral immune environment, in which bacteria present in the center of the tumor attract neutrophils, while bacteria defend against neutrophils by stimulating IL-10 production in macrophages. If IL-10 is removed, neutrophils will invade the tumor center and destroy the bacteria.

[0369] Example 13: Antitumor effects of DB-ZW1 using different administration modes and doses At present, common administration routes in clinical practice include subcutaneous injection, intravenous injection, oral administration, and topical application. The route of drug administration is closely related to the therapeutic effect on various clinical conditions, and the same drug may have significantly different effects depending on the administration route. Given the specificity of DB-ZW1 in the targeted tumor, the effects of both intratumoral and intravenous injection on the therapeutic effect were explored. First, the administration route and dose of DB-ZW1 were optimized. As shown in Figure 20A, 1 × 10 7 Fourteen days after administration of CFU of DB-ZW1, the distribution of DB-ZW1 in the tumor was significantly higher than that in all other normal tissues. The antitumor effect of the intravenous injection group was superior to that of the intratumoral injection group (Figure 20B).

[0370] Tumor treatment with inactivated DB-ZW1 was also attempted (Figure 21), and the results of tumor volume obtained 14 days after injection revealed that inactivated DB-ZW1 also showed a reasonable antitumor effect, which improved with increasing injection dose.

[0371] The effect of different doses of DB-ZW1 on the therapeutic effect in mice bearing subcutaneous MB49 bladder tumors was further explored (Figure 22). The results after 14 days of intravenous injection of DB-ZW1 showed that the dose of DB-ZW1 of 1×10 4 When the number of CFU was less than 1 × 10, no therapeutic effect was observed. 5 The therapeutic effect begins to appear when the CFU is 1×10 6 It was revealed that a more pronounced effect was observed when CFU of DB-ZW1 was injected intravenously.

[0372] The above results suggest that there is a very close relationship between the administration route and dose of DB-ZW1 and its therapeutic effect, and provide technical guidance for the future practical application of DB-ZW1 as a drug.

[0373] Array List SEQ ID NO: 1: PsseA-hlyA-loxp-KnaR-loxp

[0374] SEQ ID NO: 2: Pssbp1-dapE-Cm

[0375] SEQ ID NO: 3: loxp-knar-loxp

[0376] SEQ ID NO: 4: PdapE-dapE-loxp-KnaR-loxp

[0377] SEQ ID NO: 5: PhtrA-htrA-loxp-aadA-loxp

[0378] SEQ ID NO: 6: Msbb-HR-loxp-KnaR-loxp

[0379] Arrangement No. 7: Lpp-HR-loxp-Knar-loxp

[0380] Combination number 8: fliC-HR-loxp-KnaR-loxp

[0381] SEQ ID NO: 9: PsseA-hlyA-loxp-KnaR-loxp plasmid

[0382] SEQ ID NO: 10: Pssbp1-dapE-Cm plasmid

[0383] SEQ ID NO: 11: PsseA-hlyA-loxp-KnaR-loxp forward primer TTCACAGAAAAGTGTTGCCCCCTTCCATGGCGGAAGGGGGACAAAGGTGAATTTGTCCTACTCAGGAGAGCGTTCA

[0384] SEQ ID NO: 12: PsseA-hlyA-loxp-KnaR-loxp reverse primer TCTGACGTACACAGCAATTTTGCGTTACCTGTTAATCGAGATTGAAACACCGAAGAAAGGCCCACCCG

[0385] SEQ ID NO: 13: Pssbp1-dapE-Cm forward primer TTGGTTTCAGTGAATCCCGTTATCAGCAGTTTTTTGATGAGGTGTAGTCTATTTGTCCTACTCAGGAGAGCG

[0386] SEQ ID NO: 14: Pssbp1-dapE-Cm reverse primer CAATATTTTGCCAGCCAGTCCATGCTTATTTCCTCTTACCGGAACGCTCACGAAGAAAGGCCCACCCG

[0387] SEQ ID NO: 15: PdapE-dapE-loxp-KnaR-loxp forward primer CAATATTTTGCCAGCCAGTCCATGCTTATTTCCTCTTACCGGAACGCTCAATTTGTCCTACTCAG

[0388] SEQ ID NO: 16: PdapE-dapE-loxp-KnaR-loxp reverse primer TTGGTTTCAGTGAATCCCGTTATCAGCAGTTTTTTGATGAGGTGTAGTCTCGAAGAAAGGCCCACCCG

