Anti-GARP antibody

Abstract

To provide an antibody that binds to GARP and is useful as a therapeutic agent for a tumor, and a method for treating a tumor using the antibody, specifically to provide an antibody which inhibits the function of Treg in a tumor, making it useful as a pharmaceutical product having therapeutic effects, and a method for treating a tumor using the antibody.SOLUTION: The present invention provides an anti-GARP antibody that binds to GARP and exhibits Treg function inhibitory activity and ADCC activity, and a pharmaceutical composition comprising the antibody and used in tumor therapy.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to an antibody that binds to GARP, which is useful as a tumor therapeutic agent, and a tumor treatment method using the antibody. Regarding treatment for. [Background technology]

[0002] Regulatory T cells (Tregs) are a major contributor to immune tolerance observed in the tumor area of ​​cancer patients In other words, in cancer patients, Treg cells are activated by tumors and suppress the normal functioning of the immune system. Tumor immune cell populations are suppressed, which leads to tumor malignancy [Non-specific Reference 1]. Glycoprotein-A Repetitions Predominant (GARP) is a single transmembrane protein. It is expressed on the cell surface of activated Treg and acts as a regulator of latent TGF-β (immune tolerance) [Non-Patent Document 2]. It forms a complex with TGF-β (a precursor of TGF-β, an important molecule in tolerance induction) [Non-patent literature 3]. GARP is a cellular signaling pathway that mediates immune suppression through cell-cell interactions between Tregs and target cells. Mature TGF-β is secreted from latent TGF-β that is retained on the cell surface of Tregs via the The immunosuppressive signal of TGF-β is directly transmitted to target cells [Non-patent Documents 4, 5]. It has been shown that expression of GARP on the cell membrane is required for the maturation of β [Non-patent Document 5 ], but when soluble GARP lacking the transmembrane domain was directly added to CD4+ T cells, C The proliferation of D4-positive T cells is suppressed [Non-Patent Document 6], which suggests that TGF-β maturation on the cell membrane is suppressed. The existence of a mechanism of immunosuppression by GARP that does not involve this mechanism cannot be denied. GARP is expressed in activated Tregs derived from peripheral blood, and is also clinically expressed in tumor-affected areas of cancer patients. Tregs present among tumor-infiltrating T cells [Non-Patent Document 7], and expression in Tregs present in ascites [Non-Patent Document 8] or in Tregs present in the patient's peripheral blood. is observed [Non-Patent Document 9]. One report that examined the effect of suppressing GARP expression on Treg function was the use of siRNP against GARP. In Tregs transduced with A, the inhibition of the proliferation suppression function of helper T cells was observed. The inhibitory effect was partial [Non-Patent Document 10]. On the other hand, anti-GARP antibodies (MHG-8, LHG-10) obtained based on their ability to inhibit TGF-β maturation The helper T cells of the Treg A1 cell line established from a patient with mochromatosis [Non-patent Document 11] However, the antiproliferative function of the antibody was inhibited [Patent Document 1, Non-Patent Document 12]. It is unclear whether the body can effectively exert this inhibitory effect on Tregs in the tumor microenvironment. There have been no reports of anti-GARP antibodies with such effects. Antibodies that recognize the above are also known [Patent Document 2]. Regarding Tregs, in addition to tumors, excessive presence of Tregs has been reported in patients with malaria and HIV infection. The activation of IL-1 and IL-2 are correlated with the progression of these diseases [Non-Patent Documents 13, 14], and mouse pathology models have demonstrated that IL-1 and IL-2 are correlated with the progression of these diseases [Non-Patent Documents 13, 14]. It has been shown that removal of Tregs leads to remission of the disease in patients with rheumatoid arthritis [15, 16]. [Prior art documents] [Patent documents]

[0003] [Patent Document 1] WO2015 / 015003 [Patent Document 2] WO2016 / 125017

Non-licensed literature

[0004]

Non-licensed literature 1

Non-licensed Document 4

Non-licensed Document 5

Non-licensed Document 6

Non-licensed Document 7

Non-licensed literature 9

Non-licensed literature 10

Non-licensed Document 11

Non-licensed Document 12

Non-licensed Document 13

Non-licensed Document 14

[0005] The objective of the present invention is to provide a pharmaceutical agent that has a therapeutic effect by inhibiting the function of Treg in tumors. The present invention aims to provide an antibody which can treat tumors and a method for treating tumors using the antibody. [Means for solving the problem]

[0006] The present inventors have conducted extensive research to solve the above problems, and have found that a gene that specifically binds to GARP is We discovered an antibody that inhibits Treg function through antibody-dependent cellular cytotoxicity. The present invention has been completed. That is, the present invention includes the following inventions. (1) An antibody characterized by the following properties: (a) Specific binding to Glycoprotein-A Repetitions Predominant (GARP) (b) has inhibitory activity against the immunosuppressive function of regulatory T cells; (c) having antibody-dependent cellular cytotoxicity (ADCC) activity, and (d) has antitumor activity in vivo; (2) The antibody according to (1) above, wherein GARP is a molecule consisting of the amino acid sequence set forth in SEQ ID NO:1. body. (3) (a) amino acid numbers 366 to 377, 407 to 445, and 456 to 470 in SEQ ID NO: 1 Amino acid sequence part (b) the amino acid sequence portion of amino acid numbers 54 to 112 and 366 to 392 in SEQ ID NO: 1 (c) an amino acid sequence portion of amino acid numbers 352 to 392 in SEQ ID NO: 1; or (d) an amino acid sequence portion of amino acid numbers 18 to 112 in SEQ ID NO: 1; The antibody according to (1) or (2) above, which binds to (4) For binding to GARP, (a) a heavy chain consisting of the amino acid sequence set forth in SEQ ID NO:2 and a heavy chain consisting of the amino acid sequence set forth in SEQ ID NO:3 A light chain consisting of a string of (b) a heavy chain consisting of the amino acid sequence set forth in SEQ ID NO: 4 and a heavy chain consisting of the amino acid sequence set forth in SEQ ID NO: 5 A light chain consisting of a string of (c) a heavy chain consisting of the amino acid sequence set forth in SEQ ID NO: 25 and a heavy chain consisting of the amino acid sequence set forth in SEQ ID NO: 27 a light chain consisting of a sequence of (d) a heavy chain consisting of the amino acid sequence set forth in SEQ ID NO: 29 and a heavy chain consisting of the amino acid sequence set forth in SEQ ID NO: 31 A light chain consisting of a string of The antibody according to any one of (1) to (3) above, which has a competitive inhibitory activity against an antibody having the formula: . (5) The antibody according to any one of (1) to (4) above, wherein the tumor is cancer. (6) Cancer: lung cancer, kidney cancer, urothelial cancer, colon cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer , breast cancer, melanoma, liver cancer, bladder cancer, stomach cancer, esophageal cancer, or blood cancer as described in (5) above. antibodies. (7) (a) A CD40 having an amino acid sequence as set forth in amino acid numbers 26 to 35 in SEQ ID NO: 2. CDRH1, CDRH2 consisting of the amino acid sequence set forth in amino acid numbers 50 to 66 in SEQ ID NO:2, and CDRH3 consisting of the amino acid sequence set forth in amino acid numbers 99 to 107 in SEQ ID NO:2; and CDRL1 consisting of the amino acid sequence set forth in amino acid numbers 23 to 36 in SEQ ID NO:3; CDRL2 consisting of the amino acid sequence set forth in amino acid numbers 52 to 58 of SEQ ID NO:3 and CDRL3 consisting of the amino acid sequence set forth in amino acid numbers 91 to 101 in (b) CDRH1 consisting of the amino acid sequence set forth in amino acid numbers 26 to 35 in SEQ ID NO: 4; CDRH2 consisting of the amino acid sequence set forth in amino acid numbers 50 to 66 in SEQ ID NO:4, and CDRH3 consisting of the amino acid sequence set forth in amino acid numbers 99 to 112 in No. 4, and the sequence CDRL1 consisting of the amino acid sequence set forth in amino acid numbers 23 to 36 in SEQ ID NO:5; and CDRL2 consisting of the amino acid sequence set forth in SEQ ID NO:5. CDRL3 consisting of the amino acid sequence set forth in amino acid numbers 91 to 100 of (c) CDRH1 consisting of the amino acid sequence set forth in amino acid numbers 45 to 54 in SEQ ID NO: 25; CDRH2 consisting of the amino acid sequence set forth in amino acid numbers 69 to 78 in SEQ ID NO:25, and CDRH3 consisting of the amino acid sequence set forth in amino acid numbers 118 to 125 in sequence number 25; CDRL1 consisting of the amino acid sequence set forth in amino acid numbers 44 to 54 in sequence number 27, SEQ ID NO:2 CDRL2 consisting of the amino acid sequence set forth in SEQ ID NO: 70 to 76 in SEQ ID NO: 27; a CDRL3 consisting of the amino acid sequence set forth in amino acid numbers 109 to 117 of (d) CDRH1 consisting of the amino acid sequence set forth in amino acid numbers 45 to 54 in SEQ ID NO: 29; CDRH2 consisting of the amino acid sequence set forth in amino acid numbers 69 to 77 in SEQ ID NO:29, and CDRH3 consisting of the amino acid sequence set forth in amino acid numbers 117 to 128 in sequence number 29; CDRL1 consisting of the amino acid sequence set forth in amino acid numbers 44 to 54 in sequence number 31, SEQ ID NO:3 CDRL2 consisting of the amino acid sequence set forth in SEQ ID NO: 70 to 76 in CDRL3 consisting of the amino acid sequence set forth in amino acid numbers 109 to 117 in The antibody according to any one of (1) to (6) above, comprising: (8) (a) an amino acid sequence consisting of amino acid numbers 1 to 118 in SEQ ID NO: 2; A heavy chain variable region and an amino acid sequence set forth in amino acid numbers 1 to 112 in SEQ ID NO:3 a light chain variable region comprising (b) a heavy chain having an amino acid sequence as set forth in amino acid numbers 1 to 123 in SEQ ID NO: 4; A light molecule comprising the variable region and the amino acid sequence set forth in amino acid numbers 1 to 111 in SEQ ID NO:5. Chain variable region, (c) a heavy chain consisting of the amino acid sequence set forth in amino acid numbers 20 to 136 in SEQ ID NO: 25; A light molecule comprising the variable region and the amino acid sequence set forth in amino acid numbers 21 to 129 in SEQ ID NO:27. a chain variable region, or (d) a heavy chain consisting of the amino acid sequence set forth in amino acid numbers 20 to 139 in SEQ ID NO: 29; A light molecule comprising the variable region and the amino acid sequence set forth in amino acid numbers 21 to 129 in SEQ ID NO: 31. Chain variable region, The antibody according to any one of (1) to (7) above, comprising: (9) The antibody according to any one of (1) to (8), wherein the constant region is a human-derived constant region. antibody. (10) (a) A heavy chain having the amino acid sequence set forth in SEQ ID NO: 2 and an amino acid sequence set forth in SEQ ID NO: 3 a light chain consisting of the amino acid sequence (b) a heavy chain consisting of the amino acid sequence set forth in SEQ ID NO: 4 and a heavy chain consisting of the amino acid sequence set forth in SEQ ID NO: 5 A light chain consisting of a string of (c) a heavy chain consisting of the amino acid sequence set forth in amino acid numbers 20 to 466 in SEQ ID NO: 25; and a light chain consisting of the amino acid sequence set forth in amino acid numbers 21 to 234 in SEQ ID NO: 27; or (d) a heavy chain consisting of the amino acid sequence set forth in amino acid numbers 20 to 469 in SEQ ID NO: 29; and a light chain consisting of the amino acid sequence set forth in amino acid numbers 21 to 234 in SEQ ID NO: 31. The antibody according to any one of (1) to (9) above.

[0007] (11) The antibody according to any one of (1) to (10) above, which has been humanized. (12) (a) an amino acid sequence set forth in amino acid numbers 20 to 136 in SEQ ID NO: 33; (b) an amino acid sequence as set forth in amino acid numbers 20 to 136 in SEQ ID NO: 35; (c) an amino acid sequence set forth in amino acid numbers 20 to 139 in SEQ ID NO: 41; (d) In the sequences of (a) to (c), a sequence of a framework region other than each CDR sequence is an amino acid sequence having at least 95% homology to (e) In the sequences of the framework regions other than the CDR sequences in the sequences (a) to (c), and an amino acid sequence in which one or several amino acids are deleted, substituted or added. a heavy chain variable region consisting of an amino acid sequence selected from the group consisting of (f) an amino acid sequence set forth in amino acid numbers 21 to 129 in SEQ ID NO: 37; (g) an amino acid sequence set forth in amino acid numbers 21 to 129 in SEQ ID NO: 39; (h) an amino acid sequence set forth in amino acid numbers 21 to 129 in SEQ ID NO: 43; (i) In the sequences (f) to (h), a sequence of a framework region other than each CDR sequence is an amino acid sequence having at least 95% homology to (j) In the sequences of the framework regions other than each CDR sequence in the sequences (f) to (h), and an amino acid sequence in which one or several amino acids are deleted, substituted or added. a light chain variable region consisting of an amino acid sequence selected from the group consisting of The antibody according to (11), having the formula: (13) (a) an amino acid sequence as set forth in amino acid numbers 20 to 136 in SEQ ID NO: 33 A heavy chain variable region and an amino acid sequence set forth in amino acid numbers 21 to 129 in SEQ ID NO: 37 a light chain variable region comprising (b) a heavy chain consisting of the amino acid sequence set forth in amino acid numbers 20 to 136 in SEQ ID NO: 35; A light molecule comprising the variable region and the amino acid sequence set forth in amino acid numbers 21 to 129 in SEQ ID NO: 39. a chain variable region, or (c) Amino acid number in SEQ ID NO: 41 20 A heavy chain consisting of an amino acid sequence as set forth in any one of claims 1 to 139. A light molecule comprising the variable region and the amino acid sequence set forth in amino acid numbers 21 to 129 in SEQ ID NO: 43. Chain variable region, The antibody according to (11) or (12) above, comprising: (14) (a) having an amino acid sequence as set forth in amino acid numbers 20 to 466 in SEQ ID NO: 33 a heavy chain having an amino acid sequence set forth in amino acid numbers 20 to 466 in SEQ ID NO: 35; and a heavy chain having an amino acid sequence as set forth in amino acid numbers 20 to 469 in SEQ ID NO: 41; and a heavy chain selected from the group consisting of: (b) a light chain having an amino acid sequence set forth in amino acid numbers 21 to 234 in SEQ ID NO: 37; A light chain having an amino acid sequence as set forth in amino acid numbers 21 to 234 in SEQ ID NO: 39, and a sequence a light chain having an amino acid sequence as set forth in amino acid numbers 21 to 234 of sequence number 43; a light chain selected from the group The antibody according to any one of (11) to (13) above, comprising: (15) (a) having an amino acid sequence as set forth in amino acid numbers 20 to 466 in SEQ ID NO: 33 A heavy chain and a light chain having the amino acid sequence set forth in amino acid numbers 21 to 234 of SEQ ID NO:37. , (b) a heavy chain having an amino acid sequence as set forth in amino acid numbers 20 to 466 in SEQ ID NO: 35; and a light chain having the amino acid sequence set forth in amino acid numbers 21 to 234 in SEQ ID NO: 39; or (c) a heavy chain having an amino acid sequence as set forth in amino acid numbers 20 to 469 of SEQ ID NO: 41; and a light chain having the amino acid sequence set forth in amino acid numbers 21 to 234 of SEQ ID NO: 43. The antibody according to any one of (11) to (14) above. (16) A polynucleotide encoding the antibody according to any one of (1) to (15) above. .

[0008] (17)(a) a nucleotide sequence set forth in SEQ ID NO:6, nucleotide numbers 76 to 105 A polynucleotide of CDRH1 consisting of nucleotides 148 to 198 in SEQ ID NO:6. The polynucleotide sequence of CDRH2 is shown in SEQ ID NO:6. A polynucleotide of CDRH3 consisting of the nucleotide sequence set forth in nucleotide numbers 295 to 321; and a nucleotide sequence comprising nucleotide numbers 67 to 108 in SEQ ID NO:7. A polynucleotide of CDRL1 comprising nucleotides 154 to 174 of SEQ ID NO:7. A polynucleotide of CDRL2 consisting of the nucleotide sequence of SEQ ID NO:7. A polynucleotide of CDRL3 consisting of the nucleotide sequence set forth in sequence numbers 271 to 303; (b) a nucleotide sequence consisting of nucleotide numbers 76 to 105 in SEQ ID NO:8; A polynucleotide of CDRH1 comprising nucleotides 148 to 198 of SEQ ID NO:8. A polynucleotide of CDRH2 consisting of the nucleotide sequence and a nucleotide sequence in SEQ ID NO:8 A polynucleotide of CDRH3 consisting of the nucleotide sequence set forth in CEQ ID NOs: 295 to 336; and CDRL1 consisting of the nucleotide sequence set forth in nucleotide numbers 67 to 108 of SEQ ID NO:9 the polynucleotide set forth in SEQ ID NO:9, nucleotide numbers 154 to 174; The polynucleotide sequence of CDRL2 is nucleotide sequence 271 of SEQ ID NO:9. A polynucleotide of CDRL3 consisting of the nucleotide sequence set forth in any one of claims 1 to 300. (c) a nucleotide sequence comprising the nucleotide sequence set forth in nucleotide numbers 133 to 162 of SEQ ID NO: 24; A polynucleotide of CDRH1 comprising nucleotides 205 to 234 of SEQ ID NO:24. A polynucleotide of CDRH2 consisting of the nucleotide sequence and a nucleotide sequence in SEQ ID NO:24 a polynucleotide of CDRH3 consisting of the nucleotide sequence set forth in CEQ ID NO:352 to CEQ ID NO:375; and A CDRL consisting of the nucleotide sequence set forth in nucleotide numbers 130 to 162 of SEQ ID NO:26. 1, the nucleotide sequence set forth in SEQ ID NO:26 from nucleotide number 208 to 228; The polynucleotide of CDRL2 consisting of the nucleotide sequence at nucleotide number 3 in SEQ ID NO:26 a polynucleotide of CDRL3 consisting of the nucleotide sequence set forth in any one of 25 to 351; or (d) a nucleotide sequence consisting of nucleotide numbers 133 to 162 in SEQ ID NO: 28; A polynucleotide of CDRH1 comprising nucleotides 205 to 231 of SEQ ID NO:28. A polynucleotide of CDRH2 consisting of the nucleotide sequence and a nucleotide sequence in SEQ ID NO:28 A polynucleotide of CDRH3 consisting of the nucleotide sequence set forth in CEQ ID NO:349 to CEQ ID NO:384, A CDRL consisting of the nucleotide sequence set forth in nucleotide numbers 130 to 162 of SEQ ID NO:30. 1, the nucleotide sequence set forth in SEQ ID NO:30 from nucleotide number 208 to 228; The polynucleotide of CDRL2 consisting of the nucleotide sequence at nucleotide number 3 in SEQ ID NO:30 A polynucleotide of CDRL3 consisting of the nucleotide sequence set forth in any one of 25 to 351 of the present invention. The polynucleotide according to (16) above, comprising: (18)(a) a nucleotide sequence set forth in nucleotide numbers 1 to 354 of SEQ ID NO:6 and a polynucleotide of a heavy chain variable region comprising nucleotides 1 to 7 in SEQ ID NO:7. A polynucleotide of a light chain variable region consisting of a nucleotide sequence set forth in any one of claims 1 to 336. (b) a nucleotide sequence consisting of nucleotide numbers 1 to 369 in SEQ ID NO:8; and the heavy chain variable region polynucleotide sequence of SEQ ID NO:1 to SEQ ID NO:9. A polynucleotide of a light chain variable region consisting of the nucleotide sequence set forth in 333. (c) a nucleotide sequence consisting of nucleotide numbers 58 to 408 in SEQ ID NO: 24; and a polynucleotide sequence of the heavy chain variable region of SEQ ID NO:26 from nucleotide numbers 61 to 387. or a polynucleotide of a light chain variable region consisting of the nucleotide sequence set forth in (d) a nucleotide sequence consisting of nucleotide numbers 58 to 417 in SEQ ID NO: 28; and a polynucleotide sequence of the heavy chain variable region of SEQ ID NO:30 from nucleotide 61 to 387 in SEQ ID NO:30. The light chain variable region polynucleotide having the nucleotide sequence described in ) or (17). (19) (a) a heavy chain polynucleotide having the nucleotide sequence set forth in SEQ ID NO:6; and A light chain polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO:7; (b) A heavy chain polynucleotide having the nucleotide sequence set forth in SEQ ID NO:8 and sequence number A light chain polynucleotide consisting of the nucleotide sequence set forth in No. 9. (c) a nucleotide sequence comprising the nucleotide sequence set forth in nucleotide numbers 58 to 1398 of SEQ ID NO: 24; and the heavy chain polynucleotide set forth in nucleotide numbers 61 to 702 of SEQ ID NO:26. a light chain polynucleotide consisting of the nucleotide sequence (d) a nucleotide sequence consisting of the nucleotide sequence set forth in SEQ ID NO: 28 from nucleotide number 58 to nucleotide number 1407; and the heavy chain polynucleotide set forth in nucleotide numbers 61 to 702 of SEQ ID NO:30. a light chain polynucleotide consisting of the nucleotide sequence The polynucleotide according to any one of (16) to (18) above, comprising: (20)(a) a nucleotide sequence set forth in SEQ ID NO: 32, nucleotide numbers 58 to 408 A polynucleotide of a heavy chain variable region consisting of nucleotides 58 to 59 in SEQ ID NO:34. 408, and a heavy chain variable region polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO: 4 0, the heavy chain variable region consisting of the nucleotide sequence set forth in nucleotide numbers 58 to 417 a heavy chain variable region polynucleotide selected from the group consisting of: (b) a nucleotide sequence consisting of nucleotide numbers 61 to 387 in SEQ ID NO: 36; A polynucleotide of the light chain variable region comprising nucleotides 61 to 387 of SEQ ID NO:38. The polynucleotide of the light chain variable region consisting of the nucleotide sequence shown in SEQ ID NO: 42 A light chain variable region polypeptide consisting of the nucleotide sequence set forth in nucleotide numbers 61 to 387 of a light chain variable region polynucleotide selected from the group consisting of: The polynucleotide according to (16) or (17) above,

[0009] (21)(a) a nucleotide sequence set forth in SEQ ID NO: 32, nucleotide numbers 58 to 408 and a polynucleotide of a heavy chain variable region comprising nucleotides 61 to 64 in SEQ ID NO: 36. A polynucleotide of a light chain variable region consisting of a nucleotide sequence set forth in any one of claims 1 to 387. (b) a nucleotide sequence consisting of nucleotide numbers 58 to 408 in SEQ ID NO: 34; and a polynucleotide sequence of the heavy chain variable region of SEQ ID NO:38 from nucleotide numbers 61 to 387. or a polynucleotide of a light chain variable region consisting of the nucleotide sequence set forth in (c) a nucleotide sequence comprising the nucleotide sequence set forth in nucleotide numbers 58 to 417 of SEQ ID NO: 40; and a polynucleotide sequence of the heavy chain variable region of SEQ ID NO:42 from nucleotide numbers 61 to 387. A polynucleotide of a light chain variable region consisting of the nucleotide sequence described in The polynucleotide according to any one of (16), (17) and (20) above, comprising the following structure: (22)(a) a nucleotide sequence set forth in nucleotide numbers 58 to 1398 of SEQ ID NO: 32 A heavy chain polynucleotide consisting of the heavy chain represented by nucleotide numbers 58 to 1398 in SEQ ID NO:34. and a heavy chain polynucleotide having the nucleotide sequence set forth in SEQ ID NO: 40. A heavy chain polynucleotide consisting of the nucleotide sequence set forth in nucleotide numbers 58 to 1407. A heavy chain polynucleotide selected from the group consisting of: (b) a nucleotide sequence comprising the nucleotide sequence set forth in nucleotide numbers 61 to 702 of SEQ ID NO: 36; A light chain polynucleotide having the nucleotide sequence set forth in SEQ ID NO:38 from nucleotide number 61 to 702. A light chain polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 42. A light chain polynucleotide consisting of the nucleotide sequence set forth in SEQ ID NO:61 to 702. A light chain polynucleotide selected from The polynucleotide according to any one of (16), (17), (20) and (21) above, comprising the following structure: (23)(a) a nucleotide sequence set forth in nucleotide numbers 58 to 1398 of SEQ ID NO: 32 and a heavy chain polynucleotide consisting of nucleotide numbers 61 to 702 in SEQ ID NO:36. A light chain polynucleotide consisting of the nucleotide sequence set forth in (b) a nucleotide sequence consisting of the nucleotide sequence set forth in nucleotide numbers 58 to 1398 of SEQ ID NO: 34; and the heavy chain polynucleotide set forth in nucleotide numbers 61 to 702 of SEQ ID NO:38. or (c) a nucleotide sequence consisting of nucleotide numbers 58 to 1407 in SEQ ID NO: 40; and the heavy chain polynucleotide set forth in SEQ ID NO:42 at nucleotide numbers 61 to 702. a light chain polynucleotide consisting of the nucleotide sequence The polynucleotide according to any one of (16), (17), and (20) to (22) above, Chid. (24) An expression vector containing the polynucleotide according to any one of (16) to (23) above. Kutor. (25) A host cell transformed with the expression vector according to (24) above. (26) A process for culturing the host cell according to (25) above, and a process for producing the host cell from the culture obtained in the process. A method for producing an antibody of interest or a fragment thereof, comprising the step of collecting the antibody of interest. (27) An antibody, characterized in that it is obtained by the production method according to (26) above. (28) Glycosylation to N-linked oligosaccharides, O-linked oligosaccharides, N-terminal processing, C-terminal processing Processing, deamidation, isomerization of aspartic acid, oxidation of methionine, and addition of methionine to the N-terminus. Addition of a nin residue, amidation of a proline residue, and one or two carboxyl termini The above (1) comprising one or more modifications selected from the group consisting of heavy chains having deleted amino acids. The antibody described in any one of (15) to (27). (29) The above (28) in which one or two amino acids are deleted at the carboxyl terminus of the heavy chain. ) The antibody described in.

[0010] (30) The above-mentioned nucleic acid having one amino acid deletion at the carboxyl terminus of each of the two heavy chains. The antibody according to (29). (31) The above (28) to (30) wherein the proline residue at the carboxyl terminus of the heavy chain is further amidated. (30) The antibody according to any one of (30). (32) The above (1) in which glycosylation is regulated to enhance antibody-dependent cellular cytotoxicity. The antibody described in any one of (15) to (31) and (27) to (31). (33) A method comprising the steps of: (1) administering to a subject a subject an antibody comprising: A pharmaceutical composition comprising: (34) The pharmaceutical composition according to (33) above, which is for treating a tumor. (35) The pharmaceutical composition according to (34) above, wherein the tumor is cancer. (36) Cancer: lung cancer, renal cancer, urothelial cancer, colon cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer , breast cancer, melanoma, liver cancer, bladder cancer, stomach cancer, esophageal cancer, or blood cancer as described in (35) above. A pharmaceutical composition comprising: (37) A method for the preparation of a human subject, comprising administering to the human subject at least one of the antibodies according to (1) to (15) and (27) to (32) above. A method for treating a tumor, comprising administering to (38) The method for treatment according to (37) above, wherein the tumor is cancer. (39) Lung cancer, renal cancer, urothelial cancer, colon cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer , breast cancer, melanoma, liver cancer, bladder cancer, stomach cancer, esophageal cancer, or blood cancer as described in (38) above. Treatment methods. Effect of the Invention

[0011] According to the present invention, a compound that binds to GARP and has an antitumor activity by suppressing Treg through ADCC activity is In addition, it is possible to obtain a therapeutic agent for cancer, etc., which contains an antibody having the above structure. The excessive presence and activation of Tregs in each patient correlated with the progression of the disease, and Effective inhibition of Treg function is expected to lead to amelioration of disease in disease models. It is also expected to be effective in treating difficult-to-treat infectious diseases such as malaria and HIV. [Brief description of the drawings]

[0012] [Figure 1] FIG. 1 shows the amino acid sequence of GARP (SEQ ID NO:1). [Diagram 2] FIG. 2 shows the amino acid sequence of the 105F antibody heavy chain (SEQ ID NO:2). [Diagram 3]FIG. 3 shows the amino acid sequence of the 105F antibody light chain (SEQ ID NO:3). [Figure 4] FIG. 4 shows the amino acid sequence of the 110F antibody heavy chain (SEQ ID NO:4). [Diagram 5] FIG. 5 shows the amino acid sequence of the 110F antibody light chain (SEQ ID NO:5). [Figure 6] FIG. 6 is the nucleotide sequence of the 105F antibody heavy chain (SEQ ID NO:6). [Figure 7] FIG. 7 is the nucleotide sequence of the 105F antibody light chain (SEQ ID NO:7). [Figure 8] FIG. 8 is the nucleotide sequence of the 110F antibody heavy chain (SEQ ID NO:8). [Figure 9] FIG. 9 is the nucleotide sequence of the 110F antibody light chain (SEQ ID NO:9). [Figure 10] 10 is a diagram showing the binding of antibodies to GARP. The 105F and 110F antibodies were shown to bind to GARP by ELISA. [Figure 11] 11 is a diagram showing specific binding of antibodies to GARP. The 105F antibody did not bind to HEK293T cells into which only the vector was introduced, but only to HEK293T cells in which GARP was transiently expressed. [Figure 12] 12 is a diagram showing GARP-specific binding of antibodies. The 105F antibody exhibited binding activity to L428 cells that endogenously express GARP. [Figure 13] 13 shows the GARP-specific binding of antibodies. The 105F antibody exhibited binding activity to activated Treg. [Figure 14] 14 is a diagram showing the ADCC ability of antibodies. When L428 cells that endogenously express GARP were used as targets, the ADCC activity of the 105F antibody was observed to be enhanced in an antibody concentration-dependent manner. [Figure 15] 15 is a graph showing the ability of antibodies to inhibit Treg function. The 105F antibody (50 μg / mL) inhibited the proliferation-suppressing function of Treg against helper T cells. [Figure 16] 16 is a graph showing the ability of antibodies to inhibit Treg function. The 105F antibody (10 μg / mL) inhibited the function of Treg to suppress the proliferation of helper T cells. On the other hand, the MHG-8 and LHG-10 antibodies did not show any effect on the function of suppressing the proliferation of helper T cells. [Figure 17] FIG. 17 is a diagram showing the amino acid sequence of the c151D antibody heavy chain (SEQ ID NO:25). [Figure 18] FIG. 18 is the amino acid sequence of the c151D antibody light chain (SEQ ID NO:27). [Figure 19] FIG. 19 is the amino acid sequence of the c198D antibody heavy chain (SEQ ID NO:29). [Figure 20] FIG. 20 depicts the amino acid sequence of the c198D antibody light chain (SEQ ID NO:31). [Figure 21] FIG. 21 depicts the amino acid sequence of the h151D-H1 heavy chain (SEQ ID NO:33). [Figure 22] FIG. 22 depicts the amino acid sequence of the h151D-L1 light chain (SEQ ID NO:37). [Diagram 23] FIG. 23 depicts the amino acid sequence of the h151D-H4 heavy chain (SEQ ID NO:35). [Figure 24] FIG. 24 depicts the amino acid sequence of the h151D-L4 light chain (SEQ ID NO:39). [Diagram 25] FIG. 25 is the amino acid sequence of the h198D-H3 heavy chain (SEQ ID NO:41). [Figure 26] FIG. 26 is the amino acid sequence of the h198D-L4 light chain (SEQ ID NO:43). [Figure 27] FIG. 27 depicts the nucleotide sequence of the c151D antibody heavy chain (SEQ ID NO:24). [Figure 28] FIG. 28 is the nucleotide sequence of the c151D antibody light chain (SEQ ID NO:26). [Figure 29] FIG. 29 is the nucleotide sequence of the c198D antibody heavy chain (SEQ ID NO:28). [Diagram 30]FIG. 30 is the nucleotide sequence of the c198D antibody light chain (SEQ ID NO:30). [Diagram 31] FIG. 31 depicts the nucleotide sequence of the h151D-H1 heavy chain (SEQ ID NO:32). [Diagram 32] FIG. 32 is the nucleotide sequence of the h151D-L1 light chain (SEQ ID NO:36). [Diagram 33] FIG. 33 is the nucleotide sequence of the h151D-H4 heavy chain (SEQ ID NO:34). [Diagram 34] FIG. 34 is the nucleotide sequence of the h151D-L4 light chain (SEQ ID NO:38). [Diagram 35] FIG. 35 is the nucleotide sequence of the h198D-H3 heavy chain (SEQ ID NO:40). [Diagram 36] FIG. 36 is the nucleotide sequence of the h198D-L4 light chain (SEQ ID NO:42). [Figure 37] 37 is a diagram showing the binding of each antibody to GARP-expressing cells. h151D-H1L1, h151D-H4L4 and h198D-H3L4 showed specific binding activity to GARP. [Figure 38] 38 is a diagram showing the binding of each antibody to cells co-expressing GARP-TGFβ1. Each of the antibodies 105F, h151D-H1L1, h151D-H4L4, and h198D-H3L4 was shown to bind to both GARP and GARP mutants co-expressed with TGFβ1, and showed binding activity to a region of GARP different from that of the known antibodies MHG8 and LHG10. [Figure 39] 39 is a diagram showing the binding of each antibody to L428 cells. Each of the antibodies h151D-H1L1, h151D-H4L4, and h198D-H3L4 exhibited binding activity to endogenously expressed GARP. [Diagram 40] 40 shows the binding of each antibody to Treg. Each of the antibodies h151D-H1L1, h151D-H4L4, and h198D-H3L4 showed binding activity to FoxP3-positive Treg. [Diagram 41]41 is a diagram showing the ADCC activity of each antibody. Each of the antibodies h151D-H1L1, h151D-H4L4 and h198D-H3L4 exhibited ADCC activity. [Diagram 42] 42 is a diagram showing the Treg function inhibitory activity of each antibody. Each of the antibodies h151D-H1L1, h151D-H4L4, and h198D-H3L4 exhibited Treg function inhibitory activity. [Diagram 43] FIG. 43 shows the suppression of target cell lysis activity of CTL by Treg. [Diagram 44] 44 is a diagram showing the enhancement of anti-tumor activity by each antibody. Each of the antibodies 105F, h151D-H1L1, h151D-H4L4, and h198D-H3L4 inhibited the suppression of CTL cell activity by Treg and enhanced the anti-tumor activity. [Diagram 45] 45 is a diagram showing the in vivo antitumor activity of each antibody. Each of the antibodies 105F, h151D-H1L1, h151D-H4L4, and h198D-H3L4 exhibited antitumor activity in an in vivo model. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0013] In this specification, the terms "cancer" and "tumor" are used interchangeably.

