Cell compositions derived from dedifferentiated reprogrammed cells

Abstract

To provide pancreatic endoderm cell populations, and to provide methods of producing insulin.SOLUTION: Provided is an in vitro human pancreatic endoderm cell population comprising differentiated cells derived from dedifferentiated genetically reprogrammed cells and an ERBB receptor tyrosine kinase activating agent. In one aspect, the ERRB receptor tyrosine kinase activating agent comprises an EGF growth factor or ligand, and the EGF growth factor or ligand comprises a heregulin isoform selected from the group consisting of heregulin-1, heregulin-2, and heregulin-3 and heregulin-4.SELECTED DRAWING: None

Description

[Technical field]

[0001] (CROSS REFERENCE TO RELATED APPLICATIONS) This application is a continuation of U.S. patent application Ser. No. 13 / 761,078, filed Feb. 6, 2013. Title: CELL COMPOSITIONS DERIVED FROM DEDIFFE It claims priority over RENTIATED REPROGRAMMED CELLS, which , U.S. Patent Application Serial No. 12 / 765,714, filed April 22, 2010, entitled CE LL COMPOSITIONS DERIVED FROM DEDIFFERENT IATED REPROGRAMMED CELLS, which is a continuation-in-part of U.S. 119(e) of the U.S. Provisional Patent Application No. 2009-002166 filed on April 22, 2009. No. 61 / 171,759, Title: CELL COMPOSITIONS DERIVED FROM DEDIFFERENTIATED REPROGRAMMED CELLS No. 60 / 339,933, filed on Oct. 13, 2003, the disclosures of which are incorporated herein by reference in their entireties. Can be enjoyed.

[0002] Sequence Listing This application has been filed with a sequence listing in electronic format. The sequence listing was It was created on January 28th, named CYTHERA068P1.TXT and is 8. The electronic format of the sequence listing is provided in a 92 Kb file. Fully incorporated in the specification.

[0003] The present invention relates generally to the isolation, maintenance and use of cell cultures. More specifically, the present invention relates to The invention relates to cell compositions derived from induced pluripotent stem cells. [Background technology]

[0004] An important application of pluripotent cells is their use in cell therapy. These include, but are not limited to, human embryonic stem (hES) cells, and human embryonic germ (hEG) cells. Additionally, other types of pluripotent cells exist, e.g., dedifferentiated mouse and human Stem cells, i.e. differentiated somatic adult cells, can dedifferentiate to become pluripotent-like stem cells. These dedifferentiations are induced to establish cells with similar pluripotency and growth capacity. The resulting cells are called "induced pluripotent stem (iPS) cells," "embryonic stem cell-like cells," and "ES-like cells." or their equivalents. Such cells are potentially viable alternative pluripotent Therapeutic applications of iPS cells include clinical trials for treating diabetes and other diseases. Clinical trials have demonstrated that these cells are stable and exhibit an appropriate safety profile. Reprogramming differentiated human somatic cells to a pluripotent state is necessary for patients and and disease-specific stem cells. Takahashi, K. et al. Cell, 1-12, 2 See, e.g., 2007 and Ju, J. et al. Science 2007. and Ju et al. used four genes in adult and fetal / neonatal cells to generate iPS cells. Oct4, Sox2, Klf4 and c-myc, Ta Kahashi et al.; Oct4, Sox2, Nanog and Lin28, Ju et al. Even in these cases, iPS cells have the same morphology, marker expression, long-term proliferation, and normal They had some characteristics of hES cells, such as karyotype and pluripotency.

[0005] iPS cells could provide cell therapy-based regenerative medicine without the associated ethical controversies. However, the differentiation properties of iPS cells, such as their in vitro differentiation potential and differentiation efficiency, The mechanism of differentiation is still unclear, and no directed differentiation method for iPS cells has been demonstrated. Therefore, there is a need to determine and demonstrate the detailed differentiation characteristics and directed differentiation efficiency of iPS cells. Summary of the Invention [Problem to be solved by the invention]

[0006] The embodiments described herein relate to pluripotent cells, such as induced pluripotent stem (iPS) cells. Cell compositions derived from the dedifferentiated reprogrammed cells are provided. [Means for solving the problem]

[0007] One embodiment includes compositions comprising human cells and in vitro cell cultures comprising human cells. The present invention provides a method for producing an embryo, wherein at least about 15% of the human cells are definitive endoderm cells, The somatic cells are derived from the dedifferentiated genetically reprogrammed cells. Definitive endoderm cells are multicellular organisms that can differentiate into cells of the gut or organs derived therefrom. They are differentiated cells.

[0008] Another embodiment relates to compositions comprising human cells and in vitro cell culture media comprising human cells. The present invention provides a method for producing a culture, wherein at least about 15% of the human cells are in the pancreatic-duodenal homeobox. PDX1-positive foregut endoderm cells, are derived from dedifferentiated genetically reprogrammed cells. In one embodiment, the PDX 1-positive foregut endoderm cells co-localized with PDX1, SOX9, PROX1, and HNF6. It's positive.

[0009] Further embodiments include compositions comprising human cells and in vitro cells comprising human cells. The present invention provides a method for producing a cell culture, wherein at least about 15% of the human cells are pancreatic-duodenal homeoblastic cells. pancreatic progenitor cells positive for probox 1 (PDX1) and PDX1-positive pancreatic progenitor cells are derived from dedifferentiated genetically reprogrammed cells. In one embodiment, the PDX 1 positive pancreatic progenitor cells are co-positive for PDX1 and NKX6.1.

[0010] Yet another embodiment provides compositions comprising human cells and in vitro methods comprising human cells. o A method of producing a cell culture is provided, wherein at least about 15% of the human cells are from Neurogenomic NGN3 (nin3)-positive endocrine precursor cells. NGN3 endocrine precursor cells dedifferentiate. In one embodiment, the gene is derived from a genetically reprogrammed cell that is NGN3 positive. Secretory progenitor cells are co-positive for NGN3, PAX4 and NKX2.2. Further embodiments of the cell culture compositions described herein include those comprising dedifferentiated genetically transformed cells. Differentiated cells derived from programmed cells and ERBB receptor tyrosine kinase The present invention includes an in vitro human pancreatic endoderm cell culture comprising an enzyme activating agent. Additional embodiments described herein relate to methods of producing insulin. In such an embodiment, the method includes: (a) culturing a dedifferentiated genetically reprogrammed At least a foregut endoderm cell culture and / or at least a PDX derived from the cells 1. Negative Foregut Endoderm Cell Cultures were Treated with ERBB Receptor Tyrosine Kinase Activators in vitro and contacting in vitro, thereby obtaining pancreatic endocrine cells, including endocrine and non-endocrine cell subpopulations. (b) generating a pancreatic endoderm cell population from step (a) or The cell subpopulation of step (a) is transplanted and matured in vivo, thereby producing insulin. obtaining insulin-secreting cells, the insulin-secreting cells being capable of secreting insulin in response to glucose stimulation; and secreting insulin. Yet other embodiments described herein include a method of producing insulin, comprising: (a) Dedifferentiated genetically reprogrammed cells were transformed with TGFβ receptor family members. contacting the cells in vitro with a first medium containing an agent that activates the member; and (b) in a second medium lacking an agent that activates TGFβ receptor family members. Culturing the cells of step (a) in vitro, thereby generating at least one foregut endoderm. generating cells and / or at least PDX1-negative foregut endoderm cells; ) contacting the cell of step (b) with an ERBB receptor tyrosine kinase activating agent; thereby generating a cell population comprising endocrine cells and non-endocrine cell subpopulations. (d) culturing the cell population of step (c) or a subpopulation of cells of step (c) in vivo; and maturing the cells to obtain insulin-secreting cells. and wherein the insulin-secreting cells secrete insulin in response to glucose stimulation. Still other embodiments described herein relate to a method for producing at least foregut endoderm cells, at least At least PDX1-negative foregut endoderm cells and / or at least PDX1-positive pancreatic endoderm cells contacting the population of cells with an ERBB receptor tyrosine kinase activating agent, thereby and capable of maturing in vivo into glucose-responsive insulin-secreting cells. It concerns generating populations. Still other embodiments described herein comprise at least foregut endoderm cells, at least Contains PDX1-negative foregut endoderm cells and / or at least PDX1-positive pancreatic endoderm cells The population was treated with ERBB receptor tyrosine kinase activators and rho kinase inhibitors. and thereby maturing in vivo into glucose-responsive insulin-secreting cells. The present invention relates to generating a cell population capable of As used herein, the phrases "at least foregut endoderm cells," "at least PDX "PDX1-negative foregut endoderm cells" and "at least PDX1-positive pancreatic endoderm cells" are cell populations Some or a portion of the cells are derived from iPSCs to the foregut during their differentiation into pancreatic islet cells. endoderm cells or more, iPSC to PDX1-negative foregut endoderm cells or more, and / or iPSCs have been differentiated into PDX1-positive pancreatic endoderm cells or higher. This means: As used herein, when referring to cells of a cell population, the terms "some" and "some" are used interchangeably. and / or "a portion" means that at least 5%, at least 10%, at least 15%, %, at least 20%, at least 25%, at least 30%, at least 35%, at least at least 40%, at least 45%, at least 50%, at least 55%, at least 6 0%, at least 65%, at least 70%, at least 75%, at least 80%, at least at least 85%, at least 90%, at least 95% or more than 95% It is meant to include cells of the specified cell type. [Brief description of the drawings]

[0011] [Figure 1]1 is a photographic image of an aggregated suspension culture of dedifferentiated reprogrammed cells, or cells also referred to herein as iPS cells.

[0012] [Figure 2A-L] Bar graphs showing relative gene expression levels of OCT4 (Figure 2A), BRACHYURY (Figure 2B), CER1 (Figure 2C), GSC (Figure 2D), FOXA2 (Figure 2E), FOXA1 (Figure 2F), HNF6 (Figure 2G), PDX1 (Figure 2H), PTF1A (Figure 2I), NKX6.1 (Figure 2J), NGN3 (Figure 2K) and INS (Figure 2L). Expression levels are normalized to the average expression levels of housekeeping genes, cyclophilin G and TATA binding protein (TBP) expression. Graphs represent fold upregulation from the lowest data point in the dataset.

[0013] [Figure 3A-3D] Immunocytochemistry (ICC) micrographs of human iPS cell cultures from stage 4 differentiation using antibodies specific for (3A) PDX-1; (3B) NKX6.1; (3C) PTF1A; and (3D) Dapi.

[0014] [Figure 4A-4D] Photographs of immunocytochemistry (ICC) of iPS cell cultures from stage 4 differentiation using ligands specific for (FIG. 4A) glucagon, (FIG. 4B) insulin, (FIG. 4C) somatostatin, and (FIG. 4D) Dapi. [Figure 5A-B] FIG. 5 shows an array location map and array key provided with the Proteome Profiler™ Human Phospho-RTK Antibody Array from R&D Systems. The location map in FIG. 5A shows the coordinates or locations of the RTK antibodies. The RTK family and antibody identity or name are listed in the key in FIG. 5B. Thus, a positive signal observed in the developed film can be identified by overlaying a transparency as in FIG. 5A and identifying the signal by referencing the coordinates above the overlay (FIG. 5A) with the name of the RTK in FIG. 5B. [Figure 6A-D] Figure 1 shows RTK array analysis of iPS cell-derived pancreatic endoderm cells (PEC) under four different conditions (Figures A, B, C and D, as described in Example 5). Tyrosine phosphorylation of specific RTKs is observed by identification of high to low intensity signals. IGF 1R / IR and ERBB (EGFR) family members are identified or boxed. [Figure 7A-C] Graphs showing concentrations of human C-peptide and insulin in serum of transplanted mice from experiments E2314, E2356 and E2380 (FIG. 7A), E2347 (FIG. 7B) and E2354 (FIG. 7C) as shown in Table 9. Mice transplanted with PECs were analyzed at the indicated post-implantation time points for serum levels of human C-peptide, fasting, and 30 and 60 minutes after intraperitoneal glucose administration. In FIG. 7C, PECs were encapsulated with a cell encapsulation device (Encaptra® EN20 or EN20, ViaCyte, San Diego, CA), and in some cases the device had microperforations (pEN20, ViaCyte, San Diego, CA). Such devices are described in U.S. Pat. No. 8,278,106, the disclosure of which is incorporated herein by reference in its entirety. [Figure 8A-8B] 8A-8B are graphs showing the results of blood glucose analysis of STZ-treated mice from experiment #2347. FIG. 8A shows blood glucose for each of the 13 mice (baseline with and without Heregulin) and FIG. 8B shows the combined average measurements for each treatment (baseline with and without Heregulin). For 13 mice implanted with iPEC grafts up to 14 days prior to treatment with STZ (day 0), random non-fasting blood glucose level measurements are shown for the same mice after STZ treatment and after explantation of the grafts. STZ-treated animals received STZ approximately 26 weeks after implantation of the graft (day 0). 28 weeks after implantation of the graft, iPEC grafts were explanted (removed) approximately 2 weeks after the start of STZ treatment. Non-fasting blood glucose measurements were collected over time for each animal. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0015] The present invention is further illustrated by the following detailed description of preferred embodiments and examples of the invention contained herein. It can be easily understood by referring to the description. However, the present compounds, compositions, Prior to the disclosure and description of the methods, the present invention relates to a method for producing a cell culture medium comprising the steps of: It is understood that the present invention is not limited to specific conditions, or specific methods, and as such may vary. Numerous modifications and variations will be apparent to those of ordinary skill in the art. The terminology used is for the purpose of describing particular embodiments only and is not intended to be limiting. It should also be understood that

[0016] definition The numerical ranges expressed herein are inclusive of the stated endpoints and are not intended to limit the range of values. It will be understood that all integers between are intended to be included.

[0017] Unless otherwise noted, terms used herein are defined in accordance with conventional usage by those of ordinary skill in the art. It is understood that for purposes of this specification and the appended claims, unless otherwise specified, Unless otherwise stated, the amounts of ingredients, materials and All percentages or ratios, numbers expressing reaction conditions, and other numerical values ​​are expressly intended to be "about" in all cases. Therefore, any reference to the contrary should be understood as being modified by such terms. Unless otherwise specified, the numerical performance data set forth in the following specification and the appended claims The parameters are approximations that may vary depending on the desired properties to be obtained by the present invention. At a minimum, and without intending to limit the application of the doctrine of equivalents to the scope of the claims, Parameters should be rounded to at least the number of significant digits reported and to within the bounds of normal rounding techniques. It should be interpreted by applying the law.

[0018] The practice of the embodiments described herein may involve, but is not limited to, cell biology, genomics, and / or immunology. Conventional techniques in molecular biology, genetics, chemistry, microbiology, recombinant DNA, and immunology are used. can be.

[0019] In this specification and the appended claims, the singular forms "a," "an," and "th" are used interchangeably. "e" should be understood to include the plural unless the context clearly dictates otherwise. Thus, for example, reference to a "cell" includes reference to one or more of such distinct cells. The invention includes, and references to "methods" include, modifications or substitutions for the methods described herein. References to equivalent steps and methods known to those skilled in the art that can be used to

[0020] The term "cell" as used herein refers to an individual cell, a cell line, or a A "culture" refers to a culture derived from such cells. The term refers to a composition comprising cells that have been cultured.

[0021] As used herein, the phrase "totipotent stem cells" refers to cells derived from the fusion of an egg cell and a sperm cell. It refers to cells that have the ability to differentiate into all the cells that make up an organism, such as cells generated from The cells that result from the first few divisions of a fertilized egg may also be totipotent. pluripotent stem cells, such as ES cells, which can differentiate into embryonic and extraembryonic cell lineages They can give rise to any fetal or adult cell type, but they do not develop into extraembryonic tissues. Since they lack the ability to synthesize the extraembryonic stem cells, they cannot develop into fetal or adult animals on their own. The tissue is derived in part from the extraembryonic endoderm and is called the parietal endoderm. doderm (Reichert's membrane) and visceral endoderm m) (which form part of the yolk sac). Both endoderm support the development of the embryo but do not themselves form embryonic structures. Other extraembryonic tissues are also present, including the extraembryonic and extraembryonic ectoderm.

[0022] In some embodiments, "pluripotent cells" refer to cells of the endoderm lineage, more particularly pancreatic endoderm-type cells. As used herein, "pluripotency" refers to the ability of a cell to differentiate into multiple myeloid leukemia cells. Or a "pluripotent cell" or its equivalent is a cell that is capable of proliferation in cell culture and Refers to cells that can differentiate into various lineage-restricted cell populations that exhibit pluripotent properties; For example, both pluripotent ES cells and induced pluripotent stem (iPS) cells can be derived from three types of embryonic cell lineages: However, pluripotent cells cannot generate the entire organism. That is, pluripotent cells are not totipotent.

[0023] In certain embodiments, the pluripotent cells used as starting material are hES cells, hE Stem cells include G cells, iPS cells, and even parthenogenetic cells. In this case, an "embryonic" is a term used to describe a single zygote that is no longer in development. The appearance of an organism that ends up with a multicellular structure that does not contain any pluripotent or totipotent cells other than the gamete cells. The term "embryonic" refers to the various stages of development resulting from the fusion of gametes. In addition to embryos derived by somatic cell nuclear transfer, the term also refers to embryos derived by somatic cell nuclear transfer. In terms of morphology, pluripotent cells are not derived or directly derived from an embryo, e.g. iPS cells are derived from non-pluripotent cells, e.g., multipotent cells or terminally differentiated cells. This is what was done.

[0024] Human pluripotent stem cells contain a core set of transcription factors that ensure repression of genes directing differentiation and maintenance of pluripotency. Several transcription factors, such as Oct-4, Nanog, and Sox-2, form the nodal complex. Transcription factors and cell surface proteins, as well as the glycolipids SSEA3, SSEA4 and Ke There are cell surface antigens such as rat sulphate antigen, Tra-1-60 and Tra-1-81. It can also be defined or characterized as:

[0025] As used herein, "induced pluripotent stem cells" or "iPS cells" or "iPS cells" The phrase "SC" refers to non-pluripotent cells, generally adult somatic cells, or, for example, fibroblasts, Reprogramming from terminally differentiated cells such as hematopoietic cells, muscle cells, neurons, and epidermal cells They are artificially prepared by inserting specific genes or gene products called transcription factors. It refers to a type of pluripotent stem cell that has been isolated from humans, the disclosure of which is incorporated herein by reference in its entirety. Takahashi et al., Cell, 131:861-872 (2007); Wernig et al., Nature, 448:318-324 (2007); Park et al., Nature, 451:141-146 (2008). Induced pluripotent stem cells are hES cells. Natural human pluripotent stem cells such as pluripotent stem cells and the expression of certain stem cell genes and proteins, Chromatin methylation pattern, doubling time, embryoid body formation, teratoma formation, viable chimera formation and various other properties, including developmental potential and differentiability. Human iPS cells allow the creation of pluripotency without the use of embryos. A source of stem cells is provided.

[0026] A variety of methods can be used to generate iPS cells, which are described herein. However, all methods involve the use of Sox-2, Oct-4, NaCl, and An expression cassette encoding nog and optionally Lin-28, or Sox-2, O an expression cassette encoding ct-4, Klf4 and optionally c-myc, or So x-2, Oct-4 and optionally an expression cassette encoding Esrrb. Reprogramming factors are used. The nucleic acids encoding these reprogramming factors are The same expression cassette, a different expression cassette, the same reprogramming vector, or a different It may be in a programming vector. Oct-3 / 4 and Sox gene families Specific members of the Lee family (Sox-1, Sox-2, Sox-3 and Sox-15) It is a key transcription factor involved in the induction process, the absence of which renders induction impossible. Oct-3 / 4 (Pou5f1) is a member of a family of octameric ("Oct") transcription factors. and play an important role in maintaining pluripotency. For example, cells that are normally Oct-3 / 4+, e.g. Absence of Oct-3 / 4 in blastomeres and embryonic stem cells leads to spontaneous trophoblast differentiation. On the other hand, the presence of Oct-3 / 4 confers pluripotency and differentiation potential of embryonic stem cells. In addition, other genes in the "Oct" family, such as Oct1 and Oct6, are involved in pluripotency. Thus, this pluripotency induction process can be attributed to Oct-3 / 4. Another family of genes related to the maintenance of pluripotency similar to Oct-3 / 4 is the Sox However, the Sox family is not restricted to pluripotent cell types and can be expressed in multipotent cells. and unipotent stem cells. The Sox family has also been found to play a role in the induction process. In the earlier study by Takahashi et al. (2006), Sox2 was used. Since then, Sox1, Sox3, Sox15 and Sox18 genes have also been identified. iPS cells have been generated. The Klf family of genes (Klf-1, Klf2, Klf-3, Klf-4, Klf-5, Klf-6, Klf-7, Klf-8, Klf-9, Klf-10, Klf-11, Klf-12, Klf-13, Klf-14, Klf-15, Klf-16, Klf-17, Klf-18, Klf-19, Klf-20, Klf- Klf4 (Klf4 and Klf5) was initially developed as a factor for generating mouse iPS cells. It was identified by S. Yamanaka et al. in 2006. Human iPS cells from ka were used to explore the cell therapy applications of hIPS cells. However, Yu et al. (2007) noted that Klf4 is not required and, indeed, They reported that they were unable to generate cells that express Klf1, Klf2, and Klf5. Other members of the Klf family, including Klf1, are capable of generating iPS cells. Later, the Myc family (C-myc, L-myc, and N-myc) was linked to cancer. c-myc, a proto-oncogene that has been linked to the generation of mouse and human iPS cells However, Yu et al. (2007) reported that c-myc is a factor involved in the survival of human iPS cells. The study reported that the results were not required for the study to be completed.

[0027] As used herein, "pluripotent" or "pluripotent cells" or equivalents thereof refers to a cell type that can give rise to a limited number of other specific cell types. Potent cells are committed to one or more embryonic cell fates and thus, in contrast to pluripotent cells Generally, they are unable to give rise to each of the three germinal cell lineages, as well as extraembryonic cells. Multipotent somatic cells are more differentiated than pluripotent cells, but are not terminally differentiated. Therefore, pluripotent cells have a higher developmental potential than multipotent cells. Alternatively, developmental potential determining factors that can be used to generate iPS cells include These include, but are not limited to, Oct-4, Sox2, FoxD3, UTF1, Stella , Rexl, ZNF206, Soxl5, Mybl2, Lin28, Nanog, DPP A2, ESG1, Otx2, or a combination thereof. As used herein, "ERBB receptor tyrosine kinase activating agents" refer to The present invention includes, but is not limited to, at least 16 different proteins that bind to ERBB receptors. EGF family ligands: EGF (epidermal growth factor), AG or AREG (amphirene glucin), and TGF-alpha (transforming growth factor-alpha), Btc (beta Heparin-binding EGF (HBEGF), and Ereg (Epiregulin) ), neuregulin-1, -2, -3 and -4 (or heregulin-1, -2, -3 and and neughhhlerins (or heregulins) such as -4. , binds to any one or a combination of four ERBB receptors and inhibits endogenous kinases Homodimeric receptor complexes and heterodimeric receptor complexes that lead to activation and subsequent phosphorylation of the ze domain Any ligand capable of inducing the formation of a dimeric receptor complex is contemplated. See also 11. Some embodiments of the methods for producing insulin described herein include those that are responsive to glucose stimulation. They can mature in vivo into insulin-producing cells that secrete insulin in response to insulin. The present invention provides an animal with pancreatic endoderm cells that are capable of inhibiting the growth of diabetic animals, or for treating diabetic animals by administering to the animal ... administering to the animal pancreatic endoderm cells that are capable of inhibiting the growth of diabetic animals, or for administer This can include controlling the glucose concentration in the liquid.

[0028] One embodiment described herein is directed to the development of a method for the production of a medicament for the development ... The present invention provides a method for the development of pluripotent or pluripotent stem cells that can selectively, and in some embodiments, selectively and reversibly develop. As used herein, the term "population" includes a population of cells having the same identity. The term "cell lineage" refers to a cell culture of multiple cells with distinct characteristics. All stages in the development of a cell type from precursor cells to fully mature (i.e. specialized) cells "Progenitor cell" or "precursor cell" refers to a cell that develops into a more mature cell in a cell differentiation pathway. Progenitor cells may be any cell capable of differentiation. Thus, progenitor cells are pluripotent cells. They may be partially differentiated pluripotent cells or reversibly differentiated cells. The term "progenitor cell population" refers to cells that can develop into more mature or differentiated cell types. Progenitor cell populations are a group of cells that can be pluripotent, stem cell lineage-restricted, or That is, cells that cannot develop into all of the ectodermal lineages, or cells of e.g. neuronal lineages. These include cells that can only develop into a single lineage (cells that are reversibly restricted to the stem cell lineage), and cells that are reversibly restricted to the stem cell lineage. Thus, the term "progenitor cell" or "precursor cell" is used interchangeably with "pluripotent cell" or may be a "pluripotent cell."

[0029] As used herein, the terms "reprogramming" and "reprogrammed" refer to The term or its equivalents refers to the expression of reprogramming agents in culture or in vivo. at least measurably higher than it would have under the same conditions without the It refers to the process that endows a cell with the ability to form progeny of a single new cell type. In certain embodiments described, somatic cells are "reprogrammed" into pluripotent cells. In certain embodiments, after sufficient proliferation, the cells are cultured in vivo or in vitro. In this study, a measurable proportion of cells displayed phenotypic characteristics of new pluripotent cell types. Without reprogramming, such somatic cells would not be able to The cells will not generate progeny that display the phenotypic characteristics of new pluripotent cell types. Somatic cells generate progeny that display phenotypic characteristics of new pluripotent cell types even without ramming If successful, we would be able to present the phenotypic characteristics of new pluripotent cell types derived from these somatic cells. The percentage of progeny that are measurably higher than before reprogramming.

[0030] As used herein, the phrase "differentiation programming" refers to differentiation of cells in culture or in vivo. o than it would have under the same conditions without differentiation reprogramming. Altering the cells to form progeny of at least one new cell type in a new differentiation state. This refers to the process of differentiation, dedifferentiation and transdifferentiation. As used herein, the term "differentiation" refers to the process by which less specialized cells become more specialized. In contrast, the term "dedifferentiation" refers to the process of becoming a differentiated cell type, either partially or definitively. The reversion of differentiated cells to earlier developmental stages, e.g., pluripotent or multipotent cells. In contrast, the term "transdifferentiation" refers to the cellular process of transforming one differentiated cell type into another. This refers to the process of transformation into a differentiated cell type.

[0031] As used herein, "develop from pluripotent cells," "differentiate from pluripotent cells," " " "matured from pluripotent cells" " "generated from pluripotent cells" " "from pluripotent cells The terms "derived from" and "differentiated from pluripotent cells" and equivalent expressions refer to, for example, No. PCT / US2007, the disclosure of which is incorporated herein by reference in its entirety. / 015536, entitled "METHODS OF PRODUCING PANCREA In vivo transplanted PDX1 pancreas, as described in "TIC HORMONES" In the case of endocrine cells that mature from endodermal cells, in vitro or in vivo All such terms refer to the generation of differentiated cell types from pluripotent cells in The cells differentiate from a stage with the potential to differentiate into at least two different cell lineages to a stage of specialization and ultimate differentiation. It refers to the progression of a cell to become a terminally differentiated cell. Such terms are used for the purposes of this application. The embodiments described herein enable such differentiation. and thus pluripotency, or the ability to differentiate into at least two or more cell lineages. Culture conditions are contemplated that allow selective recovery of force.

[0032] The term "feeder cells" refers to cells that are grown in vitro and express at least one factor into cell culture and used to support the growth of other cells of interest in the culture. As used herein, "feeder cell layer" refers to a cell culture that can be cultured in a culture medium. The term "feeder cells" may be used interchangeably with the term "feeder cells." Feeder cells are cells that grow on culture plates. Even if the surface is covered with feeder cells, and contains a complete monolayer before overlapping and amplifying In a preferred embodiment, the feeder cells are adherent Contains a single layer of genus.

[0033] As used herein, the terms "cluster," "agglomerate," or "aggregate" The terms "cells" and "cell culture" can be used interchangeably and generally refer to a group of cells that have not been dissociated into single cells. Stars can be dissociated into smaller clusters. This dissociation is generally manual in nature. (e.g., using a Pasteur pipette), although other means of dissociation are contemplated. Suspension pluripotent or multipotent cell cultures are essentially the same as those described in International Publication No. PCT / US2007 / 0 62755, Title COMPOSITIONS AND METHODS FOR CUL TURING DIFFERENTIAL CELLS and PCT / US2008 / 0 82356, Title STEM CELL AGGREGATE SUSPENSION C OMPOSITIONS AND METHODS OF DIFFERENTIATI ON THEREOF, which are hereby incorporated by reference in their entirety. is incorporated into.

[0034] Similarly, pluripotent cell cultures or pluripotent aggregate suspension cultures can be produced without the use of feeder cells. Embodiments in which the cells are grown in defined conditions without feeder are "feeder-free." Derby-free culture methods increase the scalability and reproducibility of pluripotent cell cultures, e.g. For example, infectious agents derived from feeder cells or other animal-source culture components. The feeder-free method reduces the risk of contamination by microbial cells. No. 6,800,480 to Geron Corporation, Me However, the park is also listed in the National Register of Natural History (NLO Park, ceded to California). In contrast to the '480 patent, the embodiments described herein are multi-functional. Whether it is a sexual cell culture, a pluripotent cell culture or a differentiated cell culture, They are feeder-free and do not contain endogenous or exogenous extracellular matrix. i.e., the cultures described herein are not only feeder-free, but also cell-free. It is also free of extracellular matrix. For example, in U.S. Patent No. 6,800,480, The fibroblasts were cultured, the fibroblasts were lysed in situ, and the remaining The extracellular matrix is ​​prepared by washing. In issue 0,480, collagen, placental matrix, fibronectin, laminin, melo syn, tenascin, heparin sulfate, chondroitin sulfate, dermatan sulfate, aggrecan, An isolated protein selected from biglycan, thrombospondin, vitronectin, and decorin. Extracellular matrices can also be prepared from the matrix components or combinations of components. In the embodiments described herein, a feeder layer or fibroblast layer may be grown, Generate extracellular matrix by lysing cells to generate extracellular matrix First, collagen, placental matrix, fibronectin, laminin, and membrane Rosin, tenascin, heparin sulfate, chondroitin sulfate, dermatan sulfate, aggrecan , biglycan, thrombospondin, vitronectin, and decorin. Tissue culture using extracellular matrix components or combinations of extracellular matrix components There is no need to coat the container. Therefore, pluripotent cells, multipotent cells and differentiated cells can be easily cultured. The aggregated suspension cultures described herein for cultured cells contain exogenously added extracellular matrix. The fibrils that produce the extracellular matrix coating are the matrix components or components of the matrix. No feeder layer, lysed feeder cells or fibroblasts are required, and are incorporated herein by reference. International application PCT / US2008 / 080516, entitled METHODS, which is incorporated in its entirety AND COMPOSITIONS FOR FEEDER-FREE PLURIP OTENT STEM CELL MEDIA CONTAINING HUMAN S As described in ERUM, the use of soluble human serum components allows the differentiation of feeder cells or follicles. This overcomes the need for a feeder monolayer and also eliminates the need for feeder cells or fibroblasts or exogenous factors. The need for endogenous extracellular matrix derived from specifically added extracellular matrix components The necessity is also overcome.

[0035] In a preferred embodiment, the culture method does not include products of animal origin. In a preferred embodiment, the culture method is xeno-free. The culture method described herein provides one or more conditions for commercial production of human cell therapeutics or Met or exceeded requirements.

[0036] The population of pluripotent cells can be further cultured in the presence of certain supplemental growth factors to produce different cell types. obtaining a population of cells that are or will develop into a cell lineage, or , can be selectively reversed to allow development into different cell lineages. The term "supplemental growth factors" is used in its broadest context to promote the growth of pluripotent cells. to promote cell proliferation, maintain cell viability, stimulate cell differentiation, and / or refers to substances that are effective in stimulating the reversal of cell differentiation. In addition, supplemental growth factors The molecule may be a substance secreted by the feeder cells into the medium. These include, but are not limited to, cytokines, chemokines, small molecules, neutralizing antibodies, and Growth factors are important regulators of cell development and maintenance, as well as the morphology and development of tissues. In a preferred embodiment, the polypeptide may also include an intercellular signaling polypeptide that controls the expression and function of the polypeptide. The supplemental growth factor is stem cell factor (SCF ), oncostatin M (OSM), ciliary neurotrophic factor (CNTF), interleukin -6 (IL-6) and soluble interleukin-6 receptor (IL-6R), fibroblasts FGF, bone morphogenetic protein (BMP), tumor necrosis factor (TNF), and and granulocyte-macrophage colony-stimulating factor (GM-CSF).

