Childcare neglecting model animal

Abstract

To provide a novel model animal that has abnormal childcare actions.SOLUTION: A childcare neglecting model animal is a non-human mammalian that is suppressed in expression of a Rabep1 gene.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to an animal model for child abandonment and a method for screening for means for preventing and / or ameliorating child abandonment. [Background technology]

[0002] Child abandonment is one of the major problems in modern society, where the birthrate is declining and the population is aging. The causes of child abandonment are assumed to be social, economic, and psychological stress on the caregiver, but the process that leads to this behavior is not fully understood. Parenting behavior is an efficient behavior for the survival of the species. It is particularly important in mammals, whose offspring are born in a relatively immature state. However, the brain mechanisms that induce this behavior remain unclear.

[0003] In mice (Mus musculus), a model animal, parenting behavior is thought to have the following three hierarchical levels: (a) the mother recognizes her pups using hearing, touch, smell, etc.; (b) the mother decides that the pups are her object of care; and (c) the mother initiates parenting behavior. Prolactin-deficient mice and oxytocin-deficient mice have been reported as mice that exhibit child abandonment-like behavior (Non-Patent Documents 1 and 2). Prolactin-deficient mice are clearly abnormal in the above-mentioned hierarchy (c). Oxytocin-deficient mice are thought to be abnormal in the above-mentioned hierarchy (c), although there are some aspects that remain unclear. [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] TJSairenji et al.,Proceedings of the National Academy of Sciences,2017,Vol.114,No.49.p.13042-13047 [Non-Patent Document 2] DDFrancis et al.,Journal of Neuroendocrinology,2002,Vol.14,No.5.p.349-353 Summary of the Invention [Problem to be solved by the invention]

[0005] In order to establish technology aimed at improving parenting behavior, the inventors believed that by using a new model animal with abnormalities in parenting behavior and understanding its molecular mechanisms, it would be possible to develop methods that would contribute to improving parenting behavior and lead to major progress. An object of the present invention is to provide an animal model of child abandonment and a screening method for means for preventing and / or ameliorating child abandonment. [Means for solving the problem]

[0006] The present inventors have found that female mice lacking the Rabep1 gene frequently exhibit behavior resembling child abandonment. Based on this discovery, the present invention has been completed through further investigation. The present invention includes the following aspects [1] to [5]. [1] A model animal of child abandonment, a non-human mammal in which expression of the Rabep1 gene is suppressed. [2] The abandonment model animal described in [1], which is a non-human mammal lacking the Rabep1 gene. [3] The abandonment model animal described in [2], which is homozygous. [4] The model animal of child abandonment described in any one of [1] to [3], which is a mouse (Mus musculus). [5] A step of comparing the parenting behavior of the child-abandonment model animal according to any one of [1] to [4] that has been subjected to a test treatment with the parenting behavior of a control model animal; and A method for screening for means for preventing and / or improving neglect, comprising a step of selecting the test treatment as a candidate means for preventing and / or improving neglect when a non-human animal subjected to the test treatment shows improved neglect compared to the control model animal. Effect of the Invention

[0007] INDUSTRIAL APPLICABILITY The present invention provides an animal model for child abandonment and a method for screening means for preventing and / or ameliorating child abandonment. [Brief description of the drawings]

[0008] [Figure 1] Figure 1A shows a schematic diagram of the Rabep1 locus in Rabep1 knockout mice, and Figure 1B shows the results of Western blotting analysis. [Diagram 2] FIG. 2 shows the results of Example 1. [Diagram 3] FIG. 3 shows the results of Example 2. [Figure 4-1] Figure 4-1 shows the first half of the base sequence of NM_001291141.1 (sequence number 4). [Figure 4-2] Figure 4-2 shows the latter half of the base sequence of NM_001291141.1 (sequence number 4). [Diagram 5] FIG. 5 shows the amino acid sequence of NP_001278070.1 (sequence number 5). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0009] [Animal model for child neglect] The model animal of child abandonment of the present invention is a non-human mammal in which expression of the Rabep1 gene is suppressed. <Animal model for child abandonment> The model animal of child abandonment of the present invention exhibits child abandonment-like behavior. The term "abandonment-like behavior" refers to abnormalities in the parenting behavior (also called maternal behavior) that non-human mammalian mothers normally exhibit during pregnancy and after birth. For example, in the case of a mouse non-human mammal, such parenting behaviors include nest building, carrying pups to the nest, licking pups, and nursing pups.

