Vaccines against coronavirus and methods of use

JP2025010171A5Active Publication Date: 2025-06-17INOVIO PHARMACEUTICALS INC +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2024184185
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2021-01-13
Filing Date
2024-10-18
Publication Date
2025-06-17
Estimated Expiration
2041-02-25

Smart Images

  • Figure 00000000_0000_ABST
    Figure 00000000_0000_ABST
Patent Text Reader

Abstract

To provide nucleic acid molecules encoding a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), SARS-CoV-2 spike antigens, immunogenic compositions and vaccines, and their use in inducing immune responses and protecting against or treating a SARS-CoV-2 infection in a subject.SOLUTION: A nucleic acid molecule encoding a SARS-CoV-2 spike antigen is provided which comprises: a nucleic acid sequence having at least 99% identity over the entire length of the nucleic acid sequence set forth in nucleotides 55 to 3837 of SEQ ID NO: 2; a nucleic acid sequence having at least 99% identity over the entire length of SEQ ID NO: 2; the nucleic acid sequence of nucleotides 55 to 3837 of SEQ ID NO: 2; and the nucleic acid sequence of SEQ ID NO: 2.SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application is a continuation of U.S. Provisional Application No. 62 / 981,451, filed February 25, 2020, U.S. Provisional Application No. 63 / 004,380, filed April 2, 2020, U.S. Provisional Application No. 63 / 028,404, filed May 21, 2020, U.S. Provisional Application No. 63 / 033,349, filed June 2, 2020, U.S. Provisional Application No. 63 / 040,865, filed June 18, 2020, U.S. Provisional Application No. 63 / 046,415, filed June 30, 2020, U.S. Provisional Application No. 63 / 062,762, filed August 7, 2020, and U.S. Provisional Application No. 63 / 070,462, filed August 2, 2020. This application claims the benefit of U.S. Provisional Application No. 63 / 114,858, filed November 17, 2019, U.S. Provisional Application No. 63 / 130,593, filed December 24, 2020, U.S. Provisional Application No. 63 / 136,973, filed January 13, 2021, U.S. Provisional Application No. 62 / 981,168, filed February 25, 2020, U.S. Provisional Application No. 63 / 022,032, filed May 8, 2020, U.S. Provisional Application No. 63 / 056,996, filed July 27, 2020, and U.S. Provisional Application No. 63 / 063,157, filed August 7, 2020. The contents of each of these applications are incorporated herein by reference in their entirety.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted electronically as a text file named “104409_000596_SL.txt”, created on February 24, 2021, which is 58,410 bytes in size. The Sequence Listing is incorporated herein by reference.

[0003] The present invention relates to vaccines against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and methods of administering the vaccines. [Background technology]

[0004] COVID-19, previously known as 2019-nCoV pneumonia or disease, has rapidly emerged as a global threat to public health, joining the growing list of coronavirus-related illnesses transmitted from animals to people, Severe Acute Respiratory Syndrome (SARS) and Middle East Respiratory Syndrome (MERS). There is an urgent need for medical countermeasures, such as vaccines, to combat the spread of these novel coronaviruses. There are at least seven identified human-infecting coronaviruses, including MERS-CoV and SARS-CoV.

[0005] In December 2019, the city of Wuhan, China, became the epicenter of the global novel coronavirus pandemic. This coronavirus, SARS-CoV-2, was isolated and sequenced from human airway epithelial cells from infected patients (Zhu, et al. A Novel Coronavirus from Patients with Pneumonia in China, 2019. N Engl J Med. 2020, Wu, et al. A novel coronavirus associated with human respiratory disease in China. Nature. 2020). Disease symptoms can range from mild flu-like to severe cases with life-threatening pneumonia (Huang, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020). The global situation is dynamically evolving, and on January 30, 2020, the World Health Organization declared COVID-19 a Public Health Emergency of International Concern (PHEIC). Summary of the Invention

[0006] Provided herein are nucleic acid molecules encoding SARS-CoV-2 spike antigens. According to some embodiments, the encoded SARS-CoV-2 spike antigen is a consensus antigen. In some embodiments, the nucleic acid molecule comprises a nucleic acid sequence having at least about 90% identity over the entire length of the nucleic acid sequence set forth in nucleotides 55-3837 of SEQ ID NO:2, a nucleic acid sequence having at least about 90% identity over the entire length of SEQ ID NO:2, a nucleic acid sequence from nucleotides 55-3837 of SEQ ID NO:2, a nucleic acid sequence from SEQ ID NO:2, a nucleic acid sequence having at least about 90% identity over the entire length of SEQ ID NO:3, a nucleic acid sequence from SEQ ID NO:3, a nucleic acid sequence having at least about 90% identity over the entire length of nucleotides 55-3837 of SEQ ID NO:5, a nucleic acid sequence having at least about 90% identity over the entire length of SEQ ID NO:5, a nucleic acid sequence from nucleotides 55-3837 of SEQ ID NO:5, a nucleic acid sequence having at least about 90% identity over the entire length of SEQ ID NO:6, or a nucleic acid sequence from SEQ ID NO:6. Also provided herein is a nucleic acid molecule encoding a SARS-CoV-2 spike antigen, wherein the SARS-CoV-2 spike antigen comprises an amino acid sequence having at least about 90% identity over the entire length of residues 19-1279 of SEQ ID NO:1, an amino acid sequence set forth in residues 19-1279 of SEQ ID NO:1, an amino acid sequence having at least about 90% identity over the entire length of SEQ ID NO:1, an amino acid sequence of SEQ ID NO:1, an amino acid sequence having at least about 90% identity over the entire length of residues 19-1279 of SEQ ID NO:4, an amino acid sequence having at least about 90% identity over the entire length of SEQ ID NO:4, an amino acid sequence set forth in residues 19-1279 of SEQ ID NO:4, or the amino acid sequence of SEQ ID NO:4.

[0007] In some embodiments, a nucleic acid molecule encoding a SARS-CoV-2 antigen is incorporated into a viral particle.

[0008] Further provided is a vector comprising a nucleic acid molecule encoding a SARS-CoV-2 antigen. In some embodiments, the vector is an expression vector. The nucleic acid molecule can be operably linked to a regulatory element selected from a promoter and a polyadenylation signal. The expression vector can be a plasmid or a viral vector.

[0009] The immunogenic composition is disclosed, which comprises an effective amount of vector or virus particle. The immunogenic composition may comprise a pharma-ceutically acceptable excipient, such as, but not limited to, a buffer. The buffer may optionally be a saline-sodium citrate buffer. In some embodiments, the immunogenic composition comprises an adjuvant.

[0010] Also provided herein is a SARS-CoV-2 spike antigen. According to some embodiments, the SARS-CoV-2 spike antigen is a consensus antigen. In some embodiments, the SARS-CoV-2 spike antigen comprises an amino acid sequence having at least about 90% identity over the entire length of residues 19-1279 of SEQ ID NO:1, an amino acid sequence set forth in residues 19-1279 of SEQ ID NO:1, an amino acid sequence having at least about 90% identity over the entire length of SEQ ID NO:1, an amino acid sequence of SEQ ID NO:1, an amino acid sequence having at least about 90% identity over the entire length of residues 19-1279 of SEQ ID NO:4, an amino acid sequence having at least about 90% identity over the entire length of SEQ ID NO:4, an amino acid sequence set forth in residues 19-1279 of SEQ ID NO:4, or an amino acid sequence of SEQ ID NO:4.

[0011] Further provided herein is a vaccine for the prevention or treatment of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) infection. The vaccine comprises an effective amount of any one or combination of the aforementioned nucleic acid molecules, vectors, or antigens. According to some embodiments, the vaccine further comprises a pharmaceutically acceptable excipient. The pharmaceutically acceptable excipient may be a buffer, optionally a saline-sodium citrate buffer. According to some embodiments, the vaccine further comprises an adjuvant.

[0012] Further provided are methods of inducing an immune response against Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) in a subject in need thereof. In emerging embodiments, the method of inducing an immune response comprises administering to the subject an effective amount of any one or combination of the aforementioned nucleic acid molecules, vectors, immunogenic compositions, antigens, or vaccines. Also provided herein are methods of protecting a subject in need thereof from infection with SARS-CoV-2, the method comprising administering to the subject an effective amount of any one or combination of the aforementioned nucleic acid molecules, vectors, immunogenic compositions, antigens, or vaccines. Further provided are methods of treating SARS-CoV-2 infection in a subject in need thereof, the method comprising administering to the subject an effective amount of any one or combination of the aforementioned nucleic acid molecules, vectors, immunogenic compositions, antigens, or vaccines. In any of these methods, administering may comprise at least one of electroporation and injection. According to some embodiments, administering comprises parenteral administration, for example by intradermal, intramuscular, or subcutaneous injection, optionally followed by electroporation. In some embodiments of the disclosed method, an initial dose of about 0.5 mg to about 2.0 mg of the nucleic acid molecule is administered to the subject, optionally the initial dose is 0.5 mg, 1.0 mg, or 2.0 mg of the nucleic acid molecule. The method may further comprise administering to the subject a subsequent dose of about 0.5 mg to about 2.0 mg of the nucleic acid molecule about 4 weeks after the initial dose, optionally the subsequent dose is 0.5 mg, 1.0 mg, or 2.0 mg of the nucleic acid molecule. In yet a further embodiment, the method comprises administering to the subject one or more additional subsequent doses of about 0.5 mg to about 2.0 mg of the nucleic acid molecule at least 12 weeks after the initial dose, optionally the additional subsequent dose is 0.5 mg, 1.0 mg, or 2.0 mg of the nucleic acid molecule. In any of these embodiments, INO-4800 or a biosimilar thereof is administered.

[0013] Also provided herein is the use of any one or combination of the disclosed nucleic acid molecules, vectors, immunogenic compositions, antigens, or vaccines in a method of inducing an immune response against Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) in a subject in need thereof. Further provided is the use of any one or combination of the disclosed nucleic acid molecules, vectors, immunogenic compositions, antigens, or vaccines in a method of protecting a subject from infection with Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2). Also provided herein is the use of any one or combination of the disclosed nucleic acid molecules, vectors, immunogenic compositions, antigens, or vaccines in a method of treating a subject in need thereof against SARS-CoV-2 infection. In accordance with any of these uses, the nucleic acid molecules, vectors, immunogenic compositions, antigens, or vaccines may be administered to the subject by at least one of electroporation and injection. In some embodiments, the nucleic acid molecules, vectors, immunogenic compositions, antigens, or vaccines are administered parenterally to the subject, followed by electroporation. In some embodiments of the disclosed use, an initial dose of about 0.5 mg to about 2.0 mg of the nucleic acid molecule is administered to the subject, optionally the initial dose is 0.5 mg, 1.0 mg, or 2.0 mg of the nucleic acid molecule. The use may further comprise administering to the subject a subsequent dose of about 0.5 mg to about 2.0 mg of the nucleic acid molecule about 4 weeks after the initial dose, optionally the subsequent dose is 0.5 mg, 1.0 mg, or 2.0 mg of the nucleic acid molecule. In yet a further embodiment, the use comprises administering to the subject one or more additional subsequent doses of about 0.5 mg to about 2.0 mg of the nucleic acid molecule at least 12 weeks after the initial dose, optionally the additional subsequent dose is 0.5 mg, 1.0 mg, or 2.0 mg of the nucleic acid molecule. In any of these embodiments, INO-4800 or a biosimilar thereof is administered.

[0014] Further provided herein is the use of any one or combination of the disclosed nucleic acid molecules, vectors, immunogenic compositions, antigens, or vaccines in the preparation of a medicament. In some embodiments, the medicament is for treating or protecting against infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). In some embodiments, the medicament is for treating or protecting against a disease or disorder associated with SARS-CoV-2 infection. In some embodiments, the medicament is for treating or protecting against coronavirus disease 2019 (COVID-19), multisystem inflammatory syndrome in adults (MIS-A), or multisystem inflammatory syndrome in children (MIS-C).

[0015] The present invention further relates to a method for detecting a sustained cellular immune response in a subject, the method comprising the steps of administering to a subject in need thereof an immunogenic composition for inducing an immune response against a SARS-CoV-2 antigen, isolating peripheral mononuclear cells (PBMCs) from the subject, stimulating the isolated PBMCs with a spike antigen comprising an amino acid sequence selected from the group consisting of the amino acid sequence set forth in residues 19-1279 of SEQ ID NO: 1, the amino acid sequence set forth in residues 19-1279 of SEQ ID NO: 4, or the amino acid sequence of SEQ ID NO: 4, or a fragment thereof comprising at least 20 amino acids, and detecting at least one of the number of cytokine-expressing cells and the level of cytokine expression. In one embodiment, detecting at least one of the number of cytokine-expressing cells and the level of cytokine expression is performed using enzyme-linked immunospot (ELISpot) or intracellular cytokine staining (ICS) analysis using flow cytometry.

[0016] In one embodiment, a subject is administered an immunogenic composition comprising a nucleic acid molecule, wherein the nucleic acid molecule comprises a nucleotide sequence encoding a peptide comprising an amino acid sequence having at least about 90% identity over the entire length of residues 19-1279 of SEQ ID NO:1, an amino acid sequence set forth in residues 19-1279 of SEQ ID NO:1, an amino acid sequence having at least about 90% identity over the entire length of SEQ ID NO:1, an amino acid sequence of SEQ ID NO:1, an amino acid sequence having at least about 90% identity over the entire length of residues 19-1279 of SEQ ID NO:4, an amino acid sequence having at least about 90% identity over the entire length of SEQ ID NO:4, an amino acid sequence set forth in residues 19-1279 of SEQ ID NO:4, or the amino acid sequence of SEQ ID NO:4. [Brief description of the drawings]

[0017] [Figure 1]Figures 1A, 1B, 1C, and 1D show the design and expression of SARS-CoV-2 synthetic DNA vaccine constructs. Figure 1A shows a schematic of the pGX9501 (matched) and pGX9503 (outlier (OL)) SARS-CoV-2 synthetic DNA vaccine constructs containing an IgE leader sequence and a SARS-CoV-2 spike protein insert ("Covid-19 spike antigen" or "Covid-19 spike-OL antigen"). Figure 1B shows the results of RT-PCR assays of RNA extracts from COS-7 cells doubly transfected with pGX9501 or pGX9503. Extracted RNA was analyzed by RT-PCR using PCR assays designed for each target and for COS-7 β-actin mRNA used as an internal expression normalization gene. Delta CT (ΔCT) was calculated as the CT of the target minus the CT of β-actin for each transfection concentration and plotted against the logarithm of the mass of pDNA transfected (plotted as the mean ± SD). Figure 1C shows the analysis of in vitro expression of spike protein after transfection of 293T cells with pGX9501, pGX9503, or MOCK plasmids by Western blot. 293T cell lysates were resolved on gels and probed with polyclonal anti-SARS spike protein. Blots were stripped and then probed with anti-β-actin loading control. Figure 1D shows in vitro immunofluorescence staining of 293T cells transfected with 3 μg / well of pGX9501, pGX9503, or pVax (empty control vector). Spike protein expression was measured with polyclonal anti-SARS spike protein IgG and anti-IgG secondary. Cell nuclei were counterstained with DAPI. Images were captured using an ImageXpress™ Pico automated cell imaging system. [Diagram 2]Figure 1 shows IgG binding screening of a panel of SARS-CoV-2 and SARS-CoV antigens using serum from INO-4800-treated mice. BALB / c mice were immunized on day 0 with 25 μg INO-4800 or pVAX-empty vector (control) as described in Methods. Protein antigen binding of IgG at 1:50 and 1:250 serum dilutions from mice on day 14. Data shown represent the mean OD450nm values ​​(mean + SD) for each group of 4 mice. [Diagram 3] Figures 3A, 3B, 3C, and 3D show humoral responses to SARS-CoV-2 S 1+2 and S receptor binding domain (RBD) protein antigens in BALB / c mice after a single dose of INO-4800. BALB / c mice were immunized with the indicated doses of INO-4800 or pVAX-empty vector as described in Example 1 on day 0. IgG binding to SARS-CoV-2 S1+2 (Figure 3A) or SARS-CoV-2 RBD (Figure 3B) protein antigens in serial serum dilutions from mice on day 14 is shown. Data shown represent the mean OD450 nm values ​​(mean + SD) for each group of 8 mice (Figures 3A and 3B) and 5 mice (Figures 3C and 3D). Serum IgG binding endpoint titers to SARS-CoV-2 S1+2 (Figure 3B) and SARS-CoV-2 RBD (Figure 3D) proteins. Data representative of two independent experiments. [Figure 4A] Figures 4A and 4B show neutralizing antibody responses after immunization with INO-4800. BALB / c mice (n of 5 per group) were immunized twice with 10 μg INO-4800 on days 0 and 14. Serum was collected 7 days after the second immunization and serial dilutions were incubated with pseudoviruses displaying SARS-CoV-2 spikes and co-incubated with ACE2-293 T cells. Figure 4A shows neutralizing ID50 (mean ± SD) in naive and INO-4800-immunized mice. Figure 4B shows relative luminescence units (RLU) for sera from naive mice and mice vaccinated with INO-4800 as described in the methods. [Figure 4B] Same as above. [Diagram 5] Figures 5A and 5B show humoral responses to SARS-CoV-2 in Hartley guinea pigs after a single dose of INO-4800. Hartley guinea pig mice were immunized on day 0 with 100 μg of INO-4800 or pVAX-empty vector as described in Example 1. Figure 5A shows IgG SARS-CoV-2 S protein antigen binding in serial serum dilutions on days 0 and 14. Data shown represent the mean OD450 nm values ​​(mean + SD) for five guinea pigs. Figure 5B shows serum IgG binding titers to SARS-CoV-2 S protein on day 14 (mean ± SD). P values ​​were determined by Mann-Whitney test. [Figure 6]Figures 6A-6F show that INO-4800 immunized mouse and guinea pig sera compete with the ACE2 receptor for SARS-CoV-2 spike protein binding. Figure 6A shows that soluble ACE2 receptor binds to CoV-2 full-length spike with an EC50 of 0.025 μg / ml. Figure 6B shows that purified serum IgG from BALB / c mice (n of 5 per group) after the second immunization with INO-4800 produces significant competition for the ACE2 receptor. Serum IgG samples from animals were run in triplicate. Figure 6C shows that purified IgG from n=5 mice 7 days after the second immunization with INO-4800 shows significant competition for ACE2 receptor binding to SARS-CoV-2 S 1+2 protein. Soluble ACE2 concentration for the competition assay is approximately 0.1 μg / ml. Bars represent the mean and standard deviation of AUC. Figure 6D shows Hartley guinea pigs immunized on days 0 and 14 with 100 μg INO-4800 or pVAX-empty vector as described in the methods. Serum (1:20 dilution) collected on day 28 was added to SARS-CoV-2 coated wells before the addition of serial dilutions of ACE2 protein. Detection of ACE2 binding to SARS-CoV-2 S protein was measured. Serum collected from 5 INO-4800-treated and 3 pVAX-treated animals was used in this experiment. Figure 6E shows serial dilutions of guinea pig serum collected on day 21 was added to SARS-CoV-2 coated wells before the addition of ACE2 protein. Detection of ACE2 binding to SARS-CoV-2 S protein was measured. Serum collected from 4 INO-4800-treated and 5 pVAX-treated guinea pigs was used in this experiment. Figure 6F shows purified IgG from n=5 mice 14 days after the second immunization with INO-4800, compared to pooled naive mouse IgG, showing competition for ACE2 receptor binding to SARS-CoV-2 spike protein. Naive mice were run in a single column. Vaccinated mice were run in duplicate. Where error bars are not shown, the error is smaller than the data points. [Figure 7]Figures 7A-7D show detection of SARS-CoV-2 S protein-reactive antibodies in the BAL of INO-4800-immunized animals. BALB / c mice (n of 5 per group) were immunized with INO-4800 or pVAX on days 0 and 14, and BAL was collected on day 21 (Figures 7A and 7B). Hartley guinea pigs (n of 5 per group) were immunized with INO-4800 or pVAX on days 0, 14, and 21, and BAL was collected on day 42 (Figures 7C and 7D). Bronchoalveolar lavage fluids were assayed in duplicate for SARS-CoV-2 spike protein-specific IgG antibodies by ELISA. Data are presented as endpoint titers (Figures 7A and 7C), and BAL dilution curves with raw OD450nm values ​​(Figures 7B and 7D). In Figures 7A and 7C, bars represent the mean for each group, and error bars represent standard deviation. **p<0.01 by Mann-Whitney U test. [Figure 8] Figures 8A-8C show the induction of T cell responses in BALB / c mice after administration of INO-4800. BALB / c mice (n=5 / group) were immunized with 2.5 or 10 μg of INO-4800. T cell responses were analyzed in animals on days 4, 7, 10 (Figures 8A and 8B), and 14 (Figure 8C). T cell responses were measured by IFN-γ ELISpot in splenocytes stimulated for 20 h with overlapping peptide pools spanning the SARS-CoV-2 (Figure 8A), SARS-CoV (Figure 8B), or MERS-CoV (Figure 8C) spike proteins. Bars represent mean values ​​+ SD. [Figure 9] Figures 9 and 10 show cellular and humoral immune responses measured in New Zealand White (NZW) rabbits treated with INO-4800. Intradermal delivery of pDNA on days 0 and 28. PBMC IFN-γ ELISpot (Figure 9), serum IgG binding ELISA (Figure 10). [Figure 10] Same as above. [Figure 11A]11A-11E show humoral immune responses to SARS-CoV-2 spike protein measured in rhesus macaques treated with INO-4800. Intradermal delivery of pDNA on days 0 and 28. Serum IgG binding ELISA. [Figure 11B] Same as above. [Figure 11C] Same as above. [Figure 11D] Same as above. [Figure 11E] Same as above. [Figure 12A] 12A-12G show humoral immune responses against SARS and MERS spike proteins measured in rhesus macaques treated with INO-4800. Intradermal delivery of pDNA on days 0 and 28. Serum IgG binding ELISA. (FIGS. 12A-12G; left panels, 1 mg INO-4800; right panels, 2 mg INO-4800). [Figure 12B] Same as above. [Figure 12C] Same as above. [Figure 12D] Same as above. [Figure 12E] Same as above. [Figure 12F] Same as above. [Figure 12G] Same as above. [Figure 13A] Figures 13A-13C show cellular immune responses measured by PBMC IFN-γ ELISpot in rhesus macaques treated with INO-4800 after intradermal delivery of pDNA on days 0 and 28. Results are shown in Figures 13A (SARS CoV-2 spike peptide), 13B (SARS CoV spike peptide), and 13C (MERS CoV spike peptide). [Figure 13B] Same as above. [Figure 13C] Same as above. [Figure 14]Figures 14A and 14B show T cell epitope mapping following administration of INO-4800 to BALB / c mice. Splenocytes were stimulated with SARS-CoV-2 peptide matrix mapping pools for 20 hours. Figure 14A shows T cell responses following stimulation with matrix mapping SARS-CoV-2 peptide pools. Bars represent mean + SD of 5 mice. Figure 14B shows a map of the SARS-CoV-2 spike protein and identification of immunodominant peptides in BALB / c mice. Known immunodominant SARS-CoV HLA-A2 epitopes are included for comparison. Figure 14B discloses SEQ ID NOs: 26-35, respectively, in order of appearance. [Figure 15] Figures 15A-15H show humoral correlates of protection in the throat and nasal compartments. (Figures 15A-15D) Correlation of throat viral load Log10 cDNA copies mL-1 on days 1 (Figures 15A, 15B) and 3 (Figures 15C, 15D) after SARS-CoV-2 challenge with microneutralization titers (Figures 15A, 15C) and RBD IgG binding endpoint titers (Figures 15B, 15D). (Figures 15E-15H) Same analysis for nasal viral load. P-values ​​and R-values ​​provided for two-tailed nonparametric Spearman rank correlation analysis. Control animals - red filled circles, INO-4800 X1 - green filled circles, and INO-4800 X2 - blue filled circles. [Figure 16] A flow diagram of Phase I trials is shown. [Figure 17A]Figures 17A, 17B, 17C, and 17D show humoral antibody responses from a Phase I clinical trial. The humoral responses in the 1.0 mg and 2.0 mg dose groups were evaluated for their ability to neutralize live virus (n=18, 1.0 mg; n=19, 2.0 mg) (Figure 17A), bind to the RBD region (Figure 17B), and bind to the entire spike protein (S1 and S2) (Figure 17C). The endpoint titer was calculated as the titer that showed an OD3.0 SD above baseline, with the baseline titer set to 1. In Figure 17D, the humoral responses in the 1.0 mg and 2.0 mg dose groups were evaluated for their ability to bind to the entire spike protein (S1 and S2) (n=19, 1.0 mg; n=19, 2.0 mg). The endpoint titer was calculated as the titer that showed an OD3.0 SD above baseline, with the baseline titer set to 1. Responses to live virus neutralization had a PRNT IC50 > 10. In all graphs, horizontal lines represent medians and bars represent interquartile ranges. [Figure 17B] Same as above. [Figure 17C] Same as above. [Figure 17D] Same as above. [Figure 18A]Figures 18A-18G show cellular immune response analysis results from a Phase I clinical trial. PBMCs isolated from vaccinated individuals were stimulated in vitro with SARS-CoV-2 spike antigen. The number of cells capable of secreting IFN-gamma was measured in a standard ELISpot assay for the 1.0 mg and 2.0 mg dose groups (Figure 18A). The horizontal lines represent the median and the bars represent the interquartile range. As shown in Figure 18B, peptides spanning the entirety of the spike antigen were divided into pools, and the pools were mapped to specific regions of the antigen and tested individually in ELISpot. Three subjects are shown to illustrate the diversity of pool responses and associated magnitude across subjects. The pie chart represents the overall diversity of the 2.0 mg dose group. As shown in Figure 18C, SARS-CoV-2 spike-specific cytokine production was measured from CD4+ and CD8+ T cells by flow cytometry. The bars represent the average response. Cytokine production is further divided into central memory (CM), effector memory (EM) or effector (E) differentiation states using CCR7 and CD45RA in FIG. 18D, with data conveying what percentage of the overall cytokine response comes from which differentiation group. Pie charts represent the polyfunctionality of CD4+ and CD8+ T cells for each dose cohort and are provided in FIG. 18E. IL-4 production by CD4+ T cells for each dose cohort is shown in FIG. 18F. Horizontal lines represent the mean response. Graphs represent all evaluable subjects. Statistical analysis was performed on all paired data sets. Significant results are noted in the figure, and no notation in the figure represents lack of statistical significance. FIG. 18G provides a heat map of each subject in the 2.0 mg dose group and their percentage of ELISpot responses specific to each pool containing SARS-CoV-2 spike antigen. [Figure 18B] Same as above. [Figure 18C] Same as above. [Figure 18D] Same as above. [Figure 18E] Same as above. [Figure 18F] Same as above. [Figure 18G] Same as above. [Figure 19] Phase I-related systemic and local adverse events were classified as mild (grade 1), moderate (grade 2), severe (grade 3), and life-threatening (grade 4). [Figure 20] Supplementary data on humoral immune responses are provided. Three convalescent samples (all three symptomatic but not hospitalized) tested by ELISpot assay showed lower T cell responses than the 2.0 mg dose group at week 8, with a median of 33. [Figure 21] Complementary enzyme-linked immunospot (ELISpot) data are provided. [Figure 22] Figures 22A-22F show humoral and cellular responses in rhesus macaques vaccinated with INO-4800. Study overview (Figure 22A). Spike-specific IgG (Figure 22B), RBD (Figure 22C), and live virus neutralizing antibodies (Figure 22D) were measured in serum from rhesus macaques that received one or two doses of INO-4800 or were not vaccinated (control). Lines represent geometric means. Cellular immune responses in rhesus macaques vaccinated with INO-4800. SARS-CoV-2 spike-specific interferon gamma from PBMCs.

number

[0018] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. In case of conflict, the present specification, including definitions, will prevail. Although similar or equivalent methods and materials to those described herein can be used in carrying out or testing the present invention, preferred methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and are not intended to be limiting.

[0019] The term "comprising" is intended to include examples encompassed by the terms "consisting essentially of" and "consisting of," and similarly, the term "consisting essentially of" is intended to include examples encompassed by the term "consisting of." The present disclosure also contemplates other embodiments that "comprise," "consist of," and "consist essentially of" the embodiments or elements presented herein, whether or not explicitly stated.

[0020] It should be understood that certain features of the disclosed materials and methods that are, for clarity, described herein in the context of separate embodiments, can also be provided in combination in a single embodiment. Conversely, various features of the disclosed materials and methods that are, for brevity, described in the context of a single embodiment, can also be provided separately or in any subcombination.

[0021] The singular forms "a," "and," and "the" include plural references unless the context clearly dictates otherwise.

[0022] When used in reference to a numerical range, cut-off, or specific value, the term "about" is used to indicate that the recited value may vary by up to 10% from the recited value. Thus, the term "about" is used to encompass no more than ±10% variation, no more than ±5% variation, no more than ±1% variation, no more than ±0.5% variation, or no more than ±0.1% variation from the specified value. When values ​​are expressed as approximations by use of the antecedent "about," it will be understood that the particular value forms another embodiment. Reference to a particular numerical value includes at least that particular value unless the context clearly dictates otherwise.

[0023] As used herein, "adjuvant" means any molecule added to the vaccines described herein to enhance the immunogenicity of an antigen.

[0024] As used herein, "antibody" refers to an antibody of class IgG, IgM, IgA, IgD, or IgE, or fragments, fragments or derivatives thereof, including Fab, F(ab')2, Fd, and single chain antibodies, diabodies, bispecific antibodies, bifunctional antibodies, and derivatives thereof. The antibody may be an antibody isolated from a mammalian serum sample, a polyclonal antibody, an affinity purified antibody, or a mixture thereof, which exhibits sufficient binding specificity for the desired epitope or a sequence derived therefrom.

[0025] The term "biosimilar" (of an approved reference product / biological drug, i.e., a drug listed in the reference) refers to a biological product that is highly similar to the reference product with minor differences in clinically inactive ingredients, but no clinically meaningful differences between the biosimilar and the reference product, with respect to safety, purity, and potency, based on data obtained from (a) analytical studies showing that the biological product is highly similar to the reference product, with minor differences in clinically inactive ingredients, (b) animal studies (including evaluation of toxicity), and / or (c) clinical studies or studies (including evaluation of immunogenicity and pharmacokinetics or pharmacodynamics) sufficient to demonstrate safety, purity, and potency in one or more appropriate conditions of use for which the reference product is licensed and intended to be used, and for which licensing is sought for the biosimilar. Biosimilars can be interchangeable products that can be substituted for the reference product in pharmacies without the intervention of a prescribing healthcare professional. To meet the additional criteria of "interchangeability," the biosimilar is expected to produce the same clinical outcome as the reference product in any given patient, and if the biosimilar is administered multiple times to an individual, the risks in terms of safety or reduced effectiveness of alternating or switching between use of the biosimilar and use of the reference product are not greater than the risks of using the reference product without such alternation or switching. The biosimilar utilizes the same mechanism of action for the proposed conditions of use to the extent that the mechanism is known for the reference product. One or more conditions of use specified, recommended, or suggested in the proposed labeling for the biosimilar have previously been approved for the reference product. The route of administration, dosage form, and / or strength of the biosimilar are the same as those of the reference product, and the biosimilar is manufactured, processed, packaged, or held in a facility that meets standards designed to ensure that the biosimilar remains safe, pure, and effective. The biosimilar may contain minor modifications in the amino acid sequence, such as N- or C-terminal truncations, that are not expected to alter the biosimilar performance compared to the reference product.

[0026] As used herein, a "coding sequence" or "encoding nucleic acid" refers to a nucleic acid (RNA or DNA molecule) that comprises a nucleotide sequence that codes for a protein. The coding sequence may further comprise initiation and termination signals operably linked to regulatory elements including a promoter, and a polyadenylation signal capable of directing expression in cells of an individual or mammal to which the nucleic acid is administered.

[0027] As used herein, "complement" or "complementary" refers to Watson-Crick (eg, AT / U and CG) or Hoogsteen base pairing between nucleotides or nucleotide analogs of a nucleic acid molecule.

[0028] As used herein, "consensus" or "consensus sequence" may refer to a synthetic nucleic acid sequence, or a corresponding polypeptide sequence, constructed based on the analysis of an alignment of multiple subtypes of a particular antigen. This sequence may be used to induce broad immunity against multiple subtypes, serotypes, or strains of a particular antigen. Synthetic antigens, such as fusion proteins, may be engineered to generate consensus sequences (or consensus antigens).

