Novel oxo-RNA compositions and related applications thereof

Abstract

To provide novel modified RNA compositions referred to as oxo-RNA, comprising at least one oxo-nucleotide (oxopurine) at its 3' terminal region (e.g., 3' tail, 3'-UTR).SOLUTION: Oxonucleotides include 8-hydroxyguanine / 8-oxoguanine / 7,8-dihydro-8-oxoguanine (called oxo-G / oxo-dG) and 8-hydroxyadenine / 8-oxoadenine (called oxo-A / oxo-dA). The oxo-RNA may be a single stranded RNA sequence or a double stranded duplex or even an RNA-DNA hybrid duplex. This novel oxo-RNA composition, not only greatly enhances the stability and functionality of RNA / DNA but also can prevent TREX1-mediated degradation and related non-specific immune hyperactivity such as cytokine storm.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to novel modified RNA compositions that contain at least one oxo-nucleotide (oxopurine) in the sequence, such as 8-hydroxyguanine / 8-oxoguanine / 7,8-dihydro-8-oxoguanine (oxo-G / oxo-dG) and 8-hydroxyadenine / 8-oxoadenine (oxo-A / oxo-dA). Such novel modified RNA compositions, which may be in single-stranded or double-stranded conformation, or a combination thereof, are called "oxo-RNA". Preferably, the oxo-nucleotide is added to the 3'-terminal region (e.g., 3'-tail, 3'-UTR) of the oxo-RNA sequence to prevent TREX1-mediated degradation, no-go decay (NGD), and associated non-specific immune hyperactivity (e.g., cytokine storm). Oxo-RNA constructs are designed to mimic antisense RNA oligonucleotides (aRNA-ASOs), short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA) mimics, microRNA precursors (pri- / pre-miRNA), double-stranded RNA (dsRNA), RNA-DNA hybrids, long non-coding RNA (lncRNA), small activating RNA (saRNA), messenger RNA (mRNA), and / or self-amplifying RNA / mRNA (saRNA / samRNA), or combinations thereof. To facilitate delivery / transfection into cells of interest in vitro, ex vivo, and in vivo, the oxo-RNA compositions may be mixed, bound, encapsulated, or formulated with at least one reagent selected from, but not limited to, liposomes, nanoparticles, liposomal nanoparticles (LNPs), multivesicular body (MVB) agents, exosomes, triglycylglycerin (TGG)-derived agents, sugar / glucosamine / galactosamine-based binding molecules, injectable agents, gene gun materials, electroporation agents, and / or transposons / retrotransposons, or combinations thereof.Once delivered / transfected into the desired target cells, the designed oxo-RNA can be used to act as a vaccine and / or drug to treat a variety of human diseases, including, but not limited to, Alzheimer's disease (AD), Parkinson's disease (PD), spinal muscular atrophy (SMA), motor neuron disease (MND), stroke, diabetes, myocardial infarction, hemophilia, anemia, leukemia, many types of cancer, and various viral and bacterial infections. [CROSS REFERENCE TO RELATED APPLICATIONS]

[0002] This international application claims priority to U.S. Provisional Patent Application No. 63 / 531,004, entitled "Novel In-Cell Transcription (ICT) Composition and the Related Vaccine Medicine Designs Thereof," filed in the U.S. Patent and Trademark Office on August 6, 2023, and to U.S. Provisional Patent Application No. 17 / 489,357, entitled "Novel mRNA Composition and Production Method for Use in Anti-Viral and Anti-Cancer Vaccines," filed in the U.S. Patent and Trademark Office on September 29, 2021, and the proposed application is a continuation-in-part (CIP) of U.S. Provisional Patent Application No. 17 / 489,357, entitled "Novel mRNA Composition and Production Method for Use in Anti-Viral and Anti-Cancer Vaccines," filed in the U.S. Patent and Trademark Office on September 29, 2021, and the proposed application is a continuation-in-part (CIP) of U.S. Provisional Patent Application No. 17 / 489,357, entitled "Novel mRNA Composition and Production Method for Use in Anti-Viral and Anti-Cancer Vaccines," filed in the U.S. Patent and Trademark Office on October 9, 2023. This is a continuation-in-part (CIP) of U.S. Provisional Patent Application No. 18 / 378,088, entitled "Induced Cytoplasmic IVT (ICIVT)-like Composition and the Related Vaccine Medicine Designs Thereof." The entire contents of the aforementioned prior patent application are incorporated by reference into this international application. [Background technology]

[0003] Oxo-nucleotides (i.e., oxopurines) such as 8-hydroxyguanine (=8-oxoguanine, e.g., oxo-G / oxo-dG) and 8-hydroxyadenine (=8-oxoadenine, e.g., oxo-A / oxo-dA) are oxidized purines commonly found in cancer cells (especially skin cancer cells). It has already been shown that oxo-nucleotides present in the middle of DNA / RNA sequences cause mismatch mutations, such as the mutation of G::C to oxo-G::A pairing. In addition, oxo-nucleotides cause the accumulation of stalled ribosomes during mRNA translation, thereby causing no-go decay (NGD) of mRNA (Boo and Kim, Exp. Mol. Med. 52:400-408, 2020). Therefore, normally, a skilled artisan in this field would not consider in advance the use of any oxo-nucleotides when designing a DNA / RNA vaccine or drug. However, the present invention discloses for the first time the design of a novel RNA composition with oxo-nucleotides in the 3'-end tail to prevent TREX1-mediated degradation, NGD, and related non-specific immune hyperactivity (e.g., cytokine storm). In the design of the present invention, oxo-nucleotides are preferably added to the 3'-end region (e.g., 3'-tail, 3'-UTR) of the DNA / RNA construct sequence, so there is no need to worry about mismatch mutations or ribosome stalling problems.

[0004] 3' (Three prime) repair exonuclease 1 (TREX1) is the most abundant 3'-5' exonuclease in mammalian cells that degrades single- and double-stranded DNA (ssDNA / dsDNA), single-stranded RNA, and DNA-RNA hybrid sequences (Yuan et al., J. Biol. Chem. 290:13344-13353, 2015). To overcome this problem, RNA / DNA-based molecules are used as vaccines and / or drugs, although our claimed priority invention of induced cytoplasmic IVT (ICIVT)-like compositions (Lin et al., U.S. Patent Application Serial No. 18 / 378,088) already discloses the use of DNA and mRNA with oxo-nucleotides in the 3' tail to prevent TREX1-mediated degradation and associated nonspecific immune response activity. However, there is no sufficient disclosure of the use of oxo-nucleotides in the design of various modified non-coding RNA (ncRNA) constructs, including, but not limited to, antisense RNA oligonucleotides (aRNA-ASO), short interfering RNA (siRNA), short hairpin RNA (shRNA), double-stranded RNA (dsRNA), small activating RNA (saRNA), and microRNA (miRNA) / microRNA precursor (pre-miRNA). Thus, the present invention provides a novel design and related uses of these oxo-nucleotide modified ncRNAs (referred to as oxo-ncRNA). Summary of the Invention [Problem to be solved by the invention]

[0005] The principles of the present invention are based on the design of novel compositions described in priority claim US patent application Ser. No. 18 / 378,088 (Lin et al.). By incorporating at least one oxo-nucleotide (oxopurine), such as 8-hydroxyguanine / 8-oxoguanine (oxo-G / oxo-dG) and / or 8-hydroxyadenine / 8-oxoadenine (oxo-A / oxo-dA) into the 3'-end (e.g., 3'-tail, 3'-UTR) of the designed RNA / DNA construct, the resulting oxo-RNA / oxo-DNA composition bypasses TREX1-mediated rapid degradation and delivers the full functional specificity and effect of the designed RNA / DNA to the targeted cells of cancer without worrying about RNA / DNA stability or non-specific immune hyperactivity issues. It should be noted that oxo-nucleotide modified RNA (oxo-RNA) further bypasses the cellular cGAS-STING pathway, thus preventing any possible overactivation of inflammatory cytokine responses (or called cytokine storm). Clearly, this key novelty represents an important breakthrough for the safe use of related RNA-based vaccines and drugs. Currently, both fast degradation and non-specific immune response activity are significant problems that are major obstacles to the clinical use of RNA / DNA-based platform constructs as vaccines and drugs, and clearly limit the usefulness of small non-coding RNA (e.g., siRNA, shRNA, and miRNA) and long protein / peptide coding mRNA platform constructs.