[0014] In this specification, the term "gene" includes not only DNA but also its mRNA, cDNA and the like. This also includes cRNA.

[0015] As used herein, the term "polynucleotide" is used interchangeably with nucleic acid. Also included are DNA, RNA, probes, oligonucleotides, and primers.

[0016] In this specification, the terms "polypeptide" and "protein" are used interchangeably.

[0017] In this specification, the term "cell" includes cells in an animal body and cultured cells.

[0018] As used herein, "GARP" is used synonymously with GARP protein.

[0019] As used herein, "cytotoxicity" refers to any action that causes a pathological change in a cell. This refers to damage caused by not only direct trauma, but also DNA breaks, the formation of base dimers, and chromosome Damage to the structure and function of all cells, including amputation, damage to the cell division apparatus, and reduced activity of various enzymes This refers to.

[0020] As used herein, the term "cytotoxic activity" refers to the induction of the above-mentioned cell damage. As used herein, the term "antibody-dependent cellular cytotoxicity" refers to ADCC is an anti-tumor cytotoxicity (ADCC) activity in which NK cells target tumor cells and other targets via antibodies. It refers to the activity of damaging cells.

[0021] As used herein, the term "epitope" refers to a partial peptide of GARP to which a specific anti-GARP antibody binds. The epitope, which is a partial peptide of GARP, is an immunological peptide. It can be determined by assay methods well known to those skilled in the art, for example, the following method. First, various partial structures of the antigen are prepared. Oligopeptide synthesis techniques can be used. For example, GARP can be synthesized from the C-terminus or N-terminus. A series of polypeptides shortened in sequence to an appropriate length are then synthesized by recombinant gene technology well known to those skilled in the art. After preparing the antibodies using these proteins, the reactivity of the antibodies against them was examined and the rough recognition sites were determined. Later, shorter peptides were synthesized and their reactivity was examined. By using the above method, it is possible to determine the epitope. The epitope is a structure that is determined by X-ray structural analysis of the amino acid residues of the antigen adjacent to the antibody. This can be determined by identifying As used herein, "antibodies that bind to the same epitope" refers to antibodies that bind to a common epitope. The first antibody is a different antibody that binds to a partial peptide or a partial three-dimensional structure of the first antibody. If the second antibody binds, it is determined that the first and second antibodies bind to the same epitope. In addition, a second antibody can compete with the binding of the first antibody to the antigen. (i.e., the second antibody prevents the first antibody from binding to the antigen) Even if the sequence or structure of a specific epitope has not been determined, the first and second antibodies It can be determined that the first antibody and the second antibody bind to the same epitope. When the first antibody binds to the same epitope and the second antibody has a special effect such as antitumor activity, The second antibody is expected to have similar activity. If the second anti-GARP antibody binds to the corresponding partial peptide, the first and second antibodies bind to the same GARP It can be determined that the first anti-GARP antibody binds to a single epitope. By confirming that a second anti-GARP antibody competes for binding to the first antibody, It can be determined that the first antibody and the second antibody bind to the same epitope of GARP.

[0022] As used herein, "CDR" refers to a complementarity determining region. It is known that the heavy and light chains of an antibody molecule each have three CDRs. CDRs are also called hypervariable domains, and are the domains that make up the heavy and light chains of an antibody. It is a region within the variable region where the primary structure is particularly variable, and is the site of high variation in the heavy and light chain polypeptides. In the present specification, the term "antibody" refers to a peptide that is separated into three parts on the primary structure of the antibody chain. For the CDRs of the heavy chain, the CDRs are arranged as CDRH1, CDRH2, CDRH3, and CDRH4 from the amino terminal side of the heavy chain amino acid sequence. The light chain CDRs are represented as CDRL1, CDRL2, and CDRL3 from the amino-terminus of the light chain amino acid sequence. These sites are close to each other in the three-dimensional structure and determine the specificity for the antigen to which they bind. It is determined.

[0023] In the present invention, the term "hybridizing under stringent conditions" refers to a hybridization reaction using a commercially available hybridization method. Hybridization solution: ExpressHyb Hybridization Solution (Clontech) , hybridization at 68°C, or 0.7-1.0 M with DNA-immobilized filters. After hybridization at 68°C in the presence of 100% NaCl, the hybridization was performed in 0.1-2x SSC solution (1x The plate was washed at 68°C using a concentrated SSC solution (150 mM NaCl, 15 mM sodium citrate). The hybridization is performed under conditions that allow identification by the hybridization with the target gene or conditions equivalent thereto. cormorant.

[0024] 1. GARP The GARP used in the present invention is derived from GARP-expressing cells of humans or non-human mammals (rats, mice, etc.). It can be used by directly purifying it from the cells or by preparing a cell membrane fraction of the cells. GARP can be synthesized in vitro or produced in host cells by genetic engineering. Specifically, the genetic engineering can be carried out by inserting GARP cDNA into a gene capable of expressing the GARP gene. After incorporation into a suitable vector, the vector is transformed into a solution containing the enzymes, substrates, and energy materials required for transcription and translation. Synthesize in liquid or transform other prokaryotic or eukaryotic host cells. The protein can be obtained by expressing GARP using the method described above. The amino acid sequence of human GARP is set forth in SEQ ID NO: 1 of the sequence listing. The sequences are set out in FIG. In addition, in the amino acid sequence of the above GARP, one or several amino acids are substituted, deleted and / or consists of an added amino acid sequence, and a protein with the same biological activity as the protein is also known as GARP. is included.

[0025] Mature human GARP from which the signal sequence has been removed is the 20th amino acid sequence shown in SEQ ID NO:1. It corresponds to the amino acid sequence consisting of the 662nd amino acid residue.

[0026] In addition, the amino acid sequence shown in SEQ ID NO: 1 in the sequence listing, or a signal sequence derived from this sequence In the amino acid sequence from which the sequence has been removed, one or several amino acids have been substituted, deleted, or added. GARP also includes proteins that have the same amino acid sequence and have the same biological activity as GARP. In addition, a splice variant encoded by the human GARP locus has been reported. Amino acid sequence or the amino acid sequence in which one or several amino acids are substituted, deleted, A protein having an amino acid sequence added thereto and having a biological activity equivalent to that of GARP is also called GARP. is included.

[0027] 2. Production of Anti-GARP Antibodies The antibody against GARP of the present invention can be an anti-GARP human antibody. The antibody refers to a human antibody having only antibody gene sequences derived from human chromosomes. Anti-GARP human antibodies are derived from humans carrying a human chromosome fragment that contains the genes for the heavy and light chains of human antibodies. A method using antibody-producing mice (Tomizuka, K. et al., Nature Genetics (1997) 16, p. .133-143,;Kuroiwa,Y.et.al.,Nucl.Acids Res.(1998)26,p.3447-3448;Y oshida,H.et.al.,Animal Cell Technology:Basic and Applied Aspects vol. .10, p.69-73 (Kitagawa, Y., Matsuda, T. and Iijima, S. eds.), Kluwer Aca demic Publishers,1999.;Tomizuka,K.et.al.,Proc.Natl.Acad.Sci.USA(20 00)97, pp.722-727, etc.).

[0028] Such human antibody-producing mice specifically have endogenous immunoglobulin heavy and light chains. The gene locus was destroyed and replaced by a yeast artificial chromosome (YAC) vector. A gene recombination in which human immunoglobulin heavy and light chain loci have been introduced via vectors, etc. The recombinant animals are used to generate knockout and transgenic animals, and to synthesize these animals. It can be created by multiplying it with Shi.

[0029] In addition, a human antibody encoding each of the heavy and light chains of the human antibody can be produced by genetic recombination technology. A eukaryotic cell is transformed with a cDNA, preferably a vector containing the cDNA, to thereby obtain a recombinant gene. The antibody is cultured by culturing a transformed cell that produces the human monoclonal antibody. The host cell may be, for example, a eukaryotic cell, preferably a CHO cell, Mammalian cells such as lymphocytes and myelomas can be used. In addition, we obtained human antibodies derived from phage display selected from a human antibody library. How to (Wormstone, IMet.al, Investigative Ophthalmology & Visual Science nce.(2002)43(7),p.2301-2308;Carmen,S.et.al.,Briefings in Function al Genomics and Proteomics(2002),1(2),p.189-203;Siriwardena,D.et.a l., Ophthalmology (2002) 109(3), p. 427-431, etc. For example, the variable region of a human antibody is expressed on the surface of a phage as a single chain antibody (scFv), A phage display method for selecting phages that bind to the antigen (Nature Biotechnology (2005 ),23,(9),p.1105-1116) can be used.

[0030] By analyzing the genes of the phages selected by binding to the antigen, The DNA sequence encoding the variable region of the human antibody that binds to the antigen can be determined. Once the DNA sequence of the scFv is known, it can be synthesized by linking it to the DNA sequence of the antibody constant region. An IgG expression vector having the sequence is prepared and introduced into an appropriate host for expression. Human antibodies can be obtained (WO92 / 01047, WO92 / 20791, WO93 / 06213, WO93 / 11236, WO93 / 19172, WO95 / 01438, WO95 / 15388, Annu.Rev.Immunol(1994)12,p.433-455, N Nature Biotechnology (2005)23(9), p.1105-1116).

[0031] The antibody against GARP of the present invention can be prepared by a conventional method by isolating GARP or the amino acid sequence of GARP. An animal is immunized with a selected polypeptide, and antibodies produced in the body are collected and purified. The GARP antigen can be obtained by the following procedure. Alternatively, animals can be immunized with GARP derived from animals other than humans, such as rats. By testing the cross-reactivity of the obtained antibody binding to heterologous GARP with human GARP, Antibodies that are applicable to human diseases can be selected.

[0032] Also, known methods (e.g., Kohler and Milstein, Nature (1975) 256, p. 495-497, Ke nnet, R.ed., Monoclonal Antibodies, p.365-367, Plenum Press, NY (1980)). Therefore, by fusing antibody-producing cells that produce antibodies against GARP with myeloma cells, It is also possible to establish hybridomas and obtain monoclonal antibodies.

[0033] The antigen GARP is produced by genetically engineering the GARP gene in host cells. You can get this.

[0034] Specifically, a vector capable of expressing the GARP gene is prepared and introduced into a host cell to express the gene. The gene is expressed and the expressed GARP is purified. The acquisition method will be explained.

[0035] (1) Preparation of antigen As an antigen for producing an anti-GARP antibody, GARP or at least six consecutive portions thereof can be used. Polypeptides consisting of a specific amino acid sequence, or any amino acid sequence or carrier attached to these. Examples of such derivatives include those in which the aryl group is added.

[0036] GARP can be used after direct purification from human tumor tissues or tumor cells. GARP can be synthesized in vitro or produced in host cells by genetic engineering. Therefore, it can be obtained.

[0037] Specifically, the gene manipulation involves inserting the GARP cDNA into an expression vector and then transcribing it. It is synthesized in a solution containing the enzymes, substrates, and energy materials required for translation, or from other sources. By expressing GARP by transforming a karyotic or eukaryotic host cell, Thus, the antigen can be obtained.

[0038] In addition, a fusion protein that links the extracellular domain of the membrane protein GARP with the constant domain of an antibody was appropriately developed. By expressing the antigen in an appropriate host-vector system, it is possible to obtain the antigen as a secreted protein. It is also possible.

[0039] For example, the GARP cDNA was synthesized by using a cDNA library expressing the GARP cDNA as a template. Using primers that specifically amplify cDNA, polymerase chain reaction (hereafter referred to as "PCR") was performed. ) (see Saiki, RK, et al. Science (1988) 239, p. 487-489), which is called the PCR method. It can be obtained by

[0040] In vitro synthesis of polypeptides can be achieved, for example, by using the Roche Diagnostics One example is Rapid Translation System (RTS) made by Tix. This is not limited to the above.

[0041] Prokaryotic hosts include, for example, Escherichia coli and Bacillus subtilis. The gene of interest can be transformed into these host cells. To be compatible with the host, the vector must contain a replicon, i.e., an origin of replication, and regulatory sequences derived from a species compatible with the host. The host cell is transformed with a plasmid vector. It is preferable to have a sequence capable of conferring selectable phenotypes to cells. .

[0042] Eukaryotic host cells include vertebrate, insect, and yeast cells, and are classified as vertebrate cells and For example, COS cells, which are monkey cells (Gluzman, Y. Cell (1981) 23, p. 175-182, ATCC CRL-1650), mouse fibroblast NIH3T3 (ATCC No. CRL-1658), and Chinese ham A dihydrofolate reductase-deficient mutant (Urlaub, Ga) of star ovary cells (CHO cells, ATCC CCL-61) nd Chasin, LA Proc. Natl. Acad. Sci. USA (1980) 77, p. 4126-4220) are often used. Examples include, but are not limited to:

[0043] The transformant obtained as described above can be cultured according to a conventional method. As a result, the desired polypeptide is produced intracellularly or extracellularly.

[0044] The medium used for the culture may be any of various commonly used media depending on the host cell used. In the case of E. coli, for example, an LB medium containing an antibiotic such as ampicillin as necessary is used. It can be used by adding biological substances or IPMG.

[0045] The recombinant protein produced inside or outside the transformant cells by the above-mentioned culture is The substances are separated and purified by various known separation procedures that utilize their physical and chemical properties. It is possible.

[0046] Specific examples of such methods include treatment with a conventional protein precipitant, ultrafiltration, molecular Sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography Various liquid chromatography such as fluoromography and affinity chromatography, Examples of the method include the above-mentioned analytical methods and combinations thereof.

[0047] In addition, by linking a six-residue histidine tag to the recombinant protein to be expressed, It can be efficiently purified using nickel affinity columns. By linking the Fc region of IgG to a recombinant protein, it can be efficiently purified on a Protein A column. It is possible.

[0048] By combining the above methods, it is possible to easily obtain a large amount of a target polypeptide with high yield and purity. can be manufactured.

[0049] (2) Production of anti-GARP monoclonal antibodies As an example of an antibody that specifically binds to GARP, there is a monoclonal antibody that specifically binds to GARP. The method of obtaining them is as follows.

[0050] The production of a monoclonal antibody generally requires the following steps: That is, (a) purification of a biopolymer to be used as an antigen; (b) After immunizing an animal by injecting it with an antigen, blood is taken and the antibody titer is assayed. determining the time for spleen removal and then preparing antibody-producing cells; (c) preparation of myeloma cells (hereinafter referred to as "myeloma"); (d) cell fusion between antibody-producing cells and myelomas; (e) selection of hybridomas producing the desired antibody; (f) division into single cell clones (cloning); (g) In some cases, the cultivation of hybridomas for the production of large amounts of monoclonal antibodies. Cultivation or rearing of animals transplanted with hybridomas, (h) The physiological activity and binding specificity of the monoclonal antibody thus produced. These include examination of the properties as a labeling reagent, etc.

[0051] The method for producing a monoclonal antibody will be described in detail below along the above steps. Without being limited thereto, for example, antibody-producing cells other than splenocytes and myelomas may also be used. Cut.

[0052] (a) Purification of antigen As the antigen, GARP prepared by the above-mentioned method or a part thereof can be used. do.

[0053] In addition, a membrane fraction prepared from a GARP-expressing recombinant cell, or the GARP-expressing recombinant cell itself, Furthermore, a partial peptide of the protein of the present invention that has been chemically synthesized using a method well known to those skilled in the art is used as an antigen. It can also be used as.

[0054] (b) Preparation of antibody-producing cells The antigen obtained in step (a) is mixed with Freund's complete or incomplete adjuvant or Karimi. The mixture is mixed with an auxiliary agent such as alum and used as an immunogen to immunize laboratory animals. Animals used in the hybridoma production method can be used without any problems. Specifically, For example, mice, rats, goats, sheep, cows, horses, etc. can be used. From the viewpoints of availability of myeloma cells to be fused with the isolated antibody-producing cells, mouse Alternatively, rats are preferably used as the animals to be immunized.

[0055] There are no particular limitations on the strains of mice and rats that can be used. For example, each lineage A, AKR, BALB / c, BDP, BA, CE, C3H, 57BL, C57BL, C57L, DBA, FL, HTH, HT1, LP, NZB, NZW, RF, R III, SJL, SWR, WB, 129, etc., and in the case of rats, For example, Wistar, Low, Lewis, Sprague, Dawley, ACI, BN, Fischer, etc. can be used. can. These mice and rats are available from experimental animal breeding facilities such as Clare Japan, Charles River Japan, etc. It can be obtained from breeding distributors.

[0056] Among these, taking into consideration the compatibility of fusion with myeloma cells described below, the BALB / c strain of mouse is However, among rats, Wistar and Low strains are particularly preferred as animals to be immunized.

[0057] In addition, taking into account the homology of antigens between humans and mice, the mechanism of eliminating autoantibodies is suppressed. It is also preferable to use mice with an autoimmune disease, that is, mice with an autoimmune disease.

[0058] The age of the mice or rats at the time of immunization is preferably 5 to 12 weeks, more preferably The age range is usually 6 to 8 weeks.

[0059] To immunize animals with GARP or a recombinant form thereof, see, for example, Weir, DM, Handbook of Experimental Immunology, Vol.I.II.III.,Blackwell Scientific Publications ,Oxford (1987), Kabat, EA and Mayer, MM, Experimental Immunochemistry, Charles C Thomas Publisher Springfield, Illinois (1964) and other publications provide detailed information. Any known method can be used. Among these immunization methods, the preferred method in the present invention is specifically as follows: That is correct.

[0060] First, a membrane protein fraction, or cells expressing the antigen, is cultured on the skin of an animal. The drug is administered intravenously or intraperitoneally.

[0061] However, to increase the efficiency of immunity, it is preferable to use both in combination, with intradermal administration in the first half and If only the second or final injection is administered intraperitoneally, the immunological efficiency can be particularly enhanced.

[0062] The administration schedule of the antigen varies depending on the type of animal to be immunized, individual differences, etc., but generally, The antigen is preferably administered 3 to 6 times at intervals of 2 to 6 weeks, and more preferably 3 to 4 times at intervals of 2 ~4 weeks is even more preferred.

[0063] The dose of antigen varies depending on the type of animal and individual differences, but is generally 0.05 to 5 mg. The amount is preferably about 0.1 to 0.5 mg.

[0064] The booster immunization is carried out 1 to 6 weeks, preferably 2 to 4 weeks, more preferably 1 to 6 weeks after the antigen administration. Preferably, this is done 2 to 3 weeks later.

[0065] The amount of antigen administered during booster immunization varies depending on the type and size of the animal, but generally For example, in the case of a mouse, the amount is 0.05 to 5 mg, preferably 0.1 to 0.5 mg, and more preferably 0.1 to 0 Approximately 0.2 mg.

[0066] 1 to 10 days, preferably 2 to 5 days, more preferably 2 to 3 days after the booster immunization Spleen cells or lymphocytes containing antibody-producing cells are aseptically extracted from the immunized animal. If we measure the antibody titer and use animals with sufficiently high antibody titers as a source of antibody-producing cells, The efficiency of subsequent operations can be improved.

[0067] The antibody titer measurement method used here may include, for example, the RIA method or the ELISA method. The present invention can be implemented in a variety of ways, including but not limited to these.

[0068] In the present invention, the antibody titer can be measured, for example, by the ELISA method, according to the following procedure: This can be done by:

[0069] First, a purified or partially purified antigen is adsorbed onto a solid-phase surface such as a 96-well plate for ELISA, and then Furthermore, the solid phase surface to which the antigen is not adsorbed is treated with a protein unrelated to the antigen, such as bovine serum albumin. (hereinafter referred to as "BSA"), the surface was washed, and then serially diluted samples were used as the first antibody. (eg, mouse serum) so that the antibodies in the sample bind to the antigen.

[0070] Furthermore, an antibody against the enzyme-labeled mouse antibody was added as the second antibody to bind to the mouse antibody. After washing, the substrate of the enzyme is added and the change in absorbance due to the color development caused by the decomposition of the substrate is measured. The antibody titer is calculated based on this.

[0071] Isolation of antibody-producing cells from spleen cells or lymphocytes of an immunized animal can be carried out by a known method (e.g. , Kohler et al., Nature (1975) 256, p. 495,; Kohler et al., Eur. J. Immunol. (1977)6, p.511,;Milstein et al.,Nature(1977),266,p.550,;Walsh,Natur For example, in the case of spleen cells, The liver was cut into pieces, the cells were filtered through a stainless steel mesh, and then transferred to Eagle's minimum essential medium (MEM). Conventional methods for isolating antibody-producing cells by suspension can be employed.

[0072] (c) Preparation of myeloma cells (hereinafter referred to as "myeloma"). There is no particular limitation on the myeloma cells used for cell fusion, and they may be appropriately selected from known cell lines. However, considering the convenience of selecting hybridomas from fused cells, Considering this, we selected HGPRT (Hypoxanthine-GUANINE phosphoribosyl trastuzumab), for which selection procedures have been established. It is preferable to use a strain lacking nsferase.

[0073] Namely, X63-Ag8 (X63), NS1-ANS / 1 (NS1), and P3X63-Ag8.U1 (P3U1) derived from mice. , X63-Ag8.653(X63.653), SP2 / 0-Ag14(SP2 / 0), MPC11-45.6TG1.7(45.6TG), FO, S1 49 / 5XXO, BU.1, etc., 210.RSY3.Ag.1.2.3(Y3) of rat origin, etc., U266AR(S KO-007), GM1500 / GTG-A12(GM1500), UC729-6, LICR-LOW-HMy2(HMy2), 8226AR / NIP4 -1 (NP41), etc. These HGPRT-deficient strains are available from, for example, the American Type Culture Collection (ATC). n (ATCC), etc.

[0074] These cell lines were grown in a suitable medium, such as 8-azaguanine medium [RPMI-1640 medium plus glutathione]. Glutamate, 2-mercaptoethanol, gentamicin, and fetal calf serum (FCS) (a medium containing 8-azaguanine) and Iscove's modified Dulbecco's medium (Iscove's Modified Dulbecco's Medium; hereinafter referred to as "IMDM"), or Dulbecco's modified Subculture in Dulbecco's Modified Eagle Medium (hereinafter referred to as "DMEM") Three to four days before cell fusion, the cells are cultured in a normal medium [e.g., ASF104 medium containing 10% FCS (Taste On the day of fusion, 2 × 10 7 Ensure that the above cell numbers are maintained.

[0075] (d) Cell fusion The fusion of antibody-producing cells with myeloma cells was carried out by a known method (Weir, DM, Handbook of Experimental Immunology, 2001). xperimental Immunology, Vol.I.II.III.,Blackwell Scientific Publications,Ox ford (1987), Kabat, EA and Mayer, MM, Experimental Immunochemistry, Char. According to the method of C. Thomas Publisher Springfield, Illinois (1964), the cell viability was measured by The reaction can be carried out appropriately under conditions that do not excessively decrease the reaction temperature.

[0076] Such methods include, for example, dissolving an antibody in a highly concentrated polymer solution such as polyethylene glycol. Chemical methods that mix producer cells with myeloma cells, physical methods that use electrical stimulation, etc. Among these, specific examples of the above chemical methods are as follows: . That is, when polyethylene glycol is used as a high-concentration polymer solution, The mixture is then cooled to room temperature in a polyethylene glycol solution having a concentration of 1500 to 6000, preferably 2000 to 4000, at 30 to 40° C. The antibody-producing cells and myeloma cells are incubated at a temperature of preferably 35 to 38° C. for 1 to 10 minutes, preferably 5 Mix for ~8 minutes.

[0077] (e) Selection of Hybridoma Population The method for selecting hybridomas obtained by the above cell fusion is not particularly limited. (Hypoxanthine-Aminopterin-Thymidine) Selection Method (Kohler et al., Nature (1975 )256,p.495;Milstein et al.,Nature(1977)266,p.550) are used.

[0078] This method uses HGPRT-deficient myeloma cells that cannot survive on aminopterin. This is effective in obtaining hybridomas by the above method.

[0079] That is, by culturing unfused cells and hybridomas in HAT medium, amino Only hybridomas that are resistant to telin are selectively allowed to remain and grow. It is possible to do so.

[0080] (f) Division into single cell clones (cloning) Hybridoma cloning methods include, for example, the methylcellulose method, the soft agarose method, and the like. Methods known in the art, such as the limiting dilution method and the like, can be used (see, for example, Barbara, BM and Stanley, ey,MS:Selected Methods in Cellular Immunology,WHFreeman and Company,S Among these methods, the tertiary method such as the methylcellulose method is particularly For example, the hybridoma group formed by cell fusion is cultured in ClonaCel Methylcellulose such as l-HY Selection Medium D (StemCell Technologies, #03804) The hybridomas were then suspended in a culture medium and cultured. The hybridoma colonies formed were then harvested to produce monoclonal antibodies. It is possible to obtain single hybridomas. Each hybridoma colony is cultured. The hybridomas that showed stable antibody titers in the culture supernatant were classified as GARP monoclonal antibodies. A hybridoma line producing a clonal antibody is selected.

[0081] Examples of hybridoma lines established in this manner include GARP hybridoma 151D and In the present specification, the GARP hybridomas 151D and 198D are also included. The antibodies produced by 151D and 198D are referred to as "151D antibody" or "198D antibody" or simply "151D" or Write "198D". The heavy chain variable region of the 151D antibody has the amino acid sequence shown in SEQ ID NO: 15 of the sequence listing. In addition, the light chain variable region of the 151D antibody has the amino acid sequence shown in SEQ ID NO: 17 in the sequence listing. The amino acid sequence of the heavy chain variable region shown in SEQ ID NO: 15 in the sequence listing is 14. Also, the sequence shown in SEQ ID NO: 17 of the sequence listing. The amino acid sequence of the light chain variable region shown is the nucleotide sequence shown in SEQ ID NO: 16 of the sequence listing. It is coded by column. The heavy chain variable region of the 198D antibody has the amino acid sequence shown in SEQ ID NO: 19 in the sequence listing. In addition, the light chain variable region of the 198D antibody has the amino acid sequence shown in SEQ ID NO:21 in the sequence listing. The amino acid sequence of the heavy chain variable region shown in SEQ ID NO: 19 in the sequence listing is 18. Also, the sequence shown in SEQ ID NO: 21 in the sequence listing. The amino acid sequence of the light chain variable region shown is the nucleotide sequence shown in SEQ ID NO: 20 of the sequence listing. It is coded by column.

[0082] (g) Preparation of monoclonal antibodies by hybridoma culture The hybridomas selected in this manner are cultured to produce monoclonal antibodies. However, prior to the culture, the desired monoclonal antibody can be obtained efficiently. It is desirable to screen for hybridomas that produce the polypeptide.

[0083] For this screening, a method known per se can be used.

[0084] The antibody titer in the present invention is measured, for example, by the ELISA method described in the above item (b). It is possible to do so.

[0085] The hybridomas obtained by the above method are frozen in liquid nitrogen or in a freezer at -80°C or lower. It can be stored in a bound state.

[0086] The hybridomas that had completed cloning were cultured in a normal medium instead of HT medium. can be.

[0087] Mass culture is carried out using large culture flasks, either rotary culture or spinner culture. The supernatant of the culture was purified by a method well known to those skilled in the art, such as gel filtration. Thus, a monoclonal antibody that specifically binds to the protein of the present invention can be obtained.

[0088] In addition, mice of the same strain (e.g., BALB / c as mentioned above) or Nu / Nu mice were intraperitoneally The monoclonal antibodies of the present invention are produced by injecting hybridomas and allowing the hybridomas to grow. Ascites containing large amounts of cloned antibodies can be obtained.