[0029] "Electroporation," "electropermeabilization," or "electrokinetic enhancement" ("EP"), as used interchangeably herein, refers to the use of transmembrane electric field pulses to induce microscopic pathways (pores) in biological membranes, the presence of which allows biomolecules such as plasmids, oligonucleotides, siRNA, drugs, ions, and water to pass from one side of the cell membrane to the other.

[0030] As used herein, a "fragment" refers to a nucleic acid sequence or a portion thereof that encodes a polypeptide capable of eliciting an immune response in a mammal. The fragment may be a DNA fragment selected from at least one of the various nucleotide sequences encoding the protein fragments described below.

[0031] "Fragment" or "immunogenic fragment" with respect to a polypeptide sequence means a polypeptide capable of eliciting an immune response in a mammal that cross-reacts with a full-length wild-type strain SARS-CoV-2 antigen. A fragment of a consensus protein may comprise at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% of the consensus protein. In some embodiments, a fragment of a consensus protein may comprise at least 20 or more amino acids, at least 30 or more amino acids, at least 40 or more amino acids, at least 50 or more amino acids, at least 60 or more amino acids, at least 70 or more amino acids, at least 80 or more amino acids, at least 90 or more amino acids, at least 100 or more amino acids, at least 110 or more amino acids, at least 120 or more amino acids, at least 130 or more amino acids, at least 140 or more amino acids, at least 150 or more amino acids, at least 160 or more amino acids, at least 170 or more amino acids, at least 180 or more amino acids, at least 190 or more amino acids, at least 200 or more amino acids, at least 210 or more amino acids, at least 220 or more amino acids, at least 230 or more amino acids, or at least 240 or more amino acids of the consensus protein.

[0032] As used herein, the term "genetic construct" refers to a DNA or RNA molecule that contains a nucleotide sequence that codes for a protein. The coding sequence includes a start and stop signal that is operably linked to a regulatory element that includes a promoter and a polyadenylation signal that can direct expression in the cells of an individual to which the nucleic acid molecule is administered. As used herein, the term "expressible form" refers to a genetic construct that includes the necessary regulatory elements operably linked to a coding sequence that codes for a protein, such that the coding sequence is expressed when present in the cells of an individual.

[0033] "Identical" or "identity" as used herein in the context of two or more nucleic acid or polypeptide sequences means that the sequences have a specified percentage of residues that are the same over a specified region. The percentage can be calculated by optimally aligning the two sequences, comparing the two sequences in a specified region, determining the number of positions where identical residues occur in both sequences to calculate the number of matching positions, dividing the number of matching positions by the total number of positions in the specified region, and multiplying the result by 100 to obtain the percentage of sequence identity. If the two sequences are of different length or the alignment produces one or more staggered ends and only a single sequence is included in the specified comparison region, the residues of the single sequence are included in the denominator but not in the numerator of the calculation. When comparing DNA and RNA, thymine (T) and uracil (U) can be considered equivalent. Identity can be performed manually or using a computer sequence algorithm such as BLAST or BLAST 2.0.

[0034] As used herein, "immune response" refers to the activation of a host's immune system, e.g., a mammal's immune system, in response to the introduction of an antigen. The immune response can be in the form of a cellular or humoral response, or both.

[0035] As used herein, "nucleic acid" or "oligonucleotide" or "polynucleotide" or "nucleic acid molecule" refers to at least two nucleotides covalently linked to each other. The depiction of a single strand also defines the sequence of the complementary strand. Thus, the nucleic acid also encompasses the complementary strand of the depicted single strand. Many variants of a nucleic acid can be used for the same purpose as a given nucleic acid. Thus, the nucleic acid also encompasses substantially identical nucleic acids and their complements. A single strand provides a probe that can hybridize to a target sequence under stringent hybridization conditions. Thus, the nucleic acid also encompasses a probe that hybridizes under stringent hybridization conditions.

[0036] Nucleic acids may be single-stranded or double-stranded, or may contain portions of both double-stranded and single-stranded sequences. Nucleic acids may be DNA, both genomic and cDNA, RNA, or hybrids, and may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine, and isoguanine. Nucleic acids may be obtained by chemical synthesis methods or by recombinant methods.

[0037] As used herein, "operably linked" means that the expression of a gene is under the control of a promoter with which it is spatially connected. The promoter may be located 5' (upstream) or 3' (downstream) of the gene under its control. The distance between the promoter and the gene may be approximately the same as the distance between the promoter and the gene it controls in the gene from which the promoter is derived. As is known in the art, variations in this distance may be accommodated without loss of promoter function.

[0038] As used herein, "peptide," "protein," or "polypeptide" can refer to a linked sequence of amino acids, which can be natural, synthetic, or a modified or combination of natural and synthetic.

[0039] As used herein, a "promoter" refers to a synthetic or naturally derived molecule that can confer, activate, or enhance expression of a nucleic acid in a cell. A promoter can contain one or more specific transcriptional control sequences to further enhance its expression and / or to alter spatial and / or temporal expression. A promoter can also contain distal enhancer or repressor elements, which can be located as many as several thousand base pairs from the start site of transcription. Promoters can be derived from sources including viruses, bacteria, fungi, plants, insects, and animals. Promoters can constitutively or differentially regulate the expression of genetic components with respect to the cell, tissue, or organ in which expression occurs, or with respect to the developmental stage in which expression occurs, or in response to external stimuli such as physiological stress, pathogens, metal ions, or inducers. Representative examples of promoters include bacteriophage T7 promoter, bacteriophage T3 promoter, SP6 promoter, lac operator-promoter, tac promoter, SV40 late promoter, SV40 early promoter, RSV-LTR promoter, and CMV IE promoter.

[0040] "Signal peptide" and "leader sequence" are used interchangeably herein and refer to an amino acid sequence that can be linked at the amino terminus of a SARS-CoV-2 protein described herein. A signal peptide / leader sequence typically directs localization of a protein. A signal peptide / leader sequence as used herein preferably facilitates secretion of a protein from the cell in which it is produced. A signal peptide / leader sequence is often cleaved from the remainder of the protein and is often referred to as a mature protein after secretion from the cell. A signal peptide / leader sequence is linked at the N-terminus of a protein.

[0041] As used herein, "subject" may refer to a mammal that desires or needs to be immunized with an immunogenic composition or vaccine described herein. The mammal may be a human, chimpanzee, guinea pig, dog, cat, horse, cow, mouse, rabbit, or rat.

[0042] As used herein, "substantially identical" means that the first and second amino acid sequences are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 50 It can mean at least 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% over a region of 0, 600, 700, 800, 900, 1000, 1100, or more amino acids. "Substantially identical" also refers to a sequence in which the first and second nucleic acid sequences are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 200, 300, 400, 500, 60 It can mean at least 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% over a region of 0, 700, 800, 900, 1000, 1100, or more nucleotides.

[0043] As used herein, "treatment" or "treating" may refer to the protection of an animal from a disease through means of preventing, suppressing, repressing, or completely eliminating the disease. Preventing a disease involves administering an immunogenic composition or vaccine of the invention to an animal prior to the onset of the disease. Suppressing a disease involves administering an immunogenic composition or vaccine of the invention to an animal after induction of the disease but prior to its clinical appearance. Suppressing a disease involves administering an immunogenic composition or vaccine of the invention to an animal after the clinical appearance of the disease.

[0044] As used herein, unless otherwise indicated, the term "clinically proven" (used independently or to modify the terms "safe" and / or "effective") shall mean proven by clinical trials that meet the approval standards of the U.S. Food and Drug Administration, the EMA, or a corresponding national regulatory agency. For example, the proof may be provided by the clinical trials described in the examples provided herein.

[0045] The term "clinically proven safe" when referring to a dose, dosing regimen, treatment or method with a SARS-CoV-2 antigen (e.g., SARS-CoV-2 spike antigen administered as pGX9501 or INO-4800 or their biosimilars) refers to a favorable risk:benefit ratio with an acceptable frequency and / or acceptable severity of treatment-emergent adverse events (referred to as AEs or TEAEs) compared to standard of care or another comparator. An adverse event is an inappropriate medical occurrence in a patient administered a medicinal product. One measure of safety is the incidence of National Cancer Institute (NCI) adverse events (AEs) graded according to the Common Toxicity Criteria for Adverse Events CTCAE v4.03.

[0046] The terms "clinically proven efficacy" and "clinically proven efficacy" as used herein in the context of a dose, dosing regimen, treatment or method refer to the effectiveness of a particular dose, dosing or treatment regimen. Efficacy can be measured based on changes in the disease course in response to the agent of the invention. For example, a SARS-CoV-2 antigen (e.g., SARS-CoV-2 spike antigen administered as pGX9501 or INO-4800 or a biosimilar thereof) is administered to a patient in an amount and for a time sufficient to induce an improvement, preferably a sustained improvement, in at least one indicator reflecting the severity of the disorder being treated. To determine whether the amount and time of treatment is sufficient, various indicators reflecting the extent of the subject's illness, disease or condition can be evaluated. Such indicators include, for example, clinically recognized indicators of disease severity, symptoms, or manifestations of the disorder in question. The degree of improvement is generally determined by a physician who can make this determination based on signs, symptoms, biopsies, or other test results, and can utilize questionnaires given to the subject, such as quality of life questionnaires developed for a given disease. For example, a SARS-CoV-2 antigen (e.g., a SARS-CoV-2 spike antigen administered as pGX9501 or INO-4800 or a biosimilar thereof) can be administered to achieve improvement in a patient's condition associated with SARS-CoV-2 infection. Improvement can be indicated by an improvement in indicators of disease activity, resolution of clinical symptoms, or any other measure of disease activity.

[0047] "Variant," as used herein with respect to a nucleic acid, means (i) a portion or fragment of a referenced nucleotide sequence, (ii) the complement of the referenced nucleotide sequence or a portion thereof, (iii) a nucleic acid that is substantially identical to the referenced nucleic acid or its complement, or (iv) a nucleic acid that hybridizes under stringent conditions to the referenced nucleic acid, its complement, or a sequence substantially identical thereto.

[0048] A variant may be further defined as a peptide or polypeptide that differs in amino acid sequence by insertion, deletion, or conservative substitution of amino acids, but retains at least one biological activity. Representative examples of "biological activity" include the ability to bind to a specific antibody or to promote an immune response. A variant may also refer to a protein having an amino acid sequence that is substantially identical to a reference protein having an amino acid sequence that retains at least one biological activity. Conservative substitutions of amino acids, i.e., replacing an amino acid with an amino acid that has a different similar property (e.g., hydrophilicity, degree and distribution of charged regions), are typically recognized in the art as involving minor changes. These minor changes can be identified, in part, by considering the hydropathic index of the amino acid, as understood in the art. Kyte et al., J. Mol. Biol. 157:105-132 (1982). The hydropathic index of an amino acid is based on a consideration of its hydrophobicity and charge. It is known in the art that amino acids of similar hydropathic indexes can be substituted and still retain protein function. In one embodiment, amino acids with a hydropathic index of ±2 are substituted. The hydrophilicity of amino acids can also be used to identify substitutions that will result in proteins that retain biological function. Consideration of the hydrophilicity of amino acids in the context of a peptide allows for the calculation of the greatest local average hydrophilicity of the peptide, a useful measure that has been reported to correlate well with antigenicity and immunogenicity. Substitution of amino acids with similar hydrophilicity values ​​can result in peptides that retain biological activity, e.g., immunogenicity, as understood in the art. Substitutions can be made with amino acids that have hydrophilicity values ​​within ±2 of each other. Both the hydrophobic index and hydrophilicity value of an amino acid are influenced by the particular side chain of that amino acid. Consistent with that observation, it is understood that amino acid substitutions that are compatible with biological function depend on the relative similarity of the amino acids, and in particular the side chains of those amino acids, as revealed by hydrophobicity, hydrophilicity, charge, size, and other properties.

[0049] A variant may be a nucleic acid sequence that is substantially identical over the full length of a complete gene sequence or a fragment thereof. The nucleic acid sequence may be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical over the full length of a gene sequence or a fragment thereof. A variant may be an amino acid sequence that is substantially identical over the full length of an amino acid sequence or a fragment thereof. The amino acid sequence may be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical over the full length of an amino acid sequence or a fragment thereof.

[0050] "Vector" as used herein may refer to a nucleic acid sequence that includes a replication origin.Vector may be a virus vector, a bacteriophage, a bacterial artificial chromosome, or a yeast artificial chromosome.Vector may be a DNA or RNA vector.Vector may be a self-replicating extrachromosomal vector, preferably a DNA plasmid.

[0051] For the recitation of numerical ranges herein, each intervening number is expressly contemplated with the same precision. For example, for the range 6 to 9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0 to 7.0, the numbers 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are expressly contemplated.

[0052] Nucleic Acid Molecules, Antigens, and Immunogenic Compositions Provided herein are immunogenic compositions, such as vaccines, that include nucleic acid molecules encoding SARS-CoV-2 antigens, fragments thereof, variants thereof, or combinations thereof. Also provided herein are immunogenic compositions, such as vaccines, that include SARS-CoV-2 antigens, fragments thereof, variants thereof, or combinations thereof. The immunogenic compositions can be used to treat, prevent, and / or protect against SARS-CoV-2-based pathologies by protecting against and treating any number of strains of SARS-CoV-2. The immunogenic compositions can significantly induce an immune response in a subject to which the immunogenic composition is administered, thereby protecting against and treating SARS-CoV-2 infection.

[0053] The immunogenic composition may be a DNA vaccine, a peptide vaccine, or a combination of DNA and peptide vaccines. The DNA vaccine may comprise a nucleic acid molecule encoding a SARS-CoV-2 antigen. The nucleic acid molecule may be DNA, RNA, cDNA, variants thereof, fragments thereof, or a combination thereof. The nucleic acid molecule may also comprise additional sequences encoding linker, leader, or tag sequences linked to the nucleic acid molecule encoding the SARS-CoV-2 antigen by a peptide bond. The peptide vaccine may comprise a SARS-CoV-2 antigen peptide, a SARS-CoV-2 antigen protein, variants thereof, fragments thereof, or a combination thereof. The combination DNA and peptide vaccine may comprise the above-mentioned nucleic acid molecules encoding a SARS-CoV-2 antigen and a SARS-CoV-2 antigen peptide or protein, wherein the SARS-CoV-2 antigen peptide or protein and the encoded SARS-CoV-2 antigen have the same amino acid sequence.

[0054] The disclosed immunogenic compositions can induce both humoral and cellular immune responses targeting SARS-CoV-2 antigens in subjects administered the immunogenic compositions. The disclosed immunogenic compositions can induce neutralizing and immunoglobulin G (IgG) antibodies that are reactive with SARS-CoV-2 spike antigens. The immunogenic compositions can also induce CD8+ and CD4+ T cell responses that are reactive with SARS-CoV-2 antigens and produce interferon-gamma (IFN-γ), tumor necrosis factor alpha (TNF-α), and interleukin-2 (IL-2).

[0055] The immunogenic composition can induce a humoral immune response in a subject to which the immunogenic composition is administered. The induced humoral immune response can be specific to a SARS-CoV-2 antigen. The induced humoral immune response can be reactive to a SARS-CoV-2 antigen. The humoral immune response can be induced about 1.5-fold to about 16-fold, about 2-fold to about 12-fold, or about 3-fold to about 10-fold in a subject to which the vaccine is administered. The humoral immune response can be induced in a subject to which the vaccine is administered by at least about 1.5-fold, at least about 2.0-fold, at least about 2.5-fold, at least about 3.0-fold, at least about 3.5-fold, at least about 4.0-fold, at least about 4.5-fold, at least about 5.0-fold, at least about 5.5-fold, at least about 6.0-fold, at least about 6.5-fold, at least about 7.0-fold, at least about 7.5-fold, at least about 8.0-fold, at least about 8.5-fold, at least about 9.0-fold, at least about 9.5-fold, at least about 10.0-fold, at least about 10.5-fold, at least about 11.0-fold, at least about 11.5-fold, at least about 12.0-fold, at least about 12.5-fold, at least about 13.0-fold, at least about 13.5-fold, at least about 14.0-fold, at least about 14.5-fold, at least about 15.0-fold, at least about 15.5-fold, or at least about 16.0-fold.

[0056] The humoral immune response induced by the immunogenic composition can include increased levels of neutralizing antibodies associated with a subject to which the immunogenic composition is administered compared to a subject to which the immunogenic composition is not administered. The neutralizing antibodies can be specific to a SARS-CoV-2 antigen. The neutralizing antibodies can be reactive with a SARS-CoV-2 antigen. The neutralizing antibodies can provide protection against and / or treatment of SARS-CoV-2 infection and its associated pathology in a subject to which the immunogenic composition is administered.

[0057] The humoral immune response induced by the immunogenic composition can include increased levels of IgG antibodies associated with a subject to which the immunogenic composition has been administered compared to a subject to which the immunogenic composition has not been administered. These IgG antibodies can be specific to a SARS-CoV-2 antigen. These IgG antibodies can be reactive with a SARS-CoV-2 antigen. The level of IgG antibodies associated with a subject to which the immunogenic composition has been administered can be increased by about 1.5-fold to about 16-fold, about 2-fold to about 12-fold, or about 3-fold to about 10-fold compared to a subject to which the immunogenic composition has not been administered. The level of IgG antibodies associated with a subject to which the immunogenic composition has been administered is at least about 1.5-fold, at least about 2.0-fold, at least about 2.5-fold, at least about 3.0-fold, at least about 3.5-fold, at least about 4.0-fold, at least about 4.5-fold, at least about 5.0-fold, at least about 5.5-fold, at least about 6.0-fold, at least about 6.5-fold, at least about 7.0-fold, at least about 7.5-fold, at least about 8. 0-fold, at least about 8.5-fold, at least about 9.0-fold, at least about 9.5-fold, at least about 10.0-fold, at least about 10.5-fold, at least about 11.0-fold, at least about 11.5-fold, at least about 12.0-fold, at least about 12.5-fold, at least about 13.0-fold, at least about 13.5-fold, at least about 14.0-fold, at least about 14.5-fold, at least about 15.0-fold, at least about 15.5-fold, or at least about 16.0-fold.

[0058] The immunogenic composition can induce a cellular immune response in a subject to which the immunogenic composition is administered. The induced cellular immune response can be specific to a SARS-CoV-2 antigen. The induced cellular immune response can be reactive to a SARS-CoV-2 antigen. The induced cellular immune response can include eliciting a CD8+ T cell response. The induced CD8+ T cell response can be reactive to a SARS-CoV-2 antigen. The induced CD8+ T cell response can be polyfunctional. The induced cellular immune response can include eliciting a CD8+ T cell response, where the CD8+ T cells produce interferon-gamma (IFN-γ), tumor necrosis factor alpha (TNF-α), interleukin-2 (IL-2), or a combination of IFN-γ and TNF-α.

[0059] The induced cellular immune response can include an increased CD8+ T cell response associated with the subject to which the immunogenic composition is administered compared to a subject to which the immunogenic composition is not administered. The CD8+ T cell response associated with the subject to which the immunogenic composition is administered can be increased by about 2-fold to about 30-fold, about 3-fold to about 25-fold, or about 4-fold to about 20-fold compared to a subject to which the immunogenic composition is not administered. The CD8+ T cell response associated with a subject to which the immunogenic composition has been administered is at least about 1.5 fold, at least about 2.0 fold, at least about 3.0 fold, at least about 4.0 fold, at least about 5.0 fold, at least about 6.0 fold, at least about 6.5 fold, at least about 7.0 fold, at least about 7.5 fold, at least about 8.0 fold, at least about 8.5 fold, at least about 9.0 fold, at least about 9.5 fold, at least about 10.0 fold, at least about 10.5 fold, at least about 11.0 fold, at least about 11.5 fold, at least about 12.0 fold, at least about 13.0 fold, at least about 14.0 fold, at least about 15.0 fold, at least about 16.0 fold, at least about 17.0 fold, at least about 18.0 fold, at least about 19.0 fold, at least about 20.0 fold, at least about 21.0 fold, at least about 22.0 fold, at least about 23.0 fold, at least about 24.0 fold, at least about 25.0 fold, at least about 26.0 fold, at least about 27.0 fold, at least about 28.0 fold, at least about 29.0 fold, at least about 30.0 fold, at least about 31.0 fold, at least about 32.0 fold, at least about 33.0 fold, at least about 34.0 fold, at least about 35.0 fold, at least about 36.0 fold, at least about 37.0 fold, at least about 38.0 fold, at least about 39.0 fold, at least about 40.0 or by at least about 12.5-fold, at least about 13.0-fold, at least about 13.5-fold, at least about 14.0-fold, at least about 14.5-fold, at least about 15.0-fold, at least about 16.0-fold, at least about 17.0-fold, at least about 18.0-fold, at least about 19.0-fold, at least about 20.0-fold, at least about 21.0-fold, at least about 22.0-fold, at least about 23.0-fold, at least about 24.0-fold, at least about 25.0-fold, at least about 26.0-fold, at least about 27.0-fold, at least about 28.0-fold, at least about 29.0-fold, or at least about 30.0-fold.

[0060] The induced cellular immune response can include an increased frequency of CD3+CD8+ T cells that produce IFN-γ. The frequency of CD3+CD8+IFN-γ+ T cells associated with a subject to which the immunogenic composition is administered can be increased by at least about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, or 20-fold compared to a subject to which the immunogenic composition is not administered.

[0061] The induced cellular immune response can include an increased frequency of CD3+CD8+T cells that produce TNF-α. The frequency of CD3+CD8+TNF-α+T cells associated with a subject to which the immunogenic composition is administered can be increased by at least about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, or 14-fold compared to a subject to which the immunogenic composition is not administered.

[0062] The induced cellular immune response can include an increased frequency of CD3+CD8+ T cells that produce IL-2. The frequency of CD3+CD8+IL-2+ T cells associated with a subject to which the immunogenic composition is administered can be increased by at least about 0.5-fold, 1.0-fold, 1.5-fold, 2.0-fold, 2.5-fold, 3.0-fold, 3.5-fold, 4.0-fold, 4.5-fold, or 5.0-fold compared to a subject to which the immunogenic composition is not administered.

[0063] The induced cellular immune response can include an increased frequency of CD3+CD8+ T cells that produce both IFN-γ and TNF-α. The frequency of CD3+CD8+IFN-γ+TNF-α+ T cells associated with a subject to which the immunogenic composition is administered can be increased by at least about 25-fold, 30-fold, 35-fold, 40-fold, 45-fold, 50-fold, 55-fold, 60-fold, 65-fold, 70-fold, 75-fold, 80-fold, 85-fold, 90-fold, 95-fold, 100-fold, 110-fold, 120-fold, 130-fold, 140-fold, 150-fold, 160-fold, 170-fold, or 180-fold compared to a subject to which the immunogenic composition is not administered.

[0064] The cellular immune response induced by the immunogenic composition can include inducing a CD4+ T cell response. The induced CD4+ T cell response can be reactive with SARS-CoV-2 antigens. The induced CD4+ T cell response can be polyfunctional. The induced cellular immune response can include inducing a CD4+ T cell response, where the CD4+ T cells produce IFN-γ, TNF-α, IL-2, or a combination of IFN-γ and TNF-α.

[0065] The induced cellular immune response can include an increased frequency of CD3+CD4+ T cells that produce IFN-γ. The frequency of CD3+CD4+IFN-γ+ T cells associated with a subject to which the immunogenic composition is administered can be increased by at least about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, or 20-fold compared to a subject to which the immunogenic composition is not administered.

[0066] The induced cellular immune response can include an increased frequency of CD3+CD4+T cells that produce TNF-α. The frequency of CD3+CD4+TNF-α+T cells associated with a subject to which the immunogenic composition is administered can be increased by at least about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold, 21-fold, or 22-fold compared to a subject to which the immunogenic composition is not administered.

[0067] The induced cellular immune response can include an increased frequency of CD3+CD4+ T cells producing IL-2. The frequency of CD3+CD4+IL-2+ T cells associated with a subject to which the immunogenic composition is administered can be increased by at least about 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 11-fold, 12-fold, 13-fold, 14-fold, 15-fold, 16-fold, 17-fold, 18-fold, 19-fold, 20-fold, 21-fold, 22-fold, 23-fold, 24-fold, 25-fold, 26-fold, 27-fold, 28-fold, 29-fold, 30-fold, 31-fold, 32-fold, 33-fold, 34-fold, 35-fold, 36-fold, 37-fold, 38-fold, 39-fold, 40-fold, 45-fold, 50-fold, 55-fold, or 60-fold compared to a subject to which the immunogenic composition is not administered.

[0068] The induced cellular immune response can include an increased frequency of CD3+CD4+ T cells producing both IFN-γ and TNF-α. The frequency of CD3+CD4+IFN-γ+TNF-α+ associated with a subject administered the immunogenic composition is at least about 2-fold, 2.5-fold, 3.0-fold, 3.5-fold, 4.0-fold, 4.5-fold, 5.0-fold, 5.5-fold, 6.0-fold, 6.5-fold, 7.0-fold, 7.5-fold, 8.0-fold, 8.5-fold, 9.0-fold, 9.5-fold, 10.0-fold, 10.5-fold, 11.0-fold, 11.5-fold, , 12.0x, 12.5x, 13.0x, 13.5x, 14.0x, 14.5x, 15.0x, 15.5x, 16.0x, 16.5x, 17.0x, 17.5x, 18.0x, 18.5x, 19.0x, 19.5x, 20.0x, 21x, 22x, 23x, 24x, 25x, 26x, 27x, 28x, 29x, 30x, 31x, 32x, 33x, 34x, or 35x.

[0069] The immunogenic compositions of the present invention may have the characteristics necessary for an effective immunogenic composition, such as being safe so that the immunogenic composition itself does not cause illness or death, being protective against illness resulting from exposure to living pathogens such as viruses or bacteria, inducing neutralizing antibodies to prevent the generation of cells, inducing protective T cells against intracellular pathogens, as well as providing ease of administration, few side effects, biological stability, and low cost per dose.

[0070] The immunogenic composition can further induce an immune response when administered to a different tissue, such as muscle or skin. The immunogenic composition can further induce an immune response when administered parenterally, for example, by subcutaneous, intradermal, or intramuscular injection as described herein, optionally followed by electroporation.

[0071] a. SARS-CoV-2 antigens and nucleic acid molecules encoding them As described above, immunogenic compositions are provided herein that include nucleic acid molecules encoding SARS-CoV-2 antigens, fragments thereof, variants thereof, or combinations thereof. Also provided herein are immunogenic compositions that include SARS-CoV-2 antigens, fragments thereof, variants thereof, or combinations thereof.

[0072] Upon binding to cell surface proteins and membrane fusion, the coronavirus enters the cell and its single-stranded RNA genome is released into the cytoplasm of the infected cell. The single-stranded RNA genome is a positive strand and can therefore be translated into RNA polymerase that produces additional viral RNA that is a negative strand. Thus, the SARS-CoV-2 antigen can also be SARS-CoV-2 RNA polymerase.

[0073] The viral negative RNA strand is transcribed into a smaller subgenomic positive RNA strand that is used to translate other viral proteins, such as the nucleocapsid (N) protein, the envelope (E) protein, and the matrix (M) protein. Thus, SARS-CoV-2 antigens can include SARS-CoV-2 nucleocapsid protein, SARS-CoV-2 envelope protein, or SARS-CoV-2 matrix protein.

[0074] The viral negative RNA strand can also be used to replicate the viral genome bound by the nucleocapsid protein. The matrix protein, together with the spike protein, is incorporated into the endoplasmic reticulum of the infected cell. Together, the nucleocapsid protein bound to the viral genome, and the matrix and spike proteins embedded in the membrane, bud into the endoplasmic reticulum lumen, thereby enveloping the viral genome within the membrane. The viral progeny are then transported by Golgi vesicles to the plasma membrane of the infected cell and released into the extracellular space by endocytosis.

[0075] Coronaviruses, including SARS-CoV-2, are enclosed by a membrane and possess a type 1 membrane glycoprotein known as the spike (S) protein, which forms the protruding spikes on the surface of the coronavirus. The SARS-CoV-2 S protein is a class I membrane fusion protein that is the major envelope protein on the surface of the coronavirus. The spike protein promotes the binding of the coronavirus to proteins located on the surface of the cell, such as the metalloprotease aminopeptidase N, and mediates cell-virus membrane fusion. In particular, the spike protein contains an S1 subunit that promotes the binding of the coronavirus to cell surface proteins. Thus, the S1 subunit of the spike protein controls which cells are infected by the coronavirus. The spike protein also contains an S2 subunit, a transmembrane subunit that facilitates viral and cell membrane fusion. Thus, a SARS-CoV-2 antigen can include the SARS-CoV-2 spike protein, the S1 subunit of the SARS-CoV-2 spike protein, the S2 subunit of the SARS-CoV-2 spike protein, or a fragment of the S1 subunit that contains the SARS-CoV-2 spike receptor-binding domain.

[0076] In some embodiments, the SARS-CoV-2 antigen may be SARS-CoV-2 spike protein, SARS-CoV-2 RNA polymerase, SARS-CoV-2 nucleocapsid protein, SARS-CoV-2 envelope protein, SARS-CoV-2 matrix protein, a fragment thereof, a variant thereof, or a combination thereof.

[0077] The SARS-CoV-2 antigen can be a SARS-CoV-2 spike antigen, a fragment thereof, a variant thereof, or a combination thereof. The SARS-CoV-2 spike antigen can elicit an immune response in a mammal against one or more SARS-CoV-2 strains. The SARS-CoV-2 spike antigen can include epitopes that make it particularly effective as an immunogen against which an anti-SARS-CoV-2 immune response can be induced.

[0078] The SARS-CoV-2 antigen can be a consensus antigen derived from two or more strains of SARS-CoV-2. In some embodiments, the SARS-CoV-2 antigen is a SARS-CoV-2 consensus spike antigen. The SARS-CoV-2 consensus spike antigen can be derived from the sequence of spike antigens from strains of SARS-CoV-2, so that the SARS-CoV-2 consensus spike antigen is unique. In some embodiments, the SARS-CoV-2 consensus spike antigen can be an outlier spike antigen, which has greater amino acid sequence variance than from other SARS-CoV-2 spike proteins. Thus, the immunogenic compositions of the present invention are broadly applicable to multiple strains of SARS-CoV-2 due to the unique sequence of the SARS-CoV-2 consensus spike antigen. These unique sequences allow the vaccine to universally protect against multiple strains of SARS-CoV-2, including genetically diverse variants of SARS-CoV-2. Nucleic acid molecules encoding SARS-CoV-2 antigens can be modified for improved expression. Modifications can include codon optimization, RNA optimization, addition of a Kozak sequence for increased translation initiation, and / or addition of an immunoglobulin leader sequence to increase the immunogenicity of the SARS-CoV-2 antigen. SARS-CoV-2 spike antigens can include a signal peptide, such as an immunoglobulin signal peptide, for example, but not limited to, an immunoglobulin E (IgE) or immunoglobulin (IgG) signal peptide. In some embodiments, SARS-CoV-2 spike antigens can include a hemagglutinin (HA) tag. SARS-CoV-2 spike antigens can be designed to elicit stronger and broader cellular and / or humoral immune responses than the corresponding codon-optimized spike antigens.

[0079] In some embodiments, the SARS-CoV-2 antigen comprises an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity over the entire length of residues 19-1279 of SEQ ID NO: 1. In some embodiments, the SARS-CoV-2 antigen comprises the amino acid sequence set forth in residues 19-1279 of SEQ ID NO: 1. In some embodiments, the SARS-CoV-2 antigen comprises an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity over the entire length of SEQ ID NO: 1. In some embodiments, the SARS-CoV-2 antigen comprises the amino acid sequence of SEQ ID NO:1. In some embodiments, a nucleic acid molecule encoding a SARS-CoV-2 antigen comprises a nucleotide sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to nucleotides 55-3837 of SEQ ID NO:2, SEQ ID NO:2, or a sequence set forth in SEQ ID NO:3.

[0080] In some embodiments, the SARS-CoV-2 antigen comprises an amino acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity across the entire length of residues 19-1279 of SEQ ID NO:4, or across the entire length of SEQ ID NO:4. In some embodiments, the SARS-CoV-2 antigen comprises the amino acid sequence set forth in residues 19-1279 of SEQ ID NO:4. In some embodiments, the SARS-CoV-2 antigen comprises the amino acid sequence of SEQ ID NO:4. In some embodiments, a nucleic acid molecule encoding a SARS-CoV-2 antigen shares at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity over the entire length of nucleotides 55-3837 of SEQ ID NO:5, or over the entire length of SEQ ID NO:5. a nucleic acid sequence having at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity over the entire length of SEQ ID NO:6, the nucleic acid sequence of SEQ ID NO:5, the nucleic acid sequence of SEQ ID NO:6, or the nucleic acid sequence of SEQ ID NO:6.

