Synthetic oncolytic lnp-replicon RNA and uses for cancer immunotherapy

Abstract

To provide: a synthetic oncolytic virus which, upon injection at a tumor site, triggers anti-cancer immune response of local tumors and enables systemic immunity against distal tumors; a pharmaceutical composition comprising the virus; and a method of producing the pharmaceutical composition.SOLUTION: The present disclosure provides synthetic oncolytic viruses comprising a lipid nanoparticle comprising one or more types of lipid and a self-amplifying replicon RNA comprising a sequence that encodes an interleukin (IL)-12 molecule. The lipid nanoparticle is capable of triggering immunogenic cell death. The IL-12 molecule is expressed by the self-amplifying replicon RNA.SELECTED DRAWING: Figure 1

Description

[Technical field]

[0001] Related Applications This application claims priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application No. 62 / 815,611, filed March 8, 2019, the entire contents of which are incorporated herein by reference. [Background technology]

[0002] background The present disclosure relates to lipid nanoparticles comprising one or more types of lipids and synthetic oncolytic viruses comprising a self-amplifying replicon RNA that includes a sequence encoding an immunomodulatory molecule. Summary of the Invention

[0003] overview The present disclosure is based, at least in part, on the unexpected discovery that synthetic oncolytic viruses, upon injection at the tumor site, successfully elicit a local tumor anti-cancer immune response and enable systemic immunity against peripheral tumors. Accordingly, one aspect of the present disclosure provides a synthetic oncolytic virus comprising a lipid nanoparticle comprising one or more types of lipids and a self-amplifying replicon RNA comprising a sequence encoding an interleukin (IL)-12 molecule. The lipid nanoparticle can induce immunogenic cell death. The IL-12 molecule is expressed by the self-amplifying replicon RNA.

[0004] The synthetic oncolytic virus comprises a lipid nanoparticle. The lipid nanoparticle comprises one or more types of lipid. In some embodiments, the one or more types of lipid comprises a cationic lipid. In some embodiments, the cationic lipid is N1,N3,N5-tris(3-(didodecylamino)propyl)benzene-1,3,5-tricarboxamide (TT3). In some embodiments, the lipid nanoparticle comprises TT3, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, and C14-PEG2000. Additionally, the synthetic oncolytic virus comprises a self-amplifying replicon RNA. In some embodiments, the self-amplicon RNA is derived from an alphavirus or other Group IV virus (a positive single-stranded RNA virus, such as Hepatitis C virus (HCV)). In some embodiments, the alphavirus can be Venezuelan equine encephalitis virus, Semliki Forest virus, or Sindbis virus.

[0005] In some embodiments, the self-amplifying replicon RNA comprises a sequence encoding an IL-12 molecule. In some embodiments, the sequence encoding an IL-12 molecule is located in a subgenomic region of the self-amplifying replicon RNA. In some embodiments, the self-amplifying replicon RNA comprises a nucleotide sequence that is at least 90% identical to a wild-type (WT) replicon RNA having the sequence of SEQ ID NO: 1. In some embodiments, the self-amplifying replicon RNA is not identical to SEQ ID NO: 1 and is capable of expressing an IL-12 molecule at a higher level compared to a self-amplifying replicon RNA that comprises SEQ ID NO: 1. In some embodiments, the replicon RNA that is capable of expressing an IL-12 molecule at a higher level comprises the point mutations G3936C and / or A4758G of SEQ ID NO: 1.

[0006] In some embodiments, the self-amplifying replicon RNA further comprises a serum albumin coding sequence. In some embodiments, the self-amplifying replicon RNA further comprises a lumican coding sequence. In some aspects, the self-amplifying replicon RNA comprises a sequence encoding an IL-12 molecule. In some embodiments, the IL-12 molecule is selected from the group consisting of IL-12, IL-12 subunits, or mutant IL-12 molecules that retain immunomodulatory functions. In some further embodiments, the IL-12 molecule comprises IL12α and / or IL12β subunits.

[0007] In some embodiments, the lipid nanoparticles have a diameter of about 100-120 nm, hi some embodiments, the lipid nanoparticles have a zeta potential of about 3-6 mv. In some embodiments, the lipid and the self-amplifying replicon RNA have a mass ratio of about 1:2 to 2:1.

[0008] The present disclosure relates, at least in part, to a pharmaceutical composition comprising a synthetic oncolytic virus and a pharma- ceutically acceptable carrier. In some embodiments, the pharmaceutical composition is formulated for intratumoral injection.

[0009] The present disclosure relates, at least in part, to a method for treating cancer in a subject in need thereof comprising administering to the subject an effective amount of any synthetic oncolytic virus or a pharmaceutical composition containing a synthetic oncolytic virus. In some embodiments, the subject is a human patient having or suspected of having cancer. Exemplary target cancers include, but are not limited to, melanoma, breast cancer, and colon cancer. In some embodiments, the pharmaceutical composition is administered to the subject in a single dose. In some embodiments, the pharmaceutical composition is administered to the subject by intratumoral injection.

[0010] Also within the scope of the disclosure are pharmaceutical compositions containing any of the synthetic oncolytic viruses described herein for use in the treatment of any of the target diseases disclosed herein (e.g., cancer), as well as pharmaceutical compositions comprising synthetic oncolytic oligonucleotides for use in the manufacture of medicaments for the treatment of cancer. The details of one or more embodiments of the invention are set forth in the following description. Other features or advantages of the invention will also be apparent from the following drawings and detailed description of certain embodiments, and from the appended claims. [Brief description of the drawings]

[0011] BRIEF DESCRIPTION OF THE DRAWINGS [Figure 1]Figures 1A-1H are charts showing the effects of B16F10 cells transfected with DOTAP, lipofectamine (Lipo), TT3 nanoparticles (TT3), mutant replicon RNA (RNA), DOTAP, Lipo, and TT3 nanoparticles encapsulating mutant replicon RNA (DOTAP-mtRep, Lipo-mtRep, and TT3-mtRep), electroporation (Electro), and electroporation with mutant replicon RNA (Electro-mtRep). Figure 1A is a graph showing the viability of B16F10 cells 3 days after transfection. Figure 1B is a graph showing GFP expression in B16F10 cells transfected with lipid nanoparticles encapsulated with mutant or inactive (dead) replicon RNA (deRep). Figure 1C is a graph showing the percentage of B16F10 dead cells transfected with PI+Annexin V+ transfected lipid nanoparticles or lipid nanoparticles encapsulated with replicon RNA. Immunogenic cell death induced by lipid nanoparticles or lipid nanoparticles encapsulated with replicon RNA was shown by the percentage of calreticulin+ (CRT+) cells (Figure 1D), extracellular ATP (Figure 1E) and HMGB1 release (Figure 1F). Figure 1G shows the diameter of lipid nanoparticles and lipid nanoparticles loaded with mutant replicon RNA. Figure 1H shows the zeta potential of lipid nanoparticles and lipid nanoparticles loaded with mutant replicon RNA.

[0012] [Diagram 2] Figures 2A-2J are charts showing that mtRep and deRep trigger TLR3 signaling and induce ISGF3 complexes into necrotic cell death. LNP-replicon RNA triggers TLR3 signaling (Figures 2B and 2E) and activates expression of interferon-stimulated genes Stat1, Stat2, IRF9, IRF3, and cGAS (Figures 2F-2J), but does not activate TLR2 (Figure 2A), TLR7 (Figure 2C), or TLR9 (Figure 2D).

[0013] [Diagram 3] Figures 3A-3K are charts showing that TT3-mtRep recruits immune cells and abolishes tumor growth. Figure 3A shows that mtRep recruits more Ly6cloLy6G+ granulocytes at day 3 after injection. Figure 3B shows the percentage of mCherry+ cells in CD45+ and CD45- cells at day 3 after injection in tumors injected with TT3-mtRep. Figure 3C shows the expression of ISGF3 complex (Stat1 / Stat2 / IRF9) as well as IRF3 and cGAS at day 1 after injection of TT3-mtRep. Figures 3D-3F show immune cell infiltration (granulocytes, M-MDSC, monocytes, macrophages, CD4 T, CD8 T, NK, NKT, conventional DC1 (cDC1), and conventional DC2 (cDC2)) into tumors 1 day after injection of TT3-mtRep (Figure 3D), 3 days after injection (Figure 3E), and 1 day after injection of three sequential injections (Figure 3F). Figures 3G-3H show that TT3-mtRep induces more cell death (Figure 3G), more immune cell infiltration (Figure 3H), reduced tumor weight (Figure 3I), tumor area (Figure 3J), and increased expression of CCL5 (Figure 3K) 1 day after three sequential injections of TT3-mtRep.

[0014] [Figure 4]Figures 4A-4G are charts showing that TT3-mtRep encoding IL12-MSA or IL12-MSA-lumican effectively regulates the tumor microenvironment and immune cell infiltration. Figures 4A and 4B show quantification of IFNα2 by ELISA in tumors (Figure 4A) and serum (Figure 4B) at days 1 and 3 after injection of TT3-mtRep. Figure 4C shows that B16F10 cells transfected with mtRep-IL12-MSA and mtRep-IL12-MSA-lumican can produce IL-12. Figure 4D shows IL-12 levels in tumors at days 1 and 3 after a single injection of TT3-mtRep, TT3-mtRep-IL12-MSA, or TT3-mtRep-IL12-MSA-lumican. Figures 4E-4F show immune cell infiltration in tumors at 1 (Figure 4E) and 3 (Figure 4F) days after injection of a single injection of TT3-mtRep, TT3-mtRep-IL12-MSA, or TT3-mtRep-IL12-MSA-lumican. Figure 4G shows the number of conventional DC1 (cDC1) in tumor-draining lymph nodes at 1 and 3 days after injection of a single injection of TT3-mtRep, TT3-mtRep-IL12-MSA, or TT3-mtRep-IL12-MSA-lumican.

[0015] [Diagram 5] Figures 5A-5E are charts showing the in vivo synergistic anti-cancer effect of immunomodulatory IL12 and TT3-mtRep-induced immunogenic cell death. The synergistic anti-cancer effect was evaluated by changes in body weight (Figure 5A), IFNr in serum (Figure 5B), tumor area (Figure 5C), and survival curve (Figure 5D). Figure 5E shows that TT3-mtRep-IL12 treatment can prevent tumor recurrence in treated mice.

[0016] Detailed Description The present disclosure is based, at least in part, on the unexpected discovery that lipid nanoparticles comprising one or more types of lipids and a synthetic oncolytic virus comprising a self-amplifying replicon RNA comprising a sequence encoding an IL-12 molecule, upon injection at a tumor site, successfully elicit a local tumor anti-cancer immune response and enable systemic immunity against peripheral tumors.

[0017] I. Synthetic Oncolytic Viruses The present disclosure relates, at least in part, to synthetic oncolytic viruses.As used herein, the term "synthetic" refers to non-natural or modified oncolytic viruses as disclosed herein, which include lipid nanoparticles and self-amplifying replicon RNAs that contain sequences encoding IL-12 molecules. In some aspects, the present disclosure relates to the use of lipid nanoparticles (LNPs), which themselves can induce immunogenic cell death, to facilitate the delivery of biologically active agents (e.g., self-amplifying replicon RNA encoding an IL-12 molecule) into tumor cells.

[0018] (i) Lipid nanoparticles The present disclosure relates, at least in part, to the delivery of biologically active molecules to cells using lipid nanoparticles.Specifically, the present invention relates to a synthetic oncolytic virus comprising a self-amplifying replicon RNA expressing IL-12 encapsulated by lipid nanoparticles, compositions thereof, and methods of using the synthetic oncolytic virus and compositions thereof to treat subjects with or suspected of having cancer. As used herein, lipid nanoparticles (LNPs) refer to vesicles, such as spherical vesicles, that have a continuous lipid bilayer. Lipid nanoparticles can be used in methods by which pharmaceutical therapies are delivered to targeted locations. Non-limiting examples of LNPs include liposomes, bolaamphiphiles, solid lipid nanoparticles (SLNs), nanostructured lipid carriers (NLCs), and unilamellar membrane structures (e.g., archaeosomes and micelles).