[0089] When administering intraperitoneally, administer 2,6,10,14-tetramethylpentene in advance (3 to 7 days). Add mineral oil such as 2,6,10,14-tetramethyl pentadecane (pristane) When administered, a larger amount of ascites is obtained.

[0090] For example, an immunosuppressant was injected into the abdominal cavity of a mouse of the same strain as the hybridoma to induce T cell proliferation. After inactivation of the cells, 10 6 ~10 7 Hybridoma clone cells were incubated with serum The mice were suspended in a medium containing no serotonin (0.5 ml) and administered intraperitoneally. Usually, the abdomen became distended and ascites appeared. Once the cells have matured, ascites is collected from the mouse. This method results in approximately 100 times more cell culture fluid. Thus, monoclonal antibodies having the above concentrations can be obtained.

[0091] The monoclonal antibody obtained by the above method is described in, for example, Weir, DM: Handbook of Experimental ental Immunology,Vol.I,II,III,Blackwell Scientific Publications,Oxford(19 78) can be purified by the method described in

[0092] The monoclonal antibody thus obtained has high antigen specificity for GARP.

[0093] (h) Monoclonal antibody assay The isotype and subclass of the obtained monoclonal antibody are determined as follows: It is possible.

[0094] First, the identification method includes the Ouchterlony method, the ELISA method, and the RIA method. It is possible.

[0095] Although the Ouchterlony method is simple, it requires a concentration procedure when the concentration of monoclonal antibodies is low. It is necessary to create

[0096] On the other hand, when the ELISA or RIA method is used, the culture supernatant is directly reacted with the antigen-adsorbed solid phase. In addition, secondary antibodies corresponding to various immunoglobulin isotypes and subclasses were used. Identifying the isotype and subclass of monoclonal antibodies using is possible.

[0097] As a more convenient method, a commercially available identification kit (e.g., Mouse Typer Kit) can be used. (Bio-Rad Laboratories) or the like can also be used.

[0098] Protein quantification was performed using the Folin-Lowry method and the absorbance at 280 nm [1.4 (OD28 This can be calculated from the following formula: Immunoglobulin concentration (mg / ml) = 1 mg / ml of immunoglobulin.

[0099] Furthermore, the steps (a) to (h) of (2) are carried out again to obtain a separate and independent monoclonal antibody. Even if antibodies are obtained, 105F antibody, 110F antibody, 151D-derived antibody (humanized 151D antibody) and It is possible to obtain antibodies with properties equivalent to those of 198D-derived antibodies (humanized 198D antibodies). An example of such an antibody is an antibody that binds to the same epitope as each of the above antibodies. The 105F antibody has the amino acid sequence at amino acid number 366 in the amino acid sequence of GARP (SEQ ID NO:1). The 110F antibody recognizes the amino acid sequences The 151D-derived antibody (humanized 151D antibody) recognizes the sequences of 54 to 112 and 366 to 392. The 198D-derived antibody (humanized 98D antibody) recognizes amino acid numbers 352 to 392 of the 198D-derived antibody. Since the epitope recognizes and binds to amino acid numbers 18 to 112 of GARP, the epitope of interest is GARP. Such a region in the amino acid sequence can be cited as an epitope. The newly produced monoclonal antibody is a partial peptide that binds to the above-mentioned 105F antibody, etc. If the monoclonal antibody binds to the partial three-dimensional structure, it has the same endonucleases as the above-mentioned 105F antibody and other antibodies. In addition, it can be determined that the antibody binds to the GARP target. The monoclonal antibody competes for binding to the target protein (i.e., the monoclonal antibody By confirming that the binding of the 105F antibody and other antibodies to GARP is prevented, Even if the sequence or structure of the target peptide has not been determined, the monoclonal antibody has the above-mentioned 105F antibody. It can be determined that the antibody binds to the same epitope as the antibody of the human body. If it is confirmed that the monoclonal antibody has the same characteristics as the above-mentioned 105F antibody, etc. It is strongly expected that the

[0100] (3) Other antibodies The antibody of the present invention includes, in addition to the monoclonal antibody against GARP, a heterologous antibody against humans. Recombinant antibodies that have been artificially modified to reduce their virulence, such as cytotoxicity. Chimeric antibodies, humanized antibodies, and the above human antibodies are also included. These antibodies can be produced using known methods.

[0101] The obtained antibodies can be purified to homogeneity. Separation and purification of antibodies are performed in the same manner as for conventional proteins. For example, column chromatography, Filtration, ultrafiltration, salting out, dialysis, preparative polyacrylamide gel electrophoresis, isoelectric By appropriately selecting and combining techniques such as spot electrophoresis, antibodies can be separated and purified (Strate gies for Protein Purification and Characterization:A Laboratory Course Manual, Daniel R.Marshak et al.eds.,Cold Spring Harbor Laboratory Press(1996);Ant ibodies:A Laboratory Manual.Ed Harlow and David Lane,Cold Spring Harbor Labor atory (1988)), but is not limited to these.

[0102] Chromatography includes affinity chromatography, ion exchange chromatography, Chromatography, hydrophobic chromatography, gel filtration chromatography, reversed phase chromatography Examples of the methods include chromatography, adsorption chromatography, and the like. These chromatography steps are carried out using liquid chromatography such as HPLC or FPLC. It is possible.

[0103] The columns used for affinity chromatography are protein A columns, For example, a column using a protein A column can be used. Examples of suitable antibodies include Hyper D, POROS, and Sepharose FF (Pharmacia). Antibodies can also be purified by using antigen-immobilized carriers and utilizing their binding to antigens. It is possible. The obtained antibodies were evaluated for their binding to the antigen by the method described in the Examples below. Then, a suitable antibody can be selected.

[0104] Antibody stability can be used as an index for comparing antibody properties. Differential scanning calorimeter (DSC) is used to measure the thermal denaturation midpoint (Tm), which is a good indicator of the relative structural stability of a protein. DSC is a device that can measure Tm value quickly and accurately. By comparing these values, differences in thermal stability can be compared. It is known that the quality of the antibody shows some correlation with its thermal stability (Lori Burton, et al. .al.,Pharmaceutical Development and Technology(2007)12,p.265-273) A suitable antibody can be selected based on the qualitative index. The characteristics of the enzyme include high yield in suitable host cells and low aggregation in aqueous solution. For example, the antibody with the highest yield does not necessarily have the highest thermostability. Based on the above criteria, the most suitable antibody for administration to humans will be selected. It is necessary to remove it.

[0105] The anti-GARP human antibody of the present invention is an antibody obtained by the above-mentioned phage display method. and preferably the 105F antibody and the 110F antibody, which have the following structures: can.

[0106] The heavy chain of the 105F antibody has the amino acid sequence shown in SEQ ID NO: 2 of the sequence listing. In the heavy chain amino acid sequence shown in column number 2, an amino acid sequence consisting of amino acid residues 1 to 118 is The amino acid sequence is a variable region, and the amino acid sequence from amino acid residues 119 to 448 is a constant region. The variable region is an amino acid sequence of 26 to 35 in SEQ ID NO: 2 of the sequence listing. CDRH1 consisting of the amino acid sequence set forth in the sequence 50-66; and CDRH2 consisting of the amino acid sequence set forth in the sequence 99-107. The sequence of SEQ ID NO:2 is shown in FIG. do.

[0107] The light chain of the 105F antibody has the amino acid sequence shown in SEQ ID NO: 3 of the sequence listing. In the light chain amino acid sequence shown in column 3, an amino acid sequence consisting of amino acid residues 1 to 112 is The amino acid sequence is a variable region, and the amino acid sequence from amino acid residues 113 to 217 is a constant region. The variable region is an amino acid sequence of 23 to 36 in SEQ ID NO: 3 of the sequence listing. CDRL1 consisting of the amino acid sequence set forth in any one of the following: CDRL2 consisting of the amino acid sequence set forth in any one of the following: The sequence of SEQ ID NO:3 is shown in FIG. do.

[0108] The heavy chain of the 110F antibody has the amino acid sequence shown in SEQ ID NO: 4 of the sequence listing. In the heavy chain amino acid sequence shown in column number 4, an amino acid sequence consisting of amino acid residues 1 to 123 is The amino acid sequence is a variable region, and the amino acid sequence from amino acid residues 124 to 453 is a constant region. The variable region is an amino acid sequence of 26 to 35 in SEQ ID NO: 4 of the sequence listing. CDRH1 consisting of the amino acid sequence set forth in the sequence 50-66; and CDRH2 consisting of the amino acid sequence set forth in the sequence 99-112. The sequence of SEQ ID NO:4 is shown in FIG. do.

[0109] The light chain of the 110F antibody has the amino acid sequence shown in SEQ ID NO:5 in the sequence listing. In the light chain amino acid sequence shown in column number 5, an amino acid sequence consisting of amino acid residues 1 to 111 is The amino acid sequence is a variable region, and the amino acid sequence from amino acid residues 112 to 216 is a constant region. The variable region is an amino acid sequence of 23 to 36 in SEQ ID NO:5 of the sequence listing. CDRL1 consisting of the amino acid sequence set forth in any one of the following: CDRL2 consisting of the amino acid sequence set forth in any one of the following: The sequence of SEQ ID NO:5 is shown in FIG. do.

[0110] The heavy chain amino acid sequence of the 105F antibody shown in SEQ ID NO: 2 of the sequence listing is shown in SEQ ID NO: 6 of the sequence listing. The nucleotide sequence shown in SEQ ID NO:6 in the sequence listing is The nucleotide sequence consisting of nucleotides 1 to 354 of the nucleotide sequence corresponds to the heavy chain of the 105F antibody. The nucleotide sequence encoding the chain variable region is from nucleotide 355 to nucleotide 1344. The nucleotide sequence encodes the heavy chain constant region of the 105F antibody. The nucleotide sequence is represented by nucleotides 76 to 105 of SEQ ID NO:6, which encodes CDRH1. A polynucleotide having the nucleotide sequence set forth above, nucleotide number 1 encoding CDRH2 A polynucleotide comprising the nucleotide sequence set forth in any one of claims 48 to 198, and a nucleic acid encoding CDRH3. A polynucleotide having a nucleotide sequence set forth in nucleotide numbers 295 to 321 of The sequence of SEQ ID NO:6 is shown in FIG.

[0111] The amino acid sequence of the light chain of the 105F antibody shown in SEQ ID NO:3 in the sequence listing is The nucleotide sequence shown in SEQ ID NO: 7 in the sequence listing is encoded by the nucleotide sequence The nucleotide sequence consisting of nucleotides 1 to 336 of the nucleotide sequence corresponds to the light chain of the 105F antibody. Nucleotide sequence encoding the variable region and consisting of nucleotides 337 to 651 The sequence encodes the light chain constant region of the 105F antibody. The sequence is set forth in SEQ ID NO:7, nucleotides 67 to 108 which code for CDRL1. A polynucleotide comprising the nucleotide sequence of nucleotide no. 154 encoding CDRL2 A polynucleotide comprising the nucleotide sequence set forth in any one of claims 1 to 174, and encoding CDRL3. A polynucleotide having the nucleotide sequence set forth in nucleotide numbers 271 to 303. The sequence of SEQ ID NO:7 is also shown in FIG.

[0112] The heavy chain amino acid sequence of the 110F antibody shown in SEQ ID NO: 4 of the sequence listing is shown in SEQ ID NO: 8 of the sequence listing. The nucleotide sequence shown in SEQ ID NO: 8 of the sequence listing is encoded by the nucleotide sequence The nucleotide sequence consisting of nucleotides 1 to 369 of the nucleotide sequence corresponds to the heavy chain of the 110F antibody. The nucleotide sequence encoding the chain variable region is from nucleotide 370 to nucleotide 1359. The nucleotide sequence encodes the heavy chain constant region of the 110F antibody. The nucleotide sequence is represented by nucleotides 76 to 105 of SEQ ID NO:8, which encodes CDRH1. A polynucleotide having the nucleotide sequence set forth above, nucleotide number 1 encoding CDRH2 A polynucleotide comprising the nucleotide sequence set forth in any one of claims 48 to 198, and a nucleic acid encoding CDRH3. A polynucleotide having a nucleotide sequence set forth in nucleotide numbers 295 to 336 of The sequence of SEQ ID NO:8 is shown in FIG.

[0113] The amino acid sequence of the light chain of the 110F antibody shown in SEQ ID NO:5 of the sequence listing is identical to that shown in SEQ ID NO:9 of the sequence listing. The nucleotide sequence shown in SEQ ID NO:9 in the sequence listing is encoded by the nucleotide sequence The nucleotide sequence consisting of nucleotides 1 to 333 of the nucleotide sequence corresponds to the light chain of the 110F antibody. A nucleotide sequence encoding the variable region and consisting of nucleotides 334 to 648 The sequence encodes the light chain constant region of the 110F antibody. The sequence is set forth in SEQ ID NO:9, nucleotides 67 to 108 which code for CDRL1. A polynucleotide comprising the nucleotide sequence of nucleotide no. 154 encoding CDRL2. A polynucleotide comprising the nucleotide sequence set forth in any one of claims 1 to 174, and a nucleotide sequence encoding CDRL3. A polynucleotide having the nucleotide sequence set forth in nucleotide numbers 271 to 300. The sequence of SEQ ID NO:9 is also shown in FIG.

[0114] In addition to the above-mentioned anti-GARP human antibodies, the antibodies of the present invention include those obtained by methods other than the above-mentioned antibody obtaining methods. Even if an antibody is obtained separately and independently, it is not expected to have the same cytotoxicity as the 105F or 110F antibody. It is possible to obtain an antibody having anti-cancer activity. An example of such an antibody is the 105F antibody. Examples of such antibodies include antibodies that bind to the same epitope as the 110F antibody or the 110F antibody. The newly produced antibody is a partial peptide or partial stereoisomer that binds to the 105F or 110F antibody. If the antibody binds to the structure, it is determined that the antibody binds to the same epitope as the 105F antibody or the 110F antibody. In addition, the binding of the 105F antibody or the 110F antibody to GARP can be determined by the It was confirmed that the 105F antibody or the 110F antibody competes with the GARP antibody (i.e., the antibody inhibits the binding of the 105F antibody or the 110F antibody to GARP). By identifying the epitope, it is possible to identify the epitope even if the specific sequence or structure of the epitope has not been determined. It can be determined that the antibody binds to the same epitope as the 105F antibody or the 110F antibody. If it is confirmed that the antigenic region is the same as that of the 105F or 110F antibody, the antibody is considered to be equivalent to the 105F or 110F antibody. It is highly expected that it has cytotoxic activity.

[0115] Furthermore, the antibody of the present invention also includes artificially modified recombinant antibodies. The antibody can be produced by known methods. It has all six CDRs of the heavy and light chains of the 105F antibody or the 110F antibody, and has ADCC activity and Treg immunity. It is preferable that the antibody has an inhibitory activity against the immune suppression function, as long as it has this property. The heavy chain variable region of the 105F antibody or the 110F antibody is more preferably It is an antibody having a main and a light chain variable region.

[0116] In addition, the heavy chain and light chain amino acid sequences of the 105F and 110F antibodies are highly homologous to each other. By combining sequences showing the above, an antibody having the same activity as the antibody is selected. Such a homology is generally 80% or more, and preferably is 90% or more homologous, more preferably 95% or more homologous, and most preferably 99% or more homologous. % or more homology (provided that each CDR is identical to each of the above antibodies). The amino acid sequence of the light chain (excluding each CDR site) has one or several amino acid residues substituted or deleted. Combinations of deleted or added amino acid sequences can also have the same activity as the above antibodies. It is possible to select antibodies having the desired properties. Furthermore, examples of the anti-GARP antibody according to the present invention include the following chimeric and humanized antibodies. can be done.

[0117] Chimeric antibodies include antibodies in which the variable and constant regions of the antibody are of different species, such as mouse antibodies. Chimeric antibodies in which the variable regions of a mouse or rat-derived antibody are joined to constant regions of human origin are also included. (See Proc. Natl. Acad. Sci. USA, 81, 6851-6855, (1984)).

[0118] A chimeric antibody derived from the rat anti-human GARP antibody 151D is a chimeric antibody having the amino acids 1 to 117 of SEQ ID NO:15. A heavy chain comprising a heavy chain variable region consisting of an amino acid sequence consisting of 1 to 10 of SEQ ID NO: 17 An antibody having a light chain containing a light chain variable region having an amino acid sequence consisting of the 9th amino acid residue. The constant region may be of any human origin. In addition, a chimeric antibody derived from the rat anti-human GARP antibody 198D is a chimeric antibody having a sequence similar to that of the first to 120th residues of SEQ ID NO:19. A heavy chain comprising a heavy chain variable region consisting of an amino acid sequence consisting of amino acid residues and a heavy chain variable region consisting of an amino acid sequence consisting of SEQ ID NO: 21 A light chain comprising a light chain variable region consisting of an amino acid sequence consisting of amino acid residues 109 to 110. The antibody may have a constant region of any human origin.

[0119] An example of such a chimeric antibody is a chimeric antibody having amino acid residues 20 to 466 of SEQ ID NO:25 in the sequence listing. and a heavy chain having an amino acid sequence consisting of amino acid residues 21 to 234 of SEQ ID NO:27. and an antibody having a light chain having an amino acid sequence comprising the amino acid sequences 20 to 469 of SEQ ID NO:29 in the sequence listing. and a heavy chain having an amino acid sequence consisting of amino acid residues 21 to 234 of SEQ ID NO:31. An example of such an antibody is one that is composed of a light chain having an amino acid sequence composed of amino acid residues. In addition, in the heavy chain sequence shown in SEQ ID NO: 25 of the sequence listing, the amino acid residues from 1 to 19 are The amino acid sequence consisting of amino acid residues 20 to 136 is a signal sequence. The amino acid sequence is a variable region, and the amino acid sequence from amino acid residues 137 to 466 is a constant region. It is an area.

[0120] In addition, in the light chain sequence shown in SEQ ID NO: 27 of the sequence listing, The amino acid sequence consisting of amino acid residues 21 to 129 is a signal sequence. The amino acid sequence is a variable region, and the amino acid sequence consisting of amino acid residues 130 to 234 is a constant region. It is an area. Furthermore, in the heavy chain sequence shown in SEQ ID NO:29 in the sequence listing, The amino acid sequence consisting of amino acid residues 20 to 139 is a signal sequence. The amino acid sequence is a variable region, and the amino acid sequence from amino acid residues 140 to 469 is a constant region. It is an area. In addition, in the light chain sequence shown in SEQ ID NO: 31 of the sequence listing, The amino acid sequence consisting of amino acid residues 21 to 129 is a signal sequence. The amino acid sequence is a variable region, and the amino acid sequence consisting of amino acid residues 130 to 234 is a constant region. It is an area.

[0121] The heavy chain amino acid sequence of the c151D antibody shown in SEQ ID NO:25 in the Sequence Listing is The nucleotide sequence shown in SEQ ID NO: 24 in the sequence listing is encoded by the nucleotide sequence shown in SEQ ID NO: 24 in the sequence listing. The nucleotide sequence consisting of nucleotides 1 to 57 of the nucleotide sequence is The nucleotide sequence encoding the heavy chain signal sequence of The sequence of the c151D antibody heavy chain variable region is encoded by the sequence from nucleotide 409 to 1398. The nucleotide sequence consisting of the nucleotides encodes the heavy chain constant region of the c151D antibody. The light chain amino acid sequence of the c151D antibody shown in SEQ ID NO: 27 in the sequence listing is It is encoded by the nucleotide sequence shown in SEQ ID NO: 26 of the sequence listing. The nucleotide sequence consisting of nucleotides 1 to 60 of the nucleotide sequence identified is c151 The nucleotide sequence consisting of nucleotides 61 to 387 encodes the light chain signal sequence of antibody D. The peptide sequence encodes the light chain variable region of the c151D antibody and is located between nucleotides 388 and 702. The nucleotide sequence of this nucleotide encodes the light chain constant region of the c151D antibody.

[0122] Furthermore, the heavy chain amino acid sequence of the c198D antibody shown in SEQ ID NO: 29 in the sequence listing is It is encoded by the nucleotide sequence shown in SEQ ID NO: 28 of the sequence listing. The nucleotide sequence consisting of nucleotides 1 to 57 of the nucleotide sequence identified as c198 The nucleotide sequence consisting of nucleotides 58 to 417 encodes the heavy chain signal sequence of antibody D. The peptide sequence encodes the heavy chain variable region of the c198D antibody and is located between nucleotides 418 and 1407. The nucleotide sequence of this nucleotide encodes the heavy chain constant region of the c198D antibody. The light chain amino acid sequence of the c198D antibody shown in SEQ ID NO: 31 in the sequence listing is It is encoded by the nucleotide sequence shown in SEQ ID NO: 30 of the sequence listing. The nucleotide sequence consisting of nucleotides 1 to 60 of the nucleotide sequence identified as c198 The nucleotide sequence consisting of nucleotides 61 to 387 encodes the light chain signal sequence of antibody D. The peptide sequence encodes the light chain variable region of the c198D antibody and is located between nucleotides 388 and 702. The nucleotide sequence of this nucleotide encodes the light chain constant region of the c198D antibody.

[0123] Humanized antibodies are characterized by the complementarity determining regions (CDRs) of the Antibodies in which only the CDR has been introduced into a human-derived antibody (see Nature (1986) 321, p. 522-525), CDR grafting By using this method, not only the CDR sequences but also some of the framework amino acid residues are transplanted into a human antibody. Examples of such antibodies include those disclosed in International Publication WO90 / 07861.

[0124] However, a humanized antibody derived from the 151D antibody must retain all six CDR sequences of the 151D antibody, There is no limitation to a particular humanized antibody, so long as it has anti-tumor activity. The heavy chain variable region of the 151D antibody is composed of amino acid numbers 26 to 35 in SEQ ID NO: 15 of the sequence listing. CDRH1 (GFTFSNYYMA) consisting of the amino acid sequence of SEQ ID NO: 15 CDRH2 (SIGTVGGNT) consisting of the amino acid sequence consisting of amino acid residues 50 to 59 Y), and an amino acid sequence consisting of amino acid residues 99 to 106 in SEQ ID NO: 15 It possesses CDRH3 (EDYGGFPH) consisting of a sequence. The light chain variable region of the 151D antibody is composed of amino acid numbers 24 to 34 in SEQ ID NO: 17 of the sequence listing. CDRL1 (KASQNVGTNVD) consisting of the amino acid sequence of SEQ ID NO: 17 CDRL2 (GASNRYT) consisting of the amino acid sequence consisting of amino acid residues 50 to 56 and an amino acid sequence consisting of amino acid residues 89 to 97 in SEQ ID NO: 17. It possesses CDRL3 (LQYKYNPYT), which consists of the following: Furthermore, the heavy chain variable region of the 198D antibody is composed of amino acid numbers 26 to 35 in SEQ ID NO: 19 of the sequence listing. CDRH1 (GFSLTSFHVS) consisting of the amino acid sequence of SEQ ID NO: 19 and CDRH2 (TISSGGGTY ), and an amino acid sequence consisting of amino acid residues 98 to 109 in SEQ ID NO: 19. It has CDRH3 (ISGWGHYYVMDV) consisting of a sequence. The light chain variable region of the 198D antibody is composed of amino acid numbers 24 to 34 in SEQ ID NO:21 of the sequence listing. CDRL1 (QASEDIYSGLA) consisting of the amino acid sequence of SEQ ID NO: 21 CDRL2 (GAGSLQD) consisting of the amino acid sequence consisting of amino acid residues 50 to 56 and an amino acid sequence consisting of amino acid residues 89 to 97 in SEQ ID NO:21. It has CDRL3 (QQGLKFPLT), which consists of the following:

[0125] Examples of humanized antibodies of rat antibody 151D include: (1) SEQ ID NO: 33 (h151D-H1) in the sequence listing or 35(h151D-H4), (2) an amino acid sequence consisting of the 20th to 136th amino acid residues of the above. In the sequence of (1), the sequence of the framework region other than each CDR sequence is at least 95 % or more homology thereto, and (3) each CDR sequence in the sequence of (1) above. In the sequence of the framework region other than the above, one or several amino acids are deleted, substituted or added. (4) a heavy chain comprising a heavy chain variable region consisting of any one of the amino acid sequences set forth in SEQ ID NO: Amino acid residues 21 to 129 of No. 37 (h151D-L1) or No. 39 (h151D-L4) (5) a sequence corresponding to the framework region sequence other than each CDR sequence in the sequence (4) above; (6) an amino acid sequence having at least 95% homology to the sequence of (4) above; In the framework region sequences other than each CDR sequence, one or several amino acids are deleted. Any of the light chains comprising a light chain variable region having any one of the following amino acid sequences: Any combination can be mentioned. In addition, an example of a humanized antibody of rat antibody 198D is (1) SEQ ID NO: 41 (h198 D-H3), (2) an amino acid sequence consisting of the 20th to 139th amino acid residues of the sequence (1) above; At least 95% homology to the framework region sequences other than each CDR sequence in and (3) an amino acid sequence having a frame other than each CDR sequence in the sequence of (1) above. Amino acids in which one or several amino acids have been deleted, substituted, or added in the sequence of the network region (4) a heavy chain comprising a heavy chain variable region consisting of any one of the sequences of SEQ ID NO: 43 (h198D- L4), (5) an amino acid sequence consisting of the 21st to 129th amino acid residues of the sequence (4) above; At least 95% homology to the framework region sequences other than each CDR sequence and (6) a frame other than each CDR sequence in the sequence of (4) above. An amino acid sequence in which one or several amino acids are deleted, substituted, or added in the sequence of the work region. Any combination of light chains comprising a light chain variable region consisting of any one of the sequences can be used. .

[0126] A preferred combination of heavy and light chains of the humanized 151D antibody is the combination of the 20th to 136th amino acids of SEQ ID NO: 33. and a heavy chain having a heavy chain variable region consisting of the amino acid sequence of SEQ ID NO: 37. a light chain variable region consisting of an amino acid sequence consisting of the 21st to 129th amino acid residues of and an antibody having an amino acid sequence consisting of amino acid residues 20 to 136 of SEQ ID NO:35. and a heavy chain having a heavy chain variable region consisting of amino acid residues 21 to 129 of SEQ ID NO:39. and an antibody having a light chain having a light chain variable region consisting of an amino acid sequence comprising: do.

[0127] A further preferred combination is a heavy chain having the amino acid sequence of SEQ ID NO: 33 and a heavy chain having the amino acid sequence of SEQ ID NO: 37. An antibody (h151D-H1L1) having a light chain having the amino acid sequence of SEQ ID NO: 35 and a light chain having the amino acid sequence of SEQ ID NO: 39 (h151D-H4L4). Examples include:

[0128] A preferred combination of heavy and light chains of the humanized 198D antibody is the combination of the 20th to 139th amino acids of SEQ ID NO:41. and a heavy chain having a heavy chain variable region consisting of the amino acid sequence of SEQ ID NO: 43. a light chain variable region consisting of an amino acid sequence consisting of the 21st to 129th amino acid residues of Examples include antibodies consisting of chains.

[0129] A further preferred combination is a heavy chain having the amino acid sequence of SEQ ID NO: 41 and a heavy chain having the amino acid sequence of SEQ ID NO: 43. An example of such an antibody is an antibody (h198D-H3L4) consisting of a light chain having the amino acid sequence:

[0130] Combining sequences that show high homology with the above heavy chain amino acid sequences and light chain amino acid sequences By this method, it is possible to select antibodies that have cytotoxic activity equivalent to that of the above antibodies. Such homology is generally 80% or more, preferably 90% or more. More preferably, the homology is 95% or more, and most preferably, the homology is 99% or more. In addition, one or several amino acid residues are substituted or deleted in the amino acid sequence of the heavy chain or light chain. By combining deleted or added amino acid sequences, it is possible to obtain cells equivalent to the above antibodies. It is possible to select antibodies that have cytotoxic activity. In this specification, "several" means 1 to 10, 1 to 9, 1 to 8, 1 or more. means up to 7, 1 to 6, 1 to 5, 1 to 4, 1 to 3, or 1 or 2 do.

[0131] In addition, the amino acid substitutions in this specification are preferably conservative amino acid substitutions. Conservative amino acid substitutions are those that occur within a group of amino acids that are related in their amino acid side chains. Preferred amino acid groups are as follows: acidic group = aspartic acid, glutamic acid; basic group = lysine, arginine, histidine; non-polar group = arabino leucine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and uncharged polar groups = glycine, asparagine, glutamine, cysteine Other suitable amino acid groups are: Aliphatic hydroxyl groups = serine and threonine; amide-containing groups = asparagine and glutamine; aliphatic group = alanine, valine, leucine and isoleucine; and In the aromatic group = phenylalanine, tryptophan and tyrosine. The substitution is preferably carried out within a range that does not impair the properties of the substance having the original amino acid sequence.

[0132] The homology between the two amino acid sequences was determined using the Blast algorithm version 2.2.2 (Altschul, St ephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang , Webb Miller, and David J. Lipman (1997), “Gapped BLAST and PSI-BLAST: a ne generation of protein database search programs”, Nucleic Acids Res.25:3389- The determination can be made by using the default parameters of Blast 3402. The algorithm can be found on the Internet at www.ncbi.nlm.nih.gov / blast The nucleotide sequence of the antibody of the present invention and that of other antibodies can also be used. Homology between nucleotide sequences can also be determined using the Blast algorithm. Cut.

[0133] In addition, in the heavy chain amino acid sequence shown in SEQ ID NO: 33 or 35 of the sequence listing for the humanized 151D antibody, The amino acid sequence consisting of amino acid residues 1 to 19 is a signal sequence, and the amino acid sequence consisting of amino acid residues 20 to 13 is a The amino acid sequence consisting of the 6th amino acid residue is a variable region, and the amino acids 137 to 466 are The amino acid sequence consisting of acid residues is the constant region. In addition, in the light chain amino acid sequence shown in SEQ ID NO: 37 or 39 of the sequence listing for the humanized 151D antibody, The amino acid sequence consisting of amino acid residues 1 to 20 is a signal sequence, and the amino acid sequence consisting of amino acid residues 21 to 12 is a ribozyme sequence. The amino acid sequence consisting of the 9th amino acid residue is a variable region, and the amino acids 130 to 234 are The amino acid sequence consisting of acid residues is the constant region.

[0134] Furthermore, in the heavy chain amino acid sequence shown in SEQ ID NO: 41 of the sequence listing for the humanized 198D antibody, The amino acid sequence consisting of amino acid residues 20 to 139 is a signal sequence. The amino acid sequence consisting of the amino acid residues from 140 to 469 is a variable region. The amino acid sequence consisting of is the constant region. In addition, in the light chain amino acid sequence shown in SEQ ID NO: 43 of the sequence listing for the humanized 198D antibody, The amino acid sequence consisting of the 21st to 129th amino acid residues is a signal sequence, The amino acid sequence consisting of the amino acid residues 130 to 234 is a variable region. The amino acid sequence consisting of is the constant region.

