Mutant TDP-43 protein

Abstract

To provide a mutant TDP-43 protein.SOLUTION: The present invention provides a mutant TDP-43 protein, having a deletion of a nuclear localization signal sequence in the amino acid sequence of a wild-type TDP-43 protein, and also having any one of the following mutations (a) to (c) or a combination of these mutations: (a) a mutation, in which the 147th and 149th phenylalanines are substituted with leucines, (b) a mutation, in which the 194th phenylalanine is substituted with leucine, and (c) a mutation, in which the 229th and 231st phenylalanines are substituted with leucines.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a mutant TDP-43 protein, and a mutant TDP-43 accumulation model cell and mouse containing the protein. [Background technology]

[0002] In the brains of patients with many neurodegenerative diseases, intracellular aggregates that characterize the disease appear in neurons and glial cells. The major constituent proteins of intracellular aggregates differ depending on the disease. Tau has been identified as the major constituent protein of intracellular aggregates specific to each disease in Alzheimer's disease (AD), α-synuclein in Parkinson's disease (PD) and dementia with Lewy bodies (DLB), and TDP-43 in amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD). However, the mechanism by which specific proteins aggregate in cells remains largely unknown. For this reason, various models have been constructed to reproduce the intracellular accumulation of tau, α-synuclein, and TDP-43 in order to elucidate the mechanism, but there are few models that faithfully reproduce the protein accumulation pathology in patient brains. Regarding TDP-43, since it was reported in 2006 that it is the major constituent protein of ubiquitin-positive intracellular aggregates in the brains of FTLD patients (Arai et al., 2006 and Neuman et al., 2006), numerous TDP-43-expressing mice have been developed (Wils et al., 2010). Research on TDP-43 accumulation cell models has also been conducted (Patent No. 5667872). However, no model has been reported to date that adequately reproduces the intracellular accumulation of phosphorylated TDP-43 seen in patient brains, and its development is awaited. [Prior art documents] [Patent documents]

[0003] [Patent Document 1] Patent No. 5667872 [Non-patent literature]

[0004] [Non-Patent Document 1] Arai et al, Biochem Biophys Res Commun. 2006 Dec 22;351(3):602-11. [Non-Patent Document 2] Neumann et al, Science. 2006 Oct 6;314(5796):130-3. [Non-Patent Document 3] Wils H et al, Proc Natl Acad Sci US A. 2010 Feb 23;107(8):3858-63. Summary of the Invention [Problem to be solved by the invention]

[0005] Given the above background, there was a need to develop a model that could fully reproduce the intracellular accumulation of phosphorylated TDP-43 seen in patient brains. [Means for solving the problem]

[0006] As a result of intensive research conducted by the present inventors to solve the above problems, it was possible to solve the above problems by deleting the nuclear localization signal of wild-type TDP-43 and substituting and mutating some amino acids in the RNA-binding domain. That is, the present invention is as follows. [1] A mutant TDP-43 protein in which a nuclear localization signal sequence is deleted in the amino acid sequence of a wild-type TDP-43 protein and which has any one of the following mutations (a1) to (c2) or a combination of these mutations, wherein the mutant TDP-43 protein has aggregation activity in cells. (a1) A mutation in which phenylalanine at positions 147 and 149 is replaced by leucine (a2) A mutation in which phenylalanine at positions 147 and 149 is replaced by leucine and one or more amino acids other than the amino acids at positions 147 and 149 are deleted, replaced, or added. (b1) A mutation in which phenylalanine at position 194 is replaced by leucine (b2) A mutation in which the 194th amino acid is replaced by a leucine, and one or more amino acids other than the 194th amino acid are deleted, substituted, or added. (c1) A mutation in which phenylalanine at positions 229 and 231 is replaced by leucine (c2) A mutation in which phenylalanine at positions 229 and 231 is replaced by leucine and one or more amino acids other than the amino acids at positions 229 and 231 are deleted, replaced, or added. [2] The mutant TDP-43 protein according to [1], wherein the amino acid sequence of the wild-type TDP-43 protein is that shown in SEQ ID NO: 2, 4, 6 or 8. [3] A DNA encoding the mutant TDP-43 protein described in [1]. [4] A vector containing the DNA described in [3]. [5] The vector according to [4], which is an adeno-associated virus vector. [6] A mutant TDP-43 protein accumulation model animal in which the mutant TDP-43 protein described in [1] is expressed in the brain of a non-human mammal. [7] A mutant TDP-43 protein accumulation model cell in which aggregates of the mutant TDP-43 protein described in [1] were introduced into cells. [8] The model cell described in [7], wherein the mutant TDP-43 protein aggregates are derived from the brain of the model animal described in [6]. [9] The model cell according to [8], wherein aggregates of mutant TDP-43 protein have seed activity to function as seeds for intracellular accumulation of the protein.

[10] A method for screening for a therapeutic agent for a neurodegenerative disease, comprising contacting or administering a test candidate substance to the model animal described in [6] or the model cell described in [7].

[11] A kit for screening therapeutic agents for neurodegenerative diseases, comprising the model animal described in [6] or the model cell described in [7]. Effect of the Invention

[0007] The present invention provides a mutant TDP-43 protein. Cells or mice into which the mutant protein of the present invention has been introduced are useful as model cells or model animals for neurodegenerative diseases. [Brief description of the drawings]