[0037] In certain processes for generating the cells described herein, growth factors are added after For example, activin A, activin B, GD, Add growth factors such as F-8 or GDF-11 and then add them within about 1 day. , within about 2 days, within about 3 days, within about 4 days, within about 5 days, within about 6 days, within about 7 days, within about 8 days In some embodiments, the endothelial cell may be removed within about 9 days, within about 10 days, or within about 12 days. No activating factors are removed from the cell culture.

[0038] The efficiency of the differentiation process can vary depending on, but is not limited to, cell growth conditions, growth factor concentrations, and The results were obtained by modifying certain parameters, including the timing of the incubation steps and the Therefore, the differentiation procedures described herein can be used to reduce the number of cells by about 5%, about 10%, about 15%, or about 20%. %, approx. 20%, approx. 25%, approx. 30%, approx. 35%, approx. 40%, approx. 45%, approx. 50%, approx. 55 %, approx. 60%, approx. 65%, approx. 70%, approx. 75%, approx. 80%, approx. 85%, approx. 90%, approx. 95 %, or greater than about 95% of pluripotent cells, including induced pluripotent cells, are differentiated into multipotent cells or differentiated cells, e.g., definitive endoderm, foregut endoderm, PDX1-positive foregut endoderm, PDX1-positive pancreatic Visceral endoderm or PDX1 / NKX6.1 co-positive pancreatic endoderm, endocrine precursors or NGN3 / NKX2.2 co-positive endocrine precursors, and hormone-secreting endocrine cells or INS, GC It can induce the conversion of endocrine cells into G, GHRL, SST, and PP single positive cells. Isolation of preprimitive streak cells or mesendoderm cells is used The process allows for the recovery of substantially pure populations of preprimitive streak or mesendoderm cells. Cut.

[0039] Described herein are various cell compositions derived from pluripotent stem cells. The present invention includes iPS cells and cells derived therefrom. Still other related but different processes and compositions are disclosed in US Pat. U.S. Provisional Patent Application No. 60 / 532,004, entitled DEFINITIVE ENDODER M; U.S. Provisional Patent Application No. 60 / 566,293, filed April 27, 2004, entitled PD X1 EXPRESSING ENDODERM; U.S. Patent filed July 9, 2004 Provisional Application No. 60 / 586,566, entitled CHEMOKINE CELL SURFACE RECEPTOR FOR THE ISOLATION OF DEFINITIV E ENDODERM; U.S. Provisional Patent Application No. 60 / 587, filed July 14, 2004; No. 942, Title: CHEMOKINE CELL SURFACE RECEPTOR F OR THE ISOLATION OF DEFINITIVE ENDODERM; U.S. Patent Application No. 11 / 021,618, filed December 23, 2004, entitled DEFI NITIVE ENDODERM, and U.S. patent application Ser. No. 2005-0021555, filed on April 26, 2005. 11 / 115,868, Title: PDX1 EXPRESSING ENDODERM;2 No. 11 / 165,305, filed June 23, 2005, entitled METHOD S FOR IDENTIFYING FACTORS FOR DIFFERENTI ATING DEFINITIVE ENDODERM; filed on October 27, 2005 No. 60 / 730,917, entitled PDX1-EXPRESSING D ORSAL AND VENTRAL FOREGUT ENDODERM;2005 No. 60 / 736,598, filed on November 14, entitled MARKERS OF DEFINITIVE ENDODERM; U.S. Patent filed March 2, 2006 Provisional Application No. 60 / 778,649, entitled INSULIN-PRODUCING CELL S AND METHOD OF PRODUCTION; filed on July 26, 2006 No. 60 / 833,633, entitled INSULIN-PRODUCING CELLS AND METHOD OF PRODUCTION; October 2006 No. 60 / 852,878, filed on the 18th, entitled ENRICHMENT OF ENDOCRINE PRECURSOR CELLS, IMMATURE PA NCREATIC ISLET CELLS AND MATURE PANCREAT IC ISLET CELLS USING NCAM; filed on October 27, 2006 No. 11 / 588,693, entitled PDX1-EXPRESSING DOCUMENT, RSAL AND VENTRAL FOREGUT ENDODERM;20073 No. 11 / 681,687, filed on May 2, 2011, entitled ENDOCRINE PR ECURSOR CELLS,PANCREATIC HORMONE-EXPRESS ING CELLS AND METHODS OF PRODUCTION;2007 No. 11 / 773,944, filed on July 5, 2002, entitled METHODS OF PRODUCING PANCREATIC HORMONES;September 13, 2007 No. 60 / 972,174, entitled METHODS OF TREATMENT, filed on 2006 / 02 / 13, ATMENT FOR DIABETES; U.S. Patent Application filed September 24, 2007 No. 11 / 860,494, entitled METHODS FOR INCREASING DE FINITIVE ENDODERM PRODUCTION; October 3, 2007 No. 60 / 977,349, entitled CELL SURFACE MAR KERS OF HUMAN EMBRYONIC STEM CELLS AND C ANCER STEM CELLS; and U.S. patent application Ser. No. 2005 / 0236344, filed Apr. 8, 2008. 12 / 099, No. 759, Title: METHODS OF PRODUCING PANCR EATIC HORMONES; and U.S. patent application Ser. No. 1, filed Apr. 21, 2008. 2 / 107,020, Title: METHODS FOR PURIFYING ENDOD ERM AND PANCREATIC ENDODERM CELLS DERIVE What we find in D FORM HUMANE EMBRYONIC STEM CELLS , the disclosures of which are incorporated herein by reference in their entireties.

[0040] A general method for generating endoderm-lineage cells derived from hES cells is described above. See related U.S. patent applications, as well as D'Amour et al., 2005 Nat Biotechnol. ol.23:1534-41, and D'Amour et al., 2006 Nat Biol. chnol. 24(11):1392-401, the disclosures of which are incorporated herein by reference. A five-stage differentiation protocol was developed by D'Amour et al. Stage 1 (mostly resulting in definitive endoderm generation), stage 2 (mostly PDX1 negative stage 3 (the majority of the cells produce PDX1-positive foregut endoderm) stage 3 (resulting in the formation of mostly pancreatic endoderm or pancreatic endocrine precursors); stage 4 (resulting in the formation of mostly pancreatic endoderm or pancreatic endocrine precursors); Stage 5 (which results in the production of mostly hormone-expressing endocrine cells) It is listed.

[0041] The term "trophectoderm" is a hypothesis that is based on HAND1, Eomes, MASH2, ESXL1, and H CG, KRT18, PSG3, SFXN5, DLX3, PSX1, ETS2, and ER BB gene is a marker for the identification of non-trophectoderm cells or cell populations. HAND1, Eomes, MASH2, ESXL1, HCG, KRT18, P The expression levels and ratios of SG3, SFXN5, DLX3, PSX1, ETS2, and ERBB It refers to cells that are relatively highly multipotent compared to other types of cells.

[0042] "Extraembryonic endoderm" is a marker of the SOX7 gene, SOX17 gene, THBD gene, and SPAR Expression of a marker selected from the group consisting of the C gene, the DAB1 gene, or the AFP gene. Current levels of SOX7, SOX17, and THB in non-extraembryonic endoderm cells or cell populations D, high pluripotency relative to the expression levels of SPARC, DAB1, or AFP Refers to cells.

[0043] The term "preprimitive streak cells" refers to cells that express the FGF8 marker gene and / or the NODAL marker gene. The expression levels of the car genes were low for BRACHURY, low for FGF4, low for SNAI1, and low for SOX1. Relatively more multipotent cells compared to 7 low, FOXA2 low, SOX7 low and SOX1 low Refers to...

[0044] The term "mesendodermal cells" refers to the expression of the brachyury marker genes, FGF4, SN The expression levels of the AI1, MIXL1 and / or WNT3 marker genes are Low, CXCR4 low, FOXA2 low, SOX7 low and SOX1 low compared to Refers to multipotent cells.

[0045] The term "definitive endoderm (DE)" refers to the cells that differentiate into the gut or gut-derived organs. According to certain embodiments, the term refers to a multipotent endodermal lineage cell that can differentiate into an embryo. The endoderm cells are mammalian cells, and in a preferred embodiment, the definitive endoderm cells are human cells. In some embodiments of the present invention, definitive endoderm cells express certain markers. or fails to significantly express certain markers. OX17, CXCR4, MIXL1, GATA4, HNF3β, GSC, FGF17, V One selected from WF, CALCR, FOXQ1, CMKOR1 and CRIP1 In another embodiment, OCT4 is expressed in definitive endoderm cells. , alpha-fetoprotein (AFP), thrombomodulin (TM), SPARC, One or more markers selected from SOX7 and HNF4alpha are Not expressed or significantly expressed in definitive endoderm cell populations and Methods for producing this are described in U.S. patent application Ser. No. 11 / 021,618, entitled DEFINITIV No. 6,399,433, filed Dec. 23, 2004, which is incorporated herein by reference in its entirety. is fully incorporated.

[0046] Yet other embodiments are directed to "PDX1-negative foregut endoderm cells" or "foregut endoderm cells." In some embodiments, the present invention relates to a cell culture that is referred to as a foregut endoderm cell culture, or its equivalent. SOX17, HNF1β (HNF1B), HNF4 alpha (HNF4A) and F Express the OXA1 marker but not PDX1, AFP, SOX7 or SOX1 A PDX1-negative foregut endoderm cell population and a method for generating the same were also published in October 2006. U.S. patent application Ser. No. 11 / 588,693, filed on the 27th, entitled PDX1-express ing dorsal and ventral foregut endoderm No. 6,399,433, which is incorporated herein by reference in its entirety.

[0047] Other embodiments described herein include "PDX1-positive, dorsally biased, foregut endoderm cells" " (dorsal PDX1-positive foregut endoderm cells) or simply "PDX1-positive endoderm" cell culture In some embodiments, the PDX1 positive endoderm cell is one selected from Table 1. or a plurality of markers and / or one or more markers selected from Table 2. These are also incorporated herein by reference in their entirety. No. 588,693, entitled PDX1 EXPRESSING DOSAL AND VEN TRAL FOREGUT ENDODERM, and the U.S. patent application filed on April 26, 2005 US Patent Application No. 11 / 115,868, entitled PDX1-expressing endothelial cells derm, which are incorporated herein by reference in their entireties. [Table 1] JPEG2025000625000002.jpg245168 [Table 2] JPEG2025000625000004.jpg245168

[0048] PDX1-positive foregut endoderm cells, such as those produced by the methods described herein. have been reported to produce fully differentiated pancreatic hormone-secreting or endocrine cells, such as insulin-producing β cells. In some embodiments of the present invention, PD PDX1-positive foregut endoderm cells express PDX1 to form PDX1-positive foregut endoderm cells. Definitive endoderm cells that do not substantially express PDX1 (PDX1-negative definitive endoderm cells; herein, They are produced by differentiation of the first germ layers (also called germ layers).

[0049] As used herein, "pancreatic endoderm," "pancreatic epithelium," pithelial), "pancreatic epithelium (All can be abbreviated as "PE") "Pancreatic precursors", "PDX-1 positive pancreatic endogenous embryos" Pancreatic endoderm cells ("PECs"), or their equivalents, are all precursor or progenitor pancreatic cells. The PECs described herein are precursor cells after stage 4 differentiation (approximately days 12-14). The NKX6.1-expressing NKX6.1-positive cells are a subpopulation of the NKX6.1-positive cells, with at least two major distinct populations: i) those expressing NKX6.1 but not C ii) pancreatic progenitor cells that do not express HGA (or CHGA-negative, CHGA-); and ii) C Polyhormonal endocrine cells expressing HGA (CHGA positive) Without being bound by theory, NKX6.1-expressing but CHG It is hypothesized that the cell population that does not express A represents the more active and therapeutic component of PECs. On the other hand, the population of CHGA-positive polyhormonal endocrine cells expresses glucagon in vivo. These cells are hypothesized to further differentiate and mature into pancreatic islet cells, the disclosures of which are both incorporated herein by reference. Kelly et al. (2011) Cell-surface matrix arkers for the isolation of pancreatic c ell types derived from human embryonic s tem cells, Nat Biotechnol.29(8):750-756, 2 Published online July 31, 2011 and Schulz et al. (2012), A Scala ble System for Production of Functional Pancreatic Progenitors from Human Embryo nic Stem Cells, PLosOne 7(5):1-17, e37004 Please refer to. Additionally, sometimes pancreatic endoderm cells are used to refer to PECs rather than the PECs described immediately above. , generally used to refer to at least stage 3 and stage 4 type cells. The meaning will be clear from the context. Thus, pluripotent stem cells, as well as at least hES cells, Pancreatic endoderm derived from blastocysts and hIPS cells is distinct from other endodermal lineage cell types. DX1, NKX6.1, PTF1A, CPA1, cMYC, NGN3, PAX4, ARX and NKX2.2 markers are differentially or at elevated levels of expression. However, genes characteristic of pancreatic endocrine cells, such as CHGA, INS, GCG, and GHR L, SST, MAFA, PCSK1, and GLUT1 were not expressed substantially. In addition, some “endocrine precursor cells” that express NGN3 are distinct from other non-pancreatic In one embodiment, the cells can differentiate into a structure (e.g., the duodenum) as described herein. NGN3-expressing endocrine precursors differentiate into mature pancreatic lineage cells, e.g., pancreatic endocrine cells. Pancreatic endoderm or endocrine precursor cell populations and methods thereof are disclosed in U.S. patent application Ser. No. 11 / 749,333. No. 73,944, entitled "Methods of producing pancreati c hormones, filed July 5, 2007, and U.S. patent application Ser. No. 12 / 107, Issue 020, Title: METHODS FOR PURIFYING ENDODERM AN D PANCREATIC ENDODERM CELLS DERIVED FORM HUMAN EMBRYONIC STEM CELLS, filed on April 21, 2008 , the disclosures of which are incorporated herein by reference in their entireties.

[0050] As used herein, "endocrine precursor cells" refer to cells that express neurogenin 3 (NEUROG 3) express and further differentiate into cells of the endocrine system, including, but not limited to, pancreatic islet hormone-expressing cells Endocrine precursor cells are multipotent cells of the definitive endoderm lineage that can differentiate into different types of cells with lower specificity. Compared with heterologously differentiated definitive endoderm lineage cells, e.g., PDX1-positive pancreatic endoderm cells, cannot differentiate into as many different cell, tissue and / or organ types .

[0051] As used herein, the term "pancreatic islet hormone-expressing cells," "pancreatic endocrine cells," or The equivalent of is a multi-hormonal or single-hormonal Endocrine cells refer to cells that may be hormonal. Thus, endocrine cells are the function of human pancreatic islet cells. The pancreatic hormone may express one or more pancreatic hormones, including at least a portion of the pancreatic Islet hormone-expressing cells may be mature or immature. Immature pancreatic islet hormone-expressing cells The cells are identified based on the differential expression of certain markers or based on their functional capabilities, e.g., glucose They can be distinguished from mature pancreatic islet hormone-expressing cells based on their responsiveness.

[0052] In the embodiments described herein, defined media, conditioned media, feeder-free media, serum-free media, Many stem cell culture or growth environments are contemplated, including media and the like. When used herein, the term "growth environment" or "environment" or its equivalents refers to the A process in which cells or differentiated stem cells (e.g., primate embryonic stem cells) are grown in vitro. The characteristics of the environment are the medium in which the cells are cultured and the supporting structures, if any, (e.g. For culturing or maintaining pluripotent cells and / or Methods for differentiating pluripotent cells are disclosed in PCT / US2007 / 062755, entitled "Diagnostic Methods for Differentiating Pluripotent Cells." OMPOSITIONS AND METHODS USEFUL FOR CULTU RING DIFFERENTIABLE CELLS, filed February 23, 2007; U.S. National Patent Application No. 11 / 993,399, entitled EMBRYONIC STEM CELL CULTURE COMPOSITIONS AND METHODS OF USE THEREOF, filed December 20, 2007; and U.S. patent application Ser. No. 11 / 875,0 Issue 57, Title: Methods and compositions for feed r-free pluripotent stem cell media conta ining human serum, which is also described in the application filed on October 19, 2007. The disclosures of which are incorporated herein by reference in their entireties.

[0053] The terms "essentially" or "substantially" mean that a component or cell is minimally or completely The cell aggregates in any cell aggregate suspension type, e.g., the cell aggregates in the suspensions described herein, in amounts not exceeding 100%. The presence of the substance in the body is called "essentially or substantially homogeneous" or "essentially or substantially homogeneous" "essentially hES cells" or "essentially or substantially in vivo "essentially or substantially foregut endoderm cells," "essentially or substantially PDX 1-negative foregut endoderm cells," "essentially or substantially PDX1-positive prepancreatic endoderm cells," Essentially or substantially PDX1-positive pancreatic endoderm or progenitor cells," "PDX1-positive pancreatic endoderm tip cells," "essentially or substantially pancreatic endocrine progenitor cells," It means that the pancreatic endocrine tissue is composed essentially or substantially of pancreatic endocrine cells.

[0054] With respect to cells in a cell culture or cell population, the term "substantially free of" means Cell types identified as not being included in the cell culture or cell population are Less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6% of the total number of cells present in the population %, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or less than about 1% This means that

[0055] The cell culture may contain reduced serum or be substantially serum-free or serum-free. Under certain culture conditions, serum concentrations are approximately 0. % (v / v) to about 10% (v / v). For example, In the stabilization process, the serum concentration in the medium is less than about 0.05% (v / v), about 0.1% (v / v ), less than about 0.2% (v / v), less than about 0.3% (v / v), about 0.4% (v / v) Less than about 0.5% (v / v), Less than about 0.6% (v / v), Less than about 0.7% (v / v) less than about 0.8% (v / v), less than about 0.9% (v / v), less than about 1% (v / v), Less than 2% (v / v), less than about 3% (v / v), less than about 4% (v / v), less than about 5% (v / v), less than about 6% (v / v), less than about 7% (v / v), less than about 8% (v / v), less than about 9% In some processes, the blood concentration may be less than about 10% (v / v). The preprimitive streak cells are grown without serum or without serum replacement. In this study, preprimitive streak cells were grown in the presence of B27. The concentration of the supplement may range from about 0.1% (v / v) to about 20% (v / v).

[0056] Yet another process involves growing immature pancreatic islet hormone-expressing cells in the presence of B27. In such processes, the concentration of B27 supplement ranges from about 0.1% (v / v) to about 2 The concentration may range from 0% (v / v) to more than about 20% (v / v). In certain processes, the concentration of B27 in the medium is about 0.1% (v / v), about 0 .2%(v / v), approx. 0.3%(v / v), approx. 0.4%(v / v), approx. 0.5%(v / v ), approx. 0.6% (v / v), approx. 0.7% (v / v), approx. 0.8% (v / v), approx. 0.9% (v / v), approx. 1%(v / v), approx. 2%(v / v), approx. 3%(v / v), approx. 4%(v / v) ), approx. 5% (v / v), approx. 6% (v / v), approx. 7% (v / v), approx. 8% (v / v), approx. 9 %(v / v), about 10%(v / v), about 15%(v / v) or about 20%(v / v) Alternatively, the concentration of B27 supplement added may be the same as the strength of a commercially available B27 stock solution. For example, B27 is available from Invitrogen (Carl It is available as a 50x stock solution from Sigma-Aldrich (St. Louis, MO). The desired amount of B27-supplemented medium is prepared by adding the solution to a sufficient volume of growth medium. For example, add 10 ml of 50x B27 stock solution to 90 ml of growth medium. This produces a growth medium supplemented with 5x B27. The supplement concentrations are approximately 0.1x, 0.2x, 0.3x, 0.4x, and 0.5x. , approx. 0.6x, approx. 0.7x, approx. 0.8x, approx. 0.9x, approx. 1x, approx. 1.1x, approx. 1.2x , approx. 1.3x, approx. 1.4x, approx. 1.5x, approx. 1.6x, approx. 1.7x, approx. 1.8x, approx. 1. 9x, 2x, 2.5x, 3x, 3.5x, 4x, 4.5x, 5x, 6x , approx. 7x, approx. 8x, approx. 9x, approx. 10x, approx. 11x, approx. 12x, approx. 13x, approx. 14x, approx. 5x, about 16x, about 17x, about 18x, about 19x, about 20x and greater than about 20x. stomach.

[0057] As used herein, "exogenously added" refers to, for example, growth factors, differentiation factors, etc. A compound, in the context of a culture or conditioned medium, is a compound that is already present in the culture or medium. Any compound or growth factor that may be added to the culture or medium to supplement the growth factor For example, in some embodiments, the cell cultures and / or cell populations are exogenously Contains no added retinoids.

[0058] As used herein, "retinoid" refers to retinol, retinal or retinal. In a preferred embodiment, the term refers to lenoic acid as well as derivatives of any of these compounds. The tinoid is retinoic acid.

[0059] "FGF family growth factors", "fibroblast growth factors" or "fibroblast growth factors" The members of the family are FGF1, FGF2, FGF3, FGF4, FGF5, and FG F6, FGF7, FGF8, FGF9, FGF10, FGF11, FGF12, FGF1 3, FGF14, FGF15, FGF16, FGF17, FGF18, FGF19, FG FGF is selected from the group consisting of FGF20, FGF21, FGF22 and FGF23. In some embodiments, "FGF family growth factors," "fibroblast growth factors," Alternatively, a "member of the fibroblast growth factor family" refers to a known fibroblast growth factor family member. Any growth factor that shares homology with and / or function similar to members of the family. means.

[0060] As used herein, "expression" refers to the production of a material or substance as well as the production of a material or substance. It refers to the level or amount of quality produced. Thus, determining the expression of a particular marker is The present invention relates to detecting the relative or absolute amount of a marker that is expressed or simply detecting the presence or absence of a marker. This refers to detecting whether or not a

[0061] As used herein, a "marker" refers to any molecule that can be observed or detected. For example, a marker may be, but is not limited to, a molecule that indicates the translocation of a particular gene. Nucleic acids such as transcripts, polypeptide products of genes, non-gene products polypeptides, glycoproteins , carbohydrates, glycolipids, lipids, lipoproteins or small molecules (e.g., molecular weights of 10,000 0 amu).

[0062] For the majority of markers described herein, the official Human Genome Or ganization (HUGO) gene symbols are provided. HUGO Gene No Such symbols, developed by the Menclature Committee, Unique abbreviations are provided for each of the named human genes and gene products. A human can easily recognize these gene symbols and identify the corresponding unique human genes. and / or protein sequences.

[0063] According to the HUGO nomenclature, the following gene symbols are defined as follows: GHRL- Ghrelin; IAPP-islet amyloid polypeptide; INS-insulin; GCG-glucan Gon;ISL1-ISL1 transcription factor;PAX6-paired box gene 6;PAX4- Paired box gene 4; NEUROG3-neurogenin 3 (NGN3); NKX2 -2-NKX2 transcription factor-related locus 2 (NKX2.2); NKX6-1-NKX6 transcription factor-related locus 1 (NKX6.1); IPF1-insulin promoter factor 1 (P DX1);ONECUT1-One Cut Domain, Family Member 1 (HNF6); HLXB9-Homeobox B9 (HB9); TCF2-Transcription factor 2, liver (HNF1b );FOXA1-Forkhead box A1;HGF-Hepatocyte growth factor;IGF1-In Insulin-like growth factor 1; POU5F1 - POU domain, class 5, transcription factor 1 (OCT 4); NANOG-Nanog homeobox; SOX2-SRY (sex determining region Y)-box 2; CDH1-cadherin 1, type 1, E-cadherin (ECAD); T-brac hyury homolog (BRACH); FGF4-fibroblast growth factor 4; WNT3-wingless Type MMTV integration site family, member 3; SOX17-SRY (sex determining region Y) -Box17; GSC-Goosecoid; CER1-(Cerberus 1, cysteine ​​knot) Superfamily, homolog (CER); CXCR4-chemokine (CXC motif FGF17-fibroblast growth factor 17; FOXA2-forkhead branched receptor 4 Box A2; SOX7-SRY (sex determining region Y)-Box 7; SOX1-SRY (sex determining region Y) Domain Y)-Box 1; AFP-Alpha-Fetoprotein; SPARC-Secreted Protein protein, acidic, cysteine-rich (osteonectin); and THBD-thrombomodulin Lin(TM), NCAM-Nervous cell adhesion molecule; SYP-Synaptophysin; ZIC1- Zic family member 1; NEF3-neurofilament 3 (NFM); SST-soma tostatin; MAFA-v-maf musculoaponeurotic fibrosarcoma oncogene homolog A; MAFB-v- maf-musculoaponeurotic fibrosarcoma oncogene homolog B; SYP-synaptophysin; CHGA-chloro Mogranin A (parathyroid secretory protein 1).

[0064] Full gene names corresponding to non-HUGO gene symbols, as well as Other abbreviations that can be used are provided below: SS-somatostatin (SOM); PP-pancreatic polypeptide; C-peptide; C-peptide-connecting peptide; Ex4-exendin 4; NIC-nicotinamide and DAPT-N-[N-(3,5-difluorophenacetyl)-L-alanyl]- S-Phenylglycine t-butyl ester; RA-Retinoic acid; RPMI-Roswe ll Park Memorial Institute medium; CMRL-Connau ght Medical Research Labs medium; FBS-fetal bovine serum; N BP 10-NCAM-binding protein 10; PTF1a-pancreatic specific transcription factor 1a.

[0065] The progression of pluripotent cells to various multipotent and / or differentiated cells is governed by genetic and The relative expression of genetic markers, a property of a particular cell, can be determined by comparing the expression of a second gene or a control gene. monitoring by determining expression of housekeeping genes, e.g. In some processes, the expression of a particular marker can be determined by the By detecting the presence or absence of a particular marker. Expression refers to measuring the level at which a marker is present in cells of a cell culture or cell population. In such a process, the measurement of the expression of the marker is qualitative. The expression of a marker produced by a marker gene may be measured either quantitatively or quantitatively. One way to quantify is by using quantitative PCR (Q-PCR) Methods for performing Q-PCR are well known in the art. Other methods known in the art include can be used to quantify marker gene expression. The expression products are detected by using antibodies specific for the marker gene products of interest. It is possible.

[0066] In some processes, certain populations of cells are marked by high expression of the following genes: For example, extraembryonic endoderm is indicated by SOX17, SOX7, AFP, or THBD. NODAL and / or FGF8 indicate the anterior primitive streak, and brachyury, F GF4, SNAI1 and / or WNT3 indicate mesendoderm, while CER, GSC, CXCR4, SOX17 and FOXA2 indicate definitive endoderm cells, and SOX17, FOXA2, FOXA1, HNF1B, and HNF4A mediate the formation of foregut endoderm (or PDX 1-negative endoderm) was shown, and PDX1, HNF6, SOX9 and PROX1 were 1 positive endoderm was shown, with PDX1, NKX6.1, PTFA1, CPA and cMYC Pancreatic epithelium (PE or pancreatic precursor) was more strongly expressed, and NGN3, PAX4, ARX and N KX2.2 represents endocrine precursor cells and is involved in the expression of INS, GCG, GHRL, SST and P P shows that various endocrine cells express MAFA gene in relation to MAFB gene expression. Relatively high levels indicate insulin-secreting endocrine cells and are indicative of MAFA gene expression. The relative high expression of MAFB indicates glucagon-secreting endocrine cells.

[0067] The terms fibroblast growth factor 7 (FGF7) and keratinocyte growth factor (KGF) are Synonymous.

[0068] Methods for generating induced pluripotent stem (iPS) cells The embodiments described herein can be used to infect any one type of iPS cell, any one iPS cell type, or any one iPS cell type. There is also no limitation on the method of generating PS cells. Since there are various methods, the embodiment is not limited to the above. However, the level of efficiency of the generation of iPS cells may not be sufficient. Embodiments apply to differentiation of iPS cells into cells of the endoderm lineage and uses thereof.

[0069] Adenovirus, plasmid, or Cre-loxP3 or piggy BAC Induced pluripotent stem cells (iPSCs) using excision of reprogramming factors using transposition Viral, non-viral and non-integrating viral methods for producing A method is described by Stadt et al., which is incorporated herein by reference in its entirety. tfeld, M. et al., Science 322, 945-949 (2008); Okit a, K. et al., Science 322, 949-953 (2008); Kaji, K. et al. , Nature 458, 771-775(2009); Soldner, F. et al., Ce ll 136, 964-977(2009); and Woltjen, K. et al., Nature. See re 458, 766-770 (2009), see also No. 6,233,933 to Mack, A. et al., which is hereby incorporated by reference in its entirety. No. 0100003757 (published January 7, 2010) and PCT / U to Shi et al. See also S2009 / 037429. However, the reprogramming efficacy of these methods is unclear. The incidence is low (<0.003%) and vector sequences may remain despite excision. For example, the host genomes of the above transcription factors are highly conserved, which limits their therapeutic application. Viral integration and overexpression in the genome has been linked to tumorigenesis, Residual gene expression is a potential distinguishing feature between ES and iPS cells Solder, F. et al., Cell 136, incorporated herein by reference in its entirety. :964-977(2009);Foster et al., Oncogene 24:1491- 1500 (2005); and Hochedlinger, K. et al., Cell 121: Please see 465-477(2005).

[0070] In another embodiment of the present invention, a method for generating iPSCs comprises the steps of Epstein-Barr Virus-derived episomal vectors. u, J. et al., Science 324, 797-801 (2009) and Mack, A. See U.S. Patent Application Publication No. 20100003757, published January 7, 2010, to These methods involve the use of a combination of seven factors, including the oncogene SV40. Three separate plasmids are required.

[0071] In another embodiment of the invention, the method for generating iPSCs includes mouse cells and human cells. The present invention includes iPSCs based on proteins derived from human fetal and neonatal cells. Zhou, H. et al., Cell Stem Cell 4, 3, incorporated herein by reference in its entirety. 81-384(2009); and Kim, D. et al., Cell Stem Cell 4 , 472-476 (2009). These methodologies involve chemical treatments (e.g. For example, Zhou et al., 2009, in the above case valproic acid) or multiple treatments (Kim et al. , 2009, supra).

[0072] In another embodiment of the invention, a super vector lacking a bacterial origin of replication and an antibiotic resistance gene is Minicircle vectors or plasmids, which are coiled-coil DNA molecules, can be used. Chen, Z.-Y. et al., Mol. T, incorporated herein by reference in its entirety. her. 8, 495-500 (2003); Chen, Z.-Y. et al., Hum. Ge ne Ther. 16, 126-131(2005); and Jia, F. et al., Natu re Methods Advance Publication Online 7 See, e.g., U.S. Pat. No. 6,201,231. These methodologies involve exogenous silencing. This results in higher transfection efficiency and longer-lasting ectopic expression, due to the lower activation of the transcription factor receptor. iPSCs arise through sexual expression.