[0135] The heavy chain amino acid sequences shown in SEQ ID NO: 33 and SEQ ID NO: 35 of the sequence listing for the humanized 151D antibody are It is encoded by the nucleotide sequence shown in SEQ ID NO: 32 or 34 in the sequence listing. The sequence of SEQ ID NO:33 is shown in FIG. 21, the sequence of SEQ ID NO:35 is shown in FIG. 23, the sequence of SEQ ID NO:32 is shown in FIG. 31, and The sequences of SEQ ID NO:3 and SEQ ID NO:34 are respectively set forth in FIG. The nucleotide sequence consisting of nucleotides 1 to 57 of each nucleotide sequence is a humanized This gene encodes the heavy chain signal sequence of the 151D antibody and consists of nucleotides 58 to 408. The nucleotide sequence encodes the heavy chain variable region of the humanized 151D antibody and is located between 409 and 139 The nucleotide sequence consisting of the eighth nucleotide encodes the heavy chain constant region of the humanized 151D antibody. It is being done.

[0136] The heavy chain amino acid sequence shown in SEQ ID NO: 41 of the sequence listing for the humanized 198D antibody is It is encoded by the nucleotide sequence shown in SEQ ID NO: 40. The columns are set forth in FIG. 25 and the sequence of SEQ ID NO:40 in FIG. The nucleotide sequence consisting of nucleotides 1 to 57 of the nucleotide sequence is humanized 19 The heavy chain signal sequence of the 8D antibody is encoded by a nucleotide sequence consisting of nucleotides 58 to 417. The nucleotide sequence encodes the heavy chain variable region of the humanized 198D antibody and is located between 418 and 1407 The nucleotide sequence consisting of nucleotides 1 and 2 encodes the heavy chain constant region of the humanized 198D antibody. is doing.

[0137] The light chain amino acid sequences shown in SEQ ID NO: 37 and SEQ ID NO: 39 of the sequence listing for the humanized 151D antibody are It is encoded by the nucleotide sequence shown in SEQ ID NO: 36 or 38 in the sequence listing. , the sequence of SEQ ID NO:37 is shown in FIG. 22, the sequence of SEQ ID NO:39 is shown in FIG. 24, the sequence of SEQ ID NO:36 is shown in FIG. 32, and SEQ ID NO:38 are each set forth in FIG. The nucleotide sequence consisting of nucleotides 1 to 60 of each nucleotide sequence is a humanized It encodes the light chain signal sequence of the 151D antibody and consists of nucleotides 61 to 387. The nucleotide sequence encodes the light chain variable region of the humanized 151D antibody and is located between 388 and 702 The nucleotide sequence consisting of nucleotides 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 29 is doing.

[0138] The light chain amino acid sequence shown in SEQ ID NO: 43 of the sequence listing for the humanized 198D antibody is It is encoded by the nucleotide sequence shown in SEQ ID NO: 42. The columns are set forth in FIG. 26 and the sequence of SEQ ID NO:42 is set forth in FIG. The nucleotide sequence consisting of nucleotides 1 to 60 of the nucleotide sequence is humanized 19 A nucleic acid sequence consisting of nucleotides 61 to 387 that encodes the light chain signal sequence of antibody 8D. The nucleotide sequence encodes the light chain variable region of the humanized 198D antibody and is located at positions 388 to 702. The nucleotide sequence consisting of nucleotides encodes the light chain constant region of the humanized 198D antibody. is.

[0139] The homology between these nucleotide sequences and those of other antibodies was also examined. This can be determined by the ast algorithm.

[0140] The antibody of the present invention further includes a humanized antibody having the same epitope as the humanized 151D antibody or the humanized 198D antibody. An example of an anti-GARP human antibody is an antibody derived from a human chromosome. The anti-GARP human antibody refers to a human antibody having only the gene sequence of the It is possible.

[0141] The newly created human antibody is a partial peptide that binds to the humanized 151D antibody or the humanized 198D antibody. If the human antibody binds to the tide or partial conformation, the human antibody is a humanized 151D antibody or a humanized 198D antibody. In addition, it can be determined that the humanized 151D antibody or the human The human antibody competes with the 198D antibody for binding to GARP (i.e., the human antibody By confirming that the binding of the humanized 151D antibody or the humanized 198D antibody to GARP is inhibited, Even if the sequence or structure of a specific epitope has not been determined, the human antibody may be humanized. It can be determined that the antibody binds to the same epitope as the 1D antibody or the humanized 198D antibody. If it is confirmed that the two topopes are identical, the human antibody is humanized 151D antibody or humanized 19 It is strongly expected that it will have cytotoxic activity equivalent to that of the 8D antibody.

[0142] The chimeric, humanized, or human antibodies obtained by the above methods can be used in the following Examples. The binding ability to the antigen can be evaluated by the method shown in , and a suitable antibody can be selected. Cut.

[0143] The present invention also includes modified antibodies. The modified antibodies include those obtained by chemically or biologically modifying the antibodies of the present invention. Chemical modifications include those that have been chemically modified to the amino acid backbone. These include the attachment of moieties to carbohydrate moieties, chemical modifications of N-linked or O-linked carbohydrate chains, etc. The modifications include post-translational modifications (e.g., N- or O-linked glycosylation, N- or C-terminal protease activity). processing, deamidation, isomerization of aspartic acid, and oxidation of methionine. Those with an added methionine residue at the N-terminus due to expression in prokaryotic host cells, etc. Also included are labeled antibodies or antigens of the invention to allow for their detection or isolation. Such modifications also include those labeled with an enzyme, a fluorescent label, or an affinity label. Such modified antibodies of the present invention have the same stability and blood retention as the original antibodies of the present invention. These are useful for improving the activity of antibodies or antigens, reducing antigenicity, detecting or isolating such antibodies or antigens, and the like. In addition, it is possible to regulate the sugar chain modification (glycosylation, defucosylation, etc.) of the antibody of the present invention. It is possible to enhance antibody-dependent cellular cytotoxicity by glycosylation of antibodies. As techniques for adjusting the decoration, WO99 / 54342, WO00 / 61739, WO02 / 31140, etc. are known. However, the antibodies of the present invention are not limited to these. Antibodies of the present invention also include antibodies in which the glycosylation has been regulated. do.

[0144] When the antibody gene is isolated and then introduced into a suitable host to produce the antibody, a suitable A combination of a host and an expression vector can be used. Specific examples of antibody genes include , a gene encoding the heavy chain sequence of the antibody described herein, and a gene encoding the light chain sequence When transforming a host cell, the heavy chain The sequence gene and the light chain sequence gene can be inserted into the same expression vector. Alternatively, they may be inserted into separate expression vectors. When eukaryotic cells are used as hosts, animal cells, plant cells, and eukaryotic microorganisms can be used. In particular, animal cells include mammalian cells, such as monkey cells, such as COS cells (Gluzm an, Y. Cell (1981) 23, p. 175-182, ATCC CRL-1650), mouse fibroblast NIH3T3 (ATC C: No. CRL-1658) and Chinese hamster ovary cells (CHO cells, ATCC CCL-61). Hydrofolate reductase-deficient strain (Urlaub, G. and Chasin, LA Proc. Natl. Acad. Sci. U .SA(1980)77,pp.4126-4220).

[0145] When prokaryotic cells are used, examples include Escherichia coli and Bacillus subtilis. The desired antibody gene is introduced into these cells by transformation, and the transformed cells are Antibodies are obtained by in vitro culture. In this culture, depending on the antibody sequence, The yield may vary, and the yield is used as an indicator to select antibodies with equivalent binding activity as medicines. Therefore, the antibody of the present invention can be selected based on the above-mentioned transformation. Culturing the transformed host cells, and collecting the antibody of interest from the culture obtained in the process. The present invention also includes an antibody obtained by a method for producing the antibody, the method comprising the step of: In addition, the heavy chain of the antibody produced in cultured mammalian cells lacks a lysine residue at the carboxyl terminus. It is known that the chromatographic method is effective for the prevention of chromatographic defects (Journal of Chromatography A, 705: 129-134 (1995)). In addition, two amino acid residues, glycine and lysine, were deleted from the carboxyl terminus of the heavy chain, resulting in a new It is known that proline residues located at the carboxyl terminus are amidated (Analyt ical Biochemistry, 360:75-83 (2007). However, deletions and modifications of these heavy chain sequences The antigen-binding ability and effector function of antibodies (such as complement activation and antibody-dependent cellular cytotoxicity) Therefore, the present invention includes the modified antibody, and the heavy chain Deletion forms with one or two amino acids deleted at the carboxyl terminus and amidated equivalents Examples of such deletion mutants (e.g., heavy chains in which the proline residue at the carboxyl terminal is amidated) include However, as long as the antigen-binding ability and effector function are maintained, The deletion of the carboxyl terminal of the heavy chain of the antibody according to the present invention is not limited to the above types. The two heavy chains constituting the antibody are selected from the group consisting of full-length and the above-mentioned deleted heavy chains. It may be any one of the above, or any two of the above in combination. The ratio of the deletion fragments does not affect the type and culture conditions of the cultured mammalian cells that produce the antibody of the present invention. However, the main component of the antibody according to the present invention is a carboxyl-terminal nucleotide sequence of both heavy chains. An example is a case where one amino acid residue is deleted.

[0146] The isotype of the antibody of the present invention includes, for example, IgG (IgG1, IgG2, IgG3, IgG4), etc. The antibody may be any of IgG1 and IgG2, but is preferably IgG1 or IgG2. The functions of an antibody are generally classified into antigen binding activity, neutralizing activity of the antigen, and suppressing activity of the antigen. The activity of enhancing the affinity of the antibody, ADCC activity, antibody-dependent cell-mediated phagocytosis (ADCP) activity, and complement-dependent cell proliferation The functions of the antibody according to the present invention include GARP activation, CDC, and other cell death cytotoxicity activities. The binding activity to the IL-11 receptor is preferably an ADCC activity, and more preferably an ADCC activity. The antibody of the present invention has a cytotoxic activity (antitumor activity) due to the inhibitory activity against Treg function. In addition to CC activity, it may also have ADCP activity and / or CDC activity. Anti-tumor antibodies are used to directly act on tumor cells and block proliferation signals. directly affect tumor cells to induce cell death signals, and inhibit angiogenesis. NK cell-mediated ADCC activity and complement-mediated CDC activity. It has been reported that this drug suppresses the proliferation of tumor cells (J Clin Oncol 28:4390-439 9. (2010), Clin Cancer Res; 16(1);11-20. (2010)), anti-GARP antibody of the present invention The ADCP activity of antibodies has been reported as an activity of existing drugs containing antitumor antibodies. At least, the present inventors are not aware of such a phenomenon.

[0147] The antibody of the present invention may be polymerized to increase affinity for an antigen. A single antibody may recognize multiple epitopes of the same antigen. A method for multimerizing antibodies is to combine an IgG CH3 domain and two s Binding to cFv (single-chain antibody), binding to streptavidin, helix-turn-helix Examples of such modifications include the introduction of a sex motif. The antibody of the present invention is a polyclonal antibody, which is a mixture of multiple types of anti-GARP antibodies with different amino acid sequences. An example of a polyclonal antibody is a monoclonal antibody having multiple types of antibodies with different CDRs. Such polyclonal antibodies may be a mixture of antibodies of different types. The method can be carried out by culturing a mixture of cells that produce the antibody and using the antibody purified from the culture. Yes it is possible (see WO2004 / 061104).

[0148] As a modification of antibodies, antibodies bound to various molecules such as polyethylene glycol (PEG) are It can also be used.

[0149] The antibodies of the present invention may further be conjugated with other drugs ( Examples of such antibodies include antibodies that are immunoconjugates, and antibodies that are immunoconjugates of radioactive or pharmacological substances. Examples of compounds that bind to the agonistic peptides include those that bind to the agonistic peptides (Nature Biotechnology (2005) ) 23, p.1137-1146), for example, indium ( 111 Capromab pendetide (Indi um( 111 In) Capromab pendetide), Technetium ( 99m Tc) Nofetumomab Mel Pentane (Technetium ( 99m Tc) Nofetumomab merpentan), Indium ( 111 In) Ibritumomab (Indium ( 111 In) Ibritumomab), yttrium ( 90 Y) Ibritsum Mab (Yttrium ( 90 Y) Ibritumomab), iodine ( 131 I) Tositumomab (Iodine ( 13 1 I) Tositumomab) and the like.

[0150] 3. Medicine containing anti-GARP antibody The antibody obtained by the method described in the above section "2. Production of anti-GARP antibody" has the ability to inhibit Treg. As it shows cytotoxic activity, it is useful as a medicine, especially for cancer and infectious diseases (especially malaria and HIV infection). It can be used as a treatment for infections.

[0151] In vitro cell killing activity of antibodies can be measured by their ability to inhibit cell proliferation. .

[0152] For example, a cancer cell line that overexpresses GARP was cultured, and antibodies were added to the culture system at various concentrations. The inhibitory activity against focus formation, colony formation, and spheroid growth was measured. This can be done.

[0153] The therapeutic effect of antibodies against cancer using in vivo experimental animals, for example, The antibody was administered to nude mice transplanted with the tumor cell line, and changes in the cancer cells were measured. This can be done.

[0154] The types of cancer include lung cancer, kidney cancer, urothelial cancer, colon cancer, prostate cancer, glioblastoma multiforme, and ovarian cancer. Examples include cancer of the pancreas, breast cancer, melanoma, liver cancer, bladder cancer, stomach cancer, esophageal cancer, and blood cancer. However, the present invention is not limited to these, as long as the cancer cells to be treated express GARP.

[0155] The substances used in the formulation acceptable for the pharmaceutical composition of the present invention are, depending on the dosage and administration concentration, In particular, it is preferable that the pharmaceutical composition be non-toxic to the recipient.

[0156] The pharmaceutical composition of the present invention is characterized in terms of pH, osmolality, viscosity, transparency, color, isotonicity, sterility, stability, solubility, and the like. Contains formulation substances that alter or maintain the rate of dissolution, release, absorption, or penetration. Substances for formulations include, but are not limited to, the following: No amino acids such as glycine, alanine, glutamine, asparagine, arginine or lysine Antioxidants such as acetic acid, antibacterial agents, ascorbic acid, sodium sulfate or sodium bisulfite agent, phosphoric acid, citric acid, borate buffer, sodium bicarbonate, Tris-HCl (Tris- Buffers such as ethyl ethylenediaminetetraacetic acid (E Hcl) solutions, bulking agents such as mannitol and glycine, DTA) and other chelating agents, caffeine, polyvinylpyrrolidine, β-cyclodextrin, Complexing agents such as hydroxypropyl-β-cyclodextrin, glucose, mannose or Bulking agents such as dextrin, other carbohydrates such as monosaccharides and disaccharides, coloring agents, flavoring agents, diluents, Emulsifiers, hydrophilic polymers such as polyvinylpyrrolidine, low molecular weight polypeptides, salt-forming ions Benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol ethanol, methylparaben, propylparaben, chlorhexidine, sorbic acid or water peroxide Preservatives such as glycerin, propylene glycol or polyethylene glycol solvents, sugar alcohols such as mannitol or sorbitol, suspending agents, sorbitan esters, poly Polysorbates such as resorbate 20 and polysorbate 80, triton, trometabolites, etc. tromethamine, surfactants such as lecithin or cholesterol, sucrose or sol Stabilizing agents such as sorbitol, sodium chloride, potassium chloride, mannitol, sorbitol, etc. These formulation materials include elasticity enhancers, transport agents, excipients, and / or pharmaceutical adjuvants. The amount of the agent added is preferably 0.001 to 100 times, and more preferably 0.1 to 10 times, the weight of the anti-GARP antibody. The composition of the pharmaceutical composition in the formulation can be determined by those skilled in the art based on the applicable disease, the applicable administration route, etc. It can be determined appropriately depending on the situation.

[0157] In pharmaceutical compositions, excipients or carriers may be liquid or solid. Suitable excipients or carriers are It may be water, saline, artificial cerebrospinal fluid, or any other substance commonly used for parenteral administration. Physiological saline containing no active ingredient or saline containing serum albumin can also be used as a carrier. The composition includes Tris buffer at pH 7.0-8.5, acetate buffer at pH 4.0-5.5, and clathrate buffer at pH 3.0-6.2. These buffers may contain acetic acid buffers, and may also contain sorbitol or other It may also include compounds of the formula:

[0158] The pharmaceutical compositions of the present invention include pharmaceutical compositions comprising an anti-GARP antibody, as well as pharmaceutical compositions comprising an anti-GARP antibody and at least one The pharmaceutical composition of the present invention can include a pharmaceutical composition containing another cancer therapeutic agent. The drug is prepared as a lyophilized or liquid product with the desired composition and purity. Pharmaceutical compositions containing RP antibodies, and medicines containing anti-GARP antibodies and at least one cancer treatment agent The composition may also be formulated as a lyophilizate using suitable excipients such as sucrose. Cut.

[0159] In the above pharmaceutical composition, the cancer therapeutic agent contained together with the anti-GARP antibody is These may be administered to an individual separately or sequentially, with varying intervals between each administration. Such cancer treatment drugs include abraxane, carboplatin, cisplatin, gemc itabine, irinotecan (CPT-11), paclitaxel, pemetrexed, sorafenib, vinblastin or The drugs described in International Publication No. WO2003 / 038043, and further LH-RH analogs (Lupinone, Lorelin, Goserelin, etc.), estramustine phosphate, estrogen antagonists (Tamoxifen, Raloxifene, etc.), Aromatase inhibitors (Anastrozole, Retinoic Acid Examples of drugs that have antitumor activity include bromozole and exemestane. If necessary, the drug is not limited to the above. The individual to which the drug is administered is not particularly limited, but is preferably a mammal. More preferably, humans can be mentioned.

[0160] The pharmaceutical composition of the present invention can be prepared for parenteral administration, or can be absorbed orally through the gastrointestinal tract. The composition and concentration of the formulation can be determined depending on the administration method. In addition, the affinity of the anti-GARP antibody contained in the pharmaceutical composition of the present invention for GARP, i.e., the affinity of the anti-GARP antibody for GARP The higher the affinity (the lower the Kd value), the smaller the dose required for humans. Based on these results, the pharmaceutical composition of the present invention can exert its medicinal effect even without the The dosage for humans can also be determined. The dosage is determined by administering a human anti-GARP antibody to a human. When administered, approximately 0.001 to 100 mg / kg is administered once or multiple times at intervals of 1 to 180 days. The pharmaceutical composition of the present invention may be administered in the form of an injection including a drip infusion, a suppository, a nasal agent, or the like. Examples include sublingual agents and transdermal agents.

[0161] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples. It is not something that can be done. EXAMPLES

[0162] In the following examples, unless otherwise specified, each operation related to genetic manipulation is performed under the heading "Molecular Molecular Cloning" (Sambrook, J., Fritsch, E. F. and Maniatis (published by Cold Spring Harbor Laboratory Press, 1989) and The method is carried out according to the method described in the experimental manual used by other skilled artisans, or using commercially available reagents and kits. When applicable, the commercially available instructions were followed.

[0163] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples. It is not something that can be done.

[0164] Example 1: Obtaining antibodies 1)-1 Isolation of anti-GARP Fab by panning on Phage display The n-CoDeR Fab phage library (BioInvent) was used to isolate Fabs that bind to GARP. Ink NHS-Chomogenic-Biotin reagent (Thermo Scientific) was used to detect the chromatin in the GARP (R&D Systems Liquid-phase panning was performed using Dynabeads Streptavidin M-280 (Life Technology Inc.). After immobilizing biotinylated GARP on a plate (Microbiology), phages were added and the unbound phages were removed by magnetronization. The particles were removed by washing using a hotstand (DynaMag-2, Life Technologies). Then, the phages bound to GARP were collected by treatment with trypsin (Sigma-Aldrich) and then injected into the colon. The phages were amplified using bacteria. A total of three rounds of panning were performed to obtain polyclonal phages. The DNA fragment encoding Fab was excised from the nucleotide sequence using restriction enzymes and inserted into an expression vector for E. coli. After the transformation, E. coli TOP10F' (Life Technologies) was transformed and IPTG (Sigma-Aldrich Fab was expressed in the presence of IgG1 and subjected to screening by ELISA.

[0165] 1)-2 Screening of GARP-binding Fab by ELISA 384-well Maxi-sorp plate (Black, Nunc) was filled with PBS (0.138 M sodium chloride, 0.0027 M 2 in 0.01 M phosphate-buffered saline (pH 7.4, Sigma-Aldrich) containing potassium chloride. 50 μL of GARP diluted to 1 μg / mL was added to each well and allowed to stand overnight at 4°C for immobilization. Add 50 μl of NeutrAvidin (Life Technologies) diluted to 1 μg / mL in PBS to a Maxi-sorp plate. After immobilization (4°C, overnight), ELISA buffer (0.05% Tween After washing three times with PBS (Sigma-Aldrich) containing β-20 (Bio-RAD), biotinylated GARP was added. (1 pmol / 50 μL PBS / well) and shaken at room temperature for 1 hour. Washed 3 times with ELISA buffer. Afterwards, the plate was blocked with Blocker Casein (Thermo Scientific) and then ELISA buffer was added. The plate was washed three times with Fab. Then, a culture medium of E. coli expressing Fab was added and incubated at room temperature for 1 After washing three times with ELISA buffer, 2500-fold diluted Horseradish peroxidase was added. Add 50 μL of human oxidase (HRP)-labeled anti-human F(ab')2 antibody (R&D Systems) and then add 50 μL of The plate was incubated at room temperature for 1 hour with shaking. After washing three times with ELISA buffer, the plate was incubated with SuperSignal Pico ELISA. Chemiluminescent substrate (Thermo Scientific) was added and chemiluminescence was measured after 10 minutes. The results were measured using a rate reader (Envision 2104 Multilabel Reader, Perkin Elmer) and the GARP results were The combined Fab was isolated.

[0166] 1)-3 Determination of the nucleotide sequence of ELISA-positive clones Nucleotide sequence analysis of the heavy and light chain variable regions of ELISA-positive clones (105F, 110F) was determined by the Dye Terminator method (BigDye® Terminator v3.1, Life Technologies). The sequences of the main primers used in the sequence analysis are as follows:

[0167] Primer A: 5'-GAA ACA GCT ATG AAA TAC CTA TTG C-3' (SEQ ID NO: 10) Primer B: 5'-GCC TGA GCA GTG GAA GTC C-3' (SEQ ID NO: 11) Primer C: 5'-TAG GTA TTT CAT TAT GAC TGT CTC-3' (SEQ ID NO: 12) Primer D: 5'-CCC AGT CAC GAC GTT GTA AAA CG-3' (SEQ ID NO: 13)

[0168] By the above analysis, the nucleotide sequences of the variable regions of the 105F antibody and 110F antibody genes were determined. Ta. The nucleotide sequence of the heavy chain variable region of the 105F antibody is shown in SEQ ID NO:6 in the sequence listing. The sequence consists of nucleotides 1 to 354 of the nucleotide sequence of the light chain variable region. The nucleotide sequence is from nucleotide 1 to 336 of the nucleotide sequence shown in SEQ ID NO:7 in the sequence listing. The sequence consisted of tides. The nucleotide sequence of the heavy chain variable region of the 110F antibody is the nucleotide sequence shown in SEQ ID NO:8 of the Sequence Listing. The sequence consists of nucleotides 1 to 369 of the nucleotide sequence of the light chain variable region. The nucleotide sequence is from nucleotide 1 to 333 of the nucleotide sequence shown in SEQ ID NO:9 in the sequence listing. The sequence consisted of tides.

[0169] 1)-4: Creation of full-length IgG and expression and purification of IgG ELISA-positive clones including 105F and 110F were converted to full-length IgG by the following method. After determining the nucleotide sequence encoding Fab, the heavy chain and The nucleotide sequences corresponding to the variable regions of the light and dark chains were identified. The nucleotide sequence of the variable region of the heavy chain was determined by a conventional method using the constant region (CH1) of the heavy chain of human IgG1. + Fc region: the amino acid sequence from 119 to 448 of the amino acid sequence shown in SEQ ID NO: 2 of the sequence listing and a nucleotide sequence encoding the light chain variable region. The sequence is the constant region of the light chain of human IgG1 (CL: 1 of the amino acid sequence shown in SEQ ID NO: 3 of the sequence listing). After ligation with the nucleotide sequence encoding the 13th to 217th amino acids, the product was transformed into pcDNA3.3 (Inv The IgG expression vector for animal cells was constructed by inserting the IgG expression vector into an animal cell expression vector such as iucntrogen. . The nucleotide sequence of the constructed IgG expression vector was analyzed again, and the nucleotide sequence of the full-length heavy chain of the 105F antibody was The sequence is the nucleotide sequence shown in SEQ ID NO:6 in the sequence listing, and the nucleotide sequence of the entire light chain is The sequence was confirmed to be the nucleotide sequence shown in SEQ ID NO:7 in the sequence listing. The full-length nucleotide sequence of the heavy chain of the 110F antibody is shown in SEQ ID NO:8 of the sequence listing. The nucleotide sequence of the entire light chain is shown in SEQ ID NO: 9 of the sequence listing. It was confirmed that the sequence was an octide sequence. Furthermore, from the above nucleotide sequence, the full length heavy and light chains of the 105F antibody encoded by the sequence The amino acid sequence of the 110F antibody and the full-length amino acid sequences of the heavy and light chains were determined. The amino acid sequence of the heavy chain of the 105F antibody is the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing. The amino acid sequence of the light chain was the amino acid sequence shown in SEQ ID NO:3 in the sequence listing. The amino acid sequence of the heavy chain of the 110F antibody is the amino acid sequence shown in SEQ ID NO: 4 in the sequence listing. The amino acid sequence of the light chain was the amino acid sequence shown in SEQ ID NO:5 in the sequence listing.

[0170] The IgG of the 105F antibody or the 110F antibody was incubated with FreeStyle 293F cells (Life Technologies) using the above-mentioned Transient expression was achieved by inserting an IgG expression vector for human cells, and protein A was added as needed. After purification with an affinity column (HiTrap Mab Select SuRe, GE Healthcare), the antibody was purified with vivaspin 20 ( The buffer in which IgG was dissolved was replaced with PBS using a 7k MWCO filter (GE Healthcare), and the following steps were carried out. This was used in step “1)-5”.

[0171] 1)-5 Confirmation of binding to GARP by ELISA using purified IgG Human GARP (R&D) diluted to 1 μg / mL in PBS was placed in a 96-well Maxi-sorp plate (Black, Nunc). Systems, model number: 6055-LR) was added at 100 μL each, and the mixture was allowed to stand overnight at 4° C. for immobilization. After washing three times with ELISA buffer, the plate was blocked with Blocker Casein for 1 hour at room temperature. After washing three times with ELISA buffer, 50 nM of 105F antibody, 50 nM of 110F antibody, and 50 nM of human IgG (Jackson Immuno Research), 50 nM mouse anti-GARP antibody (Plato-1, ENZO Life Sciences), 100 μL of 50 nM mouse IgG (Jackson Immuno Research) and 50 nM mouse IgG (Jackson Immuno Research) were added. The reaction was carried out with shaking at room temperature for 1 hour. After washing three times with ELISA buffer, the 105F antibody, 110F antibody and human IgG added groups were diluted with 500 mL of PBS. 10-fold diluted HRP-labeled anti-human Fc antibody (R&D Systems) was added to mouse anti-GARP antibody and mouse IgG For the addition group, 100 μL of HRP-labeled anti-mouse Fc antibody (R&D Systems) diluted 5000-fold with PBS was added to each well. The mixture was reacted at room temperature for 1 hour with shaking. After washing five times with ELISA buffer, add SuperSignal Pico ELISA Chemiluminescent Substrate 0.1 mL of the solution was added, and the chemiluminescence after 10 minutes was measured using a plate reader (Envision 2104 Multilabel Reader). Measurements were performed using a 30-μm chromatograph (Perkin Elmer). As a result, the 105F and 110F antibodies were shown to bind to GARP, similar to commercially available anti-GARP antibodies. This was done (Figure 10).

[0172] Example 2: Binding to antigen gene-expressing cells The GARP expression vector was prepared by purchasing a cDNA clone of human GARP (Origene) and transfecting it with pGPCRs in the usual manner. The fragment was cloned into the cDNA3.1(+) vector (Invitrogen) and the nucleotide sequence was confirmed. The GARP expression vector and pcDNA as a control were introduced into HEK-293T cells (ATCC: CRL-11268). 3.1 The vector was introduced into the cells using Lipofectamin 2000 (Invitrogen). The cells were incubated at 37°C in DMEM medium (Invitrogen) containing fetal bovine serum (FBS, Hyclone) under 5% CO2. After overnight culture, the cells were harvested from the plate by treatment with TrypLE Express (Invitrogen). After washing twice with MACS buffer (PBS containing 0.5% BSA and 2 mM EDTA, Miltenyi Biotec), The resulting cell suspension was then added with 105F antibody and control human IgG (ENZO Li After washing twice with MACS buffer, Fluorescein Fluorescence Imaging (Fluorescein Science) was added and the mixture was left to stand for 15 minutes at 4°C. Cein isothiocyanate (FITC) labeled anti-IgG antibody (Jackson ImmunoResearch Laboratories) The cells were then washed twice with MACS buffer and then suspended in 1% The thin film was made with PFA (prepared from a 32% paraformaldehyde solution (Electron Microscopy Sciences)). The cells were fixed and detected using a flow cytometer (Facs Canto II: Becton Dickinson). Data analysis was performed using Flowjo (TreeStar) and Horizon FVS450 (Becton Dickins After excluding dead cells by gating using a FITC immunofluorescence spectrophotometer (Bio-Rad Laboratories, Inc.), a histogram of the FITC fluorescence intensity of live cells was created. Successful. In HEK-293T cells transfected with vector alone, the 105F antibody showed the same fluorescence intensity as the control IgG. On the other hand, in GARP-expressing HEK-293T cells, the fluorescence intensity of the control IgG was significantly higher than that of the control IgG. The histogram for the 105F antibody was shifted to the strong fluorescence intensity side compared to the intensity histogram. These results confirmed that the 105F antibody is specific to GARP expressed in HEK-293T cells. was shown to bind to

[0173] Example 3: Binding to cells expressing endogenous GARP 3)-1 Flow cytometry analysis using L428 cells The Alexa Fluor 647 Monoclonal antibody labeling kit (Invitrogen) was used to label the 105F antibody. A fluorescently labeled antibody was prepared. L428 cells (obtained from DSMZ) were washed twice with MACS buffer. The cells were suspended in the same solution, and the labeled 105F antibody was added thereto, followed by standing at 4° C. for 30 minutes. After washing twice with 1% PFA, the cells were fixed and analyzed by a flow cytometer (Facs Canto II, Becton Detection was performed using a 3D scanner (Dickinson). Data analysis was performed using Flowjo (TreeStar). Histogram of FITC fluorescence intensity of live cells after gating out dead cells using FVS450 A histogram of the fluorescence intensity of L428 cells with the addition of 105F antibody was created. This indicates that the 105F antibody binds to GARP endogenously expressed in cells. It was confirmed that this was the case (Figure 12).