[0010] Representative parenting behaviors are described below. Nest construction: Mother mice build larger and deeper nests than usual from around the time they are pregnant. This is to keep the baby mice warm and protect them from predators. Carrying baby mice to the nest: After giving birth, the mother mouse carries the baby mice to the nest and gathers them in one place. If the baby mice leave the nest or move to a different nest, she also carries the baby mice. Multiple baby mice are gathered together so that they come into contact with each other. Licking of pups: Mother mice lick their pups' bodies, especially their perineum, to cleanse them and encourage them to excrete. This behavior is called licking. Nursing the baby mice: Because baby mice cannot move or hunt on their own, mother mice nurse their babies. The mother mouse assumes a nursing posture that exposes her nipples to the baby mice. The baby mice find the nipples using their sense of smell and touch and suck the milk.

[0011] Such parenting behavior in mice is known and is outlined in, for example, KOKURODA, KAGAKU TO SEIBUTSU, 2013, Vol. 51, No. 11, p. 745-753.

[0012] Abnormalities in parenting behavior can be appropriately evaluated by those skilled in the art. The evaluation may be either qualitative or quantitative. Quantitative evaluation is preferred, and more preferably, the evaluation can be performed by testing for statistical significance.

[0013] <Non-human mammals> The non-human mammal may be any species of non-human mammal, so long as it exhibits parenting behavior and has the Rabep1 gene. Examples of such mammals include apes such as monkeys, rodents (rodents), rabbits, cats, dogs, horses, and cows. From the viewpoint of ease of handling as experimental animals, rodents such as mice, rats, guinea pigs, and hamsters are preferred, and mice are more preferred from the viewpoint of ease of genetic modification. Particularly preferred examples of mice (Mus musculus) include mice belonging to inbred strains such as C56BL / 6, C57BL / 6, and BALB / c. The animal model of child abandonment is a female individual of non-human mammals.

[0014] <Rabep1 gene> The Rabep1 gene (RAB GTPase binding effector protein 1; also called Rabaptin-5) is a known gene that encodes the Rabep1 protein. The Rabep1 protein is known to localize to endosomes in cells. The Rabep1 protein is a molecule involved in vesicular transport and is specifically thought to be involved in the membrane fusion of early endosomes.

[0015] For example, the Rabep1 gene of Mus musculus is located on chromosome 11 of the mouse. The genomic sequence of chromosome 11 of Mus musculus, the nucleotide sequence of the cDNA of the Rabep1 gene, and the amino acid sequence of the Rabep1 protein are registered in GenBank provided by the National Center for Biotechnology Information (NCBI) in the United States under the following accession numbers (when multiple revisions are registered, it is understood to refer to the latest revision): Mouse chromosome 11: NC_000077 (NC_000077.7) Mouse Rabep1 gene: NM_001291141 (NM_001291141.1), NM_001291142 (NM_001291141.1), NM_001291143 (NM_001291143.1), NM_019400 (NM_019400.3) Mouse Rabep1 protein: NP_001278070 (NP_001278070.1), NP_001278071 (NP_001278071.1), NP_001278072 (NP_001278072.1), NP_062273 (NP_062273.2)

[0016] As an example of the nucleotide sequence of the cDNA of the Rabep1 gene, the nucleotide sequence of NM_001291141.1 (SEQ ID NO: 4) is shown in FIGS. 4-1 and 4-2. As an example of the amino acid sequence of the Rabep1 protein, the amino acid sequence of NP_001278070.1 (SEQ ID NO: 5) is shown in FIG. 5.

[0017] <Suppression of functional expression of the Rabep1 gene> The abandoned infant model animal of the present invention is a non-human mammal in which the functional expression of the Rabep1 gene is suppressed. "Suppression of the functional expression of the Rabep1 gene" refers to any mode of suppressing the functional expression of the Rabep1 gene. As non-limiting examples, deletion of the Rabep1 gene, inhibition of the functions of the Rabep1 gene and / or the Rabep1 protein encoded by the Rabep1 gene, suppression of the expression of the Rabep1 protein (such as suppression of transcription of the Rabep1 gene, suppression of translation of the Rabep1 protein, etc.) and the like can be mentioned.