[0073] In yet another embodiment of the present invention, the present invention is directed to a method for treating diabetes, ALS, spinal muscular dystrophy, and iPS cells can be generated from human patients with a variety of diseases, including Parkinson's patients. Maehr et al., PNAS USA 10, which is incorporated herein by reference in its entirety. 6(37):15768-73(2009); Dimos et al., Science, 321: 1218-21(2008); Ebert et al., Nature 457:277-80(2 009); Park et al., Cell 134:877-886 (2008); and Sol See, Derner et al., Cell 136:964-977. At least one advantage of generating hIPS cells from a human is that the derived cells may be useful in treating human diseases. The aim of this study is to identify the genotype and cellular response of the patient. See also Table 3, which lists some of the 10 ... onal Institutes of Health(NIH) Stem Cell Registry, the Human Embryonic Stem Cell Registry and University of Massachusetts M edical School,Worcester,Massachusetts,US Including the International Stem Cell Registry at A These databases are derived from publicly available databases. It is updated periodically as strains become available and accessions are obtained. In several embodiments of the compositions and methods described herein, including but not limited to , CyT49, CyT212, CyT203, CyT25, (at least as of the time of filing of this application , ViaCyte Inc., 3550 General Atpmics Cour. t, commercially available from San Diego CA 92121), BGO1, BG02 and MEL1, and human pluripotent stem cells such as hESCs, including iPSC-482c 7 and iPSC-603 (Cellular Dynamics International onal, Inc., Madison, Wisconsin), and iPSC-G4 (hereinafter referred to as "G4") and iPSC-B7 (hereinafter referred to as "B7") (Shinya Yaman aka, Center for iPS Cell Research, Kyoto U Various types of primate cells capable of differentiation, including induced pluripotent stem (iPS) cells such as university The use of pluripotent stem cells is contemplated, and testing with G4 and B7 has been described herein. Certain of these human pluripotent stem cells are listed in the National Institute of It is registered with international registration agencies such as the Institutes of Health (NIH) and is H Listed in the Human Stem Cell Registry (e.g., C The accession number for yT49 is 0041. Other available cell lines are available from StemCells. It can also be found on the World Wide Web at nih.gov / research / registry. Further cell lines, such as BG01 and BGO1v, can be expressed by W isconsin International Stem Cell(WISC)Ba nk's affiliates, WiCell (registered trademark) (catalog name, BG01) and ATC This book is sold and distributed to third parties by SCRC-2002. Other cell lines mentioned herein are available from biological resources such as WiCell® or ATCC. Although such cell lines may not be deposited or distributed by a repository, they are available for principle research. are publicly available directly or indirectly from researchers, laboratories and / or institutions. The requirement for disclosure of methods and reagents is common to those skilled in the art, for example in the life sciences. Transfer of these cells or materials will be in accordance with standard material transfer procedures between the owner and recipient of the cell line or material. These types of material transfers occur frequently in research environments, especially in the life sciences. In fact, the applicant has 2(2009), CyT25(2002), BG01(2001), BG02(2001 ), BG03 (2001) and BGOlv (2004) were derived and characterized. From the time of the award, such agreements with commercial and non-commercial industrial partners and collaborators The years in parentheses next to each cell line listed above are Cell lines or materials become publicly available and immortalized (e.g., cell banks are created). The year in which the composition was made and the method described herein were carried out Since the establishment of these cell lines, no additional embryo destruction has been performed or required for the purpose of stomach. In August 2006, Klimanskaya et al. reported that hESCs can be derived from a single blastomere. and thus leaving the embryos intact and not causing their destruction. Using micromanipulation techniques, biopsies were taken from each embryo and nineteen (19) ES cell-like outgrowths and and two (2) stable hESC lines were obtained. These hESC lines were subsequently cultured for over six (6) months. The cells were also able to be maintained in an undifferentiated state, with normal karyotypes and the expression of Oct-4, SSEA-3, and , SSEA-4, TRA-1-60, TRA-1-81, Nanog and alkaline phosphatase These hESCs showed expression of pluripotency markers, including isoforms of phosphodiesterase (PSCs). To differentiate and form derivatives of all three (3) embryonic germ layers in vitro and in vivo vo can be formed in the form of a teratoma, creating a new stem cell line without the destruction of the embryo. These methods address the ethical concerns of using human embryos, the disclosure of which is incorporated by reference. (2006) Nature 10:1311-1355, which is incorporated herein in its entirety. e 444:481-5, Epub 23 Aug. 2006. Anskaya et al. co-cultured the derived hESC lines with other hESCs. Later, in 2008, In 2003, Chung Y. et al. re-cultured hESCs from a single blastomere without co-culture with hESCs. The system was obtained. Chung Y. et al., which is fully incorporated herein by reference. See Cell Stem Cell 2008, 2(2), pp. 113-117. Thus, the compositions and methods described herein, in particular those using induced pluripotent stem cells or genetically modified Such compositions and methods, such as those relating to dedifferentiated pluripotent stem cells, include those that are suitable for use in the treatment of human embryos. is not required. Tables 3 and 4 provide non-exhaustive lists of certain iPSCs and hESCs, respectively. The present invention relates to a method and method for the treatment of various conditions, and is publicly available and available worldwide for research and / or commercial purposes. The information in Tables 3 and 4 is taken from the literature and from, for example, Natl. onal Institutes of Health(NIH)Human Stem Cell Registry, Human Embryonic Stem Cell Registry and University of Massachusetts Medical School, Worcester, Massachusetts, U. Including the International Stem Cell Registry in SA These databases are derived from publicly available databases. It is updated regularly as cell lines become available and accessions are obtained. Human iPSCs as described herein (at least iPSC-603 and iPSC-482 -c7) is Cellular Dynamics International, Inc. (Madison, Wisconsin, USA). [Table 3] JPEG2025000625000006.jpg245168JPEG2025000625000007.jpg245168JPEG2025000625000008.jpg245168 JPEG2025000625000009.jpg245168JPEG2025000625000010.jpg245168JPEG2025000625000011.jpg166168

[0074] Another advantage is that such hIPS cells are an immunologically compatible autologous cell population and can be administered to patients The aim of this study is to investigate the origin and progression of the disease by identifying specific cells. It is therefore possible to understand the root cause of the disease and thereby improve prognosis. Insights may be provided that guide the development of preventative and therapeutic treatments.

[0075] Pluripotent human embryonic stem (hES) cells Some embodiments include, but are not limited to, the production of definitive endoderm cells and ultimately, pre-embryonic Selected cells include gut endoderm, pancreatic endoderm, endocrine precursor cells and / or pancreatic islet hormone expressing cells. Any endoderm lineage-derived cell type can be derived using human embryonic stem (hES) cells as starting material. The present invention is directed to methods for the production and / or propagation of hES cells from a morula, an embryonic inner cell mass or an embryo. The cells may be derived from the genital ridges. Human embryonic stem cells are known in the art. They are maintained in a pluripotent state in culture without substantial differentiation using methods known in the art. Such methods are described, for example, in U.S. Pat. No. 670,372, No. 5,690,926, No. 5,843,780, No. 6,2 Nos. 6,251,671 and 6,000,806, the disclosures of which are incorporated herein by reference. Fully incorporated in the specification.

[0076] In some processes, pluripotent stem cells, e.g., hES cells, are maintained on a feeder layer. Such a process allows pluripotent cells to be maintained in a pluripotent state. Any feeder layer that is suitable for culturing human embryonic stem cells can be used. One commonly used feeder layer for transplantation is a layer of mouse fibroblasts. Recently, human fiber has been developed for use in the cultivation of pluripotent cells. Blast cell feeder layers have been developed (the disclosure of which is incorporated herein by reference in its entirety). (U.S. Patent Application Publication No. 2002 / 0072117). In an alternative process, a feeder layer It is now possible to maintain pluripotent cells without the use of feeder cells. Methods for maintaining the temperature under these conditions are described in U.S. Patent Application Publication No. 2003 / 0,175,956. No. 6,399,433, the disclosure of which is incorporated herein by reference in its entirety.

[0077] The pluripotent cells described herein are cultured in a medium containing an extracellular matrix, with or without serum. The cells can be maintained in culture with or without FGF. Some pluripotent cell maintenance procedures use serum replacement. These and other methods for culturing and differentiating cells are described in PCT / US200, respectively. 7 / 062755, filed February 23, 2007, entitled COMPOSITIONS AND METHODS FOR CULTURING DIFFERENTIAL CELL S and PCT / US2008 / 080516, filed October 20, 2008, entitled ME THODS AND COMPOSITIONS FOR FEEDER-FREE P LURIPOTENT STEM CELL MEDIA CONTAINING HU MAN SERUM, which are incorporated herein by reference in their entireties.

[0078] The invention described herein relates to all hES cell lines and at least those listed in Table 4. This information is provided in the literature and in, for example, National Institute of itutes of Health(NIH) Stem Cell Registry , Human Embryonic Stem Cell Registry and Un iversity of Massachusetts Medical School International Business Center, Worcester, Massachusetts, USA Publicly available databases, including the National Stem Cell Registry These databases are compiled as cell lines become available and can be deposited. As of the filing date of this application, International Patent Office (IPO) 254 iPSC lines listed in the tem Cell Registry and 121 There was one hESC line. Table 4 below lists all of the hESC and iPSC lines. These are not inclusive but are examples of potentially available pluripotent stem cells. [Table 4] JPEG2025000625000013.jpg245168JPEG2025000625000014.jpg245168JPEG20250006250 00015.jpg245168JPEG2025000625000016.jpg245168JPEG2025000625000017.jpg245168

[0079] Pluripotent dedifferentiated somatic cells Recently, studies using certain nuclear reprogramming factors have demonstrated that pluripotent stem cells or It is now possible to derive pluripotent-like stem cells from a patient's own somatic cells. In the present invention, Shinya Yamanaka describes various iPS cell lines provided by Kyoto University. However, other iPS cell lines, such as James Thomson et al., A1. The present invention is directed to the use of a method for producing a cellular membrane comprising: US Patent Application Publication No. 20090047263 and International Publication No. WO2005 / 8059 8. U.S. Patent Application Publication No. 20080233610 and International Publication No. WO2008 / 118 82. Thus, as used herein, "induced pluripotent stem (iPS) ) cells" refers to other pluripotent stem cells, such as hES cells, hEG cells, pPS (primate pluripotent stem cells, The term "parthenogenetic stem cells" refers to cells that have similar properties to parthenogenetic cells, etc.

[0080] Nuclear programming factors are described in U.S. Patent Application Publication No. 20090047263, International Patent Application Publication No. WO 2009 / 023361, and the like. O2005 / 80598, U.S. Patent Application Publication No. 20080233610 and International Publication No. The method is described in WO2008 / 11882 and involves the use of a method for the differentiation of a mouse model mouse without using eggs, embryos, or ES cells. The present invention uses the method described herein to induce reprogramming of cells. Derived from somatic cells using nuclear reprogramming factors similar to those used in The method for preparing the iPS cells is not particularly limited. The nuclear reprogramming factor is contacted with somatic cells in an environment in which the cells and induced pluripotent stem cells can grow. An advantage of certain embodiments described herein is that the cells can be cultured using eggs, embryos, or embryonic stem (ES) cells. Induced pluripotent stem cells can be generated by contacting nuclear reprogramming factors with somatic cells in the absence of pluripotent stem cells. By using nuclear reprogramming factors, Somatic cell nuclei can be reprogrammed to obtain iPS cells or "ES-like cells." do.

[0081] The pluripotent stem cells described herein may be hES cells or iPS cells. These include, but are not limited to, alkaline phosphatase (AP); ABCG2; Disspecific Embryonic Antigen-1 (SSEA-1); SSEA-3; SSEA-4; TRA-1-60 ;TRA-1-81;Tra-2-49 / 6E;ERas / ECAT5, E-cadherin βIII-tubulin; alpha-smooth muscle actin (alpha-SMA) ;Fibroblast growth factor 4 (Fgf4), Cripto, Dax1;Zinc finger protein 296 (Zfp296); N-acetyltransferase-1 (N at1); (ES cell-associated transcript 1 (ECAT1); ESG1 / DPPA5 / ECAT2 ;ECAT3;ECAT6;ECAT7;ECAT8;ECAT9;ECAT10;EC AT15-1;ECAT15-2;Fthl17;Sall4;Blast cell transcription factors ( Utf1);Rex1;p53;G3PDH;Telomerase such as TERT;Silent X chromosome gene; Dnmt3a; Dnmt3b; TRIM28; F-box-containing protein Fbx15;Nanog / ECAT4;Oct3 / 4;Sox2;Klf4 ;c-Myc;Esrrb;TDGF1;GABRB3;Zfp42, FoxD3;GD F3; CYP25A1; developmental pluripotency-associated 2 otency-associated 2 (DPPA2); T-cell lymphoma Breakpoint syndrome T-cell lymphoma breakpoint 1 (Tcl1) ;DPPA3 / Stella;DPPA4 and any number of pluripotent cell markers. The present invention is not limited to the markers listed herein, and may include cell surface markers. -, antigens, and ESTs, RNA (including microRNA and antisense RNA) , DNA (including genes and cDNA) and other gene products, including portions thereof. It is understood to encompass markers.

[0082] In one embodiment, the iPS cell lines used herein contain the following nuclear reprogramming factors: Contains child genes: Oct family genes, Klf family genes, and Sox Family genes. In one iPS cell line, the following three genes were expressed: Oct3 / 4 The following three genes are provided: Octofc, Klf4, and Sox2. family genes, Klf family genes, and Myc family genes, e.g., O Using other iPS cell line gene products, ct3 / 4, Klf4 and c-Myc Therefore, nuclear reprogramming factors may include Myc family genes. It is understood that this is not necessary.

[0083] Nuclear reprogramming factors as described herein and known in the art can be used to induce differentiation and can be used to generate iPS cells from adult somatic cells, which There is no restriction on the type of somatic cell that can be programmed, i.e., any type of somatic cell can be programmed. Somatic cell reprogramming can be achieved by reprogramming cells from eggs and and / or since no embryo is required, the iPS cells may be mammalian cells and therefore may be useful in treating a patient. Alternatively, an opportunity may be presented to generate disease-specific pluripotent stem cells.

[0084] Aggregated suspension of pluripotent stem cells Based on seeding individual cells into polymer scaffolds, matrices and / or gels In contrast to previously known tissue engineering methods, the embodiments described herein produce multipotent stem cells. A cell aggregate suspension formed from cells, a single cell suspension or a differentiated cell derived therefrom Single cell suspensions can be used. Processing and / or production of stem cell aggregate suspensions and methods for differentiation of the cells are described in International Application PCT / US2007 / 062,755 and No. 6,356, filed on Oct. 13, 2008, which is incorporated herein by reference in its entirety. is incorporated into.

[0085] In one embodiment, a single cell of a pluripotent stem cell culture, such as a hES or iPS cell culture, A method is provided for producing a pluripotent stem cell aggregate suspension from the suspension. They can be cultured initially on blast cell feeders or even feeder-free. Methods for isolating hES cells and culturing them on human feeder cells are described in US Pat. No. 7,432,104, which is incorporated herein by reference in its entirety. .

[0086] As used herein, the term "single cell suspension" or its equivalent refers to a multipotent Single cell suspensions of sexual, multipotent or terminally differentiated cells, or pluripotent or multipotent cells Refers to a single cell suspension derived from cells by any mechanical or chemical means. Dissociate cell clusters from primary tissues, cells in attached cultures, and aggregates to produce single There are several methods to form a cell suspension, e.g., physical force (cell scraper, Disaggregation and microcentrifugation by trituration through a narrow bore pipette, fine needle aspiration, and vortexing Mechanical solutions such as forced filtration through a thick nylon or stainless steel mesh separation), enzymes (e.g. trypsin, collagenase, Accutase™, etc. In addition, pluripotent cells, multipotent cells or a combination of both may be present. Methods and culture medium conditions that can support the dissociation of differentiated cells into single cells have been widely used. Useful for proliferation, cell sorting, and defined seeding for well plate assays and allows automation of culture sequences and clonal expansion.

[0087] Other embodiments include differentiation media, such as agents, preferably receptors of the TGFβ family. TGFβ family members that can activate Pluripotent stem cells were cultured in a differentiation medium containing thybin B, GDF-8, GDF-11 and Nodal. A method for directly producing a cell aggregate suspension is provided. Growth factors for the production of endoderm are No. PCT / US2008 / 065,686, which is incorporated herein by reference in its entirety. The method of producing a cell aggregate suspension in a differentiation medium is also described herein. Pluripotent stem cell culture media, such as those described in PCT / US2007 / 062,755 StemPro® is based on the heregulin-based DC-HAIF medium ) Others that provide for the generation of cell aggregate suspension cultures in hES SFM (Invitrogen) It can be distinguished from the method.

[0088] The embodiments described herein involve the production of pluripotent cells in an undifferentiated state from pluripotent adherent cultures. The adherent pluripotent cell cultures were cultured in adherent growth culture conditions that allowed the proliferation of the cells. Dissociated single cell suspension cultures into suspension cultures, single cell suspension cultures By stirring for a period from 10 min to the formation of pluripotent derived cell aggregates in suspension, Thus, the cells are contacted with first differentiation culture conditions that allow for the formation of hES-derived cell aggregates in suspension. thereby generating pluripotent derived cell aggregates in suspension, The present invention relates to a method for generating pluripotent cell aggregates. In a preferred embodiment, a single cell suspension is The stirring of the turbid culture is carried out by rotating at about 80 rpm to 160 rpm. In certain other embodiments described herein, the aggregation, growth, proliferation, expansion and differentiation of pluripotent stem cells are achieved. and / or use a rho kinase inhibitor to facilitate cell aggregation.

[0089] The embodiments described herein provide adherent growth culture conditions that allow expansion in an undifferentiated state. The hES cells were cultured under the conditions described above; the undifferentiated hES cells were cultured under the conditions described above for differentiation into hES cells. and contacting the hES-derived cells with conditions to produce adherent pluripotent derived cells; Single cell suspension cultures form suspended pluripotent derived cell aggregates. By stirring the single cell suspension culture until such a time that the single cell suspension culture with second differentiation culture conditions that permit the formation of hES-derived cell aggregates in suspension; This generates suspended pluripotent derived cell aggregates, thereby allowing the pluripotent derived single cells to be isolated. The present invention also relates to a method for producing suspended pluripotent-derived cell aggregates from a suspension. In the present study, agitation of single cell suspension cultures is achieved by rotation at approximately 80 rpm to 160 rpm. will be done.

[0090] In a preferred embodiment, manufacturing scale suspension cultures maximize cell density while maintaining cell viability. A method to maintain the symbiosis of the cells is to use continuous perfusion of the medium. The cultures contribute fluid shear which affects attached cells and suspended aggregates differently. Fixed, adherent cells are subjected to fluid shear stress as fluid flows tangentially over the cell surface. In addition, the aggregates roll freely in response to the shear load, so the aggregate surface area experienced by the suspended aggregates Shear stress across the membrane is much weaker. Long-term shear stress is detrimental to adherent pluripotent cells. Therefore, it is expected that a suspension-aggregate format would be preferred for optimal survival and function. For the generation of pluripotent stem cells and / or multipotent progenitor cells derived from pluripotent stem cells The need for an efficient manufacturing process for, and the above observations regarding shear rate and shear stress Based on the mechanism described herein, the embodiments described herein are the first to develop a method for the preparation of suspension-based, cell-free, Pluripotent stem cells and / or pre-pluripotent stem cells derived from pluripotent stem cells in the form of an aggregate suspension A manufacturing method for the generation of progenitor cells is provided.

[0091] In yet another embodiment, the hES cell aggregate suspension is cultured in a medium that is substantially free of serum. Furthermore, the cells were cultured in the absence of exogenously added fibroblast growth factor (FGF). hE cells were cultured in medium that was serum-free but contained exogenously added growth factors such as FGF. U.S. Patent No. 7,005,200 to Thomson, J., which requires culturing S cells. In some embodiments, the iPS cell aggregate suspension is substantially free of serum. In culture medium free of and / or in addition to exogenously added fibroblast growth factor (FGF) The cells are cultured in the absence of GF.

[0092] Cell aggregates produced by known methods may vary in both size and shape In contrast to cells, the cell aggregates and methods described herein are narrowly classified into sizes and shapes. The cell aggregates have a uniform texture, i.e., the cell aggregates are substantially uniform in size and / or shape. Size uniformity of vesicle aggregates is important for differentiation performance and culture uniformity. When applying mass transport analysis to aggregates, assuming equal permeability, the mass transport Diffusion of oxygen and nutrients into the aggregates is expected to be slower compared to diffusion into smaller aggregates. Differentiation of aggregated ES or iPS cells into pancreatic lineage cells can be achieved by the temporary application of specific growth factors. Since the size of the aggregates depends on the size of the cells, cultures with a mixture of aggregates of different sizes may result in a uniform (single) cell aggregate. This mixture of cell aggregates may be asynchronous compared to cultures with different sizes and shapes. This leads to heterogeneity, resulting in poor differentiation performance and ultimately hindering manufacturing, scaling and production. Therefore, as used herein, the phrase "substantially uniform" "Uniform" or "Substantially uniform in size and shape" or the equivalent refers to the uniformity of the aggregates. In another embodiment, the degree of uniformity of the aggregates is about 20% or less. The degree is about 15%, 10% or 5% or less.

[0093] The exact number of cells per aggregate is not critical, but the size of each aggregate (and therefore the number of aggregates) is important. The number of cells per aggregate is limited by the maximum diffusion of oxygen and nutrients to the central cell. and that this number may also vary depending on the cell type and the nutrient requirements of that cell type. As will be appreciated by those skilled in the art, cell aggregates are those that contain a minimum number of cells (e.g., The aggregates may contain up to 100 or 2000 cells per aggregate. Generally, cell aggregates contain hundreds to thousands of cells per aggregate. For purposes of this study, cell aggregates are generally from about 50 microns to about 600 microns in size. However, depending on the cell type, the size may be below or above this range. In some embodiments, the cell aggregates are between about 50 microns and about 250 microns in size, or about 7 The size is between 5 and 200 microns, preferably about 100 to 150 microns. I wish.

[0094] Yet another method describes the generation of embryoid bodies (EBs). In this case, the term "embryoid body", "aggregate body" or the like is used. Values ​​are observed when ES cells are overgrown in monolayer cultures or in suspension cultures in undefined media. These results suggest that the endothelial cells may be amenable to differentiation into multiple germ layer tissues when maintained in culture or differentiated by non-directed protocols. EBs refer to aggregates of differentiated and undifferentiated cells that are formed in the endothelial cells. EBs are formed from single cell suspensions of pluripotent stem cells, but also from multilineage cells derived from pluripotent stem cells. These features alone make it possible to identify the origin of the present invention. clearly distinct from the body.

[0095] A mixture of differentiated and undifferentiated cells, generally derived from cells of several germ layers. In contrast to embryoid bodies, which are composed of cells that undergo random differentiation, the cell aggregates described herein are composed of cells that are initially differentiated. Cells that are essentially or substantially homogeneous and may be of a pluripotent, multipotent, bipotent, or unipotent type. Cells of, for example, embryonic cells, definitive endoderm, foregut endoderm, PDX1-positive pancreatic endoderm, pancreatic endoderm It exists as aggregates in secretory cells, etc.

[0096] The embodiments described herein are processes that are readily adaptable for large-scale manufacturing. Repeatedly generating cell aggregates that are substantially uniform in size and shape using The present invention addresses the above problems by providing a cost-effective manufacturing process or method that allows In one particular embodiment, differentiable cells are grown in suspension culture using the cell culture medium of the present invention. In another particular embodiment, the differentiable cells are maintained and expanded in suspension. i.e., they remain undifferentiated or are prevented from further differentiation. The term "growing" in the context of cell culture is used in the art. is used to refer to cell proliferation and an increase in cell number, preferably an increase in viable cell number. In a specific embodiment, by culturing for about 1 day, i.e., for more than about 24 hours, In a more specific embodiment, the cells are grown in culture suspension. , 5, 6, or 7 days, or at least 2, 3, 4, 5, 6, 7, or 8 weeks. Thus, the cells are grown in suspension culture.

[0097] Yet another embodiment of the invention is a differentiated pluripotent stem cell culture, e.g., the d'Am Cells from stages 1, 2, 3, 4 and 5 described in our 2005 and 2006 A cell aggregate suspension formed from cells generated from the pluripotent cells described herein, comprising: The present invention provides a method for producing a suspension, thereby producing the cell aggregates described herein. The methods are not limited to any one pluripotent or multipotent cell or cell stage, Rather, the method of use and the need for cell type optimization will determine which method is preferred. do.

[0098] Pluripotent cells, such as hES or iPS cells, and other sources of pluripotent cells, such as embryonic stem cells. The present invention relates to a method for producing aggregate suspension cultures of cells derived from apomictic or parthenogenetic organisms. The method described herein is substantially the same as that described in the application entitled Compositions and Methods for Composing Patents, filed February 23, 2007. tions and methods for culturing differences tial cells, PCT / US2007 / 062,755, and 2008 The application was filed on October 20th and is entitled "Methods and compositions." for feeder-free pluripotent stem cell me PCT / US2008 / US Pat. No. 5,399,433, which is incorporated herein by reference in its entirety. Be absorbed.

[0099] The methods described herein include, for example, those to Bodnar et al. and Geron As described in U.S. Patent No. 6,800,480 assigned to the There is no need to first coat the culture vessel with an extracellular matrix. In some embodiments, the iPS cells are derived from other pluripotent stem cells, such as hES and iPS cells. No. 6,313,633, issued Oct. 20, 2008, which is incorporated herein by reference in its entirety. The title of the book is Methods and compositions for feede r-free pluripotent stem cell media conta ining human serum, U.S. patent application PCT / US2008 / 080 The cells were cultured in the same manner as described in 516 using soluble human serum. It is possible.

[0100] The methods described herein are directed to Thomson, J., Wis. The research was transferred to the Shin Alumni Research Foundation (WARF). No. 7,005,252, which is incorporated herein by reference in its entirety. As mentioned above, exogenously added fibers provided from a source other than a fibroblast feeder layer are No fibroblast growth factor (FGF) is required.

[0101] Multipotent and Differentiated Cell Compositions The cell compositions produced by the methods described herein include pluripotent stem cells, preprimitive streak, mesendothelium, definitive endoderm, foregut endoderm, PDX1-positive foregut endoderm, PDX1-positive pancreatic endoderm or PDX1 / NKX6.1 co-positive pancreatic endoderm, endocrine precursors or NGN3 / NKX2.2 Co-positive endocrine precursors, and hormone-secreting endocrine cells or INS, GCG, GHRL, SST, cell cultures containing PP single-positive endocrine cells, at least Approximately 5-90% of the cells were generated as anterior primitive streak, mesendoderm, definitive endoderm, foregut endoderm, and PDX1 positive. Foregut endoderm, PDX1-positive pancreatic endoderm or PDX1 / NKX6.1 co-positive pancreatic endoderm, Endocrine precursors or NGN3 / NKX2.2 co-positive endocrine precursors, and hormone secreting endocrine precursors Secretory cells or INS, GCG, GHRL, SST, or PP single-positive endocrine cells.

[0102] Some embodiments described herein involve the use of pluripotent cells, such as stem cells and iPS cells, and pre- Both pluripotent cells such as primitive streak, mesendoderm or definitive endoderm, as well as PDX1-positive pre-embryonic Gut endoderm, PDX1-positive pancreatic endoderm or PDX1 / NKX6.1 co-positive pancreatic endoderm, endoderm Secretory precursors or NGN3 / NKX2.2 co-positive endocrine precursors, and hormone secretory endocrine fragments More specific endocrine cells, such as secretory cells or INS, GCG, GHRL, SST, and PP single-positive endocrine cells Cell populations and cell cultures that contain differentiated, but still potentially multipotent, cells. For example, the methods described herein can be used to generate pluripotent stem cells and other Compositions containing mixtures of multipotent or differentiated cells can be produced. In embodiments, at least about 5 multipotent or differentiated cells are obtained for every about 95 pluripotent cells. In another embodiment, a composition comprising at least about every 5 pluripotent cells is produced. 95 pluripotent or differentiated cells. Compositions comprising pluripotent or differentiated cells and pluripotent cells are contemplated. For example, about 1,0 Contains at least about 1 multipotent or differentiated cell for every 00,000 pluripotent cells. A composition comprising at least about 1 multipotent cell or differentiated cell for every about 100,000 pluripotent cells. and a composition comprising at least about 1 multipotent cell for every about 10,000 pluripotent cells. A composition comprising cells or differentiated cells, comprising at least about 1 for every about 1000 pluripotent cells. A composition comprising pluripotent or differentiated cells, comprising at least about every 500 pluripotent cells. A composition comprising about 1 multipotent or differentiated cell, at least for every about 100 pluripotent cells. A composition comprising at least about 1 multipotent or differentiated cell for every about 10 pluripotent cells. A composition comprising at least about 1 multipotent or differentiated cell, for every about 5 pluripotent cells. and at least about one multipotent or differentiated cell for every up to about one pluripotent cell. and at least about 1,000,000 multipotent cells for about one pluripotent cell. Compositions comprising potent or differentiated cells are contemplated.

[0103] Some embodiments described herein include at least about 5% multipotent or differentiated cells. A cell culture or a cell culture medium comprising at least about 99% pluripotent or differentiated cells. In some embodiments, the cell culture or cell population is a mammalian cell. In a preferred embodiment, the cell culture or cell population comprises human cells. For example, Certain embodiments include a cell culture comprising human cells, the cell culture comprising at least about 5% of the human cells. The present invention relates to cell cultures in which at least about 99% are pluripotent or differentiated cells. Another embodiment is a cell culture comprising human cells, at least about 5% of the human cells, at least about 10% of the human cells, At least about 10%, at least about 15%, at least about 20%, at least about 25%, At least about 30%, at least about 35%, at least about 40%, at least about 45%, At least about 50%, at least about 55%, at least about 60%, at least about 65%, At least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or or more than 99% of the cells are multipotent or differentiated. In some embodiments, the cell population comprises human feeder cells, or in some embodiments, the human feeder cells are cultured in cell culture. The above percentages are calculated without taking into account the driver cells.

[0104] Pluripotent, multipotent or differentiated cells include cells of the preprimitive streak, mesoendoderm, definitive endoderm, etc. and differentiation into cells, tissues and / or organs derived therefrom, or Mesoendodermal cells can differentiate into mesodermal cells and / or endomesodermal cells. Endodermal cells, as well as cells, tissues and / or organs derived from any of these lineages. In some embodiments, the preprimitive streak cells are capable of differentiating into mesodermal organs. Through the interbody, they are transformed into terminally differentiated cells of either the mesoderm or definitive endoderm lineage. For example, such processes can be used to culture human endoderm-derived tissues, such as pancreas, liver, lung, stomach, intestine, thymus, and the like. It provides the basis for the efficient generation of the thyroid glands, parathyroid glands, thymus, pharynx, gallbladder and urinary bladder. Importantly, the generation of preprimitive streak cells and / or mesoendodermal cells is mechanically As another example, it is an early step in the differentiation of pluripotent stem cells into potent insulin-producing β-cells. The differentiation of preprimitive streak cells and / or mesoendodermal cells can be used to generate human mesoderm-derived tissues, e.g. Basis for efficient generation of spheres, cardiovascular tissue, skeletal tissue and other structural and connective tissues can be provided.

[0105] The compositions and methods described herein have several useful features. For example, they may Cell cultures and cells comprising differentiated cells, e.g., preprimitive streak cells and / or mesendoderm cells The cell cultures and cell populations are derived from human embryonic stem cells. Further, the compositions and methods described herein are useful for modeling the early stages of may also serve as a therapeutic intervention in pathologies such as diabetes mellitus. For example, preprimitive streak cells and / or pure tissues, since mesendoderm cells serve as a source for only a limited number of tissues or in the development of cell types. In some processes, the pluripotent cells used as starting material are pluripotent stem cells, e.g. The cells are ES cells, hEG cells or iPS cells.

[0106] Trophectoderm cells The methods described herein can be used to produce trophectoderm cells that are substantially free of other cell types. In some embodiments described herein, a composition comprising the In the trophectoderm cell populations or cell cultures generated by the described methods, HAND1, E omes, MASH2, ESXL1, HCG, KRT18, PSG3, SFXN5, DL A marker selected from the group consisting of X3, PSX1, ETS2, and ERBB genes. Expression of HAND1, Eomes, and MASH2 in non-trophectoderm cells or cell populations , ESXL1, HCG, KRT18, PSG3, SFXN5, DLX3, PSX1, ET S2, and substantially higher compared to the expression levels of ERBB.

[0107] Anterior streak cells The methods described herein can be used to generate cells that contain preprimitive streak cells, substantially free of other cell types. In some embodiments described herein, the compositions can be produced by The preprimitive streak cell population or cell culture generated by the method of the present invention expresses the FGF8 marker gene and and / or NODAL marker genes, BRACHURY low, FGF4 low, SNAI 1 low, SOX17 low, FOXA2 low, SOX7 low and SOX1 low Manifest.