[0008] [Figure 1] FIG. 2 is a diagram showing positions at which mutations are introduced into the amino acid sequence of a mutant TDP-43 protein that has no nucleic acid-binding ability in the present invention. [Diagram 2] Fluorescence microscopy images of cells expressing TDP-43 FL mutant. [Figure 3-1] This is a diagram showing the results of immunoblotting analysis of TDP-43 FL mutant expressing cells. Plasmid expressing cells were homogenized in the presence of detergent sarkosyl, and the soluble fraction (Sar-sup) and insoluble fraction (Sar-ppt) were analyzed. Phosphorylated TDP-43 (red arrow) accumulated in the cells was detected in the Sar-ppt fraction using a phosphorylated TDP-43 specific antibody (anti-pS409 / 410). [Figure 3-2] This is a diagram showing the results of immunoblotting analysis of TDP-43 FL mutant expressing cells. Plasmid expressing cells were homogenized in the presence of detergent sarkosyl, and the soluble fraction (Sar-sup) and insoluble fraction (Sar-ppt) were analyzed. Phosphorylated TDP-43 (red arrow) accumulated in the cells was detected in the Sar-ppt fraction using a phosphorylated TDP-43 specific antibody (anti-pS409 / 410). [Figure 4] FIG. 1 shows an outline of mouse model experiments. [Diagram 5]This is a diagram showing the expression of TDP-43ΔNLS&FL-A in mouse brains by TDP-43ΔNLS&FL-A expressing AAV. AAV expressing TDP-43ΔNLS&FL-A specifically in neurons was inoculated into adult mouse brains and infected. One month after AAV inoculation, the brains were removed and subjected to immunoblot analysis. The collected mouse right brains were homogenized using Sarkosyl, a type of detergent, and then centrifuged to obtain Sarkosyl-soluble (Sar-sup) fractions. These were subjected to immunoblotting using human TDP-43-specific antibodies. Red arrow: TDP-43ΔNLS&FL-A. Expression of the target TDP-43ΔNLS&FL-A was observed in mice infected with 1 x 109 vg of AAV (lanes 1 to 5), and the expression level was reduced in mice infected with 1 x 108 vg of AAV (lanes 6 to 10). Expression could not be confirmed in mice inoculated with physiological saline (lane 11). 1-5: Mice infected with 1 x 109 vg of AAV (total of 5 mice) 6-10: Mice infected with 1 x 108 vg of AAV (total of 5 mice) 11: Mice inoculated with saline [Figure 6] Immunoblot analysis of mouse brain expressing TDP-43ΔNLS&FL-A. AAV expressing TDP-43ΔNLS&FL-A in neurons was inoculated into adult mouse brains and infected. One month after AAV inoculation, the brains were removed and subjected to immunoblot analysis. The right brains of the mice were homogenized with Sarkosyl, a type of detergent, and then centrifuged to obtain Sarkosyl-insoluble (Sar-ppt) fractions. These were subjected to immunoblotting using phosphorylated TDP-43 antibody. Red arrow: TDP-43ΔNLS&FL-A. In mice infected with 1 x 109 vg of AAV, insoluble TDP-43ΔNLS&FL-A was observed in the brain (although there were individual differences). No accumulation of TDP-43 was observed in mice inoculated with 1 x 108 vg of AAV or saline. 1-5: Mice infected with 1 x 109 vg of AAV (total of 5 mice) 6-10: Mice infected with 1 x 108 vg of AAV (total of 5 mice) 11: Mice inoculated with saline [Figure 7]This is a figure showing immunostaining of mouse brain expressing TDP-43ΔNLS&FL-A. AAV (1 x 109 vg) expressing TDP-43ΔNLS&FL-A specifically in neurons was inoculated into the brain of an adult mouse to infect it. One month after AAV inoculation, the brain was removed, and the left brain was fixed in formalin and then immunostained using a human TDP-43 specific antibody. Analysis was performed by immunohistochemical staining using the left brain. As a result, TDP-43 antibody positive staining images (brown) were obtained in neurons in the hippocampus and medial posterior parietal cortex. [Figure 8] This is a diagram showing the formation of phosphorylated TDP-43 aggregates in the brains of mice expressing TDP-43ΔNLS&FL-A. AAV (1 x 109 vg) expressing TDP-43ΔNLS&FL-A specifically in neurons was inoculated into the brains of adult mice to infect them. One month after AAV inoculation, the brains were removed, and immunohistochemical staining was performed using an antibody specific to phosphorylated TDP-43 using the left brain. As a result, intracellular aggregates positive for phosphorylated TDP-43 antibodies (dark brown staining image) were observed in neurons in the hippocampus and medial posterior parietal cortex. Such staining images were not observed in the brains of mice that had received saline. [Figure 9] This is a diagram showing the seed activity of the sarkosyl-insoluble fraction of AAV-infected mouse brain using cultured cells. Insoluble TDP-43 obtained from mouse brain infected with AAV expressing TDP-43ΔNLS&FL-A was added as a seed to SH-SY5Y cells in which the TDP-43ΔNLS plasmid was transiently expressed. After collecting the cells, the cells were homogenized using sarkosyl, a type of surfactant, and then centrifuged to obtain a sarkosyl-insoluble (Sar-ppt) fraction. These were subjected to immunoblotting using phosphorylated TDP-43 antibody. Red arrow: phosphorylated TDP-431 and 2: untreated3: only TDP-43ΔNLS plasmid expressed4: TDP-43ΔNLS plasmid expressed + insolubilized TDP-43 in mouse brain 1 month after AAV infection5: TDP-43ΔNLS plasmid expressed + insolubilized TDP-43 in mouse brain 3 months after AAV infection6: TDP-43ΔNLS plasmid expressed + insolubilized TDP-43 prepared from ALS patient brain DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0009] 1. Overview The present invention relates to a mutant TDP-43 protein in which a nuclear localization signal sequence is deleted in the amino acid sequence of wild-type TDP-43 and which has any one of the following mutations (a1) to (c2) or a combination of these mutations, wherein the mutant TDP-43 protein has an aggregation activity in cells: (a1) A mutation in which phenylalanine at positions 147 and 149 is replaced by leucine (a2) A mutation in which phenylalanine at positions 147 and 149 is replaced by leucine and one or more amino acids other than the amino acids at positions 147 and 149 are deleted, replaced, or added. (b1) A mutation in which phenylalanine at position 194 is replaced by leucine (b2) A mutation in which the 194th amino acid is replaced by a leucine, and one or more amino acids other than the 194th amino acid are deleted, substituted, or added. (c1) A mutation in which phenylalanine at positions 229 and 231 is replaced by leucine (c2) A mutation in which phenylalanine at positions 229 and 231 is replaced by leucine and one or more amino acids other than the amino acids at positions 229 and 231 are deleted, replaced, or added.

[0010] The present inventors found that when mutant TDP-43 that cannot bind to RNA is expressed in cultured cells, it is phosphorylated and accumulates in the cells. Furthermore, when an adeno-associated virus (AAV) encoding this mutant TDP-43 is prepared and inoculated into mouse brains, phosphorylated TDP-43-positive intracellular aggregates are observed in the brain. This new mouse model expressing mutant TDP-43 is expected to be useful not only for elucidating the mechanism by which TDP-43 accumulates in cells, but also for developing therapeutic and preventive methods for ALS, FTLD, and other diseases.

[0011] In patients with amyotrophic lateral sclerosis (ALS) and some frontotemporal lobar degeneration (FTLD), intracellular aggregates consisting of TDP-43 are found in neurons and glial cells. TDP-43 is a type of RNA-binding protein localized in the nucleus, but in the patient brain, it accumulates in the cytoplasm and nucleus after undergoing post-translational modifications such as phosphorylation and ubiquitination. To date, many genetically modified mice have been created to clarify the mechanism of TDP-43 accumulation, but a model that fully reproduces the TDP-43 pathology observed in the brains of ALS and FTLD patients has not yet been developed.

[0012] In this invention, we aim to develop a model that faithfully reproduces the abnormal TDP-43 lesions that appear in patient brains by expressing mutant TDP-43 in mouse brains using an adeno-associated virus (AAV) expression system. AAV expressing mutant TDP-43 was inoculated into mouse brains, and the brains were removed several months later for immunohistochemical staining and biochemical analysis. As a result, intracellular aggregates positive for phosphorylated TDP-43 antibodies were observed in the brain, and insolubilization of phosphorylated TDP-43 was biochemically confirmed.

[0013] When the insoluble TDP-43 aggregates prepared from these mouse brains were introduced into TDP-43-expressing cultured cells, the insoluble TDP-43 aggregates functioned as seeds, enhancing the accumulation of TDP-43 in the cultured cells. The mice constructed in this study in which phosphorylated TDP-43 accumulates in the brain can be used to elucidate the mechanism of intracellular accumulation of TDP-43 and to develop therapeutic drugs such as compounds that suppress TDP-43 accumulation. In addition, since the insoluble TDP-43 prepared from these mouse brains functions as a seed to induce its accumulation, it can be used to construct cell models with TDP-43 accumulation, and is considered to be useful as a new tool to replace the conventional patient-derived seeds.

[0014] In order to investigate the relationship between the RNA-binding ability and aggregation property of TDP-43, the present inventors created several mutants by introducing mutations into the RNA-binding domain of TDP-43 and examined their effects.

[0015] It has been reported that the nucleic acid binding ability of TDP-43 is lost when some Phe in the RNA-binding domain is replaced by Leu (Fig. 1, Buratti and Baralle, 2001). We then created mutants in which some Phe was replaced by Leu (FL mutants, Fig. 1) and transiently expressed them in cultured cells. In cells expressing the mutant in which both Phe at residues 147 and 149 were replaced by Leu (FL-A), the most intracellular aggregates positive for phosphorylated TDP-43 antibodies were observed (Fig. 2).

[0016] Furthermore, in biochemical analysis of FL mutant expressing cell lysates (Figure 3), a phosphorylated TDP-43 antibody positive band was observed in the detergent sarkosyl (Sar) insoluble fraction (Sar-ppt) in FL-A mutant expressing cells, confirming that this mutant aggregates intracellularly. In addition, in cells expressing a mutant (ΔNLS&FL-ABC) that has both FL mutation and a nuclear localization signal (NLS) deletion mutation (ΔNLS), significant intracellular accumulation of phosphorylated TDP-43 was observed compared to cells expressing the FL-A mutant. Figure 3-2 also shows that the effect of each FL mutation on aggregation depends only on FL-A, and the effect of FL-B and C mutations is very low.

[0017] From the above results, it was revealed that the expression of FL mutants involved in the nucleic acid binding ability of TDP-43 in cultured cells results in the accumulation of phosphorylated TDP-43 in the cells. In addition, among the FL mutations (Figure 1), the intracellular accumulation of TDP-43 was most frequently observed in FL-A, and the accumulation was significantly increased by introducing a mutation that deleted the NLS (Figure 3). Considering this, we created a new mutant called TDP-43 ΔNLS&FL-A that introduced these two mutations, and examined whether the intracellular accumulation of phosphorylated TDP-43 would occur in the mouse brain if it was expressed in the mouse brain.

[0018] According to a standard method, AAV virus (serotype: AAV-PHP.eB) expressing TDP-43 ΔNLS&FL-A was produced using HEK293 cells. The medium of the cells into which the plasmid was introduced was collected, the virus liquid was concentrated by ultrafiltration, and its concentration was measured by real-time PCR. 1.0 × 10 8 vg or 1.0×10 9 We inoculated vg into the striatum of both sides of the adult mouse brain. One or three months after virus inoculation, the brains were excised, and the right brain was subjected to biochemical analysis (immunoblot), and the left brain was subjected to immunohistochemical analysis (Fig. 4).