[0081] In some embodiments, the SARS-CoV-2 antigen is operably linked to an IgE leader sequence. In some such embodiments, the SARS-CoV-2 antigen comprises the amino acid sequence set forth in SEQ ID NO:1. In some embodiments, the SARS-CoV-2 antigen is encoded by the nucleotide sequence set forth in SEQ ID NO:2 or SEQ ID NO:3. In some embodiments where the SARS-CoV-2 antigen comprises an IgE leader, the SARS-CoV-2 antigen comprises the amino acid sequence set forth in SEQ ID NO:4. In some such embodiments, the SARS-CoV-2 antigen is encoded by the nucleotide sequence set forth in SEQ ID NO:5 or SEQ ID NO:6.

[0082] Immunogenic fragments of SEQ ID NO: 1 may be provided. Immunogenic fragments can comprise at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of SEQ ID NO: 1. In some embodiments, the immunogenic fragment comprises a leader sequence, such as, for example, an immunoglobulin leader, e.g., an IgE leader. In some embodiments, the immunogenic fragment does not comprise a leader sequence.

[0083] Immunogenic fragments of proteins having amino acid sequences homologous to immunogenic fragments of SEQ ID NO:1 may be provided. Such immunogenic fragments may include at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of a protein that is 95% homologous to SEQ ID NO:1. Some embodiments relate to immunogenic fragments having 96% homology to immunogenic fragments of the consensus protein sequences herein. Some embodiments relate to immunogenic fragments having 97% homology to immunogenic fragments of the consensus protein sequences herein. Some embodiments relate to immunogenic fragments having 98% homology to immunogenic fragments of the consensus protein sequences herein. Some embodiments relate to immunogenic fragments having 99% homology to immunogenic fragments of the consensus protein sequences herein. In some embodiments, an immunogenic fragment includes a leader sequence, such as, for example, an immunoglobulin leader, e.g., an IgE leader. In some embodiments, an immunogenic fragment does not include a leader sequence.

[0084] Some embodiments relate to immunogenic fragments of SEQ ID NO: 1. Immunogenic fragments can be at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of SEQ ID NO: 1. Immunogenic fragments can be at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to a fragment of SEQ ID NO: 1. In some embodiments, the immunogenic fragment comprises a sequence encoding a leader sequence, such as, for example, an immunoglobulin leader, e.g., an IgE leader. In some embodiments, the fragment does not comprise a coding sequence encoding a leader sequence.

[0085] Immunogenic fragments of SEQ ID NO: 4 may be provided. Immunogenic fragments can comprise at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of SEQ ID NO: 4. In some embodiments, the immunogenic fragment comprises a leader sequence, such as, for example, an immunoglobulin leader, e.g., an IgE leader. In some embodiments, the immunogenic fragment does not comprise a leader sequence.

[0086] Immunogenic fragments of proteins having amino acid sequences homologous to immunogenic fragments of SEQ ID NO: 4 may be provided. Such immunogenic fragments may include at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of a protein that is 95% homologous to SEQ ID NO: 4. Some embodiments relate to immunogenic fragments having 96% homology to immunogenic fragments of the consensus protein sequences herein. Some embodiments relate to immunogenic fragments having 97% homology to immunogenic fragments of the consensus protein sequences herein. Some embodiments relate to immunogenic fragments having 98% homology to immunogenic fragments of the consensus protein sequences herein. Some embodiments relate to immunogenic fragments having 99% homology to immunogenic fragments of the consensus protein sequences herein. In some embodiments, an immunogenic fragment includes a leader sequence, such as, for example, an immunoglobulin leader, e.g., an IgE leader. In some embodiments, an immunogenic fragment does not include a leader sequence.

[0087] Some embodiments relate to immunogenic fragments of SEQ ID NO: 4. Immunogenic fragments can be at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of SEQ ID NO: 4. Immunogenic fragments can be at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homologous to a fragment of SEQ ID NO: 4. In some embodiments, the immunogenic fragment comprises a sequence encoding a leader sequence, such as, for example, an immunoglobulin leader, e.g., an IgE leader. In some embodiments, the fragment does not comprise a coding sequence encoding a leader sequence.

[0088] b. Vector The immunogenic composition can include one or more vectors that include a nucleic acid molecule encoding a SARS-CoV-2 antigen. The one or more vectors can be capable of expressing the antigen. The vector can have a nucleic acid sequence that includes an origin of replication. The vector can be a plasmid, a bacteriophage, a bacterial artificial chromosome, or a yeast artificial chromosome. The vector can be either a self-replicating extrachromosomal vector or a vector that integrates into the host genome.

[0089] One or more vectors may be expression constructs, which are generally plasmids used to introduce specific genes into target cells. Once the expression vector enters the cell, the protein encoded by the gene is produced by the cellular transcription and translation machinery ribosome complex. Plasmids are frequently engineered to contain control sequences that act as enhancer and promoter regions and result in efficient transcription of the gene carried on the expression vector. The vectors of the present invention express large amounts of stable messenger RNA, and thus proteins.

[0090] The vector may have expression signals such as a strong promoter, a strong termination codon, adjustment of the distance between the promoter and the cloned gene, and insertion of a transcription termination sequence and a PTIS (portable translation initiation sequence).

[0091] (1) Expression vector The vector can be a circular plasmid or a linear nucleic acid. Circular plasmids and linear nucleic acids can induce the expression of a particular nucleotide sequence in appropriate target cells. The vector can have a promoter operably linked to the nucleotide sequence encoding the antigen, which can be operably linked to a termination signal. The vector can also include sequences required for proper translation of the nucleotide sequence. A vector containing a nucleotide sequence of interest can be chimeric, meaning that at least one of its components is heterologous to at least one of the other components. The expression of the nucleotide sequence in the expression cassette can be under the control of a constitutive promoter, or an inducible promoter that initiates transcription only when the host cell is exposed to some particular external stimulus. In the case of a multicellular organism, the promoter can also be specific to a particular tissue or organ or developmental stage.

[0092] (2) Circular and linear vectors Vectors can be circular plasmids (eg, autonomously replicating plasmids having an origin of replication) which can transform target cells by integration into the cellular genome, or can exist extrachromosomally.

[0093] The vector can be pVAX, pcDNA3.0, pGX-0001, or provax, or any other expression vector capable of expressing DNA encoding an antigen and allowing the cell to translate the sequence into an antigen that is recognized by the immune system.

[0094] Also provided herein is a linear nucleic acid immunogenic composition, or linear expression cassette ("LEC"), that can be efficiently delivered to a subject via electroporation and express one or more desired antigens. The LEC can be any linear DNA that does not have any phosphate backbone. The DNA can encode one or more antigens. The LEC can contain a promoter, an intron, a stop codon, and / or a polyadenylation signal. The expression of the antigen can be controlled by a promoter. The LEC may not include any antibiotic resistance genes and / or a phosphate backbone. The LEC may not include other nucleic acid sequences that are not related to the desired antigen gene expression.

[0095] The LEC can be derived from any plasmid that can be linearized. The plasmid may be capable of expressing the antigen. The plasmid can be pNP (Puerto Rico / 34) or pM2 (New Caledonia / 99). The plasmid can be WLV009, pVAX, pcDNA3.0, or Provax, or any other expression vector that can express DNA encoding an antigen and allow the cell to translate the sequence into an antigen that is recognized by the immune system.

[0096] The LEC can be perM2. The LEC can be perNP. The perNP and perMR can be derived from pNP (Puerto Rico / 34) and pM2 (New Caledonia / 99), respectively.

[0097] (3) Promoter, intron, stop codon, and polyadenylation signal The vector may have a promoter. The promoter may be any promoter that can drive gene expression and regulate the expression of isolated nucleic acid. Such promoter is a cis-acting sequence element required for transcription via DNA-dependent RNA polymerase, which transcribes the antigen sequence described herein. The selection of the promoter used to induce the expression of heterologous nucleic acid depends on the specific application. The promoter may be located at approximately the same distance from the transcription start in the vector as it is from the transcription start site in its natural setting. However, variations in this distance may be accommodated without loss of promoter function.

[0098] The promoter may be operably linked to a nucleic acid sequence encoding an antigen and a signal required for efficient polyadenylation of the transcript, a ribosome binding site, and translation termination. The promoter may be a CMV promoter, an SV40 early promoter, an SV40 late promoter, a metallothionein promoter, a mouse mammary tumor virus promoter, a Rous sarcoma virus promoter, a polyhedrin promoter, or another promoter shown to be effective for expression in eukaryotic cells.

[0099] The vector may contain an enhancer and an intron with functional splice donor and acceptor sites. The vector may contain a transcription termination region downstream of the structural gene to provide efficient termination. The termination region may be obtained from the same gene as the promoter sequence or may be obtained from a different gene.

[0100] c. Excipients and other components of the immunogenic composition The immunogenic composition may further comprise a pharma- ceutically acceptable excipient. The pharma- ceutically acceptable excipient may be a functional molecule such as a vehicle, carrier, buffer, or diluent. As used herein, a "buffer" refers to a buffer solution that resists changes in pH by the action of its acid-base conjugate components. A buffer generally has a pH of about 4.0 to about 8.0, e.g., about 5.0 to about 7.0. In some embodiments, the buffer is a saline-sodium citrate (SSC) buffer. In some embodiments, where the immunogenic composition comprises a nucleic acid molecule encoding a SARS-CoV-2 spike antigen as described above, the immunogenic composition comprises 10 mg / ml of the vector in a buffer, e.g., but not limited to, an SSC buffer. In some embodiments, the immunogenic composition comprises 10 mg / mL of the DNA plasmid pGX9501 or pGX9503 in a buffer. In some embodiments, the immunogenic composition is stored at about 2°C to about 8°C. In some embodiments, the immunogenic composition is stored at room temperature. The immunogenic composition can be stored at room temperature for at least 1 year. In some embodiments, the immunogenic composition is stable at room temperature for at least 1 year, with stability being defined as a percentage of supercoiled plasmid of at least about 80%. In some embodiments, the percentage of supercoiled plasmid is at least about 85% after storage at room temperature for at least 1 year.

[0101] The pharma- ceutically acceptable excipient may be a transfection-facilitating agent, which may include surfactants such as immune stimulating complexes (ISCOMS), Freund's incomplete adjuvant, LPS analogs including monophosphoryl lipid A, muramyl peptides, quinone analogs, vesicles such as squalene and squalene, hyaluronic acid, lipids, liposomes, calcium ions, viral proteins, polyanions, polycations, or nanoparticles, or other known transfection-facilitating agents.

[0102] The transfection facilitating agent may be a polyanion, polycation, or lipid, including poly-L-glutamic acid (LGS). The transfection facilitating agent is poly-L-glutamic acid, which may be present in the immunogenic composition at a concentration of less than 6 mg / ml. The transfection facilitating agent may also include surfactants, such as immune stimulating complexes (ISCOMS), Freund's incomplete adjuvant, LPS analogs, including monophosphoryl lipid A, muramyl peptides, quinone analogs, and vesicles, such as squalene and squalene, and hyaluronic acid may also be used in conjunction with the gene construct. The DNA plasmid immunogenic composition may also include a transfection facilitating agent such as lipids, liposomes, including lecithin liposomes or other liposomes known in the art as DNA-liposome mixtures (see, for example, WO9324640), calcium ions, viral proteins, polyanions, polycations, or nanoparticles, or other known transfection facilitating agents. The transfection facilitating agent is a polyanion, polycation, or lipid, including poly-L-glutamic acid (LGS). The concentration of the transfection agent in the immunogenic composition is less than 4 mg / ml, less than 2 mg / ml, less than 1 mg / ml, less than 0.750 mg / ml, less than 0.500 mg / ml, less than 0.250 mg / ml, less than 0.100 mg / ml, less than 0.050 mg / ml, or less than 0.010 mg / ml.

[0103] The pharma-ceutically acceptable excipient may be an adjuvant. The adjuvant may be another gene expressed in an alternative plasmid or delivered as a protein in combination with the above-mentioned plasmid in the immunogenic composition. The adjuvant may be selected from the group consisting of α-interferon (IFN-α), β-interferon (IFN-β), γ-interferon, platelet-derived growth factor (PDGF), TNFα, TNFβ, GM-CSF, epidermal growth factor (EGF), cutaneous T-cell-attracting chemokine (CTACK), epithelial thymus-expressed chemokine (TECK), mucosa-associated epithelial chemokine (MEC), IL-12, IL-15, MHC, CD80, CD86 with IL-15 with the signal sequence deleted and optionally with a signal peptide from IgE. The adjuvant can be IL-12, IL-15, IL-28, CTACK, TECK, platelet-derived growth factor (PDGF), TNFα, TNFβ, GM-CSF, epidermal growth factor (EGF), IL-1, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12, IL-18, or a combination thereof.

[0104] Other genes that may be useful as adjuvants include those encoding: MCP-1, MIP-1a, MIP-1p, IL-8, RANTES, L-selectin, P-selectin, E-selectin, CD34, GlyCAM-1, MadCAM-1, LFA-1, VLA-1, Mac-1, p150.95, PECAM, ICAM-1, ICAM-2, ICAM-3, CD2, LFA-3, M-CSF, G-CSF, IL-4, mutated forms of IL-18, CD40, CD40L , vascular growth factor, fibroblast growth factor, IL-7, IL-22, nerve growth factor, vascular endothelial growth factor, Fas, TNF receptor, Flt, Apo-1, p55, WSL-1, DR3, TRAMP, Apo-3, AIR, LARD, NGRF, DR4, DR5, KILLER, TRAIL-R2, TRICK2, DR6, caspase ICE, Fos, c-jun, Sp-1, Ap-1, Ap-2, p38, p65Rel, MyD88, IRAK, TRAF6, IkB, inactive NIK, SAP K, SAP-1, JNK, interferon response genes, NFkB, Bax, TRAIL, TRAILrec, TRAILrecDRC5, TRAIL-R3, TRAIL-R4, RANK, RANK ligand, Ox40, Ox40 ligand, NKG2D, MICA, MICB, NKG2A, NKG2B, NKG2C, NKG2E, NKG2F, TAP1, TAP2, and their functional fragments.

[0105] The immunogenic composition may further comprise a genetic vaccine facilitator agent as described in US patent application Ser. No. 021,579, filed Apr. 1, 1994, which is incorporated by reference in its entirety.

[0106] The immunogenic composition may be formulated according to the mode of administration used. According to some embodiments, the immunogenic composition is formulated in a buffer, optionally a saline-sodium citrate buffer. For example, the immunogenic composition may be formulated at a concentration of 10 mg of nucleic acid molecule per milliliter of sodium citrate buffer. The injectable immunogenic pharmaceutical composition may be sterile, pyrogen-free, and particle-free. An isotonic formulation or solution may be used. Additives for isotonicity may include chloride, dextrose, mannitol, sorbitol, and lactose. The immunogenic composition may include a vasoconstrictor. The isotonic solution may include phosphate-buffered saline. The immunogenic composition may further include a stabilizer including gelatin and albumin. The stabilizer may allow the formulation including LGS or a polycation or polyanion to be stable for an extended period of time at room or ambient temperature.

[0107] Also provided herein is an article of manufacture comprising the immunogenic composition. In some embodiments, the article of manufacture is a container that holds the immunogenic composition. The container can be, for example, but not limited to, a syringe or a vial. The vial can have a stopper that can be penetrated by a syringe.

[0108] The immunogenic composition may be packaged in a suitable sterilized container, such as an ampoule, bottle, or vial, either in multi-dose or unit dosage form. The container is preferably sealed after filling with the vaccine preparation. Preferably, the vaccine is packaged in a container with a label that identifies the vaccine and has a notice in a format prescribed by a government agency, such as the U.S. Food and Drug Administration, reflecting the approval of the vaccine under appropriate legislation, dosage information, etc. The label preferably includes information about the vaccine that is useful to medical personnel who administer the vaccine to patients. The package also preferably includes printed informational material, instructions, indications, and any necessary and required warnings regarding the administration of the vaccine.

[0109] Vaccination Method Also provided herein are methods of treating, protecting against, and / or preventing disease in a subject in need thereof by administering the immunogenic composition to the subject. Administering the immunogenic composition to a subject can induce or elicit an immune response in the subject. The induced immune response can be used to treat, prevent, and / or protect against disease, e.g., pathogens associated with SARS-CoV-2 infection. The induced immune response in a subject to which the immunogenic composition is administered can provide resistance to one or more SARS-CoV-2 strains.

[0110] The induced immune response may include an induced humoral immune response and / or an induced cellular immune response. The humoral immune response may be induced about 1.5-fold to about 16-fold, about 2-fold to about 12-fold, or about 3-fold to about 10-fold. The induced humoral immune response may include IgG antibodies and / or neutralizing antibodies that are reactive to the antigen. The induced cellular immune response may include a CD8+ T cell response, which is induced about 2-fold to about 30-fold, about 3-fold to about 25-fold, or about 4-fold to about 20-fold.

[0111] Vaccine doses can be 1 μg to 10 mg of active ingredient / kg body weight / dose, and can be 20 μg to 10 mg of ingredient / kg body weight / dose. Vaccines can be administered every 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more days, or every 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more weeks. The number of vaccine doses for effective treatment can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more.

[0112] In one embodiment, the total vaccine dose is 1.0 mg of nucleic acid. In one embodiment, the total vaccine dose is 2.0 mg of nucleic acid administered as 2 x 1.0 mg of nucleic acid.

[0113] Administration The immunogenic composition can be formulated according to standard techniques well known to those skilled in the art of pharmacy. Such compositions can be administered in dosages and by techniques well known to those skilled in the art of medicine, taking into account factors such as the age, sex, weight, and condition of the particular subject, as well as the route of administration. The vaccine can be administered, for example, in one, two, three, four, or more injections. In some embodiments, an initial dose of about 0.5 mg to about 2.0 mg of the nucleic acid molecule is administered to the subject. The initial dose can be administered in one, two, three, four, or more injections. The initial dose can be followed by administration of one, two, three, four, or more subsequent doses of about 0.5 mg to about 2.0 mg of the nucleic acid molecule about 1, 2, 3, 4, 5, 6, 7, 8, 10, 12, or more weeks after the immediately preceding dose. Each subsequent dose can be administered in one, two, three, or more injections. In some embodiments, the immunogenic composition is administered to the subject before, with, or after an additional agent. In some embodiments, the immunogenic composition is administered as a booster following administration of an agent for the treatment of SARS-CoV-2 infection or for the treatment or prevention of a disease or disorder associated with SARS-CoV-2 infection. In one embodiment, the disease or disorder associated with SARS-CoV-2 infection includes, but is not limited to, coronavirus disease 2019 (COVID-19). In some embodiments, the disease or disorder associated with SARS-CoV-2 infection is multisystem inflammatory syndrome in adults (MIS-A) or multisystem inflammatory syndrome in children (MIS-C).

[0114] The subject can be a mammal, eg, a human, horse, non-human primate, cow, pig, sheep, cat, dog, guinea pig, rabbit, rat, or mouse.

[0115] Vaccines can be administered prophylactically or therapeutically. In prophylactic administration, vaccines can be administered in an amount sufficient to induce an immune response. In therapeutic applications, vaccines are administered to subjects in need thereof in an amount sufficient to induce a therapeutic effect. An amount sufficient to achieve this is defined as a "therapeutically effective dose". Amounts effective for this use will depend, for example, on the specific composition of the vaccine regimen administered, the method of administration, the stage and severity of the disease, the general health of the patient, and the judgment of the prescribing physician.

[0116] Vaccines can be administered by methods well known in the art, such as those described in Donnelly et al. (Ann. Rev. Immunol. 15:617-648 (1997)), Felgner et al. (U.S. Patent No. 5,580,859, issued December 3, 1996), Felgner (U.S. Patent No. 5,703,055, issued December 30, 1997), and Carson et al. (U.S. Patent No. 5,679,647, issued October 21, 1997), all of which are incorporated herein by reference in their entirety. The DNA of the vaccine can be complexed to particles or beads that can be administered to an individual using, for example, a vaccine gun. Those skilled in the art will know that the choice of pharmaceutically acceptable carrier, including physiologically acceptable compounds, depends, for example, on the route of administration of the expression vector.

[0117] Vaccines can be delivered via a variety of routes. Typical delivery routes include parenteral administration, e.g., intradermal, intramuscular, or subcutaneous delivery. Other routes include oral administration, intranasal, and intravaginal routes. For DNA of the vaccine in particular, the vaccine can be delivered to the interstitial space of tissues of an individual (Felgner et al., U.S. Pat. Nos. 5,580,859 and 5,703,055, all of which are incorporated herein by reference in their entirety). Vaccines can also be administered into muscle, or via intradermal or subcutaneous injection, or transdermally, e.g., by iontophoresis. Epidermal administration of the vaccine can also be used. Epidermal administration can include mechanically or chemically irritating the outermost layer of the epidermis to promote an immune response to the irritant (Carson et al., U.S. Pat. No. 5,679,647, the contents of which are incorporated herein by reference in their entirety). Parenteral administration can optionally be followed by electroporation as described herein.

[0118] The vaccine may also be formulated for administration via the nasal cavity. Formulations suitable for nasal administration, in which the carrier is a solid, may include, for example, a coarse powder having a particle size in the range of about 10 to about 500 microns, which is administered in a sniffing manner, i.e., by rapid inhalation through the nasal passages from a container of the powder held close to the nose. The formulation may be a nasal spray, nasal drops, or by aerosol administration with a nebulizer. The formulation may include an aqueous or oily solution of the vaccine.

[0119] The vaccine may be a liquid preparation, such as a suspension, syrup, or elixir. The vaccine may also be a preparation for parenteral, subcutaneous, intradermal, intramuscular, or intravenous administration (e.g., injectable administration), such as a sterile suspension or emulsion.

[0120] Vaccines can be incorporated into liposomes, microspheres, or other polymer matrices (Felgner et al., U.S. Pat. No. 5,703,055; Gregoriadis, Liposome Technology, Vols. I to III (2nd ed. 1993), the contents of which are incorporated herein by reference in their entireties). Liposomes can be composed of phospholipids or other lipids and can be non-toxic, physiologically acceptable, metabolizable carriers that are relatively simple to make and administer.

[0121] Vaccine can be administered via electroporation, for example, by the method described in U.S. Patent No. 7,664,545, the contents of which are incorporated herein by reference.Electroporation can be carried out by the method and / or device described in U.S. Patent No. 6,302,874, U.S. Patent No. 5,676,646, U.S. Patent No. 6,241,701, U.S. Patent No. 6,233,482, U.S. Patent No. 6,216,034, U.S. Patent No. 6,208,893, U.S. Patent No. 6,192,270, U.S. Patent No. 6,181,964, U.S. Patent No. 6,150,148, U.S. Patent No. 6,120,493, U.S. Patent No. 6,096,020, U.S. Patent No. 6,068,650 and U.S. Patent No. 5,702,359, the contents of which are incorporated herein by reference in their entirety. Electroporation can be performed via a minimally invasive device.

[0122] A minimally invasive electroporation device ("MID") can be an apparatus for injecting the above-mentioned vaccine and associated fluids into body tissue. The device can include a hollow needle, a DNA cassette, and a fluid delivery means, and the device is adapted to activate the fluid delivery means in use to simultaneously (e.g., automatically) inject DNA into the body tissue while the needle is being inserted into the body tissue. This has the advantage that the ability to gradually inject DNA and associated fluids while the needle is being inserted leads to a more even distribution of fluids through the body tissue. The pain experienced during injection can be reduced due to the distribution of the injected DNA over a larger area.

[0123] The MID may inject the vaccine into tissue without the use of a needle. The MID may inject the vaccine as a small stream or jet with such force that the vaccine penetrates the surface of the tissue and enters the underlying tissue and / or muscle. The force behind the small stream or jet may be provided by expanding a compressed gas such as carbon dioxide through a micro-orifice within a fraction of a second. Examples of minimally invasive electroporation devices, and methods of using them, are described in published U.S. Patent Application No. 2008 / 0234655, U.S. Patent Nos. 6,520,950, 7,171,264, 6,208,893, 6,009,347, 6,120,493, 7,245,963, 7,328,064, and 6,763,264, the contents of each of which are incorporated herein by reference.

[0124] MID may include an injector that creates a high-speed jet of liquid that penetrates tissue painlessly.Such needleless injectors are commercially available.Examples of needleless injectors that can be utilized herein include those described in U.S. Patent Nos. 3,805,783, 4,447,223, 5,505,697, and 4,342,310, the contents of each of which are incorporated herein by reference.

[0125] The desired vaccine, in a form suitable for direct or indirect electrotransport, can be introduced (e.g., injected) using a needleless injector into the tissue to be treated, typically by contacting the tissue surface with the injector and actuating delivery of a jet of agent with sufficient force to cause penetration of the vaccine into the tissue. For example, if the tissue to be treated is a mucosa, skin or muscle, the agent is projected toward the mucosa or skin surface with sufficient force to cause the agent to penetrate through the stratum corneum into the dermis layer or into the underlying tissue and muscle, respectively.

[0126] Needleless injectors are suitable for delivering vaccines to any type of tissue, especially skin and mucous membrane.In some embodiments, needleless injectors can be used to propel liquid containing vaccines to the surface and into the skin or mucous membrane of a subject.Representative examples of different types of tissue that can be treated using the method of the present invention include pancreas, larynx, nasopharynx, sublingual, oral pharynx, lips, throat, lung, heart, kidney, muscle, breast, colon, prostate, thymus, testis, skin, mucosal tissue, ovary, blood vessels, or any combination thereof.

[0127] MID may have needle electrodes to electroporate tissue. Pulsing between multiple pairs of electrodes in multiple electrode arrays, for example set in a rectangular or square pattern, provides improved results than pulsing between a pair of electrodes. For example, U.S. Patent No. 5,702,359, entitled "Needle Electrodes for Mediated Delivery of Drugs and Genes," discloses a needle array in which multiple pairs of needles can be pulsed during therapeutic treatment. In this application, which is incorporated herein by reference as fully set forth, the needles are arranged in a circular array, but with connectors and switching devices that allow pulsing between opposing pairs of needle electrodes. A pair of needle electrodes can be used to deliver recombinant expression vectors to cells. Such devices and systems are described in U.S. Patent No. 6,763,264, the contents of which are incorporated herein by reference. Alternatively, a single needle device could be used that allows DNA injection and electroporation with a single needle similar to a regular hypodermic needle and applies lower voltage pulses than those delivered by currently used devices, thus reducing the electrical sensation experienced by the patient.

[0128] The MID may include one or more electrode arrays. The array may include two or more needles of the same or different diameters. The needles may be evenly or unevenly spaced. The needles may be 0.005 inches to 0.03 inches, 0.01 inches to 0.025 inches, or 0.015 inches to 0.020 inches. The needles may be 0.0175 inches in diameter. The needles may be spaced 0.5 mm, 1.0 mm, 1.5 mm, 2.0 mm, 2.5 mm, 3.0 mm, 3.5 mm, 4.0 mm, or more apart.

[0129] The MID may consist of a pulse generator and two or more needle vaccine injectors that deliver vaccine and electroporation pulses in a single step. The pulse generator may allow flexible programming of pulse and injection parameters via a personal computer operated with a flash card, as well as comprehensive recording and storage of electroporation and patient data. The pulse generator may deliver various voltage pulses for a short period of time. For example, the pulse generator may deliver three 15-volt pulses with a duration of 100 milliseconds. One example of such an MID is the Ergen 1000 system by Inovio Biomedical Corporation, described in U.S. Patent No. 7,328,064, the contents of which are incorporated herein by reference.

[0130] The MID can be a CELLECTRA® (Inovio Pharmaceuticals, Blue Bell PA) device and system, which is a modular electrode system that facilitates the introduction of macromolecules, such as DNA, into cells of selected tissues within the body or plant. The modular electrode system may include multiple needle electrodes, a hypodermic needle, an electrical connector that provides a conductive link from a programmable constant current pulse controller to the multiple needle electrodes, and a power source. An operator can grasp the multiple needle electrodes attached to a support structure and firmly insert them into selected tissues of the living body or plant. The macromolecule is then delivered to the selected tissue through the hypodermic needle. A programmable constant current pulse controller is activated and a constant current electrical pulse is applied to the multiple needle electrodes. The applied constant current electrical pulse facilitates the introduction of the macromolecule into the cells between the multiple electrodes. Cell death due to overheating of the cells is minimized by limiting the power consumption in the tissue with the constant current pulse. The Cellectra® device and system are described in U.S. Pat. No. 7,245,963, the contents of which are incorporated herein by reference. The CELLECTRA® device can be a CELLECTRA 2000® device or a CELLECTRA® 3PSP device.

[0131] The MID can be the Elgen 1000 system (Inovio Pharmaceuticals). The Elgen 1000 system can include a device providing a hollow needle and a fluid delivery means, where the device is adapted to activate the fluid delivery means in use to simultaneously (e.g. automatically) inject a fluid, which is a vaccine as described herein, into the body tissue while the needle is being inserted into the body tissue. The advantage is that the fluid can be injected gradually while the needle is being inserted, leading to a more even distribution of the fluid through the body tissue. It is also believed that the pain experienced during injection is reduced due to the distribution of the volume of the fluid injected over a larger area.

[0132] Additionally, the automatic injection of fluid facilitates automatic monitoring and registration of the actual dose of fluid injected. This data can be stored by the control unit for documentation purposes, if desired.

[0133] It is understood that the injection rate can be either linear or non-linear, and injection can occur after the needles are inserted through the skin of the subject being treated, and as they are further inserted into the body tissue.

[0134] Suitable tissues into which fluid may be injected by the device of the present invention include tumor tissue, skin or liver tissue, but may also be muscle tissue.

[0135] The device further comprises a needle insertion means for guiding the insertion of the needle into the body tissue. The fluid injection rate is controlled by the needle insertion rate. This has the advantage that both the needle insertion and the injection of the injection fluid can be controlled, so that the insertion rate can be adapted to the injection rate as required. It also makes it easier for the user to operate the device. If required, a means can be provided for automatically inserting the needle into the body tissue.

[0136] The user can select the time to start the injection of the liquid. Ideally, however, the injection begins when the tip of the needle reaches the muscle tissue, and the device may include means for sensing when the needle has been inserted deep enough for the injection to begin. This means that the device can be prompted to automatically start the injection of the liquid when the needle reaches the desired depth, which will usually be the depth at which the muscle tissue begins. The depth at which the muscle tissue begins may be a preset needle insertion depth, such as a value of 4 mm, which is deemed sufficient for the needle to pass through the skin layer.

[0137] The sensing means may include an ultrasonic probe. The sensing means may include means for sensing changes in impedance or resistance. In this case, the means may be adapted to not so record the depth of the needle within the body tissue, but rather to sense changes in impedance or resistance as the needle moves through different types of body tissue and into the muscle. Either of these alternatives provide a relatively accurate and simple means of operating the sensing means by which injection may be initiated. The depth of needle insertion may be further recorded if desired and used to control the injection of fluid, such that the volume of fluid injected is determined as the depth of needle insertion is recorded.

[0138] The device may further comprise a base for supporting the needle and a housing for receiving the base therein, the base being movable relative to the housing such that the needle is retracted into the housing when the base is in a first rearward position relative to the housing and the needle extends out of the housing when the base is in a second forward position within the housing. This is advantageous for a user as the housing can be lined up on a patient's skin and then the needle can be inserted into the patient's skin by moving the housing relative to the base.

[0139] As mentioned above, it is desirable to achieve a controlled rate of fluid injection so that the fluid is evenly distributed over the length of the needle as it is inserted into the skin. The fluid delivery means may include a piston drive means adapted to inject the fluid at a controlled rate. The piston drive means may be actuated, for example, by a servo motor. However, the piston drive means may be actuated by a base that is moved axially relative to the housing. It will be appreciated that alternative means of fluid delivery may be provided. Thus, for example, a closed container that can be squeezed for fluid delivery at a controlled or uncontrolled rate may be provided instead of a syringe and piston system.

