Detection method of detection target, monitoring method of waste water, detection kit for detection target and waste water monitoring kit

Abstract

To provide a detection method of a detection target, capable of detecting easily and in short time, a detection target in a sample.SOLUTION: A detection method includes a capturing step, a collecting step, and a gene detection step. The capturing step includes a sample contact step of bringing a sample which is a detection object, into contact with a scavenger. The scavenger is a composite body where an affinity substance is coupled to a magnetic carrier. The affinity substance has affinity to the detection object. The collecting step includes a step of using magnetism for collecting the scavenger. The gene detection step includes a gene amplification step of specifically amplifying genes of the detection object which is captured to the collected scavenger for detecting the genes. The gene amplification step is executed by an isothermal gene amplification method of a target sequence in a RNA genome (RICCA(RNA Isothermal Co-assisted and Coupled Amplification) reaction).SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] The present invention relates to a method for detecting a target substance, a method for monitoring wastewater, a kit for detecting a target substance, and a kit for monitoring wastewater. [Background technology]

[0002] In recent years, there have been outbreaks of RNA viral infections, such as human and avian influenza, as well as severe acute respiratory syndrome (SARS), and recently, the global infection (pandemic) caused by the novel coronavirus (SARS-CoV-2) has become a global issue. In predicting the spread of viral infections, attempts have been made to detect viruses contained in sewage (Non-Patent Document 1). Non-Patent Document 1 describes the sampling and analysis of sewage flowing into a sewage treatment plant, using a polyethylene glycol (PEG) precipitation method and other methods. [Prior art documents] [Non-patent literature]

[0003] [Non-Patent Document 1] Cabinet Secretariat COVID-19 and Other Infectious Diseases Countermeasures Promotion Office Ministry of Health, Labor and Welfare Ministry of Land, Infrastructure, Transport and Tourism, “Promotion Plan for Sewage Surveillance”, [online], November 16, 2021, [Retrieved April 26, 2023], Internet,<URL:https: / / corona.go.jp / surveillance / pdf / surveillance_plan_20211116.pdf> Summary of the Invention [Problem to be solved by the invention]

[0004] However, virus detection using the PEG precipitation method had the drawback of requiring labor to remove impurities from the sewage, which was time-consuming and labor-intensive.

[0005] Therefore, an object of the present invention is to provide a method for detecting a target substance, which can easily detect the target substance in a sample in a short period of time. [Means for solving the problem]

[0006] In order to achieve the above object, the method for detecting a detection target of the present invention comprises the steps of: The method includes a capture step, a collection step, and a gene detection step, The capture step includes a sample contact step of contacting a sample to be detected with a capture agent, The capture agent is a complex in which an affinity substance is bound to a magnetic carrier, the affinity substance has affinity for the detection target, the collecting step includes collecting the capture agent using a magnet; the gene detection step includes a gene amplification step of specifically amplifying and detecting the gene of the detection target captured by the collected capture agent, The gene amplification step is carried out by an isothermal gene amplification method of a target sequence in an RNA genome, The isothermal gene amplification method is a method for detecting a target substance, comprising the following steps: (A) an amplification reaction template generation step, (B) a DNA amplification step for increasing the amplification reaction template, and (C) an RNA amplification step: (A) the amplification reaction template generating step, which includes the following steps (A1) to (A3): (A1) a reverse transcription step of hybridizing a first primer, which includes a promoter sequence for RNA polymerase on its 5' side and a complementary sequence complementary to the sequence on the 5' side of the target sequence in the RNA genome on its 3' side, to the sequence on the 5' side of the target sequence in the RNA genome, and extending the 3' end of the first primer by reverse transcription activity of a reverse transcriptase to generate a complex double strand of the RNA genome and an extended DNA strand; (A2) a single-stranded DNA generating step of degrading the complex double-stranded RNA genome formed in (A1) by the RNA degradation activity of the reverse transcriptase to generate a single-stranded DNA containing the first primer; (A3) a double-stranded DNA generating step of hybridizing a second primer having the same sequence as the 3' sequence of the target sequence to a sequence complementary to the target sequence of the single-stranded DNA generated in the step (A2) and extending the 3' end of the second primer by the DNA synthesis activity of the reverse transcriptase to generate a single-stranded DNA containing the second primer, thereby generating a double-stranded DNA that is the amplification reaction template; (B) a DNA amplification step for increasing the amplification reaction template, comprising the following steps (B1) and (B2): (B1) a primer hybridization step in which, in the presence of a single-stranded DNA binding protein, the second primer is hybridized to the 3' side of the single-stranded DNA containing the first primer and the first primer is hybridized to the 3' side of the single-stranded DNA containing the second primer in the double-stranded DNA of the amplification reaction template of (A3) by a recombinase; (B2) a double-stranded DNA generating step of extending the 3' end of the first primer and the 3' end of the second primer by the strand-displacing DNA synthesis activity of a strand-displacing DNA polymerase in the presence of the single-stranded DNA binding protein to generate a double-stranded DNA identical to the amplification reaction template of (A3); (C) An RNA amplification step including the following steps (C1) to (C4): (C1) a single-stranded RNA synthesis step in which single-stranded RNA is synthesized using, as a template sequence, a sequence downstream of the 3'-side promoter sequence of the double-stranded DNA of the amplification reaction template of (A3) above, by the RNA synthesis activity of the RNA polymerase; (C2) a reverse transcription step of hybridizing the second primer to the 5' end of the single-stranded RNA of (C1) and extending the 3' end of the second primer by the reverse transcription activity of the reverse transcriptase to generate a complex double strand of the single-stranded RNA and an extended DNA; (C3) a step of degrading the single-stranded RNA of the complex double strand of (C2) by the RNA degradation activity of the reverse transcriptase to generate single-stranded DNA; (C4) a double-stranded DNA generating step in which the first primer is hybridized to the 3' side of the single-stranded DNA of (C3), the 3' end of the first primer is extended by the DNA synthesis activity of the reverse transcriptase, and the 3' end of the single-stranded DNA of (C3) is extended using the promoter sequence of the RNA polymerase of the first primer as a template, thereby generating a double-stranded DNA identical to the amplification reaction template generated in (A3).

[0007] The wastewater monitoring method of the present invention includes the above-mentioned method of the present invention for detecting a substance to be detected.

[0008] The detection kit of the present invention comprises: A capture agent and a gene detection agent, The gene detection agent includes a gene amplification agent, The gene amplification agent comprises the following (a1) to (a3), (b1) to (b3), and (c1): (a1) the reverse transcriptase; (a2) the first primer; (a3) the second primer; (b1) the recombinase; (b2) the single-stranded DNA binding protein; (b3) the strand-displacing DNA polymerase; (c1) the RNA polymerase: The present invention relates to a detection kit for detecting an object to be detected, the detection kit being used in the method for detecting an object to be detected of the present invention.

[0009] The wastewater monitoring kit of the present invention includes the above-mentioned detection kit for a substance to be detected of the present invention. Effect of the Invention

[0010] According to the present invention, a target substance in a sample can be easily detected in a short period of time. [Brief description of the drawings]

[0011]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

[0012] In the present invention, the "detection target" is not particularly limited, and examples thereof include viruses, proteins, bacteria, fungi, microorganisms, cells, and products produced by these.

[0013] In the present invention, the "virus" may be, for example, a DNA virus or an RNA virus. The virus may be, for example, an enveloped virus or a non-enveloped virus. Specific examples of the enveloped virus include tobamoviruses such as Pepper mild mottle virus (PMMoV); coronaviruses such as coronavirus 229E, coronavirus OC43, SARS-CoV, SARS-CoV-2, which is the causative virus of COVID-19, and MERS-CoV, which is the causative virus of MERS; flaviviruses such as hepatitis C virus, Japanese encephalitis virus, dengue fever virus, and Zika virus; orthomyxoviruses such as influenza A virus, influenza B virus, and influenza virus; togaviruses such as chikungunya virus and rubella virus; hepatitis D virus; paramyxoviruses such as measles virus and human respiratory syncytial virus (respiratory syncytial virus); rhabdoviruses such as rabies virus; filoviruses such as Ebola virus; herpesviruses such as varicella-zoster virus; monkeypox virus (Mpox virus); Examples of the non-enveloped virus include poxviruses such as smallpox virus, hepadnaviruses such as hepatitis B virus, and retroviruses such as human immunodeficiency virus. Specific examples of the non-enveloped virus include adenoviruses, human papillomaviruses, picornaviruses such as poliovirus and hepatitis A virus, caliciviruses such as norovirus, and reoviruses such as rotavirus.

[0014] In the present invention, the "bacteria" is not particularly limited, and may be, for example, Escherichia coli ( E. Coli ), Salmonella enterica ( Salmonella enterica ), Campylobacter jejuni ( Campylobacter jejuni ), Listeria monocytogenes ( Listeria monocytogenes ), Clostridioides difficile, etc.

[0015] In the present invention, the "microorganism" is not particularly limited, and can be, for example, Candida auris ( Candida auris) and other fungi; Cryptosporidium parvum ( Cryptosporidium ) and other parasitic protozoa; Giardia lamblia ( Giardia duodenalis ) and other parasitic flagellates;

[0016] In the present invention, the "sample to be detected" is not particularly limited, and may be, for example, a sample containing the object to be detected, a sample not containing the object to be detected, or a sample for which it is unclear whether it contains the object to be detected. A specific example of the sample is wastewater. Examples of the wastewater include household wastewater, industrial wastewater, wastewater from stores, wastewater from moving bodies such as airplanes, trains (e.g., bullet trains), and ships. The sample is not limited to the wastewater, and may be, for example, a biological sample such as saliva, nasal aspirate, nasal wash, nasal swab, nasal discharge, pharyngeal swab, rinse, whole blood, serum, plasma, sweat, or urine, or may be a specimen having viscosity. Examples of the specimen having viscosity include, but are not limited to, saliva, nasal aspirate, nasal wash, nasal swab, nasal discharge, pharyngeal swab, rinse, and the like. The specimen is not limited to a liquid specimen, and may be a solid specimen dissolved in a buffer solution or the like, and examples of the specimen include biological samples such as cells and feces, foods such as foods of animals and plants, and foods such as processed foods, etc. The buffer solution is not particularly limited, and examples of the buffer solution include the buffer solutions described below.

[0017] <Detection method for target substance> The method for detecting a target substance of the present invention will be described. The method for detecting a target substance of the present invention is characterized by including a capture step, a collection step, and a gene detection step, and other steps and conditions are not particularly limited.