[0019] Mouse brains (right brain) one month after infection were homogenized in a buffer containing sarkosyl, and the supernatant (soluble fraction: Sar-sup) and precipitate (insoluble fraction: Sar-ppt) were collected by centrifugation and subjected to immunoblot analysis. Analysis of the Sar-sup fraction shown in Figure 5 confirmed the expression of the target TDP-43 ΔNLS&FL-A in the virus-infected mice (band indicated by the red arrow in Figure 5). The amount of expression was dependent on the amount of virus inoculated into the mouse brain, reaching 1.0 × 10 9 Higher expression of vg was observed in the brains of mice infected with AAV, whereas expression was absent in mice inoculated with saline instead of virus.

[0020] Next, in the immunoblotting results of the Sar-ppt fraction shown in FIG. 6, 1.0×10 9 A band positive for phosphorylated TDP-43 specific antibody was confirmed in the sarkosyl-insoluble fraction of mouse brain infected with vg AAV (red arrow). The band intensity varied depending on the individual, but the band intensity was significantly higher in saline and 1.0 × 10 8 These bands were not detected in the mouse brain infected with vg AAV. These results indicate that TDP-43 ΔNLS&FL-A expressed in the brain by AAV infection is phosphorylated and aggregated in the cells.

[0021] The results of the biochemical analysis of the AAV-infected mouse brains showed that the expression of TDP-43 ΔNLS&FL-A was 1.0×10 9 Since this was observed prominently in mice infected with the VG virus, immunohistochemical analysis of the mouse brain was performed. 9 One month after infection with vg AAV, the mouse brain was removed and the left brain was fixed in formalin, then paraffin blocks were prepared, and ultrathin slices (8 μm thick slices) were prepared and stained with human TDP-43 specific antibodies and phosphorylated TDP-43 specific antibodies.

[0022] As a result, as shown in Figure 7, AAV virus infection resulted in the expression of TDP-43 ΔNLS&FL-A in the hippocampus, medial posterior parietal cortex, etc. In addition, when sections of AAV-infected mouse brains were stained with a phosphorylated TDP-43-specific antibody that specifically reacts with phosphorylated TDP-43 aggregates that appear in the patient brain, positive staining images for the phosphorylated TDP-43-specific antibody were observed in the hippocampus, medial posterior parietal cortex, etc. (Figure 8).

[0023] These results indicate that phosphorylated TDP-43 ΔNLS&FL-A forms aggregates within cells in the AAV-infected mouse brain, demonstrating the construction of a novel mouse model that faithfully reflects the TDP-43 pathology in patient brains.

[0024] It has been reported that TDP-43 accumulated in the brains of ALS and FTLD patients has prion-like properties (Nonaka et al., 2013). That is, when insoluble TDP-43 prepared as a sarkosyl-insoluble fraction from the patient brain is introduced into cultured cells expressing TDP-43 NLS, it functions as a seed and induces the aggregation of TDP-43 ΔNLS in the cells (Fig. 9, lane 6). Therefore, we investigated whether TDP-43 ΔNLS&FL-A aggregated in the brains of mice infected with AAV also has prion-like properties, i.e., whether it functions as a seed.

[0025] The sarkosyl-insoluble fraction (e.g., lane 4 in Figure 6) prepared from AAV-infected mouse brain was added with 50 μL of saline and sonicated, and used as insolubilized TDP-43 ΔNLS&FL-A. 5 μL of insolubilized TDP-43 ΔNLS&FL-A was added together with Multifectam Reagent (Promega) to SH-SY5Y cells that had previously expressed TDP-43 ΔNLS. After incubation for several days, the cells were harvested, homogenized in a buffer containing sarkosyl, and centrifuged to obtain the sarkosyl-insoluble fraction (Sar-ppt). This was subjected to immunoblot analysis using an antibody specific to phosphorylated TDP-43. Even when TDP-43 ΔNLS was expressed alone in cultured cells, it did not accumulate in the cells, and therefore almost no band was observed in the Sar-ppt fraction (lane 3 in Figure 9).

[0026] On the other hand, when insoluble TDP-43 prepared from ALS patient brain was added to cells as a seed, it functioned as a seed and induced the accumulation of TDP-43 ΔNLS in the cells (Fig. 9, lane 6). Similarly, when insoluble TDP-43 ΔNLS&FL-A prepared from AAV-infected mouse brain was added to cells, a band positive for phosphorylated TDP-43 specific antibody appeared in the Sar-ppt fraction (Fig. 9, lanes 4 and 5). Therefore, it was revealed that the insoluble TDP-43 ΔNLS&FL-A observed in the AAV-infected mouse brain has prion-like properties, similar to the insoluble TDP-43 observed in the patient brain.

[0027] On the other hand, as shown in Figure 3, when TDP-43 FL-A or ΔNLS&FL mutants are transiently expressed in cultured cells, these mutant TDP-43s accumulate in the cells. The applicants also investigated whether insoluble TDP-43 in cultured cells could function as a seed, but they did not function as a seed. These mutant TDP-43s were almost identical to the type expressed in mouse brain, but only the insoluble TDP-43 accumulated in the mouse brain had seed activity.

[0028] Until now, the only seed that can efficiently induce the accumulation of intracellular TDP-43 in cultured cells was insoluble TDP-43 derived from patient brains, and its use was limited. In addition, the use of patient brains raises ethical issues, and it is not available to many researchers. Therefore, a tool as a research reagent that anyone can easily use has been desired.

[0029] In the TDP-43 ΔNLS&FL-A expressing mice discovered in this invention, not only did TDP-43 ΔNLS&FL-A accumulate in the mouse brain as early as one month after AAV infection, but the insoluble TDP-43 ΔNLS&FL-A was found to have prion-like activity similar to the insoluble TDP-43 found in the patient's brain, indicating that this insoluble protein can be used as a research tool. These mice in which TDP-43 ΔNLS&FL-A accumulates in the brain can contribute to elucidating the mechanism of onset of neurodegenerative diseases accompanied by TDP-43 accumulation and to developing novel therapeutic drugs for ALS, FTLD, etc.

[0030] References Arai et al, Biochem Biophys Res Commun. 2006 Dec 22;351(3):602-11. Buratti and Baralle, J Biol Chem. 2001 Sep 28;276(39):36337-43. Neumann et al, Science. 2006 Oct 6;314(5796):130-3. Nonaka et al, Cell Rep. 2013 Jul 11;4(1):124-34. Watanabe et al, Acta Neuropathol Commun. 2020 Oct 28;8(1):176. Wils H et al, Proc Natl Acad Sci US A. 2010 Feb 23;107(8):3858-63.

[0031] 2. Mutant TDP-43 protein The mutant TDP-43 protein of the present invention (also simply referred to as "mutant TDP-43" or "mutant") is a mutant TDP-43 protein in which the nuclear localization signal sequence is deleted in the amino acid sequence of wild-type TDP-43 (e.g., SEQ ID NO: 2 in the case of humans) and which has any one of the following mutations (a1) to (c2) or a combination of these mutations. (a1) A mutation in which phenylalanine at positions 147 and 149 is replaced by leucine (a2) A mutation in which phenylalanine at positions 147 and 149 is replaced by leucine and one or more amino acids other than the amino acids at positions 147 and 149 are deleted, replaced, or added. (b1) A mutation in which phenylalanine at position 194 is replaced by leucine (b2) A mutation in which the 194th amino acid is replaced by a leucine, and one or more amino acids other than the 194th amino acid are deleted, substituted, or added. (c1) A mutation in which phenylalanine at positions 229 and 231 is replaced by leucine (c2) A mutation in which phenylalanine at positions 229 and 231 is replaced by leucine and one or more amino acids other than the amino acids at positions 229 and 231 are deleted, replaced, or added. The mutant TDP-43 protein is phosphorylated in cells and has aggregation activity.

[0032] Here, the term "nuclear localization signal / sequence (NLS)" refers to an amino acid sequence that serves as a marker for transporting a protein to the cell nucleus, and is also referred to as a "nuclear localization signal" or "nuclear localization sequence." In the present specification, it may be simply referred to as "NLS." In the amino acid sequence of wild-type TDP-43 (SEQ ID NO: 2 in the case of humans), the NLS is the amino acid sequence of positions 78 to 84, and this NLS is deleted in the mutant TDP-43 protein of the present invention.