[0140] The above-mentioned device can be used for any type of injection. However, it is believed to be particularly useful in the field of electroporation, and therefore it may further include a means for applying a voltage to the needle. This allows the needle to be used as an electrode during electroporation, not just injection. This is particularly advantageous since it means that the electric field is applied to the same area as the injected fluid. Previously, electroporation had a problem in that it was very difficult to accurately align the electrode with the previously injected fluid, so users tended to inject a larger volume of fluid in a larger area and apply the electric field to a higher area to ensure overlap of the injected material and the electric field. Using the present invention, a good match between the electric field and the fluid can be achieved while reducing both the volume of the injected fluid and the magnitude of the applied electric field.

[0141] Combined Use In some embodiments, the present invention provides methods of treating, protecting against, and / or preventing a SARS-CoV-2 infection or a disease or disorder associated with SARS-CoV-2 infection in a subject in need thereof by administering a combination of a nucleic acid molecule encoding a SARS-CoV-2 antigen, or a fragment or variant thereof, in combination with one or more additional agents for the treatment of SARS-CoV-2 infection or for the treatment or prevention of a disease or disorder associated with SARS-CoV-2 infection. In some embodiments, the disease or disorder associated with SARS-CoV-2 infection is coronavirus disease 2019 (COVID-19), multisystem inflammatory syndrome in adults (MIS-A), or multisystem inflammatory syndrome in children (MIS-C).

[0142] The nucleic acid molecules encoding the SARS-CoV-2 antigen and the additional agent may be administered using any suitable method such that a combination of the nucleic acid molecules encoding the SARS-CoV-2 antigen and the additional agent are both present in the subject. In one embodiment, the method may include administering a first composition comprising an agent for treating SARS-CoV-2 infection or treating or preventing a disease or disorder associated with SARS-CoV-2 infection, and administering a second composition comprising a nucleic acid molecule encoding a SARS-CoV-2 antigen less than 1 day, less than 2 days, less than 3 days, less than 4 days, less than 5 days, less than 6 days, less than 7 days, less than 8 days, less than 9 days, or less than 10 days after administering the first composition comprising an agent for treating SARS-CoV-2 infection or treating or preventing a disease or disorder associated with SARS-CoV-2 infection. In one embodiment, the method may include administration of a first composition comprising a nucleic acid molecule encoding a SARS-CoV-2 antigen and administration of a second composition comprising an agent for treating SARS-CoV-2 infection or treating or preventing a disease or disorder associated with SARS-CoV-2 infection less than 1 day, less than 2 days, less than 3 days, less than 4 days, less than 5 days, less than 6 days, less than 7 days, less than 8 days, less than 9 days, or less than 10 days after administration of the nucleic acid molecule encoding the SARS-CoV-2 antigen. In one embodiment, the method may include simultaneous administration of a first composition comprising an agent for treating SARS-CoV-2 infection or treating or preventing a disease or disorder associated with SARS-CoV-2 infection and a second composition comprising a nucleic acid molecule encoding a SARS-CoV-2 antigen. In one embodiment, the method may include administration of a single composition comprising an agent for treating SARS-CoV-2 infection or treating or preventing a disease or disorder associated with SARS-CoV-2 infection and a nucleic acid molecule encoding a SARS-CoV-2 antigen.

[0143] In some embodiments, the agent for treating SARS-CoV-2 infection or treating or preventing a disease or disorder associated with SARS-CoV-2 infection is a therapeutic agent. In one embodiment, the therapeutic agent is an antiviral agent. In one embodiment, the therapeutic agent is an antibiotic agent.

[0144] Non-limiting examples of antibiotics that can be used in combination with the nucleic acid molecules encoding the SARS-CoV-2 antigens of the present invention include aminoglycosides (e.g., gentamicin, amikacin, tobramycin), quinolones (e.g., ciprofloxacin, levofloxacin), cephalosporins (e.g., ceftazidime, cefepime, cefoperazone, cefpirome, ceftobiprole), antipseudomonal penicillins: carboxypenicillins (e.g., carbenicillin and ticarcillin) and ureidopenicillins (e.g., mezlocillin, azlocillin, and piperacillin), carbapenems (e.g., meropenem, imipenem, doripenem), polymyxins (e.g., polymyxin B and colistin), and monobactams (e.g., aztreonam).

[0145] Booster Administration In one embodiment, the immunogenic composition is administered as a booster vaccine after administration of an initial agent or vaccine for the treatment of SARS-CoV-2 infection or the treatment or prevention of a disease or disorder associated with SARS-CoV-2 infection, including but not limited to COVID-19, multisystem inflammatory syndrome in adults (MIS-A), or multisystem inflammatory syndrome in children (MIS-C). In one embodiment, the booster vaccine is administered at least once, at least twice, at least three times, at least four times, or at least five times after administration of an initial agent or vaccine for the treatment of SARS-CoV-2 infection or the treatment or prevention of a disease or disorder associated with SARS-CoV-2 infection, including but not limited to COVID-19, multisystem inflammatory syndrome in adults (MIS-A), or multisystem inflammatory syndrome in children (MIS-C). In one embodiment, the booster vaccine is administered at least 8 hours, at least 12 hours, at least 16 hours, at least 20 hours, at least 24 hours, at least 36 hours, at least 48 hours, at least 60 hours, at least 72 hours, at least 4 days, at least 5 days, at least 6 days, at least 1 week at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, at least 1 year, or more than 1 year after administration of an initial agent or vaccine for the treatment of SARS-CoV-2 infection or the treatment or prevention of a disease or disorder associated with SARS-CoV-2 infection, including, but not limited to, COVID-19, multisystem inflammatory syndrome in adults (MIS-A), or multisystem inflammatory syndrome in children (MIS-C).

[0146] Use in assays In some embodiments, the nucleic acid molecules of the present invention, or the encoded antigens, can be used in assays in vivo or in vitro. In some embodiments, the nucleic acid molecules, or the encoded antigens, can be used in assays to detect the presence of anti-SARS-CoV-2 spike antibodies. Exemplary assays in which the nucleic acid molecules or the encoded antigens can be incorporated include, but are not limited to, Western blots, dot blots, surface plasmon resonance, flow cytometry, various immunoassays, such as immunohistochemistry assays, immunocytochemistry assays, ELISA, capture ELISA, enzyme-linked immunospot (ELISpot) assays, sandwich assays, enzyme immunoassays, radioimmunoassays, fluorescent immunoassays, and the like, all of which are known to those of skill in the art. See, for example, Harlow et al., 1988, Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Harlow et al., 1999, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY.

[0147] In one embodiment, the SARS-CoV-2 spike antigen of the present invention, or a fragment thereof, can be used in an assay for intracellular cytokine staining combined with flow cytometry to assess T cell immune responses. This assay allows for the simultaneous assessment of multiple phenotypic, differentiation, and functional parameters associated with responding T cells, in particular the expression of multiple effector cytokines. These attributes make this a particularly suitable technique for the assessment of T cell immune responses induced by the vaccines of the present invention.

[0148] In one embodiment, the SARS-CoV-2 spike antigen of the present invention, or a fragment thereof, can be used in an ELIspot assay. The ELISpot assay is a highly sensitive immunoassay that measures the frequency of cytokine-secreting cells at the single cell level. In this assay, cells are cultured on a surface coated with a specific capture antibody in the presence or absence of a stimulus. In one embodiment, the SARS-CoV-2 spike antigen of the present invention, or a fragment thereof, can be used as a stimulus in an ELISpot assay.

[0149] Diagnostic methods In some embodiments, the invention relates to a method of diagnosing a subject as having a SARS-CoV-2 infection or having SARS-CoV-2 antibodies. In some embodiments, the method comprises contacting a sample from the subject with a SARS-CoV-2 antigen of the invention, or a cell comprising a nucleic acid molecule for expression of a SARS-CoV-2 antigen, and detecting binding of an anti-SARS-CoV-2 spike antibody to the SARS-CoV-2 antigen of the invention. In such embodiments, binding of an anti-SARS-CoV-2 spike antibody present in the subject's sample to an antigen of the invention, or a fragment thereof, would indicate that the subject is currently or previously infected with SARS-CoV-2.

[0150] Kits and Articles of Manufacture Provided herein is a kit that can be used to treat a subject using the vaccination method described above. The kit can include an immunogenic composition as described herein.

[0151] The kit may also include instructions for carrying out the vaccination method described above and / or instructions for using the kit. The instructions included in the kit may be affixed to the packaging material or may be included as a package insert. The instructions are typically, but are not limited to, a document or printed matter. Any medium capable of storing the instructions and transmitting them to an end user is contemplated by the present disclosure. Such media include, but are not limited to, electronic storage media (e.g., magnetic disks, tapes, cartridges), optical media (e.g., CD ROM), and the like. As used herein, the term "instructions" may include the address of an internet site that provides the instructions.

[0152] Further provided herein is an article of manufacture containing the immunogenic composition described herein. In some embodiments, the article of manufacture is a container, e.g., a vial, optionally a disposable vial. In one embodiment, the article of manufacture is a disposable glass vial with a stopper that contains the immunogenic composition described herein to be administered. In some embodiments, the vial includes a stopper that can be penetrated by a syringe and a seal. In some embodiments, the article of manufacture is a syringe.

[0153] The present invention has multiple aspects and is illustrated by the following non-limiting examples. EXAMPLES

[0154] Example 1 material and method: Cell Lines. Human Embryonic Kidney (HEK)-293T (ATCC® CRL-3216™) and African Green Monkey Kidney COS-7 (ATCC® CRL-1651™) cell lines were obtained from ATCC (Old Town Manassas, VA). All cell lines were maintained in DMEM supplemented with 10% fetal bovine serum (FBS) and penicillin-streptomycin.

[0155] In vitro protein expression (Western blot). Human embryonic kidney cells, 293T, were cultured and transfected as previously described (Yan, et al. Enhanced cellular immune responses elicited by an engineered HIV-1 subtype B consensus-based envelope DNA vaccine. Mol Ther. 2007;15(2):411-421.). 293T cells were transfected with pDNA using TurboFectin 8.0 (OriGene) transfection reagent according to the manufacturer's protocol. After 48 hours, cell lysates were harvested using modified RIPA cell lysis buffer. Proteins were separated on 4-12% Bis-Tris gels (ThermoFisher Scientific). After transfer, blots were incubated with anti-SARS-CoV spike protein polyclonal antibody (Novus Biologicals) and then visualized with horseradish peroxidase (HRP)-conjugated anti-mouse IgG (GE Amersham).

[0156] Immunofluorescence of transfected 293T cells. For in vitro staining of spike protein expression, 293T cells were cultured on 4-well glass slides (Lab-Tek) and transfected with 3 μg / well pDNA using TurboFectin 8.0 (OriGene) transfection reagent according to the manufacturer's protocol. Cells were fixed 48 hours after transfection with 10% neutral buffered formalin (BBC Biochemical, Washington State) for 10 minutes at room temperature (RT) and then washed with PBS. Before staining, chamber slides were blocked with 0.3% (v / v) Triton-X (Sigma), 2% (v / v) donkey serum in PBS for 1 hour at room temperature. Cells were stained with rabbit anti-SARS-CoV spike protein polyclonal antibody (Novus Biologicals) diluted in 1% (w / v) BSA (Sigma), 2% (v / v) donkey serum, 0.3% (v / v) Triton-X (Sigma), and 0.025% (v / v) 1 g / ml sodium azide (Sigma) in PBS for 2 h at room temperature. Slides were washed three times for 5 min in PBS and then stained with donkey anti-rabbit IgG AF488 (Life Technologies, A21206) for 1 h at room temperature. Slides were washed again, mounted, and covered with DAPI-Fluoromount (SouthernBiotech).

[0157] In vitro RNA expression (qRT-PCR). In vitro mRNA expression of the plasmids was demonstrated by analysis of total RNA extracted from cells using reverse transcription and PCR after transfection of COS-7 with serially diluted plasmids. Transfection of four concentrations of plasmids was performed using FuGENE® 6 Transfection Reagent (Promega) resulting in a final mass ranging from 80 to 10 ng / well. Transfections were performed in duplicate. After 18-26 h of incubation, cells were lysed with RLT buffer (Qiagen). Total RNA was isolated from each well using the Qiagen RNeasy kit according to the kit instructions. The resulting RNA concentration was determined by OD 260 / 280The RNA was determined by NMR spectroscopy and samples of RNA were diluted to 10 ng / μL. One hundred nanograms of RNA was then converted to cDNA using a high-capacity cDNA reverse transcription (RT) kit (Applied Biosystems) according to the kit's instructions. As a control for plasmid DNA or cellular genomic DNA sample contamination, an RT reaction containing RNA but no reverse transcriptase (minus RT) was included. 8 μL of sample cDNA was then subjected to PCR using primers and probe specific for the target sequence (pGX9501 forward-CAGGACAAGAACACACAGGAA (SEQ ID NO: 7); pGX9501 reverse-CAGGCAGGATTTGGGAGAAA (SEQ ID NO: 8); pGX9501 probe-ACCCATCAAGGACTTTGGAGG (SEQ ID NO: 9); and pGX9503 forward-AGGACAAGAACACACAGGAAG (SEQ ID NO: 10); pGX9503 reverse-CAGGATCTGGGAGAAGTTGAAG (SEQ ID NO: 11); pGX9503 probe-ACACCACCCATCAAGGACTTTGGA (SEQ ID NO: 12)). In separate reactions, the same amount of sample cDNA was subjected to PCR using primers and probes designed for the β-actin sequence of COS-7 cell line (β-actin forward-GTGACGTGGACATCCGTAAA (SEQ ID NO: 13); β-actin reverse-CAGGGCAGTAATCTCCTTCTG (SEQ ID NO: 14); β-actin probe-TACCCTGGCATTGCTGACAGGATG (SEQ ID NO: 15)). Primers and probes were synthesized by Integrated DNA Technologies, Inc. and the probes were labeled with 56-FAM and Black Hole Quencher 1. Reactions used ABI Fast Advance 2X (Cat. No. 4444557) with final forward and reverse primer concentrations of 1 μM and a probe concentration of 0.3 μM.Using the QuantStudio™ 7 Flex Real Time PCR Studio System (Applied Biosystems), samples were first subjected to a 1 min hold at 95°C, then 40 cycles of PCR, each cycle consisting of 1 s at 95°C and 20 s at 60°C. After PCR, the amplification results were analyzed as follows. Negative transfection controls (NTCs), minus RT controls, and NTCs were examined for each of their respective applications. The threshold cycles (C) of each transfection concentration for INO-4800 SARS-CoV-2 target mRNA and β-actin mRNA were analyzed. T ) were generated from the QuantStudio™ software using automatic threshold settings. TThe plasmid was considered active for mRNA expression if it was greater than 100%. Animals: Female, 6-week-old C57 / BL6 and BALB / c mice were purchased from Charles River Laboratories (Malvern, PA) and The Jackson Laboratory (Bar Harbor, ME). Female, 8-week-old Hartley guinea pigs were purchased from Elm Hill Labs (Chelmsford, MA). All animals were housed at The Wistar Institute Animal Facility or Acculab Life Sciences (San Diego, CA) animal facilities. All animal tests and investigations complied with all relevant ethical regulations and studies received ethical approval by the Wistar Institute or Acculab Institutional Animal Care and Use Committees (IACUC). For mouse studies, pDNA was administered at a dose of 2.5, 10 or 25 μg into the tibialis anterior (TA) muscle by needle injection on day 0, followed by CELLECTRA® in vivo electroporation (EP). CELLECTRA® EP delivery consisted of two sets of pulses with a 0.2 amp constant current. The second set of pulses was delayed by 3 seconds. Within each set, there were two 52 ms pulses with a 198 ms delay between pulses. Blood was collected on days 0 and 14. For analysis of cellular immune responses, parallel groups of mice were serially sacrificed on days 4, 7, and 10 after immunization. For guinea pig studies, 100 μg of pDNA was administered to the skin on day 0 by Mantoux injection followed by CELLECTRA® In Vivo EP.

[0158] Antigen binding ELISA. ELISA was performed to determine serum antibody binding titers. Nunc ELISA plates were coated with recombinant protein antigen at 1 μg / ml in Dulbecco's phosphate buffered saline (DPBS) overnight at 4° C. Plates were washed three times and then blocked with 3% bovine serum albumin (BSA) in DPBS containing 0.05% Tween® 20 for 2 hours at 37° C. Plates were then washed and incubated with serial dilutions of mouse or guinea pig serum and incubated for 2 hours at 37° C. Plates were washed again and then incubated with a 1:10,000 dilution of horseradish peroxidase (HRP)-conjugated anti-guinea pig IgG secondary antibody (Sigma-Aldrich, Cat. No. A7289) or HRP-conjugated anti-mouse IgG secondary antibody (Sigma-Aldrich) and incubated for 1 hour at room temperature. After a final wash, plates were developed using SureBlue™ TMB 1-component peroxidase substrate (KPL, Cat. No. 52-00-03) and the reaction was stopped with TMB stop solution (KPL, Cat. No. 50-85-06). Plates were read within 30 minutes at a wavelength of 450 nm using a Synergy™ HTX plate reader (BioTek Instruments, Highland Park, VT). Binding antibody endpoint titers (EPTs) were calculated as previously described (Bagarazzi ML, Yan J, Morrow MP, et al. Immunotherapy against HPV16 / 18 generates potent TH1 and cytotoxic cellular immune responses. Sci Transl Med. 2012;4(155):155ra138).The binding antigens tested include SARS-CoV-2 antigens: S1 spike protein (Sino Biological 40591-V08H), S1+S2 ECD spike protein (Sino Biological 40589-V08B1), RBD (University of Texas, at Austin (McLellan Lab.)), SARS-COV antigens: spike S1 protein (Sino Biological 40150-V08B1), S(1-1190) (Immune Tech IT-002-001P) and spike C-terminus (Meridian Life Science R18572).

[0159] ACE2 Competition ELISA. For mouse studies, an ELISA was performed to determine serum IgG antibody competition against human ACE2 with a human Fc tag. Nunc ELISA plates were coated with rabbit anti-His6X at 1 μg / mL in 1× PBS for 4-6 hours at room temperature (RT) and washed four times with wash buffer (1× PBS and 0.05% Tween® 20). Plates were blocked overnight at 4°C with blocking buffer (1× PBS, 0.05% Tween® 20, 5% evaporated milk and 1% FBS). Plates were washed four times with wash buffer and then incubated with full-length (S1+S2) spike protein containing a C-terminal His tag (Sino Biologics, Cat. No. 40589-V08B1) at 10 μg mL-1 for 1 hour at room temperature. Plates were washed and then serial dilutions of purified mouse IgG mixed with 0.1 μg mL-1 recombinant human ACE2 with a human Fc tag (ACE2-IgHu) were incubated for 1–2 h at room temperature. Plates were washed again and then incubated with a 1:10,000 dilution of horseradish peroxidase (HRP)-conjugated anti-human IgG secondary antibody (Bethyl, Cat. No. A80-304P) and incubated for 1 h at room temperature. The final washed plate was developed using 1-Step Ultra TMB-ELISA substrate (Thermo, Cat. No. 34029) followed by stopping the reaction with 1 M sulfuric acid. Plates were read at a wavelength of 450 nm within 30 min using a SpectraMax Plus 384 microplate reader (Molecular Devices, Sunnyvale, CA). Competition curves were plotted and the area under the curve (AUC) was calculated using Prism 8 analysis software with multiple t-tests to determine statistical significance.

[0160] For guinea pig studies, 96-well half-area assay plates (Costar) were coated overnight at 4°C with 25 μl per well of 5 μg / mL SARS-CoV-2 spike S1+S2 protein (Sino Biological) diluted in 1×DPBS (Thermofisher). Plates were washed with 1×PBS buffer containing 0.05% TWEEN® 20 (Sigma). 100 μl per well of 3% (w / v) BSA (Sigma) in 1×PBS containing 0.05% TWEEN® 20 was added and incubated for 1 h at 37°C. Serum samples were diluted 1:20 in 1% (w / v) BSA in 1×PBS containing 0.05% TWEEN®. After washing the assay plates, 25 μl / well of diluted serum was added and incubated for 1 h at 37°C. Human recombinant ACE2-Fc-tag (Sinobiological) was added directly to the diluted serum followed by incubation at 37°C for 1 hour. Plates were washed and 25 μl per well of 1:10,000 diluted goat anti-hu Fc fragment antibody HRP (Bethyl, A80-304P) was added to the assay plate. Plates were incubated for 1 hour at room temperature. For development, SureBlue / TMB stop solution (KPL, MD) was used and OD was recorded at 450 nm.

[0161] SARS-CoV-2 pseudovirus neutralization assay. SARS-CoV-2 pseudovirus was generated using HEK293T cells transfected with GeneJammer (Agilent) using IgE-SARS-CoV-2 S plasmid (Genscript) and pNL4-3.Luc.RE-plasmid (NIH AIDS Reagent) at a 1:1 ratio. 48 hours after transfection, transfection supernatants were harvested, concentrated with FBS to 12% final volume, sterile filtered (Millipore Sigma), and aliquoted for storage at -80°C. SARS-CoV-2 pseudovirus was titrated to obtain >50-fold relative luminescence units (RLU) over cells alone after 72 hours of infection. Mouse sera from INO-4800 vaccinated and naïve groups were heat inactivated at 56°C for 15 minutes and serially diluted 3-fold starting at a 1:10 dilution for the assay. Serum was incubated with a fixed amount of SARS-CoV-2 pseudotyped virus for 90 min. HEK293T cells stably expressing ACE2 were added after 90 min and incubated for 72 h in a standard incubator (37% humidity, 5% CO2). After infection, cells were lysed using the britelite™ plus luminescent reporter gene assay system (Perkin Elmer catalog number 6066769) and relative luminescence units (RLU) were measured using a Biotek plate reader. Neutralization titers (ID 50 ) was calculated as the serum dilution that resulted in a 50% reduction in RLU compared to the RLU in virus control wells, after subtraction of background RLU in cell control wells.

[0162] SARS-CoV-2 wild-type virus neutralization assay. SARS-CoV-2 / Australia / VIC01 / 2020 isolate neutralization assays were performed at Public Health England (Porton Down, UK). Neutralized virus titers were measured in heat-inactivated serum samples at 56°C for 30 min. SARS-CoV-2 (Australia / VIC01 / 2020 isolate) (Caly et al., Isolation and rapid sharing of the 2019 novel coronavirus (SARS-CoV-2) from the first patient diagnosed with COVID-19 in Australia. Med. J. Aust. (2020) doi:10.5694 / mja2.50569; published online: April 13, 2020) was diluted to a concentration of 933 pfu / ml and mixed 50:50 in 1% FCS / MEM containing 25 mM HEPES buffer, with serum dilutions ranging from 1:10 to 1:320 in 96-well V-bottom plates. Plates were incubated at 37°C for 1 h in a humidified box, after which 1.5 × 10 per well were mixed in 10% FCS / MEM. 5 Virus was transferred to wells of 24-well plates seeded the day before with 10 ...

[0163] SARS-CoV-2 / WH-09 / human / 2020 isolate neutralization assays were performed at the Institute of Laboratory Animal Science, Chinese Academy of Medical Sciences (CAMS), which is approved by the National Health Commission of the People's Republic of China. Seed SARS-CoV-2 (SARS-CoV-2 / WH-09 / human / 2020) stock and virus isolation studies were performed in Vero E6 cells, which were maintained in Dulbecco's modified Eagle's medium (DMEM, Invitrogen, Carlsbad, USA) supplemented with 10% fetal bovine serum (FBS), 100 IU / ml penicillin, and 100 μg / ml streptomycin, and incubated at 36.5 °C and 5% CO2. Viral titers were determined using a standard tissue culture infectious dose 50 (TCID50) assay. Serum samples taken from immunized animals were inactivated at 56°C for 30 min and serially diluted in duplicate in cell culture medium. The diluted samples were mixed with 100 TCID50 of virus suspension in a 96-well plate in a 1:1 ratio, followed by incubation for 2 h at 36.5°C in a 5% CO2 incubator. Then, 1–2 × 10 4 Vero cells were added and the plate was incubated for 3-5 days in a 36.5°C, 5% CO2 incubator. The cytopathic effect (CPE) of each well was recorded under a microscope, and the neutralization titer was calculated according to the dilution number of the 50% protective condition.

[0164] Bronchoalveolar lavage collection. Bronchoalveolar lavage (BAL) fluid was collected by lavaging the lungs of euthanized and exsanguinated mice with 700-1000 ul of ice-cold PBS containing 100 μm EDTA, 0.05% sodium azide, 0.05% Tween® 20, and 1× protease inhibitors (Pierce) (Mucosa Preparation Solution (MPS)) using a blunt end needle. Guinea pig lungs were lavaged with 20 ml of MPS via a 16G catheter inserted into the trachea. Collected BAL fluid was stored at −20°C until time of assay.

[0165] IFN-γ ELISpot. Mouse: Spleens from mice were individually harvested and processed into single cell suspensions in RPMI1640 medium supplemented with 10% FBS (R10) and penicillin / streptomycin. The cell pellets were resuspended in 5 mL of ACK lysis buffer (Life Technologies, Carlsbad, CA) for 5 min at room temperature, and then PBS was added to stop the reaction. Samples were centrifuged again at 1,500 g for 10 min, and the cell pellets were resuspended in R10 and then passed through a 45 μm nylon filter before being used for the ELISpot assay. The ELISpot assay was performed as follows: Mouse IFN-γ ELISpot PLUS ELISpot assays were performed using plates (MABTECH). 96-well ELISpot plates pre-coated with capture antibodies were blocked overnight at 4°C with R10 medium. 200,000 mouse splenocytes were plated in each well and stimulated for 20 h with pools of 15mer peptides overlapping by 9 amino acids from SARS-CoV-2, SARS-CoV, or MERS-CoV spike proteins (5 peptide pools per protein). In addition, matrix mapping was performed using peptide pools in a matrix designed to identify immunodominant responses. Cells were stimulated with a final concentration of 5 μL of each peptide / well in RPMI + 10% FBS (R10). Spots were developed based on the manufacturer's instructions. R10 and cell stimulation cocktail (Invitrogen) were used for negative and positive controls, respectively. Spots were scanned and quantified by an ImmunoSpot™ CTL reader. Spot-forming units (SFU) per million cells were calculated by subtracting negative control wells.

[0166] Flow cytometry. Intracellular cytokine staining was performed on splenocytes harvested from BALB / c and C57BL / 6 mice and stimulated with overlapping peptides spanning the SARS-CoV-2 S protein for 6 h at 37 °C, 5% CO2. Unless stated, cells were stained with the following antibodies from BD Biosciences at the dilutions listed in brackets: FITC anti-mouse CD107a (1:100), PerCP-Cy5.5 anti-mouse CD4 (1:100), APC anti-mouse CD8a (1:100), ViViD dye (1-40) (LIVE / DEAD® Fixable Violet Dead Cell Stain kit; Invitrogen, L34955), APC-Cy7 anti-mouse CD3e (1:100), and BV605 anti-mouse IFN-γ (1:75) (eBiosciences). Phorbol myristate acetate (PMA) was used as a positive control and complete medium alone was used as a negative control. Cells were washed, fixed, and cellular events were acquired using a FACS CANTO (BD Biosciences) followed by FlowJo software (FlowJo LLC, Ashland, OR) analysis.

[0167] Statistics. All statistical analyses were performed using GraphPad Prism 7 or 8 software (La Jolla, CA). The data were considered significant when p<0.05. Lines in all graphs represent the mean and error bars represent the standard deviation. No samples or animals were excluded from the analysis. No randomization was performed in the animal studies. Samples and animals were not blinded before each experiment was performed.

[0168] result Design and synthesis of SARS-CoV-2 DNA vaccine constructs Four spike protein sequences were taken from the first four available SARS-CoV-2 complete genome sequences published in GISAID (Global Initiative on Sharing All Influenza Data). Three spike sequences were 100% identical and one was considered an outlier (98.6% sequence identity with other sequences). After performing sequence alignment, a SARS-CoV-2 spike glycoprotein sequence ("Covid-19 spike antigen"; SEQ ID NO:1) was generated and an N-terminal IgE leader sequence was added. As described elsewhere herein, a highly optimized DNA sequence encoding the SARS-CoV-2 IgE-spike was created to enhance expression and immunogenicity. A SARS-CoV-2 spike outlier glycoprotein sequence ("Covid-19 spike-OL antigen"; SEQ ID NO:4) was generated and an N-terminal IgE leader sequence was added. The optimized DNA sequences were synthesized, digested with BamHI and XhoI, and cloned into the expression vector pGX0001 under the control of the human cytomegalovirus immediate early promoter and bovine growth hormone polyadenylation signal. The resulting plasmids, designated pGX9501 and pGX9503, were designed to encode the SARS-CoV-2 S protein from the three matched and outlier sequences, respectively (Figure 1A).

[0169] In vitro characterization of synthetic DNA vaccine constructs Expression of the encoded SARS-CoV-2 spike transgene was measured at the RNA level in COS-7 cells transfected with pGX9501 and pGX9503. Spike transgene expression was confirmed by RT-PCR using total RNA extracted from transfected COS-7 cells (Figure 1B). In vitro spike protein expression in 293T cells was measured by Western blot analysis using a cross-reactive antibody against SARS-CoV S protein on cell lysates. Western blots of lysates of HEK-293T cells transfected with pGX9501 or pGX9503 constructs revealed a band close to the predicted S protein molecular weight of 140-142 kDa with a slight shift likely due to the 22 potential N-linked glycans in the S protein (Figure 1C). In immunofluorescence studies, the S protein was detected in 293T cells transfected with pGX9501 or pGX9503 (Figure 1D). In summary, in vitro studies revealed the expression of spike protein at both RNA and protein levels after transfecting cell lines with candidate vaccine constructs.

[0170] Humoral immune response in mice. pGX9501 was selected as the vaccine construct to proceed to immunogenicity studies due to the broader coverage it is likely to provide compared to the outlier pGX9503. pGX9501 was hereafter referred to as INO-4800. The immunogenicity of INO-4800 was evaluated in BALB / c mice following administration to the tibialis anterior muscle using a CELLECTRA® delivery device. (Sardesai & Weiner, Curr. Opin. Immunol., 23, 421-429 (2011). Reactivity of sera from groups of mice immunized with INO-4800 was measured against a panel of SARS-CoV-2 and SARS-CoV antigens (Figure 2). Analysis revealed IgG binding to SARS-CoV-2 S protein antigen with limited cross-reactivity to SARS-CoV S protein antigen in sera of INO-4800-immunized mice. Serum IgG binding endpoint titers were measured in mice immunized with recombinant SARS-CoV-2 spike protein S1+S2 region (Figures 3A and 3B) and pDNA against recombinant SARS-CoV-2 spike protein receptor binding domain (RBD) (Figures 3C and 3D). Endpoint titers were observed in the sera of mice 14 days after immunization with a single dose of INO-4800 (Figures 3B, 3C, 3D).