[0174] 3)-2 Flow cytometry analysis using human Treg Peripheral blood mononuclear cells (PBMCs) from healthy subjects were isolated using Ficoll-Paque PLUS (GE Healthcare). The cells were cultured in RPMI1640 medium (Invitrogen) supplemented with 10% FBS (hereinafter referred to as RP-F10 medium). A low-attachment 24-well plate (Costar) was used to culture 2 × 10 6 The cells were seeded at 200 cells / mL. Anti-CD3 antibody (BD Pharmingen) and anti-CD28 antibody (BD Pharmingen) were added and cultured for 20 hours. Afterwards, the cells were resuspended in FACS buffer (10 mM Hepes (Invitrogen), 2 mM EDTA (Invitrogen), The labeled 105F prepared in 3)-1 was suspended in HBSS (Invitrogen) supplemented with 2% FBS. Add the antibody and Alexa Fluor 647-labeled anti-GARP antibody (G14D9, eBioscience) and incubate on ice for 30 minutes. The cells were washed again with FACS buffer and then placed in Fixation / Permeabilization workup. Add ng solution (eBioscience) and leave on ice for another 30 minutes to perform permeabilization. After washing the cells with Buffer (eBioscience), 2% rat serum (eBioscience) was added. After leaving the plate at room temperature for 15 minutes, PE-labeled anti-Foxp3 antibody (eBioscience) was added and the plate was then incubated for 15 minutes. After washing the cells, the cells were incubated in 4% paraformaldehyde phosphate buffer solution for 30 minutes. Add tissue fixative made by diluting ion (Wako Pure Chemical Industries, Ltd.) 2-fold with D-PBS (Invitrogen Co., Ltd.) and let sit for 15 minutes. The cells were then washed with FACS buffer and then analyzed by a flow cytometer (FACS C Measurements were performed using a fluoroscopy machine (Anto II: Becton Dickinson) and analysis was performed using FlowJo (Tree Star). As a result, it was shown that the 105F antibody binds to FoxP3-positive Tregs, similar to commercially available anti-GARP antibodies. (Figure 13).

[0175] Example 4. Properties of anti-GARP antibodies 4)-1 ADCC activity 4)-1-1 Preparation of effector cells PBMCs were isolated from fresh peripheral blood of healthy subjects by the method described above in 3)-2. NK cells were isolated from the PBMCs. The NK cells were purified using a NK cell isolation kit (Miltenyi Biotec). The cells were cultured overnight for acclimation in RP-F10 medium (Invitrogen) containing 0 IU / mL rhIL-2 (Novartis). The number of viable cells was measured using a trypan blue dye exclusion test, and the viable cell density was 2 × 10 5 Cells / mL The cells were resuspended in RP-F10 medium to prepare effector cells.

[0176] 4)-1-2 Preparation of target cells The L428 cells described in Example 3)-1 were cultured in RPMI1640 medium (Invitrogen) containing 10% FBS. 0.6×10 in 6 For each, Chromium-51( 51Cr) was mixed with 30 μL (1110 kBq) and incubated at 37°C, 5% The cells were labeled by culturing them for 2 hours under CO2 conditions. The labeled cells were incubated in 10% FBS-containing medium. Wash three times with RPMI1640 medium (Invitrogen) and place in RP-F10 medium at 4 × 10 4 It will be cells / mL The cells were then resuspended in water and used as target cells.

[0177] 4)-1-3 51 Cr release assay 105F diluted with RP-F10 medium to final assay concentrations of 1, 10, 100, and 1000 ng / mL The antibody was dispensed into a 96-well U-bottom microplate (Costar) at 50 μL per well, and the target cells were incubated. The cells were added (50 μL / well) and incubated at 4°C for 30 minutes. Effector cells were then added. After incubation at 37°C for 4 hours under 5% CO2, 50 μL of the supernatant was added to each well. The wells were collected in a LumaPlate (PerkinElmer) and the emitted gamma was counted in a gamma counter. The dose was measured. The cell lysis rate due to ADCC activity was calculated using the following formula.

[0178] Cell lysis rate (%)=(AB) / (CB)×100 A: Counting of sample wells B: Mean counts of spontaneous release (wells without antibody or effector cells) (n=3). When the antibodies and effector cells were added, 50 μL and 100 μL of RP-F10 medium were added, respectively. Otherwise, the same procedure as for the sample well was carried out.

[0179] C: Maximum release (wells in which target cells were lysed with detergent) average count (n=3 50 μL of RP-F10 medium was added when the antibody was added, and 50 μL of Triton-X100 (Sigma) was added when the effector cells were added. 100 μL of RP-F10 medium containing 2% (v / v) of erythritol phosphate phosphate (Proc. No. 102411) was added to the wells. The rest of the procedure was the same as for the sample wells. The operation was performed. The measurement results are shown in Figure 14. The 105F antibody exhibited cytolytic activity against L428 cells in an antibody concentration-dependent manner. On the other hand, no cytolytic activity was observed for the control human IgG. These results indicate that the 105F antibody has ADCC activity against L428 cells that endogenously express GARP. The human IgG1 anti-GARP antibody (MHG8) was prepared based on the sequence information described in Patent Document 1. and LHG10) did not show ADCC activity.

[0180] 4)-2 Treg function inhibitory activity 4)-2-1 Treg, Teff (effector T cells: CD4 positive CD25 negative helper T cells) and Preparation of accessory cells 4)-1-1: PBMCs were prepared using the CD4 T cell ISOLATION Kit (Miltenyi Biotec CD4 positive T cells were isolated using a FITC-labeled anti-CD4 antibody (Miltenyi Biotec) and APCs. Labeled anti-CD25 antibody (Miltenyi Biotec) was added and incubated for 30 minutes at 4°C. The cells were suspended in ACS buffer and subjected to FACS Aria IIu (Becton Dickinson). Transgenic cells (Teff) and CD4+CD25+Treg cells were isolated. On the other hand, after removing CD3 positive cells from PBMC using CD3 Microbeads (Miltenyi Biotec), The X-ray irradiation device (Hitachi Medical Corporation) was used to irradiate the patient with a dose of 1 C / kg (absorbed dose 38.76 Gy / kg (387 Accessory cells were prepared by irradiating the cells with 6 Rad / kg X-rays.

[0181] 4)-2-2 Co-culture method and Treg function inhibition assay The culture medium contained Penicillin Streptomycin (Invitrogen), 1× MEM NEAA (Invitrogen), (Invitrogen), 1× Sodium pyruvate (Invitrogen), 5 mM Hepes and 5% Human male AB serum RPMI1640 medium (Invitrogen) containing 1μm (Sigma) was used. Each well of the plate was cultured with Teff (2000 cells / well) and accessory cells (20000 cells / well). Then, Treg cells were added and seeded at 500 cells / well. A group containing no antibody was also prepared. Anti-CD3 antibody, anti-CD28 antibody, and 105F antibody were added at a final concentration of 50 or 10 The cells were incubated at 37°C and 5% CO2 for 5 days. 3 [H]-thymidin e (PerkinElmer) was adjusted to 18.5 kBq / mL and added at 20 μL / well, and the cells were incubated for another 18 hours. The cells were harvested using a cell harvester (Mach II, Tomtech) on Filtermat A (Per The cells were collected in a scintillation counter (PerkinElmer) and counted using a scintillation counter (MicroBeta, PerkinElmer). [ 3 The intracellular uptake of [H]-thymidine was calculated as the corrected count per minute (CCPM, cor The time course was measured as rectified counts per minute.

[0182] Human IgG1 anti-GARP antibodies (MHG8 and LHG10) prepared based on the sequence information described in Patent Document 1 was also subjected to this test system in the same manner.

[0183] 4)-2-3 Calculation of inhibitory activity The average value of three wells for each co-culture condition was calculated, and the proliferation activity of Teff alone was compared with that of Treg alone. The Teff proliferation activity value reduced in the co-culture system was calculated as the "proliferation inhibition rate of Teff by Treg" (= 1 - [CCPM of co-culture / CCPM of Teff only]). The inhibition rate by Tregs when no antibody was added was compared to the inhibition rate when each antibody was added. The inhibition rate (= [inhibition rate when no antibody was added] - [inhibition rate when each antibody was added]) was used to estimate the Treg function of each antibody. The inhibitory activity was calculated for each sample used in each experiment. be. The results of Treg function inhibition by 105F antibody at 50 μg / mL (inhibitory rate 72.6%) are shown in Figure 15. The results for the MHG-8 and LHG-10 antibodies at 10 μg / mL are shown in Figure 16. The MHG-8 and LHG-10 antibodies have Treg function inhibitory activity. However, the 105F antibody significantly inhibited Treg function (inhibition rate 65. It was shown that the siRNA against GARP, which is described in [Non-Patent Document 10], The above inhibition rate by Tregs introduced with 100% Teff is shown in Fig. 5A, where the CD4+CD25- (Teff):Treg ratio is 4:1. The rough estimate was about 15%.

[0184] Example 5: Generation of rat antibodies 5)-1 Preparation of GARP expression vector The GARP expression vector used was the expression vector described in Example 2. EndoFree was used for large-scale preparation. The Plasmid Giga Kit (QIAGEN) was used.

[0185] 5)-2 Rat immunization Female WKY / Izm rats (Japan SLC) were used for immunization. The area was pretreated with Hyaluronidase (Sigma-Aldrich), and the GARP expression vector was then injected intramuscularly into the area. Next, an in vivo experiment was performed at the same site using ECM830 (BTX) and a two-needle electrode. Once every two weeks, similar in vivo electroporation was performed. After repeated incubation, lymph nodes or spleens were harvested from the rats and used for hybridoma production.

[0186] 5)-3 Preparation of hybridomas Lymph node or spleen cells and mouse myeloma SP2 / 0-ag14 cells (ATCC, No. CRL-1581) The cells were electro-fused using an LF301 Cell Fusion Unit (BEX), and then the ClonaCell-HY Selection The hybridoma cells were diluted in Medium D (StemCell Technologies) and cultured. The colonies were collected to produce monoclonal hybridomas. The hybridoma colonies were cultured, and the resulting hybridoma culture supernatant was used to produce anti-GARP antibodies. Hybridoma screening was performed.

[0187] 5)-4 Antibody screening by Cell-ELISA method 5)-4-1 Preparation of antigen gene expressing cells for Cell-ELISA 293α cells (HEK-293 cells expressing integrin αv and integrin β3 (ATCC:CRL- 1573) was cultured at 7.5 × 10 5 cells / mL Lipofectamine 2000 (Life Technologies) was used to Following the transfection procedure described above, GARP expression vector or pcDNA3.1(+) vector as a negative control were used. The plate was then filled with 10% FBS and 50 μl of the medium was dispensed into a 96-half area well plate (Corning). The cells were cultured in DMEM medium containing 5% CO2 at 37°C for 24 to 27 hours. The plate was used in the attached state for Cell-ELISA.

[0188] 5)-4-2 Cell-ELISA After removing the culture supernatant of the expression vector-introduced 293α cells prepared in Example 5)-4-1, the GARP expression Hybridoma culture was performed on 293α cells transfected with the current vector or pcDNA3.1(+) vector. The culture supernatant was added and left to stand at 4°C for 1 hour. The cells in the wells were washed once with 5% FBS-containing PBS (+). Anti-Rat IgG-Peroxidase antibody produced by ELISA diluted 500-fold in 5% FBS-containing PBS (+) The cells in the wells were incubated with 5% FBS-containing PBS (+ ) three times, and then immersed in OPD coloring solution (OPD dissolving solution (0.05 M trisodium citrate, 0.1 M phosphate buffer) o-Phenylenediamine dihydrochloride (Wako Pure Chemical Industries, Ltd.) and H2O2 were added to disodium hydrogen carbonate-12 water (pH 4.5). Dissolved at 0.4mg / ml and 0.6% (v / v) respectively, at 50μl / well. The color reaction was stopped by adding 50 μl / well of 1M HCl. The absorbance at 490 nm was measured using a light reader (ENVISION: PerkinElmer). In order to select hybridomas that produce antibodies that specifically bind to human GARP expressed by the The GARP expression vector-transfected 293α cells were compared with the control pcDNA3.1(+)-transfected 293α cells. Hybridomas producing culture supernatants showing higher absorbance at 100 nm were determined to be positive for anti-human GARP antibodies. And selected.

[0189] 5)-5 Antibody screening by flow cytometry 5)-5-1 Preparation of antigen gene expressing cells for flow cytometry analysis HEK-293T cells (obtained from ATCC) were cultured at 5 × 10 4 cells / cm 2 It is 225cm 2 Flask (Sumitomo The cells were seeded on a 10% FBS-containing DMEM medium at 37°C and 5% CO2 overnight. The next day, the GARP expression vector and the pcDNA3.1(+) vector as a negative control were EK-293T cells were transfected with Lipofectamine 2000 and incubated at 37°C, 5% CO2 overnight. The next day, the expression vector-introduced HEK-293T cells were incubated with TrypLE Express (Life Technologies The cells were treated with 10% FBS-containing DMEM medium, washed with 10% FBS-containing DMEM medium, and then suspended in 5% FBS-containing PBS. The resulting cell suspension was used for flow cytometry analysis.

[0190] 5)-5-2 Flow cytometry analysis Example 5)-4-2: Antibodies produced by hybridomas determined to be positive by Cell-ELISA The binding specificity for human GARP was further confirmed by flow cytometry analysis. The suspension of the transiently expressing HEK-293T cells prepared in Example 5)-5-1 was centrifuged and the supernatant was removed. Then, hybridoma culture supernatant was added to each of them, and they were suspended and left to stand at 4°C for 1 hour. After washing twice with 5% FBS-containing PBS, the cells were incubated with Anti-Rat IgG FITC diluted 500-fold in 5% FBS-containing PBS. The conjugate (Sigma) was added and suspended, and the cells were left to stand at 4°C for 1 hour. The cells were then washed twice with PBS containing 5% FBS. After washing, the cells were placed in 5% FBS-containing PBS containing 2 μg / ml 7-aminoactinomycin D (Molecular Probes). The cells were resuspended in 100 mL of 1000 mL of 1000 mM NaCl and detected using a flow cytometer (FC500: Beckman Coulter). Data analysis was performed using Flowjo (TreeStar). 7-aminoactinomycin D-positive dead cells were gated. After excluding the live cells, a histogram of the FITC fluorescence intensity of the control cells was created. Fluorescence intensity histogram of HEK-293T cells transfected with pcDNA3.1 vector versus GARP expression vector transfected Hybrids producing antibodies with a histogram of HEK-293T cells shifted to the strong fluorescence intensity side Hybridomas (113 clones) were selected as antibody-producing hybridomas that bind to human GARP.

[0191] 5)-6 Preparation of monoclonal antibodies 5)-6-1 Cultivation of hybridomas 151D and 198D 5) Among the rat anti-human GARP antibody-producing hybridomas obtained in -5-2, human GARP was isolated. 151D and 198D, which were suggested to bind strongly to RP, were selected. Rat anti-GARP monoclonal antibody was purified from the hybridoma culture supernatant. First, rat anti-GARP monoclonal antibody-producing hybridomas were selected using the ClonaCell-HY Selection Grow to sufficient volume in Medium E and add 20% Ultra Low IgG FBS (Life Technologies). After replacing the medium with Hybridoma SFM (Life Technologies), 8–9 × 10 7 Cell Hive Lidoma 1272 cm 2 The cells were seeded in flasks (Corning) and cultured for 7 days. The culture supernatant was centrifuged. The collected solution was filtered through a 0.8 μm filter, and then filtered through a 0.45 μm filter (Corning). It was sterilized through.

[0192] 5)-6-2 Purification of monoclonal antibodies The antibody was isolated from the culture supernatant of the hybridoma prepared in Example 5)-6-1 by Protein G affinity chromatography. The product was purified by column chromatography using Protein G (GE Healthcare Bioscience). The antibody is adsorbed onto the column, washed with PBS, and then eluted with 0.1M glycine / HCl aqueous solution (pH 2.7). The eluate was adjusted to pH 7.0-7.5 by adding 1M Tris-HCl (pH 9.0), and then dialyzed (Thermo The buffer was replaced with PBS using a Slide-A-Lyzer Dialysis Cassette (Scientific Co., Ltd.). The centrifugal UF filter device VIVASPIN20 (molecular weight cutoff UF30K, Sartorius) was used. The antibody was concentrated to a concentration of 0.7 mg / mL or more. The mixture was filtered through a filter (Torius) to obtain a purified sample.

[0193] Example 6 Cloning of rat antibodies and production of human chimeric antibodies 6)-1 Cloning and sequence determination of cDNA for rat antibody 151D 6) -1-1 Preparation of total RNA from 151D-producing hybridoma To amplify cDNA containing the variable region of 151D, TRIzol Reagent was used to amplify cDNA from 151D-producing hybridomas. Total RNA was prepared using nt (Ambion).

[0194] 6)-1-2 Amplification and sequencing of cDNA containing the heavy chain variable region of 151D by 5'-RACE PCR Amplification of cDNA containing the heavy chain variable region was performed using approximately 1 μg of the total RNA prepared in Example 6)-1-1. This was performed using the SMARTer RACE cDNA Amplification Kit (Clontech). The primers used to amplify the cDNA of the variable region of the heavy chain gene of 151D by PCR were UPM (Un Iversal Primer A Mix: included in the SMARTer RACE cDNA Amplification Kit) and Primers designed based on the sequence of the constant region of the heavy chain of the ribosome were used. The cDNA containing the heavy chain variable region amplified by 5'-RACE PCR was cloned into a plasmid, and then The nucleotide sequence of the cDNA encoding the heavy chain variable region was analyzed. The determined nucleotide sequence of the cDNA encoding the heavy chain variable region of 151D is shown in SEQ ID NO:14. and the amino acid sequence is shown in SEQ ID NO:15.

[0195] 6)-1-3 Amplification and sequencing of cDNA containing the light chain variable region of 151D by 5'-RACE PCR The procedure was carried out in the same manner as in Example 6)-1-2. However, the c of the variable region of the light chain gene of 151D was As a primer for amplifying DNA by PCR, UPM (Universal Primer A Mix: SMARTer R (included in the ACE cDNA Amplification Kit) and was designed based on the known rat light chain constant region sequence. The primers used were The nucleotide sequence of the cDNA encoding the variable region of the light chain of 151D thus determined is shown in SEQ ID NO:16. and the amino acid sequence is shown in SEQ ID NO:17.

[0196] 6)-2 Cloning and sequence determination of cDNA for rat antibody 198D The sequence was determined in the same manner as in Example 6-1. The determined nucleotide sequence of the cDNA encoding the heavy chain variable region of 198D is shown in SEQ ID NO:18. The nucleotide sequence of the cDNA encoding the light chain variable region is shown in SEQ ID NO: 19. The peptide sequence is shown in SEQ ID NO:20 and the amino acid sequence is shown in SEQ ID NO:21.

[0197] 6)-3 Construction of human chimeric antibody expression vector 6)-3-1 Construction of human chimeric light chain expression vector pCMA-LK The plasmid pcDNA3.3-TOPO / LacZ (Invitrogen) was digested with restriction enzymes XbaI and PmeI to obtain and a human light chain signal sequence and a human kappa chain signal sequence shown in SEQ ID NO:22. A DNA fragment containing the DNA sequence encoding the constant region was cloned using the In-Fusion Advantage PCR cloning kit. The DNA was ligated using a kit (CLONTECH) to prepare pcDNA3.3 / LK. pCMA-LK was constructed by removing the neomycin expression unit from pcDNA3.3 / LK.

[0198] 6)-3-2 Construction of human chimeric IgG1 type heavy chain expression vector pCMA-G1 pCMA-LK was digested with XbaI and PmeI to remove the light chain signal sequence and the human κ chain constant region. The DNA fragment thus obtained was subjected to the synthesis of the amino acid sequence of the human heavy chain signal sequence and the amino acid sequence of the human IgG1 constant region shown in SEQ ID NO: 23. A DNA fragment containing a DNA sequence encoding an amino acid was cloned using the In-Fusion Advantage PCR Cloning Kit. (CLONTECH) to construct pCMA-G1.

[0199] 6)-3-3 Construction of human chimeric 151D heavy chain expression vector The cDNA encoding the variable region of the heavy chain of the rat antibody 151D obtained in Example 6-1 was used as a template. As a test, PCR was performed using primers designed for in-fusion cloning to isolate heavy chains. A DNA fragment containing the cDNA encoding the variable region was amplified. pCMA-G1 was digested with the restriction enzyme BIpI. The DNA fragment was amplified using the In-Fusion HD PCR Cloning Kit (Clontech) at the A human chimeric 151D heavy chain expression vector was constructed by inserting the fragment: The nucleotide sequence of the human chimeric 151D heavy chain and the amino acid sequence of the heavy chain are set forth in SEQ ID NO:24 and SEQ ID NO:25. Each is shown in sequence number 25.

[0200] 6)-3-4 Construction of human chimeric 151D light chain expression vector Using the cDNA encoding the variable region of the 151 light chain obtained in Example 6)-1 as a template, The light chain variable region was isolated by PCR using primers designed for in-fusion cloning. A DNA fragment containing the cDNA encoding the IL-11 was amplified. pCMA-LK was cut with the restriction enzyme BsiWI, and the I The amplified DNA fragment was inserted into the vector using the n-Fusion HD PCR Cloning Kit (Clontech). Thus, a human chimeric 151D light chain expression vector was constructed. The nucleotide sequence of the human chimeric 151D light chain and the amino acid sequence of the light chain are set forth in SEQ ID NO:26 and SEQ ID NO:30. They are shown in sequence number 27, respectively.

[0201] 6)-3-5 Construction of human chimeric 198D heavy chain expression vector The cDNA encoding the variable region of the heavy chain of the rat antibody 198D obtained in Example 6)-2 was used as a template. As a template, a human chimeric 198D heavy chain expression vector was constructed in the same manner as in Example 6)-3-3. did. The nucleotide sequence of the human chimeric 198D heavy chain and the amino acid sequence of the heavy chain are set forth in SEQ ID NO:28 and SEQ ID NO:30. They are shown in sequence number 29, respectively.

[0202] 6)-3-6 Construction of human chimeric 198D light chain expression vector Using the cDNA encoding the variable region of the 198D light chain obtained in Example 6)-2 as a template, A human chimeric 198D light chain expression vector was constructed in the same manner as in Example 6)-3-4. The nucleotide sequence of the human chimeric 198D light chain and the amino acid sequence of the light chain are set forth in SEQ ID NO: 30 and SEQ ID NO: 31. They are shown in sequence number 31, respectively.

[0203] 6)-4 Preparation of human chimeric antibodies 6)-4-1 Production of human chimeric antibodies FreeStyle 293F cells (Invitrogen) were passaged and cultured according to the manual. 1 x 10 in logarithmic growth phase 8 FreeStyle 293F cells (Invitrogen) were cultured in 250 mL Fernbach Erlenmeyer The cells were seeded in a 30-ml flask (Corning) and incubated with FreeStyle293 expression medium (Invitrogen). Dilute to 2.0 x 106 cells / mL. 20 μg of heavy chain expression vector and 30 μg of light chain expression vector were added to 5 mL of Opti-Pro SFM medium (Invitrogen). Add the vector and 150 μg of Polyethyleneimine (Polyscience #24765) and mix gently. The mixture was then left for an additional 5 minutes before being added to the FreeStyle 293F cells. After 4 hours of shaking culture at 125 rpm in an 8% CO2 incubator at 37℃, 50 mL of EX-CELL VPRO Culture medium (SAFC Biosciences), 0.36 mL of GlutaMAX I (GIBCO), and 2.5 mL of Yeastolate U Ultrafiltrate (GIBCO) was added, and the cells were incubated at 37°C in an 8% CO2 incubator for 7 days, shaking at 125 rpm. The culture supernatant obtained by shaking was filtered through a 250mL Filter System (CORNING #431096). Ta. A combination of human chimeric 151D heavy chain expression vector and human chimeric 151D light chain expression vector was used. The obtained human chimeric 151D antibody was named "c151D" and was expressed in the human chimeric 198D heavy chain expression vector. The human chimeric 198D antibody obtained by combining the human chimeric 198D light chain expression vector is referred to as "c198 It was named D.

[0204] 6)-4-2 Purification of chimeric antibodies The culture supernatant obtained in Example 6)-4-1 was subjected to rProtein A affinity chromatography. The culture supernatant was purified in a single step using a column filled with MabSelectSuRe equilibrated with PBS. After applying the solution to a column (GE Healthcare Bioscience), PBS was added to the column at least twice as large as the column volume. The column was washed with 2M arginine hydrochloride solution (pH 4.0) to elute the antibody-containing fraction. The fractions were collected and filtered using a Centrifugal UF Filter Device VIVASPIN20 (molecular weight cutoff UF30K The antibody was concentrated using a PBS buffer (Sartorius). The concentration was adjusted to 1 mg / mL or more. Finally, the solution was filtered through a Minisart-Plus filter (Sartorius) and purified. The resulting sample was used as a production sample.

[0205] 6)-5 Binding evaluation of human chimeric antibodies to human GARP The dissociation constants of c151D and c198D prepared in Example 6)-4 with human GARP were measured using Biacore T20 Protein A was immobilized on a 100-well plate using 100% glycerol (GE Healthcare Biosciences) and the antibody was attached to the immobilized Protein A as a ligand. The antigen (recombinant human GARP: R&D Systems) was analyzed. The light capture method was used. HBS-EP+ was used as the running buffer. (GE Healthcare Bioscience), and Protein A sensor chip (GE The ELISA kit (available from Ruscare Biosciences, Inc.) was used. 1· / mL of human chimeric antibody was added to the chip at 10· / min for 20 seconds, and then a dilution series of antigen was added. Solutions (8–128 nM) were added at a flow rate of 30 µ / min for 120 s, followed by monitoring the dissociation phase for 480 s. As a regeneration solution, Glycine 1.5 (GE Healthcare Bioscience) was used at a flow rate of 20 μg / min. Add for 30 seconds. The data were analyzed using a 1:1 binding model, with the association rate constant ka, dissociation rate constant kd, and dissociation rate constant kd. The constant (KD; KD=kd / ka) was calculated. The results are shown in Table 1.

[0206] Table 1 Dissociation constants of c151D and c198D with human GARP

[0207] [Table 1]

[0208] Example 7: Preparation of humanized antibodies 7)-1 Molecular modeling of the variable region of the c151D antibody Molecular modeling of the variable region of the c151D antibody was performed using a method commonly known as homology modeling. This was carried out according to the method described in Methods in Enzymology, 203, 121-153, (1991). Human immunoglobulins registered in the Protein Data Bank (Nuc.Acid Res.28,235-242 (2000)) Primary sequence of the variable domain of purine (3D structure derived from X-ray crystal structure is available) was compared with the variable region of the c151D antibody. The three-dimensional structure of the variable region shows high alignment with the heavy and light chains of the c151D antibody and their interface. By combining the coordinates of models with sequence homology, a "framework model" is obtained. It was created. Representative conformations for each CDR are then fitted to the framework model was incorporated into. Finally, an energy minimization calculation was performed to remove the energetically unfavorable interatomic contacts. The above procedure was carried out using Discovery Studio (Dassault Systèmes).

[0209] 7)-2 Design of amino acid sequence for humanized 151D antibody The construction of the humanized 151D antibody was carried out by CDR grafting (Proc. Natl. Acad. Sci. USA 86, 10029-10 The acceptor antibody was a frame-specific antibody. The sequences were selected based on amino acid homology within the network region. The framework region sequence of the c151D antibody was determined to be the same as that of the human subgroup consensus sequence. The results were compared with the framework regions. f Immunological Interest, 5th Ed. Public Health Service National Institutes of The concept of human γ-chain subgroup 3 defined in the National Institute of Health, Bethesda, MD (1991) The consensus sequences of human κ chain subgroup 1 and human κ chain subgroup 4 are Due to the high sequence homology in the framework regions, the acceptor was selected as. The consensus sequence of human γ chain subgroup 3 and human κ chain subgroup 1 and human κ chain subgroup The amino acid residues in the framework region of the group 4 consensus sequence were The amino acid residues of the corresponding sequences were aligned to identify positions where different amino acids were used. The positions of these residues were analyzed using the three-dimensional model of the c151D antibody constructed in 7)-1 above. and the donor residue to be grafted onto the acceptor is selected from the group consisting of aryl, aryl, and aryl groups, as described by Queen et al. Proc. Natl. Acad. Sci. USA 86, 10029-10033 (1989)) was selected. Humanized h1 was obtained by transferring selected donor residues to the acceptor antibody. The sequence of 51D was constructed as described in the Examples below.

[0210] 7)-3 Design of humanized 151D heavy chain h151D-H 7)-3-1h151D-H1 type heavy chain The arginine residue at the 35th amino acid position of the c151D heavy chain shown in SEQ ID NO:25 of the sequence listing is lysine residue, the 37th lysine residue to a leucine residue, and the 38th lysine residue to an arginine residue. The 42nd serine residue is replaced by an alanine residue, and the 61st threonine residue is replaced by a glycine residue. 62nd glutamine residue to a lysine residue, 68th alanine residue to a serine residue, 94th alanine residue to serine residue; 96th alanine residue to serine residue; 103 to asparagine residue, and 104 to asparagine residue. , the 107th serine residue is replaced by an alanine residue, the 112th threonine residue is replaced by a valine residue, The 130th valine residue was replaced with a threonine residue, and the 131st methionine residue was replaced with a leucine residue. The humanized 151D heavy chain designed with these modifications was named "h151D-H1 type heavy chain." In the nucleotide sequence encoding the h151D-H1 type heavy chain (SEQ ID NO: 32), the signal The sequence encoding the truncated mature heavy chain is the nucleotide sequence consisting of nucleotides 58 to 1398. The variable region is encoded by a nucleotide sequence consisting of nucleotides 58 to 408. The nucleic acid sequence encoding the constant region is from nucleotide number 409 to 1398. The variable region is a nucleotide sequence encoding CDRH1 in SEQ ID NO: 32 of the sequence listing. nucleotide sequence from nucleotide number 133 to nucleotide number 162, which encodes CDRH2; Nucleotide sequence consisting of nucleotide numbers 205 to 234 and the nucleotide sequence encoding CDRH3 It has the nucleotide sequence consisting of numbers 352 to 375. In addition, in the amino acid sequence of the h151D-H1 type heavy chain (SEQ ID NO: 33), the signal sequence was cut off. The mature heavy chain is an amino acid sequence consisting of amino acid numbers 20 to 466, and the variable region is The amino acid sequence is composed of amino acid numbers 20 to 136, and the constant region is composed of amino acid numbers 137 to 466. The variable region is an amino acid sequence consisting of the amino acid sequence of SEQ ID NO: 33 in the sequence listing. CDRH1 consisting of the amino acid sequence set forth in Nos. 45 to 54; CDRH2 consisting of the amino acid sequence set forth in amino acid numbers 118 to 125, and CDRH3 consisting of the amino acid sequence set forth in amino acid numbers 118 to 125. has. Additionally, the sequences of SEQ ID NOs: 32 and 33 are also depicted in Figures 31 and 21, respectively.