[0033] In the present invention, a mutant having the above (a1) mutations (F147L and F149L) is referred to as "FL-A." Here, the letters before and after the number at the mutation site represent phenylalanine (F) before the mutation and leucine (L) after the mutation, respectively, and the number represents the position of the mutation. The mutant having the above (b1) mutation (F194L) is referred to as "FL-B." The mutant having the above (c1) mutations (F229L and F231L) is referred to as "FL-C." A mutant having a combination of mutations (a1) and (b1) is called "FL-AB", a mutant having a combination of mutations (a1) and (c1) is called "FL-AC", a mutant having a combination of mutations (b1) and (c1) is called "FL-BC", and a mutant having a combination of mutations (a1), (b1), and (c1) is called "FL-ABC".

[0034] The present invention also includes (a2) a mutant TDP-43 having, in addition to the mutation (a1) above, a mutation in which one or more amino acids except the 147th and 149th amino acids are deleted, substituted or added; (b2) a mutant TDP-43 having, in addition to the mutation (b1) above, a mutation in which one or more amino acids except the 194th amino acid are deleted, substituted or added; and (c2) a mutant TDP-43 having, in addition to the mutation (c1) above, a mutation in which one or more amino acids except the 229th and 231st amino acids are deleted, substituted or added.

[0035] Furthermore, the present invention includes mutant TDP-43 having each of the above mutations (a1) to (c2) alone, as well as mutant TDP-43 having a combination of these mutations. However, these mutant TDP-43s have aggregation activity in cells. Here, "several" referring to the number of amino acid mutations means, for example, 2, 3, 4, 5, 6, 7, 8 or 9. In the present invention, human TDP-43 (SEQ ID NO: 2) is exemplified above as the TDP-43 to be mutated, but mutations can also be introduced into TDP-43 derived from other mammals.

[0036] The mutation sites in human TDP-43 and those corresponding to those from other mammals are shown in Table 1 below. [Table 1]

[0037] Here, the letter F at the mutation site represents phenylalanine, and the number represents the position where the phenylalanine exists.

[0038] 3. Nucleic acid encoding mutant TDP-43 protein (1) Obtaining nucleic acid encoding mutant TDP-43 protein The mutant TDP-43 used in the present invention can be obtained by obtaining gene or amino acid sequence information of wild-type TDP-43 from the accession number, and performing known genetic engineering techniques or site-directed mutagenesis based on the information (Sambrook J. et al., Molecular Cloning, A Laboratory Manual (4th edition), Cold Spring Harbor Laboratory Press (2012)). The wild-type gene can be chemically synthesized to have the base sequence shown in SEQ ID NO: 1, 3, 5, or 7, or a commercially available product can be used.

[0039] Nucleic acid (DNA) encoding a mutant can also be obtained by known techniques, for example, using site-directed mutagenesis. Examples of mutation introduction kits for site-directed mutagenesis include QuikChange Site-Directed Mutagenesis Kit (Strategene), KOD-Plus-Mutagenesis Kit (Toyobo), GenEdit Site-Directed DNA Mutagenesis Kit (Funakoshi), and TaKaRa Site-Directed Mutagenesis System (Mutan-K, Mutan-Super Express Km, etc.: Takara Bio).

[0040] In addition, the nucleic acid encoding the mutant TDP-43 can also be produced by a conventional chemical synthesis method or biochemical synthesis method. For example, a nucleic acid synthesis method using a DNA synthesizer that is commonly used as a genetic engineering method, or a gene amplification method using a PCR method or a cloning vector after isolating or synthesizing a template base sequence can be used. The nucleic acid obtained as described above is then cleaved with a restriction enzyme or the like. The DNA fragment of the gene thus excised can be inserted into an appropriate expression vector to obtain an expression vector containing a gene encoding a protein.

[0041] Expression vector construction and transformation In the present invention, the mutant TDP-43 protein can be obtained by constructing an expression vector (recombinant vector) by introducing a nucleic acid encoding the mutant TDP-43 protein into a vector as shown below, and then introducing this into a host and culturing it.

[0042] The vector for inserting the DNA encoding the mutant TDP-43 of the present invention is not particularly limited as long as it can be replicated in the host, and examples thereof include plasmid DNA, phage DNA, and viruses. Examples of plasmid DNA include plasmids derived from Escherichia coli, Bacillus subtilis, and yeast, and examples of phage DNA include λ phage. It is also possible to use viruses such as adenovirus (e.g., adeno-associated virus) and retrovirus. By using a viral vector, the mutant can be introduced into the brain or cells of a mouse.

[0043] In the present invention, in addition to a promoter and DNA, cis elements such as enhancers, splicing signals, poly A addition signals, ribosome binding sequences (SD sequences), selection marker genes, reporter genes, etc. can be linked to the expression vector as desired.

[0044] (3) Collection and purification of mutant TDP-43 or its aggregates The expression vector is introduced into a host to prepare a transformant, the transformed host is cultured or bred, and the target mutant TDP-43 protein is collected from the culture or the brain of a non-human mammal (e.g., a mouse). The term "culture" refers to (i) the culture supernatant as well as (ii) cultured cells or cultured bacteria, or their disruption.

[0045] 4. Cell and animal models of mutant TDP-43 accumulation As described above, when a vector (adeno-associated virus, AAV) expressing mutant TDP-43 is inoculated into mouse brain, intracellular aggregates positive for phosphorylated TDP-43 antibody are observed in the brain, and insolubilization of phosphorylated TDP-43 is biochemically confirmed. When the insolubilized TDP-43 aggregates prepared from this mouse brain are introduced into ΔNLS-TDP-43 expressing cultured cells, the insolubilized TDP-43 aggregates function as seeds that trigger accumulation in the cells, enhancing the accumulation of TDP-43 in the cultured cells. The mouse constructed in the present invention in which phosphorylated TDP-43 accumulates in the brain can be used as a model mouse for neurodegenerative diseases to elucidate the mechanism of intracellular accumulation of TDP-43 and to develop therapeutic drugs such as compounds that suppress TDP-43 accumulation. Furthermore, since the insoluble TDP-43 prepared from the mouse brain functions as a seed to induce its accumulation, cells into which aggregates of mutant TDP-43 accumulated in the mouse brain have been introduced can be used as model cells for neurodegenerative diseases.

[0046] In the present invention, the animal is not limited to a mouse, and other animals can also be used. The subject model animals include rats, rabbits, dogs, horses, sheep, marmosets, monkeys (macaques), etc.

[0047] 5. Screening method for therapeutic drugs for neurodegenerative diseases The screening method of the present invention is characterized by contacting a candidate substance (test substance) with any of the following animals or cells (a) to (d): (a) A non-human mammal expressing mutant human TDP-43. (b) a non-human mammal expressing a mutant non-human TDP-43; (c) a cell into which mutant TDP-43 aggregates derived from the brain of the animal (a) or (b) above have been introduced; or (d) Non-human mammals

[0048] This will make it possible to screen for substances that suppress the intracellular accumulation of mutant TDP-43 aggregates, and also to screen for drugs to treat neurodegenerative diseases. Target diseases for which drugs are screened include, for example, amyotrophic lateral sclerosis and frontotemporal lobar degeneration, but also include other diseases accompanied by accumulation of TDP-43 (for example, Alzheimer's disease and dementia with Lewy bodies accompanied by accumulation of TDP-43).

[0049] "Contact" means that a cell or a non-human mammal into which a mutant TDP-43 protein or an aggregate thereof has been introduced is placed in the same environment, reaction system, or culture system as a candidate substance (test substance), and includes, for example, adding the candidate substance to a cell culture vessel, mixing the cell with the candidate substance, culturing the cell in the presence of the candidate substance, and administering the candidate substance to a non-human mammal.

[0050] Examples of candidate substances include peptides, proteins (including antibodies), non-peptide compounds, synthetic compounds (polymeric or low molecular weight compounds), fermentation products, cell extracts, cell culture supernatants, plant extracts, tissue extracts from mammals (e.g., mice, rats, pigs, cows, sheep, monkeys, humans, etc.), plasma, etc. These compounds may be novel compounds or known compounds. These candidate substances may form salts, and examples of the salts of candidate substances include salts with physiologically acceptable acids (e.g., inorganic acids, organic acids, etc.) or bases (e.g., metallic acids, etc.).

[0051] If results confirm that administration of a certain candidate substance alleviates or eliminates cell death, the candidate substance used can be selected as a therapeutic agent for neurodegenerative diseases.