[0171] Neutralization assay. A neutralization assay was developed using a pNL4-3.Luc.RE-based pseudovirus displaying the SARS-CoV-2 spike protein. Neutralization titers were detected by the reduction in relative luciferase units (RLU) compared to the control, which did not reduce the RLU signal. BALB / c mice were immunized twice with INO-4800, on days 0 and 14, and serum was collected on day 7 after the second immunization. Pseudovirus was incubated with serial dilutions of mouse serum, and the serum-virus mixture was added to 293T cells stably expressing the human ACE2 receptor (ACE2-293T) for 72 h. A neutralization ID50 mean titer of 92.2 was observed in INO-4800-immunized mice (Figures 4A and 4B). No reduction in RLU was observed for control animals. Neutralization titers were further measured against two wild-type SARS-CoV-2 virus strains by plaque reduction neutralization test (PRNT) assay. Sera from INO-4800-immunized BALB / c mice neutralized both the SARS-CoV-2 / WH-09 / human / 2020 and SARS-CoV-2 / Australia / VIC01 / 2020 virus strains with mean ND50 titers of 97.5 and 128.1, respectively (Table 1). Live virus neutralization titers were also assessed in C57BL / 6 mice following the same INO-4800 immunization regimen. Sera from INO-4800-immunized C57BL / 6 mice neutralized wild-type SARS-CoV-2 virus with a mean ND50 titer of 340 (Table 1). [Table 1]

[0172] The immunogenicity of INO-4800 in the Hartley guinea pig model, an established model for intradermal vaccine delivery (Carter, et al. The adjuvant GLA-AF enhances human intradermal vaccine responses. Sci Adv. 2018;4(9):eaas9930; Schultheis, et al. Characterization of guinea pig T cell responses elicited after EP-assisted delivery of DNA vaccines to the skin. Vaccine. 2017;35(1):61-70), was evaluated. 100 μg of pDNA was administered into the skin by Mantoux injection followed by administration by the CELLECTRA® device on the days described in the Methods section above. On day 14, serum antibody anti-spike protein binding was measured by ELISA. Immunization with INO-4800 revealed an immune response in terms of SARS-CoV-2 S1+2 protein-binding IgG levels in serum (Figures 5A and 5B). The SARS-CoV-2 S protein binding titers at the day 14 endpoint were 10,530 and 21 in guinea pigs treated with 100 μg INO-4800 or pVAX (control), respectively (Figure 5B). Antibody neutralizing activity following intradermal INO-4800 immunization in the guinea pig model was evaluated. Guinea pigs were treated with pVAX or INO-4800 on days 0, 14, and 28, and serum samples were collected on days 35 or 42 to measure serum neutralizing activity against pseudovirus or wild-type virus, respectively. SARS-CoV-2 pseudovirus neutralizing activity with a mean ND50 titer of 573.5 was observed for INO-4800-immunized guinea pigs (Table 1). Wild-type SARS-CoV-2 viral activity was also observed for INO-4800-immunized guinea pigs with ND50 titers >320 by PRNT assay observed in all animals (Table 1). The functionality of serum antibodies was further measured by assessing their ability to inhibit ACE2 binding to the SARS-CoV-2 spike protein.Serum collected from INO-4800-immunized guinea pigs after the second immunization (1:20 dilution) inhibited binding of SARS-CoV-2 spike protein over a range of concentrations of ACE-2 (0.25 μg / ml to 4 μg / ml) (Figure 6E). Furthermore, serum dilution curves revealed that serum collected from INO-4800-immunized guinea pigs blocked ACE-2 binding to SARS-CoV-2 in a dilution-dependent manner (Figure 6F). Serum collected from pVAX-treated animals showed negligible activity in inhibiting ACE-2 binding to viral proteins, and the reduced OD signal at the highest concentration of serum is considered as a matrix effect in the assay.

[0173] Inhibition of SARS-CoV-2 S protein binding to the ACE2 receptor. The receptor inhibition function of INO-4800-induced antibody responses was examined. An ELISA-based ACE2 inhibition assay was developed as a surrogate for neutralization. As a control in the assay, ACE2 is shown to bind to the SARS-CoV-2 spike protein with an EC50 of 0.025 μg / ml (Figure 6A). BALB / c mice were immunized with 10 μg INO-4800 on days 0 and 14, and serum IgG was purified on day 21 post-immunization to ensure that inhibition was antibody-mediated. Inhibition of spike-ACE2 interaction was compared using serum IgG from naive and INO-4800-vaccinated mice (Figure 6B). The receptor inhibition assay was repeated in groups of five immunized mice, demonstrating that INO-4800-induced antibodies compete with ACE2 binding to the SARS-CoV-2 spike protein (Figures 6C and 6F). ACE2 binding inhibition was further evaluated in a guinea pig model. Serum collected from INO-4800-immunized guinea pigs inhibited SARS-CoV-2 spike protein binding over a range of ACE2 concentrations (0.25 μg / ml to 4 μg / ml) (Figure 6D). Furthermore, serum dilution curves revealed that serum collected from INO-4800-immunized guinea pigs blocked ACE2 binding to SARS-CoV-2 in a dilution-dependent manner (Figure 6E). Serum collected from pVAX-treated animals showed negligible activity in inhibiting ACE2 binding to viral proteins, and the reduced OD signal at the highest concentration of serum is considered a matrix effect in the assay. Figure 6F shows IgG purified from n=5 mice 14 days after the second immunization with INO-4800, showing competition for ACE2 receptor binding to SARS-CoV-2 spike protein compared to pooled naive mouse IgG.

[0174] In summary, immunogenicity studies in both mice and guinea pigs revealed that the SARS-CoV-2 vaccine candidate, INO-4800, is able to induce antibody responses against the SARS-CoV-2 spike protein. ACE2 is considered to be the primary receptor for SARS-CoV-2 cell entry, and blocking this interaction suggests that INO-4800-induced antibodies can prevent host infection.

[0175] Biodistribution of SARS-CoV-2-reactive IgG to the lungs. Lower respiratory tract disease (LRD) is associated with severe cases of COVID-19. The presence of antibodies in the lung mucosa targeting SARS-CoV-2 could potentially mediate protection against LRD. We assessed the presence of SARS-CoV-2-specific antibodies in the lungs of immunized mice and guinea pigs. BALB / c mice and Hartley guinea pigs were immunized with INO-4800 or pVAX control pDNA on days 0 and 14, or days 0, 14 and 28, respectively. Bronchoalveolar lavage (BAL) fluid was collected after sacrifice and SARS-CoV-2 S protein ELISA was performed. In both BALB / c and Hartley guinea pigs that received INO-4800, we measured a statistically significant increase in SARS-CoV-2 S protein-binding IgG in BAL fluid compared to animals that received the pVAX control (Figures 7A-7D). Collectively, these data demonstrate the presence of anti-SARS-CoV-2 specific antibodies in the lungs following immunization with INO-4800.

[0176] Coronavirus cross-reactive cellular immune responses in mice. T cell responses to SARS-CoV-2, SARS-CoV, and MERS-CoV S antigens were assayed by IFN-γ ELISpot. Groups of BALB / c mice were sacrificed 4, 7, or 10 days after INO-4800 administration (2.5 or 10 μg pDNA), splenocytes were harvested, and single cell suspensions were stimulated for 20 h with a pool of 15mer overlapping peptides spanning the SARS-CoV-2, SARS-CoV, and MERS-CoV spike proteins. At 7 days after INO-4800 administration, 10 6 T cell responses of 205 and 552 SFU per splenocyte were measured for the 2.5 and 10 μg doses, respectively (Figure 8A). 6 We observed higher response magnitudes of 852 and 2,193 SFU per splenocyte. Furthermore, we assayed the cross-reactivity of the INO-4800-induced cellular response against SARS-CoV and measured the response at 7 days (10 days) post-administration. 6 74 [2.5 μg dose] and 140 [10 μg dose] SFU per splenocyte), and on day 10 (10 6 Both IFN-γ and CD8+ IFN-γ T cells showed lower, but detectable, T cell responses at both 242 [2.5 μg dose] and 588 [10 μg dose] SFU per splenocyte (Figure 8B). Interestingly, no cross-reactive T cell responses to MERS-CoV peptides were observed (Figure 8C). Representative images of IFN-γ ELISpot plates are provided in Figure 31. T cell populations that were producing IFN-γ were identified. Flow cytometric analysis of splenocytes harvested from BALB / c mice 14 days after a single INO-4800 immunization revealed that the T cell compartment contained 0.04% CD4+ and 0.32% CD8+ IFN-γ+ T cells after stimulation with SARS-CoV-2 antigens (Figure 32).

[0177] BALB / c SARS-CoV-2 epitope mapping. Epitope mapping was performed on splenocytes from BALB / c mice administered a 10 μg dose of INO-4800. Thirty matrix mapping pools were used to stimulate splenocytes for 20 hours, and immunodominant responses were detected with multiple peptide pools (Figure 14A). Responses were deconvoluted to identify several epitopes (H2-Kd) clustering within the receptor binding domain and within the S2 domain (Figure 14B). Interestingly, one SARS-CoV-2 H2-Kd epitope, PHGVVFLHV (SEQ ID NO: 16), was observed to overlap and be adjacent to the SARS-CoV human HLA-A2 restricted epitope VVFLHVTVYV (SEQ ID NO: 17).

[0178] In summary, T cell responses against SARS-CoV-2 S protein epitopes were detected in mice immunized with INO-4800.

[0179] Example 2 - Cellular and humoral immune responses measured in New Zealand White (NZW) rabbits treated with INO-4800. Intradermal delivery of pDNA on days 0 and 28. PBMC IFN-γ ELISpot (FIG. 9), serum IgG binding ELISA (FIG. 10).

[0180] Example 3 Humoral immune responses to SARS-CoV-2 spike protein measured in rhesus macaques treated with INO-4800. Intradermal pDNA delivery on days 0 and 28. Serum IgG binding ELISA. (Figures 11A-11E.)

[0181] Humoral immune responses to SARS and MERS spike proteins measured in INO-4800-treated rhesus macaques. Intradermal delivery of pDNA on days 0 and 28. Serum IgG binding ELISA. (Figures 12A-12G, left panels, 1 mg INO-4800; right panels, 2 mg INO-4800). Cellular immune responses measured by PBMC IFN-γ ELISpot in INO-4800-treated rhesus macaques after intradermal delivery of pDNA on days 0 and 28. Results are shown in Figures 13A (SARS CoV-2 spike peptide), 13B (SARS CoV spike peptide), and 13C (MERS CoV spike peptide).

[0182] Example 4 INO-4800 SARS-CoV-2 Spike ELISA Assay SARS-CoV-2 spike protein is coated onto the wells of a 96-well microplate by incubation overnight or for up to 3 days. A blocking buffer is then added to block any remaining free binding sites. A human serum sample containing antibodies against the SARS-COV-2 spike protein and assay controls is added to the blocked plate and incubated for 1 hour. During the incubation, the anti-spike protein antibodies present in the sample and the positive control bind to the spike protein immobilized on the plate. The plate is then washed to remove unbound serum components. Horseradish peroxidase (HRP)-labeled anti-human IgG antibody is then added to allow detection of the antibodies bound to the spike protein. After 1 hour of incubation, the plate is washed to remove unbound HRP detection antibody and TMB substrate is added to the plate. In the presence of horseradish peroxidase, the TMB substrate turns indigo blue in proportion to the amount of HRP present in the well. After allowing the reaction to proceed for approximately 10 minutes, an acid-based stop solution is added, stopping the enzymatic reaction and turning the TMB yellow. The yellow color is proportional to the amount of bound anti-spike protein antibody in each well and is read at 450 nm. The magnitude of the assay response is expressed as a titer. The titer value is defined as the highest serial dilution at which the assay signal is greater than a cutoff value based on the assay background level for a panel of sera from normal human donors.

[0183] ELISA Assay Qualification The INO-4800 SARS-CoV-2 spike ELISA assay has been qualified and found to be suitable for its intended use to measure humoral responses in subjects participating in clinical trials involving INO-4800. The formal qualification consisted of 18 plates and was performed over a 4-day period by two operators. The qualification determined the assay sensitivity, specificity, selectivity, and precision. At the time the assay was developed, convalescent serum was not available. Therefore, monoclonal antibodies were used in the development. All parameters in the assay were tested using monoclonal antibodies diluted in normal human serum. The overall assay sensitivity was found to be 16.1ng / mL for 1 / 20 diluted serum and 322ng / mL for undiluted serum. Specificity was assessed by pre-incubating anti-spike protein antibodies with recombinant spike protein prior to the assay. Pre-incubation with recombinant spike protein resulted in a signal reduction of over 60%, indicating that the antibodies specifically bound to the spike protein coated on the plate and not to different assay components. Selectivity was investigated by spiking individual human serum samples with a positive control anti-spike antibody at concentrations near the limit of detection. Seven of 10 individuals had a signal above the cutoff, and eight of 10 individuals had an assay signal within 20% of the average signal for the 10 individuals, demonstrating that matrix effects are expected to be minor for most human serum samples at a 1 / 20 dilution. Assay precision was assessed by assaying high, low, and medium anti-spike protein antibody positive controls six times on each of six plates. Results showed low intra-assay raw signal variability, but high inter-assay variability of raw signal. Since each individual plate cutoff was based on the signal of the negative control on each plate, inter-assay variability of raw signal is not expected to affect the precision of the final titer calculation. To test this, the precision of the plate cutoff was assessed in this qualification by titrating the HPC (high positive control) six times on each of the six plates for a total of 36 titer evaluations.Thirty-five of the 36 values ​​were identical (titer of 180), but one of the titer determinations was one step lower than the rest (60 instead of 180), which resulted in an interassay CV of 4.6%.

[0184] Example 5 INO-4800 SARS-CoV-2 Spike ELISPOT Assay The enzyme-linked immunospot (ELISPOT) assay is a highly sensitive immunoassay that measures the frequency of cytokine-secreting cells at the single-cell level. In this assay, cells are cultured on a surface coated with a specific capture antibody in the presence or absence of a stimulus. After an appropriate incubation time, the cells are removed and the secreted molecules are detected using a detection antibody in a procedure similar to that used by ELISA. The detection antibody is biotinylated, followed by streptavidin-enzyme conjugate. By using a substrate with a precipitate rather than a soluble product, the final result is a visible spot on the surface. Each spot corresponds to an individual cytokine-secreting cell. Qualification of the IFN-y ELISPOT assay was successfully completed by evaluation of the specificity, reproducibility, and precision of the assay (intra- and inter-assay precision), dynamic range, linearity, relative precision, limits of detection and quantification, and robustness of the assay. The assay has been tested and certified under GLP / GCLP laboratory guidelines.

[0185] ELISPOT Assay Qualification. Specificity readouts yielded a mean value of less than 10 spot forming units (SFU) for the assay negative control (medium with DMSO), a mean of 565 SFU for the positive control peptide pool CEF, and a mean of 593 SFU in response to stimulation with mitogens (phorbol myristate acetate + lonomycin). The highest reported CV% for intra-assay variability was 7.37%. The highest reported CV% for inter-assay variability was 17.23%. The highest observed CV% for inter-operator variability was 8.11%. These values ​​are below the FDA recommended standard acceptance criteria of 20%.

[0186] Linearity of the dilution curve was demonstrated with a slope of 0.15 and an R value of 0.99. Assay precision was greater than 90% across the enumerated dynamic range (156-5000 cells / well) and fell within the acceptance criteria of 80-120%. The detection limit was set at 11 SFU / 1 x 10 6 The cells were determined to be PBMCs, and the limit of quantification was set at 20 SFU / 1 × 10 6 The robustness of the assay was evaluated by varying (i) peptide concentration, (ii) secondary antibody concentration, (iii) incubation time, and (iv) drying of the plate membrane.

[0187] Based on the results of this qualification, the IFN-y ELISPOT will be considered qualified and ready for use in clinical trials.

[0188] Example 6 A Phase 1 Open-Label Study to Evaluate the Safety, Tolerability, and Immunogenicity of INO-4800, a Prophylactic Vaccine Against SARS-CoV-2, Administered Intradermally Followed by Electroporation in Healthy Volunteers This is a Phase 1, open-label, multicenter study (clinicaltrials_gov identifier NCT04336410) to evaluate the safety, tolerability, and immunological profile of INO-4800 (pGX9501) administered by intradermal (ID) injection followed by electroporation (EP) using a CELLECTRA® 2000 device in healthy adult volunteers. Approximately 40 healthy volunteers will be evaluated across two dose levels: Study Arm 1 and Study Arm 2, as shown in Table 2. A total of 20 subjects will be enrolled in each study arm. [Table 2]

[0189] All subjects will be followed for 24 weeks after the last dose. Week 28 marks the end of study (EOS) visit.

[0190] Main purpose: To evaluate the tolerability and safety of INO-4800 administered by ID injection followed by EP in healthy adult volunteers -Evaluate cellular and humoral immune responses to INO-4800 administered by ID injection followed by EP

[0191] Primary Safety Endpoint: Incidence of adverse events by system organ class (SOC), preferred term (PT), severity, and relationship to investigational drug Administration (i.e., injection) site reactions (described by frequency and severity) Incidence of adverse events of special interest

[0192] Primary Immunogenicity Endpoints: SARS-CoV-2 spike glycoprotein antigen-specific antibodies by binding assay

number

[0193] Exploratory purpose: Evaluate an expanded immunological profile by assessing both T and B cell immune responses

[0194] Exploratory Endpoints: Expanded immunological profile that may include, but is not limited to, additional assessment of T and B cell counts, neutralization responses, and T and B cell molecular changes by measuring immunological proteins and mRNA levels of genes of interest at every week as determined by sample availability.

[0195] Safety rating: Subjects will be followed for safety for the duration of the study until the end of study (EOS) or the subject's last visit. Adverse events will be collected at all visits (and phone call on Day 1). Clinical blood and urine specimens will be collected according to the schedule of events at Screening, Day 0 (pregnancy test only), Week 1, Week 4 (pregnancy test only), Week 6, Week 8, Week 12, and Week 28 (Table 3). All adverse events, regardless of relationship, will be collected from the time of consent until EOS. All serious adverse events, adverse events of special interest, and treatment-related adverse events will be followed until resolution or stabilization. [Table 3-1] [Table 3-2]

[0196] Immunogenicity assessment: Immunologic blood samples will be collected at screening, day 0 (pre-dose), week 4 (pre-dose), week 6, week 8, week 12, and week 28. Decision-making on analysis of collected samples for immunologic endpoints will be adjudicated on an ongoing basis throughout the study.

[0197] Clinical Trial Population: Healthy adult volunteers, aged 18-50 years, inclusive.

[0198] Inclusion Criteria: a.Adults aged 18-50, inclusive. b. Determined by the investigator to be in good health based on medical history, physical exam, and vital signs performed at screening. c. Able and willing to comply with all study procedures. d. Screening test results within the normal range or that the Investigator determines to be clinically insignificant. eNegative serology for hepatitis B surface antigen (HBsAg), hepatitis C antibody, and human immunodeficiency virus (HIV) antibody screening. f. A screening electrocardiogram (ECG) judged by the investigator to have no clinically significant findings (e.g., Wolff-Parkinson-White Syndrome). g. Use of a medically effective method of contraception with a failure rate of less than 1% per year when used consistently and correctly from screening through 3 months after the last dose; being postmenopausal, surgically sterile, or having a sterile partner.

[0199] Exclusion criteria: a. Currently pregnant or breastfeeding, or intending to become pregnant or father a child within the planned duration of the study starting from the Screening Visit up to 3 months after the last dose. b. Currently participating or having participated in a study using an investigational drug within 30 days prior to Day 0. c. Previous exposure to SARS-CoV-2 (laboratory testing at the investigator's discretion) or receipt of an investigational vaccine product for the prevention of COVID-19, MERS or SARS. d. Current or history of any of the following medical conditions: Respiratory diseases (e.g. asthma, chronic obstructive pulmonary disease). Hypertension, sitting systolic blood pressure >150mm Hg or diastolic blood pressure >95mm Hg. Malignancy within 5 years of screening. Cardiovascular disease (e.g., myocardial infarction, congestive heart failure, cardiomyopathy, or clinically significant arrhythmias). e. Immunosuppression as a result of an underlying disease or treatment, including: Primary immunodeficiency. · Prolonged use of oral or parenteral glucocorticoids (more than 7 days). · Current or anticipated use of disease-modifying doses of antirheumatic drugs and biologic disease-modifying drugs. History of solid organ or bone marrow transplant. History of other clinically significant immunosuppressive or clinically diagnosed autoimmune diseases. f. Fewer than two acceptable sites available for ID injections and EP, considering the anterolateral deltoid and quadriceps. g. Any physical examination finding and / or any medical history that, in the opinion of the Investigator, may confound the results of the study or may pose additional risk to the patient by participation in the study.

[0200] Clinical Trial Treatment: INO-4800 drug product contains 10 mg / mL of DNA plasmid pGX9501 in 1x SSC buffer (150 mM sodium chloride and 15 mM sodium citrate). A volume of 0.4 mL is filled into 2 mL glass vials fitted with rubber stoppers and sealed aluminum caps. INO-4800 is stored at 2-8 °C.

[0201] Study Group 1 will receive one 1.0 milligram (mg) intradermal (ID) injection of INO-4800, followed by electroporation (EP) using the CELLECTRA® 2000 device per dosing visit on Day 0 and Week 4. Study Group 2 will receive two 1.0 mg ID injections of INO-4800 (total of 2.0 mg per dosing visit) (in two different limbs at permitted locations) on Day 0 and Week 4, followed by EP using the CELLECTRA® 2000 device.

[0202] Peripheral blood immunogenicity evaluation Obtain whole blood and serum samples. Immunologic blood and serum samples are collected at screening and at visits specified in the event schedule (Table 2). Both screening and day 0 immunologic samples are required to allow for all immunologic testing. T and B cell immune responses to INO-4800 are measured using assays that may include, but are not limited to, ELISA, neutralization, immunologic gene expression assessment, immunologic protein expression assessment, flow cytometry, and ELISPOT. The ELISA binding assay is a standard plate-based ELISA using 96-well ELISA plates. The plates are coated with SARS-CoV-2 spike protein and blocked. After blocking, serum from vaccinated subjects is serially diluted and incubated on the plates. A secondary antibody capable of binding to human IgG is used to assess the levels of vaccine-specific antibodies in the serum. T cell responses are assessed by IFN-gamma ELISPOT assay. PBMCs isolated from study volunteers are incubated with peptide fragments of the SARS-CoV-2 spike protein. Cells and peptides are placed on MabTech plates coated with an antibody that captures IFN-gamma. After 24 hours of stimulation, cells are washed off and a secondary antibody that binds IFN-gamma is added. Each vaccine-specific cell produces a spot that can be counted to determine the level of induced cellular response. In addition, humoral responses to SARS-CoV-2 nucleocapsid protein (NP) can also be assessed to rule out potential infection with wild-type SARS-CoV-2 following INO-4800 treatment during testing. The decision to analyze samples collected for immunological endpoints will be continually adjudicated throughout the study.

[0203] Primary outcome measures: 1. Proportion of participants with adverse events (AEs) [Time frame: Baseline to Week 28] 2. Percentage of patients with administration (injection) site reactions [Time frame: Day 0 to Week 28] 3. Incidence of Adverse Events of Special Interest (AESI) [Time Frame: Baseline to Week 28] 4. Change from baseline in antigen-specific binding antibody titers [Time frame: baseline to week 28]. Subjects are considered to have a positive antibody response if the post-vaccination optical density is 2.0 SD above the optical density on day 0 and above the ELISA specific cutoff. 5. Antigen-specific interferon-gamma

number

[0204] The safety of INO-4800 will be measured and graded according to the “Toxicity Grading Scale for Healthy Adult and Adolescent Volunteers Enrolled in Preventive Vaccine Clinical Trials” published in September 2007 (Appendix A). Adverse Events of Special Interest (AESI) (serious or nonserious) are one of scientific and medical concern specific to a product or program. AESIs include those listed in Table 4. [Table 4]

[0205] Dose-limiting toxicity (DLT) For the purposes of this clinical trial, the following are dose-limiting toxicities: Grade 3 or greater local injection site erythema, swelling, and / or induration observed for ≥1 day after administration of INO-4800 (See Table 5). · Pain or tenderness at the injection site requiring hospitalization despite appropriate use of non-narcotic analgesics. Grade 4 or greater non-injection site adverse events as assessed by the PI related to INO-4800 administration. Grade 4 or greater clinically significant laboratory abnormalities as assessed by the PI related to INO-4800 treatment. [Table 5]

[0206] Analysis population The analysis populations were as follows: The modified intent-to-treat (mITT) population includes all subjects who received at least one dose of INO-4800. Subjects in this sample will be analyzed by their assigned dose arm of INO-4800. The mITT population will be used to analyze multiple primary and exploratory immunological endpoints. The per-protocol (PP) population consists of mITT subjects who received all scheduled doses and had no significant protocol violations as assessed by the medical monitor. Analyses on the PP population are considered to support the corresponding mITT analyses.

[0207] The safety analysis population includes all subjects who received at least one dose of INO4800 administered by ID injection. Subjects for this population will be classified according to the dose of INO-4800 administered. This population will be used for all safety analyses of this study.

[0208] Key safety analysis The primary analyses for this study will be safety analyses of treatment-emergent adverse events (TEAEs), administration site reactions, and clinically significant changes from baseline in safety laboratory parameters.

[0209] TEAEs are defined for this study as any adverse event, adverse event of special interest, or serious adverse event occurring on or after day 0 after IP administration. All TEAEs are summarized by frequency, percentage, and associated 95% Clopper-Pearson confidence interval. Frequencies are also presented separately by number of doses and indicated by system order class and preferred term. Further frequencies are presented in terms of maximum severity and relationship to IP. Multiple occurrences of the same AE in a single subject are counted only once following a worst-case approach in terms of severity and relationship to IP. All serious TEAEs are summarized as above. AE duration is calculated as AE stop date - AE start date + 1 day. AEs and SAEs that are not TEAEs or serious TEAEs are presented in a list.

[0210] All of these primary safety analyses will be performed on subjects in the safety population.

[0211] Main immunogenicity analysis SARS-CoV-2 spike glycoprotein antigen-specific binding antibody titers, and specific cellular immune responses will be analyzed by study arm within age strata. Binding antibody titers will be analyzed for each study arm using geometric means and associated 95% confidence intervals. Increases in antigen-specific cellular immune responses will be analyzed for each study arm using medians, interquartile ranges, and 95% confidence intervals. Changes from baseline for both binding antibody titers and increases in antigen-specific cellular responses will be analyzed using geometric mean fold increases and 95% confidence intervals. Binding antibody titers will be analyzed between each study arm pair within age strata using geometric mean ratios and associated 95% confidence intervals. Antigen-specific cellular immune responses will be analyzed between each study arm pair within age strata using median differences and associated 95% confidence intervals. All of these primary immunogenicity analyses will be performed on subjects in the mITT and PP populations.

[0212] Exploratory analysis Post-baseline T and B cell counts will be analyzed descriptively by study arm with mean / median and associated 95% confidence intervals. Percent neutralizing antibodies will be analyzed for each study arm using median, interquartile range, and 95% confidence interval.

[0213] The safety and immunogenicity of the optional booster dose of INO-4800 after the prior two-dose regimen will be analyzed as described below. Bioneutralizing and pseudoneutralizing cross-antibody titers will be analyzed for each study group within age strata using geometric means and associated 95% confidence intervals. Fold increases from baseline will be tabulated for each immunogenicity biomarker. If sufficient data exists for analysis, exploratory group immunogenicity comparisons will be performed between subjects who choose to receive only two doses and those who choose to receive two doses plus a booster dose.

[0214] Further exploration of the effect of age and other potential confounding factors on the relationship between immune biomarkers and INO-4800 dose may involve the use of ANCOVA and / or logistic regression models.

[0215] Preliminary Basic Test Results All eight adverse events reported were grade 1, and five were due to local injection site reactions. No serious adverse events, adverse events of special interest, or dose-limiting toxicities were reported.

[0216] Preliminary binding ELISA analysis showed that 7 / 9 (78%) subjects had a positive antibody response. Responders had a 4-fold increase in titers.

[0217] At week 6, multiple immunological assays, including those for humoral and cellular immune responses, were performed for both the 1.0 mg and 2.0 mg dose cohorts after two doses. Analysis at that time showed that 94% (34 of 36 total study participants) demonstrated an overall immune response rate based on preliminary data assessing humoral (binding and neutralizing) and T-cell immune responses. One participant in the 1 mg dose cohort and two participants in the 2 mg dose cohort tested positive for COVID-19 immune responses at the time of study enrollment, indicating prior infection, and were therefore excluded from the immune analysis. One participant in the 2 mg dose cohort discontinued the study for reasons unrelated to safety or tolerability.

[0218] Through week 8, INO-4800 was overall safe and well tolerated in all participants in both cohorts. All 10 reported adverse events (AEs) were grade 1 in severity, most of which were injection site redness. No serious adverse events (SAEs) were reported.

[0219] Early Phase I Results Demographics of the study population A total of 55 participants were screened and 40 participants were enrolled in the first two groups (Figure 16). The median age was 34.5 years (range 18-50 years). Fifty-five percent of participants were male (Table 6). Most participants were white (82.5%). [Table 6]

[0220] Vaccines were administered by intradermal injection of 0.1 ml followed by EP at the vaccination site. EP was performed using a CELLECTRA® 2000 with four 52 ms pulses at 0.2 A (40-200 V depending on tissue resistance) per season. The first two pulses were 0.2 s apart, followed by a 3 s pulse interval, then the last two pulses were also 0.2 s apart. Dose groups were enrolled sequentially with a safety run-in for each. Participants were and will be evaluated clinically and for safety on Day 1, and at Weeks 1, 4 (Dose 2), 6, 8, 12, 28, 40, and 52. Safety laboratory tests (complete blood count, comprehensive metabolic panel, and urinalysis) were and will be performed at all follow-up visits except Day 0, Day 1, and Week 4. Immunologic specimens were obtained at all time points after Dose 1 except Day 1 and Week 1. Investigators recorded and graded local and systemic AEs, regardless of relationship to the vaccine. AEs were graded according to the Toxicity Grading Scale for Healthy Adult and Adolescent Volunteers Enrolled in Preventive Vaccine Clinical Trials guidelines published by the Food and Drug Administration in September 2007.

[0221] Vaccine safety and tolerability Thirty-nine (97.5%) completed both doses, with one subject in the 2.0 mg group discontinuing study participation before receiving the second dose due to a lack of transportation to the clinical site, unrelated to study or dosing. All remaining 39 subjects completed the visit 8 weeks after dose 1. A total of 11 local and systemic AEs were reported through week 8 after dose 1, of which 6 were considered related to the vaccine. The severity of all AEs was mild or grade 1. The most frequent AEs were injection site reactions, including injection site pain (3) and erythema (2). The one systemic AE related to the vaccine was nausea. There were no febrile reactions. No subjects discontinued the study due to AEs. No serious adverse events (SAEs) or AESIs were reported. There were no abnormal laboratory values ​​of clinical concern throughout the initial 8-week follow-up period. There was no increase in the number of participants who experienced vaccine-related AEs in the 2.0 mg group (10% of subjects) compared to the 1.0 mg group (15% of subjects). In addition, the frequency of AEs was not increased with the second dose compared to the first dose in both dose level groups. Thus, the Phase 1 safety data for INO-4800 suggests that the vaccine is likely to be a safe booster, as there was no increase in the frequency of side effects after the second vaccine dose compared to the first dose.

[0222] Immunogenicity: Thirty-eight subjects were included in the immunogenicity analysis. One subject in the 1.0 mg group was deemed seropositive at baseline and was excluded, in addition to one subject in the 2.0 mg group who discontinued before completing dosing.

[0223] Humoral immune response: Serum samples were used to measure neutralizing antibody titers against SARS-CoV-2 / Australia / VIC01 / 2020 isolates, as well as binding antibodies against the RBD and whole spike S1+S2 proteins.

[0224] S1+S2 Enzyme-Linked Immunosorbent Assay (ELISA): A standard binding ELISA was used to detect serum-bound anti-SARS-CoV-2 spike antibodies. ELISA plates were coated with recombinant S1+S2 SARS-CoV-2 spike protein (Sino Biological), incubated overnight, and blocked. Samples were serially diluted and incubated for 1 h on the blocked assay plate. The magnitude of the assay response was expressed as titer, defined as the highest serial dilution at which the optical density 3 SDs was above background on day 0. 68% of participants in the 1.0 mg group and 70% of participants in the 2.0 mg group had at least an increase in serum IgG binding titer to S1+S2 spike protein compared to the prevaccination time point (day 0), with responder GMTs of 320.0 (95% CI: 160.5, 638.1) and 508.0 (95% CI: 243.6, 1059.4) in the 1.0 mg and 2.0 mg groups, respectively (Figure 17C). In Figure 17D, humoral responses in the 1.0 mg and 2.0 mg dose groups were assessed for their ability to bind to the entire spike protein (S1 and S2) (n=19, 1.0 mg; n=19, 2.0 mg). Endpoint titers were calculated as the titer that showed an OD3.0 SD above baseline, with the baseline titer designated as 1. Responses to live virus neutralization were PRNT IC50 > 10. In all graphs, horizontal lines represent medians and bars represent interquartile ranges.