[0018] As described above, the capture step is a step of contacting the sample to be detected with a capture agent, and the contact conditions are not particularly limited. The capture agent may be, for example, a capture agent that specifically binds to the target to be detected and captures a specific target to be detected, or a capture agent that captures multiple targets to be detected. The target to be detected is not particularly limited, and examples thereof include proteins, peptides, nucleic acids, microorganisms, hormones, abused drugs, extracellular vesicles, and the like derived from the target to be detected. The capture agent is, for example, a complex in which an affinity substance is bound to a magnetic carrier. The affinity substance has affinity for the target to be detected. In the complex, the magnetic carrier may be, for example, a magnetic porous hydrogel particle. The magnetic porous hydrogel particle may be, for example, a porous hydrogel particle encapsulating magnetic nanoparticles. The affinity substance is, for example, an affinity dye. The capture agent may be, for example, composed of the magnetic porous hydrogel particle and a porous shell that covers the magnetic porous hydrogel particle. Specific examples of the capture agent may be, for example, commercially available products. Examples of such products include Nanotrap (registered trademark) Microbiome Particles from Ceres Nanosciences. Specific examples include Nanotrap (registered trademark) Microbiome A Particles, which are suitable for capturing various viruses, such as influenza A virus, influenza B virus, respiratory syncytial virus, coronavirus 229E, coronavirus OC43, SARS-CoV-2, Zika virus, chikungunya virus, dengue fever virus, pepper mild mottle virus, hepatitis A virus, monkeypox virus, and norovirus GII. Nanotrap (registered trademark) Microbiome B Particles are suitable for capturing Escherichia coli, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Clostridioides difficile, Candida auris, Cryptosporidium parvum, and Giardia lamblia.When the capture agent is Nanotrap (registered trademark), for example, the capture step and the collection step described below may employ, for example, the protocol described in the instruction manual for the Nanotrap (registered trademark) Microbiome Particles used.

[0019] The collection step is, for example, as described above, immobilization of the capture agent using magnetism. The collection step may, for example, collect the capture agent using a magnet (which may be a permanent magnet or an electromagnet), or, if the capture agent is a magnetic bead, collect the capture agent using a magnetic body. The collection step may be performed, for example, as in the examples described below, but the virus collection step of the present invention is not limited to, for example, the methods in the examples.

[0020] The gene detection step includes a gene amplification step of specifically amplifying and detecting the gene of the detection target captured by the collected virus capture agent. The gene detection step may also include, for example, an amplified gene detection step of detecting the gene amplified in the gene amplification step.

[0021] The gene amplification step is also called, for example, an RNA Isothermal Co-assisted and Coupled Amplification (RICCA) reaction. The RICCA reaction can be carried out, for example, according to the description in Reference 1 below. Reference 1: Biyani, R.; Sharma, K.; Kojima, K.; Biyani, M.; Sharma, V.; Kumawat, T.; Juma, KM; Yanagihara, I.; Fujiwara, S.; Kodama, E.; Takamura, Y.; Takagi, M.; Yasukawa, K.; Biyani, M. Lab-Free Testing of RNA Viruses”. Sci. Rep. 2021, 11 (1), 15997. https: / / doi.org / 10.1038 / s41598-021-95411-x.

[0022] A specific example of the gene amplification step (RICCA reaction) will be described below. The gene amplification step is an isothermal gene amplification method for a target sequence in an RNA genome, and is characterized by including the following steps (A) of generating an amplification reaction template, (B) of amplifying a DNA for increasing the amplification reaction template, and (C) of amplifying an RNA, and other steps and conditions are not particularly limited. (A) the amplification reaction template generating step, which includes the following steps (A1) to (A3): (A1) a reverse transcription step of hybridizing a first primer, which includes a promoter sequence for RNA polymerase on its 5' side and a complementary sequence complementary to the sequence on the 5' side of the target sequence in the RNA genome on its 3' side, to the sequence on the 5' side of the target sequence in the RNA genome, and extending the 3' end of the first primer by reverse transcription activity of a reverse transcriptase to generate a complex double strand of the RNA genome and an extended DNA strand; (A2) a single-stranded DNA generating step of degrading the complex double-stranded RNA genome formed in (A1) by the RNA degradation activity of the reverse transcriptase to generate a single-stranded DNA containing the first primer; (A3) a double-stranded DNA generating step of hybridizing a second primer having the same sequence as the 3' sequence of the target sequence to a sequence complementary to the target sequence of the single-stranded DNA generated in the step (A2) and extending the 3' end of the second primer by the DNA synthesis activity of the reverse transcriptase to generate a single-stranded DNA containing the second primer, thereby generating a double-stranded DNA that is the amplification reaction template; (B) a DNA amplification step for increasing the amplification reaction template, comprising the following steps (B1) and (B2): (B1) a primer hybridization step in which, in the presence of a single-stranded DNA binding protein, the second primer is hybridized to the 3' side of the single-stranded DNA containing the first primer and the first primer is hybridized to the 3' side of the single-stranded DNA containing the second primer in the double-stranded DNA of the amplification reaction template of (A3) by a recombinase; (B2) a double-stranded DNA generating step of extending the 3' end of the first primer and the 3' end of the second primer by the strand-displacing DNA synthesis activity of a strand-displacing DNA polymerase in the presence of the single-stranded DNA binding protein to generate a double-stranded DNA identical to the amplification reaction template of (A3); (C) An RNA amplification step including the following steps (C1) to (C4): (C1) a single-stranded RNA synthesis step in which single-stranded RNA is synthesized using, as a template sequence, a sequence downstream of the promoter sequence on the 3' side of the double-stranded DNA serving as the amplification reaction template in (A3) by the RNA synthesis activity of an RNA polymerase; (C2) a reverse transcription step of hybridizing the second primer to the 5' end of the single-stranded RNA of (C1) and extending the 3' end of the second primer by the reverse transcription activity of the reverse transcriptase to generate a complex double strand of the single-stranded RNA and an extended DNA; (C3) a step of degrading the single-stranded RNA of the complex double strand of (C2) by the RNA degradation activity of the reverse transcriptase to generate single-stranded DNA; (C4) a double-stranded DNA generating step in which the first primer is hybridized to the 3' side of the single-stranded DNA of (C3), the 3' end of the first primer is extended by the DNA synthesis activity of the reverse transcriptase, and the 3' end of the single-stranded DNA of (C3) is extended using the promoter sequence of the RNA polymerase of the first primer as a template, thereby generating a double-stranded DNA identical to the amplification reaction template generated in (A3).

[0023] Hereinafter, (A) the amplification reaction template generation step, (B) the DNA amplification step for increasing the amount of the amplification reaction template, and (C) the RNA amplification step will be described in order.

[0024] The RNA genome may be, for example, a sense strand or an antisense strand, but is preferably a sense strand. When the RNA genome is a sense strand, for example, the specificity of gene amplification in the gene amplification step can be improved.

[0025] "Isothermal amplification method" generally refers to a method of performing a nucleic acid amplification reaction isothermally. In the gene amplification step, the conditions of the amplification reaction are not particularly limited, and can be appropriately determined by a person skilled in the art, for example. In the gene amplification step, the reaction temperature is not particularly limited, and is preferably set to a temperature near or below the melting temperature (Tm) of the primer, and further, it is preferable to set the stringency level in consideration of the melting temperature (Tm) of the primer. Specific examples of the reaction temperature include, for example, 33 to 47°C, 35°C to 45°C, and 37°C to 43°C. In the gene amplification step, the reaction time is not particularly limited, and can be appropriately determined by a person skilled in the art, for example. Specific examples of the reaction time include, for example, 5 to 60 minutes, 10 to 30 minutes, and 10 to 20 minutes. Since the specificity of the amplification in the gene amplification step can be improved, the reaction time is preferably, for example, 20 minutes or less.

[0026] The target sequence is, for example, a sequence to be amplified in the target RNA genome to be detected, and is not particularly limited. The length of the target sequence is not particularly limited, and is, for example, 100 to 400 bases long.

[0027] The first primer is, for example, a single-stranded polynucleotide, and is not particularly limited except that it contains a promoter sequence for RNA polymerase on its 5' side and a complementary sequence (hereinafter also referred to as a "target binding sequence") that is complementary to the sequence on the 5' side of the target sequence in the RNA genome on its 3' side. The first primer is, for example, capable of hybridizing to the sequence on the 5' side of the target sequence in the RNA genome under reaction conditions in the gene amplification step. In the first primer, the length of the target binding sequence is not particularly limited as long as it is capable of hybridizing to the sequence on the 5' side of the target sequence, and is, for example, 20 to 35 bases long. The first primer is, for example, an antisense primer when the RNA genome is a sense strand, and is a sense primer when the RNA genome is an antisense strand, but is preferably an antisense primer. When the RNA genome is a sense strand and the first primer is an antisense primer, for example, the specificity of gene amplification by the gene amplification step can be improved.

[0028] The first primers may, for example, all contain an RNA polymerase promoter sequence, or some of the first primers may contain an RNA polymerase promoter sequence. In the latter case, for example, the first primer not containing an RNA polymerase promoter sequence may have a first binding substance incorporated at its 5' end in the amplified gene detection step described later. Specifically, the first primer not containing an RNA polymerase promoter sequence may be, for example, a biotinylated first binding primer in which biotin is incorporated as the first binding substance. In this case, for example, the amplified product can be easily detected in the amplified gene detection step described later, which is preferable.

[0029] The base sequence of the target binding sequence of the first primer is not particularly limited and can be appropriately set according to the sequence of the target nucleic acid. The target binding sequence can be set, for example, by a conventionally known method, and is usually designed to hybridize to the nucleic acid under stringent conditions so that the target sequence in the RNA genome is included in the amplification product. The "stringent conditions" can be determined, for example, depending on the melting temperature Tm (°C) of the double strand of the first primer and its complementary strand, the salt concentration of the hybridization solution, and the like. As a specific example, see "Molecular Cloning: A Laboratory Manual 2nd Ed.," edited by Sambrook et al. [Cold Spring Harbor Laboratory Press (1989)] and the like. For example, when hybridization is performed at a temperature slightly lower than the melting temperature of the primer used, the primer can specifically hybridize to a nucleic acid having a target nucleic acid sequence. Such primers can be designed using commercially available primer construction software, such as Primer3 (manufactured by Whitehead Institute for Biomedical Research). The "stringent conditions" may be, for example, low stringent conditions, medium stringent conditions, or high stringent conditions. "Low stringent conditions" are, for example, 5×SSC, 5×Denhardt's solution, 0.5% SDS, 50% formamide, and 32°C. "Medium stringent conditions" are, for example, 5×SSC, 5×Denhardt's solution, 0.5% SDS, 50% formamide, and 42°C. "High stringent conditions" are, for example, 5×SSC, 5×Denhardt's solution, 0.5% SDS, 50% formamide, and 50°C. Those skilled in the art can set the degree of stringency by appropriately selecting conditions such as temperature, salt concentration, probe concentration and length, ionic strength, and time.The "stringent conditions" are, for example, those described in the above-mentioned "Molecular Cloning: A Laboratory Manual 2nd Edition" edited by Sambrook et al. nd Alternatively, the conditions described in, for example, "Cold Spring Harbor Laboratory Press (1989)" Ed. may be employed.