[0108] extraembryonic cells The methods described herein can be used to produce cells, including extraembryonic cells, that are substantially free of other cell types. The compositions can be produced. Primitive endoderm cells, proximal endoderm cells and distal endoderm cells. are extraembryonic cells. Primitive endoderm cells give rise to proximal and distal endoderm cells. Proximal endoderm cells are endoderm cells that form part of the yolk sac. Proximal endoderm cells are cells that provide nutrition. Distal endoderm cells function in both the uptake and transport of nutrients. One of the roles of distal endoderm cells is to regulate the organization of the basement membrane. In summary, proximal and distal endoderm cells often As the name suggests, extraembryonic endoderm cells form what is called the extraembryonic endoderm. do not give rise to the embryonic structures that form during development. In contrast, the definitive endoderm cells described herein and other endodermal or pancreatic lineage cells that are embryonic or derived from embryonic cells. and give rise to tissue derived from the gut tube formed during embryonic development. In some embodiments, the extraembryonic cell populations or cells generated by the methods described herein are In cell cultures, the SOX7 gene, the SOX17 gene, the THBD gene, and the SPARC gene , DAB1 gene, FTNF4alpha gene or AFP gene The expression of markers that are involved in the differentiation of at least one of the cells in the definitive endoderm is also consistent with that of other cell types or cell populations, e.g. Not expressed SOX7, SOX17, THBD, SPARC, DAB1, or AFP is substantially higher compared to the expression level of

[0109] Mesendoderm cells The methods described herein can be used to produce cells that contain mesendoderm cells, substantially free of other cell types. In some embodiments described herein, a composition comprising the The mesendodermal cell populations or cell cultures generated by the methods described herein may be cultured using FGF4, SNAI1 , MIXL1 and / or WNT3 marker genes The expression of SOX17 low, CXCR4 low, FOXA2 low, SOX7 low and SOX1 low Substantially higher in comparison.

[0110] Screening Methods In some embodiments, the screening method is used to identify human pluripotent stem cells, induced pluripotent stem cells, Stem cells, preprimitive streak cells, mesendoderm cells, definitive endoderm cells, foregut endoderm or PDX1-negative pre Gut endoderm cells, PDX1-positive foregut endoderm cells or PDX1-positive pancreatic endoderm cells or pancreatic Pluripotent cells, multipotent cells, and endocrine cells, such as progenitor cells, endocrine precursor cells, and / or endocrine cells. A specific cell population, such as a population of cells that have been cultured and / or differentiated, is then obtained. At a first time point, which is prior to or approximately simultaneous with the delivery of the candidate differentiation factor, Alternatively, expression of the marker may be determined after introducing the candidate differentiation factor. After the first time point and providing the candidate differentiation factor to the cell population, the amount of differentiation of the cell population can be determined. At a second time point, after the step of determining expression of the same markers, the expression of the candidate differentiation factors is again determined. can promote the differentiation of pancreatic progenitor cells using markers at the first time point. The expression of the marker at the second time point is compared to the expression of the marker at the second time point. The expression of the marker at the first time point is increased or decreased compared to the expression of the marker at the second time point. In this case, the candidate differentiation factor can promote the differentiation of pancreatic progenitor cells. .

[0111] In some embodiments of the screening methods described herein, human definitive endoderm, PDX PDX-1-negative foregut endoderm, PDX-1-positive foregut endoderm, PDX-1-positive pancreatic endoderm, or pancreatic A cell population or cell culture containing endocrine precursor or endocrine progenitor cells is utilized. For example, The cell population is a substantially purified population of PDX-1 positive pancreatic endoderm or pancreatic progenitor cells. For example, the cell population may be an enriched population of human pancreatic progenitor cells, At least about 50% to 97% of the human cells in the population are human pancreatic progenitor cells, and the remainder are endogenous It is composed of secretory precursor or endocrine cells and other cell types.

[0112] In some embodiments of the screening methods described herein, the cell population is a candidate (test) Contacting with or otherwise providing a candidate (test) differentiation factor. The factor has the potential to promote differentiation of any of the above cells, e.g., human pancreatic progenitor cells. In some embodiments described herein, the candidate differentiation factor may include any molecule that Contains molecules known to be differentiation factors for one or more types of cells. In an alternative embodiment, the candidate differentiation factors include molecules not known to promote cell differentiation. In a preferred embodiment, the candidate differentiation factor is capable of promoting differentiation of human pancreatic progenitor cells. Contains unknown molecules.

[0113] In some embodiments of the screening methods described herein, the candidate differentiation factor is a small In a preferred embodiment, the small molecule has a molecular weight of about 10,000 amu or less. It is a molecule.

[0114] In other embodiments described herein, the candidate differentiation factors are large molecules, e.g., polypeptides. Polypeptides include, but are not limited to, glycoproteins, lipoproteins, extracellular matrix proteins, and the like. Proteins, cytokines, chemokines, peptide hormones, interleukins or The polypeptide may be any polypeptide containing a growth factor. Preferred polypeptides include growth factors. Includes children.

[0115] In some embodiments of the screening methods described herein, the candidate differentiation factor is Amphiregulin, B-lymphocyte stimulator, IL-16, thymopoietin, TRAIL / A po-2, pre-B cell colony-stimulating factor, endothelial differentiation-related factor 1 (EDF1), endothelial monocyte activation Activating polypeptide II, macrophage migration inhibitory factor (MIF), natural killer cells bone morphogenetic protein 2, bone morphogenetic protein 8 (NKEFA) 2), bone morphogenetic protein 6, bone morphogenetic protein 7, connective tissue growth factor (CTGF), CG I-149 protein (neuroendocrine differentiation factor), cytokine A3 (macrophage inflammatory Protein 1-alpha), glioblastoma cell differentiation-related protein 1 (GBDR1), hepatocellular carcinoma derived growth factor, neuromedin U-25 precursor, vascular endothelial growth factor (VEGF), Vascular endothelial growth factor B (VEGF-B), T cell-specific RANTES precursor, thymic dendritic Cell-derived factor 1, transferrin, interleukin-1 (IL1), interleukin Interleukin-2 (IL2), Interleukin-3 (IL3), Interleukin-4 (IL4) , interleukin-5 (IL5), interleukin-6 (IL6), interleukin Interleukin-7 (IL7), Interleukin-8 (IL8), Interleukin-9 (IL9) , interleukin-10 (IL10), interleukin-11 (IL11), interleukin -Leukin-12 (IL12), Interleukin-13 (IL13), Granulocyte colony Granulocyte-macrophage colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), Macrophage colony-stimulating factor (M-CSF), erythropoietin, thrombopoietin, Vitamin D3, epidermal growth factor (EGF), brain-derived neurotrophic factor, leukemia inhibitory factor, thyroid Hormones, basic fibroblast growth factor (bFGF), aFGF, FGF-4, FGF-6 , FGF-7 / keratinocyte growth factor (KGF), platelet-derived growth factor (PDGF), Platelet-derived growth factor-BB, beta nerve growth factor, activin A, transforming growth factor Transforming Growth Factor β1 (TGFβ1), interferon-α, interferon-β, interferon prothrombin-γ, tumor necrosis factor-α, tumor necrosis factor-β, burst promoting activity (BPA), erythropoietin promoting activity activity (EPA), PGE2, insulin growth factor-1 (IGF-1), IGF-II, Ni Neurotrophin Growth Factor (NGF), Neurotrophin- 3. Neurotrophin 4 / 5, ciliary neurotrophic factor, glial-derived nexin, dexamethasone , β-mercaptoethanol, retinoic acid, butyl hydroxyanisole, 5- Zacitidine, amphotericin B, ascorbic acid, ascorbate, isobutylxane cin, indomethacin, β-glycerol phosphate, nicotinamide, DMSO, Azolidinediones, TWS119, oxytocin, vasopressin, melanocyte-stimulating hormone mon, adrenocorticotropic hormone, lipotropin, thyroid-stimulating hormone, growth hormone, progesterone Lactin, luteinizing hormone, human chorionic gonadotropin, follicle-stimulating hormone, adrenal cortex stimulating hormone Prolactin-releasing factor, gonadotropin-releasing factor, prolactin-releasing factor, prolactin inhibitor Growth hormone releasing factor, somatostatin, thyrotropin releasing factor, calcium Tonin gene-related peptide, parathyroid hormone, glucagon-like peptide 1, glucose-dependent Insulinotropic polypeptide, gastrin, secretin, cholecystokinin, motile Phosphorus, Vasoactive Intestinal Peptide, Substance P, Pancreatic Polypeptide, Peptide Tyrosine , neuropeptide tyrosine, insulin, glucagon, placental lactogen, relaxin, a Indiotensin II, calcitriol, atrial natriuresis Peptides and melatonin, thyroxine, triiodothyronine, calcitonin, estradiol Radiol, estrone, progesterone, testosterone, cortisol, corticosterone ron, aldosterone, epinephrine, norepinephrine, androstenedione (andr ostiene), calcitriol, collagen, dexamethasone, β-mercaptoe Tanol, retinoic acid, butylated hydroxyanisole, 5-azacytidine, amphoteric acid Syn B, ascorbic acid, ascorbate, isobutylxanthine, indomethacin, β-glycerol phosphate, nicotinamide, DMSO, thiazolidinedione and The composition comprises one or more growth factors selected from the group consisting of: TWS119.

[0116] In some embodiments of the screening methods described herein, the candidate differentiation factor is In some embodiments, the candidate differentiation factor is provided to the cell population at one or more concentrations. The concentration of the candidate differentiation factor in the medium surrounding the cells is about 0.1 ng / ml to 10 mg / ml. In some embodiments, the candidate differentiation factor is provided to the cell population in the medium surrounding the cells. The concentration is from about 1 ng / ml to about 1 mg / ml. The concentration of the candidate differentiation factor in the medium is about 10 ng / ml to about 100 μg / ml. In this embodiment, the concentration of the candidate differentiation factor in the medium surrounding the cells is from about 100 ng / ml to about In a preferred embodiment, the concentration of the candidate differentiation factor in the medium surrounding the cells is 10 μg / ml. is about 5 ng / ml to about 1000 μg / ml.

[0117] In some embodiments, the steps of the screening methods described herein include a first The method includes determining the expression of at least one marker at a first time point and at a second time point. In some embodiments, the first time point is before or about the same time as providing the cell population with the candidate differentiation factor. Alternatively, in some embodiments, the first time point may be the same time point as when the candidate differentiation factor is administered. In some embodiments, the expression of a plurality of markers at the first time point is after providing the cell population. is determined.

[0118] In addition to determining the expression of at least one marker at a first time point, In some embodiments of the screening method, the expression of at least one marker is determined by a first At a second time point, which is after the first time point and after providing the cell population with the candidate differentiation factor, In such an embodiment, both the first and second time points are In some embodiments, expression of the same marker is determined at both the first and second time points. In such an embodiment, the expression of the plurality of markers is determined at the first time point and at the second time point. In some embodiments, expression of the same plurality of markers is determined at both points. A plurality of cells, each of which is obtained after one time point and after the application of a candidate differentiation factor to the cell population. In certain embodiments, expression of the marker is determined by Q-PCR. In another embodiment, the expression of the markers is determined by immunocytochemistry. do.

[0119] In certain embodiments of the screening methods described herein, the first time point and the second time point are The markers whose expression is determined at time point 2 are the most important factors in the formation of pancreatic islet tissue from pancreatic progenitor cells. It is a marker associated with differentiation into cells that are precursors of terminally differentiated cells. Examples of such cells include immature pancreatic islet hormone-expressing cells.

[0120] In some embodiments of the screening methods described herein, the cell population is treated with a candidate differentiation factor. and determining expression of the marker at the second time point. The step of providing a candidate differentiation factor to the cell population and the second step of The sufficient time between steps to determine the expression of the marker at a time point can be as short as about 1 hour. In some embodiments, the at least one marker may be present for up to about 10 days. The expression of the candidate differentiation factor is determined multiple times after providing the cell population with the candidate differentiation factor. The sufficient time is at least about 1 hour, at least about 6 hours, at least about 12 hours, At least about 16 hours, at least about 1 day, at least about 2 days, at least about 3 days , at least about 4 days, at least about 5 days, at least about 6 days, at least about 7 days , at least about 8 days, at least about 9 days, at least about 10 days, at least about 11 days days, at least about 12 days, at least about 13 days, at least about 14 days, at least at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least at least about 5 weeks, at least about 6 weeks, at least about 7 weeks, or at least about 8 weeks. do.

[0121] In some embodiments of the methods described herein, expression of the marker at the second time point is We further determined whether expression of this marker increased or decreased compared to time point 1. Increased or decreased expression of at least one marker indicates that the candidate differentiation factor is endogenous. It has been shown that the differentiation of secretory progenitor cells can be promoted. When expression is determined, the expression of the markers at the second time point is compared to the expression of the markers at the first time point. The expression of the plurality of markers is then compared to determine whether it has increased or decreased. The increase or decrease in expression of the marker is indicative of a cell population at the first time point and at the second time point. By measuring or otherwise assessing the amount, level or activity of a marker. Such determinations can be made based on other markers, e.g., housekeeping genes. It may be comparative to gene expression or it may be absolute. In certain embodiments, the expression of the marker is increased at a time point relative to the first time point. The amount is at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold , at least about 30 times, at least about 40 times, at least about 50 times, at least about 60 times , at least about 70 times, at least about 80 times, at least about 90 times, at least about 100 times fold or at least about 100-fold more. In some embodiments, the amount of increase is less than 2-fold. In an embodiment in which expression of the marker at the second time point is decreased compared to the first time point, , the amount of reduction is at least about 2-fold, at least about 5-fold, at least about 10-fold , at least about 1 / 20, at least about 1 / 30, at least about 1 / 40, At least about 1 / 50, at least about 1 / 60, at least about 1 / 70, at least about 1 / 8 0, at least about 90, at least about 100, or at least about 10 In some embodiments, the amount of reduction is no more than 2-fold.

[0122] Monitoring the generation of multipotent or differentiated cells Pluripotent cells to multipotent cells, and multipotent cells to pancreatic precursors or hormone-endocrine cells Progression to more multipotent or differentiated cells such as islet hormone in endocrine cells Expression of mon and processing of proinsulin to insulin and C-peptide expression of markers specific to specific cells, including genetic and phenotypic markers In some processes, certain Expression of a particular marker is determined by detecting the presence or absence of the marker. Alternatively, expression of a particular marker may be determined by detecting the marker in cells of the cell culture or cell population. For example, a particular The process involves the expression of markers specific to immature islet hormone-expressing cells, as well as the differentiation of pluripotent cells. vesicle, definitive endoderm, foregut endoderm, PDX1-positive foregut endoderm, endocrine precursors, extraembryonic endoderm, Markers specific to mesoderm, ectoderm, mature islet hormone-expressing cells and / or other cell types Determine the lack of significant expression of

[0123] The results are described in conjunction with monitoring the generation of other less differentiated cell types of the definitive endoderm lineage. Qualitative or semi-quantitative techniques such as blot transfer and immunocytochemistry as described previously have been used. The expression of the marker can be measured using techniques. , and can be accurately quantified by using techniques such as Q-PCR. At the polypeptide level, many of the markers for islet hormone-expressing cells are secreted proteins. It will be understood that, in this way, the amount of extracellular markers measured by ELISA or the like can be increased. Techniques are available for doing so.

[0124] For example, in one embodiment, PDX1 is a marker gene associated with PDX1-positive foregut endoderm. Thus, in some embodiments of the present invention, the expression of PDX1 is determined. In embodiments, the present invention includes, but is not limited to, SOX17, HNF6, SOX9, and PROX1. The expression of other markers expressed in PDX1-positive foregut endoderm is also determined. Certain other cell types (i.e., visceral endoderm and certain neuroectoderm) can also be expressed. Therefore, some embodiments of the present invention involve the development of mice associated with visceral endoderm and / or neuroectoderm. For example, some experiments have demonstrated the absence or substantial absence of marker gene expression. In embodiments, the gene may include, but is not limited to, SOX7, AFP, SOX1, ZIC1 and / or NFM. The expression of markers expressed in visceral endoderm and / or neural cells, including:

[0125] In some embodiments, the PDX1-positive foregut generated by the methods described herein. Endodermal cell cultures were cultured using SOX7, AFP, SOX1, ZIC1 or NFM markers. In certain embodiments, the nucleic acid is substantially free of cells expressing the polypeptides described herein. PDX1-positive foregut endoderm cell cultures generated by cessation are characterized by the presence of proximal endoderm, distal endoderm, and and / or substantially free of nerve cells.

[0126] The pluripotent cells described herein (e.g., those described in D'Amour et al. 2006, supra) may be used. The progression of development (cells that are generated as a result of steps 1–5) is called the developmental pathway. Determine the expression of markers characteristic of each hES- or iPS-derived cell type along the pathway In some processes, hES- or iPS-derived Identification and characterization of cell types can be achieved by differential expression of specific markers or multiple markers. By expression level and pattern, i.e., the presence or absence of one or more markers The presence, high or low expression of certain markers characterizes and identifies a cell type. can have a transient expression, whereby the marker is expressed only during one stage of development. Expression of certain markers is the measurement of the cellular marker abundance in a cell culture or cell population compared to a standardized or normalized control marker. Such a determination can be made by measuring the level at which the marker is present. In such processes, the measurement of marker expression may be qualitative or quantitative. One method to quantify the expression of markers produced by marker genes is quantitative PCR. By use of R (Q-PCR). Methods for performing Q-PCR are well known in the art.

[0127] In some embodiments of the invention, the presence, absence and / or expression level of a marker is determined by It can be determined by quantitative PCR (Q-PCR). For example, specific genetic markers, e.g. SOX17, CXCR4, OCT4, AFP, TM, SPARC, SOX7, CDX2, MIXL1, GATA4, HNF3β, HNF4α, GSC, FGF17, VWF , CALCR, FOXQ1, CMKOR1, CRIP1 and other genes described herein. The amount of transcript produced by the marker is determined by quantitative Q-PCR.

[0128] In another embodiment, immunohistochemistry is used to identify the proteins expressed by the above genes. In yet another embodiment, Q-PCR is used in combination with immunohistochemical techniques or or flow cytometry techniques to effectively and accurately characterize and identify cell types. and determining both the amount and relative proportion of such markers in the cell type of interest. In one embodiment, Q-PCR can be used to identify cells containing a mixed population of cells. The level of RNA expression in the culture can be quantified. However, Q-PCR , resulting in whether the markers or proteins of interest are co-expressed in the same cells or In another embodiment, Q-PCR is combined with flow cytometry. Thus, the methods described herein, e.g., For example, by using the above in combination, various types of cells, including endodermal lineage cells, can be produced. Complete characterization and identification of cell types can be achieved and demonstrated.

[0129] For example, in a preferred embodiment, pancreatic progenitors or pancreatic endoderm or PDX-1 positive Pancreatic endoderm is at least PD-L1 competent as demonstrated by Q-PCR and / or ICC. X1, Nkx6.1, PTF1A, CPA and / or cMYC, but not Such cells must be identified as PDX1 positive by ICC. co-express at least PDX1 and Nkx6.1 and express SOX17, CXCR4, or They do not express other markers, including CER. To properly identify mature hormone-secreting pancreatic cells in vo, e.g., insulin-secreting cells, In this study, C-peptide (the component responsible for the proper processing of proinsulin in mature and functional β-cells) It is demonstrated by ICC that the IL-1 protein (product of IL-1) and insulin are co-expressed.

[0130] Additionally, other methods known in the art can be used to quantitate marker gene expression. For example, expression of a marker gene product can be used to identify a marker gene product of interest. It can be detected by using specific antibodies (e.g., Western blot Certain processes use the unique properties of hES-derived cells. The significant expression of marker genes specific to hES-derived cells as well as marker genes specific to hES cells Further methods for characterizing and identifying hES-derived cell types are presented above. No. 6,399,343, which are incorporated herein by reference in their entireties.

[0131] Suitable amplification probe / primer combinations for use in the amplification assay are as follows: Insulin (INS) (GenBank NM_000207): Primer AA GAGGCCATCAAGCAGATCA (SEQ ID NO: 1); CAGGAGGCGCATC CACA (SEQ ID NO:2); Nkx6.1 (NM_006168): primer CTGGC CTGTACCCCTCATCA (SEQ ID NO: 3); CTTCCCGTCTTTGTCCA ACAA (SEQ ID NO: 4); Pdx1 (NM_000209): primer AAGTCTA CCAAAGCTCACGCG (SEQ ID NO: 5); GTAGGCGCCGCCTGC (SEQ ID NO: No. 6); Ngn3 (NM_020999): primer GCTCATCGCTCTCT ATTCTTTTGC (SEQ ID NO: 7); GGTTGAGGCGTCATCCTTTCT ( SEQ ID NO:8); FOXA2 (HNF3B) (NM_021784): primer GGGA GCGGTGAAGATGGA (SEQ ID NO: 9); TCATGTTGCTCACGGAGG AGTA (SEQ ID NO: 10); Glucagon (GCG) (NM_002054): primer AAGCATTTACTTTGTGGCTGGATT (SEQ ID NO: 11); TGATCTG GATTTCTCCTCTGTGTCT (SEQ ID NO: 12); HNF6(NM_03071 2): Primer CGCTCCGCTTAGCAGCAT (SEQ ID NO: 13); GTGTT GCCTCTATCCTTCCCAT (SEQ ID NO: 14); HNF4 alpha (NM_00 0457): Primer GAAGAAGGAAGCGTCCAGA (SEQ ID NO: 15); GACCTTCGAGTGCTGATCCG (SEQ ID NO: 16); Sox17 (NM_02 2454): Primer GGCGCAGCAGAATCCAGA (SEQ ID NO: 17); NN NNNNNNNNNNNNN NNNNN (SEQ ID NO: 18); HLxB9(NM_005 515): Primer CACCGCGGGCATGATC (SEQ ID NO: 19); ACTTC CCCAGGAGGTTCGA (SEQ ID NO: 20); Nkx2.2 (NM_002509) Primer GGCCTTCAGTACTCCCTGCA (SEQ ID NO: 21); GGGAC TTGGAGCTTGAGTCCT (SEQ ID NO: 22); PTF1a (NM_178161 ): Primer GAAGGTCATCATCTGCCATCG (SEQ ID NO: 23); GGC CATAATCAGGGTCGCT (SEQ ID NO: 24); SST (NM_001048): Primer CCCCAGACTCCGTCAGTTTC (SEQ ID NO: 25); TCCGTC TGGTTGGGTTCAG (SEQ ID NO: 26); PAX6 (NM_000280): Plasma IImer CCAGAAAGGATGCCTCATAAAGG (SEQ ID NO:27); TCTGC GCGCCCCTAGTTA (SEQ ID NO: 28); Oct4 primer: TGGGCTCG AGAAGGATGTG (SEQ ID NO:29); GCATAGTCGCTGCTTGATCG (SEQ ID NO: 30); MIXL1 primer CCGAGTCCAGGATCCAGGTA ( SEQ ID NO:31) CTCTGACGCGAGACTTGG (SEQ ID NO:32); GATA4 Primer CCTCTTGCAATGCGGAAAG (SEQ ID NO: 33) CGGGAGGA AGGCTCTCACT (SEQ ID NO: 34); GSC primer GAGGAGAAAGTG GAGGTCTGGTT (SEQ ID NO: 35) CTCTGATGAGGACCGCTTCTG (SEQ ID NO: 36); CER primer ACAGTGCCCTTCAGCCAGACT (SEQ ID NO: Sequence number 37) ACAACTACTTTTTCACAGCCTTCGT (SEQ ID NO:38); AFP primer GAGAAACCACTGGAGATGAACA (SEQ ID NO: 39) TCATGGCAAAGTTCTTCCAGAA (SEQ ID NO: 40); SOX1 primer ATGCACCGCTACGACATGG (SEQ ID NO: 41) CTCATGTAGCCCT GCGAGTTG (SEQ ID NO: 42); ZIC1 primer CTGGCTGTGGCAAG GTCTTC (SEQ ID NO: 43) CAGCCCTCAAACTCGCACTT (SEQ ID NO: 4 4); NFM primer ATCGAGGAGCGCCACAAC (SEQ ID NO: 45) TGC TGGATGGTGTCCTGGT (SEQ ID NO: 46). The other primers were FGF17( Hs00182599_m1), VWF(Hs00169795_m1), CMKOR1 (Hs00604567_m1), CRIP1(Hs00832816_g1), FOX Q1(Hs00536425_s1), CALCR(Hs00156229_m1) and and CHGA (Hs00154441_m1), available through ABI Taqman. can.

[0132] In vivo generation and differentiation of PDX1-positive pancreatic endoderm (stages 1 to 4) Summary of thurin production Methods for the generation of specific endoderm lineage and pancreatic endoderm lineage cells are provided herein. , related applications, such as U.S. Patent Application No. 11 / 773,944, filed July 5, 2007. , Title: METHODS OF PRODUCING PANCREATIC HORMO NES, which is incorporated herein by reference in its entirety, and which is incorporated herein by reference in its entirety. No. 681, 687, entitled ENDOCRINE PRECURSOR CELLS, PAN CREATIC HORMONE-EXPRESSING CELLS AND MET HODS OF PRODUCTION, which are incorporated herein by reference. Fully incorporated in the specification.

[0133] Briefly, the present invention relates to pluripotent stem cells, e.g., hES cells and iPS cells. Directed differentiation can be described in at least four or five stages. The first step is the generation of definitive endoderm from pluripotent stem cells, which takes about 2 to 5 days, preferably 2 days or It takes 3 days. Pluripotent stem cells are cultured in RPMI, a medium containing TGF superfamily member growth factors. , such as activin A, activin B, GDF-8 or GDF-11 (100 ng / m l), Wnt family members or Wnt pathway activators, such as Wnt3a ( 5ng / ml), or a rho kinase or ROCK inhibitor, such as Y-27632 (10 μM) to enhance growth, survival, and proliferation as well as cell intercellular adhesion. After about 24 hours, the medium is changed to a medium containing serum, e.g., 0.2% FBS, and T GFβ superfamily member growth factors, such as activin A, activin B, GD F-8 or GDF-11 (100 ng / mL), or rho kinase or R Replace the medium with RPMI containing OCK inhibitor and culture for another 24 h (day 1) to 48 h. Alternatively, place in medium containing activin / Wnt3a for approximately 24 hours. Afterwards, the cells were incubated in medium containing activin alone (i.e., medium containing Wnt3a) for 24 hours. Importantly, the generation of definitive endoderm requires low serum content and and therefore the need for cell culture conditions with low insulin or insulin-like growth factor content. McLean et al. (2007) Stem Cell See McLean et al., 2011, 25:29-38. Exposing S cells to insulin at a concentration of just 0.2 μg / mL led to the formation of definitive endoderm. It has also been shown that the production of pluripotent cells from embryos can be detrimental to the development of embryos. Stage 1 differentiation to definitive endoderm is essentially as described herein and in D'Amour et al. (2005). Modifications were made as described, for example at least as described in Agarwal et al. Differentiation of Functional Hepatocytes s from Human Embryonic Stem Cells, Stem C ells(2008)26:1117-1127;Borowiak et al., Small M olecules Efficiently Direct Endodermal D Identification of Mouse and Human Embryoni c Stem Cells, (2009)Cell Stem Cell 4:348- 358; and Brunner et al., Distinct DNA methylation patterns characterize differentiated hu man embryonic stem cells and developing human fetal liver, (2009) Genome Res. 19:1 044-1056. Appropriate differentiation of definitive endoderm, particularly to derive other endoderm lineage cells, is required. Definitive endoderm cells at this stage are required to be characterized and identified. Co-expression of X17 and HNF3β (FOXA2) and expression of at least HNF4alpha, HN F6, PDX1, SOX6, PROX1, PTF1A, CPA, cMYC, NKX6.1 , NGN3, PAX3, ARX, NKX2.2, INS, GSC, GHRL, SST, or PP is not appreciably expressed.

[0134] Stage 2 takes the definitive endoderm cell cultures from stage 1 and cultures them in suspension as follows: Low serum levels such as 0.2% FBS in 1000 dilutions, 25 ng of KGF (or F GF7) or RPMI containing ROCK inhibitor for 24 hours (days 2 to 3). Incubation enhances growth, survival, and proliferation, and promotes cell-cell adhesion, thereby Generate gut endoderm or PDX1-negative foregut endoderm. After 24 hours (day 3-4), The medium was modified to contain no TGFβ inhibitors, but instead to enhance cell growth, survival and proliferation. The medium was replaced with the same medium still containing ROCK inhibitor to enhance the activity, and incubated for another 24 hours (days 4-5). Leave the cells for 48 hours (day 1) to 48 hours (day 6). This is a critical step for proper specification of the foregut endoderm. is the removal of TGF-β family growth factors. Therefore, 2.5 μM of TGF-β inhibitor Number 4 or specificity of activin receptor-like kinase (ALK), a type I TGFβ receptor Stage 2 cell cultures were treated with a TGFβ inhibitor, such as 5 μM SB431542, a potent inhibitor of TGFβ. Foregut endoderm generated at stage 2 or PDX1-negative foregut The definitive endoderm cells co-express SOX17, HNF1β and HNF4α, indicating that PDX1-positive pancreatic endoderm or pancreatic progenitor or endocrine precursor cells and single or multiple At least SOX17 and HNF3β (FOXA2), hallmarks of hormone-type cells, , HNF6, PDX1, SOX6, PROX1, PTF1A, CPA, cMYC, NKX 6.1, NGN3, PAX3, ARX, NKX2.2, INS, GSC, GHRL, SS Neither T nor PP were appreciably co-expressed.

[0135] At stage 3 (days 5–8), obtain foregut endoderm cell cultures from stage 2 and incubate at 1% B27, 0.25 μM KAAD cyclopamine, 0.2 μM retinoic acid (RA), etc. of retinoid or retinoic acid analogues such as TTNPB at 3 nM, and 50 ng / m Culture in L. noggin medium, DMEM or RPMI, for approximately 24 hours (day 7) to 48 hours (day 8). Specifically, the applicants generate PDX1-positive foregut endoderm cells across a range of We have been using DMEM-high glucose since 2003, and all patents and In non-patent disclosures, DMEM-high glucose may be used even if there is no mention of "DMEM-high glucose" or the like. This is in part because manufacturers such as Gibco use MEM (Cat. No. 11960) and Knockout DMEM (Cat. No. 108 29) and other sources, DMEM was not named as such. As of the filing date of this application, Gibco offers additional DMEM products, but as always, For example, Knockout DMEM (Cat. No. 10829-018) Note that we do not label certain DMEM products that contain glucose as "high glucose." Therefore, in each case where DMEM is described, This can be assumed to mean DMEM containing glycerol, which is the basis of research in this field. Moreover, the use of ROCK inhibitors or rho Kinase inhibitors, such as Y-27632, can be used to enhance growth, survival, and proliferation. PDX1-positive foregut cells generated at stage 3 can promote cell-cell adhesion. The cells co-expressed PDX1 and HNF6, as well as SOX9 and PROX, and Definitive endoderm cells or foregut endoderm cells (PDX1 Markers indicating PDX1-negative or PDX1-positive foregut endoderm cells were not evaluated. They are not co-expressed with other genes.

[0136] For stage 4 (days 8–14), the medium was taken from stage 3 and diluted with 1% vol / vol B27 supplement, plus 50 ng / mL KGF and 50 ng / mL 100 mL of EGF, and sometimes additionally 50 ng / mL of Noggin in DMEM Again, to enhance growth, survival, proliferation, and promote cell-cell adhesion, Y-27 ROCK inhibitors such as 632 can be used. PDX generated from stage 4 1-positive pancreatic endoderm cells express at least PDX1 and Nkx6.1, as well as PTF1A and co-expressing the definitive endoderm or foregut endoderm described above at stages 1, 2 and 3. They do not express significant amounts of markers indicative of foregut endoderm (PDX1-negative foregut endoderm) cells.

[0137] Alternatively, cells from stage 4 can be cultured in 1 volume for approximately 1–6 days (days 15–20). % B27 supplement at 10% CO / vol ... , endocrine precursor or precursor type cells and / or mono- and polyhormonal pancreas Endocrine-type cells can be generated from stage 4 cells. Endocrine precursor cells co-express at least NGN3 and PAX4 as well as Nkx2.2 , definitive endoderm or foregut endoderm ( Indicative of PDX1-negative foregut endoderm) or PDX1-positive pancreatic endoderm or progenitor cells The marker is not appreciably expressed.