[0019] As used herein, lipid nanoparticles include one or more types of lipids. As used herein, lipid refers to a group of organic compounds, including but not limited to esters of fatty acids, and in some embodiments, characterized by being insoluble in water but soluble in many organic solvents. They are usually divided into at least three classes: (1) "simple lipids", including fats and oils and waxes; (2) "compound lipids", including phospholipids and glycolipids; (3) "derived lipids", such as steroids. Non-limiting examples of lipids include triglycerides (e.g., tristearin), diglycerides (e.g., glycerol bahenate), monoglycerides (e.g., glycerol monostearate), fatty acids (e.g., stearic acid), steroids (e.g., cholesterol), and waxes (e.g., cetyl palmitate). In some embodiments, one or more types of lipids in LNPs include cationic lipids.

[0020] As used herein, cationic lipid refers to any of a number of lipid species that carry a net positive charge at a selected pH, such as physiological pH. Such lipids include, but are not limited to, N1,N3,N5-tris(3-(didodecylamino)propyl)benzene-1,3,5-tricarboxamide (TT3), N-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP); lipofectamine; 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLenDMA), dioctadecyldimethylammonium (DODMA), distearyl dimethyl ammonium (DIDMMA ... Ammonium (DSDMA), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC); N-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA); N,N-distearyl-N,N-dimethylammonium bromide (DDAB); 3-(N-(N′,N′-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol) and N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (DMRIE).

[0021] In some embodiments, the cationic lipid is TT3. As used herein, TT3 can form lipid nanoparticles for intracellular delivery of various biologically active agents. In addition, the present disclosure also demonstrates that unloaded TT3-LNP can induce immunogenic cell death (ICD) in cancer cells in vivo and in vitro. As described herein, immunogenic cell death refers to a form of cell death that can induce an effective immune response through activation of dendritic cells (DCs) and the resulting activation of specific T cell responses. In some embodiments, the cells undergoing immunogenic cell death (ICD) are tumor cells. Immunogenic tumor cell death can trigger an effective anti-tumor immune response. In some embodiments, the synthetic oncolytic virus comprises TT3-LNPs that encapsulate a self-amplifying replicon (TT3-LNP-replicon RNA) that only codes for a reporter gene. The self-amplifying replicon RNA can work synergistically with TT3-LNP to induce higher levels of ICD in tumor cells compared to TT3-LNP alone. In other embodiments, synthetic oncolytic virus comprises TT3-LNP that encapsulates self-amplifying replicon RNA that codes for IL-12 molecule.IL-12, an immunomodulatory cytokine, elicits a strong immune response against local tumors.In addition, the combination of TT3-LNP, self-amplifying replicon RNA and IL-12 expression is not only effective in synergistically inhibiting tumor cells in situ, but also elicits systemic anti-tumor immune response, kills peripheral tumor cells, and prevents tumor recurrence.

[0022] In some embodiments, cationic lipid is DOTAP.As used herein, DOTAP can also form lipid nanoparticles.DOTAP can be used for the highly efficient transfection of DNA, including yeast artificial chromosome (YAC) for transient or stable gene expression into eukaryotic cells, and is also suitable for the efficient transfer of other negatively charged molecules, such as RNA, oligonucleotides, nucleotides, ribonucleo-protein (RNP) complexes, and proteins, into mammalian cell research samples.

[0023] In other embodiments, the cationic lipid is lipofectamine. As used herein, lipofectamine is produced and sold by Invitrogen and is a common transfection reagent used in molecular and cell biology. It is used to increase the transfection efficiency of RNA (including mRNA and siRNA) or plasmid DNA into cell cultures in vitro by lipofection. Lipofectamine contains lipid subunits that can form liposomes or lipid nanoparticles that capture transfection payloads, such as self-amplifying replicon RNA, in an aqueous environment. Liposomes containing RNA (their surfaces are positively charged) can fuse with the negatively charged plasma membrane of living cells due to fusion mediated by the neutral co-lipids of the liposomes with the cell membrane, allowing nucleic acid cargo molecules to cross into the cytoplasm for replication or expression.

[0024] In some embodiments, the LNPs are composed primarily of cationic lipids along with other lipid components. These typically include, but are not limited to, other lipid molecules belonging to the phosphatidylcholine (PC) class (e.g., 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), sterols (e.g., cholesterol) and polyethylene glycol (PEG)-lipid conjugates (e.g., 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[folate(polyethylene glycol)-2000 (DSPE-PEG2000) and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000 (C14-PEG2000)). Table 1 shows the formulation of two LNPs, TT3-LNP and DOTAP-LNP. [Table 1]

[0025] The particle size of lipid nanoparticles can affect the release rate of drugs, biodistribution, mucoadhesion, cellular uptake of water and exchange of buffers into the interior of the nanoparticle, and protein diffusion. In some embodiments, the diameter of the LNP ranges from 30 to 150 nm. In some embodiments, the diameter of the LNP ranges from 100 to 120 nm. In some embodiments, the diameter of the LNP can be 30 nm, 40 nm, 50 nm, 60 nm, 70 nm, 80 nm, 90 nm, 100 nm, 101 nm, 102 nm, 103 nm, 104 nm, 105 nm, 106 nm, 107 nm, 108 nm, 109 nm, 110 nm, 111 nm, 112 nm, 113 nm, 114 nm, 115 nm, 116 nm, 117 nm, 118 nm, 119 nm, or 120 nm.

[0026] Zeta potential is a measure of the effective charge on the surface of a lipid nanoparticle. The magnitude of the zeta potential provides information about the stability of the particle. In some embodiments, the zeta potential of the LNP ranges from -10 millivolts (mv) to 25 mv. In some embodiments, the zeta potential of the LNP ranges from 3 to 6 mv. In some embodiments, the zeta potential of the LNPs can be 3mv, 3.1mv, 3.2mv, 3.3mv, 3.4mv, 3.5mv, 3.6mv, 3.7mv, 3.8mv, 3.9mv, 4mv, 4.1mv, 4.2mv, 4.3mv, 4.4mv, 4.5mv, 4.6mv, 4.7mv, 4.8mv, 4.9mv, 5mv, 5.1mv, 5.2mv, 5.3mv, 5.4mv, 5.5mv, 5.6mv, 5.7mv, 5.8mv, 5.9mv, and 6mv.

[0027] The present disclosure relates, at least in part, to encapsulating replicon RNA with lipid nanoparticles. In some embodiments, the mass ratio between LNP and replicon RNA ranges from 1:2 to 2:1. In some embodiments, the mass ratio between LNP and replicon RNA can be 1:2, 1:1.5, 1:1.2, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, and 2:1. In some embodiments, the mass ratio between LNP and replicon RNA can be 1:1.

[0028] (ii) Self-amplifying replicon RNA In the present disclosure, the self-amplifying replicon RNA that encodes IL-12 molecule under the promoter of subgenomic, which is a substitute for the structural protein required for viral replication, is of substantial interest in cancer immunotherapy.As used herein, the term "self-amplifying replicon RNA" refers to a self-amplifying genetic element that comprises RNA that replicates from one replication origin.The terms "replicon RNA" and "self-amplifying replicon RNA" are used interchangeably herein.In some embodiments, the self-amplifying replicon RNA is a viral replicon.

[0029] Viruses are small pathogens that can only replicate inside living host cells (e.g., prokaryotic and eukaryotic cells). Outside living cells, viruses exist as independent particles (e.g., viral particles or virions) that contain genetic material in the form of DNA or RNA (the latter can be single-stranded or double-stranded). Viruses with DNA are referred to as DNA viruses, and viruses with RNA are referred to as RNA viruses. In some cases, viruses contain nucleic acid-associated proteins, and the combination of viral and nucleic acid-associated proteins is referred to as nucleoproteins. In addition to the genetic material, viruses have a single or double protein coat, also known as a capsid, that facilitates attachment of the virus to a receptor of a living host cell during infection and protects the viral genetic material from enzymatic degradation. The combination of nucleoproteins and capsid is referred to as a nucleocapsid. In some cases, viruses have a lipid bilayer envelope interspersed with virally encoded, glycosylated (trans-) membrane-associated proteins. Once a virus infects a living host cell, it depends on the living host cell to provide the machinery for its replication and subsequent propagation. The viral genome codes for several structural and nonstructural regulatory proteins.

[0030] As used herein, the term "subgenome" or "subgenomic" refers to a smaller section of the entire replicon genome. As a result, as used herein, transcription of a subgenome refers to transcription of one or more genes in a replicon genome, rather than all genes that make up the replicon genome. In one embodiment, transcription of a subgenome refers to transcription of a gene of experimental or therapeutic interest, as described elsewhere herein. The term "structural protein" as used in the context of viruses herein refers to proteins that constitute structural components of mature, assembled virus particles or virions. Non-limiting examples of such structural proteins include nucleocapsid core proteins (e.g., gag proteins), enzymes packaged within virus particles (e.g., pol proteins), and membrane components (e.g., env proteins). In contrast, the term "nonstructural protein" as used in the context of viruses herein refers to proteins that do not constitute structural components of virus particles or virions, but are expressed within the host cell. Some of the roles of nonstructural proteins include, but are not limited to, replicon formation, immune regulation, and transactivation of structural protein genes.

[0031] In some embodiments, the self-amplifying replicon RNA is derived from an alphavirus. Distinct in nature from host mRNA, the alphavirus replicon RNA encodes a set of four nonstructural proteins (nsPs1-4) responsible for both genome replication and, when modified to include a gene encoding a nonviral product, such as an IL-12 molecule, providing transcription of such a nonviral product under a subgenomic promoter. Alphaviruses are part of the Group IV Togaviridae family of viruses, possessing a positively oriented, single-stranded RNA genome and characterized by an icosahedral nucleocapsid. Non-limiting examples of other Group IV viruses can be Astroviridae, Caliciviridae, Coronaviridae, Flaviviridae, Picornaviridae, Arteriviridae, and Togaviridae. The alphavirus genus encompasses 26 enveloped viruses that infect eukaryotic organisms. Alphaviruses have a wide host range and are delivered by mosquitoes and blood-sucking arthropods.

[0032] Non-limiting examples of alphaviruses include Venezuelan equine encephalitis virus (VEE), Semliki Forest virus (SF), Sindbis virus (SIN), Eastern equine encephalitis virus (EEE), Western equine encephalitis virus (WEE), Everglades virus (EVE), Mucambo virus (MUC), Pixuna virus (PIX), Semliki Forest virus (SF), Middelburg virus (MID), Chikungunya virus (CHIK), O'nyong-nyong virus (ONN), Ross River virus (RR), Barmah Forest virus (BF), Getah virus (GET), Sagiyama virus (SAG), Bebaru virus (BEB), Mayaro virus (MAY), Una virus (UNA), Aura virus (AURA), Babanki virus (BAB), These include BAB, Highlands J virus (HJ), and Fort Morgan virus (FM).

[0033] In the present disclosure, at least in part, the alphavirus replicon is a VEE alphavirus replicon. The VEE virus is a viral pathogen typically carried by mosquitoes that causes VEE or encephalomyelitis primarily in equine species. However, humans can also contract VEE, and people with weakened immune systems are at risk of suffering particularly severe complications when infected with VEE. VEE virions are spherical and possess a lipid membrane with glycoprotein surface proteins spread around the outer surface. Typically, VEE has a genome of approximately 11.45 kb, excluding the 5'-end cap and 3'-end poly(A) tract, and includes four nonstructural proteins (nsPs) and five structural proteins. The nonstructural proteins include nsP1, nsP2, nsP3, and nsP4, while the structural region codes for proteins C, E3, E2, 6K, and E1. In some cases, the self-amplifying replicon RNA is a WT replicon RNA derived from VEE. The sequence of the VEE virus WT replicon RNA is represented by SEQ ID NO:1: GCCAGCAACGCGAGCTCTAATACGACTCACTATAG (SEQ ID NO: 1)

[0034] As described herein, a self-amplifying replicon RNA comprises a nucleotide sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identical to SEQ ID NO: 1. In some embodiments, the self-amplifying replicon RNA is at least 90% identical to SEQ ID NO: 1. Self-amplifying RNAs (replicons) are a promising new platform for gene therapy, but applications are still limited by the short persistence of expression in some cell types and low levels of transgene expression in vivo. In vitro evolution of synthetic replicon RNAs offers a potentially powerful strategy to alter and enhance replicon expression both in vitro and in vivo. Using in vitro evolution methods, mutations were identified in nsP2 and nsP3 of the Venezuelan equine encephalitis (VEE) replicon that promoted subgenomic expression in human cells.