[0225] Sera were also tested for their ability to neutralize live virus in a SARS-CoV-2 wild-type virus neutralization assay. SARS-CoV-2 / Australia / VIC01 / 2020 isolate neutralization assays were performed at Public Health England (Porton Down, UK). Neutralizing virus titers were measured in serum samples heat-inactivated at 56°C for 30 min. SARS-CoV-2 (Australia / VIC01 / 2020 isolate 44) was diluted to a concentration of 933 pfu ml-1 and mixed 50:50 in 1% FCS / MEM containing 25 mM HEPES buffer with doubling serum dilutions. After 5 days of incubation at 37°C in a humidified box, plates were fixed, stained, and plaques were counted. Virus titers were determined using a standard tissue culture infectious dose 50% (TCID50) assay. After the second vaccination at week 6, responder geometric mean titers (GMTs) by live virus PRNT IC50 neutralization assay were 82.4 and 63.5 in the 1.0 mg and 2.0 mg groups, respectively. The proportion of responders (post-vaccination PRNT IC50 > 10) was 83% and 84% in the 1.0 mg and 2.0 mg groups, respectively (Figure 17A and Table 7). [Table 7]

[0226] RBD Enzyme-Linked Immunosorbent Assay (ELISA): MaxiSorp 96-well plates (ThermoFisher, 439454) were coated with 50ul / well of 1ug / ml SARS-CoV-2 RBD (SinoBiological, 40592-V08H), protein diluted in PBS and incubated overnight at 4°C. Plates were washed 4 times with PBST (PBS containing 0.05% Tween®-20) and blocked with 200ul / well of blocking buffer (PBS containing 5% nonfat dry milk and 0.1% Tween®-20) for 2 hours at room temperature. After washing with PBST, 50ul / well of serum samples serially diluted in blocking buffer were added to the plates in duplicate and incubated for 2 hours at room temperature. After washing with PBST, 50ul / well of anti-human-IgG-HRP detection antibody (BD Pharmingen, 555788) diluted 1:500 in blocking buffer was added and incubated for 1 hour at room temperature. After washing with PBST, 50ul / well of 1-Step Ultra TMB (Thermo, 34028) was added and incubated for 5 minutes at room temperature. The color change reaction was stopped by adding 50ul / well of 2M sulfuric acid and the optical absorbance was measured at 450 and 570nm on a Synergy 2 microplate reader (Biotek). The endpoint titer was defined as the highest serial dilution at which the OD450-570 value was above 3 standard deviations of the matched day 0 signal. At week 6, responder GMTs were 385.6 (95% CI: 69.0, 2154.9) and 222.1 (95% CI: 87.0, 566.8) in the 1.0 mg and 2.0 mg groups, respectively (Figure 17B).

[0227] Overall seroconversion (defined as participants responding with neutralizing or binding antibodies to the S protein or RBD) after two vaccine doses in the 1.0 mg and 2.0 mg dose groups was 89% and 95%, respectively.

[0228] Cellular responses: Peripheral blood mononuclear cells (PBMCs) were isolated from blood samples, frozen and stored in liquid nitrogen for later analysis.

[0229] INO-4800 SARS-CoV-2 spike ELISPOT. Peripheral mononuclear cells (PBMCs) were isolated pre- and post-vaccination. Cells were stimulated in vitro with a pool of 15mer peptides (overlapping 9 residues) spanning the full-length consensus spike protein sequence. Cells were incubated overnight (18-22 h, 37 °C, 5% CO2) with the peptide pool (225 μg / ml), DMSO alone (0.5%, negative control), or PMA and ionomycin (positive control). The next day, cells were washed and plates were developed: the detection antibody is biotinylated, followed by a streptavidin-enzyme conjugate. The use of a precipitating substrate rather than a soluble product results in visible spots. Each spot corresponds to an individual cytokine-secreting cell. After developing the plates, spots were scanned and quantified using a CTL S6 Micro Analyzer (CTL) with ImmunoCapture™ and ImmunoSpot™ software. Values ​​are presented as background-subtracted means of triplicate measurements.

[0230] The responder rates at week 8 were 74% in the 1.0 mg dose group and 100% in the 2.0 mg dose group (Table 8). 6The median SFU per PBMC was 46 and 71 for responders in the 1.0 mg and 2.0 mg dose groups, respectively. There was a statistically significant increase in the number of interferon-γ secreting cells (SFU) obtained per million PBMCs over baseline in each group (P=0.001 and P<0.0001, respectively, Wilcoxon rank sum test, post-hoc analysis), FIG. 18A. Interestingly, five non-responders in the 1.0 mg group by T cell ELISPot assay showed strong reactivity by live virus neutralization assay. It is also interesting that the three convalescent samples tested by ELISpot assay showed lower T cell responses than the 2.0 mg dose group at week 8, with a median of 33. INO-4800 produced stronger T cell responses that were more frequent and had a higher responder median response (45.6 vs. 71.1) in the 2.0 mg dose group. As shown in Figure 18B, T cell responses in the 2.0 mg group were mapped to five epitope pools. Interestingly, T cell responses in all regions of the spike protein were observed. [Table 8]

[0231] INO-4800 SARS-CoV-2 spiked flow cytometry assay: The contribution of CD4+ and CD8+ T cells to the cellular immune response to INO-4800 was assessed by intracellular cytokine staining (ICS). PBMCs were also used for intracellular cytokine staining (ICS) analysis using flow cytometry. One million PBMCs in 200uL of complete RPMI medium were stimulated with DMSO (negative control), PMA and ionomycin (positive control, 100ng / mL and 2μg / mL, respectively), or the indicated peptide pools (225ug / mL) for 6 hours (37°C, 5% CO2). After 1 hour of stimulation, Brefeldin A and Monensin (BD GolgiStop and GolgiPlug, 0.001% and 0.0015%, respectively) were added to block secretion of expressed cytokines. After stimulation, cells were transferred to 4°C overnight. Cells were then washed in PBS for live / dead staining (Life Technologies Live / Dead aqua fixable viability dye, previously described) and then resuspended in FACS buffer (0.5% BSA, 2 mM EDTA, 20 mM HEPES). Cells were then stained for extracellular markers, fixed and permeabilized, then stained for the indicated cytokines (Table 9) for the antibodies used for flow cytometry. [Table 9]

[0232]

number

[0233] Following vaccination, CD4+ and CD8+ T cells were probed. Nearly half (47%) of the CD8+ T cells in the 2.0 mg dose group were double-positive.

number

number

number

[0234] Any cytokine (any response after vaccination,

number

[0235] Th2 responses were also measured by assessing IL-4 production, and no statistically significant increase (Wilcoxon rank sum test, post-hoc analysis) was observed in any group following vaccination (Figure 18F).

[0236] In this Phase 1 study, vaccination with INO-4800 increased the Th1 cytokine

number

number

[0237] Phase 1 Update This was designed as a Phase 1, open-label, multicenter study (NCT04336410) to evaluate the safety, tolerability, and immunogenicity of INO-4800 administered intradermally (ID) followed by electroporation using the CELLECTRA 2000 device. Healthy participants aged 18-50 years with no known history of COVID-19 disease received either a 1.0 mg or 2.0 mg dose of INO-4800 in a two-dose regimen (weeks 0 and 4).

[0238] DNA vaccine INO-4800. This vaccine was manufactured according to current good manufacturing practices. INO-4800 contains the plasmid pGX9501 expressing a synthetic optimized sequence of the SARS-CoV-2 full-length spike glycoprotein optimized as previously described at a concentration of 10 mg / ml in saline sodium citrate buffer.

[0239] Endpoints. Safety endpoints included systemic and local administration site reactions up to 8 weeks after dose 1. Immunologic endpoints included antigen-specific binding antibody titers, neutralization titers, and antigen-specific interferon-gamma (IFN-g) cellular immune responses after two doses of vaccine. For live virus neutralization, responders are defined as PRNT IC50>10 at week 6, or >4 if the subject is a responder by ELISA. For S1+S2 ELISA, responders are defined as a value >1 at week 6. For ELISpot assay, responders are defined as >10 at week 0. 6 The primary endpoint is defined as a value at week 6 or 8 of greater than 12 spot-forming units per PBMC.

[0240] Study Procedures. Forty participants were enrolled in two groups, 20 participants each in the 1.0 mg and 2.0 mg dose groups who received doses at weeks 0 and 4. The vaccine was administered via intradermal injection of 0.1 ml into the arm followed by EP at the vaccination site. Subjects in the 1.0 mg dose group received one injection at each dosing visit. The second dose of the vaccine can be injected into the same or different arm relative to the first dose. Subjects in the 2.0 mg dose group received one injection in each arm at each dosing visit. EP was performed using a CELLECTRA® 2000 as previously described. The device delivers a total of four electrical pulses, each of 52 ms duration with an intensity of 0.2 A current and 40-200 V voltage per pulse. Dose groups were enrolled sequentially with a safety run-in for each. The 1.0 mg dose group enrolled one participant per day for three days. An independent Data Safety Monitoring Board (DSMB) reviewed the week 1 safety data and recommended full enrollment of an additional 17 participants into that dose group based on favorable safety assessments. The 2.0 mg dose group was subsequently enrolled in a similar manner. Participants were assessed for safety and concomitant medications at all time points, including screening, week 0 (dose 1), post-dose phone call, post-dose 1, week 1, week 4 (dose 2), week 6, week 8, week 12, week 28, week 40, and week 52. Investigators recorded and graded local and systemic AEs, regardless of relationship to the vaccine. Safety laboratory tests (complete blood count, comprehensive metabolic panel, and urinalysis) were and will continue to be performed at screening, post-dose 1, week 1, week 6, week 8, week 12, week 28, and week 52. Immunologic specimens were obtained at all time points after dose 1, except day 1 and week 1. AEs were graded according to the Toxicity Grading Scale for Healthy Adult and Adolescent Volunteers Enrolled in Preventive Vaccine Clinical Trials guidelines published by the Food and Drug Administration in September 2007. The DSMB reviewed laboratory and AE data for participants through week 8 that are included in this report.There were protocol-specified safety stopping rules and adverse events of special interest (AESIs). For the purposes of this report, clinical and laboratory safety assessments from the first dose through 8 weeks are presented.

[0241] Protocol eligibility. Eligible participants must meet the following criteria: healthy adults aged 18–50 years, able and willing to comply with all study procedures, and with a body mass index of 18–30 kg / m at screening. 2 Negative serology for hepatitis B surface antigen, hepatitis C antibody, and human immunodeficiency virus antibody, screening electrocardiogram (ECG) judged by the investigator to have no clinically significant findings, use of medically effective contraception with a failure rate of less than 1% per year when used consistently, postmenopausal or surgically sterile or infertile partners.Major exclusion criteria included: individuals with current occupations that place them at high risk of exposure to SARS-CoV-2, previous known exposure to SARS-CoV-2 or receipt of an investigational drug for the prevention or treatment of COVID-19, autoimmune or immunosuppression as a result of underlying disease or treatment, hypersensitivity or severe allergic reaction to a vaccine or drug, medical conditions that increase the risk of severe COVID-19, reported smoking, inhalation, or active drug, alcohol or substance abuse or dependence, and fewer than two sites available for intradermal injection and electroporation.

[0242] Clinical Trial Population: Healthy adult volunteers, aged 18-50 years, inclusive.

[0243] Inclusion Criteria: a.Adults aged 18-50, inclusive. b. Determined by the investigator to be in good health based on medical history, physical exam, and vital signs performed at screening. c. Able and willing to comply with all study procedures. d. Screening test results within the normal range or that the Investigator determines to be clinically insignificant. eNegative serology for hepatitis B surface antigen (HBsAg), hepatitis C antibody, and human immunodeficiency virus (HIV) antibody screening. f. A screening electrocardiogram (ECG) judged by the investigator to have no clinically significant findings (e.g., Wolff-Parkinson-White Syndrome). g. Use of a medically effective method of contraception with a failure rate of less than 1% per year when used consistently and correctly from screening through 3 months after the last dose; being postmenopausal, surgically sterile, or having a sterile partner.

[0244] Exclusion criteria: a. Currently pregnant or breastfeeding, or intending to become pregnant or father a child within the planned duration of the study starting from the Screening Visit up to 3 months after the last dose. b. Currently participating or having participated in a study using an investigational drug within 30 days prior to Day 0. c. Previous exposure to SARS-CoV-2 (laboratory testing at the investigator's discretion) or receipt of an investigational vaccine product for the prevention of COVID-19, MERS or SARS. d. Current or history of any of the following medical conditions: Respiratory diseases (e.g. asthma, chronic obstructive pulmonary disease). Hypertension, sitting systolic blood pressure >150mm Hg or diastolic blood pressure >95mm Hg. Malignancy within 5 years of screening. Cardiovascular disease (e.g., myocardial infarction, congestive heart failure, cardiomyopathy, or clinically significant arrhythmias). e. Immunosuppression as a result of an underlying disease or treatment, including: Primary immunodeficiency. · Prolonged use of oral or parenteral glucocorticoids (more than 7 days). · Current or anticipated use of disease-modifying doses of antirheumatic drugs and biologic disease-modifying drugs. History of solid organ or bone marrow transplant. History of other clinically significant immunosuppressive or clinically diagnosed autoimmune diseases. f. Fewer than two acceptable sites available for ID injections and EP, considering the anterolateral deltoid and quadriceps. g. Any physical examination finding and / or any medical history that, in the opinion of the Investigator, may confound the results of the study or may pose additional risk to the patient by participation in the study.

[0245] Immunogenicity assessment methods. Samples taken at screening, week 0 (pre-dose), and weeks 6 and 8 were analyzed. Peripheral blood mononuclear cells (PBMCs) were isolated from blood samples by standard overlay on Ficoll hypaque followed by centrifugation. Isolated cells were frozen in 10% DMSO and 90% fetal bovine serum. Frozen PBMCs were stored in liquid nitrogen for subsequent analysis. Serum samples were stored at -80°C until used to measure binding and neutralizing antibody titers.

[0246] SARS-CoV-2 wild-type virus neutralization assay. SARS-CoV-2 / Australia / VIC01 / 2020 isolate neutralization assays were performed at Public Health England (Porton Down, UK). Neutralizing virus titers were measured in serum samples heat-inactivated at 56°C for 30 min. SARS-CoV-2 (Australia / VIC01 / 2020 isolate 44) was diluted to a concentration of 933 pfu / ml and mixed 50:50 in 1% FCS / MEM containing 25 mM HEPES buffer and doubling serum dilutions. After 1 h of incubation at 37°C, the virus-antibody mixture was transferred to a confluent monolayer of Vero E6 cells (ECACC 85020206; PHE, UK). Virus was allowed to adsorb to the cells for a further 1 h at 37°C in an incubator and the cell monolayer was overlaid with MEM / 4% FBS / 1.5% CMC. After 5 days of incubation at 37°C, plates were fixed and stained with a 0.2% crystal violet solution (Sigma) in 25% methanol (v / v). Plaques were counted.

[0247] S1+S2 enzyme-linked immunosorbent assay (ELISA). ELISA plates were coated with 2.0 mg / mL of recombinant SARS-CoV-2 S1+S2 spike protein (Acro Biosystems; SPN-C52H8) and incubated overnight at 2-8 °C. S1+S2 contains amino acid residues Val 16-Pro 1213 of the full-length spike protein, GenBank number QHD43416.1. It contains two mutations to stabilize the protein in a trimeric prefusion state (R683A, R685A) and also contains a C-terminal 10xHis tag (SEQ ID NO: 24). Plates were then washed with PBS with 0.05% Tween®-20 (Sigma; P3563) and blocked for 1-3 h at room temperature (Starting Block, Thermo Scientific; 37,538). Samples were serially diluted using blocking buffer and added in duplicate to the washed and blocked assay plates along with prepared controls. Samples were incubated on the blocked assay plate for 1 hour at room temperature. After incubation of samples and controls, the plate was washed and then a 1 / 1000 preparation of anti-human IgG HRP conjugate (BD Pharmingen; 555,788) in blocking buffer was added to each well and incubated for 1 hour at room temperature. The plate was washed and then TMB substrate (KPL; 5120-0077) was added and incubated for approximately 10 minutes at room temperature. TMB stop solution (KPL; 5150-0021) was then added and the plate was read at 450 nm and 650 nm on a Synergy HTX microplate reader (BioTek). The magnitude of the assay response was expressed as a titer, defined as the maximum reciprocal dilution factor of the highest dilution serial dilution at which the plate-corrected optical density was above 3 SD of the corresponding week 0 background of the subject.

[0248] SARS-CoV-2 spike ELISpot assay. Pre- and post-vaccination peripheral mononuclear cells (PBMCs) were stimulated in vitro with 15-mer peptides (overlapping 9 residues) spanning the full-length consensus spike protein sequence. Cells were incubated overnight in an incubator with the peptide pool at a concentration of 5 mg per ml in pre-coated ELISpot plates (Mab-Tech, Human IFN-g ELISpot Plus). The next day, cells were washed off and plates were developed with a biotinylated anti-IFN-g detection antibody followed by a streptavidin-enzyme conjugate, resulting in visible spots. Each spot corresponds to an individual cytokine-secreting cell. After developing the plates, spots were scanned and quantified using a CTL S6 Micro Analyzer (CTL) with Immuno-Capture and ImmunoSpot software. Values ​​are presented as background-subtracted means of triplicates measured. Qualification of the ELISpot assay determined that 12 spot-forming units was the lower limit of detection. Thus, anything above this cutoff is considered to be a signal of an antigen-specific cellular response.

[0249] INO-4800 SARS-CoV-2 spiked flow cytometry assay. PBMCs were also used for intracellular cytokine staining (ICS) analysis using flow cytometry. One million PBMCs in 200 mL complete RPMI medium were stimulated with DMSO (negative control), PMA and ionomycin (positive control, 100 ng / mL and 2 mg / mL, respectively), or the indicated peptide pools (225 μg / mL) for 6 h (37° C., 5% CO2). After 1 h of stimulation, brefeldin A and monensin (BD GolgiStop and GolgiPlug, 0.001% and 0.0015%, respectively) were added to block secretion of expressed cytokines. After stimulation, cells were transferred to 4° C. overnight. Cells were then washed in PBS for live / dead staining (Life Technologies Live / Dead Aqueous Fixable Viability Dye) and then resuspended in FACS buffer (0.5% BSA, 2 mM EDTA, 20 mM HEPES). Next, extracellular markers were stained, cells were fixed, permeabilized (eBioscience™ Foxp3Kit), and then stained for the indicated cytokines (Table 9) using fluorescently conjugated antibodies. Figures 22A and B show representative gating strategies for CD4+ and CD8+ T cells, as well as

number

[0250] Statistical analysis. No formal power analysis was applied to this study. Safety endpoints: Descriptive statistics were used to summarize the proportion with AEs, administration site reactions, and AESIs through week 8. Immunogenicity endpoints: Descriptive statistics were also used to summarize the median response (with 95% confidence intervals) and proportion of responders for cellular outcomes, and the geometric mean titers (with 95% confidence intervals) and proportion of responders for humoral outcomes. Post-hoc analyses were performed subtracting paired differences from post-vaccination to pre-vaccination in SARS-CoV-2 neutralization responses (on natural log scale, using paired t-tests), ELISpot responses (using Wilcoxon signed-rank tests), and intracellular flow assay responses (using Wilcoxon signed-rank tests).

[0251] result Demographics of the study population. A total of 55 participants were screened and 40 participants were enrolled in the first two groups (Figure 16). The median age was 34.5 years (range 18-50 years). 55% (22 / 40) of participants were male (Table 6). Most participants were white (82.5%, 33 / 40).

[0252] Vaccine safety and tolerability. A total of 39 of 40 participants (97.5%) completed both doses, with one participant in the 2.0 mg group discontinuing study participation before receiving the second dose due to lack of transportation to the clinical site, with discontinuation unrelated to study or dosing (Figure 16). All remaining 39 subjects completed the visit 8 weeks after dose 1. A total of 11 local and systemic adverse events (AEs) were reported by week 8 after dose 1, and six of these were considered related to the vaccine (Table 10). All AEs were grade 1 (mild) in severity. Five of the six related AEs were injection site reactions, including injection site pain (3) and erythema (2). One vaccine-related grade 1 systemic AE was nausea. All related AEs occurred on the dosing day when the subject received the first or second vaccine dose. There were no febrile reactions, and no antipyretics were used after vaccination. No subjects discontinued the study due to AEs. No serious adverse events (SAEs) or adverse events of special interest (AESIs) were reported. There were no abnormal laboratory values ​​judged by the investigators to be clinically significant throughout the initial 8-week follow-up period. There was no increase in the number of participants who experienced vaccine-related AEs in the 2.0 mg group (10%, 2 / 20) compared to the 1.0 mg group (15%, 3 / 20) (Figure 19). In addition, in both dose groups, the frequency of AEs with the second dose was not increased over the first dose. [Table 10]

[0253] Immunogenicity. Thirty-eight subjects were included in the immunogenicity analysis. One subject in the 1.0 mg group was deemed seropositive at baseline and was excluded, in addition to one subject in the 2.0 mg group who discontinued before completing dosing. Data for this subject can be found in Table 11. [Table 11]

[0254] Humoral immune response. Sera were tested for their ability to bind to the S1+S2 spike protein. 89% (17 / 19) of participants in the 1.0 mg group and 95% (18 / 19) of participants in the 2.0 mg group had increased serum IgG binding titers to the S1+S2 spike protein compared to pre-vaccination (week 0), with responder GMTs of 655.5 (95% CI: 255.6, 1681.0) and 994.2 (95% CI: 395.3, 2500.3) in the 1.0 mg and 2.0 mg groups, respectively (Figure 17B, Figure 20, and Table 13). Sera were also tested for their ability to neutralize live virus by a live virus PRNTIC50 neutralization assay. The geometric mean fold increase at week 6 over baseline was 10.8 with a 95% CI of (4.4, 27.0) and 11.5 with a 95% CI of (5.3, 24.9) in the 1.0 mg and 2.0 mg groups, respectively. There was a statistically significant increase at week 6 over baseline in each group (P<0.0001 paired t-test, post-hoc analysis), FIG. 17A. At week 6, the proportion of responders was 78% (14 / 18) and 84% (16 / 19) in the 1.0 mg and 2.0 mg groups, respectively (FIG. 17A and Table 13), and the geometric mean titers (GMTs) of responders were 102.3 (95% CI: 37.4, 280.3) and 63.5 (95% CI: 39.6, 101.8) in the 1.0 mg and 2.0 mg groups, respectively. Overall seroconversion (defined as participants responding with neutralizing and / or binding antibodies to the S protein) at week 6 in the 1.0 mg and 2.0 mg dose groups was 95% (18 / 19) for each group (Table 13).

[0255] Enzyme-linked immunospot (ELISpot). The percentage of responders at week 8 was 74% (14 / 19) in the 1.0 mg dose group and 100% (19 / 19) in the 2.0 mg dose group. These data taken together with the seroconversion data result in an overall immune response of 100% (19 / 19) in each group (Table 13, Figures 18A and 21). 6The median SFU per PBMC was 46 (95% CI: 21.1, 142.2) and 71 (95% CI: 32.2-194.4) for responders in the 1.0 mg and 2.0 mg dose groups, respectively. The median change from baseline at week 8 was 22.3 (95% CI: 2.2, 63.4) and 62.8 (95% CI: 22.2, 191.1) in the respective groups, with a statistically significant increase over baseline in each group (P=0.001 and P<0.0001, respectively, Wilcoxon rank sum test, post-hoc analysis), FIG. 18A. It is also noteworthy that the three convalescent samples tested by ELISpot assay (all three symptomatic but not hospitalized) showed lower T cell responses than the 2.0 mg dose group at week 8, with a median of 33 (FIG. 20). As shown in Figures 18B and 18G, T cell responses in the 2.0 mg group were mapped into five epitope pools. Encouragingly, T cell responses were seen in all regions of the spike protein, with the dominant pool encompassing the receptor binding domain region, followed by pools including the N-terminal domain, as well as the fusion peptide, heptad repeat 1 and the central helix.

[0256] Intracellular flow assay. The contribution of CD4+ and CD8+ T cells to the cellular immune response to INO-4800 was assessed by intracellular cytokine staining (ICS).

number

number

number

number

number

number

[0257] INO-4800 was well tolerated with a frequency of formulation-related grade 1 AEs in 15% (3 / 20 subjects) and 10% (2 / 20 subjects) of participants in the 1.0 mg and 2.0 mg dose groups, respectively. Only grade 1 AEs were observed in the study, which compared favorably to existing licensed vaccines. The safety profile of a successful COVID-19 vaccine is important and supports the broader development of INO-4800 in at-risk populations, including older adults and those with comorbidities, who are at greater risk for complications from SARS-CoV-2 infection. INO-4800 also produced balanced humoral and cellular immune responses, with all 38 evaluable participants demonstrating either antibody or T-cell responses or both after two doses of INO-4800. Humoral responses, measured by binding or neutralizing antibodies, were observed in 95% (18 / 19) of participants in each dose group. Neutralizing antibodies, as measured by live virus neutralization assay, were seen in 78% (14 / 18) and 84% (16 / 19) of participants for the 1.0 mg and 2.0 mg dose groups, respectively, with corresponding GMTs of 102.3 [95% CI (37.4, 280.3)] and 63.5 [95% CI (39.6, 101.8)]. The ranges overlap with PRNT IC50 titers reported from convalescent patients, as well as those in NHPs protected by SARS-CoV-2 challenge. Furthermore, titers were statistically significantly increased. It is important to note that all but one vaccine recipient who did not develop neutralizing antibody titers showed positive responses in T cell ELISpot assays, suggesting that the immune responses generated by the vaccine are differentially registered in these assays. Cellular immune responses were observed in 74% (14 / 19) and 100% (19 / 19) of the 1.0 mg and 2.0 mg dose groups, respectively. Importantly, INO-4800 was associated with a higher median response rate (46 [95% CI (21.1, 142.2)] vs. 71 [95% CI (32.2, 194.4)] SFU10 in the 1.0 mg and 2.0 mg dose groups, respectively. 6PBMC). These T cell responses in the 2.0 mg dose group were greater in magnitude than the convalescent samples tested (Figure 18A). Furthermore, there was a statistically significant increase in SFU. Flow cytometry assays showed increased cytokine production from both the CD4+ and CD8+ T cell compartments in both the 1.0 mg and 2.0 mg dose groups, but especially in the 2.0 mg group. The 2.0 mg group:

number

number

[0258] In this Phase 1 study, vaccination with INO-4800 increased the Th1 cytokine

number

number

[0259] Expanded Phase I Study Approximately 120 healthy volunteers will be evaluated across three dose levels (study arms). A total of 40 subjects will be enrolled in each study arm. Enrollment in each study arm will be stratified by age: n=20 for 18-50 years, n=10 for 51-64 years, and n=10 for 65 years and older (Table 14).

[0260] Subjects were adults at least 18 years of age, judged to be healthy by the investigator based on medical history, physical examination, and vital signs performed at screening, able and willing to comply with all study procedures, had clinical laboratory results at screening within the normal range for testing clinical laboratory tests or deemed clinically insignificant by the investigator, and had a body mass index of 18-30 kg / m2 at screening. 2Inclusion criteria were inclusive and included negative serological tests for hepatitis B surface antigen (HBsAg), hepatitis C antibody and human immunodeficiency virus (HIV) antibody at screening, an ECG deemed by the investigator to have no clinically significant findings (e.g. Wolff-Parkinson-White syndrome) at screening, and one of the following criteria regarding fertility: postmenopausal women as defined by spontaneous amenorrhea for ≥12 months, surgically sterile or with a partner infertile, use of medically effective contraception. Exclusion criteria were as follows:Pregnant or breastfeeding, or intending to become pregnant or father a child within the planned duration of the study beginning with the screening visit up to 3 months after the last dose; a positive serum pregnancy test during screening or a positive urine pregnancy test prior to dosing; currently participating or having participated in a study with an investigational product within 30 days prior to Day 0; previous exposure to Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2) or receipt of an investigational product for the prevention or treatment of COVID-19, Middle East Respiratory Syndrome (MERS), or Severe Acute Respiratory Syndrome (SARS); current occupation that places you at high risk of exposure to SARS-CoV-2 (e.g., healthcare workers or emergency responders who have direct interactions with or provide direct care to patients); current or history of respiratory disease, hypersensitivity or severe allergic reaction to a vaccine or drug. history, diagnosis of diabetes, hypertension, malignancy, or cardiovascular disease within 5 years of screening; immunosuppression as a result of underlying disease or treatment including primary immunodeficiency, long-term use (≥ 7 days) of oral or parenteral glucocorticoids, current or anticipated use of disease-modifying doses of antirheumatic drugs and biologic disease-modifying drugs, history of solid organ or bone marrow transplant, and previous history of other clinically significant immunosuppressive or clinically diagnosed autoimmune disease; fewer than two acceptable sites available for ID injection and EP, considering the anterolateral deltoid and quadriceps; or reported smoking, inhalation, or active drug, alcohol or substance abuse or dependence; or any physical examination finding and / or any medical history that, in the opinion of the investigator, may confound the results of the study or may pose additional risk to the patient by participation in the study.

[0261] All subjects will receive dosing on day 0 and week 4 (Table 15). Subjects who agree to receive a booster dose (Table 16) will receive the booster dose at week 12 or later of the dosing schedule at the same dose they previously received for the two-dose regimen (day 0 and week 4). Safety and immunogenicity will be evaluated two weeks after the booster dose. [Table 14]

[0262] Subjects who do not receive the optional booster dose will be followed until the 52 week end of study (EOS) visit, which will represent the EOS visit (Table 15). For subjects who receive an optional booster dose, the 48 week post-booster dose visit will represent the EOS visit (Table 16).

[0263] Main purpose: To evaluate the tolerability and safety of INO-4800 administered by ID injection followed by EP in healthy adult volunteers -Evaluate cellular and humoral immune responses to INO-4800 administered by ID injection followed by EP

[0264] Primary Safety Endpoint: Incidence of adverse events by system organ class (SOC), preferred term (PT), severity, and relationship to study drug. Proportion of participants with adverse events (AEs) [Time frame: from baseline to week 52 (if not receiving optional booster dose) or week 48 post-booster dose visit (if receiving optional booster dose)]. · Administration (i.e., injection) site reactions (described by frequency and severity). Percentage of participants with administration (injection) site reactions [time frame: day 0 to week 52 (if not receiving optional booster dose) or week 48 visit after booster dose (if receiving optional booster dose)]. Incidence of Adverse Events of Special Interest. Proportion of participants with Adverse Events of Special Interest (AESI) [Time Frame: from baseline to Week 52 (if not receiving the optional booster dose) or Week 48 post-booster dose visit (if receiving the optional booster dose)].

[0265] Primary Immunogenicity Endpoints: SARS-CoV-2 spike glycoprotein antigen-specific antibodies by binding assay. Change from baseline in SARS-CoV-2 spike glycoprotein antigen-specific binding antibody titers [Time frame: from baseline to week 52 visit (if not receiving optional booster dose) or week 48 post-booster dose visit (if receiving optional booster dose)]. Antigen-specific cellular immune response by IFN-gamma ELISpot and / or flow cytometry assays. Change from baseline in antigen-specific cellular immune response [Time frame: from baseline to week 52 visit (if not receiving optional booster dose) or week 48 post-booster dose visit (if receiving optional booster dose)].

[0266] Exploratory purpose: Evaluate an expanded immunological profile by assessing both T and B cell immune responses Evaluation of the safety and immunogenicity of INO-4800 administered by ID injection followed by an optional booster dose by EP, followed by exploratory endpoints of a two-dose regimen: Expanded immunological profile that may include, but is not limited to, additional assessment of T and B cell counts, neutralization responses, and T and B cell molecular changes by measuring immunological proteins and mRNA levels of genes of interest at every week as determined by sample availability. Incidence of all adverse events following ID injection followed by an optional booster dose of INO-4800 administered by EP SARS-CoV-2 spike glycoprotein antigen-specific neutralizing and binding antibodies following ID injection followed by an optional booster dose of INO-4800 administered by EP ID injection followed by an optional booster dose of INO-4800 administered by EP

number

[0267] Safety assessment. Subjects will be followed for safety throughout the duration of the study until EOS or the subject's last visit. Adverse events will be collected at all visits (including phone calls on Day 1 and Week 36 after the booster dose). Clinical laboratory blood and urine samples will be collected according to the schedule of events (Table 15 and Table 16). [Table 15-1] [Table 15-2] [Table 16]

[0268] Immunogenicity Assessment. Immunologic blood samples will be collected according to the schedule of events (Table 15 and Table 16). Decision making of analysis of collected samples for immunologic endpoints will be adjudicated on an ongoing basis throughout the study.

[0269] INO-4800 delivered by ID followed by EP using CELLECTRA® 2000 in healthy volunteers is expected to be well tolerated, have an acceptable safety profile, and result in the generation of an immune response against the SARS-CoV-2 spike glycoprotein.