[0018] As a preferred embodiment of the non-human mammal in which the functional expression of the Rabep1 gene is suppressed, a non-human animal in which the Rabep1 gene is deleted (knocked out) can be mentioned. The mode in which the Rabep1 gene is deleted includes a mode in which one or more bases are deleted in the region encoding the Rabep1 gene and part or all of the region is absent; a mode in which one or more bases are substituted or inserted in the region encoding the Rabep1 gene and the functional expression of the normal Rabep1 gene is suppressed, and the like. A non-human animal in which the Rabep1 gene is deleted can be produced by known methods. Such methods include genome editing techniques such as the CRISPR / Cas9 method and the TALEN method; other genetic engineering techniques such as the homologous recombination method and the gene trap method; random mutagenesis techniques using mutagens such as drugs, ultraviolet rays, and radiation, and the like. As a mode in which the Rabep1 gene is deleted, conditional knockout in which the Rabep1 gene is deleted specifically in cells / tissues and specifically in terms of time can also be mentioned.

[0019] A non-human animal lacking the Rabep1 gene is preferably a homozygote lacking both alleles.

[0020] Another embodiment of a non-human mammal in which the functional expression of the Rabep1 gene is suppressed includes a non-human mammal that has been administered or is capable of expressing a nucleic acid capable of suppressing the functional expression of the Rabep1 gene, such as an RNA molecule having RNA interference (RNAi) activity targeting the mRNA encoding the Rabep1 protein, such as siRNA, shRNA, or dsRNA, or an miRNA that can suppress the translation of the mRNA encoding the Rabep1 protein. Another embodiment of the non-human mammal in which the functional expression of the Rabep1 gene is suppressed includes a non-human mammal to which an antibody specific to the Rabep1 protein or another inhibitor specific to the Rabep1 protein has been administered.

[0021] The model animal of child neglect of the present invention can be used, for example, in a screening method for means for preventing and / or ameliorating child neglect, and a method for evaluating means for preventing and / or ameliorating child neglect, which will be described later.

[0022] [Screening method for preventive measures and / or remedial measures for child neglect] As one use of the above-mentioned model animal for child abandonment, the present invention also provides a method for screening for means for preventing and / or ameliorating child abandonment. The screening method for preventing and / or improving child abandonment of the present invention includes a step of comparing the parenting behavior of the above-mentioned child abandonment model animal subjected to a test treatment with the parenting behavior of a control model animal; If the non-human animal administered the test treatment shows improved abandonment compared to the control non-human animal, the test treatment is selected as a candidate for a means of preventing and / or improving abandonment.

[0023] Preventive measures for neglect are measures that prevent or delay for a certain period the occurrence of neglect. Preventive measures for neglect also include measures to prevent recurrence. Measures to improve child neglect refer to measures to improve existing child neglect and promote parenting behavior.

[0024] The test means are not particularly limited, so long as they are potential candidates for effective means for preventing and / or ameliorating child neglect. In one embodiment, the test means is administration of a candidate substance. The test substance is not particularly limited as long as it is a candidate substance that can prevent and / or ameliorate child abandonment by administration. The candidate substance may be any of a single substance, a natural compound (e.g., a substance derived from a living body), or a synthetic compound. Specific examples of the test substance include, but are not limited to, low molecular weight compounds, proteins such as antibodies, nucleic acids that can suppress protein expression (e.g., siRNA, shRNA, dsRNA, miRNA, etc.), sugar chains, or complex carbohydrates. The means of administration of the candidate substance may include oral administration, transdermal administration, injection administration, intravenous administration, and the like.

[0025] In another embodiment, the test means is an environmental change, such as temperature, humidity, air pressure, brightness, noise, and gas concentration such as oxygen and carbon dioxide. In still another embodiment, the test means is the imposition or reduction of physical or mental stress.

[0026] The control model animal is, for example, the above-mentioned untreated neglected model animal, the above-mentioned neglected model animal that has been subjected to a treatment other than the test means, etc., and can be appropriately selected by those skilled in the art. Comparison of parenting behaviors and evaluation of whether or not child neglect has improved can be performed appropriately by those skilled in the art.