[0030] In the present invention, the basic skeleton of the first primer and the second primer described later is not particularly limited, and may be, for example, an oligonucleotide, a modified oligonucleotide, an oligonucleoside, a modified oligonucleoside, a polynucleotide, a modified polynucleotide, a polynucleoside, a modified polynucleoside, a DNA, a modified DNA, an RNA, a modified RNA, or a chimeric molecule thereof, or may be any other structure. The nucleic acid may be, for example, one that can form a base pair bond, and in the case of a nucleic acid sample or a target nucleic acid sequence, for example, it may function as a template for complementary chain synthesis. As the first primer and the second primer, the basic skeleton is preferably, for example, an oligonucleotide, a polynucleotide, a DNA, or a modified form thereof. In the present invention, the "nucleotide" may be, for example, either a deoxynucleotide or a ribonucleotide, and the "oligonucleotide" and the "polynucleotide" may be, for example, composed of either deoxynucleotide or ribonucleotide, or may contain both. In the present invention, the number of bases constituting the nucleic acid is not particularly limited. The term nucleic acid is generally synonymous with the term polynucleotide. The term "oligonucleotide" is generally used to refer to a polynucleotide having a particularly small number of bases. In general, a polynucleotide having a length of, for example, 2 to 100 bases, more generally, about 2 to 50 bases, is called an "oligonucleotide", but is not limited to these values. In the present invention, the term "polynucleotide" includes, for example, polynucleotides and oligonucleotides.

[0031] The promoter sequence of the RNA polymerase is a sequence specifically recognized by an RNA polymerase, and a known promoter sequence of an RNA polymerase can be used. Specific examples of the promoter sequence of the RNA polymerase include a T7 promoter sequence specifically recognized by a T7 RNA polymerase derived from bacteriophage T7, and an SP6 promoter sequence specifically recognized by an SP6 RNA polymerase derived from bacteriophage SP6. Specific examples of the T7 promoter sequence include a polynucleotide represented by the base sequence shown in SEQ ID NO: 1 (5'-aattctaatacgactcactatagggaga-3'). Specific examples of the SP6 promoter sequence include a polynucleotide represented by the base sequence shown in SEQ ID NO: 2 (5'-atttaggtgacactatagaa-3').

[0032] The reverse transcriptase is a DNA polymerase that transcribes (reverse transcribes) single-stranded RNA into single-stranded DNA, and is an enzyme having reverse transcription activity and RNA degradation activity. The reverse transcriptase is not particularly limited, and for example, a known reverse transcriptase can be used. Specific examples of the reverse transcriptase include M-MuLV reverse transcriptase, AMV reverse transcriptase, Transcriptor reverse transcriptase, SuperScript (registered trademark) Transcriptor reverse transcriptase, and MultiScribe reverse transcriptase.

[0033] The second primer is, for example, a single-stranded polynucleotide, and is not particularly limited except that it has the same sequence as the 3'-side sequence of the target sequence. The "having the same sequence as the 3'-side sequence of the target sequence" means, for example, that it has the same nucleotide sequence as the nucleotide sequence continuing from the 3'-end to the 5'-side in the target sequence in the RNA genome. The length of the second primer is not particularly limited, and is, for example, 15 to 30 bases long, 20 to 30 bases long, or 22 to 27 bases long. For example, when the RNA genome is a sense strand, the second primer is a sense primer, and when the RNA genome is an antisense strand, the second primer is an antisense primer, but is preferably a sense primer. When the RNA genome is a sense strand and the second primer is a sense primer, for example, the specificity of gene amplification by the gene amplification step can be improved.

[0034] The double-stranded DNA that is the amplification reaction template generated in the step (A3) is, for example, an amplification intermediate in the gene amplification method of the present invention, and is also called an amplicon or an amplification reaction template.

[0035] The recombinase is a protein that catalyzes a recombination reaction between homologous DNA sequences, and may be, for example, a known recombinase used in a general RPA (Recombinase Polymerase Amplification) method. Specific examples of the recombinase include UvsX recombinase derived from bacteriophage T4, Cre recombinase derived from bacteriophage P1, Flp recombinase derived from yeast, and integrase derived from bacteriophage φ31.

[0036] The single-stranded DNA-binding protein is a protein that specifically binds to single-stranded DNA, and is also called SSB (Single-strand DNA-binding protein). For example, a known single-stranded DNA-binding protein used in a general RPA (Recombinase Polymerase Amplification) method can be used as the single-stranded DNA-binding protein. Specific examples of the SSB include single-stranded DNA-binding proteins derived from Escherichia coli, Drosophila melanogaster, and Xenopus laevis, gene 32 protein derived from bacteriophage T4, and these proteins derived from other species.

[0037] The strand displacement DNA polymerase is a DNA synthesis enzyme capable of synthesizing a complementary strand while dissociating a double-stranded region in the extension direction during the process of synthesizing a DNA strand complementary to a template DNA, that is, a polymerase having a strand displacement ability (strand displacement activity). The strand displacement DNA polymerase may be, for example, a known strand displacement DNA polymerase used in a general RPA (Recombinase Polymerase Amplification) method. The strand displacement DNA polymerase may be, for example, any of ordinary, mesophilic, and thermostable. The strand displacement polymerase may be, for example, a naturally occurring enzyme, an enzyme prepared by genetic engineering, or a mutant enzyme artificially mutated. For example, a DNA polymerase is preferable as such a polymerase, and more preferably a DNA polymerase that does not substantially have 5'→3' exonuclease activity. Specific examples of the DNA polymerase having strand displacement ability include Bacillus stearothermophilus (B acillus stearothermophilus (hereinafter referred to as "B.st"), Bacillus caldotenax (hereinafter referred to as "B.ca"), Bacillus thermostearophilusThe DNA polymerases derived from thermophilic Bacillus bacteria, such as 5´→3´ exonuclease-depleted mutants of these, and those derived from E. coli ( E.coli )-derived DNA polymerase I and its Klenow fragment, etc. Other examples include Vent DNA polymerase, Vent (Exo-) DNA polymerase, DeepVent DNA polymerase, DeepVent (Exo-) DNA polymerase, Φ29 phage DNA polymerase, MS-2 phage DNA polymerase, Z-Taq DNA polymerase, Pfu DNA polymerase, Pfu turbo DNA polymerase, KOD DNA polymerase, 9°Nm DNA polymerase, Therminater DNA polymerase, Aac DNA polymerase, Gca DNA polymerase, Bsm DNA polymerase, etc.

[0038] The strand-displacing DNA polymerase may also be, for example, a DNA polymerase that also has reverse transcription activity. Examples of such strand-displacing DNA polymerase include BcaBEST DNA polymerase and Bca(exo-)DNA polymerase. With such a DNA polymerase, for example, reverse transcription reaction from total RNA or mRNA and DNA polymerase reaction using cDNA as a template can be performed with one type of polymerase. Also, a DNA polymerase and the reverse transcriptase such as MMLV reverse transcriptase can be used in combination.

[0039] In the gene amplification step, the RNA polymerase is, for example, a DNA polymerase that catalyzes a transcription reaction that reads the base sequence of a template strand of DNA and synthesizes a complementary RNA, and any known RNA polymerase can be used. Specific examples of the RNA polymerase include T7RNA polymerase derived from bacteriophage T7 and SP6RNA polymerase derived from bacteriophage SP6. The T7RNA polymerase shows specificity for the T7 promoter sequence.

[0040] Next, the gene amplification step will be described in detail with reference to Fig. 1. Fig. 1 is a schematic diagram showing the mechanism and main steps of the gene amplification step. In the following explanation, for example, a case where a T7 promoter sequence is used as the promoter sequence of the RNA polymerase and T7 RNA polymerase is used as the RNA polymerase will be described as an example, but the present invention is not limited thereto.

[0041] First, the (A) amplification reaction template generation step is carried out as shown in Fig. 1. Specifically, a first primer containing a T7 promoter sequence at the 5' end is hybridized to the 3' end of a target sequence of a target RNA genome, and the 3' end of the first primer is extended using reverse transcriptase to generate a complex double strand of the RNA genome and an extended DNA strand (A1, reverse transcription step).

[0042] Next, the RNA genome in the complex double strand is degraded by the RNA degradation activity of the reverse transcriptase to generate a single-stranded DNA containing the first primer (A2, single-stranded DNA generating step).

[0043] Then, a second primer having the same sequence as the 3' sequence of the target sequence is hybridized to a sequence complementary to the target sequence of the single-stranded DNA generated in step (A2), and the 3' end of the second primer is extended by the DNA synthesis activity of the reverse transcriptase to generate single-stranded DNA containing the second primer, thereby generating double-stranded DNA, which is the amplification reaction template (A3, double-stranded DNA generation step).

[0044] Next, the (B) DNA amplification step for increasing the amount of amplification reaction template and the (C) RNA amplification step shown in Fig. 1 are carried out. The (B) DNA amplification step and the (C) RNA amplification step will be described in order below. As shown in Fig. 1, the (B) DNA amplification step and the (C) RNA amplification step are steps in which the reactions proceed in parallel and are carried out in parallel. Note that the present invention is not limited thereto, and for example, either the (B) DNA amplification step or the (C) RNA amplification step may be carried out first.

[0045] The (B) DNA amplification step for increasing the amount of amplification reaction template first involves hybridizing the second primer to the 3' side of the single-stranded DNA containing the first primer and hybridizing the first primer to the 3' side of the single-stranded DNA containing the second primer in the double-stranded DNA of the amplification reaction template generated in (A3) by using a recombinase in the presence of a single-stranded DNA binding protein (B1, primer hybridization step).