[0270] Example 7 A Phase 2 / 3 Randomized, Blinded, Placebo-Controlled Study to Evaluate the Safety, Immunogenicity, and Efficacy of INO-4800, a Prophylactic Vaccine Against COVID-19 Disease, Administered Intradermally Followed by Electroporation (EP) in Healthy Seronegative Adults at High Risk for SARS-CoV-2 Exposure This is a Phase 2 / 3 randomized, placebo-controlled, multicenter study to evaluate the safety, immunogenicity, and efficacy of INO-4800 administered by intradermal (ID) injection followed by electroporation (EP) using the CELLECTRA® 2000 device to prevent COVID-19 disease in participants at high risk of exposure to SARS-CoV-2. The Phase 2 segment will evaluate immunogenicity and safety in approximately 400 participants at two dose levels across three age groups. Safety and immunogenicity information from the Phase 2 segment will be used to determine dose levels for the Phase 3 efficacy segment of the study, which will include approximately 6,178 participants. [Table 17-1] [Table 17-2]

[0271] Primary outcome measures: 1. Phase 2: Change from baseline in antigen-specific cellular immune responses measured by interferon-gamma (IFN-γ) enzyme-linked immunospot (ELISpot) assay [Time frame: baseline to day 393] 2. Phase 2: Change from baseline in neutralizing antibody responses measured by pseudovirus-based neutralization assay [Time frame: baseline to day 393] 3. Proportion of participants with virologically confirmed COVID-19 disease [Time frame: from day 14 after completion of the 2-dose regimen to 12 months after dose 2 (i.e., from day 42 to day 393)]

[0272] Secondary outcome measures: 1. Phase 2 and 3: Proportion of Participants with Unsolicited and Solicited Injection Site Reactions [Time Frame: From time of consent through Day 28 (through Day 56) after Dose 2] 2. Phases 2 and 3: Proportion of participants with solicited and unsolicited systemic adverse events (AEs) [Time frame: from time of consent through Day 28 (through Day 56) after Dose 2] 3. Phase 2 and 3: Proportion of participants with serious adverse events (SAEs) [Time frame: Baseline to Day 393] 4. Phase 2 and 3: Proportion of participants with adverse events of special interest (AESI) [Time frame: Baseline to Day 393] 5. Phase 3: Proportion of participants who died from any cause [Time frame: baseline to day 393] 6. Phase 3: Proportion of participants with non-severe COVID-19 disease [Time frame: from day 14 after completion of the 2-dose regimen to 12 months after dose 2 (i.e., from day 42 to day 393)] 7. Phase 3: Proportion of participants with severe COVID-19 disease [Time frame: from day 14 after completion of the 2-dose regimen to 12 months after dose 2 (i.e., from day 42 to day 393)] 8. Phase 3: Percentage of participants who died from COVID-19 disease [Time frame: from day 14 after completion of the 2-dose regimen to 12 months after dose 2 (i.e., from day 42 to day 393)] 9. Phase 3: Proportion of participants with virologically confirmed SARS-CoV-2 infection [Time frame: from day 14 after completion of the 2-dose regimen to 12 months after dose 2 (i.e., from day 42 to day 393)] 10. Phase 3: Days to symptom resolution in participants with COVID-19 disease [Time frame: from day 14 after completion of the 2-dose regimen to 12 months after dose 2 (i.e., from day 42 to day 393)] 11. Phase 3: Change from baseline in antigen-specific cellular immune responses measured by IFN-gamma ELISpot assay [Time frame: baseline to day 393] 12. Phase 3: Change from baseline in neutralizing antibody responses measured by pseudovirus-based neutralization assay [Time frame: baseline to day 393]

[0273] Eligibility Criteria Eligible age for the study: 18 years or older Eligible genders for the study: All Gender-based: No Accepting healthy volunteers: Yes

[0274] Main inclusion criteria: Work or live in an environment where there is a high risk of exposure to SARS-CoV-2, where the exposure may be for a relatively long period of time, or where personal protective equipment (PPE) may not be used consistently, especially in confined environments. Screening test results that are within the normal range for a clinical test or that the investigator determines to be not clinically significant. · Being postmenopausal or surgically sterile, or having a partner who is infertile, or using a medically effective method of contraception that has a failure rate of less than 1% per year when used consistently and correctly from screening through 3 months after the last dose.

[0275] Key exclusion criteria: Acute febrile illness with a temperature >100.4°F (38.0°C) or acute onset of upper or lower respiratory tract symptoms (e.g., cough, shortness of breath, sore throat). Positive serological or molecular (reverse transcription-polymerase chain reaction [RT-PCR]) test for SARS-CoV-2 at screening - Pregnant or breastfeeding, or intending to become pregnant or father a child within the planned duration of the study beginning with the Screening Visit up to 3 months after the last dose. · Known history of uncontrolled HIV based on a CD4 count or detectable viral load of less than 200 cells per cubic millimeter ( / mm^3) within the past three months. Currently participating or having participated in a study using an investigational drug within 30 days prior to Day 0. Have previously received an investigational vaccine to prevent or treat COVID-19, Middle East Respiratory Syndrome (MERS), or Severe Acute Respiratory Syndrome (SARS) (receiving a placebo in the previous trial will qualify you for the trial). Respiratory disease (e.g., asthma, chronic obstructive pulmonary disease) requiring significant change in treatment or hospitalization due to exacerbation of the disease during the 6 weeks prior to enrollment. Immunosuppression as a result of an underlying disease or treatment · Lack of acceptable sites available for ID injection and EP -Blood donation or transfusion within 1 month prior to Day 0. ·Reporting alcohol or drug abuse or dependence, or illegal drug use (other than cannabis use). Any disease or condition that, in the opinion of the investigator, may affect the participant's safety or the assessment of any study endpoints.

[0276] Example 8 One or two dose regimens of SARS-CoV-2 DNA vaccine INO-4800 protect against airway disease burden in a non-human primate (NHP) challenge model The safety, immunogenicity, and efficacy of intradermal delivery of INO-4800, a synthetic DNA vaccine candidate encoding the SARS-CoV-2 spike antigen, was evaluated in a rhesus macaque model. Single- and two-dose vaccination regimens were evaluated. Vaccination induced both binding and neutralizing antibodies along with IFN-γ producing T cells against SARS-CoV-2. A high dose of SARS-CoV-2 Victoria01 strain (5x10^6 pfu) was used to specifically evaluate the impact of INO-4800 vaccination on lung disease burden, providing both vaccine safety and efficacy data. A wide range of lower respiratory tract disease parameters were measured by applying histopathology, pulmonary disease scoring metric system, in situ hybridization, viral RNA RT-PCR, and computed tomography (CT) scans to provide an understanding of the impact of vaccine-induced immunity on protective efficacy and potential vaccine-enhanced disease (VED).

[0277] This example describes the evaluation of the immunogenicity, efficacy, and safety of the SARS-CoV-2 DNA vaccine INO-4800 in a rigorous high-dose non-human primate challenge model. Intradermal delivery of 1 mg of INO-4800 to rhesus macaques induces humoral and T cell responses to the SARS-CoV-2 spike antigen in both a two-dose regimen and a suboptimal one-dose regimen. No overt clinical events were recorded in the animals throughout the study. After high-dose SARS-CoV-2 challenge, reduced viral load and pulmonary disease burden were observed in both the one-dose and two-dose vaccine groups supporting the efficacy of INO-4800. Importantly, no vaccine-enhanced disease (VED) was observed, even in the one-dose group.

[0278] method: Vaccine. An optimized DNA sequence encoding the SARS-CoV-2 IgELS-spike was generated using Inovio's proprietary in silico gene optimization algorithm to improve expression and immunogenicity. The optimized DNA sequence was synthesized, digested with BamHI and XhoI, and cloned into the expression vector pGX0001 under the control of the human cytomegalovirus immediate early promoter and bovine growth hormone polyadenylation signal.

[0279] Animals: Eighteen rhesus macaques (Macaca mulatta) of Indian origin were used in this study. Test groups included three males and three females of each species, all adults aged 2.5-3.5 years and weighing >4 kg at the time of challenge. Socially compatible animals were randomly assigned to challenge groups prior to the start of the experiment to minimize bias. Animals were housed in cages and in compatible social groups in accordance with the UK Home Office Code of Practice for the Housing and Care of Animal Husbandry supplied or used for scientific procedures (2014) and the National Committee for Refinement, Reduction and Replacement (NC3R) guidelines for the housing, care and use of primates, August 2006. Housing before and during challenge is described in [Salguero, FJ, et al., Comparison of Rhesus and Cynomolgus macaques as an authentic model for COVID-19. bioRxiv, 2020: p.2020.09.17.301093.]. All experimental work was subject to local ethical review at PHE Porton Down by the Animal Welfare Ethical Review Body (AWERB) and was carried out under the authority of a UK Home Office Approved Project Licence (PDC57C033) approved in accordance with the requirements of the Home Office Animals (Scientific Procedures) Act 1986. For procedures requiring removal from housing, animals were sedated by intramuscular (IM) injection with ketamine hydrochloride (Ketaset, 100 mg / ml, Fort Dodge Animal Health Ltd, Southampton, UK; 10 mg / kg). None of the animals had been used in experimental procedures before.

[0280] Vaccine Administration. Animals received 1 mg of the SARS-CoV-2 DNA vaccine, INO-4800, by intradermal injection on day 28 only (1 dose group) or on days 0 and 28 (2 dose groups), followed by EP treatment using a CELLECTRA 2000® adaptive constant current electroporation device with a 3P array (Inovio Pharmaceuticals).

[0281] During the vaccination phase, animals were sedated every other week while serum and heparinized whole blood were collected. Nasal and throat swabs were also collected on the day of challenge, day 56. After challenge, nasal swabs, throat swabs, and serum were collected at 1, 3, 5 dpc and cull (6, 7, or 8 dpc - alternated due to the high level of labor involved in the procedures), and heparinized whole blood was collected at 3 dpc and cull. Nasal and throat swabs were obtained as described [Salguero, FJ, et al., Comparison of Rhesus and Cynomolgus macaques as an authentic model for COVID-19. bioRxiv, 2020: p. 2020.09.17.301093.].

[0282] Clinical Observations. Animals were monitored multiple times per day for behavior and clinical changes. Behavior was assessed for aversive indicators including depression, withdrawal from the group, aggression, changes in feeding patterns, breathing patterns, respiratory rate, and coughing. Animals were observed and scored for activity and health throughout the study as follows: Key: Activity Levels: A0=active and alert; A1=active only when stimulated by the operator; A2=inactive / immobile even when stimulated; H=healthy; S=sneezing, C=coughing, Nd=nasal discharge, Od=ocular discharge, Rn=breathing sounds, Lb=forced breathing, L=lethargy, Di=diarrhea, Ax=anorexia, Dx=dehydration, RD=dyspnea. Animal weights, temperatures, and hemoglobin levels were measured and recorded throughout the study.

[0283] Viruses and cells SARS-CoV-2 Victoria / 01 / 2020 [Caly, L., et al., Isolation and rapid sharing of the 2019 novel coronavirus (SARS-CoV-2) from the first patient diagnosed with COVID-19 in Australia. Med J Aust, 2020. 212(10):p.459-462] was generously provided by The Doherty Institute, Melbourne, Australia, at P1 after primary growth in Vero / hSLAM cells and then passaged twice at PHE Porton Down in Vero / hSLAM cells [ECACC04091501]. Infection of cells was performed with an MOI of virus of approximately 0.0005, and remaining attached cells were dissociated by gentle rocking with sterile 5 mm borosilicate beads, followed by clarification by centrifugation at 1,000 × g for 10 min, and harvested on day 4. Whole genome sequencing was performed on P3 challenge stocks using both Nanopore and Illumina as described in Lewandowski, K., et al., Metagenomic Nanopore Sequencing of Influenza Virus Direct from Clinical Respiratory Samples. J Clin Microbiol, 2019.58(1). Viral titers of challenge stocks were determined by plaque assay on Vero / E6 cells [ECACC 85020206]. Cell lines were obtained from the European Collection of Certified Cell Cultures (ECACC) PHE, Porton Down, UK. Cell cultures were maintained at 37°C in Minimum Essential Medium (MEM) (Life Technologies, California, USA) supplemented with 10% fetal bovine serum (FBS) (Sigma, Dorset, UK) and 25 mM HEPES (Life Technologies, California, USA). In addition, Vero / hSLAM cultures were supplemented with 0.4 mg / ml geneticin (Invitrogen) to maintain the expression plasmid.Challenge material dilutions were performed in phosphate buffered saline (PBS). Inoculum (5 x 10. 6 PFU) were delivered by intratracheal route (2 ml) and intranasal instillation (1.0 ml total, 0.5 ml per nostril).

[0284] Clinical signs and in vivo imaging by computed tomography CT scans were performed 2 weeks before and 5 days after challenge with SARS-CoV2. CT imaging was performed on sedated animals using a 16-slice Lightspeed CT scanner (General Electric Healthcare, Milwaukee, WI, USA) in both supine and recumbent positions, and scans were evaluated by a respiratory medical radiology expert (as previously described [Salguero, FJ, et al., Comparison of Rhesus and Cynomolgus macaques as an authentic model for COVID-19.2020:p.2020.09.17.301093.]). To provide the ability to discern differences between individual NHPs with low disease volumes (i.e., less than 25% lung involvement), we designed an improved scoring system to impute scores for the possession of unusual distinctive features of COVID in human patients (COVID pattern score) and the distribution of features through the lungs (zone score). The COVID pattern score was calculated as the sum of the scores assigned to the number of nodules identified, as well as the possession and extent of GGOs, and consolidations according to the following system: Nodules: Score 1 for one, score 2 for two or three, and score 3 for four or more. GGOs: Each lesion was scored according to the following: Score 1 for areas measuring <1 cm, score 2 for 1-2 cm, score 3 for 2-3 cm, and score 4 for >3 cm. The scores for each area of ​​GGOs were summed to provide a total GGO score. Consolidations: Each lesion was scored according to the following: Score 1 for areas measuring <1 cm, score 2 for 1-2 cm, score 3 for 2-3 cm, and score 4 for >3 cm. The scores for each area of ​​consolidations were summed to provide a total consolidation score. To take into account the estimated additional disease impact on the host of consolidations compared to GGOs, the scoring system was weighted by doubling the score assigned for consolidations.To determine the zone score, the lung was divided into 12 zones, with each side of the lung (top to bottom) divided into three zones: the upper zone (above the carina), the middle zone (from the carina to the inferior pulmonary vein), and the lower zone (below the inferior pulmonary vein). Each zone was further divided into two regions: the anterior zone (area anterior to the vertical line of the midpoint of the diaphragm in the sagittal position) and the posterior zone (area posterior to the vertical line of the midpoint of the diaphragm in the sagittal position). This results in a total of 12 zones, with each zone containing structural changes assigned a score of 1. The COVID pattern score and zones are summed to provide a total CT score.

[0285] Necropsy and histopathology. Animals were euthanized at three different time points in groups of six (including one animal from each species and sex) at 6, 7 and 8 dpc. Bronchoalveolar lavage (BAL) was collected at necropsy from the right lung. The left lung was dissected before BAL collection and used for subsequent histopathology and virological procedures. At necropsy, nasal and throat swabs, heparinized whole blood and serum were collected along with tissue samples for histopathology. Samples from the left cranial and left caudal lung lobes along with spleen, kidney, liver, mediastinal and axillary lymph nodes, small intestine (duodenum), large intestine (colon), trachea, laryngeal inoculation site and draining lymph nodes were fixed by immersion in 10% neutral buffered formalin and routinely processed into paraffin wax. 4 μm sections were cut, stained with hematoxylin and eosin (H&E) and examined microscopically. A lung histopathology scoring system [Salguero, FJ, et al., Comparison of Rhesus and Cynomolgus macaques as an authentic model for COVID-19. bioRxiv, 2020: p.2020.09.17.301093] was used to evaluate lesions affecting the airways and parenchyma. Three tissue sections from each left lung lobe were used to evaluate lung histopathology. In addition, samples were stained using RNAscope technology to identify SARS-CoV-2 viral RNA in lung tissue sections. Briefly, tissues were pretreated with hydrogen peroxide for 10 min (room temperature), followed by target retrieval for 15 min (98–102 °C), and protease plus for 30 min (40 °C) (Advanced Cell Diagnostics). V-nCoV2019-S probe (SARS-CoV-2 spike gene specific) was incubated on the tissue for 2 h at 40 °C. In addition, samples were stained using RNAscope technology to identify SARS-CoV-2 viral RNA. Signal amplification was performed according to the RNAscope protocol using the RNAscope 2.5HD Detection Kit-Red (Advanced Cell Diagnostics, Biotechne).All H&E and ISH stained slides were digitally scanned using a Panoramic 3D-Histech scanner and viewed using CaseViewer v2.4 software. The presence of viral RNA by ISH was assessed using whole lung tissue section slides. Digital image analysis was performed on RNAscope labeled slides to confirm the percentage of stained cells within the lesions by using the Nikon-NIS-Ar software package.

[0286] Quantification of viral load by RT-qPCR. RNA was isolated from nasal and throat swabs. Samples were inactivated in AVL (Qiagen) and ethanol. Downstream extraction was then performed using BioSprint™ 96 One-For-All vet kit (Indical) and Kingfisher Flex platform according to the manufacturer's instructions. Tissues were homogenized in buffer RLT + betamercaptoethanol (Qiagen). Tissue homogenates were then centrifuged by QIAshredder homogenizer (Qiagen) and supplemented with ethanol according to the manufacturer's instructions. Downstream extraction was then performed from tissue samples using BioSprint™ 96 One-For-All vet kit (Indical) and Kingfisher Flex platform according to the manufacturer's instructions.

[0287] Viral load was determined using reverse transcription quantitative polymerase chain reaction (RT-qPCR) targeting a region of the SARS-CoV-2 nucleocapsid (N) gene and was performed using TaqPath™ 1-Step RT-qPCR Master Mix, CG (Applied Biosystems™), 2019-nCoV CDC RUO Kit (Integrated DNA Technologies) and the QuantStudio™ 7 Flex Real-Time PCR System. The sequences of the N1 primers and probe were as follows: 2019-nCoV_N1-forward, 5'GACCCCAAAATCAGCGAAAT3' (SEQ ID NO: 18); 2019-nCoV_N1-reverse, 5'TCTGGTTACTGCCAGTTGAATCTG3' (SEQ ID NO: 19); 2019-nCoV_N1-probe, 5'FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3' (SEQ ID NO: 20). Cycling conditions were as follows: 25°C for 2 min, 50°C for 15 min, 95°C for 2 min, followed by 45 cycles of 95°C for 3 s and 55°C for 30 s. The quantification standard was in vitro transcribed RNA of the SARS-CoV-2N ORF (accession number NC_045512.2) with a quantification of 1-6 log copies / μl. Positive swab and fluid samples detected below the limit of quantification (LoQ) of 4.11 log copies / ml were assigned a value of 5 copies / μl, which is equivalent to 3.81 log copies / ml, while undetected samples were assigned a value of less than 2.3 copies / μl, corresponding to the lower limit of detection (LoD) of the assay equal to 3.47 log copies / ml. Positive tissue samples detected below the limit of quantification (LoQ) of 4.76 log copies / ml were assigned a value of 5 copies / μl, which is equivalent to 4.46 log copies / g, whereas undetected samples were assigned a value of less than 2.3 copies / μl, corresponding to the lower limit of detection (LoD) of the assay, which is equivalent to 4.76 log copies / g.

[0288] Subgenomic RT-qPCR was performed on a QuantStudio™ 7 Flex Real-Time PCR System using TaqMan™ Fast Virus 1-Step Master Mix (Thermo Fisher Scientific) and oligonucleotides specified by Wolfel, et al. Virological assessment of hospitalized patients with COVID-2019. Nature 581, 465-469 (2020) with forward, probe and reverse primers at final concentrations of 250 nM, 125 nM and 500 nM, respectively. The sequences of the sgE primers and probe were as follows: 2019-nCoV_sgE-forward, 5'CGATCTCTTGTAGATCTGTTCTC3' (SEQ ID NO:21); 2019-nCoV_sgE-reverse, 5'ATATTGCAGCAGTACGCACACA3' (SEQ ID NO:22); 2019-nCoV_sgE-probe, 5'FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ13' (SEQ ID NO: 23).

[0289] Cycling conditions were 50°C for 10 min, 95°C for 2 min, followed by 45 cycles of 95°C for 10 s, and 60°C for 30 s. RT-qPCR amplicons were quantified against an in vitro transcribed RNA standard of full-length SARS-CoV-2 E ORF (accession number NC_045512.2) preceded by UTR leader sequences and putative E gene transcription regulatory sequences as described by Wolfel et al. [Wolfel, R., Corman, VM, Guggemos, W. et al. Virological assessment of hospitalized patients with COVID-2019. Nature 581, 465-469 (2020).]. Positive samples detected below the lower limit of quantification (LLOQ) were assigned a value of 5 copies / μl, while undetected samples were assigned a value of 0.9 copies / μl or less, which corresponds to the lower limit of detection (LLOD) of the assay. For extracted samples nasal swabs, throat swabs, and BAL samples, these correspond to an LLOQ of 4.11 log copies / mL and an LLOD of 3.06 log copies / mL. For tissue samples, this corresponds to an LLOQ of 4.76 log copies / g and an LLOD of 3.71 log copies / g.

[0290] Plaque reduction neutralization assay. Neutralizing virus titers were measured in heat-inactivated (56°C, 30 min) serum samples. SARS-CoV-2 was neutralized at 1.4 × 10 3 The serum samples were diluted to a concentration of 70 pfu / ml (70 pfu / 50 μl) and mixed 50:50 in 1% FCS / MEM with doubling serum dilutions of 1:10 to 1:320 in 96-well V-bottom plates. The plates were incubated for 1 h at 37 °C in a humidified box to allow antibodies in the serum samples to neutralize the virus. The neutralized virus was transferred to wells of a washed plaque assay 24-well plate (see plaque assay methodology), allowed to adsorb for an additional 1 h at 37 °C, and overlaid with plaque assay overlay medium. After 5 days of incubation at 37 °C in a humidified box, the plates were fixed, stained, and plaques were counted.

[0291] Antigen binding ELISA. Recombinant SARS-CoV-2 spike and RBD specific IgG responses were determined by ELISA. Full length trimer and stabilized forms of SARS-CoV-2 spike protein were provided by Lake Pharma (number 46328). Recombinant SARS-CoV-2 receptor binding domain (319-541) Myc-His was developed and kindly provided by MassBiologics. High binding 96-well plates (Nunc Maxisorp, 442404) were coated with 50 μl per well of 2 μg / ml spike trimer (S1+S2) or RBD in 1× PBS (Gibco) and incubated overnight at 4°C. ELISA plates were washed and blocked with 5% fetal bovine serum (FBS, Sigma, F9665) in 1× PBS / 0.1% Tween® 20 for 1 h at room temperature. Sera collected from animals after vaccination were at a starting dilution of 1 / 50 followed by 8 two-fold serial dilutions. Post-challenge samples were inactivated in 0.5% Triton and at a starting dilution of 1 / 100 followed by 8 three-fold serial dilutions. Serial dilutions were performed in 10% FBS in 1×PBS / 0.1% Tween®20. After washing the plates, 50 μl / well of each serum dilution was added in duplicate to the antigen-coated plates and incubated for 2 hours at room temperature. After washing, anti-monkey IgG conjugated to HRP (Invitrogen, PA1-84631) was diluted (1:10,000) in 10% FBS in 1×PBS / 0.1% Tween®20 and 100 μl / well was added to the plates. The plates were then incubated at room temperature for 1 hour. After washing, a 1 mg / ml solution of O-phenylenediamine dihydrochloride (Sigma P9187) was prepared and 100 μl was added per well. The progression was stopped with 50 μl per well of 1 M hydrochloric acid (Fisher Chemical, J / 4320 / 15) and absorbance was read at 490 nm on a Molecular Devices versamax plate reader using Softmax (version 7.0). Titers were determined using the end-point titration method.For each sample, the endpoint titer is defined as the interaction of the highest sample dilution giving a reading (OD) above the cutoff, which was determined for each experimental group as the mean OD+3SD of naive samples.

[0292] Peripheral blood mononuclear cell isolation and resuscitation. PBMCs were isolated from whole blood clotted with heparin (132 units per 8720 mL of blood) (BD Biosciences, Oxford, UK) using standard methods. PBMCs isolated from tissues were stored at -180°C. For resuscitation, PBMCs were thawed and washed with 1 U / ml DNase (Sigma) in R10 medium (consisting of RPMI 1640 supplemented with 2 mM L-glutamine, 50 U / ml penicillin-50 μg / ml streptomycin, and 10% heat-inactivated FBS), resuspended in R10 medium, and incubated overnight at 37°C 5% CO2.

[0293] ELISpot. IFNγ ELISpot assay was used to estimate the frequency and IFNγ producing capacity of SARS-CoV-2 specific T cells in PBMCs using a human / monkey IFNγ kit (MabTech, Nacka. Sweden) as previously described [Sibley, LS, et al., ELISPOT Refinement Using Spot Morphology for Assessing Host Responses to Tuberculosis. Cells, 2012.1(1):p.5-14.]. Cells were cultured at 2 × 10 per well. 5753 cells were assayed. Cells were stimulated overnight with a SARS-CoV-2 peptide pool spanning the ECD spike protein. Five peptide pools, consisting of 15-mer peptides overlapping by 9 amino acids, were used. Phorbol 12-myristate (Sigma) (100 ng / ml) and ionomycin (CN Biosciences, Nottingham, UK) (1 mg / ml) were used as positive controls. Results were calculated and reported as spot-forming units (SFU) per million cells. All SARS-CoV-2 peptides were assayed in duplicate and media-only wells were subtracted to obtain antigen-specific SFU. ELISPOT plates were analyzed using a CTL scanner and software (CTL, Germany) and further analysis was performed using GraphPad Prism (GraphPad Software, USA).

[0294] Statistics. All statistical analyses were performed using GraphPad Prism 7 or 8 software (La Jolla, CA). Data were considered significant when p<0.05. The type of statistical analysis performed is detailed in the figure legends. No samples or animals were excluded from the analysis.

[0295] result: Immunogenicity of one-dose and two-dose regimens of INO-4800. Twelve rhesus macaques (6 males and 6 females) were vaccinated with one (6 monkeys) or two (6 monkeys) doses of INO-4800 on day 28, or on days 0 and 28, respectively (Figure 22A). For each treatment, 1 mg of INO-4800 was administered intradermally, followed by CELLECTRA-ID EP. Six additional age- and sex-matched animals were not vaccinated and served as a control group. During the study period, animals were observed and scored as alert and healthy, and no adverse events or clinical abnormalities were recorded in the animals (Figure 23). Serum titers of SARS-CoV-2 spike antigen-reactive IgG antibodies in all animals were measured biweekly from day 0 to day 56. In the single dose group (INO-4800 X1), 14 days after vaccination, mean endpoint titers of 467 against the SARS-CoV-2 spike antigen trimer S1+S2 ECD form and 442 against the RBD antigen, as well as a live virus (matched to the challenge strain Victoria / 01 / 2020) neutralization titer of 239 (Figure 22B-D). In the two dose group (INO-4800 X2), mean endpoint titers of 2,142 against the S1+S2 ECD and 1,538 against the RBD antigen, as well as a live virus neutralization titer of 2,199, were measured 14 days after the second vaccination (Figure 22B-D). Vaccination with INO-4800 induced SARS-CoV-2 spike antigen-specific Th1 T cell responses in the PBMC population measured by IFN-γ ELISpot (Figure 22E). In summary, intradermal delivery of INO-4800 induced functional humoral and T cell responses against the SARS-CoV-2 spike protein that were enhanced after the second dose. On the day of virus challenge (day 56), levels of SARS-CoV-2 neutralizing antibodies in serum were significantly higher in the vaccinated group compared to the control group (p=0.015). After virus challenge, there was a slight increase in SARS-CoV-2 spike-binding and neutralizing antibody titers in all groups from day 56 to days 62-64 (Figure 22B-D).In the control group, there was an increase in cellular immune responses to peptides across the SARS-CoV-2 spike antigen after viral challenge, but there was little change in the vaccinated group, likely due to control of viral infection by the humoral arm of the host immune system (Figure 22F).

[0296] Viral load in the upper and lower respiratory tract after SARS-CoV-2 challenge On day 56, all animals were challenged with a total of 5x10^6 pfu of SARS-CoV-2 delivered to both the upper and lower respiratory tract. No overt clinical symptoms were observed in any of the animals throughout the challenge period (6-8 days) (Figures 23A-23C). Nasal and throat swabs were taken from the animals at the indicated time points. SARS-CoV-2 viral genome (viral RNA) and subgenome (sg mRNA), representing replicating virus, were measured by RT-qPCR (Figures 24A and 25A). Analysis of area under the curve (AUC) levels of viral RNA in the throat revealed significantly reduced levels in the vaccinated group (Figure 24B). Furthermore, peak viral load levels measured in the INO-4800 X2 group were significantly reduced compared to the control group (Figure 24C). Analysis revealed a significant inverse correlation between viral load in the throat and neutralizing and anti-RBD IgG titers (Figures 15A-15D). SARS-CoV-2 sgmRNA data revealed a similar trend of reduced viral load in vaccinated groups compared to controls (Figure 25A-C). Analysis in the nasal compartment revealed trends for reduced and accelerated clearance of viral RNA and sgmRNA in vaccinated groups compared to controls, but did not reach significance levels (Figures 24D-F and 25D-F). Analysis revealed a significant inverse correlation between nasal viral load and neutralizing and anti-RBD IgG titers on day 3, but not on day 1 (Figures 15E-15H).

[0297] At necropsy (6–8 days post-challenge), BAL fluid was collected from each animal. Measurement of SARS-CoV-2 viral RNA and sgmRNA levels revealed a reduction in mean virus in the vaccinated group, although levels varied within each group depending on the day of necropsy (Figures 26A, 26B). RT-qPCR was also performed on tissues collected at necropsy. At these time points post-challenge, detected SARS-CoV-2 viral RNA levels were below the limit of quantification in most tissues, except for the lung (Figure 27). Measurement of SARS-CoV-2 viral mRNA and sgmRNA levels detected in lung tissue samples showed a reduction in mean viral load in vaccinated animals (Figures 26C and 26D).

[0298] In summary, the data showed a significant reduction in viral load in the throat and a trend towards reduced viral load in the lungs of the vaccinated group. The collection of BAL and lung tissue samples at different time points after challenge (days 6, 7 or 8) likely added to the observed within-group variability affecting the statistical analysis. The RT-qPCR viral load data showed that INO-4800 vaccination had a positive effect on reducing viral load in rhesus macaques challenged with a high dose of SARS-CoV-2, with generally lower viral levels measured in the two-dose vaccine group compared to the one-dose vaccine group.

[0299] Lung disease burden following SARS-CoV-2 challenge. Pulmonary disease burden was assessed in harvested lung tissue collected at necropsy 6–8 days after challenge. Analysis was performed on all animals in the study in a double-blind fashion. Histopathological analysis of lung tissue was performed on multiple organ tissues, but only the lungs showed prominent lesions compatible with SARS-CoV-2 infection. Lung lesions consistent with infection with SARS-CoV-2 were observed in the lungs of animals from unvaccinated controls and at reduced levels in the vaccinated groups. Representative histopathological images are provided in Figure 28. Briefly, the lung parenchyma consisted of multifocal to confluent areas of pneumonia surrounded by unaffected parenchyma. Alveolar damage with pneumocyte necrosis was a prominent feature in affected areas. Alveolar spaces and interalveolar septa contained mixed inflammatory cells (including macrophages, lymphocytes, viable and degenerated neutrophils, and occasional eosinophils), and edema. Type II pneumocyte hyperplasia was also observed in the distal bronchioles and at the bronchiolar-alveolar junctions. In the larger airways, occasional foci of epithelial degeneration and sloughing were observed in the airway epithelium. Small numbers of mixed inflammatory cells, including neutrophils, lymphocytes, and occasionally eosinophils, infiltrated the bronchi and bronchial walls. In the lumen of some airways, mucus mixed with degenerative cells, primarily neutrophils and epithelial cells, was seen. Within the parenchyma, perivascular and peribronchiolar cellular infiltrates were also observed, with most being lymphoid cells containing infiltrates.

[0300] Histopathological scores and percent tissue area of ​​SARS-CoV-2 RNA positivity were applied to quantify disease burden. The unvaccinated group showed the highest histopathological scores in the lungs compared to the vaccinated group (Figures 29A and 29C). Animals from the vaccinated groups showed reduced pathology compared to unvaccinated animals, except for animal number 10A from the INO-4800X1 group, which showed similar histopathological scores to unvaccinated animals. In situ hybridization (ISH) was performed to detect the presence of SARS-CoV-2 RNA in lung tissue. Viral RNA was observed in lung cells and inflammatory cells within histopathological lesions at a reduced frequency in vaccinated animals (Figure 29B).