[0006] Due to the tight regulation of RNA-induced silencing complex (RISC) formation during RNA interference (RNAi)-mediated gene silencing events, several previously reported nucleotide modifications have not offered clear advantages over conventional siRNA or shRNA design. For example, reports have shown that pseudouridine modifications at the 5'-end or middle region of siRNAs provide low efficacy, and at the 3'-end show only limited prominence. In addition, two thymidine nucleotides (referred to as TT overhangs) are often added to the 3'-end of conventional siRNAs to increase the thermodynamic stability of siRNA duplex constructs, but this leads to TREX1-mediated degradation in cells and greatly reduces the gene silencing effect that occurs. To solve this problem, the present invention discloses for the first time that siRNA and shRNA constructs having an oxo-nucleotide (*dG) at the 3'-end tail (i.e., oxo-siRNA and oxo-shRNA, respectively) can be used to form effective RISC in cells and inactivate the expression of the target gene of the designed siRNA and / or shRNA without losing its target specificity or gene knockdown effect (see Figure 1).

[0007] In addition, the RNA (oxo-RNA) composition having oxo-nucleotides at the 3'-end tail of the present invention not only prevents TREX1-mediated degradation, but also strongly suppresses possible non-specific immune hyperactivity, especially significantly reducing the stimulated expression of key inflammatory cytokines / factors (e.g., IL-1β, IL-6, TNFα, interferon-γ, and GM-CSF) (Figure 2). This finding clearly indicates the importance and urgent need to use oxo-siRNA / oxo-shRNA to replace traditional siRNA / shRNA constructs and to research and develop novel RNA interference (RNAi)-based drugs and / or therapies to overcome the unsolved clinical problem of non-specific immune hyperactivity (especially cytokine storm).

[0008] In one preferred embodiment of the present invention, the designed oxo-RNA construct is an RNA duplex, such as siRNA, dsRNA, and saRNA, which contains at least one oxo-nucleotide modification at the 3' end of both strands of the RNA duplex sequence, protecting both strands from RNA degradation. Therefore, this double-stranded oxo-nucleotide modification is designed as siRNA, dsRNA, and saRNA construct to provide the best protection, not only preventing TREX1-mediated degradation, but also preventing degradation induced by many other RNA degrading enzymes.

[0009] In another preferred embodiment of the present invention, the designed oxo-RNA construct contains at least one oxo-nucleotide modification in only one strand of the duplex structure of siRNA, dsRNA, and / or saRNA, which preferentially protects one required strand while degrading the other strand. This method preferentially selects the required RNA strand (presenting oxo-RNA form) and provides a great advantage for forming RISC or RITA complex, thereby generating highly functional effect, specificity, and low off-target side effects. It should be noted that this partial oxo-RNA modification design is apparently a completely new RNA platform construct that solves the non-specific strand selection problem of conventional siRNA, dsRNA, and saRNA.

[0010] In yet another preferred embodiment of the present invention, the designed oxo-RNA constructs are single-stranded RNAs (ssRNAs), such as aRNA-ASO, shRNA, miRNA, pri- / pre-miRNA, and mRNA / saRNA / samRNA, that contain at least one oxo-nucleotide at the 3'-terminal region to protect the RNA sequence from any possible 3'-5' exonuclease degradation. It should be noted that such single-stranded oxo-RNA compositions have been shown to enhance the efficacy and duration of RNA function (e.g., mRNA translation), as described, for example, in U.S. Patent Application No. 18 / 378,088 (Lin et al.), from which we claim priority.

[0011] To further enhance the stability of the oxo-RNA, the U (uridine / uracil) content of the oxo-RNA can be fully or partially replaced by at least one modified U analogue (e.g., pseudouridine (p), methyluridine (t / tm / um), methylpseudouridine (fm / m1f), methoxyuridine (mo5U), and / or other nucleotide-like analogues, or combinations thereof). Alternatively, the C (cytosine / cytidine) content of the oxo-RNA can be fully or partially replaced by 5-methylcytidine (m 5 C) or N4-acetylcytidine (ac 4 The oxo-nucleotide modifications can further be fully or partially replaced by U, C, or both. Conceivably, one oxo-RNA can contain both U and C analog modifications. Thus, oxo-nucleotide modifications can be used in combination with other nucleotide modifications to further improve the stability and efficacy of non-coding RNAs (e.g., siRNAs, shRNAs, and / or miRNAs) and protein / peptide-coding mRNAs.

[0012] In U.S. Patent Application No. 18 / 378,088, from which we claim priority, we have already disclosed the design of a novel promoter-linked RNA / mRNA-encoding DNA (PLRcD) construct, which induces the amplification of an IVT-like RNA / mRNA in the cytoplasm of the target transfected cells, thereby generating a cytoplasmic RNA / mRNA expression system in the cells. The PLRcD construct inserts at least one internal ribosome entry site (IRES)-linked Kozak motif (IRES-kozak) in the 5'-UTR region located between the promoter and the RNA / mRNA coding sequence. In addition, to activate the expression of the encoded RNA / mRNA, the designed PLRcD construct needs to be co-transfected with at least one DNA-dependent RNA polymerase (DdRP) mRNA, including, but not limited to, T7, T3, and / or SP6 DdRP mRNA. It should be noted that, to prevent non-specific interferon-associated immune activation and TREX1-mediated degradation, the designed PLRcD constructs are dephosphorylated at the 5'-end and have at least one 8-hydroxyguanine / 8-oxoguanine (8-OHG / 8-oxo-G) and / or its derived nucleotide analogues, in particular 8-hydroxy-2-deoxyguanosine (8-OHdG / 8-oxo-dG), respectively, in the 3'-end tail, and the DdRP mRNA is 5'-capped with m7G(5')ppp(5')N (m7G, cap-0) and / or its related cap (i.e., cap-1 and / or cap-2) analogues, respectively, and further have at least one modified nucleotide analogue (e.g., 3'-cap modified G / U / A molecule, 8-oxo-G / dG, 8-oxo-A / dA and / or 5'-phosphorothioate-U) in the tail of the 3'-end region.

[0013] For the incorporation of 5'-cap, the capping enzymes include, but are not limited to, coronavirus NSP12, NSP9 / 14, NSP10 / 16, and / or vaccinia capping enzyme, and 2'-O-methyltransferase, or combinations thereof. For the incorporation of 3'-oxo-nucleotides (or previously referred to as 3'-cap), preferably terminal deoxynucleotidyl transferase (TdT), terminal uridylyl transferase, and / or polymerase θ are used. Alternatively, another preferred method is to use an oligonucleotide synthesizer to mechanically synthesize oxo-nucleotides at the 5' / 3' ends of RNA / DNA. In addition, to further prevent non-specific immune hyperactivity, the nucleotide content of oxo-RNA / DNA may be further fully or partially modified with other modified nucleotides (e.g., pseudouridine, methyluridine, methylpseudouridine, methoxyuridine, methylcytidine, acetylcytidine, and / or any other analogues similar to nucleotides, or combinations thereof).