[0027] According to the present invention, candidates for preventive measures and / or ameliorative measures for child abandonment are selected. The treatment target of the selected preventive and / or ameliorative measures for neglect is not limited to the same mammalian species as the neglect model animal, and may be a different mammalian species, including humans. A method comprising a step of comparing the parenting behavior of a child-neglecting model animal of the present invention that has been subjected to a test treatment with the parenting behavior of a control model animal can also be used as a method for evaluating the test treatment. EXAMPLES

[0028] The present disclosure will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0029] (1) Rabep1 knockout mice The Rabep1 knockout mice were established by generating individuals from mouse ES cells in which the Rabep1 gene was knocked out, obtained from the Animal Resource Development Research Facility of the Center for Resource Development and Life Sciences, Kumamoto University. Specifically, the mouse ES cells in which the Rabep1 gene was knocked out were clones prepared by the gene trapping method according to the description of Patent No. 5935692, and the insertion site of the trap vector was identified by genome sequencing from a population in which the trap vector was inserted into the genome in a shotgun fashion. In Rabep1 knockout mice, two copies of a trap vector (pU-21W) are inserted between exons 1 and 2 of the Rabep1 gene.

[0030] A schematic diagram of the Rabep1 locus is shown in Figure 1A. The trap vector was inserted between exon 1 and exon 2, preventing correct splicing between exon 1 and exon 2, and the resulting stop codon suppresses full-length expression of the Rabep1 gene.

[0031] Rabep1 knockout mice were maintained in an environment with a 12-hour / 12-hour day / night cycle, a temperature of 23°C, and a humidity of 55%. Food and water were available ad libitum.

[0032] Rabep1 knockout mice were genotyped by genomic PCR using the following primers: Primer B0662: GATCTACTTCTATCCACATCCC (SEQ ID NO: 1) B0663: CAACCTCCGCAAACTCCTAT (SEQ ID NO: 2) B0664: GTCCAAGGGTATTGCTTCAC (SEQ ID NO: 3) Primer B0662 is a sequence upstream of the insertion position of the trap vector, primer B0663 is a sequence downstream within the trap vector, and primer B0664 is a sequence downstream of the insertion position of the trap vector. When a three-primer set consisting of primers B0662, B0663 and B0664 is used, a 398 bp PCR product is amplified from the genome into which the trap vector has been inserted using primers B0662 and B0663, and a 557 bp PCR product is amplified from the genome into which the trap vector has not been inserted using primers B0662 and B0664.

[0033] The Rabep1 knockout mouse homozygous Ho was born to a female heterozygous mouse He.

[0034] (2) Western blotting analysis Western blotting analysis was performed according to the literature: S. Suzuki et al., Journal of Neuroscience, 2007, Vol. 27, No. 24, p. 6417-6427 and T. Ochiishi et al., Scientific Reports, 2019, Vol. 9, No. 1, p. 17368. Specifically, the cerebrum and hippocampus were dissected from each genotype mouse in ice-cold dACSF (dissecting artificial cerebrospinal fluid) and stored at -80°C. The collected brain tissue was homogenized in ice-cold TBS buffer or RIPA buffer (Nacalai Tesque, Inc.) containing 1% Triton-X100. The supernatant was collected by centrifugation at 10,000×g for 30 minutes. The total protein concentration in the supernatant was measured using a BCA assay kit (Thermo Fisher Scientific). Each sample was applied at 10 μg protein / lane (10 μg in the figure) and twice the amount (20 μg in the figure) to SDS-PAGE, and then transferred to a PVDF membrane. The PVDF membrane was reacted with the primary antibody diluted with Blocking One (Nacalai Tesque, Inc.) overnight at 4° C. Then, the secondary antibody was reacted at room temperature for 30 minutes. As the primary antibody, anti-Rabep1 monoclonal antibody (BD Biosciences) was used at a dilution of 1:8000. As the secondary antibody, HRP-labeled anti-mouse antibody (FUJIFILM Wako Pure Chemical Industries, Ltd.) was used. After washing, the membrane was reacted with Immobilon Forte Western HRP substrate (Merck), and signals were detected using ImageQuant LAS 500 (Cytiva).