[0035] In some embodiments, the self-amplifying replicon RNA comprises a mutation that allows the replicon RNA to express an IL-12 molecule at a higher level compared to a replicon RNA comprising SEQ ID NO:1. In some embodiments, the self-amplifying replicon RNA comprises at least one point mutation at nucleic acid positions 3936 and / or 4758 of the WT replicon of SEQ ID NO:1. In some embodiments, the self-amplifying replicon RNA comprises at least one of the following point mutations: a guanine to cytosine at position 3936 of the WT replicon sequence of SEQ ID NO:1 (G3936C) and an adenine to guanine at position 4758 of the WT replicon sequence of SEQ ID NO:1 (A4758G). The G3936C mutation would result in a glycine to arginine change at amino acid residue 1309 (G1309R). The A4758G mutation would result in a serine to glycine change at amino acid residue 1583 (S1583G). In some embodiments, the sequence of the mutant self-amplifying replicon RNA (mt replicon RNA) is represented by SEQ ID NO:2 (mutations highlighted (bold, underlined letters)): [ka] [ka] [ka] [ka]

[0036] In other embodiments, the self-amplifying replicon RNA is derived from Hepatitis C virus (HCV). HCV is part of the group IV Flaviviridae family of viruses and possesses a monopartite, linear, single-stranded RNA genome of positive polarity, 9.6-12.3 kilobases in length. The 5' end of Flaviviruses has a methylated nucleotide cap, while other members of this family are uncapped and encode an internal ribosome entry site.

[0037] In another embodiment, the alphavirus is SF virus. SF virus is a viral pathogen typically carried by mosquitoes that causes encephalitis. Semliki Forest virus is a positive-stranded RNA virus with a genome of approximately 13,000 base pairs that encodes nine proteins. The 5'-thirds of the genome encodes four nonstructural proteins involved in RNA synthesis, and the structural proteins are encoded in the 3'-third. Of the structural proteins, the C protein constitutes an icosahedral capsid surrounded by a lipid bilayer derived from the host cell. The outermost surface of the virus is almost entirely covered by a heterodimer of glycoproteins E1 and E2 arranged in an interconnected trimer that forms the outer shell. The trimer is anchored to the membrane by the E2 cytoplasmic domain associated with the nucleocapsid.

[0038] In another embodiment, the alphavirus is a SIN virus. The virus is delivered by mosquitoes. SIN virus causes Sindbis fever in humans, and symptoms include joint pain, rash, and malaise. Sindbis virus is an enveloped particle with an icosahedral capsid. Its genome is a single stranded RNA approximately 11.7 kb long. It has a 5' cap and a 3' polyadenylated tail, and thus serves as a direct messenger RNA (mRNA) in the host cell. The genome encodes four nonstructural proteins at the 5' end, and a capsid and two envelope proteins at the 3' end. This is characteristic of all togaviruses. Replication is cytoplasmic and rapid. The genomic RNA is partially translated at the 5' end to produce nonstructural proteins that are then involved in genome replication and the production of new genomic RNA and shorter subgenomic RNA strands. This subgenomic strand is translated into structural proteins. Viruses assemble on the surface of host cells and acquire their envelope through budding. Non-coding RNA elements were found to be essential for Sindbis virus genome replication.

[0039] Viral replicon RNA can stimulate immune responses through toll-like receptors (TLRs). A subset of TLRs, TLR3, TLR7 / 8, and TLR9, participate in antiviral responses by triggering the production of antiviral cytokines such as type I interferon (IFN). TLR3 responds to double-stranded RNA, which is an intermediate state of replication for many viruses. TLR7 / 8 recognize viral single-stranded RNA, while TLR9 recognizes unmethylated CpG motifs within viral DNA. The TLRs involved in virus recognition are expressed on endosomal membranes and can be separated according to their requirement for the adaptor protein MyD88: TLR3 activity is MyD88 independent, whereas TLR7 / 8 / 9 are MyD88 dependent. Activation of TLR3 leads to the production of type I interferon (IFN). Type I interferon signaling through the ISGF3 (STAT1 / STAT2 / IRF9) complex is required for sustained Rip3 activation and necroptosis.

[0040] In some embodiments, LNP-replicon RNA can stimulate TLR3 signaling in tumor cells, which leads to necrotic cell death of tumor cells. In some embodiments, LNP-replicon RNA can enhance immunogenic cell death (ICD) induced by LNP. In some embodiments, TT3-LNP-replicon RNA can exert tumor inhibition by synergistically induced ICD in tumor cells, and trigger anti-tumor immune response (e.g., recruitment of immune cells such as granulocytes, monocytes, macrophages, myeloid-derived suppressor cells, dendritic cells, T cells, and NK cells). In some embodiments, synthetic oncolytic virus comprises TT3-LNP-mt replicon RNA.

[0041] In some embodiments, the replicon RNA comprises a coding sequence for a detectable molecule in the subgenomic region. In some embodiments, the detectable molecule is a nucleic acid or a polypeptide. In some embodiments, the polypeptide is a fluorescent protein. Fluorescent proteins are known in the art and are a subclass of fluorophores, which are fluorescent chemical compounds that have the ability to re-emit light upon excitation. Fluorophores will absorb excitation light energy at a first specific wavelength and then re-emit light energy at a second, longer specific wavelength. Each type of fluorophore responds to and emits light at different wavelengths, depending on the nature of its chemical structure and the environment.

[0042] In some embodiments, the fluorescent protein may be, but is not limited to, wt-GFP, green fluorescent protein (e.g., EGFP, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen, T-Sapphire, etc.), blue fluorescent protein (e.g., EBFP, EBFP2, Azurite, mTagBFP, etc.), cyan fluorescent protein (e.g., ECFP, mECFP, Cerulean, mTurquoise, CyPet, AmCyan1, Midori-Ishi Cyan, TagCFP, mTFP1(Teal), etc.), yellow fluorescent protein (e.g., EYFP, Topaz, Venus, mCitrine, YPet, TagYFP, PhiYFP, ZsYellow1, mBanana, etc.), orange fluorescent protein (e.g., Kusabira Orange, Kusabira Orange2, mOrange, mOrange2, dTomato, dTomato-Tandem, TagRFP, TagRFP-T, DsRed, DsRed2, DsRed-Express(T1), DsRed-Monomer, mTangerine, etc.), or red fluorescent proteins (e.g., mRuby, mApple, mStrawberry, AsRed2, mRFP1, JRed, mCherry, HcRed1, mRaspberry, dKeima-Tandem, HcRed-Tandem, mPlum, AQ143, etc.).

[0043] In some aspects, as described herein, the self-amplifying replicon RNA comprises a coding sequence for expression of IL-12 within the subgenomic region. An exemplary coding sequence for IL-12 is represented in SEQ ID NO:3:

[0044] Structurally, IL-12 belongs to type I cytokines and has a four α-helical bundle structure. IL-12 acts in the form of a heterodimeric protein (IL-12-p70; IL-12-p30 / p40), consisting of two covalently linked p30 and p40 subunits. Contrary to the heterodimeric form, the IL-12-p40 / p40 homodimer acts primarily as an antagonistic inhibitor of IL-12-p70 action. IL-12 is a pleiotropic cytokine, whose actions create an interconnection between innate and adaptive immunity. IL-12 was first described as a factor secreted from PMA-induced EBV-transformed B cell lines. Based on its actions, IL-12 was initially called "cytotoxic lymphocyte maturation factor" and "natural killer cell-stimulating factor." Due to its ability to bridge innate and adaptive immunity and to potently stimulate the production of IFN-γ, a cytokine that orchestrates natural mechanisms of potent anti-cancer defense, IL-12 has been considered an ideal candidate for tumor immunotherapy in humans. However, the severe side effects associated with systemic administration of IL-12 in clinical investigations and the very narrow therapeutic index of this cytokine have significantly tempered the enthusiasm for its use in cancer patients.

[0045] Following the discovery of IL-12, three other members (IL-23, IL-27, and IL-35) were added to the IL-12 family and shown to play a critical role in the function of Th1 cells. IL-12 is a ligand for a receptor composed of two amino acid chains, IL-12R-β1 and IL-12R-β2. The IL-12 receptor is expressed in a constitutive (e.g., IL-12R-β1 in B cells) or inducible (IL-12R-β2) manner in various immune cells, including NK cells, T, and B lymphocytes. Ligand-bound IL-12R-β2 is phosphorylated on tyrosine, which provides harboring sites for two kinases, JAK2 and TYK2. Among the transcription factors of the STAT family, STAT4 is considered to be the most specific mediator of cellular responses elicited by IL-12.

[0046] The main elements of IL-12 action are: increasing the production of IFN-γ from NK and T cells, which is the most potent mediator of IL-12 action; stimulating the growth and cytotoxicity of activated NK cells, CD8+ and CD4+ T cells, and shifting the differentiation of CD4+ Th0 cells toward a Th1 phenotype; enhancing antibody-dependent cellular cytotoxicity (ADCC) against tumor cells; and inducing IgG and suppressing IgE production from B cells. The main source of IL-12 in humans is activated antigen-presenting cells, such as dendritic cells, especially those of the CD1c+ phenotype, and hematopoietic phagocytes (monocytes, macrophages, and neutrophils as well), although IL-12 can also be produced by other cell types. While IL-12 acts on a variety of immune cells, the overall physiological role for IL-12 appears to be to orchestrate a Th1-type immune response against a pathogen.

[0047] In some aspects, the present disclosure describes the local delivery of IL-12 by LNPs encapsulating a viral replicon RNA that encodes IL-12 in its subgenomic region. In addition to the synergistic tumor cell immunogenic cell death (ICD) induced by LNP-replicon RNA, in some embodiments, the expression of IL12 in the tumor microenvironment can lead to further immunostimulation and enhance anti-tumor immune responses. In some embodiments, the combination of LNP-replicon RNA-IL-12 in the tumor microenvironment can induce a systemic anti-tumor immune response. In other embodiments, the combination of LNP-replicon RNA-IL-12 in the tumor microenvironment can eradicate tumor cells and prevent tumor recurrence. In some embodiments, the synthetic oncolytic virus comprises TT3-LNP-mt replicon RNA-IL12.

[0048] In some embodiments, the replicon RNA-IL12 further comprises a coding sequence for serum albumin. The half-life of peptides and proteins (e.g., cytokines) in biological environments (e.g., serum, tumor microenvironment) is influenced by various factors, including size, charge, susceptibility to proteolysis, their biological properties, turnover rate of their binding proteins, and other factors. In some cases, the half-life of proteins in biological environments can be roughly correlated with their size. Peptides and proteins (e.g., cytokines) smaller than approximately 70 kDa can be removed via renal filtration, so they generally have a very short half-life. However, larger proteins will persist for several days. Three types of proteins, IgG, serum albumin, and transferrin, persist for much longer than would be expected by their size. In some embodiments, the serum albumin is human serum albumin. In some embodiments, the serum albumin is mouse serum albumin (MSA).