[0014] A Kozak motif is a nucleotide sequence of 5'-RCCRCC-3' (SEQ ID NO:1; R is A or G) or 5'-RCCDCC-3' (SEQ ID NO:2; D is A, G, or T / U), and an IRES may contain at least one homologue of the following hairpin / stem-loop sequences, where the contents U (uracil / uridine) and T (thymine / thymidine) are interchangeable, including, but not limited to, the following sequences: [1] (1) 5'-GCUCCCUUCA ACUUUAACAU GGAAGUGCUU UCUGUGACUU UAAAAGUAAG UGCUUCCAUG UUUUAGUAGG AGU-3' (73-nt) (SEQ ID NO:3) (2) 5'-CCUUUGCUUU AACAUGGGGG UACCUGCUGU GUGAAACAAA AGUAAGUGCU UCCAUGUUUC AGUGGAGG-3' (68-nt) (SEQ ID NO:4) (3) 5'-CCACCACUUA AACGUGGAUG UACUUGCUUU GAAACUAAAG AAGUAAGUGC UUCCAUGUUU UGGUGAUGG-3' (69-nt) (SEQ ID NO:5) (4) 5'-CCUCUACUUU AACAUGGAGG CACUUGCUGU GACAUGACAA AAAUAAGUGC UUCCAUGUUU GAGUGUGG-3' (68-nt) (SEQ ID NO:6) (5) 5'-CUGUGUGGCU GUCACUCGGC UGCAUGCUUA GUGCACUCAC GCAG-3' (44-nt) (SEQ ID NO:7) (6) 5'-CUGUGUGGCU GUCACUCGGC UGCAUGCUUA GUGCACUCAC GCAGUAUAAU UAAUAACUAA UUACU-3' (65-nt) (SEQ ID NO:8) (7) 5'-GUCGUUGACA GGACACGAGU AACUCGUCUA UCUUCUGCAG GCUGCUUACG GUUUCGUCCG UGUUGCAGCC GAUCAUCAGC ACAUCUAGGU UUCGUCCGGG UGUGACCGAA AGGUAAGAUG GAGAGCCUUG UCCCUGGUU-3' (14GQ-Q-Q) ID NO:9) (8) 5'-AAUUAUAAAU UACCAGAUGA UUUUACAGGC UGCGUUAUAG CUUGGAAUUC UAACAAUCUU GAUUCUAAGG UUGGUGGUAA UUAUAAUU-3' (88-nt) (SEQ ID NO:10) (9) 5'-CACAAAUAUU ACCAGAUCCA UCAAAACCAA GCAAGAGGUC AUUUAUUGAA GAUCUACUUU UCAACAAAGU GACACUUGCA GAUGCUGGCU UCAUCAAACA AUAUGGUGAU UGCCUUGGUG AUAUUGCUG-3' (129) ID: (129) NO (10) 5'-GCAAAAAUGU GAUCUUGCUU GUAAAUACAA UUUUGAGAGG UUAAUAAAUU ACAAGUAGUG CUAUUUUUGU AUUUAGGUUA GCUAUUUAGC UUUACGUUCC AGGAUGCCUA GUGGCAGCCC CAGAAAGCUCCUCCUGCUGCU UUUCAGAUUC GUUAGUCGAA AAACCUAAGA AAUUUAAUG-3' (189-nt) (SEQ ID NO:12) (11) 5'-CACUCCCCUG UGAGGACUAC UGUCUUCACG CAGAAAGCGU CUAGCCAUGG CGUUAGUAUG AGUGUCGUGC AGCCUCCAGG ACCCCCCCUC CCGGGAGAGC CAUAGUGGUC UGCGGAACCG GUGAGUACAC CGGAAUUGCC AGGAAGGACCCG UCCGAUCCUC CGCUCAAUGC CUGGAGAUUU GGGCGUGCCC CCGCGAGACU GCUAGCCGAG UAGUGUUGGG UCGCGAAAGG CCUUGUGGUA CUGCCUGAUG GGUGCUUGCG AGUGCCCCGG GAGGUCUCGU AGAC-3' (294-nt) (SEQ ID NO:13) (12) 5'-GGACACGAGU AACUCGUCUA UCUUCUGCAG GCUGCUUACG GUUUCGUCCG UGUUG-3' (55-nt) (SEQ ID NO:14) (13) 5'-CAGCCGAUCA UCAGCACAUC UAGGUUUUGU CCGGGUGUGA CCGAAAGGUA AG-3' (52-nt) (SEQ ID NO:15)

[0015] For the implementation of induced cytoplasmic IVT-like transcription (ICIVT), our priority application US patent application Ser. No. 18 / 378,088 further discloses a novel method of co-transfecting at least one designed PLRcD template and at least one DdRP mRNA (e.g., T7, T3, and / or SP6 DdRP mRNA) into a desired target cell. The newly transcribed RNA / mRNA product (located in the cytoplasm / cytosol) may not carry any suitable 5'-cap structure, and the inventive IRES-Kozak motif of the designed PLRcD template acts as an internal ribosome entry site (IRES) to promote ribosome biogenesis of the transcribed mRNA and activate protein / peptide synthesis. At the same time, the IRES-linked Kozak motif marks the precise start position of mRNA translation, thus promoting highly accurate and efficient protein / peptide synthesis. However, apart from coding for protein / peptide mRNA, the RNA encoded by PLRcD can also be antisense RNA oligonucleotides (aRNA-ASOs), small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), small activating RNAs (saRNAs), and / or non-coding RNAs (ncRNAs) such as microRNAs (miRNAs) / pre-miRNAs (pre-miRNAs), all of which do not require the IRES-Kozak motif for their functions.

[0016] IRES are highly structured nucleotide sequences, often containing hairpin-like and / or stem-loop structures. To generate highly structured PLRcD templates, we have already developed a novel PCR-IVT method in our other priority claim U.S. Patent Application No. 17 / 489,357 ('357), which uses a specific helicase activity to overcome the problem of low efficiency of amplifying highly structured RNA by conventional IVT reaction. Since the hairpin-like stem-loop structure resembles the intrinsic transcription termination signal of prokaryotic RNA polymerase (McDowell et al., Science 266:822-825, 1994), the '357 method employs a novel IVT system that utilizes a mixture of RNA polymerase and helicase activity to overcome this problem. In this way, the additional helicase activity during IVT clearly reduces the secondary structure of the designed PLRcD template and the acquired RNA / mRNA product, thereby achieving high productivity of RNA / mRNA amplification. Our study identifies coronavirus NSP7 and NSP13 proteins as two suitable helicases for enhancing the amplification efficiency of IVT and ICIVT.

[0017] To facilitate delivery / transfection of the designed oxo-RNA construct(s) to a desired target cell in vitro, ex vivo and / or in vivo, the designed oxo-RNA composition may be mixed, combined, encapsulated and / or formulated with at least one delivery / transfection agent selected from, but not limited to, liposomes, nanoparticles, liposomal nanoparticles (LNPs), exosomes, sugar / glucosamine / galactosamine based binding molecules, injection / infusion agents, glycylglycerin derived molecules, gene gun materials, electroporation agents, and / or transposons / retrotransposons, or combinations thereof.

[0018] A.Definition To facilitate the understanding of this invention, several terms are defined below.

[0019] Nucleic Acid: A polymer of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), either single-stranded or double-stranded.

[0020] Nucleotide: A monomeric unit of DNA or RNA that consists of a sugar moiety (pentose), a phosphate ester, and a nitrogen-containing heterocyclic base. The base is attached to the sugar moiety by the glycosidic carbon (the 1' carbon of the pentose), and the combination of base and sugar is a nucleoside. A nucleoside that contains at least one phosphate ester group attached to the 3' or 5' position of the pentose is a nucleotide. DNA and RNA are composed of different types of nucleotide units called deoxyribonucleotides and ribonucleotides, respectively.

[0021] Deoxyribonucleoside triphosphates (dNTPs): Building block molecules used in DNA synthesis, including dATP, dGTP, dCTP, and dTTP, and optionally further including some modified deoxyribonucleotide analogs.

[0022] Ribonucleoside triphosphates (rNTPs): Building block molecules used in RNA synthesis that contain ATP, GTP, CTP, and UTP, and optionally further contain pseudouridine, 5' methyluridine, methoxyuridine, and / or some other modified ribonucleotide analogs.

[0023] Nucleotide Analog: A purine or pyrimidine nucleotide that is structurally different from adenine (A), thymine (T), guanine (G), cytosine (C), or uracil (U), but similar enough to substitute for the normal nucleotide in a nucleic acid molecule.

[0024] Oligonucleotide: A molecule composed of two or more, preferably more than three, and usually more than 10 DNA and / or RNA monomer units. Oligonucleotides longer than 13 nucleotide monomers are also called polynucleotides. The exact size is determined by several factors and is determined by the ultimate function or use of the oligonucleotide. Oligonucleotides may be generated in any manner, including chemical synthesis, DNA replication, RNA transcription, reverse transcription, or a combination thereof.

[0025] Nucleic acid composition: A nucleic acid composition refers to an oligonucleotide or polynucleotide in a single-stranded or double-stranded molecular structure, for example, a DNA or RNA sequence, or a mixed DNA / RNA sequence.