[0389] SEQ ID NO: 17: loxp-KnaR-loxp forward primer ATGAAAAAAATAATGCTAGTTTTTATTACACTTATATTAGTTAGTCTACCGCCGATCATATTCAATAACCC

[0390] SEQ ID NO: 18: loxp-KnaR-loxp reverse primer TTATTCGATTGGATTATCTACTTTATTACTATATTTCGGATAAAGCGTGGCTAGTGAACCTCTTCGAGGG

[0391] SEQ ID NO: 19: PhtrA-htrA-loxp-aadA-loxp forward primer GATAATGTATTCACAGGTTGCTCCGGGCTTGAAAAAGTTAAATGACATCCATTTGTCCTACTCAGGAGAGC

[0392] SEQ ID NO: 20: PhtrA-htrA-loxp-aadA-loxp reverse primer AAAAGGAACTTTTTACCTTTTCGCCTTCCCGTTTCGTTCAACTTAGTATACGAAGAAAGGCCCACCC

[0393] SEQ ID NO: 21: msbB-HR-loxp-KnaR-loxp forward primer AGGTAGTACAGGGTTTGTCAGCATAAAGCCTCTCTTACGAGAGGCTTTATGCCGATCATATTCAATAACCC

[0394] SEQ ID NO: 22: msbB-HR-loxp-KnaR-loxp reverse primer TCGCTACACTATTCACAATTCCTTTTCGCGTCAGCAGACCCTGGAAAAGCCTAGTGAACCTCTTCGAGGG

[0395] SEQ ID NO: 23: lpp-HR-loxp-KnaR-loxp forward primer CGGACAAAAAAATGGCGCACGATGTGCGCCATTTTATATTGTGCGTCAAAGCCGATCATATTCAATAACCC

[0396] SEQ ID NO: 24: lpp-HR-loxp-KnaR-loxp reverse primer AATACTTGTAACGCTACATGGAGATTAACTCAATCTAGAGGGTATTAATACTAGTGAACCTCTTCGAGGG

[0397] SEQ ID NO: 25: fliC-HR-loxp-KnaR-loxp forward primer GCTTTCGCTGCCTTGATTGTGTACCACGTGTCGGTGAATCAATCGCCGGAGCCGATCATATTCAATAACCC

[0398] SEQ ID NO: 26: fliC-HR-loxp-KnaR-loxp reverse primer ACGGTGAGAAACCGTGGGCAACAGCCCAATAACATCAAGTTGTAATTGATCTAGTGAACCTCTTCGAGGG

[0399] SEQ ID NO: 27: dapE (encoding succinyl-1,1-diaminopimelic acid desuccinylase, gene ID: 1254005)

[0400] SEQ ID NO: 28: htrA (encoding a serine protease, gene ID: 1251727)

[0401] SEQ ID NO: 29: hlyA (encoding Listeria hemolysin, Gene ID: 987033)

[0402] SEQ ID NO: 30: Promoter pepTp GCAGGGGTAAAAGTGACCTGACGCAATATTTGTCTTTTTCTTGCTTCTTAATAATGTTGTCACAAAAAGTGAGGGTGACTACATGG

[0403] SEQ ID NO: 31: Promoter fnrSp CGCCGCAAAGTTTGAGCGAAGTCAATAAACTCTCTACCCATTCAGGGCAATATCTCTCTTGCAGGTGAATGCAACGTCAAGCGAT

[0404] SEQ ID NO: 32: Promoter ysgAp TCAGAAGAAGCAAAAAGACACTTTACCGAAGGGTTTAACATTTTTTCGTGATACTCATCACCATGACGCAAATGCGTTGCATAAA

[0405] SEQ ID NO: 33: Promoter ssbp1 AACCGAGGTCACAACATAGTAAAAGCGCTATTGGTAATGGTACAATCGCGCGTTTACACTTATTCAGAACGATTTTTTTCAGGAG