[0052] 5. Kit for screening method of therapeutic drugs for neurodegenerative diseases The model cells of the present invention can be provided in the form of a kit for screening a therapeutic drug for neurodegenerative disease. The kit of the present invention includes the above-mentioned cells, and can also include a labeling substance, a cell death detection reagent (e.g., LDH, etc.). The labeling substance means an enzyme, a radioisotope, a fluorescent compound, a chemiluminescent compound, etc. In addition to the above-mentioned components, the kit of the present invention can also include other reagents for carrying out the method of the present invention, for example, when the label is an enzyme label, an enzyme substrate (such as a chromogenic substrate), an enzyme substrate dissolving solution, an enzyme reaction stopping solution, etc. In addition, the kit of the present invention can also include a diluent for the test compound, various buffers, sterilized water, various cell culture vessels, various reaction vessels (such as Eppendorf tubes), a cleaning agent, an experimental operation manual (instructions), etc.

[0053] Working Example The present invention will be described in more detail below with reference to examples, although the scope of the present invention is not limited to these examples. EXAMPLES

[0054] cultured cells Human neuroblastoma cells (SH-SY5Y line, purchased from American Type Culture Collection, Cat. #CRL-2266) were used. The cells were cultured in Dulbecco's modified eagle's medium nutrient mixture (DMEM) / F-12HAM (Sigma-Aldrich, Cat. #D8062-500ML) supplemented with 10% (v / v) fetal bovine serum, non-essential amino acid solution (MEM Non-Essential Amino Acids Solution (100X), ThermoFisher, Cat. #11140050), and penicillin-streptomycin-glutamine solution (Penicillin-Streptomycin-Glutamine (100X), ThermoFisher, Cat. #10378016) at 37°C in a 5% CO2 incubator (Thermo Scientific). Collagen-coated 6 cm petri dishes (BD Biocoat) and 6-well plates (BD Biocoat) were used for culturing. Cell passage was performed with the cells in a 100% confluent state as follows. After removing the medium from the 6 cm petri dish, the cells were washed with 1.5 mL of physiological saline, and the physiological saline was removed. 1 mL of 0.25% trypsin was added and incubated at 37°C for 5 minutes. Then, 2 mL of fresh medium was further added to stop the trypsin reaction, after which the cells were thoroughly suspended and seeded in a 6 cm petri dish containing 3 mL of medium. Usually, 4-6 × 10 5 When cells were added to a 6 cm dish containing 3 mL of medium, they became nearly 100% confluent (2–3 × 10 6 (pieces / mL).

[0055] HEK293T cells were used for AAV production. They were cultured in DMEM (Dulbecco's Modified Eagle Medium (High Glucose), Sigma-Aldrich, #D5796-500ML) supplemented with 10% (v / v) fetal bovine serum, non-essential amino acid solution (MEM Non-Essential Amino Acids Solution (100X), ThermoFisher, Cat. # 11140050), penicillin-streptomycin-glutamine (100X), ThermoFisher, Cat. #10378016), and sodium pyruvate (GIBCO, #11360) at 37°C in a 5% CO2 incubator (Thermo Scientific).

[0056] Generation of mutant TDP-43 The plasmid encoding mutant TDP-43 was prepared using QuikChange Site-Directed Mutagenesis Kit (Strategene). In the preparation of mutants with deleted nuclear localization signal (NLS) (ΔNLS mutant) and mutants with Phe involved in RNA binding substituted with Leu (FL mutant), PCR was performed using the following primers with pcDNA3-TDP-43 (cultured cell expression vector) encoding wild-type TDP-43 as a template. In the preparation of ΔNLS&FL-A mutants, PCR was performed with the following primers with pcDNA3-TDP ΔNLS as a template.

[0057] ΔNLS-FW GTATGTTGTCAACTATATGGATGAGACAGATGC (SEQ ID NO: 9) ΔNLS-RV GCATCTGTCTCATCCATATAGTTGACAACATAC (SEQ ID NO: 10)

[0058] FL-A(F147&149L)-FW AGACTGGTCATTCAAAGGGGTTGGGCTTGGTTCGTTTTACGGAATATGA (SEQ ID NO: 11) FL-A-RV TCATATTCCGTAAAACGAACCAAGCCCAACCCCTTTGAATGACCAGTCT (SEQ ID NO: 12)

[0059] FL-B(F194L)-FW CTTTGAGAAGCAGAAAAGTGTTGGTGGGGCGCTGTACAGAGGA (SEQ ID NO: 13) FL-B-RV TCCTCTGTACAGCGCCCCACCAACACTTTTCTGCTTCAAAG (SEQ ID NO: 14)

[0060] FL-C(F229&231L)-FW TCCCCAAGCCATTCAGGGCCTTGGCCTTGGTTACATTTGCAGATGATCA (SEQ ID NO: 15) FL-C-RV TGATCATCTGCAAATGTAACCAAGGCCAAGGCCCTGAATGGCTTGGGGA (SEQ ID NO: 16)

[0061] Construction of AAV expression vectors To prepare the AAV expression vector, we used pcDNA3-TDP-43 wild-type or mutant-type as a template and performed PCR with the following primers to introduce the wild-type or mutant TDP-43 sequence into the EGFP portion of AAV-hsyn-EGFP (Addgene, #114213), which has a synapsin promoter.

[0062] hSyn-TDP-FW GGATCCGCCGCCACCATGTCTGAATATATTCGGGTA (SEQ ID NO: 17) hSyn-TDP-RV CGCGGCCGCACTAGTCTACATTCCCCAGCCAGA (SEQ ID NO: 18)

[0063] Prime STAR Max Premix (Takara, R045A) was used for PCR. The PCR products were electrophoresed using an agarose gel, and the bands of interest were excised and DNA was extracted using NucleoSpin Gel and PCR Clean-up (Takara, U0609B). The extracted DNA was circularized using an In-Fusion HD Cloning kit (Takara, #639648) and used as an expression vector (the vector expressing wild-type TDP-43 was AAV-hsyn-TDP wild-type, and the mutant type without nucleic acid binding ability was AAV-hsyn-TDP FL-A).

[0064] Preparation of AAV HEK293T cells were seeded at 2.0×10^6 cells per ten 10cm petri dishes. A mixture of AAV vector (AAV-hsyn-TDP wild-type or FL-A), AAV-PHP.eB vector (plasmid that determines the AAV serotype), AAV helper plasmid pAdDeltaF6 (Addgene, #112867) and PEI (Polysciences, Inc.) was added to the cells. Specifically, 2.5μg of AAV vector, 5μg of pΔF6, 2.5μg of AAV-PHP.eB and 50μL of 1mg / mL PEI were added to 1mL of Opti-Mem (gibco Opti-MEM #11058-021) for each 10cm petri dish, mixed and left at room temperature for 20 minutes. The entire mixture was then added to the culture medium in the petri dish for transfection. After 2 days, the entire medium was replaced with serum-free DMEM medium. After 4 days, the medium was collected and centrifuged at 4500 rpm for 5 minutes to remove the cells. The medium was then filtered through a 0.45 μm filter (Thermo Nalgene Rapid-Flow Filters, #165-0045) to remove excess cell debris, transferred to a centrifuge tube (Millipore Amicon Ultra, #UFC910024) and centrifuged at 5000 g until about 800 μL remained on the membrane. Next, 10 mL of PBS was added on the membrane and centrifuged at 5000 g until about 800 μL remained on the membrane. This procedure was repeated three times, and the virus solution on the membrane was collected and frozen and stored at -80°C.

[0065] AAV titer measurement The WPRE sequence, which is a specific sequence of AAV, was amplified by real-time PCR using the following primers.

[0066] FW TGGCGTGGTGTGCACTGT (SEQ ID NO: 19) RV AGGGACGTAGCAGAAGGACG (SEQ ID NO: 20)

[0067] For the PCR sample, 2 μL of the AAV sample was mixed with PCR alkaline treatment buffer (25 mM NaOH, 0.2 mM EDTA) and heat-treated at 100°C for 10 minutes using a thermal cycler (BioRAD). Then, 50 μL of PCR neutralization buffer (1 M Tris-HCl, pH 5.0) was added and mixed by pipetting. 2 μL of the mixture was mixed with 10 μL of SYBR Green (Thermo Scientific, #4367659), 2 μL of primer, and 6 μL of DW and analyzed by real-time PCR. The ABI 7500 Fast (Thermo Fisher, #4406984) was used, and the conditions were 25°C for the first 10 minutes, followed by 40 cycles of 95°C for 15 seconds, 60°C for 30 seconds, and 72°C for 30 seconds.