[0026] Gene: A nucleic acid composition whose oligonucleotide or polynucleotide sequence codes for an RNA and / or a polypeptide (protein). A gene may be RNA or DNA. A gene may code for a non-coding RNA, such as short hairpin RNA (shRNA), microRNA (miRNA), rRNA, tRNA, snoRNA, snRNA, and RNA precursors and derivatives thereof. Alternatively, a gene may code for a protein-encoding RNA essential for protein / peptide synthesis, such as messenger RNA (mRNA) and RNA precursors and derivatives thereof. In some circumstances, a gene may also code for a protein-encoding RNA that includes at least one microRNA or shRNA sequence.

[0027] Primary RNA transcript: The RNA sequence directly transcribed by a gene, without any RNA processing or modification.

[0028] precursor messenger RNA (pre-mRNA): the primary RNA transcript of a protein-coding gene, generated by an intracellular mechanism that functions in eukaryotes and is transcribed by eukaryotic type II RNA polymerase (Pol-II). The pre-mRNA sequence contains the 5'-untranslated region (UTR), 3'-UTR, exons, and introns.

[0029] Intron: One or more portions of a gene transcript sequence that encodes a non-protein reading frame, for example, in-frame introns, 5'-UTR, and 3'-UTR.

[0030] Exon: One or more portions of a gene transcript sequence (cDNA) that encode a protein reading frame, such as the cDNA of a cellular gene, growth factor, insulin, antibody, and analogs / homologs and derivatives thereof.

[0031] Messenger RNA (mRNA): A collection of pre-mRNA exons, formed after removal of introns by the cellular RNA splicing machinery (spliceosome), and encoding proteins used in peptide / protein synthesis. Structurally, an mRNA sequence may contain a 5'-cap nucleotide [e.g., m7G(5')ppp(5')N-], a 5'-untranslated region (5'-UTR), at least one Kozak consensus translation initiation site (e.g., 5'-GCCACC-3'), at least one protein / peptide coding region, a polyadenylation signal (e.g., 5'-AUAAA-3' or 5'-AUUAAA-3'), and / or a 3'-UTR with or without a polyA tail. Peptides / proteins encoded by mRNA include, but are not limited to, enzymes, growth factors, insulin, antibodies, and analogs / homologs and derivatives thereof.

[0032] Complementary DNA (cDNA): Single- or double-stranded DNA that contains a sequence complementary to an mRNA sequence and does not contain any intron sequences.

[0033] Sense: A nucleic acid molecule in which the cognate mRNA exhibits the same sequence order and composition. The sense conformation is indicated by a "+", "s", or "sense" symbol.

[0034] Antisense: A nucleic acid molecule that is complementary to the respective mRNA molecule. The antisense conformation is indicated by a "-" sign or by adding an "a" or "antisense" before the DNA or RNA. For example, "aDNA" or "aRNA".

[0035] Base pair (bp): The pairing of adenine (A) and thymine (T) or cytosine (C) and guanine (G) in a double-stranded DNA molecule. In RNA, uracil (U) substitutes for thymine. Generally, the pairing is achieved by hydrogen bonding. For example, the sense nucleotide sequence 5'-ATCGU-3' forms a perfect base pair with its antisense sequence 5'-ACGAT-3'.

[0036] 5'-end: the end of a sequence of nucleotides with no 5' position nucleotides, in which the 5'-hydroxy of one nucleotide is linked by a phosphodiester bond to the 3'-hydroxy of the next nucleotide. One or more other groups, such as phosphate, may be present at the end.

[0037] 3'-end: The end of a sequence of nucleotides that does not have a 3'-position nucleotide in which the 5'-hydroxy of one nucleotide is phosphodiester-linked to the 3'-hydroxy of the next nucleotide. Other groups (usually hydroxy) may be present at the end. The 3'-UTR is positioned close to or adjacent to the 3' end of the oligonucleotide.

[0038] Template: A nucleic acid molecule that is copied by a nucleic acid polymerase. The template can be single-stranded, double-stranded, or partially double-stranded RNA or DNA, as determined by the polymerase. The synthesized copy is complementary to at least one strand of the template or a double-stranded or partially double-stranded template. Both RNA and DNA are synthesized in the 5' to 3' direction. Both strands of a nucleic acid duplex are aligned, with the 5' ends of each strand at opposite ends of the duplex (and necessarily the 3' ends).

[0039] Nucleic acid template: A double-stranded DNA molecule, a double-stranded RNA molecule, a hybrid molecule (eg, a DNA-RNA or RNA-DNA hybrid), or a single-stranded DNA or RNA molecule.

[0040] Conservative: A nucleotide sequence is hybridized intentionally to the exact complement of a preselected sequence, making the nucleotide sequence conservative to the preselected (reference) sequence.

[0041] Homology or Homology: A term indicating the similarity between a polynucleotide and a gene or mRNA sequence. In one example, a nucleic acid sequence is partially or completely homologous to a particular gene or mRNA sequence. Homology is expressed as a percentage of the number of similar nucleotides compared to the total number of nucleotides.

[0042] Complementary, Complementary, or Complementary: Terms used in reference to matched base pairing between two polynucleotides (e.g., sequences of mRNA and cDNA) in relation to the "base pair (bp)" rules mentioned above. As an example, the sequence "5'-AGT-3'" is not only complementary to the sequence "5'-ACT-3'" but also to "5'-ACU-3'". Complementarity exists between two DNA strands, between a DNA and an RNA strand, or between two RNA strands. Complementarity can be "partial", "complete", or "total". Partial complementarity or complementarity occurs when nucleic acid bases match according to some base pairing rules. Complete, total complementarity or complementarity occurs when bases match completely or perfectly between nucleic acid strands. The degree of complementarity between nucleic acid strands significantly affects the efficiency and strength of hybridization between the nucleic acid strands. This is particularly important in amplification reactions and detection methods that depend on binding between nucleic acids. Percentage complementarity or complementarity refers to the number of mismatched bases compared to the total bases in one strand of nucleic acid. Thus, 50% complementarity means that half the bases are mismatched and half are matched. If the number of bases in two strands of nucleic acid differs, the two strands may also be complementary. In this situation, complementarity occurs between the bases of the short strand and the corresponding part of the long strand that pairs with the bases of the long strand.

[0043] Complementary Bases: Nucleotides that normally pair when DNA or RNA adopts a double-stranded conformation.

[0044] Complementary Nucleotide Sequence: A sequence of nucleotides in a single-stranded molecule of DNA or RNA that is sufficiently complementary to the nucleotide sequence of another single strand to form specific hybrids that result in hydrogen bonds between the two strands.

[0045] Hybridize / Hybridization: The formation of a duplex between nucleotide sequences that are sufficiently complementary to form a complex by base pairing. When a primer (or splice template) and a target (template) "hybridize," such a complex (or hybrid) is sufficiently stable to provide the priming function required for DNA polymerase to initiate DNA synthesis. Specificity exists between two complementary polynucleotides that are competitively inhibited, i.e., interact deterministically.

[0046] Post-transcriptional gene silencing: A targeted gene knockout or gene knockdown effect at the level of mRNA degradation or translational suppression, usually triggered by an exogenous / viral DNA or RNA transgene or small inhibitory RNA.

[0047] RNA interference (RNAi): A post-transcriptional gene silencing mechanism in eukaryotes that is triggered by small inhibitory RNA molecules such as microRNAs (miRNAs), short hairpin RNAs (shRNAs), and short interfering RNAs (siRNAs). These small RNA molecules are usually gene silencers that interfere with the expression of genes in cells that have full or partial complementarity to the small RNA.

[0048] MicroRNA (miRNA): A single-stranded RNA capable of binding to target gene transcripts with partial complementarity to the miRNA. miRNAs are usually about 17-27 oligonucleotides in length and can either directly degrade their intracellular mRNA targets or inhibit protein translation of their target mRNA, depending on the complementarity between the miRNA and its target mRNA. Natural miRNAs are expressed in nearly all eukaryotic organisms, where they provide defense against viral infections and allow regulation of gene expression during plant and animal development.