[0406] SEQ ID NO: 34: Promoter Hip1 GGATAAAAGTGACCTGACGCAATATTTGTCTTTTCTTGCTTAATAATGTTGTCA

[0407] SEQ ID NO: 35: Promoter BBa_I14018 TGTAAGTTTATACATAGGCGAGTACTCTGTTATGG

[0408] SEQ ID NO: 36: Promoter BBa_R1074 TTAAATTTCCTCTCGTCAGGCCGGAATAACTCCCTATAATGCGCCACCACACTGATAGTGCTAGTGTAGATCAC

[0409] SEQ ID NO: 37: Promoter Ptet-Fnr AAAATTGATCTGAATCAATATTTTGACAAAAATTGATCTGAATCAATATTTACTGAGC

[0410] SEQ ID NO: 38: Promoter Ptet-arcA GTTAATAAAATGTTATTGACAGTTAATAAAATGTTATACTGAGC

[0411] SEQ ID NO: 39: Promoter PsseA TTAGCACGTTAATTATCTATCGTGTATATG

Claims

1. 1. A modified bacterium, said bacterium comprising a hypoxia-regulated essential gene expression cassette comprising an essential gene of said bacterium under the control of an obligate hypoxia-inducible promoter, said bacterium being deficient in at least one gene or its functional expression product involved in or regulating an endogenous antioxidant stress response pathway compared to an unmodified starting strain.

2. 2. The modified bacterium of claim 1, wherein the obligate hypoxia-inducible promoter is selected from the group consisting of pepTp, fnrSp, ysgAp, ssbp1, Hip1, BBa_I14018, BBa_R1074, Ptet-arcA, and Ptet-Fnr.

3. The modified bacterium of claim 1 , wherein the obligate hypoxia-inducible promoter is the ssbp1 promoter.

4. 4. The modified bacterium according to claim 1, wherein the expression product of the essential gene is involved in the synthesis of 2,6-diaminopimelic acid (DAP) in the bacterium, and when cultured under aerobic conditions, the growth of the bacterium is dependent on additional DAP or an analogue thereof being added to the medium.

5. 5. The modified bacterium of claim 4, wherein the essential genes are selected from dapA, dapB, dapD, dapE, argD, dapF, and any combination thereof.

6. The modified bacterium of claim 4 , wherein the essential genes are selected from dapA and dapE.

7. The modified bacterium according to any one of claims 1 to 6, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is an HtrA serine protease family gene.

8. The modified bacterium of any one of claims 1 to 7, wherein the functional expression product of a gene involved in or regulating the endogenous antioxidant stress response pathway is a protein related to the HtrA serine protease family.

9. The modified bacterium of any one of claims 1 to 8, wherein the bacterium is deficient in HtrA serine protease activity.

10. The modified bacterium according to any one of claims 1 to 9, wherein the gene involved in or regulating the endogenous antioxidant stress response pathway is htrA.

11. The modified bacterium of any one of claims 1 to 10, wherein the bacterium is defective with htrA.

12. 12. The modified bacterium of any one of claims 1 to 11, wherein the essential gene is a gene naturally occurring in the bacterial chromosome and the native promoter of the essential gene functionally replaces the obligate hypoxia-inducible promoter, such that expression of the essential gene in the bacterium is entirely under the control of the obligate hypoxia-inducible promoter.

13. 12. The modified bacterium of any one of claims 1 to 11, wherein the essential gene expression cassette is exogenous and an essential gene naturally occurring in the bacterial chromosome has been deleted or functionally inactivated, whereby expression of the essential gene in the bacterium is entirely under the control of the obligate hypoxia-inducible promoter.

14. The modified bacterium of claim 13 , wherein the exogenous essential gene expression cassette is integrated into the bacterial chromosome.

15. The modified bacterium of claim 13 , wherein the exogenous essential gene expression cassette is external to the bacterial chromosome.

16. 16. The modified bacterium of claim 15, wherein the exogenous essential gene expression cassette is present within a plasmid carried by the bacterium.

17. The modified bacterium of any one of claims 1 to 16, further comprising a pH-regulated expression cassette, the pH-regulated expression cassette comprising a gene encoding a bacterial hemolysin protein under the control of a promoter that is active under acidic pH conditions.

18. The modified bacterium of claim 17 , wherein the bacterial hemolysin protein is a gram-negative bacterial hemolysin protein.

19. 20. The modified bacterium of claim 18, wherein the gene encoding the Gram-negative bacterial hemolysin protein is hlyA or hlyE.

20. 20. The modified bacterium of claim 19, wherein the hlyA or hlyE is derived from Listeria monocytogenes, Vibrio cholerae, or Escherichia coli.