[0046] Next, in the presence of the single-stranded DNA binding protein, the 3' end of the first primer and the 3' end of the second primer are extended by the strand-displacing DNA synthesis activity of the strand-displacing DNA polymerase to generate a double-stranded DNA identical to the amplification reaction template in (A3) (B2, double-stranded DNA generation step). Here, "synthesizing a double-stranded DNA identical to the amplification reaction template" means that the double-stranded DNA generated in step (B2) and the amplification reaction template generated in (A3) are substantially identical double-stranded DNA. The term "substantially identical" means, for example, that the sense strand and antisense strand of each of the double-stranded DNA generated in step (B2) and the amplification reaction template generated in (A3) can hybridize to the antisense strand and sense strand of the other, respectively. Specifically, the double-stranded DNA generated in the step (B2) and the amplification reaction template generated in the step (A3) may have a completely identical sequence (full match) or may have a sequence in which some bases are different (mismatch). The mismatch may be, for example, a sequence in which one of the two sequences is caused by at least one of deletion, substitution, and insertion of bases in the other sequence. The number of bases in the sequence that have been deleted, substituted, or inserted is preferably less than 10% of the total number of bases in the double-stranded DNA and the amplification reaction template, and it is particularly preferable that the sequence is completely identical, that is, no deletion, substitution, or insertion has occurred. In addition, the site in the sequence where deletion, substitution, or insertion has occurred is, for example, excluding the C-terminus of the sequence.

[0047] Thereafter, (B1) to (B2) are repeated using the double-stranded DNA generated in step (B2) that is the same as the amplification reaction template, until the reaction is terminated, to produce double-stranded DNA that is the same as the amplification reaction template.

[0048] The (C) RNA amplification step first involves synthesizing single-stranded RNA using the RNA synthesis activity of T7 RNA polymerase, using as a template the sequence 3' downstream of the T7 promoter in the double-stranded DNA of the amplification reaction template in (A3) (C1, single-stranded RNA synthesis step).

[0049] Next, the second primer is hybridized to the 5' end of the single-stranded RNA synthesized in (C1), and the 3' end of the second primer is extended by the reverse transcription activity of the reverse transcriptase to generate a complex double strand of the single-stranded RNA and the extended DNA (C2, reverse transcription step).

[0050] Next, the single-stranded RNA of the complex double strand generated in (C2) is degraded by the RNA degradation activity of the reverse transcriptase to generate single-stranded DNA (C3, single-stranded DNA generating step).

[0051] Then, the first primer is hybridized to the 3' side of the single-stranded DNA generated in (C3), the 3' end of the first primer is extended by the DNA synthesis activity of the reverse transcriptase, and the 3' end of the single-stranded DNA of (C3) is extended using the T7 promoter sequence of the first primer as a template to generate a double-stranded DNA identical to the amplification reaction template generated in (A3) (C4, double-stranded DNA generation step). Here, "synthesizing a double-stranded DNA identical to the amplification reaction template" means that the double-stranded DNA generated in step (C4) and the amplification reaction template generated in (A3) are substantially identical double-stranded DNA. The "substantially identical" means, for example, that the sense strand and antisense strand of each of the double-stranded DNA generated in step (C4) and the amplification reaction template generated in (A3) can hybridize to the antisense strand and sense strand of the other, respectively. Specifically, the double-stranded DNA generated in the step (C4) and the amplification reaction template generated in the step (A3) may have a completely identical sequence (full match) or may have a sequence in which some bases are different (mismatch). The mismatch may be, for example, a sequence in which one of the two sequences is caused by at least one of deletion, substitution, and insertion of bases in the other sequence. The number of bases in the sequence that have been deleted, substituted, or inserted is preferably less than 10% of the total number of bases in the double-stranded DNA and the amplification reaction template, and it is particularly preferable that the sequence is completely identical, that is, no deletion, substitution, or insertion has occurred. In addition, the portion in the sequence where deletion, substitution, or insertion has occurred is, for example, excluding the C-terminus of the sequence.

[0052] Thereafter, steps (C1) to (C4) are repeated using the double-stranded DNA generated in step (C4) that is the same as the amplification reaction template, until the reaction is terminated, to produce the single-stranded RNA and the double-stranded DNA that is the same as the amplification reaction template.

[0053] As described above, the key point of the gene amplification step is that the (B) DNA amplification step and the (C) RNA amplification step are combined. Thus, for example, when the (B) DNA amplification step and the (C) RNA amplification step are performed in parallel, it is presumed that the (B) DNA amplification step supplies a template, which is an amplification reaction intermediate (amplicon), and the efficiency of the (C) RNA amplification reaction is improved. However, the present invention is not limited to the above presumption.

[0054] Furthermore, the gene amplification step may include, for example, an RNA extraction step of extracting the RNA genome from a sample prior to carrying out the steps (A), (B), and (C). The sample may be, for example, a biological sample collected from a subject, or an environmental sample collected from the environment.

[0055] In the RNA extraction step, the RNA extraction method is not limited in any way, and any conventionally known method such as guanidine isothiocyanate and phenol-chloroform extraction can be used. Alternatively, a commercially available RNA extraction reagent can be used.

[0056] Next, the amplified gene detection step will be described. The amplified gene detection step is not particularly limited, and a known method for detecting an amplified gene, such as agarose gel electrophoresis, can be used, but it is preferable to perform the amplified gene detection step by the gene detection method described below. Specific examples of the amplified gene detection step will be described below, but the amplified gene detection step is not limited to the implementation of the gene detection method in the following examples. The amplified gene detection step may detect the amplified gene by, for example, performing quantification of the detection target. The quantification can be performed, for example, by real-time PCR, qPCR, sequencing by a next-generation sequencer (NGS), etc. In this case, the amplified gene detection step is also referred to as, for example, a quantification step of the detection target.

[0057] A specific example of the amplified gene detection step will be described. In the following description, in the gene amplification step, for example, one of the first primer and the second primer is a primer having an antigen incorporated at its 5' end that can specifically bind to an immobilized antibody immobilized on a substrate, and the other of the first primer and the second primer has a first conjugate incorporated at its 5' end. In the amplified gene detection step, the antigen of one of the primers of the gene amplification product generated in the gene amplification step binds to the immobilized antibody to immobilize the gene amplification product on the substrate, and the first conjugate of the other primer binds to a label containing a second conjugate that specifically binds to the first conjugate via the second conjugate, thereby immobilizing the label on the substrate, and detecting the label immobilized on the substrate.

[0058] The amplified gene detection step can refer to, for example, various steps, conditions, reagents, etc. in a general lateral flow immunoassay (LFIA). Specifically, the amplified gene detection step can be performed, for example, by the method shown in the Examples described below.

[0059] The antigen incorporated into the 5'-side of either the first primer or the second primer is not particularly limited, and may be any known antigen capable of forming an antigen-antibody complex with an immobilized antibody described below. A specific example of the antigen is digoxin. In the following description, the primer into which the antigen is incorporated out of the first primer and the second primer is also referred to as, for example, a labeled primer.

[0060] The binding between the 5' side of either the first primer or the second primer and the antigen may be, for example, a direct bond or an indirect bond. An example of the indirect bond is a bond via a linker.

[0061] The immobilized antibody is not particularly limited as long as it is, for example, an antibody capable of binding to the antigen bound to the first primer or the second primer, i.e., capable of forming the antigen-antibody complex. When the antigen is, for example, digoxin, the antibody is an anti-digoxin antibody. The method for immobilizing the immobilized antibody on the substrate is not particularly limited, and a conventionally known method can be used, for example, by applying an antibody liquid containing the immobilized antibody onto the porous body of the substrate using a coating device or the like, and air-drying the antibody using a dryer or the like.

[0062] The first binder is not particularly limited as long as it is a substance capable of specifically binding to the second binder described later, and examples thereof include biotin or a biotin analogue. Examples of the biotin analogue include desthiobiotin. In the following description, when the first binder is biotin, the primer into which the first binder is incorporated, among the first primer and the second primer, is also referred to as a biotinylated primer.

[0063] The bond between the 5' side of either the first primer or the second primer and the first conjugate may be, for example, a direct bond or an indirect bond. An example of the indirect bond is a bond via a linker.

[0064] The second binder is not particularly limited as long as it can specifically bind to the first binder, and when the first binder is biotin, the second binder may be, for example, avidin or an avidin analogue. Examples of the avidin analogue include streptavidin and neutravidin.

[0065] The label is, for example, a colored microparticle having the second binding entity fixed on the surface. The colored microparticle is not particularly limited, and examples thereof include colored latex particles, metal colloid particles, colored polymethyl methacrylate particles, colored polylactic acid particles, colored porous glass particles, colored silica particles, colored agarose particles, and colored dextran particles. The colored latex particles are not particularly limited, and examples thereof include blue latex particles and red latex particles. The metal colloid particles are not particularly limited, and examples thereof include gold colloid particles and platinum colloid particles. The average particle diameter of the colored microparticles is not particularly limited, and in the case of the colored latex particles, it is, for example, in the range of 0.05 μm to 5 μm, and preferably in the range of 0.1 μm to 1 μm, and in the case of the metal colloid particles, it is, for example, in the range of 2 nm to 100 nm, and preferably in the range of 10 nm to 50 nm.

[0066] The substrate may be, for example, a substrate used in a known lateral flow immunoassay. The substrate may, for example, comprise a support, a porous membrane that is a porous body, a conjugate pad, and a sample pad. The porous membrane, which is shorter than the support, is disposed on the support, the conjugate pad is disposed at one end on the surface of the porous membrane, and the sample pad is disposed at the other end of the conjugate pad opposite to the side where the porous membrane is disposed. The sample pad is a sample supplying section to which a sample containing the gene amplification product generated in the gene amplification step is supplied, and the sample pad side is the upstream side of the flow of the sample. On the surface of the porous membrane, a detection section to which the immobilized antibody is fixed is formed in order from the upstream side, and, for example, an absorption pad is disposed at the other end opposite to the side where the conjugate pad is disposed. The conjugate pad may be entirely placed on the porous membrane, or only a part of it may be placed on the porous membrane. Furthermore, the sample pad may be entirely placed on the conjugate pad, or only a portion of the sample pad may be placed on the conjugate pad.

[0067] The material of the support is not particularly limited, and examples thereof include polyethylene terephthalate, polyethylene, polystyrene, polyester, cellulose acetate, etc. The shape of the support is not particularly limited, and examples thereof include a film, a sheet, a plate, etc. The shape and size of the support are not particularly limited, and can be appropriately set depending on other configurations, etc.