[0049] An exemplary coding sequence for the replicon RNA-IL12-MSA is represented in SEQ ID NO:4:

[0050] In some embodiments, replicon RNA-IL-12 is fused with serum albumin coding sequence.In some embodiments, IL-12-albumin fusion molecule has longer half-life in tumor microenvironment.In some embodiments, IL-12-albumin fusion protein can persist in tumor microenvironment for at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days or longer. In some embodiments, the synthetic oncolytic virus comprises LNP-replicon RNA-IL-12-serum albumin. In other embodiments, the synthetic oncolytic virus comprises TT3-LNP-replicon RNA-IL-12-serum albumin. In other embodiments, the synthetic oncolytic virus comprises TT3-LNP-mt replicon RNA-IL-12-serum albumin. The sustained presence of IL-12 in the tumor microenvironment will prolong the anti-tumor immune response exerted by the synthetic oncolytic virus.

[0051] In some embodiments, the replicon RNA-IL12-serum albumin further comprises a coding sequence for lumican. Lumican is one of the major extracellular proteins in the interstitial extracellular matrix (ECM) of skin, corneal stroma, sclera, aorta, muscle, lung, kidney, bone, cartilage and intervertebral disc. It is a member of the family of small leucine-rich proteoglycans (SLRPs), which has a 30-50 kDa core protein that contains a signal peptide, a negatively charged N-terminal domain, a highly conserved leucine-rich internal domain and a carboxyl-terminal domain. The protein core and glycan chains of lumican can interact with various cellular effectors, including cytokines, growth factors and cell surface receptors, to regulate cell adhesion, proliferation and migration. As an endogenous collagen-binding protein, the presence of lumican in the tumor microenvironment will promote the local retention of IL-12 and enhance the efficacy and safety of tumor immunotherapy, as described herein. In some embodiments, the replicon RNA-IL-12-MSA comprises a coding sequence for lumican. In other embodiments, the mt replicon RNA-IL-12-MSA (mtRep-IL12-MSA) comprises a coding sequence for lumican.

[0052] An exemplary coding sequence for mt replicon RNA-IL-12-MSA-lumican (mtRep-IL12-MSA-lumican) is represented in SEQ ID NO:5:

[0053] In some embodiments, the synthetic oncolytic virus comprises LNP-replicon RNA-IL-12-serum albumin-lumican. In other embodiments, the synthetic oncolytic virus comprises TT3-LNP-replicon RNA-IL-12-serum albumin-lumican. In other embodiments, the synthetic oncolytic virus comprises TT3-LNP-mt replicon RNA-IL-12-serum albumin-lumican. Retention of IL-12 in the tumor microenvironment will improve the efficacy and safety of the synthetic oncolytic virus.

[0054] In some cases, the replicon RNA may contain one or more genes of experimental or therapeutic interest. In some embodiments, the genes of experimental or therapeutic interest code for cytokines, chemokines, or growth factors other than IL-12. Cytokines are known in the art, and the term itself refers to a generalized grouping of small proteins that are secreted by certain cells in the immune system and have effects on other cells. Cytokines are known to enhance cellular immune responses, and as used herein, may include, but are not limited to, TNFα, IFN-γ, IFN-α, TGF-β, IL-1, IL-2, IL-4, IL-10, IL-13, IL-17, IL-18, and chemokines.

[0055] Chemokines are useful in studies investigating responses to infection, immune responses, inflammation, trauma, sepsis, cancer, and reproduction, among other applications. Chemokines are known in the art and are a type of cytokine that induces chemotaxis, typically of white blood cells, in responding cells in the immediate vicinity of the site of infection. Non-limiting examples of chemokines include CCL14, CCL19, CCL20, CCL21, CCL25, CCL27, CXCL12, CXCL13, CXCL-8, CCL2, CCL3, CCL4, CCL5, CCL11, and CXCL10. Growth factors are known in the art and the term itself is sometimes interchangeable with the term cytokine. As used herein, the term "growth factor" refers to a naturally occurring substance that can stimulate cell-cell signaling and cell proliferation. While a cytokine may be a growth factor, some types of cytokines may also have an inhibitory effect on cell growth, thus distinguishing the two terms.

[0056] Non-limiting examples of growth factors include adrenomedullin (AM), angiopoietin (Ang), autocrine motility stimulating factor, bone morphogenetic protein (BMP), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), interleukin-6 (IL-6), macrophage colony-stimulating factor (m-CSF), granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), epidermal growth factor (EGF), ephrin A1, ephrin A2, ephrin A3, ephrin A4, ephrin A5, ephrin B1, ephrin B2, ephrin B3, erythropoietin (EPO), fibroblast growth factor 1 (FGF1), fibroblast growth factor 2 (FGF2), fibroblast growth factor 3 (FGF3), fibroblast growth factor 4 (FGF4), fibroblast growth factor 5 (FGF5), Fibroblast growth factor 6 (FGF6), Fibroblast growth factor 7 (FGF7), Fibroblast growth factor 8 (FGF8), Fibroblast growth factor 9 (FGF9), Fibroblast growth factor 10 (FGF10), Fibroblast growth factor 11 (FGF11), Fibroblast growth factor 12 (FGF12), Fibroblast growth factor 13 (FGF13), Fibroblast growth factor 14 (FGF14), Fibroblast growth factor 15 ( FGF15), Fibroblast Growth Factor 16 (FGF16), Fibroblast Growth Factor 17 (FGF17), Fibroblast Growth Factor 18 (FGF18), Fibroblast Growth Factor 19 (FGF19), Fibroblast Growth Factor 20 (FGF20), Fibroblast Growth Factor 21 (FGF21), Fibroblast Growth Factor 22 (FGF22), Fibroblast Growth Factor 23 (FGF23), Fetal Bovine Growth Hormone ... Bovine Somatotrophin (FBS), glial cell line-derived neurotrophic factor (GDNF), neurturin, persephin, artemin, growth differentiation factor-9 (GDF9), hepatocyte growth factor (HGF), hepatoma-derived growth factor (HDGF), insulin, insulin-like growth factor-1 (IGF-1), insulin-like growth factor-2 (IGF-2), interleukin-1 (IL-1), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, keratinocyte growth factor (KGF), migration-stimulating factor (MSM-1),These include macrophage stimulating protein (MSF), macrophage stimulating protein (MSP), myostatin (GDF-8), neuregulin 1 (NRG1), neuregulin 2 (NRG2), neuregulin 3 (NRG3), neuregulin 4 (NRG4), brain-derived neurotrophic factor (BDNF), nerve growth factor (NGF), neurotrophin-3 (NT-3), neurotrophin-4 (NT-4), placental growth factor (PGF), platelet-derived growth factor (PDGF), renalase (RNLS), T-cell growth factor (TCGF), thrombopoietin (TPO), transforming growth factor alpha (TGF-α), transforming growth factor beta (TGF-β), tumor necrosis factor alpha (TNF-α), and vascular endothelial growth factor (VEGF).

[0057] II. Pharmaceutical Compositions In some aspects, the disclosure relates at least in part to a pharmaceutical composition comprising a synthetic oncolytic virus as described herein. The pharmaceutical composition described herein may further comprise a pharmaceutically acceptable carrier (excipient) to form a pharmaceutical composition for use in treating a target disease. "Acceptable" means that the carrier must be compatible with (and preferably capable of stabilizing) the active ingredient of the composition and not deleterious to the subject to be treated. Pharmaceutically acceptable excipients (carriers), including buffers, are well known in the art. See, for example, Remington: The Science and Practice of Pharmacy 20th Ed. (2000) Lippincott Williams and Wilkins, Ed. KE Hoover.

[0058] Pharmaceutical compositions used for in vivo administration must be sterile. This can be easily accomplished, for example, by filtration through a sterile filtration membrane. The composition containing the synthetic oncolytic virus may be placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper that can be pierced by a hypodermic injection needle. In some embodiments, the pharmaceutical composition used herein can be formulated for intratumoral injection.As used herein, intratumoral injection refers to the direct injection of antitumor composition (for example, immunostimulatory synthetic oncolytic virus) into tumor.High concentration of composition can be achieved in situ while using small amount of drug.Local delivery of immunotherapy allows multiple combination treatments while significantly preventing systemic exposure and off-target toxicity.

[0059] In other embodiments, the pharmaceutical compositions may be formulated for intramuscular, intravenous, or subcutaneous injection. The pharmaceutical composition used in the method may contain pharma- ceutically acceptable carriers, buffers, excipients, salts, or stabilizers in the form of lyophilized formulations or aqueous solutions. See, for example, Remington: The Science and Practice of Pharmacy 20th Ed. (2000) Lippincott Williams and Wilkins, Ed. KE Hoover. Acceptable carriers, excipients, or stabilizers are non-toxic to recipients at the dosages and concentrations used, and may include buffers such as phosphate, citrate, and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzylammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens, such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; serum albumin; The surfactants may include proteins such as amine, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextran; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., Zn-protein complexes); and / or non-ionic surfactants such as TWEEN™, PLURONICS™, or polyethylene glycol (PEG).

[0060] In some examples, the pharmaceutical compositions described herein include lipid nanoparticles, which can be prepared by methods known in the art, such as those described in Epstein, et al., Proc. Natl. Acad. Sci. USA 82:3688 (1985); Hwang, et al., Proc. Natl. Acad. Sci. USA 77:4030 (1980); and U.S. Patent Nos. 4,485,045 and 4,544,545. Liposomes with enhanced circulation time are disclosed in U.S. Patent No. 5,013,556. Particularly useful liposomes can be produced by reverse phase evaporation with a lipid composition comprising phosphatidylcholine, cholesterol and PEG-derivatized phosphatidylethanolamine (PEG-PE). Liposomes are extruded through filters of defined pore size to produce liposomes with the desired diameter.

[0061] In other examples, the pharmaceutical compositions described herein can be formulated in sustained release form.A suitable example of sustained release preparation is a semipermeable matrix of solid hydrophobic polymers containing synthetic oncolytic viruses, the matrix being in the form of a shaped article, for example, a film, or a microcapsule.Examples of sustained release matrices include polyesters, hydrogels (e.g., poly(2-hydroxyethyl-methacrylate), or poly(vinyl alcohol)), polylactides (U.S. Pat. No. 3,773,919), copolymers of L-glutamic acid and 7-ethyl-L-glutamate, non-degradable ethylene-vinyl acetate, degradable lactic acid-glycolic acid copolymers such as LUPRON DEPOT™ (injectable microspheres composed of lactic acid-glycolic acid copolymer and leuprolide acetate), sucrose acetate isobutyrate, and poly-D-(-)-3-hydroxybutyric acid.

[0062] Suitable surfactants include non-ionic agents such as polyoxyethylene sorbitan (e.g., TWEEN™ 20, 40, 60, 80 or 85) and other sorbitans (e.g., SPAN™ 20, 40, 60, 80 or 85), among others. Compositions having a surfactant conveniently contain between 0.05 and 5% surfactant, and may be between 0.1 and 2.5%. It will be appreciated that other ingredients, such as mannitol or other pharma- ceutically acceptable vehicles, may be added, if required. The pharmaceutical compositions described herein may be in unit dosage form, such as tablets, pills, capsules, powders, granules, solutions or suspensions, or suppositories, for oral, parenteral or rectal administration, or by administration by inhalation or insufflation.

[0063] To prepare solid compositions such as tablets, the first active ingredient can be mixed with pharmaceutical carriers, such as corn starch, lactose, sucrose, sorbitol, talc, stearic acid, magnesium stearate, dicalcium phosphate or gums, and other pharmaceutical diluents, such as water, to form a solid preformulation composition containing a homogeneous mixture of the compound of the present invention, or its non-toxic pharmaceutically acceptable salt. When these preformulation compositions are called homogeneous, it means that the active ingredient is evenly distributed throughout the composition, so that the composition can be easily subdivided into unit dosage forms, such as tablets, pills and capsules, which are equally effective. This solid preformulation composition is then subdivided into unit dosage forms of the above-described type containing 0.1 to about 500 mg of the active ingredient of the present invention. The tablets or pills of the novel composition can be coated or otherwise compounded to provide a dosage form that provides the advantage of sustained action. For example, the tablet or pill can include an inner dosage and an outer dosage component, the latter covering the former in the form of an envelope. The two components can be separated by an enteric layer which serves to resist disintegration in the stomach and permits the inner component to pass intact into the duodenum or to be delayed in release. A variety of materials can be used for such enteric layers or coatings, such materials including a number of polymeric acids and mixtures of polymeric acids with such materials as shellac, cetyl alcohol, and cellulose acetate.