[0068] The plasmid concentration and copy number were calculated using the following formula. [plasmid concentration ng / μL (1.2×10^15)] / (number of bases bp*607.4)+157.9] AAV-hsyn-EGFP (Addgene #114213), whose plasmid concentration and base number were known, was serially diluted to prepare a standard curve of copy number versus reaction time, and the copy number was calculated from the reaction time of the purified virus solution.

[0069] AAV infection of mice Male wild-type mice (C57BL / 6J) were purchased from Japan SLC Co., Ltd. and bred in the animal breeding facility of the Tokyo Metropolitan Institute of Medical Science. The samples inoculated into the mouse brain were as follows: 1. AAV produced from the AAV-hsyn-EGFP vector, 1.0×10^8vg or 1.0×10^9g (negative control) 2. AAV hsyn- TDP43ΔNLS&FL-A, 1.0×10^8 vg or 1.0×10^9 vg

[0070] The mouse was placed in an anesthesia chamber, filled with 3% anesthetic (20% isoflurane, Japanese Pharmacopoeia, Pfizer) and left to stand for several minutes. The anesthetized mouse was then fixed with auxiliary ear bars and further administered 2% isoflurane inhalation anesthesia. The above four types of AAV were used as samples and inoculated into the striatum of both sides of the mouse as follows. First, the scalp of the mouse was incised to confirm the position of the bregma, and a hole was drilled in the skull 2 ​​mm to the left and right and 0.5 mm vertically from that position. The needle of a syringe (HAMILTON, Cat. #80301) containing the sample was inserted to a depth of 3 mm so as not to bend, and 5 μL was inoculated. To reduce sample leakage, the needle was left to stand for 1 minute, then removed, and the hole on the opposite side was inoculated in the same way. The mouse was then sutured, and finally, a hole was punched in the ear for individual identification, and the mouse was returned to its cage.

[0071] 1. Mouse Brain Removal The mouse brain was removed one month after the sample was inoculated into the brain. The mouse was anesthetized by injecting 0.5 mL of triple-mix anesthetic into the abdominal cavity. The triple-mix anesthetic was prepared by mixing 750 μL of medetomidine hydrochloride (Domitor, Nippon Zenyaku Kogyo Co., Ltd.), 800 μL of midazolam (Sandoz Co., Ltd.), 1 mL of butorphanol tartrate (Betorfal, Meiji Seika Pharma Co., Ltd.) with 7.45 mL of physiological saline (Japanese Pharmacopoeia Physiological Saline Solution, Otsuka Saline Injection, Otsuka Pharmaceutical Factory, Inc.). After the anesthesia procedure, the whole body was bled with physiological saline (Terumo Saline, Type B, Terumo) and the brain was removed.

[0072] Preservation of mouse brains The mouse brain was immediately placed on a petri dish and divided into left and right along the midline with a single-edged feather steel blade (black blade). The right brain was frozen on dry ice and stored at -80°C. The left brain was fixed in 10% neutral buffered formalin (Fujifilm Wako Pure Chemical Industries, Cat. #062-01661) at 4°C. The tissue was fixed as quickly as possible (2-3 days) because not only does the tissue disintegrate over time, but there is also a risk of the target antigen leaking out.

[0073] Paraffin block embedding After the fixation was completed, the mouse brain was placed in a paraffin block embedding cassette (SAKURA Tissue-Tek #4143) and immersed in paraffin using an automatic paraffin embedding device (Sakura Seiki Co., Ltd., Tissue-Tek VIP5 Junior) according to the protocol for channel 1. Then, the mouse brain and liquid paraffin were poured into a metal mold for paraffin embedding and solidified at 0°C to prepare a paraffin block.

[0074] Preparation of vibratome sections and immunohistochemical analysis The mouse brain embedded in the paraffin block was sliced ​​to a thickness of 8 μm using a thin-slicing device (Daiwa Koki Kogyo Co., Ltd., ritratome, #REM-710) equipped with a tissue blade holder (Daiwa Koki Kogyo Co., Ltd., hard tissue blade holder, #BH-220) and a microtome blade (Feather, Microtome Blades, #S35 TYPE) to prepare sections. These were attached to anti-peeling coated slide glass (MATSUNAMI). The sections were then infiltrated in xylene for 20 minutes, and then in ethanol for 20 minutes to dissolve the paraffin.

[0075] The sections were washed in running water for 5 min to remove residual organic solvent, and then autoclaved in 0.01 M sodium citrate buffer at 121°C for 20 min. Then, they were immersed in PBS containing 3% H2O2 and washed three times with PBS. Blocking was performed for 20 min with 10% bovine serum (CS:Bovine Serum, ThermoFisher, Cat. #16170-078) containing 0.03% TritonX-100, and incubated overnight with a 6,000-fold diluted human-specific TDP-43 antibody (Proteintech, Cat. #60019-2-Ig) or a 1,000-fold diluted phosphorylated TDP-43 antibody (Cosmo Bio Co., Ltd., Cat. #TIP-PTD-P07).

[0076] The next day, the sections were washed three times with PBS and incubated with secondary antibodies (1:1,000 dilution: Biotin-Goat anti mouse IgG, Vector, Cat. # BA-9200-1.5 or Biotin-Goat anti rabbit IgG, Vector, Cat. # BA-1000-1.5) at room temperature for 2 hours. After washing three times with PBS, the sections were reacted with avidin-biotin-peroxidase complex using the ABC Kit (peroxidase-labeled avidin-biotin complex (ABC Standard Kit, Vector, Cat. #PK-4000) at room temperature for 30 minutes. The sections were washed three times with PBS and then colored for 20 minutes using the prepared color development solution (Tris-saline containing 0.1% 3,3'-Diaminobenzidine (Sigma-Aldrich, Cat. #D8001-5G) and 0.05% H2O2 (hydrogen peroxide solution, Sigma-Aldrich Japan, Cat. #13-1910-5)).

[0077] The color reaction was stopped by washing the slides with the sections attached with tap water. After drying, the sections were treated with Mayer's Hematoxylin (Muto Chemicals, Cat. #30002) for 1 minute to stain the nuclei, and then washed with running water for 5 minutes. The specimens were completely dried, immersed in xylene for 10 minutes, dehydrated, and then mounted using Antifade Mounting Medium for fluorescence (VECTASHIELD, Cat. #H-1000-10). The prepared slides were stored at room temperature. An all-in-one microscope (KEYENCE: BZ-X710) was used for observation.

[0078] Detection of phosphorylated TDP-43 by immunoblotting Frozen mouse brain was homogenized in 18 volumes of A68 buffer (10 mM Tris-HCl, pH 7.5 / 1 mM EGTA / 10% sucrose / 0.8 M NaCl) per 0.25 g. 20% Sarkosyl (N-lauroyl sarcosine sodium salt, Sigma-Aldrich, Cat. #L5125-500G) solution was added to the suspension to a final concentration of 1%, and the mixture was stirred and incubated at 37°C for 30 min. The suspension was then centrifuged at 20,400 g for 10 min at room temperature (TOMY MX-307, Tomy Seiko Co., Ltd.), and the supernatant was collected. The supernatant was further centrifuged at 113,000 g for 20 min (himac CS100GXL, Eppendorf Himac Technologies). The supernatant was collected as the Sarkosyl supernatant fraction (Sar-sup). 500 μL of PBS was added to the precipitate, and the mixture was centrifuged again at 113,000 g for 20 minutes (himac CS100GXL, Eppendorf Himac Technologies). The supernatant was discarded, and the precipitate was collected as the sarkosyl-insoluble fraction (Sar-ppt).

[0079] The protein content of the sarkosyl supernatant fraction was quantified by BCA assay (BCA Protein Assay Kit, ThermoFisher, Cat. #23225). 100 μL of 2x SDS sample buffer (2xSB) containing 5% 2-mercaptoethanol was added to 100 μL of the remaining sample. 50 μL of 2xSB containing 5% 2-mercaptoethanol was added to the sarkosyl insoluble fraction, which was then sonicated (TAITEC VP-050 sonicator, Taitec Co., Ltd.) and heat-treated at 100°C for 5 minutes before recovery.