[0068] The porous membrane is not particularly limited as long as it exhibits capillary action, and examples thereof include cellulose membrane, cellulose acetate, cellulose nitrate, and other cellulose derivative membranes, glass filters, and filter paper. In the present invention, the shape of the porous membrane is not particularly limited, and examples thereof include rectangular and circular shapes. In the present invention, the size of the porous membrane is not particularly limited and can be set appropriately. In the present invention, the porous body is not limited to the porous membrane, and may be, for example, granular substances or fine powders such as polymer beads, glass beads, titanium dioxide, cellulose, salts, and hydrophobized polysaccharides, and is not particularly limited as long as it has a porous structure. In the present invention, the shape and size of the porous body are not particularly limited and can be set appropriately. The porous membrane can be placed on the support by a conventional method, and specifically, it can be fixed on the support using double-sided tape or adhesive.

[0069] The material of the conjugate pad is not particularly limited, and examples thereof include polyethylene, glass fiber, rayon, nylon, paper, cellulose, etc. The shape and size of the conjugate pad are not particularly limited and can be appropriately set. The conjugate pad holds, for example, the labeling substance including the second conjugate.

[0070] The detection method of the present invention can, for example, rapidly and simply concentrate and collect the target substance in a sample by the capture step and the collection step. The existing method of concentrating the target substance (e.g., virus) using PEG precipitation requires a long period of time, about 3 to 7 days, for the treatment (concentration treatment) to make the virus detectable from sewage. In contrast, the detection method of the present invention can perform the capture step and the collection step in a short time of only about 20 to 30 minutes, as shown in the examples described below. In addition, in the detection method of the present invention, when the gene amplification step is, for example, the RICCA reaction, the gene amplification step can also be performed inexpensively and in a short time. Therefore, according to the detection method of the present invention, the target substance can be detected from a sample inexpensively and in a short time.

[0071] <Drainage monitoring method> As described above, the wastewater monitoring method of the present invention includes the detection method of the detection target of the present invention. The wastewater monitoring method of the present invention is characterized by, for example, including the detection method of the detection target of the present invention, and other configurations and steps are not particularly limited. The description of the detection method of the detection target of the present invention can be used for the wastewater monitoring method of the present invention. According to the wastewater monitoring method of the present invention, for example, wastewater can be easily monitored. According to the wastewater monitoring method of the present invention, for example, monitoring of the detection target (e.g., coronavirus) in wastewater can be easily performed. For example, by applying the wastewater monitoring method of the present invention to monitoring wastewater from a moving body such as an airplane, a train (e.g., a Shinkansen), or a ship, it is also possible to predict the spread of infectious diseases in the moving body such as an airplane.

[0072] <Detection kit for target substance> The target substance detection kit of the present invention (hereinafter, sometimes referred to as "the kit of the present invention") includes a capture agent and a gene detection agent, as described above. According to the target substance detection kit of the present invention, for example, the target substance detection method of the present invention can be easily and simply carried out. For the capture agent, for example, the description of the target substance detection method of the present invention can be used. The capture agent may include, for example, a commercially available reagent. For example, the commercially available reagent is Nanotrap (registered trademark) Microbiome Particles by Ceres Nanosciences.

[0073] The gene detection agent includes, for example, a gene amplification agent. The gene amplification agent includes, for example, the following (a1) to (a3), (b1) to (b3), and (c1). (a1) the reverse transcriptase; (a2) the first primer; (a3) the second primer; (b1) the recombinase; (b2) the single-stranded DNA binding protein; (b3) the strand-displacing DNA polymerase; (c1) the RNA polymerase.

[0074] The gene amplification agent is characterized by including the above (a1) to (a3), (b1) to (b3), and (c1), and other configurations and conditions are not particularly limited. The reverse transcriptase, the first primer, the second primer, the recombinase, the single-stranded DNA binding protein, the strand-displacing DNA polymerase, and the RNA polymerase are not particularly limited, and the description of the target detection method of the present invention can be used.

[0075] The kit of the present invention may include other configurations other than the above (a1) to (a3), (b1) to (b3), and (c1). The other configurations may include, for example, an instruction manual. The kit of the present invention may further include, for example, a substrate such as dNTP mix (dATP, dTTP, dCTP, dGTP); a buffer solution such as Tris-HCl buffer, Trisine buffer, sodium phosphate buffer, potassium phosphate buffer; a catalyst such as magnesium chloride, magnesium acetate, magnesium sulfate; an additive such as dimethyl sulfoxide (DMSO) or betaine (N,N,N-trimethylglycine); a cationic complex; an enzyme stabilizer, etc. The enzyme stabilizer is not particularly limited, and examples thereof include glycerol, bovine serum albumin, and sugars, among which sugars are preferred, and more preferably monosaccharides or oligosaccharides, and more preferably trehalose, sorbitol, or mannitol, or a mixture of two or more of these. The kit of the present invention may further include a melting temperature regulator. The melting temperature regulator may be, for example, DMSO, betaine, formamide, or glycerol, or any combination thereof, and is preferably DMSO. In the kit of the present invention, the ratio of these reagents is not particularly limited and can be appropriately determined by a person skilled in the art. The kit of the present invention may include, for example, a commercially available reagent, and a specific example of the commercially available reagent is, for example, Twist Amp (registered trademark) Basic kit (TwistDx).

[0076] In the kit of the present invention, the capture agent, the gene detection agent (the above (a1) to (a3), (b1) to (b3), and (c1)), and the other components and other reagents may be contained in separate containers or may be contained in the same container. The kit of the present invention can also be referred to as a target detection reagent for use in, for example, the detection method of the present invention for a target substance.

[0077] Furthermore, in the method for detecting a target substance of the present invention, when the gene amplification method includes the RNA extraction step, the kit of the present invention may further include, for example, a commercially available RNA extraction reagent.

[0078] The gene detection agent may include, for example, an amplified gene detection agent. The amplified gene detection agent includes, for example, (d1) to (d3). (d1) the immobilized antibody; (d2) substrate; (d3) Labeled object.

[0079] The reverse transcriptase, the first primer, the second primer, the recombinase, the single-stranded DNA binding protein, the strand-displacing DNA polymerase, the RNA polymerase, the immobilized antibody, the substrate, and the label are not particularly limited, and the descriptions of the method for detecting the target substance of the present invention can be cited.

[0080] <Drainage monitoring kit> As described above, the wastewater monitoring kit of the present invention includes the detection kit for a substance to be detected of the present invention. The wastewater monitoring kit of the present invention is characterized by, for example, including the detection kit for a substance to be detected of the present invention, and other configurations are not particularly limited. The description of the detection method and detection kit for a substance to be detected of the present invention can be used for the wastewater monitoring kit of the present invention. For example, the wastewater monitoring method of the present invention can be easily implemented by using the wastewater monitoring kit of the present invention. EXAMPLES

[0081] Next, examples of the present invention will be described. However, the present invention is not limited to the following examples. Commercially available reagents were used according to their protocols unless otherwise indicated.

[0082] [Example 1] It was confirmed that viruses can be detected by the detection method of the present invention for detecting a detection target substance.

[0083] (1) Sample preparation First, the virus (SARS-CoV-2, obtained from the American Type Culture Collection (ATCC)) was added to saline solution as the detection target to a concentration of 10,000 copies / ml, 1,000 copies / ml, or 100 copies / ml to create samples 1 to 3 (sample 1: 10,000 copies / ml, sample 2: 1,000 copies / ml, sample 3: 100 copies / ml).

[0084] (2) Examples Next, the target substance (virus) in the sample prepared in (1) above was detected by the target substance detection method of the present invention.

[0085] (2-1) Capture process The capture and collection steps were carried out using a Ceres Nanosciences Nanotrap (registered trademark) kit, following its protocol (APP-034, reference URL: https: / / www.ceresnano.com / _files / ugd / f7710c_215bb60d02c04572ae60153e24770650.pdf). First, 30 ml of each of Samples 1 to 3 was dispensed into a 50 ml conical tube using a syringe, and each sample was allowed to stand at room temperature (about 25°C) for 45 seconds. Next, 300 μl of Nanotrap (registered trademark) Enhancement Reagent 2 (ER2) was added to the conical tube containing each of Samples 1 to 3, and the mixture was thoroughly mixed for several seconds. Next, 150 μl of Nanotrap (registered trademark) Magnetic Virus Particles (a complex in which a virus-specific binding body is bound to a magnetic carrier) was added to the conical tube containing each mixed sample, and the particles were mixed by inverting 2 to 3 times. Next, the mixed samples 1 to 3 were incubated at room temperature (25° C.) for 10 minutes, during which they were inverted 2 to 3 times every 5 minutes. This allowed the viruses in the samples to come into contact with the complex and bind specifically.

[0086] (2-2) Collection process After (2-1), the tube was placed on a magnetic rack (IBA Lifesciences GmbH, Germany) to pellet the complex (magnetic virus particles bound to the detection target substance). The supernatant was discarded using a pipette without disturbing the pellet, and 500 μl of molecular grade water was added to the tube to resuspend the pellet. The suspension was transferred to a 1.5 ml microtube. Then, separation using a magnetic rack (MagneSphere® Technology Magnetic Separation Stands, Promega), removal of the supernatant, and resuspension were repeated to separate and collect the complex from the sample. Then, the supernatant in the tube was completely removed using a pipette without disturbing the pellet.

[0087] (2-3) Gene detection process (2-3-1) RNA extraction process (2-2) Nucleic acid (RNA) was extracted from the pellet obtained in the collection step. Specifically, 7 μl of 1×PBS and 23 μl of Buffer AVE of QIAamp Viral RNA Mini Kit were added to the pellets of Samples 1 to 3, respectively, and vortexed for 30 seconds. Then, the pellets were incubated at room temperature for 5 minutes and further incubated at 95° C. for 5 minutes to prepare the RNA template for each sample.

[0088] (2-3-2) Gene amplification process (A) DNA amplification step to increase the amplification reaction template Next, 5 μl of the RNA template, 10 μl of the substrate stock solution, 10 μl of the primer stock solution, and 5 μl of the enzyme stock solution were added to a PCR tube, and incubated at 41° C. for 30 minutes to prepare a reaction mixture.

[0089] The composition of the substrate stock solution was 17.6 μl of nuclease-free water (NFW), 5.6 μl of 1 M MgCl2, 19.8 μl of 1.9 M Tris HCl (pH 8.6), 0.6 μl of 40 U / μl RNase Inhibitor, 3.3 μl of 100 mM DTT, 41.3 μl of 2.0 mM dNTPs, 17.1 μl of 58 mM NTPs, and 4.8 μL of 250 mM ITP. The primer stock solution consisted of 32.5 μl of NFW, 21.5 μl of 2M KCl, 6.6 μl of 50 μM sense forward primer (forward primer 1), 6.6 μl of 50 μM antisense reverse primer (reverse primer 2) containing a T7 promoter in the 5' sequence, and 42.9 μl of dimethyl sulfoxide. The enzyme stock solution consisted of 4.0 μl of 10 mg / ml bovine serum albumin, 4.4 μl of 20,000 unit / ml AMV Reverse Transcriptase (Life sciences Inc, Petersburg, FL), 11.1 μl of 60% sorbitol, and 35.5 μl of T7 RNA Polymerase Solution (Toyobo).