[0049] Precursor microRNA (pre-miRNA): A hairpin-like single-stranded RNA containing a stem arm and a stem loop region, which is used to generate one or more microRNAs (miRNAs) that can silence one or more target genes that are complementary to the microRNA sequence by interacting with the intracellular RNase III endoribonuclease. The stem arm of the pre-miRNA can form a perfect (100%) or partial (mismatch) hybridizing duplex, and the stem loop is joined to one end of the stem arm duplex to form a circular or hairpin loop conformation. However, in the present invention, the precursor of the microRNA may also include a pri-miRNA.

[0050] Small interfering RNA (siRNA): A short double-stranded RNA that is approximately 18-27 perfectly base-paired ribonucleotide duplex in size and can degrade target gene transcripts with near-perfect complementarity.

[0051] Small or short hairpin RNA (shRNA): A single stranded RNA that contains a pair of partially or perfectly matched stem arm nucleotide sequences that are separated by a non-matching loop or bubble oligonucleotide to form a hairpin-like structure. Many natural miRNAs are derived from short hairpin-like RNA precursors, i.e., precursor microRNAs (pre-miRNAs).

[0052] Vector: A recombinant nucleic acid composition capable of moving and remaining in different genetic environments, e.g., recombinant DNA (rDNA). Typically, it is engineered so that other nucleic acids are attached thereto. Vectors can replicate autonomously in cells, in which case the vector and the parts to which it is linked are replicated. One type of preferred vector is an episome, i.e., a nucleic acid molecule that replicates extrachromosomally. Preferably, the vector is one that is capable of replicating autonomously and expressing a nucleic acid. Vectors capable of directing the expression of genes encoding one or more polypeptides and / or non-coding RNA are referred to herein as "expression vectors" or "expression-competent vectors". Vectors of particular interest allow for cloning cDNA from mRNA generated using reverse transcriptase. The vector comprises components consisting of a viral or type II RNA polymerase (Pol-II or pol-2) promoter, or both, a Kozak consensus translation initiation site (e.g., 5'-GCCACC-3'), a polyadenylation signal (e.g., 5'-AUAAA-3' or 5'-AUUAAA-3'), multiple restriction / cloning sites, a pUC origin of replication, an SV40 early promoter for expressing at least one antibiotic gene in a replication-competent prokaryotic cell, an SV40 origin present in context for replicating in a mammalian cell, and / or a tetracycline response element. The structure of the vector may be a linear or circular single-stranded or double-stranded DNA selected from the group consisting of a plasmid, a viral vector, a transposon, a retrotransposon, a DNA transgene, a jumping gene, and combinations thereof.

[0053] Promoter: A nucleic acid that a polymerase molecule can recognize and bind to, and that allows an RNA transcript to occur. For purposes of this invention, a promoter may be any sequence that is capable of initiating synthesis of an RNA transcript by a desired polymerase, including known polymerase binding sites, enhancers and their analogs.

[0054] RNA processing: Cellular mechanisms that cause RNA maturation, modification, and degradation, including RNA splicing, intron excision, exosome digestion, nonsense-mediated mRNA decay (NMD), RNA editing, RNA processing, 5'-capping, 3'-poly(A) tailing, and combinations thereof.

[0055] Gene delivery: A genetic engineering method selected from the group consisting of polysome transfection, liposome transfection, chemical (nanoparticle) transfection, electroporation, viral infection, DNA recombination, transposon insertion, jumping gene insertion, microinjection, gene gun delivery, and combinations thereof.

[0056] Genetic engineering: A method for recombining DNA selected from the group consisting of DNA restriction and conjugation, homologous recombination, transgene integration, transposon insertion, jump gene integration, reverse transcription viral infection, and combinations thereof.

[0057] Transfected Cell: A single or multiple eukaryotic cells after artificially inserting at least one nucleic acid sequence or protein / peptide molecule into one or more cells selected from the group consisting of somatic cells, tissue cells, stem cells, germline cells, tumor cells, cancer cells, virus-infected cells, and combinations thereof.

[0058] Antibody: A peptide or protein molecule having a preselected conserved domain structure that encodes a receptor capable of binding a preselected ligand.

[0059] Pharmaceutical and / or Therapeutic Applications: Biomedical applications and / or equipment for stem cell generation, drug / vaccine research and development, non-GMO gene therapy, cancer therapy, disease treatment, wound healing, tissue / organ repair and regeneration, and high yield production of proteins / peptides / antibodies, drug components, medicines, vaccines and / or food delivery, and combinations thereof.

[0060] B. Composition and Applications The novel modified RNA compositions contain at least one oxo-nucleotide (oxopurine) in their 3'-terminal region (3'-tail, 3'-UTR) in their single-stranded or double-stranded sequence, or a combination thereof, including, but not limited to, 8-hydroxyguanine / 8-oxoguanine / 7,8-dihydro-8-oxoguanine (oxo-G / oxo-dG) and 8-hydroxyadenine / 8-oxoadenine (oxo-A / oxo-dA). Such novel RNA compositions with oxo-nucleotides in the 3'-tail (referred to as oxo-RNA) have been used to prevent TREX1-mediated degradation, no-go decay (NGD), and associated non-specific immune hyperactivity (e.g., cytokine storm). Oxo-RNA conformational constructs have been designed to mimic antisense RNA oligonucleotides (aRNA-ASOs), short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), microRNA precursors (pri- / pre-miRNA), double-stranded RNA (dsRNA), RNA-DNA hybrids, long non-coding RNA (lncRNA), small activating RNA (saRNA), messenger RNA (mRNA), and / or self-amplifying RNA / mRNA (saRNA / samRNA), or combinations thereof.

[0061] To facilitate delivery / transfection into the target cells in vitro, ex vivo, and / or in vivo, the oxo-RNA composition may be mixed, combined, encapsulated, or formulated with at least one agent selected from, but not limited to, liposomes, nanoparticles, liposomal nanoparticles (LNPs), exosomes, triglycidylglycerol (TGG)-derived agents, sugar / glucosamine / galactosamine-based binding molecules, injectable agents, gene gun materials, electroporation agents, and / or transposons / retrotransposons, or combinations thereof. Once delivered / transfected into the target cells, the oxo-RNA may be used in vaccines and / or drugs to treat a variety of human diseases. These human diseases include, but are not limited to, Alzheimer's disease (AD), Parkinson's disease (PD), spinal muscular atrophy (SMA) disease, motor neuron disease (MND), stroke, diabetes, myocardial infarction, hemophilia, anemia, leukemia, various cancers, and various viral and bacterial infections.

[0062] At least the following points will become apparent from the following specification and drawings. [Brief description of the drawings]