[0138] PDX1-positive pancreatic endoderm generated at stage 4 was loaded into the macroencapsulation device. , fully contain and transplant into patients to produce pancreatic endoderm cells in vivo Mature into hormone-secreting cells, e.g., insulin-secreting cells. PDX1-positive pancreatic endoderm The encapsulation of cells and the production of insulin in vivo are described in U.S. Patent Application Serial No. 12 / 6 No. 18,659 (the '659 application) entitled "ENCAPSULATION OF PAN CREATIC LINEAGE CELLS DERIVED FROM HUMAN "PLURIPOTENT STEM CELLS" filed on November 13, 2009. The '659 application is a joint venture with Provisional Patent Application No. 61 / 114,857, entitled "E NCAPSULATION OF PANCREATIC PROGENITORS D ERIVED FROM HES CELLS,” filed November 14, 2008; and U.S. Provisional Patent Application No. 61 / 121,084, entitled "ENCAPSULATION OF PANCREATIC ENDODERM CELLS, filed December 9, 2008 The disclosure of each of these applications is hereby incorporated by reference in its entirety. is incorporated into.

[0139] The methods, compositions and devices described herein represent presently preferred embodiments and are illustrative only. The present invention is intended to be illustrative and not limiting of the scope of the present invention. Modifications and other uses are contemplated herein. It will occur to those skilled in the art that such modifications are within the spirit of the invention and are defined by the scope of the present disclosure. Accordingly, the scope and subject matter of the invention disclosed herein is not to be construed as limiting the scope of the invention. It will be apparent to those skilled in the art that various substitutions and modifications can be made without departing from the spirit and scope of the present invention. Let's become one.

[0140] For example, to generate definitive endoderm from pluripotent cells, such as hES cells and iPS cells, To this end, members of the TGFβ superfamily of growth factors or signaling proteins Activin A is used, which is a compound of International Patent Application No. 2003 / 0133634, which is incorporated herein by reference in its entirety. Application No. PCT / US2008 / 065686, entitled "GROWTH FACTORS FOR PRODUCTION OF DEFINITIVE ENDODERM”, 2 Other TGF-β superfamily members, such as those described in the June 3, 2008 application. using GDF-8 and GDF-11 to generate definitive endoderm can be done.

[0141] Differentiation of stage 2 PDX1-negative foregut endoderm cells into stage 3 PDX1-positive foregut cells Retinoic acid (RA) is used to stimulate the synthesis of 4-[(E)-2-(5,6, 7,8-Tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propanol Other retinoids or retinoic acid analogs such as [phenyl]benzoic acid (or TTNPB) and similar analogs (eg, 4-HBTTNPB) can be used.

[0142] Noggin inhibits the function of the TGFβ superfamily, e.g. bone morphogenetic protein-4 (BMP4). However, it is a protein that inactivates members of the Cochlear signaling proteins. Twisted Gastrulation (Tsg) and No other BMP4 inhibitor or anti-BMP neutralizing antibody inhibited BMP and its cell surface receptors. This can prevent the binding of the BMP to the nucleosomes, thereby effectively inhibiting BMP signaling. In addition, the gene for human noggin has been cloned and sequenced. See U.S. Patent No. 6,075,007, incorporated herein by reference. showed a carboxy-terminal region that has homology to Kunitz-type protease inhibitors. This potentially allows other Kunitz-type protease inhibitors to be used in the inhibition of BMP. It has been shown that it can have a similar effect.

[0143] Finally, the same compounds as described herein and in U.S. application Ser. No. 12 / 618,659 and which are hereby incorporated by reference. The macroencapsulation devices, which are fully incorporated herein by reference, are again merely exemplary. In particular, the size of the device, the number of channels within the device, and the number of channels are not intended to limit the scope of the present invention. Multiple bars or subdivisions, or multiple ports, and even devices Any changes in device design, such as loading and extraction mechanisms, are within the scope of the present invention. Thus, various substitutions and modifications to the differentiation methods described herein are encompassed within the scope of the present invention. Various substitutions and modifications to the containment device as well as the invention disclosed herein may be incorporated herein by reference. It will be understood by those skilled in the art that such modifications may be made without departing from the scope and spirit of the present invention. It will become clear in time.

[0144] Generation and Composition of Definitive Endoderm (Stage 1) In some processes, differentiation to definitive endoderm is sufficient to promote differentiation to definitive endoderm. By providing sufficient amounts of growth factors of the TGFβ superfamily to pluripotent cell cultures, This is achieved by the development of the TGFβ superfamily, which is beneficial for the generation of definitive endoderm. Factors include Nodal / activin, GDF-8, -9, -10, -11, etc., or BMPs. In some preferred differentiation processes, the growth factor is selected from the Nodal , activin A, activin B, GDF-8, GDF-11 and BMP4 Additionally, the growth factors Wnt3a, other Wnt family members, and Wnt3a are selected from the nt pathway activators are beneficial for the generation of definitive endoderm cells. The process may use any combination of the aforementioned growth factors. Other methods are described in detail in U.S. Pat. No. 7,510,876, which is incorporated herein by reference in its entirety. This is incorporated herein by reference.

[0145] As a part of the process for differentiating pluripotent cells into definitive endoderm cells, The growth factor induces the differentiation of at least a portion of the pluripotent cells into definitive endoderm cells in culture. It is supplied to cells in sufficient concentrations to promote differentiation. In the present invention, the above growth factors are present in the cell culture at a concentration of at least about 5 ng / mL and at least about 1 0 ng / mL, at least about 25 ng / mL, at least about 50 ng / mL, at least About 75 ng / mL, at least about 100 ng / mL, at least about 200 ng / mL, At least about 300ng / mL, at least about 400ng / mL, at least about 500ng / mL, at least about 1000ng / mL, at least about 2000ng / mL, at least At least about 3000 ng / mL, at least about 4000 ng / mL, at least about 5000 ng / mL or greater than about 5000 ng / mL.

[0146] In one particular process for differentiation of pluripotent cells into definitive endoderm cells, the aforementioned growth factors The molecules are removed from the cell culture after they have been added. Within about 1 day, within about 2 days, within about 3 days, within about 4 days, within about 5 days, within about 6 days, within about 7 days They can be removed within about 8 days, within about 9 days, or within about 10 days. A preferred process involves adding the growth factors and then removing them about four days later.

[0147] In some embodiments of the processes described herein, the definitive endoderm cells are cultured to undergo further differentiation. In such embodiments, the definitive endoderm cells are enriched, isolated and / or purified prior to The can be enriched, isolated and / or purified using any known method. In a preferred embodiment, the definitive endoderm cells are described in U.S. patent application Ser. No. 2004 / 0133634, filed Dec. 23, 2004. No. 11 / 021,618, entitled DEFINITIVE ENDODERM, and 200 No. 60 / 736,598, filed Nov. 14, 2005, entitled MARKER One or more of the methods described in S OF DEFINITIVE ENDODERM The methods of the present invention are characterized in that the present invention is enriched, isolated and / or purified using methods such as those described herein, the disclosure of which is incorporated herein by reference in its entirety. is incorporated into.

[0148] In a preferred embodiment, the levels are normalized to the level of a control gene, such as a housekeeping gene. When compared, the definitive endoderm cells produced and described herein have a relatively high with significant CER, GSC, CXCR4, SOX17 and FOXA2 gene expression.

[0149] Generation and composition of PDX1-negative foregut endoderm (stage 2) Definitive endoderm cells are then subjected to further differentiation of these cells to generate PDX1-negative foregut endoderm cells. By the differentiation process described herein, the cells can be specified in the direction of pancreatic differentiation. In some processes, cell cultures containing definitive endoderm cells as well as enriched or purified cell populations are prepared. The present invention relates to cell cultures and / or enriched cell populations containing PDX1-negative foregut endoderm cells. can be used for further differentiation into

[0150] Generally, cell cultures or cell populations of SOX17-positive definitive endoderm cells are stimulated with TGFβ. Reducing, eliminating or removing per-family growth factor signaling By removing the definitive endoderm cells, PDX1-negative foregut endoderm cells were obtained. In some embodiments, TGFβ superfamily growth factor signaling Reducing or eliminating exogenously added TGFβ superfamily growth factors For example, activin A may be diluted or removed from the definitive endoderm cell culture or cell population. In another embodiment, the activation of the TGFβ superfamily growth factor receptor activator is mediated by the activation of the TGFβ superfamily growth factor receptor activator. Signal transmission is a compound that blocks TGF-β superfamily growth factor signaling. For example, by providing follistatin and / or noggin to definitive endoderm cells. In some embodiments, the TGFβ superfamily growth factor signaling is reduced or eliminated. Null transfer is performed on about day 1, about day 2, about day 3, or about day 4 after differentiation of human pluripotent cells into definitive endoderm cells. About 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days or more than about 10 days , can be reduced or eliminated.

[0151] In some embodiments, FGF family growth factor and / or Hedgehog pathway inhibition The agent is provided to the definitive endoderm cell culture or cell population to induce differentiation into foregut endoderm cells. In one embodiment, the differentiation of definitive endoderm cells is enhanced. Activation and / or Hedgehog pathway inhibitors inhibit TGFβ superactivation in definitive endoderm cell cultures -family growth factor signaling reduction or elimination After about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, or more than about 10 days In a preferred embodiment, the FGF family growth factors and / or Hedgehog pathway inhibitors inhibit TGFβ superfamily expression in definitive endoderm cell cultures The therapeutic agent is provided at approximately the same time as the reduction or elimination of long-term factor signaling.

[0152] In a preferred embodiment, the FGF factor provided to the definitive endoderm cell culture or cell population is The primary growth factors are FGF10 and / or FGF7. However, other FGFs The present invention relates to a method for treating mycobacterial growth factors, or FGF family growth factor analogs or mimetics, comprising administering to the patient a compound comprising FGF10 and It is understood that the present invention may be provided in place of, or in addition to, FGF7 and / or FGF1. For example, FGF1, FGF2, FGF3, and FGF23 are In one embodiment, a growth factor of the FGF family is provided. In this embodiment, the FGF family growth factors and / or FGF family growth factor analogs may be or mimetics are at least about 10 ng / ml, at least about 25 ng / ml, at least About 50 ng / ml, at least about 75 ng / ml, at least about 100 ng / ml, at least about 200ng / ml, at least about 300ng / ml, at least about 400ng / ml ml, at least about 500 ng / ml, or at least about 1000 ng / ml The cells are supplied to the cells of the cell culture so that the

[0153] In another preferred embodiment, the hedgehog inhibitor is KAAD-cyclopamine. However, it is understood that other hedgehog inhibitors may be used. Inhibitors include KAAD-cyclopamine analogs, jervine, jervine analogs, hedgehog Hedgehog pathway blocking antibodies, and any other inhibitors of Hedgehog pathway function known to those of skill in the art. These include, but are not limited to, alone or in combination with FGF family growth factors. When administered, the hedgehog inhibitor is provided at a concentration of at least about 0.01 μM to 50 μM. It is possible.

[0154] A preferred process for the generation of a population of PDX1-negative foregut endoderm cells from definitive endoderm cells In this study, TGFβ superfamily growth factor signaling is involved in the transcription of human multiple myelin to definitive endoderm. A substantial portion of the differentiation potential cells is reduced or eliminated for about 2 days (see, for example, the Examples below). After 3, 4 or 5 days of differentiation protocol as described. At the same time, definitive endoderm cells were Cultures or cell populations may be treated with Noggin and KAAD-cyclopamine, e.g., 2 mM RA or 50 ng / ml of Noggin and 0 in DMEM medium in the presence of 3 nM TTNPB. Provides .25 μM KAAD-cyclopamine.

[0155] In some embodiments, the PDX1-negative foregut endoderm cells are treated with a retinoic acid (RA) or other contacting or otherwise providing the cells with a medium containing a tinoid; In some embodiments, the cells can be further differentiated into PDX1-positive foregut endoderm cells. In this embodiment, retinoids are added to the cell culture medium so that they are present at a concentration of at least about 1 nM to 50 μM. In such an embodiment, the retinoid is provided to cells of the definitive endoderm cell culture. About 1 day after reduction or elimination of TGFβ superfamily growth factor signaling in After 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, In a preferred embodiment, the TGFβ subunit is administered to the cells after more than about 10 days. Approximately 2-3 days after reduction or elimination of perfamily growth factor signaling, Approximately 1 μM to 2 μM of RA is delivered to PDX1-negative foregut endoderm cell cultures.

[0156] In some of the differentiation processes described herein, the differentiation factors are added to the cells. For example, the differentiation factors are removed from the culture after about 1 day, about 2 days, or about 3 days from the addition. Within about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, or about 10 days. This can be done.

[0157] In a preferred embodiment, the levels are normalized to the level of a control gene, such as a housekeeping gene. When generated and described herein, the PDX1-negative foregut endoderm cells have relatively high The expression of SOX17, FOXA1, HNF1B and HNF4A genes was significantly higher in In addition, HNF4A gene expression levels were significantly increased in the control and control mice, e.g., TGFβ superfamily cells from definitive endoderm cultures. It does not increase substantially until removal of family growth factor signaling (eg, activin).

[0158] Generation and composition of PDX1-positive foregut endoderm (stage 3) PDX1-negative foregut endoderm cells were identified as PDX1-positive foregut endoderm cells or PDX1-positive pancreatic Further differentiation of these cells to generate endoderm or their equivalents results in pancreatic differentiation. In some of the differentiation processes described herein, In one embodiment, cell cultures containing definitive endoderm cells as well as enriched or purified cell populations are characterized by the expression of PDX1 Further fractionation into cell cultures and / or enriched cell populations containing positive foregut endoderm cells It can be used for the purpose of

[0159] Generally, retinoids such as retinoic acid (RA) are used to inoculate SOX17-positive foregut endoderm cells. PDX1-negative foregut endoderm cells were cultured in a cell culture medium containing As part of the differentiation process, PDX1-negative foregut endoderm cells in culture were differentiated into gut endoderm cells. Leaf cells express fibroblast growth factor family members either before or at approximately the same time as RA addition. A preferred fibroblast growth factor is FGF-7. Another preferred In the process, fibroblast growth factor is any fibroblast growth factor or fibroblast growth factor. stimulates or otherwise interacts with the growth factor 2 receptor IIIb (FGFR2(IIIb)) In a further preferred process, the FGF family growth factor comprises a ligand that interacts with the FGF family growth factor. , in combination with a hedgehog pathway inhibitor. A preferred hedgehog pathway inhibitor is KAAD -cyclopamine. A particularly favorable differentiation process is in PDX1-negative embryos in the presence of RA. Cell cultures containing definitive endoderm cells were cultured with FGF-10 and / or KAAD-cyclopamine In one particular process, BMP4 is activated by FGF10 and / or or KAAD-cyclopamine. In some processes, retinoids Members of the ΤGFβ superfamily of growth factors and / or Connaught Medical Research Labs medium (CRML medium) (Invitro gen, Carlsbad, CA).

[0160] For some of the embodiments of the differentiation process described herein, retinoids and / or or combinations of the aforementioned differentiation factors, these factors promote the differentiation of PDX1-positive foregut endoderm cells. 1. Negative foregut endoderm cell culture or sufficient to promote differentiation of at least a portion of the cell population The antibody or antibody may be provided to the cells at a concentration sufficient to be present in the cell culture or cell population.

[0161] In other processes, the FGF-10 is at least about 1 ng / ml, at least about 2 ng / ml / ml, at least about 5ng / ml, at least about 10ng / ml, at least about 25ng / ml It is supplied to cells in cell culture at concentrations up to 50 μM and up to 100 μg / ml. In some embodiments of the invention, fibroblast growth factor or fibroblast growth factor 2 receptor. Ligands that stimulate or otherwise interact with FGFR3(IIIb) The compound is provided alone or in combination with a hedgehog pathway inhibitor.

[0162] For the generation of a population of PDX1-positive foregut endoderm cells from PDX1-negative foregut endoderm cells In a preferred process, cell cultures or enriched cells of PDX1-negative foregut endoderm cells are The population was treated with FGF-7, KAAD-cyclopamine and retinoic acid (RA), e.g., 2μ 25 ng / ml FGF-7 and 0.2 μM KA in CMRL medium in the presence of μM RA AD-cyclopamine is provided.

[0163] In some processes described herein, TGFβ signaling factors, such as actin Activin A and / or activin B, GDF-8, GDF-11, etc., act in conjunction with retinoids and and / or fed to cell cultures together with fibroblast growth factors and hedgehog inhibitors For example, in such a process, activin A and / or activin B and / or or GDF-8 and / or GDF-11 at least about 5 ng / ml, at least About 10 ng / ml, at least about 25 ng / ml, at least about 50 ng / ml, About 75 ng / ml, at least about 100 ng / ml, at least about 200 ng / ml , at least about 300ng / ml, at least about 400ng / ml, at least about 500 The antibody is provided to the cell culture at a concentration of about ng / ml or at least about 1000 ng / ml.

[0164] In some processes, differentiation factors and / or CRML medium may be used to induce differentiation from pluripotent cells. About 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, After 10 days or more, PDX1-negative foregut endoderm cells were fed. In a preferred process, the differentiation factors and / or CRML medium are used to induce differentiation from pluripotent stem cells. Approximately 3, 4, or 5 days after the initiation of differentiation, the cells were subjected to PDX1-negative foregut endoderm cells. will be provided.

[0165] In certain processes described herein, the differentiation factors are added to the cells. For example, the differentiation factors are removed from the culture after about 1 day, about 2 days, or about 3 days from the addition. Within about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, or about 10 days. This can be done.

[0166] These and other methods are described in U.S. Provisional Patent Application No. 60 / 7, filed October 27, 2005. Issue 30,917, title PDX1-EXPRESSING DORSAL AND VEN The PDX1-positive foregut endoderm is described in detail in TRAL FOREGUT ENDODERM. Leaf cells are disclosed in U.S. patent application Ser. No. 11 / 115,868, filed Apr. 26, 2005, entitled PDX1 EXPRESSING ENDODERM, the disclosure of which is incorporated herein by reference. No. 6,399,433, which is incorporated herein by reference in its entirety.

[0167] In a preferred embodiment, the levels are normalized to the level of a control gene, such as a housekeeping gene. When compared, the PDX1 positive foregut endoderm cells generated and described herein Relatively high levels of PDX1, NKX6.1, PTF1A, CPA and cMYC genes It has expression.

[0168] Generation and composition of PDX1-positive pancreatic endoderm (Stage 4) Generation of PDX1-positive pancreatic endoderm or “pancreatic epithelium” or more generally pancreatic precursors and The composition is described in U.S. patent application Ser. No. 12 / 167,227, filed Jul. 2, 2008, entitled ETHODS OF PRODUCING PANCREATIC HORMONES This is described in detail in U.S. Pat. No. 7,534,608, which was filed on May 19, 2009. Application No. 12 / 167,227 was filed on July 5, 2007. Application No. 11 / 773,944, entitled METHODS OF PRODUCING PAN This is a continuation of CREATIC HORMONES, which was filed on March 2, 2007. No. 11 / 681,687, entitled ENDOCRINE PRECURSO R CELLS,PANCREATIC HORMONE-EXPRESSING CE This is a continuation-in-part of LLS AND METHODS OF PRODUCTION. The disclosure of each of these applications is incorporated herein by reference in its entirety.

[0169] Example 22 of the 12 / 167,227 application is described in Stages 1-4 of this specification. Various modifications of cell culture conditions are described in detail. In general, stage 3 PDX1-positive foregut Endodermal cells were grown in DMEM with 1% v / v B27 supplement plus noggin or or another BMP4-specific inhibitor for about 1-3 days, or about 1-4 days, or are cultured for 1–5 days, or approximately 1–6 days. At the end of stage 4, PDX1-positive pancreatic Visceral endoderm is generated, and its cells express PDX1 and Nkx6.1 as well as PTF1A. Cell cultures were cultured to produce stage 5 single or multihormonal endocrine cells. , or stage 1 definitive endoderm cells, or stage 2 PDX1-negative foregut endoderm cells. or stage 3 PDX1-positive foregut endoderm cells were observed. Does not appear.

[0170] Endocrine progenitor cell generation and composition (stage 5) Some embodiments described herein involve generating endocrine precursor cells starting from pluripotent cells. As described above, endocrine precursor cells are first differentiated from pluripotent cells to produce embryonic Generate definitive endoderm cells, which are then further differentiated into PDX1-positive foregut endoderm In one embodiment, the PDX1 Positive foregut endoderm cells further differentiate into multipotent endocrine precursor cells, which are expressed in human islet hormone receptors. It is possible to differentiate into IL-1-expressing cells.

[0171] In one embodiment, the PDX1 positive foregut endoderm cells are cultured for a period of time sufficient to generate endocrine progenitor cells. Incubation of PDX1-positive foregut endoderm cells in the presence of retinoids, such as retinoic acid In some embodiments, the cells are differentiated into endocrine precursor cells by continuing the cell-cell transfer. The time required for the generation of progenitor cells is determined by the expression of the PDX1 marker in a portion of the cells in the cell culture. In some embodiments, the retinoid is administered to the cell culture. , about 1 hour, about 2 hours, about 3 hours, or about 4 hours after expression of the PDX1 marker in a portion of the cells in the cell culture. 4 hours, about 6 hours, about 8 hours, about 10 hours, about 12 hours, about 16 hours, about 1 day, about 2 days, About 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, or about 10 days It will be maintained for more than 10 days.

[0172] In some processes described herein, the endocrine precursor cells are cultured or cultured in a cell culture medium. The concentration of retinoid used to differentiate PDX1-positive foregut endoderm cells in the group was From about 1 nM to about 100 μM.

[0173] In some preferred embodiments, cell cultures comprising human PDX1-positive foregut endoderm cells or By providing a gamma secretase inhibitor to a cell population, PDX1-positive foregut endoderm cells In a preferred embodiment, the differentiation of gamma secretion mediated by the IL-1 receptor agonist (IL-1 receptor) into pancreatic endocrine progenitor cells is mediated by the IL-1 receptor agonist (IL-1 receptor). The tase inhibitor is N-[N-(3,5-difluorophenacetyl-L-alanyl)]-S -phenylglycine t-butyl ester (DAPT).

[0174] In other embodiments, gamma secretase inhibitors are used at the beginning of the differentiation process, e.g., to inhibit are delivered at the potent stage and remain in cell culture throughout differentiation into pancreatic islet hormone-expressing cells. In yet other embodiments, the gamma secretase inhibitor is administered only after the initiation of differentiation. and added prior to differentiation to the PDX1-positive foregut endoderm stage. Gamma secretase inhibitors promote the conversion of definitive endoderm to PDX1-positive endoderm differentiation The cell culture or cell population is provided at the same time as the provision of the factors. In this study, a substantial proportion of cells in a cell culture or cell population were PDX1-positive foregut endoderm cells. After differentiation, a gamma secretase inhibitor is provided to the cell culture or cell population.

[0175] In some embodiments, differentiation of PDX1-positive foregut endoderm cells into endocrine precursor cells is In addition, gamma secretase inhibitors promote the differentiation of at least some of the PDX1-positive cells into endocrine precursor cells. to cells so that they are present in the cell culture or cell population at a concentration sufficient to promote differentiation of In some embodiments, the gamma secretase inhibitor is provided at a concentration of from about 0.01 μM to about It is present in the cell culture or cell population at a concentration of 1000 μM. The secretase inhibitors are administered to cell cultures or cells at concentrations of about 0.1 μM to about 100 μM. It is present in the cell population.

[0176] In certain embodiments of the processes for generating endocrine precursor cells described herein, Gamma secretase inhibitors inhibit the depletion of one or more previously supplied differentiation factors from the cell culture. For example, one or more differentiation factors may be provided after the differentiation factor or factors have been removed from the The drug should be removed about 1 to 10 days or more before the addition of the secretase inhibitor. In other embodiments, the gamma secretase inhibitor may be provided previously or Cell culture containing one or more differentiation factors provided at the same time as a gamma secretase inhibitor In a preferred embodiment, the culture medium or cell population is fed with the previously fed or gamma-sec Differentiation factors that were introduced at the same time as the retinase inhibitors included FGF-10, KAAD-seq lopamine, activin A, activin B, GDF-8, GDF-11, BMP4 and / or RA.

[0177] In some embodiments of the invention described herein, the differentiating cell culture or cell population , which brings about the same time as gamma-secretaase inhibitors and exendin 4. In embodiments, exendin 4 is administered to the cell culture or cell population at a concentration of at least about 0.1 It is brought to be present in concentrations from ng / mL up to 1000 ng / mL.

[0178] A favorable process for the generation of endocrine precursor cells from PDX1-positive foregut endoderm cells Cell cultures or cell populations of PDX1-positive foregut endoderm cells were treated with 3 μM DAPT and and 40 ng / ml of exendin 4. In a particularly preferred embodiment, the cells are In another particularly preferred process, PDX1-positive foregut endoderm cells are differentiated in CMRL. Cell culture of PDX1-positive foregut endoderm cells or cells for the generation of endocrine progenitor cells The cohort received 3 μM DAPT and 40 ng / ml exendate in the presence of 2 μM RA. 4 is provided.

[0179] Expression of NGN3, NKX2.2 and / or PAX4 markers is associated with endocrine precursor cells It will be appreciated that the expression of the IL-1 gene is induced at various different levels depending on the state of differentiation. As such, in some embodiments described herein, endocrine precursor cells or cell populations are Expression of NGN3, NKX2.2 and / or PAX4 markers in non-endocrine precursors Cells or cell populations, e.g., pluripotent stem cells, definitive endoderm cells, PDX1-positive foregut endoderm cells cells, immature pancreatic islet hormone expressing cells, mature pancreatic islet hormone expressing cells, extraembryonic endoderm cells, NGN3, NKX2.2 and / or PA in germinal and / or ectodermal cells At least about 2-fold to at least about 10,000-fold higher than the expression of the X4 marker. Morphology indicates that NGN3, NKX2.2 and / or Expression of the PAX4 marker indicates the presence of non-endocrine progenitor cells or cell populations, e.g., pluripotent stem cells. , definitive endoderm cells, PDX1-positive foregut endoderm cells, immature pancreatic islet hormone-expressing cells, mature pancreas In islet hormone-expressing cells, extraembryonic endodermal cells, mesodermal cells and / or ectodermal cells At least about 4-fold, or less than 5-fold, expression of the NGN3, NKX2.2 and / or PAX4 markers In some embodiments, the endocrine precursor cells or cells are at least about 6-fold to 10,000-fold. Expression of NGN3, NKX2.2 and / or PAX4 markers in the cell population was Secretory precursor cells or cell populations, e.g., pluripotent cell-like iPS cells and hES cells, embryonic bodies Endoderm cells, PDX1-positive foregut endoderm cells, immature pancreatic islet hormone-expressing cells, mature pancreatic islet hormone-expressing cells NGN in Mon-expressing cells, extraembryonic endodermal cells, mesodermal cells and / or ectodermal cells 3, much higher than the expression of NKX2.2 and / or PAX4 markers.

[0180] Another embodiment of the invention is a cell culture comprising human cells, such as human endocrine precursor cells, or A composition, such as a cell population, comprising at least about 2% of human cells that are at least partially or completely human. The expression of AFP, SOX7, SOX1, ZIC1, NFM, MAFA, SYP, and CHGA , INS, GCG, SST, GHRL, and / or PAX6 marker expression. In another embodiment, the composition comprises at least about 5% to 98% of human cells. The expression of NGN3 markers was significantly higher than that of AFP, SOX7, SOX1, ZIC1, NFM, MAFA, and SYP, CHGA, INS, GCG, SST, GHRL, and / or PAX6 markers In some embodiments, the expression of NGN3 in the cell culture or cell population is greater than the expression of The expression of AFP, SOX7, SOX1, ZIC1, NFM, MAFA, SYP, and CHGA , INS, GCG, SST, GHRL, and / or PAX6 marker expression. The percentage of large human cells is calculated without taking into account the feeder cells.

[0181] Some embodiments of the present invention relate to cell cultures or cell populations comprising human endocrine precursor cells. In at least about 2% to at least about 98% or more of human cells, NKX2.2 and / or PAX4 expression was associated with AFP, SOX7, SOX1, ZIC1, NFM, MAFA, SYP, CHGA, INS, GCG, SST, GHRL, and / or It will be understood that the present invention relates to compositions that have greater expression of the PAX6 marker or PAX7 marker. In an embodiment, NKX2.2 and NKX3 are expressed in at least about 5% to 98% of human cells. and / or PAX4 expression is associated with AFP, SOX7, SOX1, ZIC1, NFM, MAFA , SYP, CHGA, INS, GCG, SST, GHRL, and / or PAX6 mers In some embodiments, the expression of NKX in the cell culture or cell population is greater than the expression of NKX. 2.2 and / or PAX4 expression is related to AFP, SOX7, SOX1, ZIC1, and NFM , MAFA, SYP, CHGA, INS, GCG, SST, GHRL, and / or P The percentage of human cells with greater expression of the AX6 marker was calculated without considering feeder cells. Put out.

[0182] Additional embodiments of the present invention include mammalian cells differentiated in vitro from definitive endoderm. Compositions comprising human cells differentiated, e.g., in vitro, from definitive endoderm, e.g., cells With respect to a culture or cell population, a small number of cells differentiated in vitro from definitive endoderm are In approximately 2% of cases, expression of NGN3, NKX2.2 and / or PAX4 markers was FP, SOX7, SOX1, ZIC1, NFM, MAFA, SYP, CHGA, INS, Greater expression of GCG, SST, GHRL and / or PAX6 markers. Morphologically, at least about 5% of cells differentiated from definitive endoderm in vitro were 98% of cells differentiated from definitive endoderm in vitro expressed NGN3, NKX2.2 and and / or PAX4 marker expression was significantly higher in patients with AFP, SOX7, SOX1, ZIC1, NFM, MAFA, SYP, CHGA, INS, GCG, SST, GHRL and / or PAX Greater than 6 marker expression.

[0183] The processes described herein can be used to produce endocrine precursor cells that are substantially free of other cell types. In some embodiments of the present invention, a composition comprising the cells described herein can be produced. The endocrine precursor cell population or cell culture generated by the method of Substantially free of cells that significantly express OX1, ZIC1 and / or NFM markers In some embodiments, the endocrine destination of the cell culture produced by the methods described herein. The progenitor population is composed of AFP, SOX7, SOX1, ZIC1, NFM, MAFA, SYP, and C Significantly increased HGA, INS, GCG, SST, GHRL, and / or PAX6 markers Substantially free of expressing cells.

[0184] In one embodiment of the present invention, the description of endocrine precursor cells based on the expression of markers is 3, high NKX2.2, high PAX4, low AFP, low SOX7, low SOX1, low ZIC1, low NFM, low MAFA; low SYP; low CHGA; low INS, low GCG, low SST, low GHR L and / or low PAX6.

[0185] Generation of immature pancreatic islet hormone-expressing cells The embodiments described herein involve the generation of immature pancreatic islet hormone-expressing cells starting from pluripotent cells. As described above, immature pancreatic islet hormone-expressing cells are initially induced to pluripotent Differentiating the cells to produce definitive endoderm cells, and differentiating the definitive endoderm cells to produce foregut endoderm cells. The PDX1-positive foregut endoderm cells were generated by differentiation of the foregut endoderm. by further differentiation of positive foregut endoderm cells to generate endocrine precursor cells. In some embodiments, endocrine precursor cells can be transformed into immature pancreatic islet hormone-expressing cells. The process continues by differentiating the

[0186] In some embodiments of the invention, the cells are substantially inhibited from expressing NGN3 and are inhibited from expressing PA. A period of time sufficient to initiate expression of X6 and for the cells to express at least one islet cell hormone Culture of endocrine precursor cells with gamma secretase inhibitors to have the ability to express By continuing the incubation, immature islet hormone-producing endocrine precursor cells were produced. In some embodiments, the gamma secretase inhibitor is an endocrine About 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days of precursor cell induction, The cells are removed after about 9 days, about 10 days, or about 10 days or more. The secretase inhibitor is N-[N-(3,5-difluorophenacetyl-L-alanine] [yl)]-S-phenylglycine t-butyl ester (DAPT).