[0090] The primer sequences used in the gene amplification process are shown below. In the base sequences of the primers shown below, the underlined sequence is the T7 promoter sequence. The primer set (forward primer 1 and reverse primer 2) was purchased from Eurofins Genomics, Tokyo, Japan. The primer set below is a sequence that targets the 28195-29358 region of the sequence of SARS-CoV-2 (MN908947.3) as an amplification target. Forward primer 1 (SEQ ID NO:3) 5´-GTTGTTCGTTCTATGAAGAC-3´ Reverse primer 2 (SEQ ID NO: 4) 5´- AATTCTAATACGACTCACTATAGGGAGA TCTGGTTACTGCCAGTTGAATCTG-3´

[0091] (B) DNA amplification process and (C) RNA amplification process The (B) DNA amplification step and (C) RNA amplification step were carried out using a commercially available reagent (TwistAmp (registered trademark) Basic kit (TwistDx, Cambridge, MA)). Specifically, each of the obtained amplification products was mixed with 5 μl of a probe mix (10 μM digoxin-modified probe and 10 μM biotin-modified probe) and 29.5 μl of a primer-free replacement buffer. Next, the dried enzyme pellet included in the TwistAmp (registered trademark) Basic kit was added to the mixed solution (49.5 μl) after the mixing, and 2.5 μl of 280 mM magnesium acetate was added to start the reaction, and the mixture was left at 41° C. for 10 minutes, and these were used as the amplification products of Examples 1-1, 1-2, and 1-3. Digoxin modified probe (SEQ ID NO:5) 5´-Digoxigenin-CGTTCTATGAAGACTTTTTAGAGTATCATG-3´ Biotin-modified probe (SEQ ID NO:6) 5´-CCAAATCAGCGAAATGCACCCCGCATTAC- Biotin-3´

[0092] (2-3-3) Amplified gene detection process Next, the amplification products of Examples 1-1, 1-2, and 1-3 were subjected to a lateral flow immunoassay using a lateral flow dipstick (LFD). The LFD was prepared by attaching a cover (manufactured by BioSeeds) having a sample addition section and a detection section to a substrate (lateral flow strip (manufactured by Asahi Kasei Corporation)) containing a conjugate pad containing gold colloid-labeled streptavidin and a membrane filter on which an anti-digoxin antibody was immobilized. Then, 5 μl of the amplification product or 5 μl of a negative control (amplified product not containing a genomic RNA sample) was added to 90 μL of NFW, and the mixture was added to the sample pad on the LFD strip. After that, the mixture was left to stand for 5 to 10 minutes, and the possibility of detection was judged based on the presence or absence of color development in the detection section of the LFD.

[0093] (3) Comparative Example Next, the detection method of the comparative example will be described. The detection method of the comparative example was the same as the detection method of the example, except that, for the samples 1 to 3 in (1) above, instead of the capture step (2-1) and the collection step (2-2), the sample was concentrated by the PEG precipitation method described in Reference 2 below, and the RNA extraction method was changed. Specifically, the detection method of the comparative example will be described. First, 40 ml of any of the samples 1 to 3, 4 g of PEG8000 (Wako Pure Chemical Industries, 593-09765), and 2.35 g of NaCl (Wako Pure Chemical Industries, 191-01665) were added to a 50 ml tube. Next, the mixture was placed in a shaker with a cooling function and incubated overnight at 4°C to equilibrate. Thereafter, the mixture was centrifuged at 10,000×g for 30 minutes, and the pellet after centrifugation was suspended in 500 μl of phosphate buffer, and the supernatant was discarded after centrifugation. Then, the pellet was left to stand at -80°C for one day. In the detection method of the comparative example, the sample was concentrated by PEG precipitation, so it took 2.5 days to carry out the gene detection process. Then, instead of the RNA extraction process of (2-3-1), the PEG suspension in phosphate buffer was subjected to RNA extraction treatment using the QIAamp Viral RNA Mini Kit, and the gene detection process (2-3) was carried out in the same manner to obtain the amplification products of Comparative Example 1-1, Comparative Example 1-2, and Comparative Example 1-3. Then, the possibility of detection was judged based on the presence or absence of color development in the detection section of the LFD. (Reference 2: "Manual for detecting novel coronavirus genes in sewage" by the Task Force of the Japan Society on Water Environment, Japan Sewage Works Innovation Institute, March 2021, URL:<https: / / www.jswe.or.jp / aboutus / pdf / SARS-CoV-2_RNA_Detection_Manual_for_Wastewater.pdf> )

[0094] (4) Detection results The detection results of the above-mentioned Examples (Example 1-1, Example 1-2, Example 1-3) and Comparative Examples (Comparative Example 1-1, Comparative Example 1-2, Comparative Example 1-3) are shown in FIG. 2. FIG. 2 is a photograph showing the results of a lateral flow immunoassay. In FIG. 2, each stick shows the results of Example 1-1, Example 1-2, Example 1-3, Comparative Example 1-1, Comparative Example 1-2, and Comparative Example 1-3 from the left. In FIG. 2, the detected target band is shown surrounded by a frame. As shown in FIG. 2, it was found that the detection method of the present invention can detect the detection target (virus). Also, as mentioned above, in the comparative example, it took 2.5 days for the PEG precipitation method from concentrating the sample to obtaining the detection result. In contrast, it was found that the detection method of the present invention requires about 15 minutes for the capture step and the collection step, and a total time until the detection result is obtained is 30 to 60 minutes.

[0095] (5) Quantification Furthermore, for each of Example 1-1, Example 1-2, Example 1-3, Comparative Example 1-1, Comparative Example 1-2, and Comparative Example 1-3, RT-qPCR was performed using a QuantStudio (registered trademark) 5 real-time PCR system (ThermoFisher). qPCR was performed using the following primer set and SuperScript (trademark) III Platinum (registered trademark) CellsDirect One-Step qRT-PCR Master Mix (Invitrogen -Thermo Fisher Scientific, USA) targeting the N1 and N2 genes of SARS-CoV-2. The reaction conditions were performed according to the attached protocol. Human RNase P was used as the endogenous control. The Ct value was determined by automatic setting using the software built into the qPCR device. CDC N1 Forward primer (SEQ ID NO: 7) 5´-GACCCCAAAATCAGCGAAAT-3´ CDC N1 Reverse primer (SEQ ID NO: 8) 5´-TCTGGTTACTGCCAGTTGAATCTG-3´ CDC N1 Probe primer (SEQ ID NO: 9) 5´-HEX-ACCCCGCATTACGTTTGGTGGACC-BHQ1-3´ The 5' end of the probe was labeled with HEX and the 3' end with BHQ1. CDC N2 Forward primer (SEQ ID NO: 10) 5´-TTACAAACATTGGCCGCAAA-3´ CDC N2 Reverse primer (SEQ ID NO: 11) 5´-GCGCGACATTCCGAAGAA-3´ Probe (SEQ ID NO: 12) 5´-Cy5-ACAATTTGCCCCAGCGCTTCAG-BHQ1-3´ The 5' end of the probe was labeled with Cy5, and the 3' end was labeled with BHQ1. Human RNaseP Forward primer (SEQ ID NO: 13) 5´-AGATTTGGACCTGCGAGCG-3´ Human RNaseP Reverse primer (SEQ ID NO: 14) 5´-GAGCGGCTGTCTCCACAAGT-3´ Probe (SEQ ID NO: 15) 5´-FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1-3´ The 5' end of the probe was labeled with FAM and the 3' end with BHQ1.

[0096] The amplification curve rising value (cycle threshold: Ct value) during amplification is shown in Table 1 below. Table 1 below shows the Ct value and the average value of three qPCR reactions performed for each sample. As shown in Table 1 below, Examples 1-1, 1-2, and 1-3 all had Ct values ​​similar to those of Comparative Examples 1-1, 1-2, and 1-3. Therefore, it was found that the object detection method of the present invention can detect an object with the same sensitivity as the comparative example (existing detection method). [Table 1]

[0097] [Example 2] It was confirmed that the method for detecting a detection target substance of the present invention can detect viruses from sewage.

[0098] In the above-mentioned Example 1 (1), samples of Example 2 (sample 1: 10,000 copies / ml, sample 2: 1,000 copies / ml, sample 3: 100 copies / ml) were prepared in the same manner as in the above-mentioned Example 1 (1), except that wastewater (collected in Kanazawa City) was used instead of physiological saline. Next, for the sample of Example 2, the amplification products of the examples and the amplification products of the comparative examples were obtained in the same manner as in the examples and comparative examples of Example 1, and the possibility of detection was determined by LFD. In Example 2, the samples treated by the object detection method of the present invention (each step of the above-mentioned Example 1 (2)) were designated as Examples 2-1, 2-2, and 2-3, and the materials treated by the comparative examples (each step of the above-mentioned Example 1 (3)) were designated as Comparative Examples 2-1, 2-2, and 2-3. In addition, the results of carrying out the detection method of the comparative examples using physiological saline instead of Samples 1 to 3 (mixture of wastewater and virus) were designated as negative controls. The results are shown in FIG. 3.

[0099] FIG. 3 is a photograph showing the results of the lateral flow immunoassay. In FIG. 3, each stick shows, from the left, the results of Example 2-1, Example 2-2, Example 2-3, Comparative Example 2-1, Comparative Example 2-2, Comparative Example 2-3, and the negative control. In FIG. 3, the detected target band is shown surrounded by a frame. As shown in FIG. 3, it was found that the detection method of the object of the present invention can detect the detection object (virus). Also, as described above, in the comparative example, it took 2.5 days for the PEG precipitation method from concentrating the sample to obtaining the detection result. In contrast, according to the detection method of the present invention, it was found that even if the sample is sewage, the capture step and collection step take about 15 minutes, and the total time until the detection result is obtained is 30 to 60 minutes.