[0064] Suitable emulsions may be prepared using commercially available fat emulsions such as INTRALIPIDS™, LIPOSYN™, INFONUTROL™, LIPOFUNDIN™ and LIPIPHYSAN™. The active ingredient may either be dissolved in a premixed emulsion composition or alternatively dissolved in oil (e.g., soybean oil, safflower oil, cottonseed oil, sesame oil, corn oil or almond oil) and mixed with phospholipids (e.g., egg phospholipids, soybean phospholipids or soybean lecithin) and water to form an emulsion. It will be understood that other ingredients, such as glycerol or glucose, may be added to adjust the tonicity of the emulsion. Suitable emulsions will typically contain up to 20% oil, e.g., between 5-20% oil. The fat emulsion may contain fat droplets having a suitable size and may have a pH in the range of 5.5-8.0.

[0065] Pharmaceutical compositions for inhalation or insufflation include solutions and suspensions in pharma- ceutically acceptable, aqueous or organic solvents, or mixtures thereof, and powders. The liquid or solid compositions may contain suitable pharma- ceutically acceptable excipients as set out above. In some embodiments, the compositions are administered by the oral or nasal respiratory route for local or systemic effect. Compositions, preferably in sterile, pharma- ceutically acceptable solvents, may be nebulized by use of a gas. Nebulized solutions may be breathed directly from the nebulizing device or the nebulizing device may be attached to a face mask, tent, or intermittent positive pressure breathing machine. Solution, suspension, or powder compositions may be administered, preferably orally or nasally, from devices which deliver the formulation in an appropriate manner.

[0066] III. Therapeutic Applications The pharmaceutical compositions disclosed herein, including the synthetic oncolytic viruses, can be used to treat cancer, e.g., cancer immunotherapy. To practice the methods disclosed herein, an effective amount of any of the pharmaceutical compositions described herein can be administered to a subject (e.g., a human) in need of treatment via a suitable route, such as intravenous administration, e.g., as a bolus or by continuous infusion over a period of time, intravenous administration, intramuscular, intraperitoneal, intracerebrospinal, subcutaneous, intraarticular, intrasynovial, intrathecal, oral, inhalation or topical routes, intratumoral administration, etc. Commercially available nebulizers for liquid formulations, including jet nebulizers and ultrasonic nebulizers, are useful for administration. Liquid formulations can be directly nebulized, and lyophilized powders can be nebulized after reconstitution. Alternatively, pharmaceutical compositions containing synthetic oncolytic viruses can be aerosolized using fluorocarbon formulations and metered dose inhalers, or inhaled as lyophilized and milled powders. In some examples, the pharmaceutical compositions described herein are formulated for intratumoral injection. In certain examples, the pharmaceutical compositions can be administered to a subject (e.g., a human patient) via a local route, e.g., injection into a local site, such as a tumor site or an infection site.

[0067] As used herein, "effective amount" refers to the amount of each active agent required to provide a therapeutic effect to a subject, either alone or in combination with one or more other active agents. In some embodiments, the therapeutic effect is reduced tumor burden, reduction of cancer cells, or increased immune activation. Determining whether an amount of synthetic oncolytic virus has achieved a therapeutic effect would be clear to one of ordinary skill in the art. Effective amounts, as recognized by one of ordinary skill in the art, will vary depending on the specific disease being treated, the severity of the disease, individual patient parameters including age, physical condition, size, sex, and weight, duration of treatment, nature of concomitant treatment (if any), the specific route of administration, and similar factors within the knowledge and expertise of the health practitioner. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is generally preferred that the maximum dose of the individual components or combinations thereof be used, i.e., the highest safe dose according to sound medical judgment.

[0068] Empirical considerations such as half-life will generally contribute to the determination of dosage.The frequency of administration may be determined and adjusted during treatment, and is generally, but not necessarily, based on the treatment and / or suppression and / or remission and / or delay of the target disease / disorder.Alternatively, a sustained continuous release formulation of synthetic oncolytic virus may be appropriate.Various formulations and devices for achieving sustained release are known in the art. In some embodiments, the treatment is a single injection of a pharmaceutical composition containing the synthetic oncolytic virus. In some embodiments, the single injection is administered intratumorally to a subject in need thereof.

[0069] In some instances, dosages for synthetic oncolytic viruses as described herein may be empirically determined in individuals given one or more administrations (singular or plural) of synthetic oncolytic. Individuals are given gradually increasing dosages of a composition containing synthetic oncolytic. Disease / disorder guidelines may be followed to assess the effectiveness of synthetic oncolytic viruses. For repeated administration over several days or longer, depending on the disease, treatment is sustained until suppression of the desired symptoms occurs or sufficient therapeutic levels are achieved to alleviate the targeted disease or disorder or its symptoms.

[0070] In some embodiments, the frequency of administration is once a week, once every 2 weeks, once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, or once every 10 weeks; or once a month, once every 2 months, once every 3 months, or once longer.The progress of this treatment is easily monitored by conventional techniques and assays.The administration regimen of the synthetic oncolytic virus used can be changed over time. In some embodiments, the methods described herein include administering to a subject (e.g., a human patient) in need of treatment one or more doses of a pharmaceutical composition containing a synthetic oncolytic virus.

[0071] For purposes of this disclosure, the appropriate dosage of a synthetic oncolytic virus as described herein will depend on the particular synthetic oncolytic virus, the type and severity of the disease / disorder, whether the synthetic oncolytic virus is administered for prophylactic or therapeutic purposes, previous treatments, the patient's clinical history and response to the synthetic oncolytic virus, and the discretion of the attending physician. The clinician may administer the synthetic oncolytic virus until a dosage is reached that achieves the desired result. In some embodiments, the desired result is a reduction in tumor burden, a reduction in cancer cells, or increased immune activation. Methods for determining whether a dosage has resulted in a desired result will be apparent to one of skill in the art. Administration of one or more synthetic oncolytic viruses may be continuous or intermittent, depending, for example, on the physiological condition of the recipient, whether the purpose of administration is therapeutic or prophylactic, and other factors known to the skilled practitioner. Administration of the synthetic oncolytic virus may be essentially continuous over a preselected period of time, or may be in a series of spaced doses, for example, either before, during, or after the onset of the target disease or disorder.

[0072] As used herein, the term "treat" refers to the application or administration of a composition comprising one or more active agents to a subject having a target disease or disorder, a symptom of a disease / disorder, or a predisposition to a disease / disorder, for the purpose of curing, curing, alleviating, ameliorating, improving, or affecting the disorder, the symptom of a disease, or the predisposition to a disease or disorder.

[0073] Alleviating the target disease / disorder encompasses delaying the onset or progression of the disease or reducing the severity of the disease. Alleviating the disease does not necessarily require a therapeutic outcome. As used herein, "delaying" the onset of the target disease or disorder means to postpone, prevent, slow, retard, keep constant, and / or postpone the progression of the disease. This delay can be of various lengths of time, depending on the history of the disease and / or the individual to be treated. A method of "delaying" or alleviating the onset of a disease or delaying the onset of a disease is a method that reduces the probability of developing one or more symptoms of the disease within a given time frame and / or reduces the spread of symptoms within a given time frame compared to not using the method. Such comparisons are typically based on clinical studies using a sufficient number of subjects to provide statistically significant results.

[0074] "Onset" or "progression" of a disease refers to the first signs of disease and / or subsequent progression. Onset of a disease can be detectable and assessed using standard clinical techniques well known in the art. However, onset also refers to progression that may be undetectable. For purposes of this disclosure, onset or progression refers to the biological course of a symptom. "Onset" includes onset, recurrence, and onset. As used herein, "onset" or "onset" of a target disease or disorder includes initial onset and / or recurrence.

[0075] In some embodiments, a pharmaceutical composition containing a synthetic oncolytic virus as described herein is administered to a subject in need of treatment in an amount sufficient to reduce tumor burden or cancer cell growth in vivo by at least 5% (e.g., 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more). In other embodiments, a pharmaceutical composition containing a synthetic oncolytic virus as described herein may be administered in an amount effective to increase immune activity by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more.

[0076] The subject to be treated by the methods described herein can be a mammal, such as human, livestock, sport animals, pets, primates, horses, dogs, cats, mice and rats.In one embodiment, the subject is a human.The composition containing the synthetic oncolytic virus as described herein can be used to enhance immune activity, for example T cell activity, in a subject in need of treatment. In some embodiments, the subject may be a human patient with cancer, suspected of having cancer, or at risk of cancer.Non-limiting examples of cancer include melanoma, squamous cell carcinoma, small cell lung cancer, non-small cell lung cancer, adenocarcinoma of the lung, squamous cell carcinoma of the lung, peritoneal cancer, hepatocellular carcinoma, gastrointestinal cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, liver cancer, bladder cancer, liver cancer, breast cancer, colon cancer, colorectal cancer, endometrial or uterine cancer, salivary gland cancer, kidney cancer, prostate cancer, vulvar cancer, thyroid cancer, liver cancer, gastric cancer, and various types of head and neck cancer, including squamous cell head and neck cancer.In some embodiments, the cancer may be melanoma, lung cancer, colorectal cancer, renal cell carcinoma, urothelial carcinoma, or Hodgkin's lymphoma.

[0077] A subject having a target disease or disorder (e.g., cancer) may be identified by routine examination, e.g., laboratory tests, organ function tests, CT scans, or ultrasound. A subject suspected of having any of such target diseases / disorders will exhibit one or more symptoms of the disease / disorder. A subject at risk of a disease / disorder may have one or more risk factors associated with the disease / disorder. Such a subject may also be identified by routine medical practice.

[0078] In some embodiments, the pharmaceutical composition containing the synthetic oncolytic virus may be used with another suitable therapeutic agent (e.g., an anti-cancer agent, an anti-viral agent, or an anti-bacterial agent) and / or other agents that serve to enhance and / or complement the immunostimulatory effect of the synthetic oncolytic virus. In such combination therapy, the composition containing the synthetic oncolytic virus and the additional therapeutic agent (e.g., an anti-cancer therapeutic agent or other as described herein) may be administered to the subject in need of treatment in a sequential manner (i.e., each therapeutic agent is administered at a different time). Alternatively, these therapeutic agents, or at least two of the agents, are administered to the subject in a manner that is substantially simultaneous.

[0079] Combination therapy can also include the administration of the agents described herein (e.g., pharmaceutical compositions containing synthetic oncolytic viruses and anti-cancer agents) in further combination with other biologically active ingredients (e.g., various anti-cancer agents) and non-pharmaceutical therapies (e.g., surgery).

[0080] It should be understood that any combination of a composition containing a synthetic oncolytic virus and another anti-cancer agent (e.g., a chemotherapeutic agent) may be used in any sequence to treat cancer. The combinations described herein may be selected based on a number of factors, including, but not limited to, efficacy in reducing tumor formation or tumor growth, reducing cancer cells, increasing immune activation, and / or alleviating at least one symptom associated with cancer, or efficacy in reducing the side effects of another agent in the combination. For example, the combination therapy described herein may reduce any of the side effects associated with each individual member of the combination, such as the side effects associated with an anti-cancer agent.

[0081] In some embodiments, the other anticancer therapeutic agent is chemotherapy, radiation therapy, surgery, and / or immunotherapy. Examples of chemotherapy agents include, but are not limited to, carboplatin or cisplatin, docetaxel, gemcitabine, Nab-paclitaxel, paclitaxel, pemetrexed, and vinorelbine. Examples of radiation therapy include, but are not limited to, ionizing radiation, gamma radiation, neutron radiation therapy, electron beam radiation therapy, proton therapy, brachytherapy, systemic radioactive isotopes, and radiosensitizers. Examples of surgical therapy include, but are not limited to, curative surgery (e.g., tumor removal surgery), preventive surgery, laparoscopic surgery, and laser surgery. Examples of immunotherapy include, but are not limited to, adoptive cell transfer and therapeutic cancer vaccines.