[0187] Certain processes for the generation of immature pancreatic islet hormone-expressing cells disclosed herein The present invention relates to the administration of nicotinamide, exogenous ... It consists of endothelin 4, hepatocyte growth factor (HGF), and insulin-like growth factor 1 (IGF1). In some embodiments, the method is mediated by the provision of one or more factors selected from the group. In some embodiments, all four of the above factors are provided together. The or each of the above-mentioned two or more is provided to the cell culture prior to differentiation of the endocrine precursor cells, and is used to induce cell proliferation into the endocrine precursor cells. At least a portion of the cells in the cell culture remain in the cell culture during differentiation. The present invention relates to a method for the differentiation of endocrine precursor cells comprising the steps of: and wherein at least a substantial portion of the cells are immature pancreatic islet hormone-expressing cells. In some embodiments of the present invention, the above factors are added to the cell culture medium until the cells are differentiated into the cells. One or more may be provided at the beginning of the differentiation process, e.g., at the pluripotent cell stage, and may be used to differentiate into undifferentiated cells. They remain in cell culture throughout differentiation into mature pancreatic islet hormone-expressing cells.

[0188] In some processes for the generation of immature pancreatic islet hormone-expressing cells disclosed herein, , nicotinamide, nicotinamide adenine dinucleotide (NAD) or nicotinic acid promotes differentiation of at least a portion of endocrine precursor cells into immature pancreatic islet hormone-expressing cells The cells are provided with a sufficient concentration of the compound to be present in the cell culture or cell population. In embodiments, nicotinamide is at least about 0.1 mM, at least about 0.5 mM The antibody is present in the cell culture or cell population at a concentration of from 1 to 1000 mM.

[0189] In another process for the generation of immature pancreatic islet hormone-expressing cells disclosed herein, Exendin-4 induces at least a portion of endocrine precursor cells into immature pancreatic islet hormone-expressing cells Provide cells with sufficient concentration to promote differentiation in a cell culture or cell population In some embodiments, exendin 4 is at least about 1 ng / ml, at least Both are present in cell cultures or cell populations at concentrations between approximately 5 ng / ml and 1000 ng / ml. do.

[0190] Further processes for the generation of immature pancreatic islet hormone-expressing cells as disclosed herein In this study, HGF was shown to induce at least a portion of endocrine precursor cells into immature pancreatic islet hormone-expressing cells. is provided to the cells so as to be present in the cell culture or cell population at a concentration sufficient to promote In some embodiments, HGF is at least about 1 ng / ml, at least about 5 ng / ml, The antibody is present in the cell culture or cell population at a concentration of from 1000 ng / ml to 1000 ng / ml.

[0191] Further processes for the generation of immature pancreatic islet hormone-expressing cells as disclosed herein We hypothesized that IGF1 mediates at least a partial differentiation of endocrine precursor cells into immature pancreatic islet hormone-expressing cells. The cells are supplied with the α-amino acid so that they are present in the cell culture or cell population at a concentration sufficient to promote cell proliferation. In some embodiments, IGF1 is at least about 1 ng / ml to 1000 ng / ml. The antibody is present in the cell culture or cell population at a concentration of 1000 μg / ml.

[0192] Certain of the processes for generating immature pancreatic islet hormone-expressing cells described herein In embodiments, one of nicotinamide, exendin 4, HGF, and IGF1. or removing one or more differentiation factors from the cell culture that were previously provided. In another embodiment, nicotinamide, exendin 4, HGF and I are provided at a later time. GF1, nicotinamide, exendin 4, HGF, and Provided before or at about the same time as one or more of the IGF1 The cell culture or cell population is provided with one or more differentiation factors. In terms of form, it may contain one of the following: nicotinamide, exendin 4, HGF, and IGF1. This is the only differentiation factor that is supplied before or at almost the same time as multiple other types. These include, but are not limited to, DAPT, FGF-10, KAAD-cyclopamine, and activin A , activin B, BMP4 and / or RA.

[0193] Another embodiment of the invention is a method for producing a cell comprising administering to a subject a cell culture medium comprising administering to said ... A composition, such as a culture or cell population, comprising at least about 2% of human cells that are MA. FB, SYP, CHGA, NKX2.2, ISL1, PAX6, NEUROD, PDX1 , HB9, GHRL, IAPP, INS, GCG, SST, PP, and / or C-Pe Expression of peptide markers: NGN3, MAFA, MOX1, CER, POU5F1, and AFP , greater than expression of SOX7, SOX1, ZIC1 and / or NFM markers In another embodiment, the method further comprises: in at least about 10% to 95% of human cells or in at least about 98% of human cells MAFB, SYP, CHGA, NKX2.2, ISL1, PAX6, NEUROD, P DX1, HB9, GHRL, IAPP, INS, GCG, SST, PP, and / or The expression of C-peptide markers was significantly higher in NGN3, MAFA, MOX1, CER, and POU5F1. greater than expression of AFP, SOX7, SOX1, ZIC1 and / or NFM markers stomach.

[0194] In some embodiments, MAFB, SYP, CHGA, NKX2.2, ISL1, PAX 6, NEUROD, PDX1, HB9, GHRL, IAPP, INS GCG, SST, PP and / or C-peptide expression is associated with NGN3, MAFA, MOX1, CER, and POU Expression of 5F1, AFP, SOX7, SOX1, ZIC1 and / or NFM markers If the percentage of human cells in the cell culture or population is greater than or equal to the number of cells per cell, the percentage of human cells per cell is independent of the number of feeder cells. It is calculated quickly.

[0195] In certain embodiments of the present invention, cell cultures comprising immature pancreatic islet hormone-expressing cells and and / or cell populations expressing ghrelin, insulin, somatostatin and / or glucagon. The present invention also includes a medium containing one or more secreted hormones selected from the group consisting of: In a preferred embodiment, the medium contains one or more C-peptides. The concentrations of several secreted hormones or C-peptide were low per μg of cellular DNA. At least about 1 pmol of ghrelin, insulin, somatostatin, glucagon or C-peptide From the peptide, at least about 1000 picomoles (pmol) of the peptide per μg of cellular DNA These range from retinol, insulin, somatostatin, glucagon or C-peptide. .

[0196] Methods for producing insulin in vivo In some embodiments, the in vitro derived pancreatic progenitor cells or PDXs described above are The method comprises transplanting the -1 positive pancreatic endoderm cells or their equivalent into a mammalian subject. , International Application No. PCT / US2007 / 015536, entitled "METHODS OF RODUCING PANCREATIC HORMONES" The method is fully incorporated herein by reference. In a preferred embodiment, the mammalian subject is a human Particularly preferred subjects are those who have sufficient immunity to respond to physiologically high blood glucose concentrations. In a subject identified as having a condition that limits the subject's ability to produce insulin at high levels, What constitutes a physiologically high blood glucose level for any particular mammalian species? Blood glucose level ranges can be readily determined by one of skill in the art. Any sustained blood glucose level that results in a disease or condition is considered to be a physiologically high blood glucose level. This is considered to be at the radioactive level.

[0197] Further embodiments of the present invention relate to in vitro pluripotent stem cells or their progeny, e.g. , PDX-1-positive foregut endoderm cells, PDX-1-positive pancreatic endoderm or pancreatic progenitor cells, N Multipotent cells, such as endocrine precursors, such as GN3-positive endocrine precursors, or insulin-secreting cells, glucagon-secreting cells, somatostatin-secreting cells, glucagon Functionally differentiated hormone secreting cells, such as pancreatic polypeptide-secreting cells, The present invention relates to in vivo insulin-secreting cells derived from secretory cells. Either the cells or the pluripotent cells are transplanted into a host or mammal to increase the host's blood glucose. Physiologically functional hormone-secreting cells, such as cells that secrete insulin in response to blood glucose levels In a preferred embodiment, the cells are capable of maturing to form teratomas in vivo. If so formed, they remain localized in the area of ​​implantation and are easily excised. In a particularly preferred embodiment, the cells can be cultured or removed in vitro. during the differentiation process in mammals, or when transplanted in vivo or in Upon maturation and development into functional islets in vivo, they do not contain any karyotypic abnormalities.

[0198] Additionally, the embodiments described herein may include engineered or genetically modified , pluripotent cells, human iPS cells, and other pluripotent cells according to the description provided herein. The present invention relates to pluripotent or differentiated cells derived from iPS cells, but not to iPS cells. Similar physiological functions and gene marker expression profiles in S cells and hES-derived cells This demonstrates that iPS cells have similar physiological properties to those in vivo. is predicted.

[0199] Methods for Encapsulating Pancreatic Precursors In some embodiments, the pluripotent cells, multipotent cells and differentiated cells described herein The compositions can be encapsulated in biological and / or non-biological mechanical devices, The device separates and / or segregates the cellular composition from the host.

[0200] The method of encapsulation is described in U.S. Patent Application No. 61 / 114,857, filed November 14, 2008. Issue, Title: ENCAPSULATION OF PANCREATIC PROGENIT ORS DERIVED FROM HES CELLS, and December 12, 2008 No. 61 / 121,086, entitled ENCAPSULATION OF PANCREATIC ENDODERM CELLS is incorporated herein in its entirety by reference, and is intended to describe semipermeable membranes, such as Theracyte™ Alternatively, encapsulation of pancreatic endoderm cells using a Gore device is described.

[0201] In one embodiment, the hES derived cells are dissolved in biocompatible polyethylene glycol (PEG). PEG-based encapsulation is described in U.S. Pat. No. 7,427,415. Issue number, title IMPLANTATION OF ENCAPSULATED BIOLOGY CAL MATERIALS FOR TREATING DISEASES;US Patent No. 6,911,227, entitled GELS FOR ENCAPSULATION OF BIOLOGICAL MATERIALS; and U.S. Pat. No. 6,911,227. Nos. 5,529,914, 5,801,033 and 6,258,870, entitled GE LS FOR ENCAPSULATION OF BIOLOGICAL MATER These are described in further detail in IALS, which are incorporated herein by reference in their entireties, and are incorporated herein by reference in their entireties. This paper describes conformal coating of cell aggregates using polyethylene glycol.

[0202] In one embodiment, the encapsulation device contains pluripotent derived cells, such as PDX-1 positive foregut embryos. pancreatic endoderm cells, PDX-1-positive pancreatic endoderm or progenitor cells, NGN3-positive endocrine precursor cells, etc. Endocrine precursors, or insulin-secreting cells, glucagon-secreting cells, somatostatin-secreting cells Functionally differentiated host cells, such as ghrelin-secreting cells, or pancreatic polypeptide-secreting cells, The researchers then used a combination of chemoattractant and chemoattractant receptors to prevent the passage of luminal secreting cells through the transplanted cell population and retain them within the device. At the same time, certain secreted polypeptides, such as insulin, glucagon, and so Contained in a semipermeable membrane that allows the passage of tomatostatin, ghrelin, pancreatic polypeptide, etc. Alternatively, the device may have multiple membranes, such as a vascularized membrane.

[0203] Growth, survival, proliferation and differentiation of human pluripotent stem cells, e.g. hES cells and iPS cells US20130236633A1 - Use of agents to enhance and promote intercellular adhesion - Google Patents They affect cell regulation by transmitting extracellular signals across the membrane, which in turn It can modulate biochemical pathways within the cell. Protein phosphorylation enhances cell A process by which intracellular signals are transmitted from molecule to molecule, ultimately resulting in a cellular response These signal transduction cascades are highly regulated Many of these proteins are involved in the synthesis of multiple protein kinases and phosphatases. In humans, protein tyrosine kinases are redundant, as evidenced by It is known to play an important role in the progression of many pathologies, including diabetes and cancer. It has been reported to cause glaucoma and has been associated with a wide variety of congenital syndromes. Threonine kinases, such as Rho kinase, when inhibited, can lead to diabetes, cancer, and and enzymes that may be relevant for the treatment of human diseases, including various inflammatory cardiovascular disorders and AIDS. The majority of inhibitors identified to date act at the ATP binding site. Such ATP-competitive inhibitors target less conserved regions of the ATP-binding site. Selectivity has been demonstrated through their ability to

[0204] The Rho kinase family of small GTP-binding proteins consists of RhoA-E and R At least 10, including hoG, Rac1 and Rac2, Cdc42, and TC10 The inhibitors are often ROK inhibitors or ROCK inhibitors or These are referred to as Rho kinase inhibitors, and are used interchangeably herein. The effector domains of Rho, RhoB, and RhoC have the same amino acid sequence and are similarly Rho kinase is thought to be the first downstream mediator of Rho. It acts as a signaling regulator and exists in two isoforms: α (ROCK2) and β (ROCK1). Rho kinase family proteins contain catalytic It has a ribosome-specific kinase domain, a coiled-coil domain in the center, and its C-terminal It contains a putative pleckstrin homology (PH) domain within the terminal region. Rho binding of ROCK The activity domain is located in the C-terminal part of the coiled-coil domain and is expressed in the GTP-bound form of R Binding to ho leads to enhanced kinase activity. Rho / Rho kinase mediated The vasopressin pathway includes angiotensin II, serotonin, thrombin, endothelin-1, and norepinephrine. Pinephrine, platelet-derived growth factor, ATP / ADP and extracellular nucleotides, and Signal transduction initiated by many agonists, including lotensin II Rho kinase plays an important role in the regulation of its target effector / substrate modules. Through this synthesis, smooth muscle contraction, actin cytoskeleton organization, cell adhesion and motility are all regulated. It also plays an important role in various cellular functions such as gene expression. Rho kinase proteins play a key role in mediating several cellular functions that are recognized to be associated with Due to the role of enzymes in the regulation of vascular function, inhibitors of these kinases may also be useful in treating various atherosclerotic cardiovascular diseases. or may be useful for preventing and are involved in endothelial contraction.

[0205] In some embodiments, including but not limited to, the Rho kinase inhibitor Y-2763 2. Fasudil (also known as HA1077), H-1152P and ITS (insulin selenium / transferrin / selenium; Gibco), Wf-536, Y-30141 (US Patent No. No. 5,478,838, which is incorporated herein by reference in its entirety. ) and their derivatives, as well as antisense nucleic acids against ROCK, RNA interference induction nucleic acids (e.g., siRNA), competitive peptides, antagonist peptides, inhibitory antibodies , antibody-scFV fragments, dominant negative variants and their expression vectors, etc. and / or agents that promote and / or support cell growth, survival, proliferation, and cell-cell adhesion. In addition, other small molecule compounds have been used as ROCK inhibitors. Since such compounds are known, or derivatives thereof, can also be used in the present invention. (See, e.g., U.S. Patent Application No. 200502002, which is incorporated herein by reference in its entirety. No. 9261, No. 20050192304, No. 20040014755, No. 20 No. 040002508, No. 20040002507, No. 20030125344 and International Patent Publication No. 2003 / 062227. , No. 2003 / 059913, No. 2003 / 062225, No. 2002 / 07 (see US Pat. Nos. 6976 and 2004 / 039796).

[0206] The present invention also includes the use of one or a combination of two or more ROCK inhibitors. These agents can, in part, stimulate the expression of dissociated hES cells, iPS cells, or differentiated cell cultures, e.g., definitive endoderm, foregut endoderm, pancreatic endoderm, pancreatic epithelium, pancreatic precursors It functions by facilitating the reassociation of the endocrine precursors and endocrine cells. The agent may also function when cell dissociation is not performed. , Increased proliferation and cell-cell adhesion occurred when cells formed from cell aggregates in suspension. or adherent plate cultures (with or without components of the extracellular matrix, With or without serum, with or without fibroblast feeders, with FGF with or without activin) independently of whether it is derived from The increased viability of these cell populations allows for purification using a cell sorter. The system is facilitated and improved, thus allowing for improved cell recovery. The use of Rho kinase inhibitors such as , during stepwise passaging of dissociated single cells, also allows for the expansion of differentiated cell types by enhancing their survival from cryopreservation. Rho kinase inhibitors such as Y27632 can inhibit the proliferation and differentiation of human pluripotent stem cells (e.g., hES It has been tested on cells (cells and iPS cells) and their differentiated cells, but The enzyme inhibitors are useful in the treatment of other cell types, such as, but not limited to, intestinal, lung, breast, It is applicable to epithelial cells, including glandular, renal, and retinal pigment epithelium as well as neural cell types. can.

[0207] The concentration of the ROCK inhibitor in the cell culture medium is determined so that the desired effect is achieved. For example, the enhancement, increase, and / or promotion of cell growth, survival, proliferation, and cell-cell adhesion. As long as it can be realized, it is not limited to those described in the following examples. It will be appreciated by those skilled in the art that inhibitors may need to be optimized under different conditions. For example, when Y-27632 is used, the preferred concentration is about 0.01 to about 1000 μM, more preferably about 0.1 to about 100 μM, and even more preferably about 1.0 to about 50 μM. M, most preferably in the range of about 5-20 μM. When using Y-27632, the concentration can be approximately two or three times that mentioned above. When using 1152, the amount is approximately a fraction of the amount of the Y-27632 concentration mentioned above, e.g., about 1 Available in / 10, 1 / 20, 1 / 30, 1 / 40, 1 / 50 or 1 / 60 The concentration of ROCK inhibitor used will depend, in part, on the biological activity and potency of the inhibitor. It depends on the nature of the material and the conditions under which it is used.

[0208] The time and duration of treatment with ROCK inhibitors affects growth, survival, proliferation (cell population) and and are limited depending on the desired effect, such as enhancing, increasing, and / or promoting cell-cell adhesion. However, the addition of a ROCK inhibitor is more fully described in Example 7. As has been shown, differentiation can also be affected in surprising ways. Human pluripotent stem cell cultures treated for 24 hours, 48 ​​hours, or longer Methods and / or differentiated cell cultures are described.

[0209] The density of human pluripotent stem cell cultures treated with ROCK inhibitors was also significantly increased by 100%. Desirable effects, such as enhancing, increasing, and / or promoting cell growth, survival, proliferation, and cell-cell adhesion. The cell density of the cells to be seeded is not limited as long as the effect of the present invention is realized. These include, but are not limited to, the use of adherent or suspension cultures, the nature of the cell culture medium used, Adjust according to various factors including the specific recipe, growth conditions and intended use of the cultured cells. Examples of cell culture densities include, but are not limited to, 1 ml 0.01 x 10 cells per 5 0.05 x 10 cells per ml 5 Pieces per 1ml cell 0.1×10 5 0.5 x 10 cells per ml 5 1.0 x 1 cell per ml 0 5 1.2 x 10 cells per ml 5 1.4 x 10 cells per ml 5 pieces, 1m 1.6 x 10 cells per liter 5 1.8 x 10 cells per ml 5 pcs, cells per ml 2.0×10 5 , 3.0 x 10 cells per ml 5 4.0 x 10 cells per ml 5 5.0 x 10 cells per ml 5 6.0 x 10 cells per ml 5 pieces, 1ml 7.0 x 10 cells 5 8.0 x 10 cells per ml 5 9 cells per ml. 0×10 5 or 10.0 x 10 cells per ml 5 or more, e.g. 1mL cells 5 x 10 7 Up to, or more than, or any value in between, good The cells were cultured with regard to their growth, survival, proliferation and cell-cell adhesion.

[0210] Use of agents that activate members of the TGF-beta receptor family In yet another embodiment, the agent that activates a TGFβ receptor family member is , which includes members of the TGFβ superfamily of growth factors, as described herein As used herein, a "TGFβ superfamily member" or its equivalent. These substances are TGFβ1, TGFβ2, TF-β3, GDF-15, GDF-9, and BMP-1. 5, BMP-16, BMP-3, GDF-10, BMP-9, BMP-10, GDF-6 , GDF-5, GDF-7, BMP-5, BMP-6, BMP-7, BMP-8, BMP -2, BMP-4, GDF-3, GDF-1, GDF11, GDF8, activin βC, βΕ, βΑ and βΒ, BMP-14, GDF-14, MIS, inhibin alpha, L efty1, Lefty2, GDNF, Neurteurin, Par More than 30 structurally related members of the family, including the subfamilies cefin and artemin. Chang et al. (2002) Endocrine Rev.23(6 ):787-823.

[0211] TGF-β family members mediate the alteration of cell properties in response to TGF-β family members. Polypeptides or interactions involved in transmitting or otherwise causing the change TGFβ signaling pathway activators, compounds that stimulate one or more of the following actions: These can be used in place of or in conjunction with TGFβ signaling. The pathway involves the TGFβ family members themselves. TGFβ superfamily members The present study involves the identification of type II and type I serine-threonine kinase receptors and cellular functions known as Smads. These receptors transmit signals to the nucleus via signal transduction through intracellular effectors. The body recognizes type I and type II receptors that work together to bind ligands and transmit signals. The receptors fall into two known subfamilies (Attisano et al., Mol Cell l Biol 16(3), 1066-1073(1996)). The ligand is type I receptor. and II receptors and promotes activation of type I receptors by phosphorylation. This activated complex in turn activates intracellular Smads, which in turn activate multiple subunits that regulate transcription. Members of the TGF-beta superfamily assemble into two subunit complexes. Signal transduction subgroup: Functionally related to TGFβ / activin and BMP Most TGFβ ligands are related to the GDF / GDF subfamily. First, the ligand binds to the type II receptor, and then the ligand / type II receptor complex binds to the type I receptor. It is believed that the phospholipids mobilize or phosphorylate the phospholipids (Mathews, LS, Endocrinology, ev 15:310-325(1994); Massague, Nature Rev: Mol Cell Biol.1, 169-178(2000)). Type II receptor kinase The enzyme then phosphorylates and activates type I receptor kinases, which then act as Smad kinases. TGFβ / activin ligand phosphorylates and activates TGFβ and It binds to the activin type II receptor and induces the activation of Smad-2, Sma d-3, Nodal and Lefty signaling. F ligand binds to BMP type II receptors and inhibits Smad1, Smad5, and Smad 8. Derynck, R. et al., Cell 95, 737-740 (1998). Upon ligand stimulation, Smads translocate into the nucleus and form transcription complexes. It functions as a component of.

[0212] TGFβ signaling is positively and negatively regulated through a variety of mechanisms. In the latter case, the signal is amplified to a sufficient level for biological activity. Family ligands bind to the type II receptor, which recruits and phosphorylates the type I receptor The type I receptor then mediates the synthesis of receptor-regulated SMADs (R-SMADs, For example, SMAD1, SMAD2, SMAD3, SMAD5, and SMAD8) where they can bind to the common mediators Smad or co-SMADs. R-SMAD / coSMAD complexes accumulate in the nucleus, where they function as transcription factors. They function to regulate the expression of target genes. For example, growth and differentiation factors 1, 2, 3, 5, 6, 7, 8, 9, 10, 11, and 15. In one preferred embodiment, In terms of morphology, GDF8 and GDF11 are TGFβ family members, as well as TG It is also an activator of the Fβ signaling pathway (positive regulator) and acts as an extracellular ligand for the ActRII receptor. It binds to the ligand-binding domain and then forms a complex with ActRI, thereby Inhibition of mad7 negative regulators and leading to phosphorylation of Smad2 / Smad3 complexes The Smad2 / Smad3 complex associates with Smad4 and mediates the expression of specific genes. Regulates the expression of.

[0213] Negative regulation of TGFβ signaling occurs at the extracellular, membrane, cytoplasmic and nuclear levels. Interfering with signal transduction to suppress signal transduction initiated by GFβ This can be achieved by blocking TGFβ receptor and SMAD protein interactions. Between TGFβ receptor(s) and SMAD proteins, including proteins that compete with it This can be accomplished by any means known in the art that antagonizes or prevents the interaction of Alternatively, they can be used to block signaling along a signaling pathway. , TGFβ receptor or SMAD protein by any means known in the art. It can alter the transcription or translation of various TGF-β member proteins. and negative regulation is further illustrated by a more detailed description of some of the factors below.

[0214] The use of any agent of the TGFβ superfamily in cell culture media, as well as The concentration of the members determines how, for example, TGFβ receptor family members are activated. As long as the desired effects, such as the above, can be achieved, the following examples will be described. For example, activin, e.g., activin A and / or activin B. When using cutin B, or GDF8 and GDF-11, the preferred concentration is about 1 0 to about 300 nM, more preferably about 50 to about 200 nM, and even more preferably about 75 to about The range may be about 150 nM, and most preferably about 100 to 125 nM. The concentration of such a compound can be readily tested and determined using standard techniques in the art. To determine the effectiveness of such concentrations, for example, gene markers (genomic markers) for a given cell type. Differentiation can be assessed by determining the expression and non-expression of a panel of ne markers. This can be done.

[0215] These and other growth factors used to differentiate human pluripotent stem cells have been U.S. Patent Application No. 12 / 132,437, filed June 3, 2008, entitled GROWTH FA CTORS FOR PRODUCTION OF DEFINITIVE ENDOD ERM, which is incorporated herein by reference in its entirety.

[0216] Having generally described the invention, the invention is provided herein for purposes of illustration only. A further understanding can be gained by reference to certain specific examples, which are illustrative and not limiting. It is possible. EXAMPLES

[0217] It should be understood that the above relates to preferred embodiments of the present invention and that the above does not depart from the scope of the present invention. It should also be understood that numerous modifications can be made thereto without departing from the spirit and scope of the present invention. The present invention is further illustrated in the following examples, which should not be construed as limiting its scope in any way. On the contrary, various other embodiments, modifications, and equivalents may be used. It should be clearly understood that, after reading the description in this specification, Anything that would occur to one skilled in the art without departing from the spirit of the invention and / or the scope of the appended claims. can be done.

[0218] Example 1 Induction of human iPS cells into pancreatic precursors and endocrine cells via definitive endoderm and endoderm intermediates Cell differentiation Generate populations of pancreatic cell types, including pancreatic progenitors, endocrine progenitors and hormone-expressing endocrine cells. To achieve this, a four (4) stage procedure was used over approximately two weeks (or 14 days) to prepare the suspension. Human induced pluripotent stem (iPS) cells were differentiated in the aggregates. The cellular system was analyzed by S. Yamanaka, Kyoto University, Japan, and Cellular Dynamism Center, Kyoto University, Japan. Provided by cs International, Inc. (CDI).

[0219] The iPS cells described herein were first developed by Shinya Yamanaka. The undifferentiated iPS cells were cultured in 20% knockout serum replacement medium. on mitotically inactivated mouse embryonic fibroblasts in DMEM / F12 containing Or preferably, the cells were grown feeder-free (without a fibroblast feeder cell layer). Differentiation was initiated by dissociating undifferentiated iPS cells into single cells using Cutase. Cell samples were taken for RNA isolation and analysis. Cells were incubated with 1:5000 dilution of insulin. In-transferrin-selenium (ITS), activin A (100 ng / mL), wnt 3a (50 ng / mL) and a rho kinase or ROCK inhibitor, Y-27632 10 μM cells per milliliter in RPMI + 0.2% FBS (vol / vol). The cells were then resuspended at 1–2 million units and placed on a rotating platform. The cultures were placed in ultra-low attachment 6-well plates and rotated at approximately 100 rpm. The medium was changed daily and rotated at 100 rpm for the remainder of the process. The generation and propagation are substantially as described in U.S. Pat. Nos. 7,961,402 and 8,211,699. No. 6,313,633, the disclosure of which is incorporated herein by reference in its entirety.

[0220] Pluripotent cells, such as hES or iPS cells, and cells derived from pluripotent cells The method described herein for producing aggregate suspension cultures is substantially as described herein on February 2, 2007. The title of the application filed on the 3rd was Compositions and methods for PCT / US200, which is a culturing differential cell 7 / 062755, and the application filed on October 20, 2008, entitled Methods and compositions for feeder-free pluripo tent stem cell media containing human se rum, as described in PCT / US2008 / 080516, is incorporated herein by reference in its entirety.

[0221] The methods described herein may be implemented, for example, in accordance with the methods disclosed in US Pat. No. 6,393,311, which is owned by Geron Corporation. The culture vessel may be slit into a microtubule as described in U.S. Pat. No. 6,800,480 to Bodnar et al. This can be promoted by first coating the cells with extracellular matrix. Similar to other methods for culturing stem cells, e.g., hES and iPS cells, this method , filed on October 20, 2008, entitled Methods and Com positions for feeder-free pluripotent st em cell media containing human serum, U.S. Patent Application No. PCT / US2008 / 0805, which is hereby incorporated by reference in its entirety. 16, the cells can be cultured using soluble human serum.

[0222] The methods described herein are based on the Wisconsin Alumni Research The Warren Buffett Foundation (WARF), incorporated herein by reference in its entirety. As described in U.S. Pat. No. 7,005,252 to Thomson, J. Exogenously added fibroblasts provided from a source other than exclusively a fibroblast feeder layer This can be promoted by growth factors (FGF).

[0223] During the first 24 h of rotation, single cells that adhere to each other form cell aggregates, which then release RNA. Sufficient cell samples were obtained for isolation and analysis of the cell aggregates, which were approximately 60 microns in diameter. The iPS cell sample was placed on the rotating platform and then cooled to 120 microns. After 24 h, the cultures were incubated with 1:5000 dilution of ITS, activin A (100–2 RPMI+ containing 0.00 ng / mL), and Wnt3a (50–100 ng / mL) 0.2% volume / volume FBS for approximately 1 day (from day 0 to day 1), and for an additional day Or they were given the same medium (from day 1 to day 2) but without Wnt3a. Cell samples were taken daily for isolation and analysis. After 2 days of differentiation, cultures were diluted with 1:10 00 dilution of ITS, KGF (or FGF7, 25ng / mL) and TGFβ inhibitor RPMI + 0.2% volume / volume FBS containing o.4 (2.5 μM) for 1 day (or For the next 2 days (days 3 to 5), TGFβ The same growth factor cocktail medium was added to the iPS cell aggregate suspension except that the inhibitors were omitted from the medium. Again, at the end of this stage (stage 2 or day 5), the cells were cultured for RNA isolation. Cell samples were taken at 0.5-1.5 days. For stage 3 (days 5 to 8), TTNPB[4-[ E-2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalene phenyl)-1-propenyl]benzoic acid] (3 nM), KAAD-cyclopamine (0.25 DMEM + 1% vol / vol B27 supplement containing 1 μM and noggin (50 ng / mL) The cell culture medium was replaced at the end of this stage (stage 3 or day 8). Instead, cell samples were taken for RNA isolation and analysis. For the eyes, Noggin (50 ng / mL), KGF (50 ng / mL) and EGF ( The medium was replaced with DMEM + 1% volume / volume B27 supplement containing 50 ng / mL Again, at the end of stage 4 (or day 14), cells were harvested for RNA isolation and analysis. A sample was taken.

[0224] Real-time PCR was performed to measure gene expression of various marker genes during differentiation. Gene expression of specific markers or genes was measured using housekeeping genes, The mean expression levels of clofilin G and TATA binding protein (TBP) were first measured. The normalized relative gene expression was then compared to the expression levels in undifferentiated iPS cells. The results are displayed in a bar graph as a function of the number of cells in the 100-well plate, thus representing the fold upregulation of various differentiation markers. For 4, gene expression was set for the lowest sample in the data set (day 14) Normalized and therefore represent fold downregulation during differentiation.

[0225] FIG. 2A-L shows the expression levels of the identified genes compared to the expression levels of the same genes in undifferentiated iPS cells. Genes (e.g., Oct4, Brachyury, Cer1, GSC, FOXA2, FO XA1, HNF6, PDX1, PTF1A, NKX6.1, NGN3 and INS) 1 is a bar graph showing gene expression versus housekeeping gene expression. By normalizing to a set of controls and comparing gene expression levels at two different time points, The results showed that the genes or expression markers were up- or down-regulated. For T4 (Figure 2A), gene expression was normalized and the sample with the lowest level of expression was set to 1. Therefore, as shown in Figure 2A, the relative expression of OCT4 was Current levels are downregulated during differentiation (X-axis, stages 0 to 4 or days 0 to 14). Magnification (y-axis) is shown.