[0211] 7)-3-2 h151D_H4 type heavy chain The arginine residue at the 35th amino acid position of the c151D heavy chain shown in SEQ ID NO:25 of the sequence listing is lysine residue, the 37th lysine residue to a leucine residue, and the 38th lysine residue to an arginine residue. The 42nd serine residue is replaced by an alanine residue, and the 61st threonine residue is replaced by a glycine residue. 62nd glutamine residue to a lysine residue, 94th alanine residue to a serine residue, 10 The 3rd aspartic acid residue is replaced by an asparagine residue, and the 107th serine residue is replaced by an alanine residue. 112th threonine residue to valine residue, 130th valine residue to threonine residue , humanized 151, which was designed by replacing the methionine residue at position 131 with a leucine residue; The D heavy chain was named "h151D_H4 type heavy chain." In the nucleotide sequence encoding the h151D-H4 type heavy chain (SEQ ID NO: 34), the signal The sequence encoding the truncated mature heavy chain is the nucleotide sequence consisting of nucleotides 58 to 1398. The variable region is encoded by a nucleotide sequence consisting of nucleotides 58 to 408. The nucleic acid sequence encoding the constant region is from nucleotide number 409 to 1398. The variable region is a nucleotide sequence encoding CDRH1 in SEQ ID NO: 34 of the sequence listing. nucleotide sequence from nucleotide number 133 to nucleotide number 162, which encodes CDRH2; Nucleotide sequence consisting of nucleotide numbers 205 to 234 and the nucleotide sequence encoding CDRH3 It has the nucleotide sequence consisting of numbers 352 to 375. In addition, in the amino acid sequence of the h151D-H4 type heavy chain (SEQ ID NO: 35), the signal sequence was truncated. The mature heavy chain is an amino acid sequence consisting of amino acid numbers 20 to 466, and the variable region is The amino acid sequence is composed of amino acid numbers 20 to 136, and the constant region is composed of amino acid numbers 137 to 466. The variable region is an amino acid sequence consisting of the amino acid sequence of SEQ ID NO: 35 in the sequence listing. CDRH1 consisting of the amino acid sequence set forth in Nos. 45 to 54; CDRH2 consisting of the amino acid sequence set forth in amino acid numbers 118 to 125, and CDRH3 consisting of the amino acid sequence set forth in amino acid numbers 118 to 125. has. Additionally, the sequences of SEQ ID NOs: 34 and 35 are also set forth in Figures 33 and 23, respectively.

[0212] 7)-4 Design of humanized 151D light chain h151D_L 7)-4-1h151D-L1 type light chain The threonine residue at amino acid number 29 of the c151D light chain shown in SEQ ID NO:27 in the sequence listing is the 31st methionine residue to a leucine residue, and the 32nd phenylalanine residue to a the 33rd isoleucine residue to alanine residue, the 35th valine residue to valine residue, the 37th aspartic acid residue to a glutamic acid residue, and the 39th ba The phosphorus residue is replaced by an alanine residue, the 41st methionine residue is replaced by an isoleucine residue, and the 60th triamine residue is replaced by an isoleucine residue. The threonine residue at position 83 was replaced by a proline residue, the threonine residue at position 83 was replaced by a serine residue, and the aspartate residue at position 97 was replaced by a The paragine residue was replaced by a serine residue, the 98th methionine residue was replaced by a leucine residue, and the 103rd leucine residue was replaced by a leucine residue. The isine residue was replaced by a valine residue, the 120th threonine residue was replaced by a glutamine residue, and the 124th lo 126th leucine residue to isoleucine residue, and 127th aline residue to valine residue. The sparagine residue is replaced by a lysine residue, and the 129th alanine residue is replaced by a threonine residue. The humanized 151D light chain designed based on this was named "h151D_L1 type light chain." In the nucleotide sequence encoding the h151D-L1 type light chain (SEQ ID NO:36), the signal The sequence encoding the truncated mature light chain is the nucleotide sequence consisting of nucleotides 61 to 702. The variable region is encoded by a nucleotide sequence consisting of nucleotides 61 to 387. The constant region is encoded by the nucleotide sequence consisting of nucleotides 388 to 702. The variable region is a nucleotide sequence encoding CDRL1 in SEQ ID NO: 36 of the sequence listing. a nucleotide sequence consisting of nucleotide numbers 130 to 162 which corresponds to the nucleotide sequence encoding CDRL2; The nucleotide sequence consisting of nucleotide numbers 208 to 228 and the nucleotide numbers encoding CDRL3 It has the nucleotide sequence consisting of nos. 325 to 351. In addition, in the amino acid sequence of the h151D_L1 type light chain (SEQ ID NO: 37), the signal sequence was cut off. The removed mature light chain has an amino acid sequence consisting of amino acid numbers 21 to 234, and the variable region is The amino acid sequence is composed of amino acid numbers 21 to 129, and the constant region is composed of amino acid numbers 130 to 234. The variable region is an amino acid sequence consisting of the amino acid sequence shown in SEQ ID NO: 37 of the sequence listing. CDRL1 consisting of the amino acid sequence set forth in Nos. 44 to 54; and CDRL3 consisting of the amino acid sequence set forth in amino acid numbers 109 to 117. has. Additionally, the sequences of SEQ ID NOs: 36 and 37 are also set forth in Figures 32 and 22, respectively.

[0213] 7)-4-2h151D-L4 type light chain: The threonine residue at amino acid number 29 of the c151D light chain shown in SEQ ID NO: 27 of the sequence listing is substituted with phosphorus residue, 31st methionine residue to leucine residue, 32nd phenylalanine residue to a serine residue, the 33rd isoleucine residue to an alanine residue, and the 41st methionine residue to an isoleucine residue, the 60th threonine residue to a proline residue, and the 62nd glutamine residue to a the 83rd threonine residue to a serine residue, and the 97th asparagine residue to a lysine residue. The 98th methionine residue is replaced by a leucine residue, and the 100th alanine residue is replaced by a serine residue. to a proline residue, the 103rd leucine residue to a phenylalanine residue, and the 105th valine residue to a the 120th threonine residue to a glutamine residue, and the 124th leu 126th leucine residue to isoleucine residue, and 127th aspartate residue to valine residue. By replacing the paragine residue with a lysine residue and the 129th alanine residue with a threonine residue, The humanized 151D light chain designed with these features was named "h151D-L4 type light chain."

[0214] In the nucleotide sequence encoding the h151D-L4 type light chain (SEQ ID NO: 38), the signal The sequence encoding the truncated mature light chain is the nucleotide sequence consisting of nucleotides 61 to 702. The variable region is encoded by a nucleotide sequence consisting of nucleotides 61 to 387. The constant region is encoded by the nucleotide sequence consisting of nucleotides 388 to 702. The variable region is a nucleotide sequence encoding CDRL1 in SEQ ID NO: 38 of the sequence listing. a nucleotide sequence consisting of nucleotide numbers 130 to 162 which corresponds to the nucleotide sequence encoding CDRL2; The nucleotide sequence consisting of nucleotide numbers 208 to 228 and the nucleotide numbers encoding CDRL3 It has the nucleotide sequence consisting of nos. 325 to 351. In addition, in the amino acid sequence of the h151D-L4 type light chain (SEQ ID NO: 39), the signal sequence was cut off. The removed mature light chain has an amino acid sequence consisting of amino acid numbers 21 to 234, and the variable region is The amino acid sequence is composed of amino acid numbers 21 to 129, and the constant region is composed of amino acid numbers 130 to 234. The variable region is an amino acid sequence consisting of the amino acid sequence of SEQ ID NO: 39 in the sequence listing. CDRL1 consisting of the amino acid sequence set forth in Nos. 44 to 54; and CDRL3 consisting of the amino acid sequence set forth in amino acid numbers 109 to 117. has. Additionally, the sequences of SEQ ID NOs: 38 and 39 are also set forth in Figures 34 and 24, respectively.

[0215] 7) Molecular modeling of the variable region of -5c198D Molecular modeling of the variable region of the c198D antibody was performed using a method commonly known as homology modeling. The protein was purified by the method described in Methods in Enzymology, 203, 121-153, (1991). Human immunoglobulin variable fragments registered in the ATA Bank (Nuc. Acid Res. 28, 235-242 (2000)) The primary sequence of the domain (for which the three-dimensional structure derived from the X-ray crystal structure is available) was determined using the c198D antibody. compared with the variable regions of the body. The three-dimensional structure of the variable region is highly aligned with the heavy and light chains of the c198D antibody and their interface. By combining the coordinates of models with sequence homology, a "framework model" is obtained. It was created. Representative conformations for each CDR are then fitted to the framework model was incorporated into. Finally, an energy minimization calculation was performed to remove the energetically unfavorable interatomic contacts. The above procedure was carried out using Discovery Studio (Dassault Systèmes).

[0216] 7)-6 Design of amino acid sequence for humanized 198D The construction of the humanized 198D antibody was carried out by CDR grafting (Proc. Natl. Acad. Sci. USA 86, 10029-10 The acceptor antibody was a frame-specific antibody. The sequences were selected based on amino acid homology within the network region. The framework region sequence of the c198D antibody was compared with the human subgroup consensus sequence. The results were compared with the framework regions. Immunological Interest, 5th Ed. Public Health Service National Institutes of H The consensus of human γ-chain subgroup 2 defined in the Journal of Clinical Nucleic Acids, Bethesda, MD (1991) The consensus sequence of the human κ chain subgroup 1 and the ss sequence are located in the framework region. It was selected as the acceptor due to its high sequence homology with Some residues in the chain were transferred from the consensus sequence of human γ chain subgroup 3. The consensus sequence of human γ-chain subgroup 2 contains a portion of the consensus sequence of human γ-chain subgroup 3. The framework regions of the consensus sequence of human κ chain subgroup 1 and the consensus sequence of human κ chain subgroup 1 The amino acid residues of the c198D antibody were aligned with those of the c198D antibody, and different amino acids were used. The positions of these residues were identified as those of the c198D antibody constructed in 7)-5 above. The dopants to be analyzed using the three-dimensional model and grafted onto the acceptor are The ner residue was determined by Queen et al. (Proc. Natl. Acad. Sci. USA 86, 10029-10033 (1989)). The samples were selected based on criteria given in the table. Humanized h1 was obtained by transferring selected donor residues to the acceptor antibody. The sequence of 98D was constructed as described in the Examples below.

[0217] 7)-7 Design of humanized 198D heavy chain h198D-H 7)-7-1h198D-H3 type heavy chain The glutamine residue at the 20th amino acid position of the c198D heavy chain shown in SEQ ID NO:29 in the sequence listing is the 24th arginine residue to a valine residue, and the 28th proline residue to a glutamic acid residue. The 32nd glutamine residue is replaced by a lysine residue, and the 61st glutamic acid residue is replaced by a glutamine residue. The 80th serine residue is replaced by a proline residue, and the 81st alanine residue is replaced by a serine residue. Based on this, the 86th leucine residue is replaced with a valine residue, the 87th serine residue is replaced with a threonine residue, The 95th serine residue is replaced by an asparagine residue, and the 98th phenylalanine residue is replaced by a serine residue. 101st methionine residue is replaced by a leucine residue, and 103rd threonine residue is replaced by a serine residue. 104th leucine residue to valine residue, 105th glutamine residue to threonine residue 106th threonine residue is replaced by an alanine residue, and 107th glutamic acid residue is replaced by an alanine residue. The 111th methionine residue was replaced with a valine residue, and the 113th phenylalanine residue was replaced with a thiol residue. 133rd alanine residue to threonine residue, 134th serine residue to leucoside residue, The humanized 198D heavy chain, which was designed by replacing the sRNA residues with sRNA residues, was named "h198D_H3 type heavy chain." Named it.

[0218] In the nucleotide sequence encoding the h198D-H3 type heavy chain (SEQ ID NO: 40), the signal The sequence encoding the truncated mature heavy chain is the nucleotide sequence consisting of nucleotides 58 to 1407. The variable region is encoded by a nucleotide sequence consisting of nucleotides 58 to 417. The nucleic acid sequence encoding the constant region consists of nucleotides 418 to 1407. The variable region is a nucleotide sequence encoding CDRH1 in SEQ ID NO: 40 of the sequence listing. nucleotide sequence from nucleotide number 130 to nucleotide number 162, which encodes CDRH2; Nucleotide sequence consisting of nucleotide numbers 205 to 231 and the nucleotide sequence encoding CDRH3 It has the nucleotide sequence consisting of numbers 349 to 384. In addition, in the amino acid sequence of the h198D-H3 type heavy chain (SEQ ID NO: 41), the signal sequence was cut off. The mature heavy chain is an amino acid sequence consisting of amino acid numbers 20 to 469, and the variable region is The amino acid sequence is composed of amino acid numbers 20 to 139, and the constant region is composed of amino acid numbers 140 to 469. It is an amino acid sequence consisting of: Additionally, the sequences of SEQ ID NOs: 40 and 41 are also depicted in Figures 35 and 25, respectively.

[0219] 7)-8 Design of humanized 198D light chain h198D-L 7)-8-1h198D-L4 type light chain The alanine residue at the 29th amino acid position of the c198D light chain shown in SEQ ID NO:31 in the sequence listing is substituted with seryl the 33rd glycine residue to an alanine residue, and the 35th leucine residue to a valine residue 37th glutamic acid residue is replaced by an aspartic acid residue, and 38th threonine residue is replaced by an alkyl residue. the 42nd glutamine residue to a threonine residue, and the 65th glutamine residue to a threonine residue. Lysine residue, 85th glycine residue to serine residue, 92nd serine residue to threonine residue The 94th lysine residue was replaced by a threonine residue, and the 98th methionine residue was replaced by a leucine residue. Based on this, the 100th threonine residue was replaced with a proline residue, and the 103rd glutamic acid residue was replaced with a phenyl the 104th glycine residue to an alanine residue, and the 105th valine residue to a valinyl residue. The leucine residue at position 120 is replaced by a glutamine residue, and the leucine residue at position 124 is replaced by a leucine residue. The 129th alanine residue was replaced with a threonine residue at the phosphorus residue. The humanized 198D light chain was named "h198D-L4 type light chain."

[0220] In the nucleotide sequence encoding the h198D-L4 type light chain (SEQ ID NO: 42), the signal The sequence encoding the truncated mature light chain is the nucleotide sequence consisting of nucleotides 61 to 702. The variable region is encoded by a nucleotide sequence consisting of nucleotides 61 to 387. The constant region is encoded by the nucleotide sequence consisting of nucleotides 388 to 702. The variable region is a nucleotide sequence encoding CDRL1 in SEQ ID NO: 42 of the sequence listing. a nucleotide sequence consisting of nucleotide numbers 130 to 162 which corresponds to the nucleotide sequence encoding CDRL2; The nucleotide sequence consisting of nucleotide numbers 208 to 228 and the nucleotide numbers encoding CDRL3 It has the nucleotide sequence consisting of nos. 325 to 351. In addition, in the amino acid sequence of the h198D_L4 type light chain (SEQ ID NO: 43), the signal sequence was truncated. The removed mature light chain has an amino acid sequence consisting of amino acid numbers 21 to 234, and the variable region is The amino acid sequence is composed of amino acid numbers 21 to 129, and the constant region is composed of amino acid numbers 130 to 234. It is an amino acid sequence consisting of: Additionally, the sequences of SEQ ID NOs: 42 and 43 are also set forth in Figures 36 and 26, respectively.

[0221] 7)-9 Construction of expression vector for humanized antibody 7)-9-1 Construction of expression vector for humanized anti-human GARP antibody h151D-H1L1 Nucleotide sequence of the h151D-H1 type heavy chain shown in SEQ ID NO: 32 in the sequence listing A DNA fragment containing a sequence encoding the h151D-H1 type heavy chain shown in Nos. 58 to 1398 was synthesized. (GENEART artificial gene synthesis service). The synthesized DNA fragments were used to develop the According to the protocol of Potelligent (registered trademark) CHOK1SV Technology, A chain expression vector was constructed and named "GSV-h151D-H1." Next, the nucleotide sequence of the h151D-L1 type light chain shown in SEQ ID NO: 36 in the sequence listing is A DNA fragment containing a sequence encoding the h151D-L1 type light chain shown in octet numbers 61 to 702 was synthesized. (GENEART artificial gene synthesis service). The synthesized DNA fragments were then subjected to PCR using Potelligent® CHOK1SV Technology from BioWa and Lonza. According to the protocol of the present invention, an h151D-L1 type light chain expression vector was constructed. The projector was named "GSV-h151D-L1." Next, the constructed expression vectors “GSV-h151D-H1” and “GSV-h151D-L1” were used for and Lonza's Potelligent® CHOK1SV Technology protocol. The 1511a expression vector was constructed. The resulting expression vector was named "DGV-h151D-H1L1-GS". Ta.

[0222] 7)-9-2 Construction of expression vector for humanized anti-human GARP antibody h151D_H4L4 As in Example 7)-9-1, the nucleic acid sequence of the h151D-H4 type heavy chain shown in SEQ ID NO: 34 of the sequence listing was used. The heavy chain encoding h151D-H4 type shown in nucleotide numbers 58 to 1398 of the nucleotide sequence and the nucleotide sequence of the h151D-L4 type light chain shown in SEQ ID NO: 38 of the sequence listing. The sequence encoding the h151D-L4 type light chain shown in nucleotide numbers 61 to 702 of the sequence A DNA fragment containing this gene was synthesized (GENEART, Inc., Artificial Gene Synthesis Service). The synthesized DNA fragment was used in a PCR reaction using Potelligent® CHOK1SV Technol (BioWa and Lonza). The MACA-1514a expression vector was constructed according to the protocol of the chemistry. The target was named "DGV-h151D-H4L4-GS."

[0223] 7)-9-3 Construction of expression vector for humanized anti-human GARP antibody h198D_H3L4 As in Example 7)-9-1, the nucleic acid sequence of the h198D-_H3 type heavy chain shown in SEQ ID NO: 40 in the sequence listing was used. The heavy chain encoding h198D-H3 type shown in nucleotide numbers 58 to 1407 of the nucleotide sequence and the nucleotide sequence of the h198D-L4 type light chain shown in SEQ ID NO: 42 of the sequence listing. The sequence encoding the h198D-L4 type light chain shown in nucleotide numbers 61 to 702 of the sequence A DNA fragment containing this gene was synthesized (GENEART, Inc., Artificial Gene Synthesis Service). The synthesized DNA fragment was used to develop the Potelligent® CHOK1SV Technology of BioWa and Lonza. The MACA-1983a expression vector was constructed according to the protocol. It was named "DGV-h198D-H3L4-GS".

[0224] 7)-10 Preparation of humanized anti-human GARP antibody 7)-10-1 Generation of humanized anti-human GARP antibody-producing cells 7)-10-1-1 Preparation of cells producing humanized anti-human GARP antibody h151D-H1L1 According to the protocol of Potelligent® CHOK1SV Technology of BioWa and Lonza, Therefore, the humanized anti-human GARP antibody h151D-H1L1 expression vector constructed in Example 7)-9-1, DGV -h151D-H1L1-GS was transfected into Potelligent CHOK1SV cells (BioWa and Lonza). The resulting production strain was designated "MAC1-1 " and named it.

[0225] 7)-10-1-2 Preparation of cells producing humanized anti-human GARP antibody h151D-H4L4 As in Example 7)-10-1-1, the humanized anti-human GARP antibody constructed in Example 7)-9-2 was used. The human h151D-H4L4 expression vector, DGV-h151D-H4L4-GS, was transfected with Potelligent CHOK1SV cells (BioWa and and Lonza) to construct a strain producing the humanized anti-human GARP antibody h151D-H4L4. The resulting production strain was named "MAC2-1."

[0226] 7)-10-1-3 Preparation of cells producing humanized anti-human GARP antibody h198D-H3L4 As in Example 7)-10-1-1, the humanized anti-human GARP antibody constructed in Example 7)-9-3 was used. The human h198D_H3L4 expression vector, DGV-h198D_H3L4-GS, was transfected with Potelligent CHOK1SV cells (BioWa and and Lonza) to construct a strain producing the humanized anti-human GARP antibody h198D-H3L4. The resulting production strain was named "MAC3-1."

[0227] 7)-10-2 Cultivation of humanized anti-human GARP antibody-producing cells 7)-10-2-1 Cultivation of humanized anti-human GARP antibody h151D-H1L1 producing cells Example 7)-10-1-1: Humanized anti-human GARP antibody h151D-H1L1 producing strain "MAC1-1 The culture of " was carried out using a Wave reactor (GE Healthcare Japan). The strain "MAC1-1" was thawed using Dsp04B (JX Energy) medium and incubated at 37°C, 5% CO2. The culture was diluted with C36 (JX Energy) medium. The cells were then expanded at 37°C in a 5% CO2 incubator at 120 rpm. The resulting culture solution had a cell density of 30 × 10 4 Dilute WAVE CELLB in C36 medium to 100 cells / mL. The mixture was placed in a GE Healthcare Bioscience AG (GE Healthcare Bioscience) and incubated at 37°C, 5% CO2, 0.3 L / min air supply, and shaker. The plates were cultured for 13 days at a rotation speed of 18-24 rpm and an angle of 6-8°. From the third day of culture, FM4Ae2 medium (self-prepared) was added daily at 6% of the starting amount. The resulting culture medium was filtered through a depth filter Millistak MC0HC054H1 (Merck Millipore). After rough filtration, the solution was filtered through a 0.22 μm filter (Sartorius) attached to the Flexboy Bags. The filtrate was named "MACA-1511a culture supernatant."

[0228] 7)-10-2-2 Cultivation of humanized anti-human GARP antibody h151D_H4L4 producing cells Similarly to Example 7)-10-2-1, the humanized anti-human The GARP antibody h151D-H4L4-producing strain "MAC2-1" was cultured and expanded, and then cultured in a Wave reactor (GE Health Fed-batch culture was performed using a 30×10 4 cells / mL The mixture was diluted with C36 medium and placed in a WAVE CELLBAG (GE Healthcare Bioscience). The resulting culture medium was filtered, and the filtrate was named "MACA-1514a culture supernatant." Named it.

[0229] 7)-10-2-3 Cultivation of humanized anti-human GARP antibody h198D-H3L4 producing cells Similarly to Example 7)-10-2-1, the humanized anti-human The GARP antibody h198D-H3L4-producing strain "MAC3-1" was cultured and expanded, and then cultured in a Wave reactor (GE Healthcare) Fed-batch culture was performed using a 30×10 4 cells / mL The mixture was diluted with C36 medium and placed in a WAVE CELLBAG (GE Healthcare Bioscience). The resulting culture medium was filtered, and the filtrate was named "MACA-1983a culture supernatant." Named it.

[0230] 7)-10-3 Purification of humanized anti-human GARP antibody 7)-10-3-1 Purification of humanized anti-human GARP antibody h151D-H1L1 The "MACA-1511a culture supernatant" obtained in Example 7)-10-2-1 was subjected to rProtein A affinity chromatography. Chromatography, anion exchange chromatography, cation exchange chromatography It was purified in a three-step process by Fee. First, the culture supernatant was applied to rProtein A affinity chromatography resin equilibrated with PBS. After the culture medium was completely loaded into the column, the column was washed with PBS, a buffer containing arginine, and PBS. The column was then washed with acetate buffer, and the absorbance peak at 280 nm was collected. The mixture was neutralized with a buffer solution and then roughly filtered through a glass fiber filter AP20 (Merck Millipore). The solution was filtered through a 0.22 μm filter, Stericup-GV (Merck Millipore), and then The teinA purified pool was used.

[0231] The rProtein A purified pool was then applied to an anion exchange chromatography resin equilibrated with PBS. After the entire applied solution had entered the column, PBS was passed through. The absorption peak at 280 nm was collected. The pH of the collected solution was adjusted with acetic acid, and the glass fiber filter was After rough filtration with a filter AP20 (Merck Millipore), the solution was filtered through a 0.22 μm filter, Stericut. The resulting solution was filtered through Pool-GV (Merck Millipore) to obtain the AEX purified pool. The AEX purified pool was then applied to a cation exchange chromatographic resin equilibrated with acetate buffer. After the entire application solution had been poured into the column, the column was washed with acetate buffer. The elution was carried out using an acetate buffer containing 100% NaCl, and the absorption peak at 280 nm was collected. After coarse filtration through a glass fiber filter AP20 (Merck Millipore), the solution was filtered through a 0.22 μm filter. The resulting solution was filtered through a Stericup-GV (Merck Millipore) to obtain the CEX purified pool. . The CEX purified pool was purified using a Pellicon 3 Cassette 30kDa (Merck Millipore) at an antibody concentration of 25mM. After concentrating to 100 µg / mL, the mixture was placed in histidine buffer (25 mM histidine, 5% sorbitol, pH 6.0). Finally, the mixture was roughly filtered through a glass fiber filter AP20 (Merck Millipore) and then diluted to 0. The purified sample was filtered through a 22 μm filter, Stericup-GV (Merck Millipore). The purified sample was named "h151D-H1L1."

[0232] 7)-10-3-2 Purification of humanized anti-human GARP antibody h151D-H4L4 In the same manner as in Example 7)-10-3-1, “MACA-1514a The culture supernatant was subjected to rProtein A affinity chromatography, anion exchange chromatography, and The purified sample was classified as " It was named "h151D-H4L4".

[0233] 7)-10-3-3 Purification of humanized anti-human GARP antibody h198D-H3L4 In the same manner as in Example 7)-10-3-1, the “MACA-1983a The culture supernatant was subjected to rProtein A affinity chromatography, anion exchange chromatography, and The purified sample was classified as " The new strain was named "h198D-H3L4."

[0234] 7)-11 Binding evaluation of humanized anti-human GARP antibodies to human GARP The humanized anti-human GARP antibodies h151D-H1L1, h151D-H4L4, and h198D- The dissociation constant between H3L4 and GARP was measured using a Biacore T200 (GE Healthcare Biosciences, Inc.). The antibody is captured as a ligand by immobilized Protein A, and the antigen is then detected. The measurement was performed using the capture method, which measures α-aminobutyric acid as an analyte. HB was used as the running buffer. S-EP+ (GE Healthcare Biosciences), Protein A sensor as the sensor chip A 3-chip (GE Healthcare Biosciences, Inc.) was used. After applying 1 μg / mL of human chimeric antibody to the chip at 10 μL / min for 20 seconds, a dilution series of antigens was added. The column solution (8-128 nM) was added at a flow rate of 30 μl / min for 120 seconds, and the dissociation phase was then monitored for 480 seconds. As a regenerating solution, Glycine 1.5 (GE Healthcare Biosciences) was used at a flow rate of 20 Addition was at .mu.l / min for 30 seconds. The data were analyzed using a 1:1 binding model, with the association rate constant ka, dissociation rate constant kd, and dissociation rate constant kd. The constant (KD; KD=kd / ka) was calculated.

[0235] The results are shown in Table 2.

[0236] Table 2. Dissociation constants of humanized anti-human GARP antibodies

[0237] [Table 2]

[0238] Example 8: Binding to antigen gene-expressing cells 8)-1 Binding to GARP The human GARP expression vector and the control vector were introduced by the method described in Example 2. The HEK-293T cell suspension was prepared by injecting h151D-H1L1, h151D-H4L4, and h198D-H3L4, and control human IgG (human IgG: Eureka Therapeutics) was added and the mixture was left to stand at 4°C for 15 minutes. After washing twice with FACS buffer (PBS containing 3% FBS (Invitrogen)), R-Phycoerythrin (PE )-labeled anti-IgG antibody (Jackson ImmunoResearch Laboratories) and Horizon FVS450 (Becton) The cells were suspended in 100% ethanol (Dickinson's) and allowed to stand for an additional 15 minutes at 4°C. The method of analysis was the same as that described in Example 2, and a histogram of PE fluorescence intensity was obtained. Created (Figure 37). In HEK-293T cells transfected with the control vector, h151DH-1L1, h151D-H4L4, and h1 98D-_H3L4 showed a fluorescence intensity histogram similar to that of the control IgG (Mock vector is not shown in the figure). (denoted as r-transfected HEK293T). On the other hand, in GARP-expressing HEK-293T cells (indicated as hGARP-transfected HEK293T in the figure), Fluorescence intensity histogram of control human IgG against h151D-H1L1, h151D-H4L4, and h19 It was confirmed that each histogram of 8D_H3L4 was shifted to the stronger fluorescence intensity side. These results indicate that h151D-H1L1, h151D-H4L4, and h198D-H3L4 specifically bind to GARP. It became clear that...

[0239] 8)-2 Binding of GARP to TGFβ1 8)-2-1 Construction of human GARP mutant expression vector The human GARP expression vector (Origene) was used as a template, and the primer F (cacggcaacctgctggag cggctgctgggggagg) (SEQ ID NO: 44), primer R (caggctgttcccagacaggtccag) (SEQ ID NO: No. 45) and the KOD-Plus-Mutagenesis Kit (Toyobo Co., Ltd.) were used to elucidate the human GARP amino acid sequence ( A human GARP mutant expression vector in which the amino acid sequence 137-139 of SEQ ID NO:1 was converted from YSG to HGN. A vector was constructed and the base sequence was confirmed.

[0240] 8)-2-2 Co-expression of GARP and TGFβ1 Human TGFβ1 expression vector (Sino Biological Co., Ltd.) was transfected with human GARP expression vector or human GARP expression vector. The P mutant expression vector was transfected into HEK-293T cells using Lipofectamin 2000 (Invitrogen). The gene was then introduced. After overnight culture in 10% FBS-containing DMEM medium (Invitrogen) at 37°C under 5% CO2, Cells were harvested from the plate by treatment with TrypLE Express (Invitrogen), and then washed with FACS buffer. After washing twice with hexane, the cells were suspended in the same solution. The obtained cell suspension was added with 105F, h151D-H1L1, h151D-H4L4, and h198D-H3L4 according to the present invention. and a known antibody (human IgG1 anti-GARP antibody prepared based on the sequence information described in Patent Document 1). MHG8, and LHG10 antibodies, and control human IgG (Eureka Therapeutics) The mixture was then allowed to stand at 4°C for 15 minutes. After washing twice with FACS buffer, PE-labeled anti-IgG antibody (Jackson ImmunoResearch Laboratories, (Becton Dickinson) and Horizon FVS450 (Becton Dickinson), and then the mixture was suspended in water for another 15 minutes at 4°C. The subsequent flow cytometer analysis was carried out in the same manner as described in Example 2. A histogram of PE fluorescence intensity was created (FIG. 38). In HEK-293T cells co-transfected with TGFβ1 and GARP, all antibodies showed fluorescence intensity similar to that of the control IgG. It was confirmed that the fluorescence intensity histogram was shifted toward the strong fluorescence intensity side (Figure 38). On the other hand, in HEK-293T cells co-transfected with TGFβ1 and GARP mutants, 105F, h151D-H1L1, and h151D- A similar shift to stronger fluorescence intensity was observed with the antibodies H4L4 and h198D-H3L4, but MHG8 For LHG10, the fluorescence intensity histogram was similar to that of the control IgG. As described in [Reference 12], it was shown not to bind to GARP mutants. From the above results, the 105F, h151D-H1L1, h151D-H4L4, and h198D-H3L4 antibodies inhibited TGFβ1 The results showed that the GARP mutants co-expressed with IgG10 and IgG20 bind to both GARP and GARP mutants co-expressed with IgG10 and IgG20, respectively, and bind to both GARP and GARP mutants co-expressed with IgG10 and MHG8 antibodies. were found to bind to distinct regions of GARP.