[0035] The results are shown in Figure 1B. In wild-type mice (+ / +), a protein equivalent to 110 kDa was clearly detected, whereas in Rabep1 knockout heterozygote mice (+ / -), the band was reduced, and in Rabep1 knockout homozygote mice (- / -), the band was not detected at all. This revealed that expression of the Rabep1 protein was suppressed in the Rabep1 knockout homozygous model.

[0036] (3) Example 1: Observation of parenting behavior For each genotype, wild type Wt, Rabep1 knockout heterozygote He, and Rabep1 knockout homozygote Ho, mice aged 9 to 15 weeks were used for observing parenting behavior. Male and female mice of different genotypes were mated. After pregnancy was confirmed, the female mice were kept individually and the birth and nursing behavior was observed. Since the mother mouse is nursing, it is desirable to have an environment that is not stressful and does not threaten the survival of the mother mouse. Therefore, after birth was confirmed, the experiment staff did not touch the cage or interfere with the mother mouse. Behavior was recorded with a video camera, and when observing the behavior of mother mice toward their pups, the environment was open but the illuminance was set to 20 lux to reduce stress.

[0037] A typical example of wild-type Wt is shown in Figures 2A and 2B. After giving birth, wild-type (Wt) mothers exhibited characteristic parenting behaviors, such as building a nest, licking the pups, nursing the pups, and carrying the pups to the nest. As shown in the figure, we were able to confirm that they formed a nest (Fig. 2A, upper panel) and gathered the pups to the nest (Fig. 2A, lower panel). Rabep1 knockout homozygous mice were left to give birth to pups (Fig. 2B). The figure shows the state of the pups within 24 hours after birth, with the arrow indicating the mother mouse and the arrowhead indicating the pups. Videotapes confirmed that the pups did not exhibit behaviors such as nursing or carrying them to the nest.

[0038] One week after birth, the live / dead mice were checked, and the results of judging whether or not they were nursing are shown in Figure 2 C. If the live mice were alive after one week, they were judged as nursing, and if they were not alive, they were judged as neglecting. FIG. 2C shows the ratio of abandonment to the total number of caregiving + abandonment (Neglect (ratio)) for each of the female genotypes Wt, He, and Ho. It was revealed that Rabep1 knockout homozygous mice frequently exhibited neglect-like behavior.

[0039] (4) Example 2: Evaluation of genotype-dependent abandonment-like behavior We assessed whether the neglect-like behavior observed above was dependent on the female or male genotype.

[0040] Figure 3A plots parenting behavior by mating male genotype (male / Wt, male / He, male / Ho) in groups with female genotypes of Wt, He, and Ho. There was no tendency for parenting behavior to depend on the mating male in any of the female genotypes. Figure 3B plots parenting behavior by female genotype (female / Wt, female / He, female / Ho) in groups with mating male genotypes of Wt, He, and Ho. Parenting behavior depended on the female genotype regardless of the mating male genotype.

[0041] We investigated the possibility that the abandonment-like behavior was due to poor growth of the mother mice. FIG. 3C shows the body weight (g) of each mother mouse genotype. Body weight, an index of growth, did not differ between wild-type and Rabep1 knockout mice, suggesting that neglect-like behavior is unlikely to be a phenotype dependent on poor growth or other factors.

[0042] These results suggest that Rabep1 knockout homozygous mice frequently exhibit neglect-like behavior. There is no clear causal relationship between the Rabep1 gene and neglect behavior. Therefore, it is expected that this study will contribute to the development of treatment methods at a different level from previously reported model animals for neglect.

Claims

1. A model animal of child abandonment, which is a non-human mammal in which expression of the Rabep1 gene is suppressed.

2. The model animal of claim 1, which is a non-human mammal lacking the Rabep1 gene.

3. The abandonment model animal of claim 2, which is homozygous.

4. The model animal of claim 1 , which is a mouse (Mus musculus).

5. A step of comparing the parenting behavior of the child-abandonment model animal according to any one of claims 1 to 4 that has been subjected to a test treatment with the parenting behavior of a control model animal; and A method for screening for means for preventing and / or improving neglect, comprising a step of selecting the test treatment as a candidate means for preventing and / or improving neglect if a non-human animal subjected to the test treatment shows improved neglect compared to the control model animal.

Images