[0226] As shown in Figure 2A, OCT4 (POU5F1) was expressed at high levels in undifferentiated iPS cells. It is expressed in the IL-16 / ... , OCT4 expression levels are reduced by more than 3000-fold from those observed in undifferentiated cells In contrast, the brachyury gene ( There was a transient upregulation of expression of brachyury (Fig. 2B). Transient upregulation of pluripotency / iPSCs by application of activin A and wnt3a This resulted in induced differentiation into mesoendodermal cells. As shown by the upregulation of ER1, GSC and FOXA2 (Figures 2C-E), Mesoderm is transformed into definitive endoderm during days 2 and 3 by continuous exposure to activin A. Upregulation of FOXA1 and maintenance of FOXA2 expression were observed until day 6 of differentiation. As shown by the downregulation of CER1 and GSC (Fig. 2C–F), During day 2, the definitive endoderm was further induced to differentiate into gut endoderm. As indicated by the upregulation of HNF6 and PDX1 (Figure 2G–H), stage 3 During the course of development, exposure to the retinoids, cyclopamine and noggin, results in the intestinal endoderm forming the posterior foregut / They were further induced to differentiate into PDX1-expressing endoderm. As indicated by the upregulation of KX6-1, NGN3 and INS ( Figures 2I–L ). During stage 4, exposure to KGF and EGF resulted in the posterior foregut / PDX1-expressing endoderm , and further induced to differentiate into pancreatic precursors, endocrine precursors, and hormone-expressing endocrine cells. It was done.

[0227] Example 2 Rho kinase inhibitors promote iPS cell growth, survival, proliferation and cell-cell adhesion Methods for differentiating various hES and iPS cell lines are substantially as described herein and in the Examples. 1. Enhancement of growth, survival, proliferation and cell-cell adhesion during differentiation and In addition to the culture conditions described for stages 1, 2, 3, 4 and 5, Add apoptosis inhibitors and / or Rho kinase or ROCK inhibitors to the culture medium. Generally, about 10 μM of a Rho kinase inhibitor, such as Y-27632, was administered to each stage. Alternatively, at least stages 1 and 2, and stage 4 were added to the cell culture. and 5, or any combination thereof, were added with a Rho kinase inhibitor. Morphology and gene marker expression profiles of suspension (aggregate) cell cultures are consistent with those of hES cells. The cell culture medium is substantially similar to that of the suspension cell culture derived from the culture medium.

[0228] Figures 3 and 4 show immunocytochemistry (IC) of iPS cell cultures from stages 4 and 5, respectively. C) Figure 3 shows PDX1-positive pancreatic endoderm including PDX1 / NKX6.1 co-positive cells. Expresses typical genetic markers characteristic of pancreatic epithelium (also called pancreatic progenitors) Figure 3 shows a cell aggregate from stage 4. Although not shown in Figure 3, stage 4 cells , insulin (INS), glucagon (GCG), somatostatin (SST) and pancreas The hormone-secreting proteins, such as polypeptide (PP), which are more characteristic of stage 5 cells, Figure 4 shows the cytoplasmic aggregation of hormone-expressing cells from stage 5. These ICC results were further confirmed using QPCR. PCR is a population-wide study of the total levels of RNA expressed in a sample or cell culture; It cannot be shown conclusively that any one cell expresses multiple markers.

[0229] Example 3 Encapsulation of iPS-derived pancreatic precursors To date, methods for generating iPS cells and sources for generating iPS cells have been reported. However, for potential use in cell therapy to treat certain diseases, e.g. diabetes, For this purpose, there is no sufficient description of the differentiation of any iPS cells into any functional differentiated cells.

[0230] Stage 4 PDX1-positive pancreatic endoderm or pancreatic progenitor derived from human iPS cells The cell cultures were allowed to develop and mature in vivo into glucose-sensitive insulin-secreting cells. To determine whether it is entirely possible to achieve this, a method was carried out substantially as described in Examples 1 and 2. The pancreatic progenitor population was prepared using the method described herein on Nov. 13, 2009, which is incorporated by reference in its entirety. Filed U.S. patent application Ser. No. 12 / 618,659, entitled ENCAPSULATION OF PANCREATIC LINEAGE CELLS DERIVED FROM H UMAN PLURIPOTENT STEM CELLS; and U.S. Patent No. 7,5 Nos. 34,608 and 7,695,965, entitled METHODS OF PRODUCTION A compound substantially similar to that described in CING PANCREATIC HORMONES. Briefly, approximately 3×10 6 With cell number, 5-10- 20 μL of gravity settled cell suspension aggregates were added to each device.

[0231] The device is then inserted into a mammal, e.g., an immunodeficient SCID / Bg mouse, for implantation. Encapsulated cells are prepared and then transplanted into larger animals such as rats, pigs, monkeys or human patients. The method and device for transplanting encapsulated cells is essentially the same as that of GELFOA. Pancreatic progenitors engrafted into M-matrix and transplanted under the epididymal fat pad (EFP) Cells et al., U.S. Patent Application Serial No. 12 / 618,659, U.S. Patent No. 7,534,608 and and 7,695,965.

[0232] Although immunosuppression was not required in these studies, the precursors within the device were not fully matured and Immunosuppression may be required for certain mammals for an initial intermediate period until they become radioresponsive. In some mammals, immunosuppressive regimens may last approximately 1, 2, 3, 4, 5, It may be six weeks or more, depending on the mammal.

[0233] The transplanted cells were allowed to differentiate and further mature in vivo. To determine whether a cell has normal physiological function, e.g., like a naturally occurring beta cell. Next, human insulin levels are determined by testing human C-peptide levels. The peptide is cleaved or processed from human proinsulin and therefore is not an endogenous mouse C peptide. Specific detection of human C-peptide, but not human C-peptide, indicates that insulin secretion is mediated by transplanted (xenogeneic) cells. The animals with the implants were not administered arginine or glutamate. A course of human C, preferably by bolus injection of glucose, every 2, 3 or 4 weeks The peptide levels will then be examined. Mature beta cells (derived from differentiated pluripotent iPS cells) will then be (derived from the human beta cell line) are physiologically functional and similar to naturally occurring or endogenous beta cells. Generally, the concentration should be 50 pM or the mean basal (threshold) level. The amount of human C-peptide exceeding that of the beta cells from transplanted precursors is now an indicator of function. be.

[0234] Kroon et al. (2008), supra, which is incorporated herein by reference in its entirety; U.S. Pat. Application 12 / 618,659, U.S. Patent Nos. 7,534,608; 7,695,965 and 7,993,920, similar to those described in Pancreatic progenitors are functionally distinct, with endocrine, acinar, and ductal cells similar to those of naturally occurring islets. It is expected that the cells will mature into potent islet clusters. The purified or enriched pancreatic precursors released also mature and develop into functional islets in We have purified and enriched various differentiated cell populations that are predicted to produce insulin in vivo. Specific embodiments for reducing the size of the stencil are described in U.S. patent application Ser. No. 12 / 144, filed Apr. 8, 2008. 07,020, Title: METHODS FOR PURIFYING ENDODERM AND PANCREATIC ENDODERM CELLS DERIVED FR OM HES CELLS, as further described in current U.S. Pat. No. 8,338,170. The disclosure of which is incorporated herein by reference in its entirety. Pancreatic progenitors derived from cells can be thawed and culture-adapted prior to transplantation. As a result, it is further predicted that they will be able to mature and produce insulin in vivo. In diabetic animals with transplanted pancreatic progenitors derived from hIPS cells, It can improve hypoglycemia.

[0235] In summary, fully encapsulated pancreatic progenitor cells derived from hIPS cells in macroencapsulation devices These cells mature into physiologically functional pancreatic islets and respond to glucose and insulin in vivo. It is expected to generate

[0236] Example 4 Pancreatic Progenitor and Hormone-Secreting Cell Compositions Differentiation was analyzed using flow cytometry as shown in Tables 5a, 5b, and 6, respectively. The resulting hIPS cell population was classified as PDX1-positive pancreatic endoderm or pancreatic progenitor cells (stage 4); and endocrine or endocrine precursor cell (stage 5) content. The same data set as in Table 5a, but presented as in Table 9 for comparison. The overall PDX1+ and NKX6.1+ counts were NKX6.1+ / PDX1+ / CHGA- thin Since the populations in Table 5a overlap with those in the cell population (column 5 of Table 5a), the populations in Table 5a overlap with each other, e.g. Total cell counts are >100%. Table 5b shows PDX1+ only and triple negative (residual) data. These i Certain of the PEC grafts, as well as others using substantially similar formulations, have been transferred to animals. However, human serum C-peptide levels are not stable enough for any potential therapeutic purposes. (data not shown). Values ​​shown are the percentage of total cells belonging to a given population. Pancreatic precursors (NKX6.1(+) / PDX1(+) / chromogranin) in turbid cell aggregates The number of patients with NKX6.1+ / PDX1- / CHGA- was significantly higher than that of patients with NKX6.1+ / PDX1- / CHGA-. , consistent with that observed in hES cell-derived pancreatic progenitor cell suspension aggregates, U.S. patent application 12 / 264,760, filed November 4, 2008, entitled STEM CEL L AGGREGATE SUSPENSION COMPOSITIONS AND It is described in METHODS OF DIFFERENTIATION THEREOF, The cells aggregated at the ESC stage, as fully incorporated herein by reference. and / or levels of endocrine precursor cells. U.S. patent application 12 / 107,020, filed April 8, 2008, entitled METHODS FOR PURIFYING ENDODERM AND PANCREATIC EN hES in DODERM CELLS DERIVED FROM HES CELLS The results were substantially consistent with those obtained with hES-derived cell cultures. As with the body, different growth factors in the medium at specific stages of differentiation (e.g., stage 4) Varying concentrations of IL-16 were used to identify pancreatic endoderm, endocrine, PDX1-positive endoderm or non-pancreatic cells. The antibody should increase and / or decrease specific populations of the type. [Table 5] [Table 6]

[0237] Example 5 PEC receptor tyrosine kinase The above method is described in Table 7 below, adapted from Schulz et al. (2012) supra. These and other methods described herein are substantially similar to those disclosed herein. No. 7,964,402; No. 8, Nos. 211,699; 8,334,138; 8,008,07; and 8,15 No. 3,429, and other related patents and non-patent publications of the applicant. [Table 7]

[0238] The same method was applied to iPS cells and pancreatic precursors transplanted into animals. Compared to the application to hESC and hES-derived pancreatic progenitors, Applicants have demonstrated similarly stable However, iPS cells have not consistently achieved robust in vivo function. The morphology and gene expression pattern of SCs were observed in vitro in embryoid bodies and in v Human pluripotent stem cells capable of forming teratomas in ivo, and they were isolated from three embryos This is significant, given that the results show that cells from all parts of the leaf can be generated. See, at least, Yu et al. (2007); U.S. Patent Application Publication No. 2006-202354, supra. No. 09 / 0047263, International Patent Application Publication No. WO2005 / 80598; U.S. Patent Application Publication No. and International Patent Application Publication No. WO2008 / 11882, See, These references state that iPS cells meet the defining criteria of ESCs. Thus, further maturation and differentiation into fully functional glucose-responsive cells in vivo An in vitro differentiation protocol that allows hES-derived pancreatic progenitor cells to develop It is expected that iPS cells can be a substitute for ESCs in the above areas. In view of the inconsistent in vivo functional data using the method of and / or pancreatic endoderm cells (PECs), i.e., PECs derived from hESCs. Provides a stable level of in vivo function that is substantially similar to that consistently observed It is possible to specifically target stage 4-derived cells from hiPSCs (or "iPECs") Therefore, we sought to find a differentiation medium formulation that would be effective.

[0239] Applicant believes that the endocrine (CHGA+ cells) cells present in PEC are multihormonal endocrine cells. and generate islets with glucose-responsive insulin-secreting cells in vivo We previously reported that IL-16 is not a subpopulation of cells in PECs. See Kelly et al. (2011) supra. Rather, it is the non-endocrine cell population (CHGA-cells), specifically in vivo NKX6.1 and NKX6.1 are thought to be the PECs that actually generate functional islands in vo. Thus, Applicants have identified endocrine and non-endocrine subpopulations that co-express PDX-1. Modulating, changing, or shifting the relative ratio of groups can lead to later in vivo o We explored whether it would affect function.

[0240] Previous efforts to decipher receptor-ligand signaling in hESCs have demonstrated that The identification of growth factors that stimulate the growth of fibroblasts has enabled the development of defined culture conditions. (2007). Wang et al. Hereglin is a ligand that induces merization and thus affects hESC self-renewal. ERBB is a receptor tyrosine kinase (RTK), and RTK is a Widely expressed membrane receptors that act as receptors for growth factors and other extracellular signaling molecules As a result of ligand binding, they bind to specific residues in the cytoplasmic tail. Binding of other protein substrates that undergo phospholysine and are involved in RTK-mediated signaling Initiates signaling cascades for the regulation of cell survival, proliferation, and motility The functions of RTKs in several developmental processes and their role in cancer formation are well documented. It has been demonstrated that ERBB tyrosine kinase receptors are expressed throughout the developing fetal human pancreas. It was also known that ERBB receptors are expressed in the ERBB subunits, but the specificity of specific ERBB receptors and their ligands was unknown. The therapeutic role of ERRB is unknown. Signaling Regulates Lineage Determinati on of Developing Pancreatic Islet Cells in Embryonic Organ Culture, Endocrinology Please see 143(11):4437-4446.

[0241] The autonomy of pluripotent stem cells in fetal human pancreas as demonstrated by Wang et al. (2007) ERBs in autoreplication and their expression, and ERBB RTK expression in human fetal pancreas Due to the role of BRTK signaling, Applicant next investigated the role of BRTK signaling in PEC specification during differentiation, and islet cells are either self-renewing or transformed into physiologically functional islet hormone-secreting cells. Receptors and possibly other unknown mechanisms that promote ivo maturation In an effort to identify ligands, in vitro pancreatic endoderm derived from hESCs We began by investigating the potential activation of RTK in protease inhibitors (PECs). PECs were generated in suspension of differentiated aggregates qualitatively as described in Table 8.

[0242] Four PEC samples were generated for RTK blot analysis: db-N50 K50 A “steady-state” sample of PEC aggregates at E50 was collected at the end of stage 4 (or d13). "Fasted" samples were collected in db(DMEM high glucose or 0.5x B-27 DMEM high glucose supplemented with supplements (Life Technologies) ) Represents d12 PEC aggregates that were fed medium alone (no growth factors) and harvested on d13. The two "pulse" samples were cultured in db medium on d12, then on d13, Before harvesting, place the cells in either db-K50 E50 medium or db medium containing 2% FBS for 15 minutes. Such conditions provided the detection of RTKs that were active in the stage 4 conditions, and In addition, KGF, EGF and insulin (present in B27 supplement) or serum palladium were added to the The aim of this study was to discover what kind of response could be elicited by administration of serum pulses. Administration of RP is sufficient to stimulate R cells that are present in PECs and can be activated but not activated in this stage 4 condition. We aimed to use broad-spectrum growth factor stimulation to potentially identify TK.

[0243] RTK assays were performed essentially as previously described in Wang et al. (2007), supra. Briefly, the Proteome Profiler™ Human Phospho-RTK Antibody Array (R&D Systems) was used according to the manufacturer's instructions. 1% NP-40, 2 0 mM Tris-HCl (pH 8.0), 137 mM NaCl, 10% glycerol, 2 0.0 mM EDTA, 1.0 mM sodium orthovanadate, 10 μg / mL apro Protein lysates were prepared with 10 μg / mL leupeptin, 500 μg / mL tyrosine, and 10 μg / mL leupeptin. Fresh protein lysates were incubated with 42 anti-RTK antibodies and five negative control antibodies. Duplicate spots, as well as eight anti-phosphotyrosine positive control spots. The arrayed antibodies were incubated overnight with a nitrocellulose membrane dotted with IgG (Figure 5A). captures the extracellular domains of phosphorylated and non-phosphorylated RTKs, and bound phospho-RTKs are , using chemiluminescence to detect amplicons conjugated to horseradish peroxidase (HRP). RTK array layout is shown in Figure 5, as well as See Table 8 below for a list of RTKs in the array. [Table 8]

[0244] Analysis of RTK blots (Figure 6A) demonstrated that, similar to what has been previously observed in hESCs, The IR and IGF1 receptors (IR and IGF1R, respectively) were phosphorylated under all conditions. (2007) supra. F receptor (EGFR, also known as ERBB1) was phosphorylated under steady-state conditions, , which was expected given the presence of EGF in the stage 4 medium. , low levels of phosphorylation of ERBB2 were detected under both steady-state and fasting conditions. Phosphorylation of both GFR and ERBB2 was increased under each pulse treatment condition, and the phosphorylation of both ligands was increased. The ability of the assay to detect activation in response to administration of VEGF R3 was also detected under all conditions and increased in the pulsed samples. These results suggest that VEGFR3 ligands are generated, with possible candidates being VEGF-C and Serum pulsing increased the levels of additional receptor agonists, including low levels of ERBB3 phosphorylation. Detection of phosphorylated ERBB2 / 3 was associated with the activation of heregulin-like EGF phagocytosis. These results suggest that myri members can activate signaling in PECs. E-2 is one of two angiopoietin receptors and is expressed at low levels in response to serum Angiopoietin 1 and angiopoietin 4 appear to be oxidized by Tie-2. It is known that angiopoietin 2 and angiopoietin 3 act as activating ligands. 3 functions as a situation-dependent competitive antagonist. Hepatocyte growth factor also elicits signal transduction in PECs. Finally, low levels of the ephrinB2 RTK (EPHB2) were Phosphorylation of ephrin was detected, but ephrin / Eph signaling is not a membrane-bound intercellular signaling pathway. It is a system that does not appear to be readily exploited in PEC differentiation. Therefore, RTK analysis was performed to determine whether RTK was phosphorylated in PEC or not. have clearly identified several receptors that can be phosphorylated in response to different conditions, e.g., serum. These results suggest that some soluble ligands can induce RTK signaling in PECs. can be produced, potentially affecting cell proliferation, differentiation and / or specification, Thus, it could potentially affect subsequent in vivo maturation into functional islets. This suggests that...

[0245] Example 6 Heregulin and FGF2 growth factors influence PECs derived from hESC compositions influence As described in Example 5 above, certain RTKs are activated (or phosphorylated) under certain conditions. Considering the RTK analysis that demonstrated that at least ERBB2 and ERBB Because 3 appeared to be activated in PECs (after 13 days of differentiation from stages 1–4), Applicants sought to determine the effect of heregulin when applied to stage 3 and 4 cells. I tried my best.

[0246] Preliminary studies were conducted using heregulin and FGF. These preliminary studies included the Rho kinase inhibitor Y-27632 at 10 ng / mL. mL heregulin-1β (same concentration and Treatment of pluripotent stem cells at stage 1 for 1 day with heregulin-1β ( The aggregate size of hES-derived cell aggregates in suspension cultures without Hrg1β was compared to that of hES-derived cell aggregates in suspension cultures without Hrg1β. Increased cell aggregate size of hES-derived cell aggregates in culture. Increased cell aggregate size This has the advantage of providing a larger cell mass for subsequent transplantation and functional testing in animals. Furthermore, Hrg1β increased from 10 ng / mL to 50 ng / mL in stage 3. The aggregate disk size increased when FGF2 was added to the culture medium. This was also observed when 50 ng / mL of another growth factor, FGF2, was used in stage 3. Increases in cell aggregate size can be seen after stage 3 cultures have been exposed to FGF2 for additional days, e.g., 2 days. This was also observed when exposed to 50 ng / mL FGF2 for 3 days compared with 5 days.

[0247] Table 9 shows the results of treatment with Hrg1β and FGF2 at stage 3 and / or stage 4. A summary of flow cytometry analysis of PEC cells is provided. Endocrine cells are CHGA-positive ( or CHGA+) cells, and non-endocrine cells are CHGA-negative (or CHGA-) cells. Endocrine (CHGA+) and non-endocrine (CHGA-) cells are identified using other markers. can stain positively, e.g., stain positively for PDX1 and / or NKX6.1 Cells that do not stain for any of the markers tested are classified as triple negative or residual cells ( This is expressed as CHGA- / NKX6.1- / PDX1). [Table 9]

[0248] To determine whether the increase in cell aggregate size affects PEC subpopulations, PE The composition of the C population was analyzed by flow cytometry. Compared to control cultures in which 1β and FGF2 were not used, the PEC non-endocrine subpopulation (C HGA-) was reduced from 54.01% to 64.01% by adding 10 ng / mL of Hrg1β at stage 3. 61.2%, and at stage 3, the addition of 50 ng / mL Hrg1β increased the rate to 54.01 % to 64.2%. The endocrine subpopulation (CHGA+) had an Hrg of 10 ng / mL or higher. Treatment with 1β had little effect, but more so at 50 ng / mL. The relative level of residual cells was reduced, more so at 50 ng / mL Hrg1β. Therefore, the increase in cell aggregate size by Hrg1β treatment was greater than that of the endocrine and residual subpopulations. This was largely attributable to increases in non-endocrine subpopulations.

[0249] The effect of FGF2 in stage 3 cultures was similar, but more pronounced than that of Hrg1β. For example, the PEC non-endocrine subpopulation (CHGA-) showed a marked increase in Hrg1β. The primary effect of FGF2 in these cultures was a substantial increase in the endocrine subpopulations. In some cases, these cells were nearly undetectable after 3 days of treatment. (32.9% to 0.33%). Therefore, the cell aggregate size in cultures treated with FGF2 Increases in size were due to an increase in non-endocrine, and in some cases residual, cell subpopulations (over the course of 3 days in stage 3). This was mostly attributed to the 13.1% to 22.7%

[0250] Thus, heregulin and / or FGF2 may play a role in cell specification in the PEC population. Heregulin alone appears to play a role in the regulation of pluripotent stem cells. Considering the above-mentioned report by Wang et al. (2007) that α-amyloid plays a role in cell regeneration, So, this is surprising.

[0251] Example 7 In vivo engraftment of PECs by treatment of iPS-derived cell cultures with heregulin How to improve one-sided function The methods according to Table 7 when applied to iPSCs to generate iPECs are stable in animals. As these methods do not provide the in vivo functionality required for iPEC generation, Applicants have identified other methods for generating iPECs. Modifications to the standard method shown in Table 7 include, but are not limited to, the following: Optimizing the passage number of any iPSC; modulating the level of BMP signaling and; modulating iPSC suspension aggregation parameters during expansion and differentiation (e.g. shear forces, rotational speed, etc.); growth factors, e.g. Wnt, activin and rho kinase inhibitors Optimization of the concentration, timing and duration of use of the toxic agent; and steps 1 to 4 of the differentiation protocol. Other candidates for improving cell quantity, proliferation, differentiation, survival, etc. at various stages Treatment with growth factors (e.g. ERBB ligands). Differentiation of iPSCs between stages 1-4 Many of these replicate experiments were conducted to determine how the purification method could be optimized. These optimized differentiation methods were tested alone or in combination. Finally, we demonstrated stable glucose-responsive in vitro expression of IFN-γ-α-γ-α-glycoprotein (IFN-γ-α)-1-phosphate dehydrogenase (PDHV ... Table 10 below shows the iPEC population that gave rise to insulin-secreting cells in vivo. The iPSCs were then differentiated into iPECs that subsequently matured into glucose-responsive islet cells in vivo. Describe the baseline conditions with and without heregulin that have been demonstrated to improve The in conditions were the same as those described in the Examples herein, except that heregulin was added at stages 3 and 4. 1, 2 and 5 and similar to those described in Table 7. Ηrg of 30 ng / mL 1β was used, but concentrations of 10ng / mL to 50ng / mL or 50ng / mL were used. Even concentrations above 100% are suitable. In addition, as described in Example 2, the Rho kinase inhibitor, Y Addition of -27632 was maintained in differentiation cultures. [Table 10]

[0252] Heregulin or heregulin and rho kinase on subpopulations of stage 3 and 4 cells To determine the effect of adding enzyme inhibitors, iPEC populations were analyzed by flow cytometry. Table 11 shows the composition shown in Table 10 and the activin concentration at 200 ng / ml. Flow cytometry of various iPEC populations using modified formulations by increasing L Additionally, Table 11 provides a summary of the chromatometric analysis for each set of experiments (heregulin availability). The general conditions used in the study (baseline with or without IL-1) and the cell types (endocrine , non-endocrine, PDX1 only and triple negative or residual cell subpopulations) are shown. Table 11 also discloses data regarding the in vivo function of cells generated in each experiment. [Table 11]

[0253] Under certain conditions, PEC (hESC, E2354) and iPEC (E2314, E2344, E2347) The ratio of cell subpopulations in the population changed. For example, sometimes The percentage of endocrine (CHGA+) cells was decreased compared to the line (no heregulin) condition. The percentage of non-endocrine cells (CHGA- / NKX6.1+ / PDX1+) increased. Glynn significantly increased the proportion of endocrine cells compared to non-endocrine cells in these PEC and iPEC populations. In experiment #2380 (E2380), heregulin The addition of α-aminobutyric acid increased, but did not decrease, the level of endocrine (CHGA+) cells.

[0254] We investigated whether changes in the composition of PEC and iPEC populations affected their in vivo functions. To determine whether PEC and iPEC transplants from most of the experiments described in Table 11 The strips were prepared substantially as described herein and in Schulz et al. (2012) and Kroon et al., supra. (2008), and the above-mentioned U.S. Patents Nos. 7,534,608 and 7,695,965. Applicant's other patents, including Nos. 7,993,920 and 8,278,106; Mice were transplanted as previously described in non-patent publications. Briefly, PEC and iPEC populations were cultured in vitro and cultured in vitro. All were encapsulated in biodegradable, semipermeable cell encapsulation devices, some of which contained microperforations. The device is manufactured by the applicant and is a U.S. patent application filed on November 13, 2009. No. 8,278,106, entitled ENCAPSULATION OF PANCREATIC CELLS FROM HUMAN PLURIPOTENT STEM CELLS The disclosure of which is incorporated herein by reference in its entirety. Glucose stimulatory insulin secretion (GSIS) assays were performed from about 56 days after transplantation. A combination of pre-administration (fasting state) and 30 and / or 60 minutes after glucose administration Blood was collected at 0°C for 10 min. The serum human C-peptide concentration in response to glucose administration was measured. Graft function was evaluated by:

[0255] The amount of human C-peptide released into the serum is an indicator of the amount of insulin released. The peptide connects or links the A and B chains of proinsulin and preproinsulin. It is a short 31 amino acid peptide expressed by functional beta or insulin secreting cells. As previously described by Kroon et al. (2008) and others, human C peptide Measurement of insulin is suitable for evaluating the release of newly produced insulin by transplanted cells. Therefore, the levels of human C-peptide in the serum of these animals were significantly higher in mature PECs and iPECs. Human C-peptide is a measure of in vivo graft function. Additional weeks of transplantation and fasting resulted in glucose-stimulated C-peptide Levels increased, with peak C-peptide levels occurring 30 minutes after glucose administration instead of 60 minutes after. This shift indicates a faster response to glucose administration, which is consistent with the maturation of insulin cells. The few that failed to demonstrate function or were killed due to poor health However, these mice were among a cohort of animals that otherwise showed high functioning. Therefore, the failure of engraftment is due to the inability of transplanted cells to differentiate and function. indicated defeat.

[0256] 7A-C show the glucose administration time for all of the experiments shown in Table 11 except E2344. 7A-C show human C-peptide levels in serum after 1 h compared to baseline controls. Heregulin treatment resulted in higher levels of human C-peptide in serum. For example, in experiment 2380, Figure 7A shows that the Approximately 5% of grafts resulted from heregulin treatment compared to baseline. There is a 2-fold increase (933 pM: 200 pM 60 minutes after glucose administration). (FIG. 7C) Serum levels in grafts resulting from heregulin treatment compared to baseline controls Heregulin does not show higher levels of C-peptide, and thus is not a predictor of P2P2 produced from hESCs. Furthermore, the effect of IFN-γ on hESC-derived PECs (C When comparing iPEC derived from iPSCs (yT203), iPEC grafts showed a higher PE C have the same functions in vivo as grafts (e.g., Figures 7A and 7B (iPS Compare Figure 7C (C grafts) with Figure 7C (CyT203 hESCs). The explants are as robust as PEC grafts. Furthermore, the endocrine and non-endocrine subpopulations iPEC from E2380, which did not have the same shift, also showed excellent performance, so iPE C population (e.g. E2314, E2347 and E2354). The relative ratio of endocrine to non-endocrine cells appears to influence in vivo function. (See Figures 7A-C).

[0257] In addition to testing glucose-stimulated insulin secretion, we also destroyed beta cells in the host animal. When the cells were cultured, normoglycemia was maintained similar to that maintained by hESC-derived PECs. To determine whether they could sustain the sugars on their own, mature iPECs were transfected. The researchers tested explants, which showed stronger responses to mouse beta cells compared to human beta cells. Transplanted using the cytotoxic beta cell toxin streptozotocin (STZ). It was necessary to destroy the beta cells of the mice. Random non-fasting blood glucose was measured. iPEC transplantation on day 13 after STZ treatment. Explantation of the explants resulted in resumption of hyperglycemia (a sudden rise in blood glucose), which was due to endogenous myelin. We demonstrate control of glycemia by iPEC grafts but not by mouse pancreas (Figure 8A and Figure 8B). (see below).

[0258] In addition, heregulin and a rho kinase inhibitor were given during stages 1–4 of differentiation. There appeared to be a synergistic effect when rho-kinase was administered. iPSCs treated with heregulin at stages 3 and 4 without enzyme inhibitors showed no visible This resulted in poor cell mass and made transplantation impossible. Heregulin and rho kinase inhibitors Further evidence of synergy between the two is evident in some of the experiments, e.g., E2356, E2380. There were cases where the baseline condition with rho kinase inhibitor alone was The grafts did not function as stably as those grafted with enzyme inhibitors and heregulin (Fig. 7A and The addition of heregulin alone provided insufficient cell mass for transplantation, and rho kinase activity was not observed. The addition of enzyme inhibitors alone (baseline conditions) had poor in vivo function. However, treatment with heregulin and rho kinase inhibitors did not appear to be additive. As such, providing only heregulin or only a rho kinase inhibitor is not sufficient to achieve the same therapeutic effect as combining the two. The combined effects of these two drugs are not substantially equivalent; Although they do not confer the same glucose responsiveness to hES-derived cells, when combined they Thus, heregulin and rho kinase The provision of both inhibitors is important because their combined effect is greater than the sum of the effects of each separately. The results showed that the effect of treatment with rho kinase inhibitors and heregulin was synergistic. The iPECs matured in vivo and exhibited glucose-stimulated insulin secretion, which led to diabetes We were able to maintain normoglycemia in the mouse model (see Figures 7A-B and 8A-B). I want to.

[0259] ERBB functionality requires ligand binding, receptor dimerization and receptor trafficking. Variations in processes may result in differential regulation of receptors and the downstream signals they control. For example, different ERBB ligands bind to ERBB receptors with different affinities, This alters the pattern and dynamics of ERBB dimer formation. Many different possible combinations of ligand and receptor binding complexes are shown. For a comprehensive review, see Oda et al. (2005) ay map of epidermal growth factor recept or signaling, Mol. Syst. Biol., 1 (2005) and La Zzara et al. (2009) Quantitative modeling perspective ctives on the ERBB system of cell regulation tory processes, Experimental Cell Research h 315(4):717-725, the disclosure of which is incorporated herein by reference. is fully integrated into [Table 12]

[0260] Huotari et al. reported that neuregulin-4 acts at the expense of glucagon (alpha) cells. Increasing the number of somatostatin (delta) cells increases the relative levels of endocrine cell subpopulations. Neuregulin-4 can modulate the endocrine (e.g. (e.g., β-insulin, α-glucagon, δ-somatostatin, PP-pancreatic polypeptide) suggested that it does not affect the ratio of exocrine (e.g., amylase) cells to However, these studies used whole mount organ tissue samples obtained from mice at day E12.5. This was carried out by incubating neuregulin-4 on tissue cultures. The mouse explant cell population is cultured at stage 3 (e.g., PDX1-negative foregut) as described herein. stage 1 (PDX1-positive foregut endoderm) and / or stage 2 (PDX1-positive foregut endoderm) cell populations. Neuregulin-4 binds only to the ERBB4 RTK, so whole-mount Only the endocrine subpopulation of mouse cultures was modulated in this context by neuregulin-4. Thus, Hrg1 binds to ERBB3 and mediates the upregulation of ERBB2 / 3. Since it has already been shown that β-glucosidase induces dimerization of β-glucosidase, as described herein, different β-glucosidases can be used to induce dimerization of β-glucosidase ERBB ligands, such as Hrg1, regulate the differentiation of the endogenous PDX1-negative foregut endoderm at stage 3 and Treatment of stage 4 (PDX1-positive foregut endoderm) cells and / or stage 5 (PDX1-positive foregut endoderm) cells in Huotari However, it would not be expected that the IL-1 receptors would modulate the relative endocrine subpopulations as shown in FIG. As shown, due to the low level of expression of ERBB2 and 3 in PEC, stage 3 and Type 4 cells express low or high levels of ERBB2 and 3 and bind Hrg1. It was unclear whether this would happen.