[0063] [Figure 1]Figure 1 shows the gene silencing effect of siRNA on the expression of copGFP in A549 cells expressing copGFP. From left to right, each figure shows: [1] blank control (no siRNA added), [2] one treatment of siRNA with additional 3'-oxo-G / oxo-dG (*dG) tail (1-2000nM oxo-siRNA; SEQ ID NO:22), [3] one treatment of conventional siRNA with 3'-TT-overhang (1-2000nM siRNA-tt; SEQ ID NO:23), and [4] one treatment of scrambled siRNA (1-2000nM) without any nucleotide overhang or tail (negative control; SEQ ID NO:24). These microscopy results clearly show that the gene silencing effect is extremely high (>85% gene knockdown rate) in the two test groups using conventional siRNA-tt and the newly invented oxo-siRNA, compared with the blank group and the negative control group. It should be noted that the oxo-siRNA-mediated gene silencing effect (lasting >12 days) was obviously longer-lasting than that using conventional siRNA-tt (lasting 8–10 days). [Diagram 2] Western blotting results of protein expression of the following induced key inflammatory cytokines / factors (e.g., IL-1β, IL-6, TNFα, IFNγ, and GM-CSF) in transfected co-cultured cell lines of Jurkat T and THP-1 cells are shown: [1] blank control (no added RNA), [2] one treatment with oxo-RNA (eGFP-mRNA with 3'-oxo-dG modified polyA tail), [3] one treatment with eGFP-encoding mRNA with unmodified 3'-polyA tail, and [4] one treatment with T7-polymerase-encoding mRNA with unmodified 3'-polyA tail. [Diagram 3]The results of non-denaturing agarose gel electrophoresis of an IVT-like reaction using a mixed composition of a designed PLRcD template (e.g., PLRcD dsDNA encoding green fluorescent eGFP mRNA) and T7 DdRP are shown. It should be noted that the amplification level of PLRcD-encoding mRNA (e.g., eGFP mRNA) is proportional to the amount of DdRP used. [Figure 4] FIG. 3 shows microscopy results of eGFP protein expression obtained by co-transfecting a mixture of LNP-designed PLRcD template (see FIG. 3) and T7 DdRP oxo-mRNA into target cells of interest. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0064] <Example>: 1. Human Cell Isolation, Culture, and Processing Human cancer and normal cell lines (e.g., MCF7, HepG2, Jurkat T, THP-1, copGFP-positive A549, and BEAS-2B cells) were obtained from the American Type Culture Collection (ATCC, Rockville, MD) or our collaborators and subsequently maintained according to the respective manufacturers' recommendations. In some cases, cytochalasin D was added to each cell culture after treatment (final concentration = 0.25 μM) to prevent drug dilution due to cell division. For intracellular mRNA transfection, 0.5-1000 micrograms (μg) of the mixture of PLRcD template and DdRP mRNA (e.g., T7 / T3 RNA polymerase mRNA) was mixed with 0.5 mL of fresh cell culture medium containing 1-50 μL of In-VivoJetPEI transfection agent, depending on the desired final mixture concentration. After a short incubation, the above mixture is added to cell culture conditions containing 20%-65% confluence of the desired cell culture, as determined by the design and purpose of the study. Alternatively, for intracellular siRNA transfection, the siRNA / shRNA (e.g., anti-copGFP) is mixed with 0.5 mL of fresh cell culture medium containing 1-50 μL of In-VivoJetPEI transfection agent, and then this is added to each cell culture to obtain a final siRNA / shRNA concentration ranging between 1-2000 nanomolar (nM), as determined by the final dose according to demand. For long-term maintenance, the cell culture medium is replenished every 24-72 hours, as determined by the type of cells transfected. This intracellular transfection process is performed in duplicate to increase the transfection efficiency. The results after siRNA / shRNA or mRNA transfection treatment are shown in Figure 1 and Figure 4, respectively.

[0065] 2. In Vivo Delivery / Transfection Following the manufacturer's procedures, the engineered PLRcD template and DdRP mRNA mixture (weight ratios ranging between about 200:1 and 1:200) composition is mixed with an appropriate amount of a delivery / transfection agent (e.g., In-VivoJet PEI Reagent or other similar LNP-based delivery / transfection agent) and then injected into an animal intravenously or intramuscularly, as determined by the purpose of the application. The delivery / transfection agent is used to mix, bind, encapsulate, and / or formulate the engineered composition, not only to protect the associated DNA / RNA content from degradation, but also to facilitate the delivery / transfection of the engineered composition to specific desired target cells in vitro, ex vivo, and in vivo.

[0066] 3. Preparation of PLRcD Template and DdRP mRNA Following the manufacturer's recommendations, approximately 0.01 ng-10 micrograms (μg) of isolated RNA / mRNA is added to 20-50 μL of RT reaction (SuperScript III RT kit, ThermoFisher Scientific, MA, USA) to perform reverse transcription (RT) of the desired RNA / mRNA. The RT reaction mixture further contains approximately 0.01-20 nanomoles of RT primer, and 1× RT buffer containing 0.1-10 mM each of deoxyribonucleoside triphosphate molecules (dNTPs; dATP, dTTP, dGTP, and dCTP) and reverse transcriptase, which is determined by the amount of RNA / mRNA. The RT reaction is then incubated at 37°C-65°C for 1-3 hours (hr) to form complementary DNA (cDNA) of the desired RNA / mRNA, which is then used in the subsequent PCR step, which is determined by the length and structural complexity of the desired RNA / mRNA sequence. Regarding the design of RT primers, for demonstration purposes, we use 5'-CAGTTCCAAT TGTGAAGATT CTC-3' (SEQ ID NO:16) for RT of the desired RdRp mRNA sequence, and another 5'-CTTGATGACG TTCTCAGTGC-3' (SEQ ID NO:17) for RT of the target green fluorescent protein (GFP)-encoding mRNA (e.g., mRNA encoding eGFP) containing microRNA (miRNA), but are not limited to this design.

[0067] Next, adhering to the manufacturer's recommendations, add approximately 0.01 pg to 10 μg of RT-derived cDNA to 20 to 50 μL of PCR formulation mixture (High-Fidelity PCR Master Kit, ThermoFisher Scientific, MA, USA) to perform the polymerase chain reaction (PCR). The PCR mixture is then incubated in twenty to thirty (20-30) denaturing cycles at 94 °C for 30 s to 1 min, respectively, annealed at 50 °C to 58 °C for 30 s to 1 min, and then extended at 72 °C for 1 to 3 min, which is determined by the structure and length of the required cDNA sequence. For demonstration purposes, we used two PCR primer pairs to amplify PLRcD templates associated with two COVID-19 viruses (i.e., SARS-CoV-2), including, but not limited to, one pair 5'-GATATCTAAT ACGACTCACT ATAGGGAGAG GTGCCACCAT GGTACTTGGT AGTT-3' (SEQ ID NO:18), SEQ ID NO:16 (used to amplify the RNA encoding the 12.5 k-nucleotide (nt) SARS-CoV-2 RdRp / helicase / S protein) and the other pair 5'-GATATCTAAT ACGACTCACT ATAGGGAGAC TAGTGGCCAC CATGTTCTTG TTAACAACT-3' (SEQ ID NO:19), SEQ ID NO:16 (used to amplify the mRNA encoding the 2.8 k-nt coronavirus S protein). We also used other different PCR primer pairs to amplify the PLRcD template encoding eGFP-mRNA containing miRNA, including 5'-primer 5'-GATATCTAAT ACGACTCACT ATAGGGAGAG GTATGGTACT TGGTAGTT-3' (SEQ ID NO: 20) and SEQ ID NO: 17. In principle, the design of the 5'-primer should include at least one consensus promoter sequence used in IVT, including, but not limited to, T7, T3, and / or SP6 pol promoter sequences, such as 5'-TCTAATACGA CTCACTATAG GGAGA-3' (SEQ ID NO: 21).

[0068] To generate RNA (e.g., DdRP mRNA), a promoter is engineered into the obtained PLRcD template and a new IVT reaction is prepared using 0.01 ng-10 μg of PCR product, 0.1-10 U of helicase (e.g., coronavirus NSP7 and / or NSP13 protein; choose accordingly), NTPs, and RNA polymerase (i.e., T7, T3, and / or SP6) in a 1x transcription buffer mixture. The IVT reaction is then incubated at 37°C for 1-6 hours, as determined by the stability and activity of the RNA polymerase used. The obtained mRNA (e.g., DdRP mRNA) product is preferably 5'-capped using vaccinia capping enzyme, coronavirus NSP9 / 14, and / or NSP10 / 16 protein, or a combination thereof, and further 5'-capped using NSP7, NSP13, NSP9 / 14 and / or NSP10 / 16, or a combination thereof, and a mixed composition of the designed PLRcD template and DdRP mRNA may be used to perform intracellular co-transfection, and the 5'-capped mRNA is amplified in the transfected cells.

[0069] 4. RNA Purification and Northern Blot Analysis Following the manufacturer's procedures, the desired RNA (10 μg) is isolated using the mirVana® RNA Isolation Kit (Ambion, Austin, TX) or a similar purification filter column, and then further purified using 5%-10% TBE-Urea polyacrylamide or 1%-3.5% low melting point agarose gel electrophoresis. For Northern blotting analysis, the gel fractionated RNA is electroblotted onto a nylon membrane. Detection of the RNA and its IVT template (PCR-derived cDNA product) is performed using a probe labeled [LNA]-DNA that is complementary to the target sequence of the desired RNA. The probe is further purified by high performance liquid chromatography (HPLC) and tail-labeled with terminal transferase (20 units) for 20 minutes in the presence of dye-labeled nucleotide analogs or [32P]-dATP (>3000 Ci / mM, Amersham International, Arlington Heights, IL).