[0080] The obtained samples (Sar-sup and Sar-ppt) were electrophoresed on a 13.5% polyacrylamide gel and transferred to a PVDF membrane (Millipore) at 200 mA for 1 hour. The PVDF membrane was blocked with saline containing 3% gelatin (Fujifilm Wako Pure Chemical Industries, Ltd., Cat. #077-03155) for 10 minutes at room temperature, and then incubated overnight at room temperature with primary antibodies (human specific TDP-43 antibody (Proteintech, Cat. #60019-2-Ig) diluted 1:6,000 in saline containing 10% bovine serum (CS: Bovine Serum, ThermoFisher, Cat. #16170-078) and 0.1% NaN3 (10% CS / PBS) or phosphorylated TDP-43 antibody (Cosmo Bio Co., Ltd., Cat. #TIP-PTD-P07) diluted 1:1,000 in saline containing 10% CS / PBS) for 1 hour.

[0081] The PVDF membrane was then washed with several mL of PBS and reacted with secondary antibodies diluted with 10% CS / saline (1:1,000 dilution: Biotin-Goat anti mouse IgG, Vector, Cat. # BA-9200-1.5 or Biotin-Goat anti rabbit IgG, Vector, Cat. # BA-1000-1.5) at room temperature for 1 hour, and then washed with PBS. The PVDF membrane was incubated with peroxidase-labeled avidin-biotin complex (ABC Standard Kit, Vector, Cat. #PK-4000) for 30 min, washed with PBS, and treated with PBS containing 0.1% 3,3'-Diaminobenzidine (Sigma-Aldrich, Cat. #D8001-5G), 0.2 mg / mL nickel(II) chloride hexahydrate (Fujifilm Wako Pure Chemical Industries, Cat. #141-01045), and 0.05% H2O2 (hydrogen peroxide solution, Sigma-Aldrich Japan, Cat. #13-1910-5) to develop the protein bands on the membrane for 10 min. The color development reaction was stopped by washing the PVDF membrane with DW.

[0082] Examination of seed activity of Sarkosyl-insoluble fraction: Preparation of seed fraction (sarkosyl-insoluble fraction) Frozen mouse brain was homogenized in 18 volumes of A68 buffer (10 mM Tris-HCl, pH 7.5 / 1 mM EGTA / 10% sucrose / 0.8 M NaCl) per 0.25 g. 20% Sarkosyl (N-lauroyl sarcosine sodium salt, Sigma-Aldrich, Cat. #L5125-500G) solution was added to the suspension to a final concentration of 1%, and the mixture was stirred and incubated at 37°C for 30 min. The suspension was then centrifuged at 20,400 g for 10 min at room temperature (TOMY MX-307, Tomy Seiko Co., Ltd.), and the supernatant was collected. The supernatant was further centrifuged at 113,000 g for 20 min (himac CS100GXL, Eppendorf Himac Technologies).

[0083] The supernatant was collected as the sarkosyl supernatant fraction (Sar-sup). 500 μL of PBS was added to the precipitate, and the mixture was centrifuged again at 113,000 g for 20 minutes (himac CS100GXL, Eppendorf-Himac Technologies). The supernatant was discarded, and the precipitate was collected as the sarkosyl insoluble fraction (Sar-ppt). 50 μL of saline was added to the obtained sarkosyl insoluble fraction, which was sonicated using a TAITEC VP-050 sonicator, and this was used as the mouse brain-derived seed fraction. As a positive control, a sarkosyl insoluble fraction was also obtained from the ALS patient brain by the same method as above using a frozen brain preparation (0.5 g). 50 μL of saline was added to this, which was sonicated using a TAITEC VP-050 sonicator, and this was used as the human brain-derived seed fraction.

[0084] Adding seed fraction to cells The seed activity of the sarkosyl-insoluble fraction from TDP-43ΔNLS&FL-A expressing mouse brain using cultured cells was determined as follows. 8 x 10 per well in a 6-well plate 5SH-SY5Y cells were seeded and cultured overnight. The next day, the TDP-43 ΔNLS mutant expression plasmid (pcDNA3-TDP-43 ΔNLS) was introduced into the cells using X-treamGENE9 (Roche, Cat. # 6365809001). Specifically, Opti-MEM (ThermoFisher, Cat. # 31985062), plasmid, and X-treamGENE9 were gently mixed in a ratio of 100 μL:1 μg:3 μL and left at room temperature for 15 minutes. The mixture was then dropped into the culture medium in each well. After 3-5 hours, 5 μL of mouse brain-derived seeds or human brain-derived seeds as a positive control were added to the culture medium in each well. The treated cells were incubated in a CO2 incubator and harvested after 2 days as follows.

[0085] Detection of insoluble TDP-43 by immunoblotting The culture medium in each well was removed with an aspirator, and 1 mL of physiological saline was added thereto to detach the cells from the plate and collect them. The cells were collected by centrifugation at 1,800 g for 5 minutes, and 300 μL of 1% sarkosyl (N-lauroyl sarcosine sodium salt, Sigma-Aldrich, Cat. #L5125-500G)-containing A68 buffer (10 mM Tris-HCl, pH 7.5 / 1 mM EGTA / 10% sucrose / 0.8 M NaCl) was added, and the cells were disrupted by treatment with a TAITEC VP-050 ultrasonic treatment device (PWM 17% intensity) for 40-60 seconds.

[0086] After that, 300 μL of A68 buffer containing 1% Sarkosyl was added and centrifuged at 113,000 g for 20 minutes (himac CS100GXL, Eppendorf Himac Technologies). 100 μL of the resulting supernatant was collected and 100 μL of 2x SDS sample buffer (2xSB) containing 5% 2-mercaptoethanol was added. The mixture was heat-treated at 100°C for 5 minutes and collected as Sarkosyl supernatant fraction: Sar-sup. The protein content of the supernatant fraction was quantified by BCA assay (BCA Protein Assay Kit, ThermoFisher, Cat. #23225) using 15 μL of the supernatant.

[0087] On the other hand, the precipitate fraction was added with 50 μL of 2×SB containing 5% 2-mercaptoethanol, then ultrasonicated and heat-treated at 100°C for 5 minutes to recover the sarkosyl-insoluble fraction (Sar-ppt). The obtained samples (Sar-sup and Sar-ppt) were electrophoresed on a 13.5% polyacrylamide gel and transferred to a PVDF membrane (Millipore) at 200 mA for 1 hour. The PVDF membrane was blocked with saline containing 3% gelatin (Fujifilm Wako Pure Chemical Industries, Ltd., Cat. #077-03155) for 10 min at room temperature and then incubated overnight at room temperature with primary antibodies (human specific TDP-43 antibody (Proteintech, Cat. #60019-2-Ig) diluted 1:6,000 in saline containing 10% bovine serum (CS: Bovine Serum, ThermoFisher, Cat. #16170-078) and 0.1% NaN3 (10% CS / saline) or phosphorylated TDP-43 antibody (Cosmo Bio Co., Ltd., Cat. #TIP-PTD-P07) diluted 1:1,000 in saline containing 10% CS / saline).

[0088] The PVDF membrane was then washed with several mL of PBS and reacted with secondary antibodies diluted with 10% CS / saline (1:1,000 dilution: Biotin-Goat anti mouse IgG, Vector, Cat. # BA-9200-1.5 or Biotin-Goat anti rabbit IgG, Vector, Cat. # BA-1000-1.5) at room temperature for 1 hour, and then washed with PBS. The PVDF membrane was incubated with peroxidase-labeled avidin-biotin complex (ABC Standard Kit, Vector, Cat. #PK-4000) for 30 min, washed with PBS, and treated with PBS containing 0.1% 3,3'-Diaminobenzidine (Sigma-Aldrich, Cat. #D8001-5G), 0.2 mg / mL nickel(II) chloride hexahydrate (Fujifilm Wako Pure Chemical Industries, Cat. #141-01045), and 0.05% H2O2 (hydrogen peroxide solution, Sigma-Aldrich Japan, Cat. #13-1910-5) to develop the protein bands on the membrane for 10 min. The color development reaction was stopped by washing the PVDF membrane with DW.

[0089] result: We investigated the relationship between the RNA binding ability and aggregation of TDP-43. It has been reported that the substitution of some Phe in the RNA binding domain of TDP-43 with Leu abolishes its nucleic acid binding ability (Fig. 1). We then prepared mutants in which these Phe were substituted with Leu (FL mutants, Fig. 1) and transiently expressed them in cultured cells, and observed intracellular aggregates positive for phosphorylated TDP-43 antibodies (Fig. 2). Furthermore, biochemical analysis of lysates from FL mutant-expressing cells (Fig. 3) revealed that a phosphorylated TDP-43 antibody-positive band was observed in the detergent sarkosyl (Sar)-insoluble fraction (Sar-ppt) in FL-A mutant-expressing cells, confirming that this mutant aggregates most strongly in cells. Furthermore, in cells expressing a mutant (ΔNLS&FL-ABC) that has both FL mutations and a deletion mutation (ΔNLS) in the nuclear localization signal (NLS), significant intracellular accumulation of phosphorylated TDP-43 was observed compared to cells expressing the FL-A mutant.