[0261] Furthermore, in a different context, Applicant has demonstrated that Hrg1 binds to ERRB2 / 3 and mediates the induction of pluripotent stem cells. (See Wang et al., 2007.) It is possible that g1 can act in the same capacity in stages 3 and 4, but The applicant believes that the majority of cell expansion for the generation of PECs occurs at the pluripotent stem cell stage (stage 0). During stage 0, hESCs are grown and passaged for approximately two (2) weeks. Therefore, most of the self-renewal that leads to cell proliferation or cell growth is Most do not occur between stages 1 and 4. See Schulz et al. (2012) supra. Furthermore, assuming that ERRB2 / 3 is present during stages 3 and 4, It has the same effect (self-renewal) as pluripotent stem cells, as opposed to affecting the differentiation induced by them. If so, the difference in function may be due to the situation, i.e., whether pluripotent stem cells or The extent of differentiation appears to depend on whether the cell type is of endodermal or pancreatic lineage.

[0262] In summary, foregut endoderm (stage 3) and PDX1-expressing pancreatic endoderm cells (stage Heregulin or heregulin and rho kinase inhibitors to end of stage 3 and stage 4 The in vitro delivery of the toxic agent will mature and convert it into a glycoprotein in vivo when implanted. We generated PEC and iPEC populations that developed into insulin-responsive insulin-secreting cells (Figure 7 and and 8). Heregulin or heregulin and rho kinase inhibitors Such uses are reported here for the first time. Such uses and effects are not disclosed in any patent or non-patent literature. It is not recognizable from anything previously described in the literature.

[0263] The Q-PCR results described herein were further confirmed by immunocytochemistry (ICC). It is understood that the above-mentioned method can be easily implemented by a person skilled in the art.

[0264] The methods, compositions and devices described herein represent presently preferred embodiments. These are illustrative and are not intended to limit the scope of the present invention. Modifications thereto and other uses are contemplated, as encompassed by the spirit and scope of the disclosure. Accordingly, various substitutions and modifications may be made without departing from the scope and spirit of the present invention. It will be apparent to one of ordinary skill in the art that various modifications and variations can be made to the invention disclosed herein. It would be.

[0265] In the claims below and throughout this disclosure, the phrase "consisting essentially of" shall be used as the The term "compound" refers to any element listed that has an activity or function specified in the disclosure. The term "from fact" to "actual facts" is therefore limited to other factors that do not interfere with or contribute to the functioning of the "Above" means that the listed elements are required or mandatory, while other elements are optional. , whether they exist or not, depending on whether they affect the activity or action of the listed element. Furthermore, numerical values, e.g., amounts, concentrations, percentages, proportions or ranges, may not necessarily be used. In the recited embodiments, a value is referred to as "at least about" that value, or "about" that value. It is understood that the number may be "at least" that number.

[0266] Embodiment Embodiment 1. In vitro human pancreatic endoderm cell culture. Embodiment 2. The cell culture of embodiment 1, wherein the pancreatic endoderm cells are derived from pluripotent cells. Nutrition. Embodiment 3. The cell culture is contacted with an ERBB tyrosine kinase receptor activating agent. 3. The cell culture of embodiment 1 or 2, Embodiment 4. The ERBB tyrosine kinase receptor activating agent is EGF (epidermal growth factor AREG (amphiregulin), TGF-alpha (transforming growth factor child-alpha), Btc (betacellulin), HBEGF (heparin-binding EGF), Er 5. The method of claim 3, wherein the cellular component is eg (epiregulin), neuregulin or heregulin. vacuole culture. Embodiment 5. Pancreatic endoderm cells include pancreatic progenitor cells and multihormonal endocrine cells. 5. The cell culture according to any one of embodiments 1 to 4. Embodiment 6. Pancreatic progenitor cells express NKX6.1 but do not express CHGA. 6. The cell culture according to embodiment 5. Embodiment 7. The cell of embodiment 5, wherein the multihormonal endocrine cells express CHGA. vacuole culture. Embodiment 8. An embodiment in which the pancreatic endoderm cells include CHGA positive and CHGA negative cells. 5. The cell culture according to any one of 1 to 4. Embodiment 9. At least 30% of the pancreatic endoderm cells are CHGA-negative cells. 9. The cell culture according to any one of 1 to 8. Embodiment 10. At least 50% of pancreatic endoderm cells are PDX1 positive cells. The cell culture according to any one of aspects 1 to 9. Embodiment 11. The ERBB tyrosine kinase receptor activating agent is heregulin-4. The cell culture of embodiment 3, Embodiment 12. Any of embodiments 1 to 11, in contact with fibroblast growth factor (FGF). The cell culture according to any one of claims 1 to 5. Embodiment 13 The cell culture of embodiment 12, wherein the FGF is FGF-7. Embodiment 14. A method for the preparation of a medicament for use in a method for the treatment of a cancer, comprising contacting an ERBB tyrosine kinase receptor activating agent and an FGF. The cell culture of any one of embodiments 1 to 13, Embodiment 15. ERBB tyrosine kinase receptor activating agents and rho kinase 16. The cell culture of any one of embodiments 1 to 15, in contact with an inhibitor. Embodiment 16. ERBB tyrosine kinase receptor activating agents, FGF and rho 17. The cell culture of any one of embodiments 1-16, wherein the cell culture is in contact with a kinase inhibitor. Embodiment 17. An in vitro human pancreatic endoderm population. Embodiment 18. The method of embodiment 17, wherein the pancreatic endoderm cells are derived from pluripotent cells. Cell population. Embodiment 19. The pluripotent cells are human embryonic stem cells or dedifferentiated genetically reprogramming cells. 20. The cell population of embodiment 18, wherein the cell population is a cloned cell. Embodiment 20. The cell culture is contacted with an ERBB tyrosine kinase receptor activating agent. 20. The cell population according to any one of embodiments 17 to 19, Embodiment 21. The ERBB tyrosine kinase receptor activating agent is EGF (epithelial growth factor AREG (amphiregulin), TGF-alpha (transforming growth factor factor-alpha), Btc (betacellulin), HBEGF (heparin-binding EGF), E As described in embodiment 20, which is reg(epiregulin), neuregulin or heregulin. cell population. Embodiment 22. Pancreatic endoderm cells include pancreatic progenitor cells and multihormonal endocrine cells. A cell population according to any one of embodiments 17 to 21. Embodiment 23. Pancreatic progenitor cells express NKX6.1 but do not express CHGA. 23. The cell population of claim 22. Embodiment 24. As described in embodiment 22, the multihormonal endocrine cells express CHGA. cell population. Embodiment 25. An embodiment in which the pancreatic endoderm cells include CHGA positive and CHGA negative cells. The cell population according to any one of aspects 17 to 24. Embodiment 26. At least 30% of the pancreatic endoderm cells are CHGA-negative cells. The cell population according to any one of aspects 17 to 25. Embodiment 27. At least 50% of pancreatic endoderm cells are PDX1 positive. The cell population according to any one of 7 to 26. Embodiment 28. The ERBB tyrosine kinase receptor activating agent is heregulin-4. 21. The cell population of embodiment 20, Embodiment 29. The cell culture is contacted with fibroblast growth factor (FGF). 29. The cell population according to any one of 17 to 28. Embodiment 30 The cell population of embodiment 29, wherein the FGF is FGF-7. Embodiment 31. A cell culture comprising an ERBB tyrosine kinase receptor activating agent and F 31. The cell population of any one of embodiments 17-30, in contact with a GF. Embodiment 32. A cell culture comprising an ERBB tyrosine kinase receptor activating agent and The cell collection method according to any one of embodiments 17 to 30, which is in contact with a HO kinase inhibitor. Group. Embodiment 33. The cell culture is administered an ERBB tyrosine kinase receptor activating agent, FGF and a rho kinase inhibitor. cell population. Embodiment 34. Human pancreatic cancer in contact with an ERBB tyrosine kinase receptor activating agent An in vitro cell population comprising visceral endoderm cells. Embodiment 35. The method of embodiment 34, wherein the pancreatic endoderm cells are derived from pluripotent cells. Cell population. Embodiment 36. The pluripotent cells are human embryonic stem cells or dedifferentiated genetically reprogramming cells. 36. The cell population of embodiment 35, wherein the cell population is a cloned cell. Embodiment 37. The ERBB tyrosine kinase receptor activating agent is EGF (epithelial growth factor AREG (amphiregulin), TGF-alpha (transforming growth factor factor-alpha), Btc (betacellulin), HBEGF (heparin-binding EGF), E reg (epiregulin), neuregulin or heregulin, embodiments 34-36. 2. The cell population according to claim 1 . Embodiment 38. Pancreatic endoderm cells include pancreatic progenitor cells and multihormonal endocrine cells. A cell population according to any one of embodiments 34 to 37. Embodiment 39. Pancreatic progenitor cells express NKX6.1 but do not express CHGA. The cell population of embodiment 38. Embodiment 40. As described in embodiment 38, the multihormonal endocrine cells express CHGA. cell population. Embodiment 41. An embodiment in which the pancreatic endoderm cells include CHGA-positive and CHGA-negative cells. The cell population according to any one of aspects 34 to 40. Embodiment 42. At least 30% of the pancreatic endoderm cells are CHGA-negative cells. 42. The cell population according to any one of aspects 34 to 41. Embodiment 43. At least 50% of pancreatic endoderm cells are PDX1 positive. The cell population according to any one of 4 to 42. Embodiment 44. The ERBB tyrosine kinase receptor activating agent is heregulin-4. The cell population according to any one of embodiments 34 to 36. Embodiment 45. The human pancreatic endoderm cells are contacted with fibroblast growth factor (FGF). A cell population according to any one of embodiments 34 to 44. Embodiment 46 The cell population of embodiment 45, wherein the FGF is FGF-7. Embodiment 47. Human pancreatic endoderm cells are treated with an ERBB tyrosine kinase receptor activating agent. and FGF. Embodiment 48. Human pancreatic endoderm cells are treated with an ERBB tyrosine kinase receptor activating agent. and a rho kinase inhibitor, cell population. Embodiment 49. Human pancreatic endoderm cells are treated with an ERBB tyrosine kinase receptor activating agent. 49. Any one of embodiments 34 to 48, in contact with an FGF and a rho kinase inhibitor. 1. The cell population according to claim 1. Embodiment 50. A method for producing insulin, comprising: a. contacting a foregut endoderm cell with an ERBB tyrosine kinase receptor activating agent; thereby generating a cell population comprising pancreatic endoderm; b. The pancreatic endoderm of step (a) is transplanted and matured in vivo, thereby forming an in vitro pancreatic endoderm. obtaining insulin-secreting cells, the insulin-secreting cells being responsive to glucose stimulation; and secreting insulin. The method includes: Embodiment 51. A method for producing insulin, comprising: a. Foregut endoderm cells derived from dedifferentiated genetically reprogrammed cells Contacting the ERBB tyrosine kinase receptor activating agent in vitro, generating a cell population comprising endocrine and non-endocrine subpopulations by b. The subpopulation of step (a) is transplanted and matured in vivo, thereby forming an in vivo Obtaining phosphorus-secreting cells, wherein the insulin-secreting cells respond to glucose stimulation. The step of secreting insulin The method includes: Embodiment 52. A method for producing insulin, comprising: a. Transplanting and maturing pancreatic endoderm cells in vivo, thereby producing insulin secretion Obtaining cells, the insulin-secreting cells secreting insulin in response to glucose stimulation. The step of secreting The method includes: Embodiment 53. Pancreatic endoderm cells are foregut endoderm cells that are activated by ERBB tyrosine kinase receptor activity. 53. The method of embodiment 52, wherein the antibody is produced by contacting the antibody with a activating agent. Embodiment 54. The ERBB tyrosine kinase receptor activating agent is EGF (epithelial growth factor AREG (amphiregulin), TGF-alpha (transforming growth factor factor-alpha), Btc (betacellulin), HBEGF (heparin-binding EGF), E reg (epiregulin), neuregulin or heregulin, 53. The method according to any one of claims 1 to 53. Embodiment 55. The foregut endoderm cells are further contacted with fibroblast growth factor (FGF). , A method according to any one of embodiments 50 to 52 and 53 to 54. Embodiment 56 The method of embodiment 55, wherein the FGF is FGF-7. Embodiment 57. The embodiment in which the foregut endoderm cells are further contacted with a rho kinase inhibitor. 57. The method according to any one of aspects 50 to 52 and 53 to 56. Embodiment 58. The foregut endoderm cells are further contacted with a rho kinase inhibitor and FGF. The method according to any one of embodiments 50 to 52 and 53 to 57, Embodiment 59. The rho kinase inhibitor is Y-27632, fasudil, H-1152 P, Wf-536, Y-30141, ROCK antisense nucleic acid, RNA interference-inducing nucleic acid , competitive peptides, antagonist peptides, inhibitory antibodies, antibody-ScFV fragments, and their derivatives. selected from the group consisting of dominant negative variants, derivatives and expression vectors; The method according to any one of embodiments 57 to 58. Embodiment 60. The rho kinase inhibitor is Y-27632, fasudil, H-1152 P, Wf-536 and Y-30141 and their derivatives 60. The method according to any one of embodiments 57 to 59. Embodiment 61. The Rho kinase inhibitor is selected from the group consisting of Y-27632, fasudil and H-11 52P, and derivatives thereof. or one of the methods described above. Embodiment 62. The method of embodiment 50, wherein the pancreatic endoderm comprises endocrine and non-endocrine cell subpopulations. The method described. Embodiment 63. The embodiment in which the endocrine cell subpopulation is CHGA positive (CHGA+) cells. 62. The method according to claim 62. Embodiment 64. Embodiment 6, in which the non-endocrine cell subpopulation is CHGA negative (CHGA-). 2. The method according to claim 2. Embodiment 65. The method of embodiment 62, wherein the non-endocrine cell subpopulation expresses NKX6.1. method. Embodiment 66. At least 30% of the pancreatic endoderm is CHGA negative. The method described. Embodiment 67. At least 50% of the pancreatic endoderm is PDX1 positive. The method described. Embodiment 68. A method for producing insulin, comprising: a. Dedifferentiated genetically reprogrammed cells are transformed with TGFβ receptor family members. contacting the cells in vitro with a first medium containing an agent that activates the member; and, b. Stem cells were cultured in a second medium lacking an agent that activates TGF-β receptor family members. The cells of step (a) are cultured in vitro, thereby generating foregut endoderm cells. Tep and c. (b) contacting the foregut endoderm cells with an ERBB tyrosine kinase receptor activating agent thereby generating a cell population comprising endocrine and non-endocrine cell subpopulations. and, d. The cell population of (c) is transplanted in vivo and allowed to mature, thereby producing insulin. obtaining insulin-secreting cells, the insulin-secreting cells being capable of secreting insulin in response to glucose stimulation; A step of secreting phosphorus; The method includes: Embodiment 69. The non-endocrine cells are CHGA-negative (CHGA-) cells, embodiment 68. The method described above. Embodiment 70. The endocrine cells are CHGA positive (CHGA+) cells. 69. The method according to any one of claims 69 to 70. Embodiment 71. CHGA-negative (CHGA-) cells express NKX6.1. 69. The method according to claim 69. The foregut endoderm cells of embodiment 72(b) are contacted with a rho kinase inhibitor. 69. The method according to claim 69. The foregut endoderm cells of embodiment 73 (b) are contacted with FGF, as described in embodiment 69. method. The foregut endoderm cells of embodiment 74(b) are contacted with a rho kinase inhibitor and FGF. 70. The method of embodiment 69, wherein Embodiment 75. The rho kinase inhibitor is Y-27632, fasudil, H-1152 P, Wf-536, Y-30141, ROCK antisense nucleic acid, RNA interference-inducing nucleic acid , competitive peptides, antagonist peptides, inhibitory antibodies, antibody-ScFV fragments, and their derivatives. selected from the group consisting of dominant negative variants, derivatives and expression vectors; The method according to any one of embodiments 72 to 74. 76. Increasing the proportion of non-endocrine cells in a pancreatic endoderm cell population compared to endocrine cells. A method of adding Contacting foregut endoderm cells with an ERBB tyrosine kinase receptor activating agent; Increasing the proportion of non-endocrine cells in a pancreatic endoderm cell population. Embodiment 77 The method of embodiment 76, wherein the foregut endoderm cells are contacted with FGF. Embodiment 78. The method of embodiment 76, in which the foregut endoderm cells are contacted with a rho kinase inhibitor. The method described. Embodiment 79. The foregut endoderm cells are further contacted with FGF and a rho kinase inhibitor. 77. The method of embodiment 76, wherein Embodiment 80. A method for improving glucose responsiveness of transplanted pancreatic endoderm, comprising: Contacting foregut endoderm cells with an ERBB tyrosine kinase receptor activating agent; generating a cell population more comprising pancreatic endoderm; Pancreatic endoderm is transplanted and matured in vivo, thereby obtaining insulin-secreting cells. The step of: inducing insulin-secreting cells by inducing foregut endoderm cells with ERBB tyrosine kinase. Insulin derived from pancreatic endoderm produced without contact with a phospholipase receptor activating agent secrete insulin better than phosphorus-secreting cells; The method includes: Embodiment 81. Pancreatic endoderm cells are derived from dedifferentiated genetically reprogrammed cells. The method of embodiment 80, wherein the Embodiment 82. A method for producing insulin, comprising: (a) transfecting living cells with ERBB tyrosine kinase inhibitors; (b) contacting the cells with a kinase receptor activating agent at the end of step a. and maturing the cells to obtain insulin-secreting cells. and causing the insulin-secreting cells to secrete insulin in response to glucose stimulation. Embodiment 83. The living cells are foregut endoderm or PDX1-negative foregut endoderm. 2. The method according to claim 2. Embodiment 84. A living cell is derived from a dedifferentiated genetically reprogrammed cell. The method according to any one of embodiments 82 to 83, Embodiment 85. A cell population comprising endocrine and non-endocrine cell subpopulations. Embodiment 86. Endocrine and non-endocrine cell subpopulations are derived from pluripotent cells. 86. The cell population according to embodiment 85. Embodiment 87. The pluripotent cells are human embryonic stem cells or dedifferentiated genetically reprogramming cells. 87. The cell population of embodiment 86, wherein the cell population is a cloned cell. Embodiment 88. The ERBB tyrosine kinase receptor activating agent is EGF (epithelial growth factor AREG (amphiregulin), TGF-alpha (transforming growth factor factor-alpha), Btc (betacellulin), HBEGF (heparin-binding EGF), E reg (epiregulin), neuregulin or heregulin, embodiments 85-87. 2. The cell population according to claim 1 . Embodiment 89. Non-endocrine cells express NKX6.1 but do not express CHGA. 89. The cell population of any one of aspects 85 to 88. Embodiment 90. Any one of embodiments 85 to 89, wherein the endocrine cells express CHGA. The cell population described in Embodiment 91. At least 30% of the cells are CHGA-negative cells, embodiments 85-9. 10. The cell population according to any one of claims 1 to 9. Embodiment 92. The method of any one of embodiments 85 to 91, wherein at least 50% of the cells are PDX1 positive. The cell population according to any one of claims 1 to 4. Embodiment 93. The ERBB tyrosine kinase receptor activating agent is heregulin-4. The cell population according to any one of embodiments 85 to 92. Embodiment 94. The cell culture is contacted with fibroblast growth factor (FGF). 85. The cell population according to any one of claims 85 to 93. Embodiment 95 The cell population of embodiment 94, wherein the FGF is FGF-7. Embodiment 96. A cell culture comprising an ERBB tyrosine kinase receptor activating agent and F The cell population of any one of embodiments 85-95, in contact with a GF. Embodiment 97. A cell culture comprising an ERBB tyrosine kinase receptor activating agent and The cell collection of any one of embodiments 85 to 96, which is in contact with a ho kinase inhibitor. Group. Embodiment 98. The cell culture is administered an ERBB tyrosine kinase receptor activating agent, FGF and a rho kinase inhibitor, cell population. Embodiment 99. A method for producing insulin, comprising: (a) administering to a patient a genetically reproducible insulin-producing cell line that is dedifferentiated; The programmed cells were treated with an agent that activates TGFβ receptor family members. (b) contacting in vitro with a first medium containing a TGFβ receptor family member; Incubating the cells of step (a) in a second medium lacking a substance that activates the leukocytes. In vitro, the cells were cultured to identify at least foregut endoderm or at least PDX1-negative progenitor cells. (c) generating gut endoderm cells; and (b) inducing the cells of (b) to express ERBB tyrosine kinase receptors. and contacting the cells with a receptor-activating agent, thereby activating cells including endocrine and non-endocrine cell subpopulations. (d) generating a cell population from (c); and (d) transplanting the cell population from (c) in vivo and maturing the cells. thereby obtaining insulin-secreting cells, and secreting insulin in response to radioactivity stimulation. Embodiment 100. A method for producing insulin, comprising: (a) transfecting PDX1 positive cells with ER (b) contacting the cells of (a) with a BB tyrosine kinase receptor activating agent; The cell population is transplanted and matured in vivo to obtain insulin-secreting cells. The method comprises the steps of: (a) secreting insulin in response to glucose stimulation; and Embodiment 101. The method of claim 1, wherein a rho kinase inhibitor is added in step a, b or c. 99. The method of claim 68 or 99. Embodiment 102. A method according to the present invention, in which a rho kinase inhibitor is added in steps a, b and c. 99. The method of claim 68 or 99. Embodiment 103. An embodiment in which a rho kinase inhibitor is added in steps a and b. 68 or 99-100. Embodiment 104. The ERBB tyrosine kinase receptor activating agent is a compound according to any one of the preceding claims. The method of embodiment 68 or 99, further comprising step c. Embodiment 105. The ERBB tyrosine kinase receptor activating agent is a compound according to the method of claim 1, The method of embodiment 68 or 99, further comprising step c. Embodiment 106. The present invention relates to a method for maturing glucose-responsive insulin-secreting cells in vivo. The present invention relates to a method for generating a cell population capable of culturing at least foregut endoderm, at least PDX. A population of PDX1-negative foregut endoderm, or at least a population of PDX1-positive pancreatic endoderm cells, was isolated from the ER BB receptor tyrosine kinase activating agent, thereby Steps for generating a cell population capable of maturing into glucose-responsive insulin-secreting cells A method including: Embodiment 107. A method for generating pancreatic endoderm, comprising: a. contacting a foregut endoderm cell with an ERBB tyrosine kinase receptor activating agent; thereby generating a cell population comprising pancreatic endoderm. The method includes: Embodiment 108. Contacting foregut endoderm cells with fibroblast growth factor (FGF) 108. The method of embodiment 107, further comprising: Embodiment 109. The method of embodiment 108, wherein the FGF is FGF-7. Embodiment 110. The method further comprises contacting the foregut endoderm cells with a rho kinase inhibitor. 110. The method according to any one of embodiments 107 to 109. Embodiment 111. Contacting foregut endoderm cells with a rho kinase inhibitor and FGF The method of any one of embodiments 107 to 109, further comprising: Embodiment 112. At least 30% of the pancreatic endoderm is CHGA negative. 7. The method according to claim 111. Embodiment 113. At least 50% of pancreatic endoderm is PDX1 positive. 7. The method according to any one of claims 7 to 112. Embodiment 114. Foregut endoderm cells are derived from pluripotent cells, embodiments 50, 76, 107 to 113. Embodiment 115. The pluripotent cells are human embryonic stem cells or dedifferentiated genetically reprogrammable stem cells. The method according to any one of embodiments 50, 76, 107 to 114, wherein the cell is a cultured cell. Law. Embodiment 116. The pluripotent cells are human embryonic stem cells or dedifferentiated genetically reprogrammable stem cells. 2. The cell culture of embodiment 1, wherein the cell is a cultured cell. Embodiment 117. Differentiation derived from dedifferentiated genetically reprogrammed cells In vitro assays were performed using cells containing ERBB receptor tyrosine kinase activating agents. o Human pancreatic endoderm cell population. Embodiment 118. The ERRB receptor tyrosine kinase activating agent is an EGF growth factor or 118. The pancreatic endoderm cell population of embodiment 117, comprising a nucleosome or a ligand. Embodiment 119. The EGF growth factor or ligand is heregulin-1, heregulin-2 and a heregulin isoform selected from the group consisting of heregulin-3 and heregulin-4. The pancreatic endoderm cell population of embodiment 118, comprising a foam. Embodiment 120. The heregulin isoforms include heregulin-1 and heregulin-4. 120. The pancreatic endoderm cell population of embodiment 119, comprising: Embodiment 121. The embodiment in which the ligand heregulin isoform comprises heregulin-4. 120. The pancreatic endoderm cell population according to embodiment 119. Embodiment 122. A method for producing insulin, comprising: a. Foregut endoderm cell culture derived from dedifferentiated genetically reprogrammed cells contacting the culture in vitro with an ERBB receptor tyrosine kinase activating agent; thereby generating a cell population comprising endocrine cells and non-endocrine cell subpopulations. , b. maturing the subpopulation from step (a) in vivo, thereby producing insulin-secreting Obtaining cells, the insulin-secreting cells secreting insulin in response to glucose stimulation. Step 1: The method includes: Embodiment 123. The method further comprises contacting the foregut endoderm cell culture with a rho kinase inhibitor. 123. The method of embodiment 122, comprising: Embodiment 124. The rho kinase inhibitor is Y-27632, fasudil, H-115 2P, Wf-536, Y-30141, ROCK antisense nucleic acid, RNA interference induction Acids, competitive peptides, antagonist peptides, inhibitory antibodies, antibody-ScFV fragments, domino acids, The group consisting of anantagonistic variants, their derivatives and their expression vectors 124. The method of embodiment 123, wherein the method is selected from the group consisting of: Embodiment 125. The rho kinase inhibitor is Y-27632, fasudil, H-115 2P, Wf-536, Y-30141 and derivatives thereof; The method of embodiment 123. Embodiment 126. The Rho kinase inhibitor is Y-27632, fasudil, H-115 126. The method of embodiment 125, wherein the agonist is selected from the group consisting of 2P and derivatives thereof. Embodiment 127. A method for producing insulin, comprising: a. Dedifferentiated genetically reprogrammed cells are transformed with TGFβ receptor family members. contacting the cells in vitro with a first medium containing an agent that activates the member; and, b. Stem cells were cultured in a second medium lacking an agent that activates TGF-β receptor family members. The cells of step (a) are cultured in vitro, thereby generating foregut endoderm cells. Tep and c. Inducing the foregut endoderm cells of step (b) with an ERBB receptor tyrosine kinase activating agent. contacting the cells with a substrate, thereby generating a cell population comprising endocrine cells and non-endocrine cell subpopulations. and d. maturing the cell subpopulation of step (c) in vivo, thereby producing insulin. Obtaining insulin-secreting cells, the insulin-secreting cells being capable of secreting insulin in response to glucose stimulation. and secreting sulin. The method includes: Embodiment 128. The method of embodiment 1, in which the non-endocrine cells are CHGA-negative (CHGA-) cells. 27. The method according to claim 27. Embodiment 129. The endocrine cells are CHGA positive (CHGA+) cells. 7. The method according to claim 7. Embodiment 130. CHGA-negative (CHGA-) cells further express NKX6.1. The method of embodiment 127. Embodiment 131. The method further comprises contacting the foregut endoderm cells with a rho kinase inhibitor. 128. The method of embodiment 127. Embodiment 132. The rho kinase inhibitor is Y-27632, fasudil, H-115 2P, Wf-536, Y-30141, ROCK antisense nucleic acid, RNA interference induction Acids, competitive peptides, antagonist peptides, inhibitory antibodies, antibody-ScFV fragments, domino acids, The group consisting of anantagonistic variants, their derivatives and their expression vectors 132. The method of embodiment 131, wherein the method is selected from the group consisting of:

Claims

1. Differentiated cells and E cells derived from dedifferentiated genetically reprogrammed cells In vitro human pancreatic endoderm containing RBB receptor tyrosine kinase activating agent Cell population.

2. The ERRB receptor tyrosine kinase activating agent contains an EGF growth factor or ligand. The pancreatic endoderm cell population of claim 1 .

3. EGF growth factors or ligands include heregulin-1, heregulin-2 and heregulin Heregulin isoforms selected from the group consisting of heregulin-3 and heregulin-4, The pancreatic endoderm cell population of claim 2.

4. 3. The method of claim 2, wherein the heregulin isoforms include heregulin-1 and heregulin-4. A described pancreatic endoderm cell population.

5. 4. The intrapancreatic antibody of claim 3, wherein the ligand heregulin isoform comprises heregulin-4. Endodermal cell population.

6. 1. A method for producing insulin, comprising: a. Foregut endoderm cell culture derived from dedifferentiated genetically reprogrammed cells contacting the culture in vitro with an ERBB receptor tyrosine kinase activating agent; thereby generating a cell population comprising endocrine cells and non-endocrine cell subpopulations. 、 b. Maturating the subpopulation of step (a) in vivo, thereby enhancing insulin secretion. Obtaining cells, the insulin-secreting cells secreting insulin in response to glucose stimulation. and The method includes:

7. The method of claim 1, further comprising contacting the foregut endoderm cell culture with a rho kinase inhibitor.

6. The method according to claim 6.

8. Rho kinase inhibitors include Y-27632, fasudil, H-1152P, and Wf-53.

6. Y-30141, ROCK antisense nucleic acid, RNA interference-inducing nucleic acid, competitive peptide , antagonist peptide, inhibitory antibody, antibody-ScFV fragment, dominant negative variants thereof, derivatives thereof and expression vectors thereof. The method according to claim 7.

9. Rho kinase inhibitors include Y-27632, fasudil, H-1152P, and Wf-53. 6, Y-30141 and derivatives thereof. method.

10. Rho kinase inhibitors include Y-27632, fasudil, H-1152P and the like.

10. The method of claim 9, wherein the compound is selected from the group consisting of derivatives of

11. 1. A method for producing insulin, comprising: a. Dedifferentiated genetically reprogrammed cells are transformed with TGFβ receptor family members. contacting the cell in vitro with a first medium containing an agent that activates the cell member; and, b. Stem cells are cultured in a second medium lacking an agent that activates TGFβ receptor family members. The cells of step (a) are cultured in vitro to generate foregut endoderm cells. Tep and c. Treating the foregut endoderm cells of step (b) with an ERBB receptor tyrosine kinase activating agent contacting the cells with a substrate, thereby generating a cell population comprising endocrine cells and non-endocrine cell subpopulations. and d. The cell subpopulation of step (c) is matured in vivo, thereby producing insulin. Obtaining insulin-secreting cells, the insulin-secreting cells being capable of secreting insulin in response to glucose stimulation. and secreting sulin. The method includes:

12. The method of claim 11, wherein the non-endocrine cells are CHGA-negative (CHGA-) cells.

13. The method of claim 11, wherein the endocrine cells are CHGA positive (CHGA+) cells.

14. The method of claim 11, wherein the CHGA-negative (CHGA-) cells further express NKX6.

1. How to.

15. 12. The method of claim 11, further comprising contacting the foregut endoderm cells with a rho kinase inhibitor. The method described.

16. Rho kinase inhibitors include Y-27632, fasudil, H-1152P, and Wf-53.

6. Y-30141, ROCK antisense nucleic acid, RNA interference-inducing nucleic acid, competitive peptide , antagonist peptide, inhibitory antibody, antibody-ScFV fragment, dominant negative variants thereof, derivatives thereof and expression vectors thereof. The method according to claim 15.

Images