[0241] Example 9: Binding to cells expressing endogenous GARP 9)-1 Flow cytometry analysis using L428 cells L428 cells were washed twice with FACS buffer, suspended in the same solution, and then incubated with h151D-H1L1, h151D-H4L4, and h198D_H3L4, and control human IgG (human IgG: Eureka Therapeutics) After washing twice with FACS buffer, PE-labeled anti-IgG antibody was added to each well. The antibody (Jackson ImmunoResearch Laboratories) was added and suspended, and the mixture was incubated at 4°C for another 15 minutes. The subsequent analysis using a flow cytometer was carried out in the same manner as described in Example 3. The PE fluorescence intensity was measured and a histogram was created. Compared to the fluorescence intensity histogram of L428 cells with control IgG, h151D-H1L1, h The histograms in which the 151D-H4L4 and h198D_H3L4 antibodies were added shifted to the strong fluorescence intensity side. It was found that h151D-H1L1, h151D-H4L4, and h198D-H3L4 were endogenously expressed. It was confirmed that the IL-11 protein binds to GARP (FIG. 39).

[0242] 9)-2 Flow cytometry analysis using human Treg Frozen human PBMCs (Cellular Technology) were thawed according to the protocol and incubated for 10 100% FBS-containing RPMI1640 (Invitrogen) was used to culture in a 24-well plate (Sumitomo Bakelite). 2×10 6 The cells were seeded at 200 cells / mL. Dynabeads Human T-Activator CD3 / CD28 (Life Technologies) was added and cultured for 48 hours. After incubation, the cells were suspended in FACS buffer and incubated with each of the antibodies h151D-H1L1, h151D-H4L4, and h198D-H3L4. The antibody and control human IgG (human IgG: Eureka Therapeutics) were incubated with APC-labeled anti-CD The plate was then added with antibody 4 (Becton Dickinson) and incubated at 4° C. for 10 minutes. After washing the cells with FACS buffer, FITC-labeled anti-IgG antibody (Jackson ImmunoResearch Laboratories) was used to Tories) and Horizon FVS450 (Becton Dickinson) were added and suspended, and the mixture was further stirred for 15 minutes. It was left standing at ℃. After washing the cells again with FACS buffer, the cells were stained with FoxP3 Staining Buffer Set (Miltenyi Biotec). ) to prepare cells, then PE-labeled anti-Foxp3 antibody (Miltenyi Biotec) was added and incubated at 4°C. The mixture was left at RT for 30 min. After washing the cells, the cells were measured using a flow cytometer (Facs Canto II: Becton Dickinson). The CD4+ cells were then analyzed using FlowJo (Tree Star The data were analyzed by the National Institute of Advanced Industrial Science and Technology (NASDA). As a result, the h151D-H1L1, h151D-H4L4, and h198D-H3L4 antibodies were found to bind to FoxP3-positive Tregs. It was shown that the α-amino acid residues were significantly increased in the α-amino acid residues (Figure 40).

[0243] Example 10: Properties of anti-GARP antibodies 10)-1 ADCC activity h151D-H1L1, h151D-H4L4, and h198D-H3L4, as well as known antibodies (sequences described in Patent Document 1) Human IgG1 anti-GARP antibodies (MHG8 and LHG10) prepared based on sequence information, and the control The ADCC activity of each antibody in the monoclonal antibody human IgG (Sigma) was measured by the method described in Example 4. The h151D-H1L1, h151D-H4L4, and h198D-H3L4 antibodies inhibited L428 cells in an antibody concentration-dependent manner. It exhibited cytolytic activity (FIG. 41A). On the other hand, as described in Example 4, MHG8 and LHG10 were treated with the same method as the control human IgG. No lytic activity was observed (FIG. 41B). From the above, it was found that the h151D-H1L1, h151D-H4L4, and h198D-H3L4 antibodies have ADCC activity. It was shown that.

[0244] 10)-2 Treg function inhibitory activity The Treg function inhibitory activity of each of the antibodies h151D-H1L1, h151D-H4L4, and h198D-H3L4 is described in Example 4. The T values ​​of h151D-H1L1, h151D-H4L4, and h198D-H3L4 at a final concentration of 1 μg / mL were measured by the method described above. reg function inhibitory activity (h151D-H1L1 inhibition rate 81.5%, h151D-H4L4 inhibition rate 80.4%, h198D-H3L4 inhibition rate 70.8%) is shown in Figure 42. The h151D-H1L1, h151D-H4L4, and h198D-H3L4 antibodies have been shown to have Treg function inhibitory activity. It was done.

[0245] 10)-3 Antitumor activity (in vitro) 10)-3-1 Preparation of Cytotoxic T Lymphocytes (CTL) CTL cells with NY-ESO-1 specific T cell receptor (MU28 CD8B35 Clone #7: from Mie University) (obtained) according to the protocol of Mie University, 3 × 10 5 cell / 25 cm 2 Flask (Sumitomo Bakelite The mice were incubated with anti-CD3 antibody (OKT3: Imgenex), IL-2 (Novartis), and feeder cells. In the presence of RPMI1640 medium (Invitrogen) containing 10% human male AB serum (Sigma). The cells were cultured in for 7 days. The feeder cells were prepared by culturing frozen human PBMCs (Cellular Technology) according to the protocol. CD8 positive cells were removed from thawed PBMCs using CD8 MicroBeads (Miltenyi Biotech). CD8-depleted PBMCs (7.5 × 10 6 cell / 25 cm 2 flask), and 103-LCL cells (Rika Obtained from the Bioresource Center of the Institute of Biological Sciences) (1.5 × 10 6 cell / 25 cm 2 Flask) was exposed to X-rays. The specimens were irradiated with X-rays using an X-ray irradiation device (Hitachi Medical Corporation). Treg obtained by the method shown in Example 4)-2-1 was added at the start of the main culture (1.5 × 10 5 cells / 25 cm 2 The inhibitory effect of Treg on CTL cell activity was evaluated by culturing the cells in a 3-cell flask. The obtained Treg (7.5 × 10 4 cell / 25 cm 2 flask), 105F, h151D-H1L1, h151D-H4L4, and h19 8D-H3L4 and human IgG1 (Enzo) antibodies were added (10 μg / ml) at the start of the main culture. The antitumor activity of each antibody was evaluated. After each culture, CD8 + CD8 positive cells were isolated using the T Cell Isolation Kit (Miltenyi Biotech). CTL cells were prepared by purification and isolation and used for activity evaluation.

[0246] 10)-3-2 Preparation of target cells SK-MEL-52 cells, a human melanoma cell line expressing NY-ESO-1 (obtained from Mie University: Proc Natl Acad Sci U S A. 1980 Jul; 77(7): 4260-4) was cultured in RPMI1640 medium containing 10% FBS (Invitro gen) and cultured. 51 Labeling with Cr was performed in the same manner as in Example 4)-1-2. The method was carried out at 2 x 10 4 The cells were adjusted to 100 cells / mL and used as target cells.

[0247] 10)-3-3 51 Cr release assay Target cells were dispensed (50 μL / well) into a 96-well U-bottom microplate (Costar). . Next, the number of CTL cells was 16, 8, 4, and 2 times that of the target cells (CTL cells: target cells = 16:1, 8:1, 4:1 CTL cells were added (100 μL / well) at a ratio of 1:2 (1:1) and incubated for 4 hours at 37°C in 5% CO2. The incubation was carried out at 7°C. Thereafter, the method of Example 4)-1-3 was followed. The inhibitory activity was The results were calculated for each sample provided in each experiment. It has been confirmed that the antibody does not induce cell lysis in cells that do not express the antibody. The measurement results are shown in Figures 43 and 44. The cytolytic activity of CTL cells against SK-MEL-52 was suppressed by Tregs (FIG. 43). On the other hand, in the CTL cells to which the 105F, h151D-H1L1, h151D-H4L4, and h198D-H3L4 antibodies were added, The cytolysis rate against SK-MEL-52 cells increased with an increase in the number of CTL cells, and The effect was clearly higher than the lysis rate at each cell ratio when control IgG was added ( Figure 44). Therefore, the 105F, h151D-H1L1, h151D-H4L4, and h198D-H3L4 antibodies suppressed the Tre of CTL cell activity. It has been shown that it inhibits the suppression by g and enhances antitumor activity.

[0248] 10)-4 Antitumor activity (in vivo) NOD / Shi-scid with L428 cells, IL-2Rγ null By transferring human PBMCs into (NOG) mice It is known that the antitumor effect of a chimeric antibody with ADCC activity can be evaluated by J Immunol. 2009 Oct 1;183(7):4782-91). RPMI1640 medium (Invitrogen) and Matrigel (Becton Dickinson) 1:1 mixture 1x10 7 L428 cells (DSMZ) suspended at 1000 cells / mL were cultured in NOG mice (female, In vivo Science). 0.1 mL of the tumor was implanted subcutaneously in the axilla, and the day of implantation was designated as Day 0. On Day 6, the tumor was divided into groups based on tumor volume. (n=6 per group) and the following administration groups were established:

[0249] PBS control 1: Administered on Days 6, 10, 14, 18, 22, and 26, and administered human PBMC (Lot: 20140707) Administration 105F antibody: 5 mg / kg on Day 6, 10, 14, 18, 22, and 26, and human PBMC (Lot: 20) on Day 6, 14, and 22. 140707) Administration PBS control 2: Administered on Days 6, 10, 14, 18, and 22, and administered human PBMC (Lot: 2015 0924) Administration h151D-H1L1 antibody: 1 mg / kg was administered on Day 6, 10, 14, 18, and 22, and human PBMC (Lot: 20150924) Administration h151D-H4L4 antibody: 1 mg / kg was administered on days 0, 6, 10, 14, 18, and 22, and human PBMC (L ot:20150924) Administration h198D-H3L4 antibody: 1 mg / kg was administered on days 0, 6, 10, 14, 18, and 22, and human PBMC (L ot:20150924) Administration

[0250] Each antibody was diluted with PBS (Invitrogen) and administered (10 mL / kg) via the tail vein. Human PBMCs were prepared by thawing frozen human PBMCs (Cellular Technology) according to the protocol. 1x10 7 The solution was adjusted to 100 cells / mL and 0.2 mL was administered via the tail vein. The long and short diameters of the tumor were measured over time using an electronic digital caliper (Mitsuto Corporation). The tumor volume was measured using a CT scanner (manufactured by Yodobashi Camera) and the tumor volume was calculated using the following formula. Tumor volume (mm3) = 1 / 2 × [tumor long diameter] × [tumor short diameter] × [tumor short diameter] The changes in the mean tumor volume ±standard error (SE) for each group are shown in FIG. The 105F, h151D-H1L1, h151D-H4L4, and h198D-H3L4 antibodies were administered to control mice receiving only PBMCs. The antitumor activity against L428 cells was significantly higher than that of the control group. Difference (105F: t-test, h151D-H1L1, h151D-H4L4, and h198D-H3L4: Dunnett's multiple comparison test) On the last day of measurement for each treatment group (105F: Day 31, h151D-H1L1, h151D-H4L4, and h19 The results of the significance test (P value) for 8D-H3L4: Day 25) are also shown in the figure. Therefore, the 105F, h151D-H1L1, h151D-H4L4, and h198D-H3L4 antibodies were It was also revealed that it exhibited antitumor activity.

[0251] Example 11 Epitope analysis of anti-GARP antibodies The epitopes of the anti-human GARP antibodies (105F, 110F, h151D-H1L1, and h198D-H3L4) are Analyzed by hydrogen exchange mass spectrometry. 7 mg / mL anti-human GARP antibody and 3 mg / mL human GARP (R&D Systems) or blank buffer Equal amounts of these were mixed, and 9 equivalents of light water or heavy water were added to this solution. After overnight, the samples were deuterized by adding an equal volume of 100 mM phosphoric acid, 4 M Gdn HCl, 150 mM TCEP, pH 2.5. The deuterium-substituted sample was injected into the HPLC under cooling, and the immobilized peptide was dissolved in 0.1% TFA solution. The solution was then pumped onto the pucine column. The peptide fragments obtained by digestion of human GARP in a pepsin column were analyzed by C18 tracking. The column was then loaded with 0.1% formic acid and 0.025% TFA in water and acetonitrile. The peptides were eluted with a linear gradient and separated on a C18 analytical column. The peptide fragments were mass analyzed by time-of-flight mass spectrometry. The deuterium substitution rate was calculated from the mass of each peptide, and the deuterium substitution rate was increased by adding anti-human GARP antibody. The peptide fragments showing a marked decrease in conversion rate were identified as epitope fragments. 105F is a deuterium-substituted nucleotide sequence at residues 366-377, 407-445, and 456-470 of human GARP as shown in SEQ ID NO:1. Inhibition of conversion was observed and the epitope was identified. 110F suppresses the deuterium substitution rate at residues 54-112 and 366-392 of human GARP shown in SEQ ID NO:1 was recognized and identified as an epitope. In h151D-H1L1, the deuterium substitution rate was suppressed at residues 352-392 of human GARP shown in SEQ ID NO:1. was recognized and identified as an epitope. In h198D-H3L4, suppression of deuterium substitution rate was observed in residues 18-112 of human GARP shown in SEQ ID NO:1. and identified as an epitope. [Industrial Applicability]

[0252] The anti-GARP antibody of the present invention has antitumor activity due to its Treg function inhibitory activity mediated by ADCC activity. A pharmaceutical composition containing the anti-GARP antibody can be an anticancer agent.

[0253] In addition, the excessive presence and activation of Tregs in patients with malaria and HIV infection may be associated with the progression of these diseases. and that removal of Tregs leads to amelioration of the disease in a mouse disease model. Therefore, effective inhibition of Treg function may be effective in treating intractable infectious diseases such as malaria and HIV. We can expect the following. [Sequence List Free Text]