[0090] From the above results, it was revealed that the expression of FL mutants involved in the nucleic acid binding of TDP-43 in cultured cells results in the accumulation of phosphorylated TDP-43 in the cells. In addition, considering that FL-A exhibits the strongest aggregation among FL mutations (Figure 1) and that its accumulation is significantly increased by introducing a mutation that removes the NLS (Figure 3), we created a new mutant called TDP-43 ΔNLS&FL-A by introducing these two mutations and examined whether intracellular accumulation of phosphorylated TDP-43 occurs in mouse brain when this mutant is expressed in mouse brain. According to the usual method, an AAV virus (serotype: AAV-PHP.eB) expressing TDP-43 ΔNLS&FL-A was produced using HEK293 cells. The medium of the cells into which the plasmid was introduced was collected, the virus liquid was concentrated by ultrafiltration, and its concentration was measured by real-time PCR. 1.0 × 10 8 vg or 1.0×10 9 We inoculated vg into the striatum of both sides of the adult mouse brain. One or three months after virus inoculation, the brains were excised, and the right brain was subjected to biochemical analysis (immunoblot), and the left brain was subjected to immunohistochemical analysis (Fig. 4).

[0091] Mouse brains (right brain) one month after AAV infection were homogenized in a buffer containing sarkosyl, and the supernatant (soluble fraction: Sar-sup) and precipitate (insoluble fraction: Sar-ppt) were collected by centrifugation and subjected to immunoblot analysis. Analysis of the Sar-sup fraction shown in Figure 5 confirmed the expression of the target TDP-43 ΔNLS&FL-A in the virus-infected mice (band indicated by the red arrow in Figure 5). The amount of expression was dependent on the amount of virus inoculated into the mouse brain, reaching 1.0 × 10 9 The expression of vg was observed in the brains of mice infected with AAV. On the other hand, no expression was observed in mice inoculated with saline instead of the virus. Next, the immunoblot results of the Sar-ppt fraction shown in Figure 6 showed that 1.0 × 10 9A band positive for phosphorylated TDP-43 specific antibody was confirmed in the sarkosyl-insoluble fraction of mouse brain infected with vg AAV (red arrow). The band intensity varied depending on the individual, but the band intensity was significantly higher in saline and 1.0 × 10 8 These bands were not detected in the mouse brain infected with vg AAV. These results indicate that TDP-43 ΔNLS&FL-A expressed in the brain by AAV infection is phosphorylated and aggregated in the cells.

[0092] The results of the biochemical analysis of the AAV-infected mouse brains showed that the expression of TDP-43 ΔNLS&FL-A was 1.0×10 9 Since this was observed prominently in mice infected with the VG virus, immunohistochemical analysis of the mouse brain was performed. 9 One month after infection with vg AAV, mouse brains were removed and the left brain was fixed in formalin. Paraffin blocks were then prepared, and ultrathin slices (8 μm thick slices) were prepared and stained with human TDP-43-specific antibodies and phosphorylated TDP-43-specific antibodies. As a result, as shown in Figure 7, expression of TDP-43 ΔNLS&FL-A was observed in the cerebellum, cerebral cortex, hippocampus, and medial posterior parietal cortex due to AAV virus infection. In addition, when sections of AAV-infected mouse brains were stained with phosphorylated TDP-43-specific antibodies that specifically react with phosphorylated TDP-43 aggregates that appear in the patient brain, positive staining images for phosphorylated TDP-43-specific antibodies were observed in the hippocampus and medial posterior parietal cortex (Figure 8). These results indicate that phosphorylated TDP-43 ΔNLS&FL-A forms aggregates within cells in the AAV-infected mouse brain, demonstrating the construction of a novel mouse model that faithfully reflects the TDP-43 pathology in patient brains.

[0093] It has been reported that TDP-43 accumulated in the brains of ALS and FTLD patients has prion-like properties (6). That is, when insoluble TDP-43 prepared as a sarkosyl-insoluble fraction from the patient brain is introduced into cultured cells expressing TDP-43 ΔNLS, it functions as a seed to induce the aggregation of TDP-43 ΔNLS in the cells (Fig. 9, lane 6). Therefore, we investigated whether TDP-43 ΔNLS&FL-A aggregated in the brains of mice infected with AAV also has prion-like properties, i.e., whether it functions as a seed.

[0094] The sarkosyl-insoluble fraction (e.g., lane 4 in Figure 6) prepared from AAV-infected mouse brain was added with 50 μL of physiological saline and sonicated, and used as insolubilized TDP-43 ΔNLS&FL-A. 5 μL of insolubilized TDP-43 ΔNLS&FL-A was added together with Multifectam Reagent (Promega) to SH-SY5Y cells that had previously expressed TDP-43 ΔNLS. After incubation for several days, the cells were harvested, homogenized in a buffer containing sarkosyl, and centrifuged to obtain the sarkosyl-insoluble fraction (Sar-ppt). This was subjected to immunoblot analysis using a phosphorylated TDP-43-specific antibody.

[0095] When TDP-43 ΔNLS was expressed alone in cultured cells, it did not accumulate in the cells, and therefore almost no band was observed in the Sar-ppt fraction (Fig. 9, lane 3). On the other hand, when insoluble TDP-43 prepared from the brain of an ALS patient was added to the cells as a seed, it functioned as a seed and induced the accumulation of TDP-43 ΔNLS in the cells (Fig. 9, lane 6). Similarly, when insoluble TDP-43 ΔNLS&FL-A prepared from the brain of a mouse infected with AAV was added to the cells, a band positive for phosphorylated TDP-43 specific antibody appeared in the Sar-ppt fraction (Fig. 9, lanes 4 and 5).

[0096] Therefore, it was revealed that the insoluble TDP-43 ΔNLS&FL-A observed in the AAV-infected mouse brain has prion-like properties, similar to the insoluble TDP-43 observed in the patient brain.

Claims

1. A mutant TDP-43 protein in which a nuclear localization signal sequence is deleted in the amino acid sequence of a wild-type TDP-43 protein and which has any one of the following mutations (a1) to (c2) or a combination of these mutations, wherein the mutant TDP-43 protein has aggregation activity in cells. (a1) A mutation in which phenylalanine at positions 147 and 149 is replaced by leucine (a2) A mutation in which the 147th and 149th phenylalanines are replaced by leucines and one or more amino acids other than the 147th and 149th amino acids are deleted, substituted, or added. (b1) A mutation in which phenylalanine at position 194 is replaced by leucine (b2) A mutation in which the 194th amino acid, phenylalanine, is replaced by leucine and one or more amino acids other than the 194th amino acid, are deleted, replaced, or added. (c1) A mutation in which phenylalanine at positions 229 and 231 is replaced by leucine (c2) A mutation in which phenylalanine at positions 229 and 231 is replaced by leucine and one or more amino acids other than the amino acids at positions 229 and 231 are deleted, replaced or added.

2. The mutant TDP-43 protein according to claim 1, wherein the amino acid sequence of the wild-type TDP-43 protein is as shown in SEQ ID NO: 2, 4, 6 or 8.

3. A DNA encoding the mutant TDP-43 protein according to claim 1.

4. A vector comprising the DNA of claim 3.

5. The vector of claim 4, which is an adeno-associated virus vector.

6. A mutant TDP-43 protein accumulation model animal, in which the mutant TDP-43 protein according to claim 1 is expressed in the brain of a non-human mammal.

7. A mutant TDP-43 protein accumulation model cell, into which an aggregate of the mutant TDP-43 protein according to claim 1 has been introduced.

8. The model cell according to claim 7, wherein the mutant TDP-43 protein aggregate is derived from the brain of the model animal according to claim 6.

9. The model cell according to claim 8, wherein aggregates of the mutant TDP-43 protein have seed activity that functions as a seed for intracellular accumulation of the protein.

10. A method for screening a therapeutic agent for a neurodegenerative disease, comprising contacting or administering a test candidate substance to the model animal according to claim 6 or the model cell according to claim 7.

11. A kit for screening therapeutic agents for neurodegenerative diseases, comprising the model animal according to claim 6 or the model cell according to claim 7.

Images