[0100] Furthermore, for Examples 2-1, 2-2, and 2-3, RT-qPCR was performed using a mobile real-time PCR device PicoGene (registered trademark) PCR 1100 (Nippon Sheet Glass Co., Ltd.). For Comparative Examples 2-1, 2-2, and 2-3, RT-qPCR was performed using the mobile real-time PCR device PicoGene (registered trademark) PCR 1100 and QuantStudio (registered trademark) 5 Real-time PCR System (ThermoFisher). qPCR was performed using the following primer set and SuperScript (trademark) III Platinum (registered trademark) CellsDirect One-Step qRT-PCR Master Mix (Invitrogen -Thermo Fisher Scientific, USA) targeting the N1 and N2 genes of SARS-CoV-2. The reaction conditions were performed according to the attached protocol. The endogenous x control was human RNaseP. The Ct value was determined by automatic setting using the software built into the qPCR device. CDC N1 Forward primer (SEQ ID NO: 7) 5´-GACCCCAAAATCAGCGAAAT-3´ CDC N1 Reverse primer (SEQ ID NO: 8) 5´-TCTGGTTACTGCCAGTTGAATCTG-3´ CDC N1 Probe primer (SEQ ID NO: 9) 5´-HEX-ACCCCGCATTACGTTTGGTGGACC-BHQ1-3´ The 5' end of the probe was labeled with HEX and the 3' end with BHQ1. CDC N2 Forward primer (SEQ ID NO: 10) 5´-TTACAAACATTGGCCGCAAA-3´ CDC N2 Reverse primer (SEQ ID NO: 11) 5´-GCGCGACATTCCGAAGAA-3´ Probe (SEQ ID NO: 12) 5´-Cy5-ACAATTTGCCCCAGCGCTTCAG-BHQ1-3´ The 5' end of the probe was labeled with Cy5, and the 3' end was labeled with BHQ1. Human RNaseP Forward primer (SEQ ID NO: 13) 5´-AGATTTGGACCTGCGAGCG-3´ Human RNaseP Reverse primer (SEQ ID NO: 14) 5´-GAGCGGCTGTCTCCACAAGT-3´ Probe (SEQ ID NO: 15) 5´-FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1-3´ The 5' end of the probe was labeled with FAM and the 3' end with BHQ1.

[0101] The results are shown in FIG. 4. FIG. 4 is a graph showing the qPCR results of the amplification products of the examples (Example 2-1, Example 2-2, Example 2-3). As shown in FIG. 4, the detection method of the detection target of the present invention was able to detect viral RNA using any sample. In addition, the amplification curve rise value (cycle threshold: Ct value) during amplification in Example 2-1 and Example 2-2 and Comparative Example 2-1 and Comparative Example 2-2 is shown in Table 2 below. As shown in Table 2 below, both Example 2-1 and Example 2-2 had Ct values ​​similar to Comparative Example 2-1 and Comparative Example 2-2. Therefore, it was found that the target detection method of the present invention can detect the target with the same sensitivity as the comparative example (existing detection method). In addition, as shown in Table 2 below, it was found that the difference in Ct value due to the difference in qPCR device was small. Therefore, it was found that the target can be detected more quickly by using PicoGene (registered trademark) 1100 when performing quantification. [Table 2]

[0102] [Example 3] It was confirmed that the method for detecting a detection target substance of the present invention can detect viruses in sewage.

[0103] As samples for virus detection, sewage samples were obtained from three locations ((A), (B), and (C)) in Kanazawa City. The obtained sewage samples were stored at -80°C until testing. The obtained sewage samples were dispensed into 50 ml conical tubes in 30 ml portions using a syringe, and each sample was left to stand at room temperature (about 25°C) for 45 seconds to prepare sewage samples (A), (B), and (C). In addition, as a control, a sample was prepared by adding a virus (SARS-CoV-2, obtained from the American Type Culture Collection (ATCC)) to the sewage sample (A) so that the concentration was 100,000 copies / ml. Next, the sewage samples (A), (B), and (C) and the control sample were subjected to the same procedure as in Example 1 to obtain the amplification products of Example 3 (amplification product A, amplification product B, amplification product C, and control). Then, RT-qPCR was performed on the amplification products of Example 3 (amplification product A, amplification product B, amplification product C, and control) using a mobile real-time PCR device PicoGene (registered trademark) PCR 1100 (Nippon Sheet Glass Co., Ltd.). qPCR was performed using the following primer set and SuperScript (trademark) III Platinum (registered trademark) CellsDirect One-Step qRT-PCR Master Mix (Invitrogen - Thermo Fisher Scientific, USA) targeting the N1 and N2 genes of SARS-CoV-2. The reaction conditions were performed according to the protocol for SuperScript (trademark) III Platinum (registered trademark) CellsDirect One-Step qRT-PCR Master Mix. In addition, to confirm the fecal concentration in the sewage, the endogenous control was Pepper mild mottle virus (PMMoV). CDC N1 Forward primer (SEQ ID NO: 7) 5´-GACCCCAAAATCAGCGAAAT-3´ CDC N1 Reverse primer (SEQ ID NO: 8) 5´-TCTGGTTACTGCCAGTTGAATCTG-3´ CDC N1 Probe primer (SEQ ID NO: 9) 5´-HEX-ACCCCGCATTACGTTTGGTGGACC-BHQ1-3´ The 5' end of the probe was labeled with HEX and the 3' end with BHQ1. CDC N2 Forward primer (SEQ ID NO: 10) 5´-TTACAAACATTGGCCGCAAA-3´ CDC N2 Reverse primer (SEQ ID NO: 11) 5´-GCGCGACATTCCGAAGAA-3´ Probe (SEQ ID NO: 12) 5´-Cy5-ACAATTTGCCCCAGCGCTTCAG-BHQ1-3´ The 5' end of the probe was labeled with Cy5, and the 3' end was labeled with BHQ1. PMMoV Forward primer (SEQ ID NO: 16) 5´-GAGTGGTTTGACCTTAACGTTTGA-3´ PMMoV Reverse primer (SEQ ID NO: 17) 5´-TTGTCGGTTGCAATGCAAGT-3´ Probe (SEQ ID NO: 18) 5´-FAM-CCTACCGAAGCAAATG-MGBEQ-3´ The 5' end of the probe was labeled with FAM and the 3' end with MGBEQ.

[0104] The quantitative results are shown in FIG. 5, and the amplification curve rise values ​​(cycle threshold: Ct value) during amplification are shown in Table 3 below. FIG. 5 is a graph showing the qPCR results of the amplification products of the examples (Example 3-1, Example 3-2, Example 3-3, and the control), and Table 3 shows the amplification curve rise values ​​(cycle threshold: Ct value) during amplification. As shown in FIG. 5 and Table 3, the virus was detectable in all sewage samples. Therefore, it was found that the target detection method of the present invention can detect the target to be detected from a sewage sample. [Table 3]

[0105] Although the present invention has been described above with reference to the embodiment and examples, the present invention is not limited to the above embodiment. Various modifications that can be understood by those skilled in the art can be made to the configuration and details of the present invention within the scope of the present invention.

[0106] <Additional Notes> Some or all of the above embodiments may be described as follows, but are not limited to the following supplementary notes. (Appendix 1) The method includes a capture step, a collection step, and a gene detection step, The capture step includes a sample contact step of contacting a sample to be detected with a capture agent, The capture agent is a complex in which an affinity substance is bound to a magnetic carrier, the affinity substance has affinity for the detection target, the collecting step includes collecting the capture agent using a magnet; the gene detection step includes a gene amplification step of specifically amplifying and detecting the gene of the detection target captured by the collected capture agent, The gene amplification step is carried out by an isothermal gene amplification method of a target sequence in an RNA genome, The isothermal gene amplification method is a method for detecting a target substance, comprising the following steps: (A) an amplification reaction template generation step, (B) a DNA amplification step for increasing the amplification reaction template, and (C) an RNA amplification step: (A) the amplification reaction template generating step, which includes the following steps (A1) to (A3): (A1) a reverse transcription step of hybridizing a first primer, which includes a promoter sequence for RNA polymerase on its 5' side and a complementary sequence complementary to the sequence on the 5' side of the target sequence in the RNA genome on its 3' side, to the sequence on the 5' side of the target sequence in the RNA genome, and extending the 3' end of the first primer by reverse transcription activity of a reverse transcriptase to generate a complex double strand of the RNA genome and an extended DNA strand; (A2) a single-stranded DNA generating step of degrading the complex double-stranded RNA genome formed in (A1) by the RNA degradation activity of the reverse transcriptase to generate a single-stranded DNA containing the first primer; (A3) a double-stranded DNA generating step of hybridizing a second primer having the same sequence as the 3' sequence of the target sequence to a sequence complementary to the target sequence of the single-stranded DNA generated in the step (A2) and extending the 3' end of the second primer by the DNA synthesis activity of the reverse transcriptase to generate a single-stranded DNA containing the second primer, thereby generating a double-stranded DNA that is the amplification reaction template; (B) a DNA amplification step for increasing the amplification reaction template, comprising the following steps (B1) and (B2): (B1) a primer hybridization step in which, in the presence of a single-stranded DNA binding protein, the second primer is hybridized to the 3' side of the single-stranded DNA containing the first primer and the first primer is hybridized to the 3' side of the single-stranded DNA containing the second primer in the double-stranded DNA of the amplification reaction template of (A3) by a recombinase; (B2) a double-stranded DNA generating step of extending the 3' end of the first primer and the 3' end of the second primer by the strand-displacing DNA synthesis activity of a strand-displacing DNA polymerase in the presence of the single-stranded DNA binding protein to generate a double-stranded DNA identical to the amplification reaction template of (A3); (C) An RNA amplification step including the following steps (C1) to (C4): (C1) a single-stranded RNA synthesis step in which single-stranded RNA is synthesized using, as a template sequence, a sequence downstream of the 3'-side promoter sequence of the double-stranded DNA of the amplification reaction template of (A3) above, by the RNA synthesis activity of the RNA polymerase; (C2) a reverse transcription step of hybridizing the second primer to the 5' end of the single-stranded RNA of (C1) and extending the 3' end of the second primer by the reverse transcription activity of the reverse transcriptase to generate a complex double strand of the single-stranded RNA and an extended DNA; (C3) a step of degrading the single-stranded RNA of the complex double strand of (C2) by the RNA degradation activity of the reverse transcriptase to generate single-stranded DNA; (C4) a double-stranded DNA generating step in which the first primer is hybridized to the 3' side of the single-stranded DNA of (C3), the 3' end of the first primer is extended by the DNA synthesis activity of the reverse transcriptase, and the 3' end of the single-stranded DNA of (C3) is extended using the promoter sequence of the RNA polymerase of the first primer as a template, thereby generating a double-stranded DNA identical to the amplification reaction template generated in (A3). (Appendix 2) In the complex, the magnetic carrier is a magnetic porous hydrogel particle. A method for detecting an object to be detected as described in appendix 1. (Appendix 3) The affinity substance is an affinity dye. A method for detecting a detection target substance according to appendix 1 or 2. (Appendix 4) The capture agent is composed of the magnetic porous hydrogel particles and a porous shell covering the magnetic porous hydrogel particles. A method for detecting a detection target substance according to appendix 2 or 3. (Appendix 5) The sample is a wastewater, The detection target is at least one of a virus and a microorganism in the wastewater. A method for detecting a detection target substance according to any one of appendix 1 to 4. (Appendix 6) the promoter sequence of an RNA polymerase contained in the first primer is a T7 promoter sequence; 6. The method for detecting a target substance according to any one of claims 1 to 5, wherein the RNA polymerase is T7 RNA polymerase. (Appendix 7) the RNA genome is a sense strand, the first primer is an antisense primer, and the second primer is a sense primer; A method for detecting a detection target substance according to any one of appendix 1 to 6. (Appendix 8) the gene detection step includes an amplified gene detection step of detecting the gene amplified in the gene amplification step, In the gene amplification step, one of the first primer and the second primer has an antigen incorporated at its 5' end that is capable of specifically binding to an immobilized antibody immobilized on a substrate, and the other of the first primer and the second primer has a first binding entity incorporated at its 5' end; In the amplified gene detection step, the antigen of the one primer of the gene amplification product generated in the gene amplification step binds to the immobilized antibody, and the gene amplification product is immobilized on the substrate, and the first conjugate of the other primer binds to a label containing a second conjugate that specifically binds to the first conjugate via the second conjugate, thereby immobilizing the label on the substrate, and the label immobilized on the substrate is detected. A method for detecting a detection target substance according to any one of appendix 1 to 7. (Appendix 9) The first binder is biotin, the second binder is streptavidin, and the label is a colored microparticle having the streptavidin immobilized on its surface. A method for detecting an object to be detected as described in Appendix 8. (Appendix 10) A wastewater monitoring method including the method for detecting a detection target substance according to any one of appendices 1 to 9. (Appendix 11) The capture agent and a gene detection agent are included, The gene detection agent includes a gene amplification agent, The gene amplification agent comprises the following (a1) to (a3), (b1) to (b3), and (c1): (a1) the reverse transcriptase; (a2) the first primer; (a3) the second primer; (b1) the recombinase; (b2) the single-stranded DNA binding protein; (b3) the strand-displacing DNA polymerase; (c1) the RNA polymerase: A detection kit for use in the method for detecting an object to be detected according to any one of appendices 1 to 9. (Appendix 12) 12. The target substance detection kit according to claim 11, wherein the capture agent comprises a complex in which an affinity substance is bound to the magnetic carrier. (Appendix 13) 13. The target substance detection kit according to claim 12, wherein in the complex, the magnetic carrier is a magnetic porous hydrogel particle. (Appendix 14) 14. The target substance detection kit according to claim 12 or 13, wherein the affinity substance is an affinity dye. (Appendix 15) A detection kit for a target substance according to claim 13 or 14, wherein the capture agent is composed of the magnetic porous hydrogel particles and a porous shell covering the magnetic porous hydrogel particles. (Appendix 16) The gene detection agent includes an amplified gene detection agent, and the amplified gene detection agent includes the following (d1) to (d3), and the detection kit for a target substance according to any one of Supplementary Notes 11 to 15 is used in the detection method for a target substance according to Supplementary Note 8 or 9: (d1) the immobilized antibody; (d2) substrate; (d3) Labeled object. (Appendix 17) A wastewater monitoring kit comprising the detection kit for detecting a detection target substance according to any one of appendixes 11 to 16. [Industrial Applicability]