[0070] 5. Protein Extraction and Western Blotting Analysis Following the manufacturer's recommendations, cells (10 6) are lysed in CelLytic-M lysis / extraction reagent (Sigma) supplemented with protease inhibitors Leupeptin, TLCK, TAME, and PMSF. Lysates are centrifuged at 12,000 rpm for 20 min at 4°C and the supernatants are collected. Protein concentrations are measured using the modified SOFTmax protein assay package on an E-max microplate reader (Molecular Devices, CA). Thirty micrograms of each cell lysate are added to SDS-PAGE sample buffer under reducing (+50 mM DTT) and non-reducing (no DTT) conditions and boiled for 3 min before loading onto a 6%-8% polyacrylamide gel. Proteins are resolved by SDS-polyacrylamide gel electrophoresis (PAGE), electroblotted to nitrocellulose membranes, and incubated in Odyssey inhibitor reagent (Li-Cor Biosciences, Lincoln, NB) for 2 h at room temperature. Primary antibodies were then applied and mixed into the reagents before co-incubation at 4°C. After overnight incubation, the membranes were rinsed three times with TBS-T and then exposed to goat anti-mouse IgG conjugated to the secondary antibodies and Alexa Fluor 680 reactive dye (1:2,000; Invitrogen-Molecular Probes) for 1 h at room temperature. After three additional rinses with TBS-T, fluorescent scanning and image analysis of immunoblots were performed using a Li-Cor Odyssey infrared imager and Odyssey software v.10 (Li-Cor).

[0071] 6. Immunostaining analysis Cell / tissue samples were first fixed in 100% methanol at 4°C for 30 min, then in 4% paraformaldehyde (in 1× PBS, pH 7.4) at 20°C for 10 min. Samples were then further incubated in 1× PBS containing 0.1%-0.25% Triton X-100 for 10 min, followed by three continuous 5-min washes in 1× PBS. For immunostaining, the corresponding primary antibodies were purchased from Invitrogen (CA, USA) and Sigma-Aldrich (MO, USA), respectively. Dye-labeled goat anti-rabbit or horse anti-mouse antibodies were used as secondary antibodies (Invitrogen, CA, USA). Results were examined and analyzed by a Fluorescence 80i microscope quantification system with Metamorph image program (Nikon) at a magnification of 100× or 200×.

[0072] 7.Statistical analysis All data are presented as mean and standard deviation (SD). The mean value of each test group is calculated by AVERAGE in Microsoft Excel. SD is performed by STDEV. Statistical analysis of data is performed by one-way ANOVA. Tukey and Dunnett's t post hoc test is used to distinguish the significance of the difference in data between groups. p<0.05 is considered significant (SPSS v12.0, Claritas Inc). <Reference text> 1. Boo and Kim; The emerging role of RNA modifications in the regulation of mRNA stability. Exp. Mol. Med. 52:400-408, 2020. 2. Yuan et al.; Human DNA exonuclease TREX1 is also a exonuclease that acts on single-stranded RNA. J. Biol. Chem. 290:13344-13353, 2015. 3. McDowell et al.; Determination of intrinsic transcription termination efficiency by RNA polymerase elongation rate. Science 266:822-825, 1994.

[0073] <Sequence List> (1) General information: (iii) Sequence number: 24 (2) Information regarding SEQ ID NO:1: (i) Sequence characteristics: (A) Length: 6 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: Linear (ii) Molecule type: DNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: No (xi) Sequence Description: SEQ ID NO: 1: RCCRCC 6 (2) Information on SEQ ID NO:2: (i) Sequence characteristics: (A) Length: 6 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: Linear (ii) Molecule type: DNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: No (xi) Sequence Description: SEQ ID NO:2: RCCDCC 6 (2) Information on SEQ ID NO:3: (i) Sequence characteristics: (A) Length: 73 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: hairpin (ii) Molecule type: RNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: No (xi) Sequence Description: SEQ ID NO:3: GCUCCCUUCA ACUUUAACAU GGAAGUGCUU UCUGUGACUU UAAAAGUAAG UGCUUCCAUG UUUUAGUAGG AGU73 (2) Information on SEQ ID NO:4: (i) Sequence characteristics: (A) Length: 68 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: hairpin (ii) Molecule type: RNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: No (xi) Sequence Description: SEQ ID NO: 4: CCUUUGCUUU AACAUGGGGG UACCUGCUGU GUGAAACAAA AGUAAGUGCU UCCAUGUUUC AGUGGAGG 68 (2) Information on SEQ ID NO:5: (i) Sequence characteristics: (A) Length: 69 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: hairpin (ii) Molecule type: RNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: No (xi) Sequence Description: SEQ ID NO:5: CCACCACUUA AACGUGGAUG UACUUGCUUU GAAACUAAAG AAGUAAGUGC UUCCAUGUUU UGGUGAUGG 69 (2) Information on SEQ ID NO:6: (i) Sequence characteristics: (A) Length: 68 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: hairpin (ii) Molecule type: RNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: No (xi) Sequence Description: SEQ ID NO:6: CCUCUACUUU AACAUGGAGG CACUUGCUGU GACAUGACAA AAAUAAGUGC UUCCAUGUUU GAGUGUGG 68 (2) Information on SEQ ID NO:7: (i) Sequence characteristics: (A) Length: 44 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: stem-loop (ii) Molecule type: RNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: No (xi) Sequence Description: SEQ ID NO:7: CUGUGUGGCU GUCACUCGGC UGCAUGCUUA GUGCACUCAC GCAG 44 (2) Information on SEQ ID NO:8: (i) Sequence characteristics: (A) Length: 65 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: stem-loop (ii) Molecule type: RNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: No (xi) Sequence Description: SEQ ID NO:8: CUGUGUGGCU GUCACUCGGC UGCAUGCUUA GUGCACUCAC GCAGUAUAAU UAAUAACUAA UUACU 65 (2) Information on SEQ ID NO:9: (i) Sequence characteristics: (A) Length: 147 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: stem-loop (ii) Molecule type: RNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: No (xi) Sequence Description: SEQ ID NO:9: GUCGUUGACA GGACACGAGU AACUCGUCUA UCUUCUGCAG GCUGCUUACG GUUUCGUCCG UGUUGCAGCC GAUCAUCAGC ACAUCUAGGU UUCGUCCGGG UGUGACCGAA AGGUAAGAUG GAGAGCCUUG UCCCUGGUUU CAACGAG 147 (2) Information on SEQ ID NO:10: (i) Sequence characteristics: (A) Length: 88 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: stem-loop (ii) Molecule type: RNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: No (xi) Sequence Description: SEQ ID NO: 10: AAUUAUAAAU UACCAGAUGA UUUUACAGGC UGCGUUAUAG CUUGGAAUUC UAACAAUCUU GAUUCUAAGG UUGGUGGUAA UUAUAAUU 88 (2) Information on SEQ ID NO:11: (i) Sequence characteristics: (A) Length: 129 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: multiple stem-loops (ii) Molecule type: RNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: No (xi) Sequence Description: SEQ ID NO: 11: CACAAAUAUU ACCAGAUCCA UCAAAACCAA GCAAGAGGUC AUUUAUUGAA GAUCUACUUU UCAACAAAGU GACACUUGCA GAUGCUGGCU UCAUCAAACA AUAUGGUGAU UGCCUUGGUG AUAUUGCUG 129 (2) Information on SEQ ID NO:12: (i) Sequence characteristics: (A) Length: 189 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: multiple stem-loops (ii) Molecule type: RNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: No (xi) Sequence Description: SEQ ID NO: 12: GCAAAAAUGU GAUCUUGCUU GUAAAUACAA UUUUGAGAGG UUAAUAAAUU ACAAGUAGUG CUAUUUUUGU AUUUAGGUUA GCUAUUUAGC UUUACGUUCC AGGAUGCCUA GUGGCAGCCC CACAAUAUCC AGGAAGCCCU CUCUGCGGUU UUUCAGAUUC GUUAGUCGAA AAACCUAAGA AAUUUAAUG 189 (2) Information on SEQ ID NO:13: (i) Sequence characteristics: (A) Length: 294 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: multiple stem-loops (ii) Molecule type: RNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: No (xi) Sequence Description: SEQ ID NO: 13: CACUCCCCUG UGAGGACUAC UGUCUUCACG CAGAAAGCGU CUAGCCAUGG CGUUAGUAUG AGUGUCGUGC AGCCUCCAGG ACCCCCCCUC CCGGGAGAGC CAUAGUGGUC UGCGGAACCG GUGAGUACAC CGGAAUUGCC AGGACGACCG GGUCCUUUCU UGGAUCAACC CGCUCAAUGC CUGGAGAUUU GGGCGUGCCC CCGCGAGACU GCUAGCCGAG UAGUGUUGGG UCGCGAAAGG CCUUGUGGUA CUGCCUGAUG GGUGCUUGCG AGUGCCCCGG GAGGUCUCGU AGAC 294 (2) Information on SEQ ID NO:14: (i) Sequence characteristics: (A) Length: 55 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: stem-loop (ii) Molecule type: RNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: No (xi) Sequence Description: SEQ ID NO: 14: GGACACGAGU AACUCGUCUA UCUUCUGCAG GCUGCUUACG GUUUCGUCCG UGUUG 55 (2) Information on SEQ ID NO:15: (i) Sequence characteristics: (A) Length: 52 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: stem-loop (ii) Molecule type: RNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: No (xi) Sequence Description: SEQ ID NO: 15: CAGCCGAUCA UCAGCACAUC UAGGUUUUGU CCGGGUGUGA CCGAAAGGUA AG 52 (2) Information on SEQ ID NO:16: (i) Sequence characteristics: (A) Length: 23 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: Linear (ii) Molecule type: DNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: Yes (xi) Sequence Description: SEQ ID NO: 16: CAGTTCCAAT TGTGAAGATT CTC 23 (2) Information on SEQ ID NO:17: (i) Sequence characteristics: (A) Length: 20 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: Linear (ii) Molecule type: DNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: Yes (xi) Sequence Description: SEQ ID NO: 17: CTTGATGACG TTCTCAGTGC 20 (2) Information on SEQ ID NO:18: (i) Sequence characteristics: (A) Length: 54 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: Linear (ii) Molecule type: DNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: No (xi) Sequence Description: SEQ ID NO: 18: GATATCTAAT ACGACTCACT ATAGGGAGAG GTGCCACCAT GGTACTTGGT AGTT 54 (2) Information on SEQ ID NO:19: (i) Sequence characteristics: (A) Length: 59 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: Linear (ii) Molecule type: DNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: No (xi) Sequence Description: SEQ ID NO:19: GATATCTAAT ACGACTCACT ATAGGGAGAC TAGTGGCCAC CATGTTCTTG TTAACAACT 59 (2) Information on SEQ ID NO:20: (i) Sequence characteristics: (A) Length: 48 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: Linear (ii) Molecule type: DNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: No (xi) Sequence Description: SEQ ID NO: 20: GATATCTAAT ACGACTCACT ATAGGGAGAG GTATGGTACT TGGTAGTT 48 (2) Information on SEQ ID NO:21: (i) Sequence characteristics: (A) Length: 25 base pairs (B) Type: Nucleic acid (C) Chain type: single strand (D) Topological structure: Linear (ii) Molecule type: DNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: No (xi) Sequence Description: SEQ ID NO:21: TCTAATACGA CTCACTATAG GGAGA 25 (2) Information on SEQ ID NO:22: (i) Sequence characteristics: (A) Length: 26 base pairs (B) Type: Nucleic acid (C) Chain type: Duplex (D) Topological structure: Linear (ii) Molecule type: RNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: Yes (xi) Sequence Description: SEQ ID NO: 22: CUCUUGAAGU GCAUGUGGCU GUCTT*dG 26 (2) Information on SEQ ID NO:23: (i) Sequence characteristics: (A) Length: 25 base pairs (B) Type: Nucleic acid (C) Chain type: Duplex (D) Topological structure: Linear (ii) Molecule type: RNA (A) Description: / desc = "synthesis" (iii) Hypothesis: No (iv) Antisense: Yes (xi) Sequence Description: SEQ ID NO: 23: CUCUUGAAGU GCAUGUGGCU GUCTT 25 (2) Information on SEQ ID NO:24: (i) Sequence characteristics: (A) Length: 21 base pairs (B) Type: Nucleic acid (C) Chain type: Duplex (D) Topological structure: Linear (ii) Molecule type: RNA (A) Description: / desc = "synthesis" (iii) Hypothesis: Yes (iv) Antisense: Yes (xi) Sequence Description: SEQ ID NO: 24: UUCUCCGAAC GUGUCACGUT T 21