21. 21. The modified bacterium of any one of claims 17 to 20, wherein the promoter that is active under acidic pH conditions is active at a pH lower than 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, 6.0, 5.9, 5.8, 5.7, 5.6, or 5.

5.

22. 22. The modified bacterium of any one of claims 17 to 21, wherein the promoter that is active under acidic pH conditions is selected from the group consisting of sseA, ssrA, ssaB, ssaG, ssaM, and ssaR.

23. The modified bacterium of any one of claims 17 to 21, wherein the promoter that is active under acidic pH conditions is sseA.

24. The modified bacterium of any one of claims 1 to 23, wherein the unmodified starting strain is a facultative anaerobic bacterium.

25. The modified bacterium of any one of claims 1 to 24, wherein the bacterium is of the family Enterobacteriaceae.

26. 26. The modified bacterium of any one of claims 1 to 25, wherein the bacterium is a bacterium of the genera Escherichia, Salmonella, Shigella, Klebsiella, Yersinia, Citrobacter, Enterobacter, Serratia, Proteus, Morganella, Providencia, Hafnia, and Pantoea.

27. The bacteria may be Escherichia coli, Enterobacter blattae, Enterobacter fergusonii, Enterobacter hermannii, Enterobacter vulneris, Salmonella enterica, Salmonella bongori, Salmonella typhi, Salmonella choleraesuis, Salmonella typhimurium, Shigella disintegrata, Salmonella choleraesuis, Salmonella typhimurium, Shigella disintegrata, Salmonella choleraesuis, Salmonella choleraesuis, Salmonella typhimurium, Shigella disintegrata, Salmonella choleraesuis, Salmonella choleraesuis, Salmonella choleraesuis, Shigella disintegrata ... S. dysenteriae, S. flexneri, S. boydii, S. sonnei, K. pneumoniae, Klebsiella oxytoca, Y. pestos, Y. enterocolitica, Y. pseudotuberculosis, Y. aldovae, Y. bercovieri, Y. erythroderma ... Y. frederiksenii, Y. intermedia, Y. kristersenii, Y. mollaretti, Y. rohdei, Y. ruckeri, C. freundii, C. koseiri, C. braakii, Enterobacter aerogenes (E. aerogenes), Enterobacter cloacae (E. cloacae), Enterobacter gergoviae (E. gergoviac), Enterobacter sakazakii (E. sakazakii), Enterobacter tylorae (E. taylorae), Enterobacter amnigenus (E. amnigenus), Enterobacter intermedius (E. intermedius), Enterobacter asburiae (E. asburiae), Enterobacter cancelogenus (E. cancerogenus),Enterobacter dissolvens (E. dissolvens), Enterobacter nimipressuralis (E. nimipressuralis), Serratia marcescens (S. marcescens), Serratia entomophila (S. entomophila), Serratia ficaria (S. ficaria), Serratia fonticola (S. fonticola), Serratia grimeshii (S. grimeshii mesii), Serratia liquefaciens (S. liquefaciens), Serratia odorifera (S. odorifera), Serratia plymuthica (S. plymuthica), Serratia proteamaculans (S. proteamaculans), Serratia rubidaea (S. rubidaea), Serratia ureilytica (S. ureilytica), Proteus mirabilis (P. m irabilis), Proteus vulgaris (P. vulgaris), Proteus myxofaciens (P. myxofaciens), Proteus penneri (P. penneri), Proteus hauseri (P. hauseri), Morganella morganii (M. morganii), Providencia alcalifaciens (P. alcalifaciens), Providencia rustigianii ( 27. The modified bacterium of any one of claims 1 to 26, wherein the bacterium is selected from the group consisting of P. rustigianii, P. stuartii, P. rettgeri, P. heimbochae, H. alvei, and P. agglomerans.

28. The modified bacterium of any one of claims 1 to 27, wherein the bacterium is Salmonella typhimurium.

29. 29. The modified bacterium of claim 28, wherein the starting strain is Salmonella typhimurium SL7207.

30. The modified bacterium of any one of claims 1 to 29, wherein the bacterium expresses wild-type lipopolysaccharide (LPS).

31. The modified bacterium of any one of claims 1 to 30, wherein the bacterium, when administered to a subject having a tumor, has the ability to survive and grow in tumor tissue and is rapidly eliminated in normal tissue.

Images