[0301] CT scans were performed to provide an in vivo, unbiased, quantifiable metric of lung disease. Results from lung CT imaging performed 5 days after challenge with SARS-CoV-2 were evaluated for the presence of ground-glass opacities (GGOs), consolidations, crazy paving, nodules, perilobular consolidations; distribution-upper, middle, lower, central 2 / 3, peripheral, bronchiocentric, and for pulmonary emboli, which are characteristic of COVID-19 disease. Medical radiologists were blinded to the treatment and clinical status of the animals. The extent of lung lesions was assessed and quantified using a scoring system developed for COVID disease. Parameters of the scoring system are provided in the Materials and Methods section. Lung abnormalities characteristic of COVID-19 disease were observed in 3 of 6 and 2 of 6 animals in the INO-4800 1 or 2 dose groups, respectively, and in 5 of 6 unvaccinated animals in the control group (representative CT scan images are provided in Figure 30). The extent of lung lesions in animals with disease lesions was less than 25% and was considered a low level of disease (Figure 29D). Disease scores were highest in the unvaccinated control group and tended to decrease in the INO-4800 1- and 2-dose groups (Figures 29E-29G). Comparison of scores between groups did not reach statistical difference (p=0.0584 between the INO-4800 2-dose group and the non-vaccinated group, Mann-Whitney test). One outlier animal (10A) in the INO-4800 X1 group had a higher score than the other animals. However, disease levels were still considered low and comparable disease burdens were observed in other NHP SARS-CoV-2 challenge studies performed under the same conditions. In summary, CT scanning provides a useful measure of SARS-CoV-2-induced disease in rhesus macaques. Low levels of abnormalities were reported (involving less than 25% of the lungs) on day 5 after SARS-CoV-2 infection. Evidence from CT scans suggested a trend towards differences in lung disease burden between the groups, with the highest disease burden in the unvaccinated control group.

[0302] In summary, following high-dose SARS-CoV-2 challenge of non-human primates, disease burden was reduced in animals that received one of the two-dose regimens of INO-4800 vaccine, and there were no signs of vaccine-enhanced disease in animals that received a suboptimal one-dose vaccination regimen.

[0303] Consideration This example describes the evaluation of the safety, immunogenicity, and efficacy of SARS-CoV-2 DNA vaccine INO-4800 in a rigorous high-dose non-human primate challenge model. Intradermal delivery of 1 mg of INO-4800 to rhesus macaques induces both humoral and T cell responses to the SARS-CoV-2 spike antigen in both a two-dose and a one-dose regimen. No overt clinical events were recorded in the animals throughout the study. After high-dose SARS-CoV-2 challenge, reduced viral load and pulmonary disease burden were observed in both the one-dose and two-dose vaccine groups supporting the efficacy of INO-4800. Importantly, no vaccine-enhanced disease (VED) was observed, even in the one-dose group.

[0304] The rhesus macaque model has become a widely used model to evaluate medical countermeasures against SARS-CoV-2. Importantly, wild-type non-adapted SARS-CoV-2 replicates in the respiratory tract of rhesus macaques, and the animals exhibit some of the characteristics observed in humans with mild COVID-19 symptoms [Salguero, FJ, et al., Comparison of Rhesus and Cynomolgus macaques as an authentic model for COVID-19. 2020: p. 2020.09.17.301093., Munoz-Fontela, C., et al., Animal models for COVID-19. Nature, 2020. 586(7830): p. 509-515]. Here, we focused on the lung disease burden in SARS-CoV-2-challenged rhesus macaques vaccinated with INO-4800. Although the levels of lung disease burden measured in the animals were mild, a significant reduction in histopathology and virus detection scores in the lungs of vaccinated animals was observed (Figure 29). This suggests a possible positive impact on the LRT disease observed in COVID-19 patients progressing to severe disease. Interestingly, a significant reduction in viral load in the throat compartment of the upper respiratory tract was also observed, but only a trend for reduction in the nasal compartment. Differential induction of mucosal immunity may exist between the throat and nasal compartments. Interestingly, a significant inverse correlation was observed between RBD-targeting and neutralizing antibodies in serum with viral load in the throat, but not the nose, at day 1 post-challenge (Figure 15). However, the levels of these antibodies in either of these URT compartments were not assayed to provide further evidence of the presence of increased levels of functional antibodies in the throat compared to the nasal cavity. Another possibility is that a broad range (5 × 10 6One possible explanation is that the viral control in the nasal compartment, where a SARS-CoV-2 challenge dose of 10000 pfu is directly instilled, may be at a higher level than in other mucosal compartments. In support of this, data in control animals show that nasal swabs yield higher viral titers than throat swabs, and similar observations have been reported in COVID-19 subjects [Mohammadi, A., et al., SARS-CoV-2 detection in different respiratory sites: A systematic review and meta-analysis. EBioMedicine, 2020. 59: p. 102903.]

[0305] Importantly, the data showed that enhanced respiratory disease (ERD) was not associated with INO-4800 immunization in either the one- or two-dose regimen. In the INO-4800 X1 dose group, one animal (10A) showed the highest lung histopathology and CT scan scores. However, the multifocal lesions in animal 10A showed a similar histopathological pattern to those observed in animals from the unvaccinated group, with no obvious influx of distinct inflammatory cell subpopulations in the infiltrate. A potential feature of vaccine-enhanced disease is an increased influx of inflammatory cells such as eosinophils [Bolles, M., et al., A double-inactivated severe acute respiratory syndrome coronavirus vaccine provides incomplete protection in mice and induces increased eosinophilic proinflammatory pulmonary response upon challenge. J Virol, 2011. 85(23): p. 12201-15; Yasui, F., et al., Prior Immunization with Severe Acute Respiratory Syndrome (SARS)-Associated Coronavirus (SARS-CoV) Nucleocapsid Protein Causes Severe Pneumonia in Mice Infected with SARS-CoV. The Journal of Immunology, 2008. 181(9): p. 6337-6348.]. The CT scan and histopathology data for animal 10A do not appear to be associated with ERD, but rather disease scores and patterns similar to those of unvaccinated animals.Similar lung histopathological inflammation scores ranging from minimal-mild to mild-moderate have been reported in samples analyzed 7 or 8 days after challenge in rhesus macaques receiving other vaccine candidates [Corbett, KS, et al., Evaluation of the mRNA-1273 Vaccine against SARS-CoV-2 in Nonhuman Primates. New England Journal of Medicine, 2020. 383(16):p.1544-1555]. Currently, VED remains a theoretical concern with SARS-CoV-2 vaccination, and attempts to induce enhanced disease using formalin-inactivated whole virus preparations of SARS-CoV-2 have failed to reproduce the lung pathology previously reported for other inactivated respiratory viral vaccines [Bewley, KR, et al., Immunological and pathological outcomes of SARS-CoV-2 challenge after formalin-inactivated vaccine immunization of ferrets and rhesus macaques. 2020: p. 2020.12.21.423746].

[0306] This data complements the NHP SARS-CoV-2 challenge study that demonstrated a drop in LRT viral load several months after immunization with INO-4800 (Example 9). However, there are clear differences between the studies, including the different doses and variants used in the challenge stock, as well as the timing of the challenge. In the study described in this example, animals were challenged 4 weeks after the last vaccination, at a time when high levels of circulating neutralizing antibodies were present. In other studies, the levels of serum SARS-CoV-2 neutralizing antibodies were low at the time of challenge, and protection appeared to depend on the recall of a memory response, with strong humoral and cellular responses to the SARS-CoV-2 spike antigen detected in the animals. Here, anamnestic responses of similar magnitude were not observed, suggesting that protection may have been mediated by antibodies present in the circulation at the time of challenge, supported by the correlation between SARS-CoV-2-targeting antibody levels in serum and the drop in viral load (Figure 15).

[0307] In conclusion, our results in a rigorous preclinical SARS-CoV-2 animal model provide further support for the efficacy and safety of the DNA vaccine INO-4800 as a preventative measure against COVID-19. Importantly, when tested as a single-dose immunization, we observed a positive impact on lung disease burden and no VED. Taken together with INO-4800's clinical data, INO-4800 has many attributes in terms of safety, efficacy, and logistical feasibility due to its high stability, negating the need for challenges of cold chain distribution requirements for global access. Furthermore, synthetic DNA vaccine technology is amenable to highly accelerated development timelines, allowing for the rapid design and testing of candidates against new SARS-CoV-2 variants that exhibit potential immune evasion [Wibmer, CK, et al., SARS-CoV-2 501Y.V2 escapes neutralization by South African COVID-19 donor plasma. 2021:p.2021.01.18.427166.; Moore, JPand PAOffit, SARS-CoV-2 Vaccines and the Growing Threat of Viral Variants. JAMA, 2021.].

[0308] Example 9 SARS-COV-2 DNA vaccine induces humoral and cellular immunity resulting in a memory response that provides anamnestic protection upon challenge in rhesus macaques The immunogenicity of a synthetic DNA vaccine encoding the SARS-CoV-2 spike protein was previously demonstrated in both mice and guinea pigs (Example 1). In this example, the durability of INO-4800-induced immune responses in rhesus macaques is demonstrated. ID-EP administration in rhesus macaques induces cellular and humoral responses to the SARS-CoV-2 S protein, with additional cross-reactivity to the SARS-CoV-1 S protein. Protective effects are demonstrated for longer than 3 months after the final immunization, demonstrating the establishment of anamnestic immune responses and reduced viral loads in vaccinated macaques. Following viral challenge, a reduction in subgenomic messenger RNA (sgmRNA) BAL viral load was observed compared to control animals administered 1 mg (one-fifth the DNA dose) via intradermal (ID) delivery. This was associated with the induction of rapid recall responses in both the cellular and humoral immune arms, supporting the potential of the INO-4800 candidate against moderate disease. No adverse events or evidence of vaccine-enhanced disease (VED) were observed in animals in the vaccine group. Reductions in viral subgenomic RNA load in the lower lung and lower VL were observed. A trend toward reduced VL was observed in the nose. These data support that immunization with this DNA vaccine candidate has the potential to limit active viral replication, reduce disease severity, and reduce viral shedding in the nasal cavity.

[0309] The initial viral load detected in control animals in this study was comparable to that in similar published studies carried out under identical conditions (approximately 10 7 PFU / swab) (Yu et al., 2020, Science, eabc6284) was on average 1-2 logs higher (10 9It is important to note that the number of PFU / swab was 100%. Only two of the previously reported NHP studies included intranasal delivery as the inoculation route for challenge (van Doremalen et al., 2020, bioRxiv 2020.05.13.093195; Yu et al., 2020, Science, eabc6284). Although high-dose challenge inoculations are frequently utilized to ensure infection, non-lethal systems such as this SARS-CoV-2 rhesus macaque model can artificially reduce the impact of potential protective vaccines and interventions (Durudas et al., 2011, Curr HIV Res 9, 276-288; Innis et al., 2019, Vaccine 37, 4830-4834). Despite these limitations, this study demonstrated a significant reduction in peak BAL sgmRNA and overall viral RNA, likely induced by the rapid induction of immune memory mediated by both the B and T cell compartments. Wolfel et al. found a mean of 6.5 × 10 5 reported nasal titers in copies / swab (Wolfel et al., 2020, Nature 581, 465-469). These titers are significantly lower than the challenge dose and supportive potential for early control of vaccine candidates during SARS-CoV-2 infection.

[0310] This study indicates that DNA vaccination with vaccine candidates targeting the full-length SARS-CoV-2 spike protein is likely to increase the availability of T cell immunodominant epitopes that result in broader and stronger immune responses compared to partial domain and truncated immunogens. In this study, T cell cross-reactivity was observed against SARS-CoV-1.

[0311] In addition to T cells, INO-4800 induced durable antibody responses that rapidly increased after SARS-CoV-2 challenge. It is further demonstrated that INO-4800 induced robust neutralizing antibody responses against both D614 and G614 SARS-CoV-2 variants. Although the D / G 614 site is outside the RBD, it has been suggested that this shift may affect vaccine-induced antibodies (Korber B et al., 2020, Cell 182:1-16). Other studies have reported that the G614 variant exhibits increased SARS-CoV-2 infectivity (Hu et al., 2020, bioRxiv 2020.06.20.161323, Ozono S, 2020, bioRxiv 2020.06.15.151779). The data show induction of comparable neutralizing titers between the D614 and G614 variants, indicating that these responses are similarly recalled following SARS-CoV-2 challenge.

[0312] material and method Non-human primate immunization, IFNγ ELISpot and ELISA DNA Vaccine, INO-4800: A highly optimized DNA sequence encoding the SARS-CoV-2 IgE-spike was generated using Inovio's proprietary in silico gene optimization algorithm to enhance expression and immunogenicity (Smith et al., 2020, Nat Commun 11, 2601). The optimized DNA sequence was synthesized, digested with BamHI and XhoI, and cloned into the expression vector pGX0001 under the control of the human cytomegalovirus immediate early promoter and bovine growth hormone polyadenylation signal.

[0313] Animals: All rhesus macaque experiments were approved by the Institutional Animal Care and Use Committee at Bioqual (Rockville, Maryland), an Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC) International accredited facility. Blood was collected for blood chemistry, PBMC isolation, and serological analyses. BAL was collected at week 8 to assay lung antibody levels and at days 1, 2, 4, and 7 postchallenge to assay lung viral load.

[0314] Immunization, sample collection, and virus challenge. Ten Chinese rhesus macaques (ranging from 4.55 kg to 5.55 kg) were randomly assigned to the immunization trial (three males and two females) or naïve (two males and three females). Immunized macaques received two 1 mg injections of the SARS-CoV-2 DNA vaccine, INO-4800, at weeks 0 and 4 by ID-EP administration using a CELLECTRA 2000® adaptive constant current electroporation device (Inovio Pharmaceuticals) with a 3P array. Blood was collected at the indicated time points to analyze blood chemistry, peripheral blood mononuclear cell (PBMC) isolation, and serum was collected for serological analysis. Bronchoalveolar lavage was collected at week 8 to assay lung antibody levels. BAL from naïve animals was used as a control. At week 17, all animals were immunized with 1.2 × 10 8 VP(1.1×10 4 The mice were challenged with 100 PFU of SARS-CoV-2. Virus was administered as 1 ml by the intranasal (IN) route (0.5 ml in each nostril) and 1 ml by the intratracheal (IT) route.

[0315] Peripheral blood mononuclear cell isolation. Blood was collected from each macaque into sodium citrate cell preparation tubes (CPT, BD Biosciences). Tubes were centrifuged to separate plasma and lymphocytes according to the manufacturer's protocol. Samples were transported by same-day shipping on cold packs from Bioqual to The Wistar Institute for PBMC isolation. PBMCs were washed and residual red blood cells were removed using ammonium chloride-potassium (ACK) lysis buffer. Cells were counted using a ViCell counter (Beckman Coulter) and resuspended in RPMI 1640 (Corning) supplemented with 10% fetal bovine serum (Atlas), and 1% penicillin / streptomycin (Gibco). Fresh cells were then plated for IFNγ ELISpot assays and flow cytometry.

[0316] IFN-γ Enzyme-Linked Immunospot (ELISpot). Monkey interferon gamma (IFN-γ) ELISpot assays were performed to detect cellular responses. Monkey IFN-γ ELISpotPro (alkaline phosphatase) plates (Mabtech, Sweeden, catalog no. 3421M-2APW-10) were blocked for a minimum of 2 h with RPMI 1640 (Corning) supplemented with 10% FBS and 1% penn / strep (R10). After PBMC isolation, 200000 cells from macaques were added to each well in the presence of 1) overlapping peptide pools (15mers with 9mer overlaps) corresponding to SARS-CoV-1, SARS-CoV-2, or MERS-CoV spike proteins (5 μg / mL / well final concentration), 2) R10 with DMSO (negative control), or 3) anti-CD3 positive control (Mabtech, 1:1000 dilution). All samples were plated in triplicate. Plates were incubated overnight at 37°C, 5% CO2. After 18-20 hours, plates were washed in PBS and spots were developed according to the manufacturer's protocol. Spots were imaged using a CTL Immunospot plate reader and antigen-specific responses were determined by subtracting the number of spots in R10+DMSO negative control wells from wells stimulated with peptide pools.

[0317] Antigen-binding ELISA. Serum and BAL were collected at each time point and assessed for binding titers as indicated. 96-well immunosorbent plates (NUNC) were coated with recombinant SARS-CoV-2 S1+S2 ECD protein (Sino Biological 40589-V08B1), S1 protein (Sino Biological 40591-V08H), S2 protein (Sino Biological 40590-V08B), or receptor binding domain (RBD) protein (Sino Biological 40595-V05H) at 1ug / mL in DPBS overnight at 4°C. ELISA plates were also coated with recombinant SARS-CoV S1 protein (Sino Biological 40150-V08B1) and RBD protein (Sino Biological 40592-V08B) or MERS-CoV spike (Sino Biological 40069-V08B) at 1ug / mL. Plates were washed 4 times with PBS + 0.05% Tween® 20 (PBS-T) and blocked with 5% nonfat dry milk in PBS-T (5% SM) for 90 min at 37°C. Sera or BAL from macaques vaccinated with INO-4800 were serially diluted in 5% SM and added to the washed ELISA plates and incubated for 1 h at 37°C. After incubation, plates were washed 4 times with PBS-T and anti-monkey IgG conjugated to horseradish peroxidase (Southern Biotech 4700-5). Plates were washed 4 times with PBS-T and one-step TMB solution (Sigma) was added to the plates. The reaction was stopped with an equal volume of 2N sulfuric acid. Plates were read at 450 nm and 570 nm within 30 min of development using a Biotek Synergy2 plate reader.

[0318] ACE2 Competitive ELISA-Non-Human Primates. 96-well half-area plates (Corning) were coated with 1 μg / mL PolyRab anti-His antibody (ThermoFisher, PA1-983B) for 3 hours at room temperature, then blocked overnight with blocking buffer containing 1×PBS, 5% nonfat dry milk, 1% FBS, and 0.2% Tween®-20. Plates were then incubated with 10 μg / mL His6x-tagged SARS-CoV-2 ("His6x" disclosed as SEQ ID NO:25), S1+S2 ECD (Sinobiological, 40589-V08B1) for 1-2 hours at room temperature. NHP serum (day 0 or week 6) was serially diluted 3-fold in 1×PBS containing 1% FBS and 0.2% Tween® and premixed with huACE2-IgMu at a fixed concentration of 0.4ug / ml. The premix was then added to the plate and incubated for 1-2 h at room temperature. The plate was further incubated with goat anti-mouse IgG H+L HRP (A90-116P, Bethyl Laboratories) at a 1:20,000 dilution for 1 h at room temperature, followed by the addition of 1-step TMB super substrate (ThermoFisher) and then quenching with 1 M H2SO4. The absorbance at 450 nm and 570 nm was recorded on a BioTEK plate reader.

[0319] Flow cytometry-based ACE2 receptor binding inhibition assay. HEK-293T cells stably expressing ACE2-GFP were generated using retroviral transduction. After transduction, cells were flow sorted based on GFP expression to isolate GFP-positive cells. Single cell cloning was performed on these cells to generate cell lines with comparable expression of ACE2-GFP. To detect inhibition of spike binding to ACE2, S1+S2 ECD-his tag (Sino Biological, Cat. No. 40589-V08B1) was incubated with serum collected from vaccinated animals at the indicated time points and dilutions at a concentration of 2.5 μg / ml on ice for 60 minutes. This mixture was then transferred to 150,000 293T-ACE2-GFP cells and incubated on ice for 90 minutes. After this, cells were washed twice with PBS and subsequently stained for surelight® APC-conjugated anti-his antibody (Abcam, ab72579) on ice for 30 minutes. As a positive control, spike protein was preincubated with recombinant human ACE2 and then transferred into 293T-Ace2-GFP cells. Data were acquired using a BD LSRII and analyzed by FlowJo (version 10).

[0320] Pseudovirus neutralization assay. SARS-CoV-2 pseudovirus was generated using HEK293T cells transfected with GeneJammer (Agilent) using IgE-SARS-CoV-2 S plasmid (Genscript) and pNL4-3.Luc.RE-plasmid (NIH AIDS Reagent) at a 1:1 ratio. 48 hours after transfection, transfection supernatants were harvested, concentrated with FBS to a final volume of 12%, sterile filtered (Millipore Sigma), and aliquoted for storage at -80°C. SARS-Cov-2 pseudovirus neutralization assays were set up using D10 medium (DMEM supplemented with 10% FBS and 1x penicillin-streptomycin) in a 96-well format. CHO cells stably expressing Ace2 were used as target cells (Creative Biolabs, catalog no. VCeL-Wyb019). SARS-Cov-2 pseudovirus was titrated to obtain >20-fold relative luminescence units (RLU) over cells alone control 72 hours after infection. To set up the neutralization assay, 10,000 CHO-ACE2 cells were plated in 96-well plates in 100ul D10 medium and rested at 37°C overnight and 5% CO2 for 24 hours. The next day, monkey and rabbit sera from INO-4800 vaccinated and control groups were heat inactivated and serially diluted as desired. Serum was incubated with a fixed amount of SARS-Cov-2 pseudovirus for 90 minutes at room temperature. 50ul medium was removed from the wells containing plated CHO-Ace2 cells. After 90 minutes, the mixture was added to plated CHO-Ace2 cells and incubated for 72 hours in a standard incubator (37% humidity, 5% CO2). After 72 hours, cells were lysed using the britelite plus luminescent reporter gene assay system (Perkin Elmer catalog number 6066769) and RLU was measured using a Biotek plate reader. Neutralization titers (ID50) were calculated using GraphPad Prism 8 and were defined as the reciprocal serum dilution that resulted in a 50% reduction in RLU compared to the RLU in virus control wells after subtraction of background RLU in cell control wells.

[0321] Viral RNA Assay. RT-PCR assays were utilized to monitor viral load essentially as previously described (Abnink P et al 2019 Science). Briefly, RNA was extracted from bronchoalveolar lavage (BAL) supernatants and nasal swabs using a QIAcube HT (Qiagen, Germany) and Cador pathogen HT kit. RNA was reverse transcribed using superscript VILO (Invitrogen) and run in duplicate using a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer's specifications. Viral load was calculated as viral RNA copies per mL or per swab, with an assay sensitivity of 50 copies. The target for amplification was the SARS-CoV2 N (nucleocapsid) gene. Primers and probes for the targets were as follows: 2019-nCoV_N1-F: 5'-GACCCCAAAATCAGCGAAAT-3' (sequence number 18); 2019-nCoV_N1-R: 5'-TCTGGTTACTGCCAGTTGAATCTG-3' (sequence number 19); 2019-nCoV_N1-P: 5'-FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1-3' (sequence number 20).

[0322] Subgenomic mRNA assay. SARS-CoV-2 E gene subgenomic mRNA (sgmRNA) was assessed by RT-PCR using an approach similar to that previously described (Wolfel R et al. 2020, Nature, 581, 465-469). To generate a standard curve, SARS-CoV-2 E gene sgmRNA was cloned into a pcDNA3.1 expression plasmid and the insert was transcribed using the AmpliCap-Max T7 High Yield Message Maker Kit (Cellscript) to obtain RNA for the standards. Prior to RT-PCR, samples taken from challenged animals or standards were reverse transcribed using Superscript III VILO (Invitrogen) according to the manufacturer's instructions. A Taqman custom gene expression assay (ThermoFisher Scientific) was designed using a sequence targeting the E gene sgmRNA (18). Reactions were performed on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer's specifications. A standard curve was used to calculate sg mRNA in copies per ml or per swab, with a quantitative assay sensitivity of 50 copies per ml or per swab.

[0323] result Induction of memory humoral and cellular immune responses in INO-4800-immunized non-human primates. Non-human primates (NHPs) are valuable models in the development of COVID-19 vaccines and therapeutics because they can be infected with wild-type SARS-CoV-2 and exhibit pathology similar to humans (Chandrashekar et al., 2020, Science, eabc4776; Qin et al., 2005, J Pathol 206, 251-259; Yao et al., 2014, J Infect Dis 209, 236-242; Yu et al., 2020, Science, eabc6284). Rhesus macaques (n=5) received two immunizations of INO-4800 (1 mg), at weeks 0 and 4 (Figure 33A). Naive control animals (n=5) did not receive the vaccine. Humoral and cellular immune responses were monitored for 15 weeks (approximately 4 months) after prime immunization for ...

Claims

1. 1. A nucleic acid molecule encoding a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) spike antigen, the nucleic acid molecule comprising: A nucleic acid sequence having at least about 90% identity over the entire length of the nucleic acid sequence set forth in nucleotides 55 to 3837 of SEQ ID NO:2; A nucleic acid sequence having at least about 90% identity over the entire length of SEQ ID NO:2; The nucleic acid sequence of nucleotides 55 to 3837 of SEQ ID NO:2, the nucleic acid sequence of SEQ ID NO:2, A nucleic acid sequence having at least about 90% identity over the entire length of SEQ ID NO:3; The nucleic acid sequence of SEQ ID NO:3, A nucleic acid sequence having at least about 90% identity over the entire length of nucleotides 55 to 3837 of SEQ ID NO:5; A nucleic acid sequence having at least about 90% identity over the entire length of SEQ ID NO:5; The nucleic acid sequence of nucleotides 55 to 3837 of SEQ ID NO:5, the nucleic acid sequence of SEQ ID NO:5, A nucleic acid sequence having at least about 90% identity over the entire length of SEQ ID NO:6, or A nucleic acid molecule comprising the nucleic acid sequence of SEQ ID NO:

6.

2. An expression vector comprising the nucleic acid molecule of claim 1.

3. An immunogenic composition comprising an effective amount of the expression vector of claim 2 and a pharma- ceutically acceptable excipient.

4. The immunogenic composition of claim 3, wherein the pharma- ceutically acceptable excipient comprises a buffer, optionally a saline-sodium citrate buffer.

5. 5. The immunogenic composition of claim 4, wherein the composition comprises 10 mg of the vector per milliliter of saline-sodium citrate buffer.

6. The immunogenic composition according to any one of claims 3 to 5, further comprising an adjuvant.

7. 10. A method of inducing an immune response against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in a subject in need thereof, said method comprising administering to said subject an effective amount of the immunogenic composition of any one of claims 3 to 6.

8. 11. A method of protecting a subject in need thereof from infection by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), said method comprising administering to said subject an effective amount of the immunogenic composition of any one of claims 3 to 6.

9. 11. A method of treating a subject in need of treatment for severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection, the method comprising administering to the subject an effective amount of the immunogenic composition of any one of claims 3-6, whereby the subject is resistant to one or more SARS-CoV-2 strains.

10. The method of any one of claims 7 to 9, wherein administering comprises at least one of electroporation and injection.

11. The method of any one of claims 7 to 9, wherein administering comprises parenteral administration followed by electroporation.

12. 12. The method of any one of claims 7 to 11, wherein an initial dose of about 0.5 mg to about 2.0 mg of the vector is administered to the subject, optionally wherein the initial dose is 0.5 mg, 1.0 mg or 2.0 mg of the vector.

13. 13. The method of claim 12, wherein a subsequent dose of about 0.5 mg to about 2.0 mg of the vector is administered to the subject about 4 weeks after the initial dose, optionally wherein the subsequent dose is 0.5 mg, 1.0 mg or 2.0 mg of the vector.

14. 14. The method of claim 13, wherein one or more further subsequent doses of about 0.5 mg to about 2.0 mg of the vector are administered to the subject at least 12 weeks after the initial dose, optionally wherein the further subsequent doses are 0.5 mg, 1.0 mg, or 2.0 mg of the vector.

15. The method of any one of claims 7 to 14, wherein the immunogenic composition is INO-4800 or a biosimilar thereof.

16. 16. The method of any one of claims 7 to 15, further comprising administering to the subject at least one additional agent for the treatment of SARS-CoV-2 infection or the treatment or prevention of a disease or disorder associated with SARS-CoV-2 infection.

17. 17. The method of claim 16, wherein the immunogenic composition is administered to the subject before, simultaneously with, or after the additional agent.

18. Use of the immunogenic composition of any one of claims 3 to 6 in a method for inducing an immune response against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) in a subject in need thereof.

19. 13. Use of the immunogenic composition of any one of claims 3 to 6 in a method for protecting a subject from infection with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).

20. 13. Use of the immunogenic composition of any one of claims 3 to 6 in a method for treating a subject in need thereof against a severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection.

21. The use according to any one of claims 18 to 20 in combination with at least one additional agent for the treatment of a SARS-CoV-2 infection or the treatment or prevention of a disease or disorder associated with a SARS-CoV-2 infection.

22. The use according to any one of claims 18 to 21, wherein the immunogenic composition is administered to the subject by at least one of electroporation and injection.

23. The use according to claim 22, wherein the immunogenic composition is administered parenterally to the subject, followed by electroporation.

24. 24. The use of any one of claims 18 to 23, wherein an initial dose of about 0.5 mg to about 2.0 mg of the vector is administered to the subject, optionally wherein the initial dose is 0.5 mg, 1.0 mg, or 2.0 mg of the vector.

25. 25. The use of claim 24, wherein a subsequent dose of about 0.5 mg to about 2.0 mg of the vector is administered to the subject about 4 weeks after the initial dose, optionally wherein the subsequent dose is 0.5 mg, 1.0 mg, or 2.0 mg of the vector.

26. 26. The use of claim 25, wherein a further subsequent dose of about 0.5 mg to about 2.0 mg of the vector is administered to the subject at least 12 weeks after the initial dose, optionally wherein the further subsequent dose is 0.5 mg, 1.0 mg, or 2.0 mg of the vector.

27. The use according to any one of claims 18 to 26, wherein the immunogenic composition is INO-4800 or a biosimilar thereof.

28. Use of the vector according to claim 2 in the preparation of a medicament.

29. 3. Use of the vector of claim 2 in the preparation of a medicament for treating or protecting against infection by Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2).

30. 1. A method for detecting a sustained cellular immune response in a subject, the method comprising: administering to a subject in need thereof an immunogenic composition for inducing an immune response against a SARS-CoV-2 antigen; isolating peripheral blood mononuclear cells (PBMCs) from the subject; stimulating the isolated PBMCs with a SARS-CoV-2 spike antigen comprising an amino acid sequence selected from the group consisting of an amino acid sequence having at least about 90% identity over the entire length of residues 19-1279 of SEQ ID NO:1, an amino acid sequence set forth in residues 19-1279 of SEQ ID NO:1, an amino acid sequence having at least about 90% identity over the entire length of SEQ ID NO:1, said amino acid sequence of SEQ ID NO:1, an amino acid sequence having at least about 90% identity over the entire length of residues 19-1279 of SEQ ID NO:4, an amino acid sequence having at least about 90% identity over the entire length of SEQ ID NO:4, an amino acid sequence set forth in residues 19-1279 of SEQ ID NO:4, an amino acid sequence of SEQ ID NO:4, and fragments thereof comprising at least 20 amino acids; detecting at least one of the number of cytokine-expressing cells and the level of cytokine expression.

31. 31. The method of claim 30, wherein the step of detecting at least one of the number of cytokine-expressing cells and the level of cytokine expression is carried out using an assay selected from the group consisting of enzyme-linked immunospot (ELISpot) and intracellular cytokine staining (ICS) analysis using flow cytometry.

32. The subject is administered an immunogenic composition comprising a nucleic acid molecule, the nucleic acid molecule comprising: A nucleic acid sequence having at least about 90% identity over the entire length of the nucleic acid sequence set forth in nucleotides 55 to 3837 of SEQ ID NO:2; A nucleic acid sequence having at least about 90% identity over the entire length of SEQ ID NO:2; The nucleic acid sequence of nucleotides 55 to 3837 of SEQ ID NO:2, the nucleic acid sequence of SEQ ID NO:2, A nucleic acid sequence having at least about 90% identity over the entire length of SEQ ID NO:3; The nucleic acid sequence of SEQ ID NO:3, A nucleic acid sequence having at least about 90% identity over the entire length of nucleotides 55 to 3837 of SEQ ID NO:5; A nucleic acid sequence having at least about 90% identity over the entire length of SEQ ID NO:5; The nucleic acid sequence of nucleotides 55 to 3837 of SEQ ID NO:5, the nucleic acid sequence of SEQ ID NO:5, A nucleic acid sequence having at least about 90% identity over the entire length of SEQ ID NO:6, and 31. The method of claim 30, comprising a nucleotide sequence selected from the group consisting of the nucleic acid sequence of SEQ ID NO:6.