[0082] Additional examples of chemotherapy include, but are not limited to, platinum agents such as carboplatin, oxaliplatin, cisplatin, nedaplatin, satraplatin, lobaplatin, triplatin, tetranitrate, picoplatin, Prolindac, aroplatin and other derivatives; topoisomerase I inhibitors such as camptothecin, topotecan, irinotecan / SN38, rubitecan, belotecan, and other derivatives; Topoisomerase II inhibitors such as toposide (VP-16), daunorubicin, doxorubicin preparations (e.g., doxorubicin, doxorubicin HCl, doxorubicin analogs, or doxorubicin in liposomes and its salts or analogs), mitoxantrone, aclarubicin, epirubicin, idarubicin, amrubicin, amsacrine, pirarubicin, valrubicin, zorubicin, teniposide and other derivatives; antimetabolites such as methotrexate, pemetrexed, raltitrexed, aminopterin, and analogs; purine antagonists (thioguanine, fludarabine, cladribine, 6-mercaptopurine, pentostatin, clofarabine, and analogs) and pyrimidine antagonists (cytarabine, floxuridine, azacytidine, tegafur, carmofur, capecitabine, gemcitabine, hydroxyurea, 5-fluorouracil (5FU), and analogs); nitrogen mustards (e.g., cyclophosphamide, melphalan, chlorambucil, mechlorethamine, ifosfamide, trophoblastic acid, cyclophosphamide ... Alkylating agents such as sufamide, prednimustine, bendamustine, uramustine, estramustine, and analogs; nitrosoureas (e.g., carmustine, lomustine, semustine, fotemustine, nimustine, ranimustine, streptozocin, and analogs); triazenes (e.g., dacarbazine, altretamine, temozolomide, and analogs); alkyl sulfonates (e.g., busulfan, mannosulfan, treosulfan, and analogs); procarbazine; mitobronitol, and aziridines (e.g., carboquone, triaziquone, thioTEPA, triethylenemelamine, and analogs);Antibiotics such as hydroxyurea, anthracyclines (e.g., doxorubicin, daunorubicin, epirubicin, and other derivatives); anthracenediones (e.g., mitoxantrone and analogs); the Streptomyces family (e.g., bleomycin, mitomycin C, actinomycin, plicamycin); and ultraviolet light.

[0083] III. KITS FOR USE IN THERAPEUTICS The present disclosure also provides kits for use in immunotherapy against cancer (e.g., melanoma, lung cancer, colon cancer, or renal cell carcinoma) and / or for treating or reducing the risk of cancer. Such kits can include one or more containers containing a synthetic oncolytic virus-containing pharmaceutical composition, e.g., any of those described herein. In some embodiments, the kit may include instructions for use according to any of the methods described herein. For example, the included instructions may include instructions for administration of a composition containing a synthetic oncolytic virus for treatment, delaying onset, or alleviating a target disease, such as those described herein. The kit may further include instructions for selecting an individual suitable for treatment based on identifying whether the individual has the target disease. In yet other embodiments, the instructions include instructions for administering a composition containing a synthetic oncolytic virus to an individual at risk of having the target disease.

[0084] Instructions for use of compositions containing synthetic oncolytic viruses will generally include information regarding dosage, dosing schedule, and route of administration for the intended treatment. Containers may be unit dose, bulk packages (e.g., multi-dose packages) or sub-unit doses. Instructions provided with kits of the invention are typically written instructions on a label or insert (e.g., a paper sheet included in the kit), although computer readable instructions (e.g., instructions carried on a magnetic or optical memory disk) are also acceptable. The label or package insert indicates that the composition is used for treating, delaying the onset of, and / or ameliorating a cancer-related disease or disorder, such as those described herein. Instructions may be provided for practicing any of the methods described herein.

[0085] The kit as described herein is in suitable packaging. Suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging (e.g., sealed Mylar or plastic bags), and the like. Also contemplated is packaging for use in combination with a specific device, such as an inhaler, a nasal administration device (e.g., an atomizer) or an injection device, such as a minipump. The kit may have a sterile access port (e.g., the container may be an intravenous solution bag or vial with a stopper that can be pierced by a hypodermic needle). The container may also have a sterile access port (e.g., the container may be an intravenous solution bag or vial with a stopper that can be pierced by a hypodermic needle). At least one active agent in the composition is a composition containing a synthetic oncolytic virus, such as those described herein. The kit may optionally provide additional components such as buffers and descriptive information. Typically the kit includes a container and a label or package insert(s) on or associated with the container. In some embodiments, the invention provides an article of manufacture that includes the contents of the kit described above.

[0086] IV. General Techniques The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art. Molecular Cloning: A Laboratory Manual, second edition (Sambrook, et al., 1989) Cold Spring Harbor Press;Oligonucleotide Synthesis (MJ Gait, ed., 1984);Methods in Molecular Biology, Humana Press; Cell Biology: A Laboratory Notebook (JE Cellis, ed., 1998) Academic Press; Animal Cell Culture (RI Freshney, ed., 1987); Introduction to Cell and Tissue Culture (JP Mather and PE Roberts, 1998) Plenum Press; Cell and Tissue Culture: Laboratory Procedures (A. Doyle, JB Griffiths, and DG Newell, eds., 1993-8) J. Wiley and Sons; Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FM Ausubel, et al., eds., 1987); PCR: The Polymerase Chain Reaction, (Mullis, et al., eds.Current Protocols in Immunology (JE Coligan et al., eds., 1991); Short Protocols in Molecular Biology (Wiley and Sons, 1999); Immunobiology (CA Janeway and P. Travers, 1997); Antibodies (P. Finch, 1997); Antibodies: a practical approach (D. Catty., ed., IRL Press, 1988-1989); Monoclonal antibodies: a practical approach (P. Shepherd and C. Dean, eds., Oxford University Press, 2000); Using antibodies: a laboratory manual (E. Harlow and D. Lane (Cold Spring Harbor Laboratory Press, 1999); The Antibodies (M. Zanetti and JD Capra, eds., Harwood Academic Publishers, 1995). Without further elaboration, it is believed that one skilled in the art can, based on the above description, utilize the present invention to its fullest extent. The following specific embodiments are, therefore, to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. All publications cited herein are incorporated by reference for the purpose or subject matter mentioned herein.

[0087] Without further elaboration, it is believed that one skilled in the art can utilize the present invention to its fullest extent based on the above description. Accordingly, the following specific embodiments are to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way. All publications cited herein are incorporated by reference for the purposes or subject matter mentioned herein.

[0088] example material and method Cell lines and animals Cell lines B16F10 (ATCC® CRL-6475™), HEK-blue-TLR2 (Invivogen), HEK-blue-TLR3 (Invivogen), HEK-blue-TLR7 (Invivogen), HEK-blue-TLR9 (Invivogen), and Raw-Lucia ISG (Invivogen) were cultured according to the manufacturer's instructions (37°C, 5% CO2). Six- to eight-week-old female C57BL / 6J (JAX part number 000664) mice were purchased and maintained in the Massachusetts Institute of Technology (MIT) animal facility. All animal studies and procedures were performed in accordance with federal, state, and local guidelines under an IACUC-approved animal protocol by the MIT Committee of Animal Care.

[0089] Antibodies, staining, and FACS analysis Antibodies against mouse Ly6c (HK1.4), CD11b (M1 / 70), CD11c (N418), F4 / 80 (BM8), MHC-II (M5 / 114.15.2), CD45 (30-F11), CD3 (17A2), CD4 (GK1.5), CD8 (53-6.7), NK1.1 (PK136), CD45.2 (104), CD24 (30-F1), XCR1 (ZET), CD64 (X54-5 / 7.1) were from Biolegend. Antibodies against mouse Ly6G (1A8), CD16 / 32 (2.4G2) and CD103 (M290) were from BD Biosciences. Antibody against mouse calreticulin (ab2907) was from Abcam. Live / dead dye (L34966) was from ThermoFisher.

[0090] B16F10 melanoma-bearing mice were sacrificed and necropsied in accordance with federal, state, and local guidelines under an IACUC-approved animal protocol by the MIT Committee on Animal Care. Tumor-draining lymph nodes were then minced and tumors were sliced ​​and digested with collagenase IV (1 mg / ml) for 1 hour for single cell suspensions. Single cell suspensions were filtered through 70 μm nylon constrainers and stained as described. 10 . Stained samples were analyzed on a FACS analyzer (LSR-II or LSR-II-Fortessa) from BD Biosciences. Analysis was performed on a BD-LSRII Fortessa analyzer. All flow cytometry data was analyzed with FlowJo (Flowjo LLC) and plots were prepared using GraphPad Prism.

[0091] Constructs, In Vitro Transcription, Capping / Methylation of Replicon RNA, and Neon Transfection The backbone of the mutant replicon constructs was from in vitro development in a previous study (under revision). IL12-MSA and IL12-MSA-lumican were amplified from plasmids from the Prof. Dane Wittrup Lab and engineered in the subgenomic region of the mutant replicon. Replicon RNA was in vitro transcribed (IVT) from the linearized VEE construct template using the MEGAscript™ T7 Transcription Kit (ThermoFisher) according to the manufacturer's instructions. The resulting replicon RNA was capped and methylated using the ScriptCap™ m7G Capping System and ScriptCap™ 2'-O-Methyltransferase Kit (Cellscript) according to the manufacturer's instructions. RNA purity was assessed by gel electrophoresis. In vitro transfection was performed using 5 μg of RNA per 500,000 cells in 100 μl of R buffer from the NEON electroporation kit (ThermoFisher) at 1200 voltage, 20 ms, and 1 pulse.

[0092] Formulation of lipid nanoparticles and encapsulation of replicon RNA To encapsulate 10 μg of replicon RNA in DOTAP nanoparticles, a lipid mixture consisting of 16.9375 μl DOTAP (Avanti, Cat#890890, 10 mg / ml), 15.965 μl DSPC (Avanti, Cat#850365, 3 mg / ml), 18.7675 μl cholesterol (Sigma-Aldrich, Cat#C8667, 6 mg / ml), 13.6 μl DSPE-PEG2000 (Avanti Cat#880128, 2.5 mg / ml) in a molar ratio of 40:10:48:2 was prepared in ethanol and evaporated under N2 until one third of the initial total volume remained. 10 μg of replicon RNA (1 mg / ml) in 11.8 μl of 0.1 M citrate buffer (pH 6.0) was then added by pipetting, followed by a second addition of an additional 22 μl of 0.1 M citrate buffer (pH 6.0) by pipetting. The mixture was shaken for 1 hour and then dialyzed against PBS in a 3,500 MWCO dialysis cassette at 25° C. for an additional hour.

[0093] Encapsulation of replicon RNA into lipofectamine nanoparticles followed the instructions for Lipofectamine™ MessengerMAX™ Transfection Reagent (thermofisher.com / order / catalog / product / LMRNA008). 10 μl of TT3 (10 mg / ml) in a molar ratio of 20:30:40:0.75 to encapsulate 10 μg of replicon RNA within TT3 nanoparticles 11A lipid mixture consisting of 8.04 μl DOPE (Avanti, Cat# 850725, 10 mg / ml), 5.572 μl cholesterol (Sigma-Aldrich, Cat# C8667, 10 mg / ml), 3.452 μl C14-PEG2000 (Avanti Cat# 880150, 2 mg / ml) was prepared in 10.437 μl ethanol. 4.167 μl citrate buffer (PH 3.0, 10 mM) was added to the mixture. 10 μg replicon RNA (1 mg / ml) in 31.667 μl citrate buffer (PH 3.0, 10 mM) was then added by pipetting. The mixture was dialyzed against PBS in a 3,500 MWCO dialysis cassette at 25° C. for 80 minutes. The resulting replicon-loaded lipid nanoparticles were fractionated in appropriate dosages for intratumoral injection (10 μg / mouse) and for in vitro transfection (5 μg / 500,000 cells in 500 μl of medium).