[0107] According to the present invention, a target substance in a sample can be easily detected in a short time, and therefore the present invention is extremely useful in the fields of medicine, public health, and the like.

Claims

1. The method includes a capture step, a collection step, and a gene detection step, The capture step includes a sample contact step of contacting a sample to be detected with a capture agent, The capture agent is a complex in which an affinity substance is bound to a magnetic carrier, The affinity substance has affinity for a detection target substance, the collecting step includes collecting the capture agent using a magnet; the gene detection step includes a gene amplification step of specifically amplifying and detecting the gene of the detection target captured by the collected capture agent, The gene amplification step is carried out by an isothermal gene amplification method of a target sequence in an RNA genome, The isothermal gene amplification method is a method for detecting a target substance, comprising the following steps: (A) an amplification reaction template generation step, (B) a DNA amplification step for increasing the amplification reaction template, and (C) an RNA amplification step: (A) the amplification reaction template generating step, which includes the following steps (A1) to (A3): (A1) a reverse transcription step of hybridizing a first primer, which includes a promoter sequence for RNA polymerase on the 5' side and a complementary sequence complementary to the 5' side sequence of the target sequence in the RNA genome on the 3' side, to the sequence on the 5' side of the target sequence in the RNA genome, and extending the 3' end of the first primer by reverse transcription activity of a reverse transcriptase to generate a complex double strand of the RNA genome and an extended DNA strand; (A2) a single-stranded DNA generating step of degrading the RNA genome of the complex double strand formed in (A1) by the RNA degradation activity of the reverse transcriptase to generate a single-stranded DNA containing the first primer; (A3) a double-stranded DNA generating step of hybridizing a second primer having the same sequence as the 3' sequence of the target sequence to a sequence complementary to the target sequence of the single-stranded DNA generated in the step (A2) and extending the 3' end of the second primer by the DNA synthesis activity of the reverse transcriptase to generate a single-stranded DNA containing the second primer, thereby generating a double-stranded DNA that is the amplification reaction template; (B) a DNA amplification step for increasing the amplification reaction template, comprising the following steps (B1) and (B2): (B1) a primer hybridization step in which, in the presence of a single-stranded DNA binding protein, the second primer is hybridized to the 3' side of the single-stranded DNA containing the first primer and the first primer is hybridized to the 3' side of the single-stranded DNA containing the second primer in the double-stranded DNA of the amplification reaction template of (A3) by a recombinase; (B2) a double-stranded DNA generating step of extending the 3′ end of the first primer and the 3′ end of the second primer by the strand-displacing DNA synthesis activity of a strand-displacing DNA polymerase in the presence of the single-stranded DNA binding protein to generate a double-stranded DNA identical to the amplification reaction template of (A3); (C) an RNA amplification step including the following steps (C1) to (C4): (C1) a single-stranded RNA synthesis step of synthesizing single-stranded RNA using, as a template sequence, a sequence downstream of the 3'-side promoter sequence of the RNA polymerase in the double-stranded DNA serving as the amplification reaction template in (A3) above, by the RNA synthesis activity of the RNA polymerase; (C2) a reverse transcription step of hybridizing the second primer to the 5' side of the single-stranded RNA of (C1) and extending the 3' end of the second primer by the reverse transcription activity of the reverse transcriptase to generate a complex double strand of the single-stranded RNA and extended DNA; (C3) degrading the single-stranded RNA of the complex double strand of (C2) by the RNA degradation activity of the reverse transcriptase to generate single-stranded DNA; (C4) a double-stranded DNA generating step in which the first primer is hybridized to the 3' side of the single-stranded DNA of (C3), the 3' end of the first primer is extended by the DNA synthesis activity of the reverse transcriptase, and the 3' end of the single-stranded DNA of (C3) is extended using the promoter sequence of the RNA polymerase of the first primer as a template, thereby generating a double-stranded DNA identical to the amplification reaction template generated in (A3).

2. In the complex, the magnetic carrier is a magnetic porous hydrogel particle. The method for detecting a detection target substance according to claim 1.

3. The affinity substance is an affinity dye. The method for detecting a detection target substance according to claim 1.

4. The capture agent is composed of the magnetic porous hydrogel particles and a porous shell covering the magnetic porous hydrogel particles. The method for detecting a detection target substance according to claim 2.

5. The sample is a wastewater, The detection target is at least one of a virus and a microorganism in the wastewater. A method for detecting a detection target substance according to claim 1 .

6. the promoter sequence of an RNA polymerase contained in the first primer is a T7 promoter sequence; The method for detecting an object to be detected according to claim 1 , wherein the RNA polymerase is T7 RNA polymerase.

7. the RNA genome is a sense strand, the first primer is an antisense primer, and the second primer is a sense primer; The method for detecting a detection target substance according to claim 1 .

8. the gene detection step includes an amplified gene detection step of detecting the gene amplified in the gene amplification step, In the gene amplification step, one of the first primer and the second primer has an antigen incorporated at its 5' end that is capable of specifically binding to an immobilized antibody immobilized on a substrate, and the other of the first primer and the second primer has a first binder incorporated at its 5' end; In the amplified gene detection step, the antigen of the one primer of the gene amplification product generated in the gene amplification step binds to the immobilized antibody, and the gene amplification product is immobilized on the substrate, and the first conjugate of the other primer binds to a label containing a second conjugate that specifically binds to the first conjugate via the second conjugate, thereby immobilizing the label on the substrate, and the label immobilized on the substrate is detected. The method for detecting a detection target substance according to claim 1 .

9. the first binder is biotin, the second binder is streptavidin, and the label is a colored microparticle having the streptavidin immobilized on its surface; The method for detecting a detection target substance according to claim 8.

10. A wastewater monitoring method comprising the method for detecting a detection target according to any one of claims 1 to 4.

11. The capture agent and a gene detection agent are included, The gene detection agent includes a gene amplification agent, The gene amplification agent includes the following (a1) to (a3), (b1) to (b3), and (c1): (a1) the reverse transcriptase; (a2) the first primer; (a3) the second primer; (b1) the recombinase; (b2) the single-stranded DNA binding protein; (b3) the strand-displacing DNA polymerase; (c1) the RNA polymerase: A detection kit for a target substance used in the method for detecting a target substance according to any one of claims 1 to 4.

12. The target substance detection kit according to claim 11 , wherein the capture agent comprises a complex in which an affinity substance is bound to the magnetic carrier.

13. The target substance detection kit according to claim 12 , wherein in the complex, the magnetic carrier is a magnetic porous hydrogel particle.

14. The target substance detection kit according to claim 12 , wherein the affinity substance is an affinity dye.

15. The target substance detection kit according to claim 13 , wherein the capture agent is composed of the magnetic porous hydrogel particles and a porous shell body covering the magnetic porous hydrogel particles.

16. The target substance detection kit according to claim 11, wherein the gene detection agent comprises an amplified gene detection agent, and the amplified gene detection agent comprises the following (d1) to (d3), and is used in the target substance detection method according to claim 8 or 9: (d1) the immobilized antibody; (d2) substrate; (d3) A label.

17. A wastewater monitoring kit comprising the detection kit for detecting a substance to be detected according to claim 11.

Images