Claims

1. A modified RNA composition comprising at least one oxo-nucleotide (oxopurine) in the 3'-terminal region (e.g., 3'-tail, 3'-UTR) of the sequence, wherein the oxo-nucleotide is 8-hydroxyguanine (8-oxoguanine; oxo-G / oxo-dG) or 8-hydroxyadenine (8-oxoadenine; oxo-A / oxo-dA).

2. The modified RNA composition of claim 1, characterized in that the conformation of the modified RNA is a single-stranded sequence or a double-stranded duplex.

3. The modified RNA composition of claim 1, characterized in that the modified RNA construct comprises highly structured conformations such as hairpins and stem-loops.

4. The modified RNA composition of claim 1, characterized in that the modified RNA construct is designed to mimic a non-coding RNA (ncRNA).

5. The modified RNA composition of claim 4, characterized in that the non-coding RNA is a single-stranded RNA selected from the group consisting of antisense RNA oligonucleotides (aRNA-ASO), short hairpin RNAs (shRNA), microRNA precursors (pre-miRNA), and long non-coding RNAs (lncRNA), or combinations thereof.

6. The modified RNA composition of claim 4, wherein the non-coding RNA is a double-stranded duplex RNA selected from the group consisting of short interfering RNA (siRNA), microRNA (miRNA) mimic, RNA-DNA hybrid, and small activating RNA (saRNA), or a combination thereof.

7. The modified RNA composition of claim 1, characterized in that the modified RNA construct is designed to mimic the coding of an mRNA for a protein / peptide.

8. The modified RNA composition of claim 7, characterized in that the mRNA coding for the protein / peptide is a self-amplifying RNA / mRNA (saRNA / samRNA).

9. The modified RNA composition of claim 7, wherein the coding mRNA for the protein / peptide is capped with a 5'-cap molecule.

10. The modified RNA composition of claim 7, characterized in that the mRNA coding for the protein / peptide contains a polyA tail.

11. The modified RNA composition of claim 1, characterized in that the U (uridine / uracil) content of the modified RNA is further fully or partially replaced by other modified nucleoside analogues.

12. The modified RNA composition of claim 11, wherein the other modified nucleoside analogue is pseudouridine (p), methyluridine (t / tm / um), methylpseudouridine (fm / m1f), or methoxyuridine (mo5U), or a combination thereof.

13. The modified RNA composition of claim 1, characterized in that the C (cytosine / cytidine) content of the modified RNA is further fully or partially replaced by other modified nucleoside analogues.

14. The modified RNA composition of claim 13, wherein the other modified nucleoside analog is 5-methylcytidine (m5C) or N4-acetylcytidine (ac4C).

15. The modified RNA composition of claim 1, characterized in that the modified RNA is used to prevent TREX1-mediated degradation and associated non-specific immune hyperactivity.

16. The modified RNA composition of claim 1, wherein the modified RNA is a pharmaceutical compound or composition.

17. The modified RNA composition of claim 1, characterized in that the modified RNA is further formulated with at least one delivery agent to facilitate intracellular transfection in vitro, ex vivo, and in vivo.

18. The modified RNA composition of claim 1, characterized in that the delivery agent is a liposome, a nanoparticle, a liposome nanoparticle (LNP), an exosome, a binding molecule, an injection / infusion agent, a triglycylglycerin (TGG)-derived molecule, an electroporation agent, or a transposon / retrotransposon, or a combination thereof.

19. The modified RNA composition of claim 1, wherein the modified RNA is prepared using an oligonucleotide synthesizer.

20. The modified RNA composition of claim 1, characterized in that the modified RNA is produced by an enzymatic reaction using terminal deoxynucleotidyl transferase (TdT), terminal uridylyl transferase, or polymerase θ.

Images