[0094] Annexin V / PI staining, ATP assay, and Elisa Annexin V / PI staining was according to the instructions of the kit from Biolegend (Cat#640932). Extracellular ATP was assayed by ENLITEN® ATP Assay System (Promega). HMGB1, CCL5, IFNα2, IL12, IFNγ were measured by ELISA kits from Chondrex (Cat#6010, HMGB1), R & D System (Cat#DY478, CCL5), Abcam (Cat#ab215409, IFNα2), and Biolegend (Cat#88-7121-88, IL12, Cat#88-7314-88, IFNγ) and followed their instruction manuals.

[0095] RNA extraction and quantitative PCR analysis To quantify the levels of RNA transcripts, total RNA was extracted from cells or tumors transfected with LNP-replicon RNA as indicated and reverse transcribed with TaqMan™ Reverse Transcription Reagents Kit (ABI Catalog No. N8080234), followed by amplification with Sybr Green Master Mix (Roche) and specific primers for Stat1 (Cat#MP215434), Stat2 (Cat#MP215434), IRF9 (Cat#MP206708), IRF3 (Cat#MP206702), cGAS (Cat#MP214711), and detected by a Roche LightCycler 480. Ct values ​​were normalized with the housekeeping gene mouse actin B for comparison.

[0096] Example 1: Synthetic All in One LNP Replicon RNA for Cancer Immunotherapy The therapeutic process may be simplified and the therapeutic effect amplified by synthetic multifunctional lipid nanoparticles (LNPs) encapsulating replicon RNA, where each of the lipid and RNA components fulfills multiple roles: lipid formulations that promote both cellular uptake / cytosolic delivery of RNA, while also directly triggering immunogenic cell death. In parallel, the LNPs deliver self-amplifying replicon RNAs that encode immunomodulatory therapeutic proteins and directly provide an amplification of immunostimulation and subsequent immune responses. Functionally, the synthetic LNP replicon RNA induces local immunogenic cell death in tumors and naturally also expresses immunomodulatory properties in transfected cells. Immunogenic cell death may enhance tumor infiltration by immune cells and provide a reservoir of tumor-specific antigens that can be cross-presented to prime new T cell responses. LNP formulations containing the cationic lipid TT3 were identified as particularly suitable for these goals: three cationic lipid nanoparticles were compared, each containing the key cationic lipids DOTAP, Lipofectamine (Lipo), or TT3. As RNA cargo, an alphavirus replicon derived from the Venezuelan equine encephalitis virus was used, in which the structural proteins were replaced by a cargo gene of interest inserted under a subgenomic promoter. When formulated with this self-amplifying replicon RNA (LNP-mtRep), the DOTAP, Lipo, and TT3 lipid formulations formed particles with mean nanoparticle diameters of 97, 46, and 105 nm, respectively, and zeta potentials of +22.9, -6.7, and +4.3 mv (Figures 1G-1H).

[0097] The toxicity of "empty" versus RNA-loaded (mtRep) LNPs was assessed by incubating B16F10 melanoma tumor cells with each formulation in vitro. This assay revealed that viability was significantly reduced for cells treated with TT3 LNPs, and that mtRep synergized with TT3 to further promote tumor cell killing 3 days after transfection (Figure 1A). TT3 LNPs were more effective than DOTAP or Lipo in promoting tumor cell death. Notably, direct electroporation of the replicon into tumor cells was relatively non-toxic, indicating that LNP delivery promoted cell killing. To determine whether TT3 LNP-delivered replicons could drive expression of cargo genes prior to cell death, we assessed expression of the reporter gene GFP following LNP (mtRep) treatment. TT3-mtRep treatment led to approximately 35.4% of B16F10 cells expressing GFP 12 hours after transfection, which was lower than electroporation (approximately 90%) but significantly better than DOTAP-mtRep (approximately 0.05%) or Lipo-mtRep (approximately 7.6%) treatment (Figure 1B). Consistent with Figure 1A, cells transfected with TT3 nanoparticles showed a large population of Annexin V+ / PI+ dead cells, and mtRep again synergized this cell death (Figure 1C).

[0098] To determine whether cell death triggered by TT3(mtRep) is a type of immunogenic cell death (ICD), we measured calreticulin (CRT), which generally remains on the endoplasmic reticulum (ER) and is transported to the cell surface as an eat-me signal during ICD1. TT3 and mtRep exerted a synergistic effect to promote CRT to be transported to the cell surface (Figure 1D). Extracellular ATP activates the NLRP3 inflammasome2, and extracellular HMGB1 mediates inflammation3 during ICD3. TT3, TT3-mtRep, and TT3-deRep effectively induced the release of ATP and HMGB1. (Figures 1E and 1F). Taken together, TT3-mtRepRNA is a promising oncolytic formulation that can induce immunogenic cell death while also leading to the transient expression of cargo genes encoded by the replicon.

[0099] Example 2: Replicon RNA triggers TLR3 signaling and induces the ISGF3 complex involved in necrotic cell death To determine the mechanism underlying the synergism of cell death by replicon and TT3 LNPs, DOTAP, Lipo, or TT3 nanoparticles with or without encapsulated mtRep (or encapsulated a mutant "inactive" replicon (deRep) lacking expression of a functional gene) encoding a reporter gene were transfected into reporter cells HEK-TLR2, HEK-TLR3, HEK-TLR7, or HEK-TLR9 (invivogen.com). Both Lipo and TT3 LNPs carrying mtRep or deRep activated TLR3 signaling but did not stimulate any of the other tested TLRs (Figure 2A-D). When tested on Raw-Lucia-ISG reporter cells (invivogen.com), interferon stimulated genes were significantly induced by these same LNP formulations (Figure 2E). These data suggest that TLR3 recognizes the replicon RNA and induces an interferon response in response to LNP-mediated delivery.

[0100] Replicon RNA activates the ISGF3 (Stat1 / Stat2 / IRF9) complex for necrotic cell death 5 Activates TLR3 signaling through TRIF for type I interferon production, leading to 4 To investigate this, we assayed the mRNA transcript levels of Stat1, Stat2, and IRF9, components of the ISGF3 complex, and IRF3 and cGAS, STING pathway genes, by qPCR. TT3 nanoparticles encapsulating mtRep or deRep increased the levels of Stat1, Stat2, and IRF9 by approximately 6-fold, 16-fold, and 3-fold, respectively, over untreated controls (Fig. 2F-H). In contrast, they had no effect on the transcription of IRF3 or cGAS (Fig. 2I-J). DOTAP and Lipo formulations failed to induce the ISGF3 complex (Fig. 1B), possibly due to the low transfection efficiency of replicon RNA by these nanoparticles. These data suggested that mtRep and deRep likely activated TLR3 signaling and induced the ISGF3 complex to promote necrotic cell death, a type of immunogenic cell death.

[0101] Example 3: TT3-mtRep recruits immune cells and eradicates established tumors We aimed to determine whether TT3-mtRep has an effect on immunogenic cell death and expression of cargo genes in vivo. 6 , Ly6c lo Ly6G +The absolute number of the granulocyte population was measured in the tumor 3 days after intratumoral injection of TT3 nanoparticles encapsulating wild-type replicon RNA (wtRep), another mutant replicon RNA (mt2Rep), and the mutant replicon (mtRep) used above. Unexpectedly, mtRep showed significantly greater recruitment of this granulocyte population to the tumor (about 2-fold higher) (Figure 3A) and better expression of the subgenomic promoter-encoded genes (Figure 3B). Thus, TT3-mtRep induces immunogenic cell death together with expression of the appropriate cargo genes. In vivo studies using TT3-mtRep were subsequently performed.

[0102] Following intratumoral LNP delivery of the replicon, we measured the in vivo expression levels of Stat1 / Stat2 / IRF9 and the STING signaling genes IRF3 and cGAS. Consistent with Figures 2F-J in vitro, TT3-mtRep-injected tumors expressed significantly higher Stat1 / Stat2 / IRF9 (ISGF3 complex), but expressed comparable levels of IRF3 and cGAS (Figure 3C), suggesting that administration of TT3-mtRep also initiated necrotic cell death in vitro.

[0103] To better understand the effect of TT3-mtRep on the immune composition in tumors, we investigated the effect of TT3-mtRep on granulocytes (CD45 + CD11b + Ly6c lo Ly6G + ), M-MDSCs (CD45 + CD11b + Ly6c hi Ly6G + ), monocytes (D45 + CD11b + Ly6c lo Ly6G - ), macrophages (CD45 + CD11b + Ly6c - Ly6G - F4 / 80 + ), CD4 T (CD45 + CD3ε+ CD4 + ), CD8 T(CD45 + CD3ε + CD8 + ), NK(CD45 + CD3ε - NK1.1 + ), NKT(CD45 + CD3ε + NK1.1 + ), conventional DC1 (cDC1, CD45 + CD11c + MHC-II + CD24 + CD64 - CD103 + CD11b - XCR1 hi ), and conventional DC2 (cDC2, CD45 + CD11c + MHC-II + CD24 + CD64 - CD103 + CD11b + XCR1 lo Immune cells such as CD4 T cells, CD8 T cells, CD9 T cells, and CD1 T cells were mapped and quantified in tumors 1 day (Fig. 3D) and 3 days (Fig. 3E) after a single injection of LNP-replicon RNA, and 1 day after three sequential injections (Fig. 3F). In this dynamic analysis of immune composition in tumors, granulocytes and cDC1 were rapidly recruited and decreased, respectively, 1 day after injection of replicon RNA (Fig. 3C), suggesting that granulocytes are an early event and cDC1 probably start to traffic to tumor-draining lymph nodes in response to LNP-replicon RNA. At 3 days after injection of replicon RNA, CD4 T, CD8 T, NK, and NKT cells were also recruited (Fig. 3D).

[0104] When three sequential injections of LNP-replicon RNA were administered, monocytes were increased and macrophages were decreased, but no significant changes were observed in lymphoid cells such as CD4 T, NK, and NKT cells (Figure 3E). The effect of these approximately three sequential injections was approximately 10% more cell death (Figure 3F), approximately 4-fold higher tumor-infiltrating immune cells (Figure 3G), and a two-fold reduction in tumor weight (Figure 3H) in samples from the TT3-mtRep group, resulting in a significant regression of tumor growth (Figure 3I). Consistent with the increase in NK and NKT cells associated with TT3-mtRep treatment, the expression of CCL5 was significantly induced (Figure 3I), which is mainly secreted by NK. 7 , and activated CD8 T cells (rstats.immgen.org / Skyline / skyline.html). These data indicate that TT3-mtRep induced immunogenic cell death in tumors along with the expression of cargo genes, as observed in vitro in Figure 1 and Figure 2. Most importantly, TT3-mtRep significantly regulated the tumor microenvironment and led to tumor recruitment of CD8 T cells and NK cells.

[0105] Example 4: TT3-mtRep encoding IL12-MSA or IL12-MSA-lumican together effectively modulates the tumor microenvironment and immune composition Intratumoral injection of TT3 (mtRep) encoding a reporter gene led to delayed tumor growth, while encoding immunomodulatory proteins in the replicon could lead to further immune stimulation and enhanced antitumor immunity. An attractive candidate is IL-12, which can differentiate CD4 T helpers into Th1 and enhance the cytotoxic effect of NK and CD8 T cells. 8 One of the subunits of IL12, also named IL12b or IL12p40, is expressed primarily by antigen-presenting cells (CD8 + DCs) (rstats.immgen.org / Skyline / skyline.html), which can be functionally activated by type I interferons. 9However, interferon α2 (IFNα2), the major form of type I interferon, was low in either serum (Figure 4A) or tumor (Figure 4B) on days 1 and 3 after TT3-mtRep injection, suggesting that IL-12 secreted by DCs would remain low in the tumor microenvironment (TME). Therefore, we designed IL12-MSA or IL12-MSA-lumican by fusing IL12α (P30), IL12β (P40) with mouse serum albumin (MSA), or MSA and lumican. Lumican is an endogenous collagen-binding protein, and we reasoned that it would promote the retention of IL-12 expressed on it in the TME, enhancing the efficacy and safety of replicon therapy. The replicon construct was transfected into B16F10 cells by NEON transfection in vitro, and we confirmed the secretion of IL-12 in these transfected cells by ELISA (FIG. 4C).

[0106] Consistently, tumors injected with TT3-mtRep encoding IL12-MSA (TT3-mtRep-IL12-MSA) or IL12-MSA-lumican (TT3-mtRep-IL12-MSA-lumican) expressed high levels of IL12 in vivo, reaching 40 ng / mg in tumors (Figure 4D). Comparing the immune composition in tumors 1 day after injection, granulocytes were increased 1.5-3 fold in tumors treated with TT3-mtRep expressing IL12-MSA and IL12-MSA-lumican, in contrast to the group treated with TT3-mtRep encoding the reporter gene mCherry (Figure 4E). On day 3, the IL12-MSA and IL12-MSA-lumican groups recruited approximately 2-3 times higher granulocytes, CD8 T cells, and cDC2 cells to the tumor compared to the replicon encoding an unrelated reporter gene (Figure 4F). Interestingly, tumors treated with TT3-mtRep encoding a reporter gene, IL12-MSA, or IL12-MSA-lumican all showed a decrease in cDC1 cells compared to the untreated group (Figure 4E-4F). To determine whether cDC1s are transported to the TDLN, we counted cDC1 cells there and showed that cDC1 cells in lymph nodes were significantly increased after TT3-mtRep treatment, no matter which cargo gene was encoded (Figure 4G). The increase in cDC1 cells continued in the IL12-MSA group (Figure 4G).

[0107] Example 5: Immunomodulatory IL12 and ICD induced by TT3-mtRep effectively eradicate B16F10 tumors Because administering IL12 protein has severe side effects in clinical studies, we measured the body weight change of tumor-bearing mice treated with replicon-encoded IL-12. The mtRep-IL12-MSA group had about 5% body weight loss that lasted for a week. In contrast, the mtRep and mtRep-IL12-MSA-lumican groups had only about 2% body weight loss and recovered within a few days (Figure 5A). Consistently, we failed to measure IL-6 or TNFα in serum on the first or third day after injection of mtRep-IL12-MSA or mtRep-IL12-MSA-lumican (data not shown). However, we observed a significant increase in IFN-γ in serum in the mtRep-IL12-MSA group (Figure 5B), consistent with the body weight loss in Figure 5A. Interestingly, replicons expressing IL12-MSA or IL12-MSA-lumican were 50 mm in size at the time of treatment. 2 Even some large established tumors showed dramatic tumor regression (Figure 5C). Tumor-bearing mice treated with IL12-MSA and TT3-mtRep encoding IL12-MSA-lumican were 60% and 80% tumor-free, respectively, 75 days after injection of B16F10. To determine whether these treated mice elicited a systemic immune response that prevented B16F10 tumor recurrence, these mice were immunized with 100,000 B16F10 cells in the contralateral flank. As expected, all treated mice rejected B16F10 tumors compared to naive mice that rapidly developed B16F10 tumors. These data indicate that the synergy of immunomodulatory IL12 and ICD (immunogenic cell death) can effectively eradicate B16F10 tumors and induce a systemic immune response to prevent B16F10 tumor recurrence.

[0108] References: [Table 2-1] [Table 2-2]

[0109] Other Aspects All features disclosed herein may be combined in any combination. Each feature disclosed herein may be replaced by an alternative feature serving the same, equivalent, or similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is only an example of a generic series of equivalent or similar features. From the above description, those skilled in the art can easily ascertain the essential features of the present invention, and can make various changes and modifications to the present invention to adapt it to various usages and conditions without departing from the spirit and scope thereof. Therefore, other embodiments are also within the scope of the claims.

[0110] Equivalent Although several inventive aspects have been described and illustrated herein, those skilled in the art will readily envision various other means and / or structures for performing the functions described herein and / or obtaining the results and / or one or more advantages described herein, and each of such variations and / or modifications will be deemed to be within the scope of the inventive aspects described herein. More generally, those skilled in the art will readily appreciate that all parameters, dimensions, materials, and configurations described herein are meant to be exemplary, and that the actual parameters, dimensions, materials, and / or configurations will depend on the particular application(s) for which the teachings of the present invention are used. Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, many equivalents to the specific inventive aspects described herein. Thus, the above embodiments are presented by way of example only, and it should be understood that, within the scope of the appended claims and their equivalents, the inventive aspects may be practiced otherwise than as specifically described and claimed. The inventive aspects of the present disclosure are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more of such features, systems, articles, materials, kits, and / or methods, where such features, systems, articles, materials, kits, and / or methods are not mutually inconsistent, is encompassed within the inventive scope of the present disclosure.

[0111] All definitions defined and used herein should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the terms defined. All references, patents, and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, and in some cases may include incorporation of the document in its entirety.

[0112] As used in the specification and claims, the indefinite articles "a" and "an" should be understood to mean "at least one," unless clearly indicated to the contrary. As used herein and in the claims, the phrase "and / or" should be understood to mean "either or both" of the elements so conjoined, i.e., the elements are conjunctive in some cases and disjunctive in other cases. Multiple elements listed with "and / or" should be interpreted in the same manner, i.e., "one or more" of the elements so conjoined. Other elements, other than the elements specifically identified by the "and / or" clause, may optionally be present, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, when used in conjunction with an open-ended term such as "comprising," a reference to "A and / or B" may refer in one embodiment to only A (optionally including elements other than B); in another embodiment to only B (optionally including elements other than A); in yet another embodiment to both A and B (optionally including other elements); and so forth.

[0113] As used in this specification and the claims, "or" should be understood to have the same meaning as "and / or" as defined above. For example, when items in a list are separated, "or" or "and / or" should be interpreted to be inclusive, i.e., to include not only the inclusion of at least one of the number or list elements, but more than one, and, optionally, to include additional unlisted items. Only terms clearly indicating to the contrary, such as "only one of" or "exactly one of," or, when used in the claims, "consisting of," will refer to the inclusion of exactly one element of the number or list elements. In general, the term "or" as used herein should be construed to refer to exclusive alternatives (i.e., "one or the other, but not both") only when it is preceded by exclusive terms such as "either," "one of," "only one of," or "exactly one of." When used in the claims, "Consisting essentially of" should have its ordinary meaning as used in the field of patent law.

[0114] As used herein and in the claims, the phrase "at least one" in connection with a list of one or more elements should be understood to mean at least one element selected from any one or more of the elements in the list of elements, but not necessarily inclusive of at least one of each and every element specifically listed in the list of elements, and not exclusive of any combination of elements in the list of elements. This definition also allows for the optional presence of elements other than the elements specifically identified in the list of elements to which the phrase "at least one" refers, whether related or unrelated to those elements specifically identified. Thus, as a non-limiting example, "at least one of A and B" (or, equivalently, "at least one of A or B" or, equivalently, "at least one of A and / or B") can refer to, in one embodiment, at least one where B is not present, optionally including one or more As (and optionally including elements other than B); in another embodiment, at least one where A is not present, optionally including at least one, optionally including one or more Bs (and optionally including elements other than A); in yet another embodiment, at least one where optionally including one or more As, and at least one where optionally including one or more Bs (and optionally including other elements); and so forth.

[0115] Unless expressly indicated to the contrary, in any method claimed herein that includes more than one step or act, it should be understood that the order of the method steps or acts is not necessarily limited to the order in which the method steps or acts are recited.

Claims

1. (i) lipid nanoparticles comprising one or more types of lipids; and (ii) a self-amplifying replicon RNA containing a sequence encoding an interleukin (IL)-12 molecule; 1. A synthetic oncolytic virus comprising: wherein the lipid nanoparticles are capable of causing immunogenic cell death, and wherein the IL-12 molecule is expressed by a self-amplifying replicon RNA; The synthetic oncolytic virus.

2. 2. The synthetic oncolytic virus of claim 1, wherein the one or more types of lipids include cationic lipids.

3. 3. The synthetic oncolytic virus of claim 2, wherein the cationic lipid is N1,N3,N5-tris(3-(didodecylamino)propyl)benzene-1,3,5-tricarboxamide (TT3).

4. 3. The synthetic oncolytic virus of claim 2, wherein the lipid nanoparticle comprises TT3, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), cholesterol, and C14-PEG2000.

5. The synthetic oncolytic virus of any one of claims 1 to 4, wherein the self-amplifying replicon RNA is derived from an alphavirus or a hepatitis C virus.

6. 6. The synthetic oncolytic virus of claim 5, wherein the alphavirus is Venezuelan equine encephalitis virus, Semliki Forest virus, or Sindbis virus.

7. The synthetic oncolytic virus of any one of claims 1 to 6, wherein the sequence encoding the IL-12 molecule is located in the subgenomic region of the self-amplifying replicon RNA.

8. The synthetic oncolytic virus of any one of claims 1 to 7, wherein the self-amplifying replicon RNA comprises a nucleotide sequence that is at least 90% identical to SEQ ID NO:

1.

9. 9. The synthetic oncolytic virus of claim 8, wherein the self-amplifying replicon RNA is not identical to and is capable of expressing an IL-12 molecule at a higher level compared to a self-amplifying replicon RNA that is not identical to and includes SEQ ID NO:

1.

10. 10. The synthetic oncolytic virus of claim 9, wherein the replicon RNA comprises the point mutations G3936C and / or A4758G of SEQ ID NO:

1.

11. The synthetic oncolytic virus of any one of claims 1 to 10, wherein the self-amplifying replicon RNA further comprises a serum albumin coding sequence.

12. The synthetic oncolytic virus of any one of claims 1 to 11, wherein the self-amplifying replicon RNA further comprises a lumican coding sequence.

13. 13. The synthetic oncolytic virus of any one of claims 1 to 12, wherein the IL-12 molecule is selected from the group consisting of IL-12, an IL-12 subunit, or a mutant IL-12 molecule that retains immunomodulatory function.

14. 14. The synthetic oncolytic virus of claim 13, wherein the IL-12 molecule comprises an IL-12α and / or IL-12β subunit.

15. The synthetic oncolytic virus of any one of claims 1 to 14, wherein the lipid nanoparticle has a diameter of about 100 to 120 nm.

16. The synthetic oncolytic virus of any one of claims 1 to 15, wherein the lipid nanoparticle has a zeta potential of about 3 to 6 mV.

17. 17. The synthetic oncolytic virus of any one of claims 1 to 16, wherein the lipid and the self-amplifying replicon RNA have a mass ratio of about 1:

1.

18. A pharmaceutical composition comprising the synthetic oncolytic virus of any one of claims 1 to 17 and a pharma- ceutically acceptable carrier.

19. 20. The pharmaceutical composition of claim 18, formulated for intratumoral injection.

20. 20. A method for treating cancer in a subject in need thereof comprising administering to the subject an effective amount of the synthetic oncolytic virus of any one of claims 1 to 17 or the pharmaceutical composition of claim 18 or 19.

21. 21. The method of claim 20, wherein the subject is a human patient having or suspected of having cancer.

22. 22. The method of claim 21, wherein the human patient has a cancer selected from the group consisting of melanoma, breast cancer and colon cancer.

23. The method of any one of claims 19 to 22, wherein the synthetic oncolytic virus or pharmaceutical composition is administered to the subject in a single dose.

24. The method of any one of claims 19 to 23, wherein the synthetic oncolytic virus or pharmaceutical composition is administered to the subject by intratumoral, intramuscular, subcutaneous, or intravenous injection.

Images