[0254] SEQ ID NO:1 - Amino acid sequence of GARP SEQ ID NO:2 - Amino acid sequence of the 105F antibody heavy chain SEQ ID NO:3 - Amino acid sequence of the 105F antibody light chain SEQ ID NO:4 - Amino acid sequence of the 110F antibody heavy chain SEQ ID NO:5 - Amino acid sequence of the 110F antibody light chain SEQ ID NO:6 - Nucleotide sequence of the 105F antibody heavy chain SEQ ID NO:7 - Nucleotide sequence of the 105F antibody light chain SEQ ID NO:8 - Nucleotide sequence of the 110F antibody heavy chain SEQ ID NO:9 - Nucleotide sequence of the 110F antibody light chain SEQ ID NO:10 - Primer A SEQ ID NO:11 - Primer B SEQ ID NO:12 - Primer C SEQ ID NO:13 - Primer D SEQ ID NO:14 - Nucleotide sequence of the cDNA encoding the variable region of the heavy chain of 151D SEQ ID NO: 15 - Amino acid sequence of the variable region of the heavy chain of 151D SEQ ID NO:16 - Nucleotide sequence of the cDNA encoding the variable region of the light chain of 151D SEQ ID NO: 17 - Amino acid sequence of the variable region of the light chain of 151D SEQ ID NO:18 - Nucleotide sequence of the cDNA encoding the variable region of the heavy chain of 198D SEQ ID NO: 19 - Amino acid sequence of the variable region of the heavy chain of 198D SEQ ID NO:20 - Nucleotide sequence of the cDNA encoding the variable region of the light chain of 198D SEQ ID NO:21 - Amino acid sequence of the variable region of the light chain of 198D SEQ ID NO:22 - Sequence encoding the amino acid sequence for the human light chain signal sequence and the human kappa chain constant region. Nucleotide sequence of the DNA fragment containing the sequence SEQ ID NO:23 - Sequence encoding the amino acids of the human heavy chain signal sequence and the human IgG1 constant region. Nucleotide sequence of the DNA fragment containing the sequence SEQ ID NO:24 - Nucleotide sequence of the human chimeric antibody c151D heavy chain SEQ ID NO:25 - Amino acid sequence of the human chimeric antibody c151D heavy chain SEQ ID NO:26 - Nucleotide sequence of the human chimeric antibody c151D light chain SEQ ID NO:27 - Amino acid sequence of the human chimeric antibody c151D light chain SEQ ID NO:28 - Nucleotide sequence of the human chimeric antibody c198D heavy chain SEQ ID NO:29 - Amino acid sequence of the human chimeric antibody c198D heavy chain SEQ ID NO:30 - Nucleotide sequence of the human chimeric antibody c198D light chain SEQ ID NO:31 - Amino acid sequence of the human chimeric antibody c198D light chain SEQ ID NO:32 - Nucleotide sequence of humanized antibody h151D-H1 SEQ ID NO:33 - Amino acid sequence of humanized antibody h151D-H1 SEQ ID NO:34 - Nucleotide sequence of humanized antibody h151D-H4 SEQ ID NO:35 - Amino acid sequence of humanized antibody h151D-H4 SEQ ID NO:36 - Nucleotide sequence of humanized antibody h151D-L1 SEQ ID NO:37 - Amino acid sequence of humanized antibody h151D-L1 SEQ ID NO:38 - Nucleotide sequence of humanized antibody h151D-L4 SEQ ID NO:39 - Amino acid sequence of humanized antibody h151D-L4 SEQ ID NO:40 - Nucleotide sequence of humanized antibody h198D-H3 SEQ ID NO: 41 - Amino acid sequence of humanized antibody h198D-H3 SEQ ID NO:42 - Nucleotide sequence of humanized antibody h198D-L4 SEQ ID NO: 43 - Amino acid sequence of humanized antibody h198D-L4 SEQ ID NO:44 - Primer F SEQ ID NO: 45 - primer R SEQUENCE LISTING <110> DAIICHI SANKYO CO. LTD. <120> ANTI-GARP ANTIBODY <130> FP1628 <150> JP2015-187488 <151> 2015-09-24 <160> 45 <170> PatentIn version 3.5 <210> 1 <211> 662 <212> PRT <213> Human <400> 1 Met Arg Pro Gln Ile Leu Leu Leu Leu Ala Leu Leu Thr Leu Gly Leu 1 5 10 15 Ala Ala Gln His Gln Asp Lys Val Pro Cys Lys Met Val Asp Lys Lys 20 25 30 Val Ser Cys Gln Val Leu Gly Leu Leu Gln Val Pro Ser Val Leu Pro 35 40 45 Pro Asp Thr Glu Thr Leu Asp Leu Ser Gly Asn Gln Leu Arg Ser Ile 50 55 60 Leu Ala Ser Pro Leu Gly Phe Tyr Thr Ala Leu Arg His Leu Asp Leu 65 70 75 80 Ser Thr Asn Glu Ile Ser Phe Leu Gln Pro Gly Ala Phe Gln Ala Leu 85 90 95 Thr His Leu Glu His Leu Ser Leu Ala His Asn Arg Leu Ala Met Ala 100 105 110 Thr Ala Leu Ser Ala Gly Gly Leu Gly Pro Leu Pro Arg Val Thr Ser 115 120 125 Leu Asp Leu Ser Gly Asn Ser Leu Tyr Ser Gly Leu Leu Glu Arg Leu 130 135 140 Leu Gly Glu Ala Pro Ser Leu His Thr Leu Ser Leu Ala Glu Asn Ser 145 150 155 160 Leu Thr Arg Leu Thr Arg His Thr Phe Arg Asp Met Pro Ala Leu Glu 165 170 175 Gln Leu Asp Leu His Ser Asn Val Leu Met Asp Ile Glu Asp Gly Ala 180 185 190 Phe Glu Gly Leu Pro Arg Leu Thr His Leu Asn Leu Ser Arg Asn Ser 195 200 205 Leu Thr Cys Ile Ser Asp Phe Ser Leu Gln Gln Leu Arg Val Leu Asp 210 215 220 Leu Ser Cys Asn Ser Ile Glu Ala Phe Gln Thr Ala Ser Gln Pro Gln 225 230 235 240 Ala Glu Phe Gln Leu Thr Trp Leu Asp Leu Arg Glu Asn Lys Leu Leu 245 250 255 His Phe Pro Asp Leu Ala Ala Leu Pro Arg Leu Ile Tyr Leu Asn Leu 260 265 270 Ser Asn Asn Leu Ile Arg Leu Pro Thr Gly Pro Pro Gln Asp Ser Lys 275 280 285 Gly Ile His Ala Pro Ser Glu Gly Trp Ser Ala Leu Pro Leu Ser Ala 290 295 300 Pro Ser Gly Asn Ala Ser Gly Arg Pro Leu Ser Gln Leu Leu Asn Leu 305 310 315 320 Asp Leu Ser Tyr Asn Glu Ile Glu Leu Ile Pro Asp Ser Phe Leu Glu 325 330 335 His Leu Thr Ser Leu Cys Phe Leu Asn Leu Ser Arg Asn Cys Leu Arg 340 345 350 Thr Phe Glu Ala Arg Arg Leu Gly Ser Leu Pro Cys Leu Met Leu Leu 355 360 365 Asp Leu Ser His Asn Ala Leu Glu Thr Leu Glu Leu Gly Ala Arg Ala 370 375 380 Leu Gly Ser Leu Arg Thr Leu Leu Leu Gln Gly Asn Ala Leu Arg Asp 385 390 395 400 Leu Pro Pro Tyr Thr Phe Ala Asn Leu Ala Ser Leu Gln Arg Leu Asn 405 410 415 Leu Gln Gly Asn Arg Val Ser Pro Cys Gly Gly Pro Asp Glu Pro Gly 420 425 430 Pro Ser Gly Cys Val Ala Phe Ser Gly Ile Thr Ser Leu Arg Ser Leu 435 440 445 Ser Leu Val Asp Asn Glu Ile Glu Leu Leu Arg Ala Gly Ala Phe Leu 450 455 460 His Thr Pro Leu Thr Glu Leu Asp Leu Ser Ser Asn Pro Gly Leu Glu 465 470 475 480 Val Ala Thr Gly Ala Leu Gly Gly Leu Glu Ala Ser Leu Glu Val Leu 485 490 495 Ala Leu Gln Gly Asn Gly Leu Met Val Leu Gln Val Asp Leu Pro Cys 500 505 510 Phe Ile Cys Leu Lys Arg Leu Asn Leu Ala Glu Asn Arg Leu Ser His 515 520 525 Leu Pro Ala Trp Thr Gln Ala Val Ser Leu Glu Val Leu Asp Leu Arg 530 535 540 Asn Asn Ser Phe Ser Leu Leu Pro Gly Ser Ala Met Gly Gly Leu Glu 545 550 555 560 Thr Ser Leu Arg Arg Leu Tyr Leu Gln Gly Asn Pro Leu Ser Cys Cys 565 570 575 Gly Asn Gly Trp Leu Ala Ala Gln Leu His Gln Gly Arg Val Asp Val 580 585 590 Asp Ala Thr Gln Asp Leu Ile Cys Arg Phe Ser Ser Gln Glu Glu Val 595 600 605 Ser Leu Ser His Val Arg Pro Glu Asp Cys Glu Lys Gly Gly Leu Lys 610 615 620 Asn Ile Asn Leu Ile Ile Ile Leu Thr Phe Ile Leu Val Ser Ala Ile 625 630 635 640 Leu Leu Thr Thr Leu Ala Ala Cys Cys Cys Val Arg Arg Gln Lys Phe 645 650 655 Asn Gln Gln Tyr Lys Ala 660 <210> 2 <211> 448 <212> PRT <213> Human <400> 2 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Tyr Met Ser Trp Ile Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Val Ser Trp Asn Gly Ser Arg Thr His Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Gln Arg Gln Leu Ala Glu Phe Asp Tyr Trp Gly Gln Gly Thr 100 105 110 Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro 115 120 125 Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly 130 135 140 Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn 145 150 155 160 Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln 165 170 175 Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser 180 185 190 Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser 195 200 205 Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Asp Lys Thr 210 215 220 His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser 225 230 235 240 Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg 245 250 255 Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro 260 265 270 Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala 275 280 285 Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val 290 295 300 Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr 305 310 315 320 Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr 325 330 335 Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu 340 345 350 Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys 355 360 365 Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser 370 375 380 Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp 385 390 395 400 Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser 405 410 415 Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala 420 425 430 Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 435 440 445 <210> 3 <211> 217 <212> PRT <213> Human <400> 3 Gln Ser Val Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln 1 5 10 15 Arg Val Thr Ile Ser Cys Thr Gly Ser Ser Ser Asn Ile Gly Ala Gly 20 25 30 Tyr Val Val His Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu 35 40 45 Leu Ile Tyr Ala Asp Thr Asn Arg Pro Ser Gly Val Pro Asp Arg Phe 50 55 60 Ser Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu 65 70 75 80 Arg Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Ser Ser 85 90 95 Leu Arg Gly Trp Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly 100 105 110 Gln Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser Glu 115 120 125 Glu Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Phe 130 135 140 Tyr Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro Val 145 150 155 160 Lys Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn Lys 165 170 175 Tyr Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys Ser 180 185 190 His Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val Glu 195 200 205 Lys Thr Val Ala Pro Thr Glu Cys Ser 210 215 <210> 4 <211> 453 <212> PRT <213> Human <400> 4 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ala Gly Ile Ser Trp Asn Ser Ala Ile Thr Val Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Asp Ala Gly Gly Arg Tyr Ser Gly Ser Tyr Tyr Phe Asp Tyr 100 105 110 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly 115 120 125 Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly 130 135 140 Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val 145 150 155 160 Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe 165 170 175 Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val 180 185 190 Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val 195 200 205 Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys 210 215 220 Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu 225 230 235 240 Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 245 250 255 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 260 265 270 Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val 275 280 285 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser 290 295 300 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 305 310 315 320 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala 325 330 335 Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 340 345 350 Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln 355 360 365 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 370 375 380 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 385 390 395 400 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu 405 410 415 Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser 420 425 430 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 435 440 445 Leu Ser Pro Gly Lys 450 <210> 5 <211> 216 <212> PRT <213> Human <400> 5 Gln Ser Val Leu Thr Gln Pro Pro Ser Ala Ser Gly Thr Pro Gly Gln 1 5 10 15 Arg Val Thr Ile Ser Cys Thr Gly Ser Ser Ser Asn Ile Gly Ala Gly 20 25 30 Tyr Asp Val His Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Lys Leu 35 40 45 Leu Ile Tyr Gly Asn Ser Asn Arg Pro Ser Gly Val Pro Asp Arg Phe 50 55 60 Ser Gly Ser Lys Ser Gly Thr Ser Ala Ser Leu Ala Ile Ser Gly Leu 65 70 75 80 Arg Ser Glu Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Tyr Asp Arg Ser 85 90 95 Leu Asn Trp Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu Gly Gln 100 105 110 Pro Lys Ala Ala Pro Ser Val Thr Leu Phe Pro Pro Ser Ser Glu Glu 115 120 125 Leu Gln Ala Asn Lys Ala Thr Leu Val Cys Leu Ile Ser Asp Phe Tyr 130 135 140 Pro Gly Ala Val Thr Val Ala Trp Lys Ala Asp Ser Ser Pro Val Lys 145 150 155 160 Ala Gly Val Glu Thr Thr Thr Pro Ser Lys Gln Ser Asn Asn Lys Tyr 165 170 175 Ala Ala Ser Ser Tyr Leu Ser Leu Thr Pro Glu Gln Trp Lys Ser His 180 185 190 Arg Ser Tyr Ser Cys Gln Val Thr His Glu Gly Ser Thr Val Glu Lys 195 200 205 Thr Val Ala Pro Thr Glu Cys Ser 210 215 <210> 6 <211> 1344 <212> DNA <213> Human <400> 6 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt gactactaca tgagctggat ccgccaggct 120 ccaggcaagg ggctggagtg ggtatcgggt gttagttgga atggcagtag gacgcactat 180 gcagactctg tgaagggccg attcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgag agccgaggac actgccgtgt attactgtgc cagacagagg 300 cagctggctg aatttgacta ctggggccaa ggtaccctgg tcaccgtgag ctcagcctcc 360 accaagggcc caagcgtctt ccccctggca ccctcctcca agagcacctc tggcggcaca 420 gccgccctgg gctgcctggt caaggactac ttccccgaac ccgtgaccgt gagctggaac 480 tcaggcgccc tgaccagcgg cgtgcacacc ttccccgctg tcctgcagtc ctcaggactc 540 tactccctca gcagcgtggt gaccgtgccc tccagcagct tgggcaccca gacctacatc 600 tgcaacgtga atcacaagcc cagcaacacc aaggtggaca agagagttga gcccaaatct 660 tgtgacaaaa ctcacacatg cccaccctgc ccagcacctg aactcctggg gggaccctca 720 gtttctctct tccccccaaa acccaaggac accctcatga tctcccggac ccctgaggtc 780 acatgcgtgg tggtggacgt gagccacgaa gaccctgagg tcaagttcaa ctggtacgtg 840 gacggcgtgg aggtgcataa tgccaagaca aagccccggg aggagcagta caacagcacg 900 taccgggtgg tcagcgtcct caccgtcctg caccaggact ggctgaatgg caaggagtac 960 aagtgcaagg tctccaacaa agccctccca gcccccatcg agaaaaccat ctccaaagcc 1020 aaaggccagc cccgggaacc acaggtgtac accctgcccc catcccgggga ggagatgacc 1080 aagaaccagg tcagcctgac ctgcctggtc aaaggcttct atcccagcga catcgccgtg 1140 gagtgggaga gcaatggcca gccgagaac aactacaaga ccacccctcc cgtgctggac 1200 tccgacggct ccttcttcct ctacagcaag ctcaccgtgg acaagagcag gtggcagcag 1260 ggcaacgtct tctcatgctc cgtgatgcat gaggctctgc acaaccacta cacccagaag 1320 agcctctccc tgtctcccgg caaa 1344 <210> 7 <211> 651 <212> DNA <213> Human <400> 7 cagtctgtgc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcctgcactg ggagcagctc caacattggg gcgggttatg ttgtacattg gtatcagcag 120 ctcccaggaa cggcccccaa actcctcatc tatgctgaca ccaatcggcc ctcaggggtc 180 cctgaccgat tctctggctc caagtctggc acctcagcct ccctggccat cagtgggctc 240 cggtccgagg atgaggctga ttattactgc cagtcctatg acagcagcct gagaggttgg 300 gtgttcggcg gaggaaccaa gctgacggtc ctaggtcagc ctaaggctgc ccctagcgtg 360 accctgttcc ctccttccag cgaggagctt caagctaaca aggccaccct ggtgtgtctt 420 atctctgact tctaccctgg cgctgtgacc gtggcctgga aggctgacag ctcccctgtg 480 aaggccggag tggagaccac cacacctagc aagcagtcta acaacaagta cgctgccagc 540 tcctacctga gccttacccc tgagcagtgg aagtctcaca gaagctactc ctgtcaagtg 600 acccacgagg gcagcaccgt ggagaagacc gtggctccta ccgagtgttc c 651 <210> 8 <211> 1359 <212> DNA <213> Human <400> 8 gaggtgcagc tgttggagtc tgggggaggc ttggtacagc ctggggggtc cctgagactc 60 tcctgtgcag cctctggatt caccttcagt agctatggca tgcactgggt ccgccaggct 120 ccaggcaagg ggctggagtg ggtcgccgga attagttgga acagtgccat cacagtctat 180 gcggactctg tgaagggccg gttcaccatc tccagagaca attccaagaa cacgctgtat 240 ctgcaaatga acagcctgag agccgaggac actgccgtgt attactgtgc aaaagatgcc 300 gggggccggt atagtgggag ctactacttt gactactggg gccaaggtac cctggtcacc 360 gtgagctcag cctccaccaa gggcccaagc gtcttccccc tggcaccctc ctccaagagc 420 acctctggcg gcacagccgc cctgggctgc ctggtcaagg actacttccc cgaacccgtg 480 accgtgagct ggaactcagg cgccctgacc agcggcgtgc acaccttccc cgctgtcctg 540 cagtcctcag gactctactc cctcagcagc gtggtgaccg tgccctccag cagcttgggc 600 acccagacct acatctgcaa cgtgaatcac aagcccagca acaccaaggt ggacaagaga 660 gttgagccca aatcttgtga caaaactcac acatgcccac cctgcccagc acctgaactc 720 ctggggggac cctcagtctt cctcttcccc ccaaaaccca aggacaccct catgatctcc 780 cggacccctg aggtcacatg cgtggtggtg gacgtgagcc acgaagaccc tgaggtcaag 840 ttcaactggt acgtggacgg cgtggaggtg cataatgcca agacaaagcc ccgggaggag 900 cagtacaaca gcacgtaccg ggtggtcagc gtcctcaccg tcctgcacca ggactggctg 960 aatggcaagg agtacaagtg caaggtctcc aacaaagccc tcccagcccc catcgagaaa 1020 accatctcca aagccaaagg ccagccccgg gaaccacagg tgtacaccct gcccccatcc 1080 cgggaggaga tgaccaagaa ccaggtcagc ctgacctgcc tggtcaaagg cttctatccc 1140 agcgacatcg ccgtggagtg ggagagcaat ggccagcccg agaacaacta caagaccacc 1200 cctcccgtgc tggactccga cggctccttc ttcctctaca gcaagctcac cgtggacaag 1260 agcaggtggc agcagggcaa cgtcttctca tgctccgtga tgcatgaggc tctgcacaac 1320 cactacaccc agaagagcct ctccctgtct cccggcaaa 1359 <210> 9 <211> 648 <212> DNA <213> Human <400> 9 cagtctgtgc tgactcagcc accctcagcg tctgggaccc ccgggcagag ggtcaccatc 60 tcctgcactg ggagcagctc caacatcggg gcaggttatg atgtacactg gtatcagcag 120 ctcccaggaa cggcccccaa actcctcatc tatggtaaca gcaatcggcc ctcaggggtc 180 cctgaccgat tctctggctc caagtctggc acctcagcct ccctggccat cagtgggctc 240 cggtccgagg atgaggctga ttattactgc cagtcctatg acagaagcct gaattgggtg 300 ttcggcggag gaaccaagct gacggtccta ggtcagccta aggctgcccc tagcgtgacc 360 ctgttccctc cttccagcga ggagcttcaa gctaacaagg ccaccctggt gtgtcttatc 420 tctgacttct accctggcgc tgtgaccgtg gcctggaagg ctgacagctc ccctgtgaag 480 gccggagtgg agaccaccac acctagcaag cagtctaaca acaagtacgc tgccagctcc 540 tacctgagcc ttacccctga gcagtggaag tctcacagaa gctactcctg tcaagtgacc 600 cacgagggca gcaccgtgga gaagaccgtg gctcctaccg agtgttcc 648 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer A <400> 10 gaaacagcta tgaaatacct attg 24 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Primer B <400> 11 gcctgagcag tggaagtcc 19 <210> 12 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primer C <400> 12 taggtatttc attatgactg tctc 24 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Primer D <400> 13 cccagtcacg acgttgtaaa acg 23 <210> 14 <211> 351 <212> DNA <213> Rat <400> 14 gaggtgcagc tggtggagtc tgggggaggc ttagtgcagc ctggaaggtc caagaaactc 60 tcctgttcag cctcaggatt cactttcagt aactattaca tggcctgggt ccgccaggct 120 ccaacgcagg gtctggagtg ggtcgcatcc attggtactg ttggtggtaa cacttactat 180 cgagactccg tgaagggccg attcactatc tccagagatg atgcaaaaag caccctatac 240 ctgcaaatgg acagtctgag gtctgaggac acggccactt attactgtgc aagagaggat 300 tacggagggt ttccccactg gggccaagga gtcatggtca cagtctcctc a 351 <210> 15 <211> 117 <212> PRT <213> Rat <400> 15 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Arg 1 5 10 15 Ser Lys Lys Leu Ser Cys Ser Ala Ser Gly Phe Thr Phe Ser Asn Tyr 20 25 30 Tyr Met Ala Trp Val Arg Gln Ala Pro Thr Gln Gly Leu Glu Trp Val 35 40 45 Ala Ser Ile Gly Thr Val Gly Gly Asn Thr Tyr Tyr Arg Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ala Lys Ser Thr Leu Tyr 65 70 75 80 Leu Gln Met Asp Ser Leu Arg Ser Glu Asp Thr Ala Thr Tyr Tyr Cys 85 90 95 Ala Arg Glu Asp Tyr Gly Gly Phe Pro His Trp Gly Gln Gly Val Met 100 105 110 Val Thr Val Create Create 115 <210> 16 <211> 327 <212> DNA <213> Rat <400> 16 aatattgtga tgactcagtc tcccacatcc atgttcatat cagtcggaga cagggtcacc 60 atgaactgta aggccagtca gaatgtggga actaatgtag actggtacca gcagaaaaca 120 gggcagtctc ctaaactgct tatctatggg gcgtccaacc gctacactgg agtccctgat 180 cgcttcacag gcagtggatc tggaacagat ttcactctca ccatcagcaa catgcaggct 240 gaagacctgg ctgtttatga ctgtctacag tataagtaca atccatacac gtttggaact 300 gggaccaagc tggaactgaa ccgggct 327 <210> 17 <211> 109 <212> PRT <213> Rat <400> 17 Asn Ile Val Met Thr Gln Ser Pro Thr Ser Met Phe Ile Ser Val Gly 1 5 10 15 Asp Arg Val Thr Met Asn Cys Lys Ala Ser Gln Asn Val Gly Thr Asn 20 25 30 Val Asp Trp Tyr Gln Gln Lys Thr Gly Gln Ser Pro Lys Leu Leu Ile 35 40 45 Tyr Gly Ala Ser Asn Arg Tyr Thr Gly Val Pro Asp Arg Phe Thr Gly 50 55 60 Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Asn Met Gln Ala 65 70 75 80 Glu Asp Leu Ala Val Tyr Asp Cys Leu Gln Tyr Lys Tyr Asn Pro Tyr 85 90 95 Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Asn Arg Ala 100 105 <210> 18 <211> 360 <212> DNA <213> Rat <400> 18 caggtgcagc tgagggagtc aggacctggt ctggtgcagc cctcacagac cctgtccctc 60 acctgcactg tctctgggtt ctcactaacc agctttcatg tagactgggt tcgccagcct 120 ccagagaagg gtctggagtg gattgcaaca atttcaagtg gtggaggtac atattataat 180 tcagctctca aatcccgact gagcatcagc agggacacct ccaagagcca agttttctta 240 aagatgagca ctctgcaaac tgaagacaca gccatgtact tctgtgcccg gatttcgggc 300 tggggccatt actatgttat ggatgtctgg ggtcaaggag cttcagtcac tgtctcctca 360 <210> 19 <211> 120 <212> PRT <213> Rat <400> 19 Gln Val Gln Leu Arg Glu Ser Gly Pro Gly Leu Val Gln Pro Ser Gln 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Thr Ser Phe 20 25 30 His Val Ser Trp Val Arg Gln Pro Pro Glu Lys Gly Leu Glu Trp Ile 35 40 45 Ala Thr Ile Ser Ser Gly Gly Gly Thr Tyr Tyr Asn Ser Ala Leu Lys 50 55 60 Ser Arg Leu Ser Ile Ser Arg Asp Thr Ser Lys Ser Gln Val Phe Leu 65 70 75 80 Lys Met Ser Thr Leu Gln Thr Glu Asp Thr Ala Met Tyr Phe Cys Ala 85 90 95 Arg Ile Ser Gly Trp Gly His Tyr Tyr Val Met Asp Val Trp Gly Gln 100 105 110 Gly Ala Ser Val Thr Val Ser Ser 115 120 <210> 20 <211> 327 <212> DNA <213> Rat <400> 20 gacatccaga tgacacagtc tccagcttcc ctgtctggat ctctgggaga aactgtcacc 60 atccaatgtc aagcaagtga ggacatttac agtggtttag cgtggtatca gcagaagcca 120 gggaaatctc ctcagctcct gatctatggt gcaggtagct tacaagacgg cgtcccatca 180 cgattcagtg gcggtggatc tggcacacat tattctctca agatcagcag catgcaaact 240 gaagatgaag gggtttattt ctgtcaacag ggtttaaagt ttccgctcac gttcggttct 300 gggaccaagc tggagatcaa acgggct 327 <210> 21 <211> 109 <212> PRT <213> Rat <400> 21 Asp Ile Gln Met Thr Gln Ser Pro Ala Ser Leu Ser Gly Ser Leu Gly 1 5 10 15 Glu Thr Val Thr Ile Gln Cys Gln Ala Ser Glu Asp Ile Tyr Ser Gly 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ser Pro Gln Leu Leu Ile 35 40 45 Tyr Gly Ala Gly Ser Leu Gln Asp Gly Val Pro Ser Arg Phe Ser Gly 50 55 60 <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Gly Gly Ser Gly Thr His Tyr Ser Leu Lys Ile Ser Ser Met Gln Thr<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 65 70 75 80<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Glu Asp Glu Gly Val Tyr Phe Cys Gln Gln Gly Leu Lys Phe Pro Leu<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 85 90 95<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys Arg Ala<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 100 105<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <210> 22<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <211> 449<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <212> DNA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <213> Human<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <400> 22<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gcctccggac tctagagcca ccatggtgct gcagacccag gtgttcatct ccctgctgct 60<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gtggatctcc ggcgcgtacg gcgatatcgt gatgattaaa cgtacggtgg ccgccccctc 120<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> cgtgttcatc ttccccccct ccgacgagca gctgaagtcc ggcaccgcct ccgtggtgtg 180<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> cctgctgaat aacttctacc ccagagaggc caaggtgcag tggaaggtgg acaacgccct 240<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gcagtccggg aactcccagg agagcgtgac cgagcaggac agcaaggaca gcacctacag 300<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> cctgagcagc accctgaccc tgagcaaagc cgactacgag aagcacaagg tgtacgcctg 360 cgaggtgacc caccagggcc tgagctcccc cgtcaccaag agcttcaaca ggggggagtg 420 ttaggggccc gtttaaacgg gggaggcta 449 <210> 23 <211> 1132 <212> DNA <213> Human <400> 23 gcctccggac tctagagcca ccatgaaaca cctgtggttc ttcctcctgc tggtggcagc 60 tcccagatgg gtgctgagcc aggtgcaatt gtgcaggcgg ttagctcagc ctccaccaag 120 ggcccaagcg tcttccccct ggcaccctcc tccaagagca cctctggcgg cacagccgcc 180 ctgggctgcc tggtcaagga ctacttcccc gaacccgtga ccgtgagctg gaactcaggc 240 gccctgacca gcggcgtgca caccttcccc gctgtcctgc agtcctcagg actctactcc 300 ctcagcagcg tggtgaccgt gccctccagc agcttgggca cccagaccta catctgcaac 360 gtgaatcaca agcccagcaa caccaaggtg gacaagagag ttgagcccaa atcttgtgac 420 aaaactcaca catgcccacc ctgcccagca cctgaactcc tggggggacc ctcagtcttc 480 ctcttccccc caaaacccaa ggacaccctc atgatctccc ggacccctga ggtcacatgc 540 gtggtggtgg acgtgagcca cgaagaccct gaggtcaagt tcaactggta cgtggacggc 600 gtggaggtgc ataatgccaa gacaaagccc cgggaggagc agtacaacag cacgtaccgg 660 gtggtcagcg tcctcaccgt cctgcaccag gactggctga atggcaagga gtacaagtgc 720 aaggtctcca acaaagccct cccagccccc atcgagaaaa ccatctccaa agccaaaggc 780 cagccccggg aaccacaggt gtacaccctg cccccatccc gggaggagat gaccaagaac 840 caggtcagcc tgacctgcct ggtcaaaggc ttctatccca gcgacatcgc cgtggagtgg 900 gagagcaatg gccagcccga gaacaactac aagaccaccc ctcccgtgct ggactccgac 960 ggctccttct tcctctacag caagctcacc gtggacaaga gcaggtggca gcagggcaac 1020 gtcttctcat gctccgtgat gcatgaggct ctgcacaacc actacaccca gaagagcctc 1080 tccctgtctc ccggcaaatg agatatcggg cccgtttaaa cggggggc ta 1132 <210> 24 <211> 1398 <212> DNA <213> Artificial Sequence <220> <223> Chimeric Antibody <400> 24 atgaaacacc tgtggttctt cctcctgctg gtggcagctc ccagatgggt gctgagcgag 60 gtgcagctgg tggagtctgg gggaggctta gtgcagcctg gaaggtccaa gaaactctcc 120 tgttcagcct caggattcac tttcagtaac tattacatgg cctgggtccg ccaggctcca 180 acgcagggtc tggagtgggt cgcatccatt ggtactgttg gtggtaacac ttactatcga 240 gactccgtga agggccgatt cactatctcc agagatgatg caaaaagcac cctatacctg 300 caaatggaca gtctgaggtc tgaggacacg gccacttatt actgtgcaag agaggattac 360 ggagggtttc cccactgggg ccaaggagtc atggtcacag tcagctcagc ctccaccaag 420 ggcccaagcg tcttccccct ggcaccctcc tccaagagca cctctggcgg cacagccgcc 480 ctgggctgcc tggtcaagga ctacttcccc gaacccgtga ccgtgagctg gaactcaggc 540 gccctgacca gcggcgtgca caccttcccc gctgtcctgc agtcctcagg actctactcc 600 ctcagcagcg tggtgaccgt gccctccagc agcttgggca cccagaccta catctgcaac 660 gtgaatcaca agcccagcaa caccaaggtg gacaagagag ttgagcccaa atcttgtgac 720 aaaactcaca catgcccacc ctgcccagca cctgaactcc tggggggacc ctcagtcttc 780 ctcttccccc caaaacccaa ggacaccctc atgatctccc ggacccctga ggtcacatgc 840 gtggtggtgg acgtgagcca cgaagaccct gaggtcaagt tcaactggta cgtggacggc 900 gtggaggtgc ataatgccaa gacaaagccc cgggaggagc agtacaacag cacgtaccgg 960 gtggtcagcg tcctcaccgt cctgcaccag gactggctga atggcaagga gtacaagtgc 1020 aaggtctcca acaaagccct cccagccccc atcgagaaaa ccatctccaa agccaaaggc 1080 cagccccggg aaccacaggt gtacaccctg cccccatccc gggaggagat gaccaagaac 1140 caggtcagcc tgacctgcct ggtcaaaggc ttctatccca gcgacatcgc cgtggagtgg 1200 gagagcaatg gccagcccga gaacaactac aagaccaccc ctcccgtgct ggactccgac 1260 ggctccttct tcctctacag caagctcacc gtggacaaga gcaggtggca gcagggcaac 1320 gtcttctcat gctccgtgat gcatgaggct ctgcacaacc actacaccca gaagagcctc 1380 tccctgtctc ccggcaaa 1398 <210> 25 <211> 466 <212> PRT <213> Artificial Sequence <220> <223> Chimeric Antibody <400> 25 Met Lys His Leu Trp Phe Phe Leu Leu Leu Val Ala Ala Pro Arg Trp 1 5 10 15 Val Leu Ser Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 20 25 30 Pro Gly Arg Ser Lys Lys Leu Ser Cys Ser Ala Ser Gly Phe Thr Phe 35 40 45 Ser Asn Tyr Tyr Met Ala Trp Val Arg Gln Ala Pro Thr Gln Gly Leu 50 55 60 Glu Trp Val Ala Ser Ile Gly Thr Val Gly Gly Asn Thr Tyr Tyr Arg 65 70 75 80 Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ala Lys Ser 85 90 95 Thr Leu Tyr Leu Gln Met Asp Ser Leu Arg Ser Glu Asp Thr Ala Thr 100 105 110 Tyr Tyr Cys Ala Arg Glu Asp Tyr Gly Gly Phe Pro His Trp Gly Gln 115 120 125 Gly Val Met Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val 130 135 140 Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala 145 150 155 160 Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser 165 170 175 Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val 180 185 190 Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 195 200 205 Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 210 215 220 Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Asp 225 230 235 240 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly 245 250 255 Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile 260 265 270 Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu 275 280 285 Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His 290 295 300 Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg 305 310 315 320 Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 325 330 335 Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu 340 345 350 Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr 355 360 365 Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu 370 375 380 Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp 385 390 395 400 Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val 405 410 415 Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 420 425 430 Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His 435 440 445 Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 450 455 460 Gly Lys 465 <210> 26 <211> 702 <212> DNA <213> Artificial Sequence <220> <223> Chimeric Antibody <400> 26 atggtgctgc agacccaggt gttcatctcc ctgctgctgt ggatctccgg cgcgtacggc 60 aatattgtga tgactcagtc tcccacatcc atgttcatat cagtcggaga cagggtcacc 120 atgaactgta aggccagtca gaatgtggga actaatgtag actggtacca gcagaaaaca 180 gggcagtctc ctaaactgct tatctatggg gcgtccaacc gctacactgg agtccctgat 240 cgcttcacag gcagtggatc tggaacagat ttcactctca ccatcagcaa catgcaggct 300 gaagacctgg ctgtttatga ctgtctacag tataagtaca atccatacac gtttggaact 360 gggaccaagc tggaactgaa ccgggctgtg gccgccccct ccgtgttcat cttccccccc 420 tccgacgagc agctgaagtc cggcaccgcc tccgtggtgt gcctgctgaa taacttctac 480 cccagagagg ccaaggtgca gtggaaggtg gacaacgccc tgcagtccgg gaactcccag 540 gagagcgtga ccgagcagga cagcaaggac agcacctaca gcctgagcag caccctgacc 600 ctgagcaaag ccgactacga gaagcacaag gtgtacgcct gcgaggtgac ccaccagggc 660 ctgagctccc ccgtcaccaa gagcttcaac aggggggagt gt 702 <210> 27 <211> 234 <212> PRT <213> Artificial Sequence <220> <223> Chimeric Antibody <400> 27 Met Val Leu Gln Thr Gln Val Phe Ile Ser Leu Leu Leu Trp Ile Ser 1 5 10 15 Gly Ala Tyr Gly Asn Ile Val Met Thr Gln Ser Pro Thr Ser Met Phe 20 25 30 Ile Ser Val Gly Asp Arg Val Thr Met Asn Cys Lys Ala Ser Gln Asn 35 40 45 Val Gly Thr Asn Val Asp Trp Tyr Gln Gln Lys Thr Gly Gln Ser Pro 50 55 60 Lys Leu Leu Ile Tyr Gly Ala Ser Asn Arg Tyr Thr Gly Val Pro Asp 65 70 75 80 Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser 85 90 95 Asn Met Gln Ala Glu Asp Leu Ala Val Tyr Asp Cys Leu Gln Tyr Lys 100 105 110 Tyr Asn Pro Tyr Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Asn Arg 115 120 125 Ala Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln 130 135 140 Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr 145 150 155 160 Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser 165 170 175 Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr 180 185 190 Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys 195 200 205 His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro 210 215 220 Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 <210> 28 <211> 1407 <212> DNA <213> Artificial Sequence <220> <223> Chimeric Antibody <400> 28 atgaaacacc tgtggttctt cctcctgctg gtggcagctc ccagatgggt gctgagccag 60 gtgcagctga gggagtcagg acctggtctg gtgcagccct cacagaccct gtccctcacc 120 tgcactgtct ctgggttctc actaaccagc tttcatgtaa gctgggttcg ccagcctcca 180 gagaagggtc tggagtggat tgcaacaatt tcaagtggtg gaggtacata ttataattca 240 gctctcaaat cccgactgag catcagcagg gacacctcca agagccaagt tttcttaaag 300 atgagcactc tgcaaactga agacacagcc atgtacttct gtgcccggat ttcgggctgg 360 ggccattact atgttatgga tgtctggggt caaggagctt cagtcactgt cagctcagcc 420 tccaccaagg gcccaagcgt cttccccctg gcaccctcct ccaagagcac ctctggcggc 480 acagccgccc tgggctgcct ggtcaaggac tacttccccg aacccgtgac cgtgagctgg 540 aactcaggcg ccctgaccag cggcgtgcac accttccccg ctgtcctgca gtcctcagga 600 ctctactccc tcagcagcgt ggtgaccgtg ccctccagca gcttgggcac ccagacctac 660 atctgcaacg tgaatcacaa gcccagcaac accaaggtgg acaagagagt tgagcccaaa 720 tcttgtgaca aaactcacac atgcccaccc tgcccagcac ctgaactcct ggggggaccc 780 tcagtcttcc tcttcccccc aaaacccaag gacaccctca tgatctcccg gacccctgag 840 gtcacatgcg tggtggtgga cgtgagccac gaagaccctg aggtcaagtt caactggtac 900 gtggacggcg tggaggtgca taatgccaag acaaagcccc gggaggagca gtacaacagc 960 acgtaccggg tggtcagcgt cctcaccgtc ctgcaccagg actggctgaa tggcaaggag 1020 tacaagtgca aggtccaa caaagccctc ccagccccca tcgagaaaac catctccaaa 1080 gccaaaggcc agccccggga accacaggtg tacaccctgc ccccatcccg ggaggagatg 1140 accaagaacc aggtcagcct gacctgcctg gtcaaaggct tctatcccag cgacatcgcc 1200 gtggagtggg agagcaatgg ccagcccgag aacaactaca agaccacccc tccctgctg 1260 gactccgacg gctccttctt cctctacagc aagctcaccg tggacaagag caggtggcag 1320 cagggcaacg tcttctcatg ctccgtgatg catgaggctc tgcacaacca ctacacccag 1380 aagagcctct ccctgtctcc cggcaaa 1407 <210> 29 <211> 469 <212> PRT <213> Artificial Sequence <220> <223> Chimeric Antibody <400> 29 Met Lys His Leu Trp Phe Phe Leu Leu Leu Val Ala Ala Pro Arg Trp 1 5 10 15 Val Leu Ser Gln Val Gln Leu Arg Glu Ser Gly Pro Gly Leu Val Gln 20 25 30 Pro Ser Gln Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Phe Ser Leu 35 40 45 Thr Ser Phe His Val Ser Trp Val Arg Gln Pro Pro Glu Lys Gly Leu 50 55 60 Glu Trp Ile Ala Thr Ile Ser Ser Gly Gly Gly Thr Tyr Tyr Asn Ser 65 70 75 80 Ala Leu Lys Ser Arg Leu Ser Ile Ser Arg Asp Thr Ser Lys Ser Gln 85 90 95 Val Phe Leu Lys Met Ser Thr Leu Gln Thr Glu Asp Thr Ala Met Tyr 100 105 110 Phe Cys Ala Arg Ile Ser Gly Trp Gly His Tyr Tyr Val Met Asp Val 115 120 125 Trp Gly Gln Gly Ala Ser Val Thr Val Ser Ser Ala Ser Thr Lys Gly 130 135 140 Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly 145 150 155 160 Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val 165 170 175 Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe 180 185 190 Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val 195 200 205 Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val 210 215 220 Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys 225 230 235 240 Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu 245 250 255 Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 260 265 270 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 275 280 285 Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val 290 295 300 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser 305 310 315 320 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 325 330 335 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala 340 345 350 Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 355 360 365 Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln 370 375 380 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 385 390 395 400 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 405 410 415 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu 420 425 430 Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser 435 440 445 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 450 455 460 Leu Ser Pro Gly Lys 465 <210> 30 <211> 702 <212> DNA <213> Artificial Sequence <220> <223> Chimeric Antibody <400> 30 atggtgctgc agacccaggt gttcatctcc ctgctgctgt ggatctccgg cgcgtacggc 60 gacatccaga tgacacagtc tccagcttcc ctgtctggat ctctgggaga aactgtcacc 120 atccaatgtc aagcaagtga ggacatttac agtggtttag cgtggtatca gcagaagcca 180 gggaaatctc ctcagctcct gatctatggt gcaggtagct tacaagacgg cgtcccatca 240 cgattcagtg gcggtggatc tggcacacat tattctctca agatcagcag catgcaaact 300 gaagatgaag gggtttattt ctgtcaacag ggtttaaagt ttccgctcac gttcggttct 360 gggaccaagc tggagatcaa acgggctgtg gccgccccct ccgtgttcat cttccccccc 420 tccgacgagc agctgaagtc cggcaccgcc tccgtggtgt gcctgctgaa taacttctac 480 cccagagagg ccaaggtgca gtggaaggtg gacaacgccc tgcagtccgg gaactcccag 540 gagagcgtga ccgagcagga cagcaaggac agcacctaca gcctgagcag caccctgacc 600 ctgagcaaag ccgactacga gaagcacaag gtgtacgcct gcgaggtgac ccaccagggc 660 ctgagctccc ccgtcaccaa gagcttcaac aggggggagt gt 702 <210> 31 <211> 234 <212> PRT <213> Artificial Sequence <220> <223> Chimeric Antibody <400> 31 Met Val Leu Gln Thr Gln Val Phe Ile Ser Leu Leu Leu Trp Ile Ser 1 5 10 15 Gly Ala Tyr Gly Asp Ile Gln Met Thr Gln Ser Pro Ala Ser Leu Ser 20 25 30 Gly Ser Leu Gly Glu Thr Val Thr Ile Gln Cys Gln Ala Ser Glu Asp 35 40 45 Ile Tyr Ser Gly Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ser Pro 50 55 60 Gln Leu Leu Ile Tyr Gly Ala Gly Ser Leu Gln Asp Gly Val Pro Ser 65 70 75 80 Arg Phe Ser Gly Gly Gly Ser Gly Thr His Tyr Ser Leu Lys Ile Ser 85 90 95 Ser Met Gln Thr Glu Asp Glu Gly Val Tyr Phe Cys Gln Gln Gly Leu 100 105 110 Lys Phe Pro Leu Thr Phe Gly Ser Gly Thr Lys Leu Glu Ile Lys Arg 115 120 125 Ala Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln 130 135 140 Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr 145 150 155 160 Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser 165 170 175 Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr 180 185 190 Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys 195 200 205 His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro 210 215 220 Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 <210> 32 <211> 1398 <212> DNA <213> Artificial Sequence <220> <223> Humanized Antibody <400> 32 atgaagcacc tgtggttctt tctgctgctg gtggccgctc ccagatgggt gctgtctgaa 60 gtgcagctgg tggaatccgg cggaggcctg gtgcagcctg gcggatctct gagactgtct 120 tgtgccgcct ccggcttcac cttctccaac tactacatgg cctgggtgcg acaggcccct 180 ggcaagggac tggaatgggt gtcctctatc ggcaccgtgg gcggcaacac ctactacgcc 240 gattctgtga agggccggtt caccatctcc cgggacgact ccaagaacac cctgtacctg 300 cagatgaact ccctgcgggc cgaggacacc gccgtgtact actgtgccag agaggactac 360 ggcggcttcc ctcattgggg ccagggcaca ctcgtgaccg tgtcctctgc ttccaccaag 420 ggcccctccg tgtttcctct ggccccttcc agcaagtcca cctctggcgg aacagccgct 480 ctgggctgcc tcgtgaagga ctacttcccc gagcccgtga cagtgtcttg gaactctggc 540 gccctgacct ccggcgtgca cacctttcca gctgtgctgc agtcctccgg cctgtactcc 600 ctgtcctccg tcgtgactgt gccctccagc tctctgggca cccagaccta catctgcaac 660 gtgaaccaca agccctccaa caccaaggtg gacaagcggg tggaacccaa gtcctgcgac 720 aagacccaca cctgtccccc ttgtcctgcc cctgaactgc tgggcggacc ttccgtgttc 780 ctgttccccc caaagcctaa ggacaccctg atgatctccc ggacccccga agtgacctgc 840 gtggtggtgg atgtgtccca cgaggaccct gaagtgaagt tcaattggta cgtggacggc 900 gtggaagtgc acaacgccaa gaccaagcct agagaggaac agtacaactc cacctaccgg 960 gtggtgtccg tgctgaccgt gctgcatcag gactggctga acggcaaaga gtacaagtgc 1020 aaggtgtcca acaaggccct gcctgccccc atcgaaaaga ccatctccaa ggccaagggc 1080 cagccccggg aaccccaggt gtacacactg ccccctagcc gggaagagat gaccaagaac 1140 caggtgtccc tgacctgtct cgtgaaaggc ttctacccct ccgatatcgc cgtggaatgg 1200 gagagcaacg gccagcccga gaacaactac aagaccaccc cccctgtgct ggactccgac 1260 ggctcattct tcctgtacag caagctgaca gtggacaagt cccggtggca gcagggcaac 1320 gtgttctcct gctccgtgat gcacgaggcc ctgcacaacc actacaccca gaagtccctg 1380 tccctgagcc ccggcaaa 1398 <210> 33 <211> 466 <212> PRT <213> Artificial Sequence <220> <223> Humanized Antibody <400> 33 Met Lys His Leu Trp Phe Phe Leu Leu Leu Val Ala Ala Pro Arg Trp 1 5 10 15 Val Leu Ser Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 20 25 30 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 35 40 45 Ser Asn Tyr Tyr Met Ala Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 50 55 60 Glu Trp Val Ser Ser Ile Gly Thr Val Gly Gly Asn Thr Tyr Tyr Ala 65 70 75 80 Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn 85 90 95 Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 100 105 110 Tyr Tyr Cys Ala Arg Glu Asp Tyr Gly Gly Phe Pro His Trp Gly Gln 115 120 125 Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val 130 135 140 Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala 145 150 155 160 Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser 165 170 175 Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val 180 185 190 Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 195 200 205 Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 210 215 220 Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Asp 225 230 235 240 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly 245 250 255 Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile 260 265 270 Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu 275 280 285 Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His 290 295 300 Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg 305 310 315 320 Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 325 330 335 Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu 340 345 350 Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr 355 360 365 Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu 370 375 380 Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp 385 390 395 400 Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val 405 410 415 Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 420 425 430 Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His 435 440 445 Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro 450 455 460 Gly Lys 465 <210> 34 <211> 1398 <212> DNA <213> Artificial Sequence <220> <223> Humanized Antibody <400> 34 atgaagcacc tgtggttctt tctgctgctg gtggccgctc ccagatgggt gctgtctgaa 60 gtgcagctgg tggaatccgg cggaggcctg gtgcagcctg gcggatctct gagactgtct 120 tgtgccgcct ccggcttcac cttctccaac tactacatgg cctgggtgcg acaggcccct 180 ggcaagggac tggaatgggt ggcctctatc ggcaccgtgg gcggcaacac ctactaccgg 240 gattctgtga agggccggtt caccatctcc cgggacgact ccaagtccac cctgtacctg 300 cagatgaact ccctgcgggc cgaggacacc gccgtgtact actgtgccag agaggactac 360 ggcggcttcc ctcattgggg ccagggcaca ctcgtgaccg tgtcctctgc ttccaccaag 420 ggcccctccg tgtttcctct ggccccttcc agcaagtcta cctccggcgg aacagccgct 480 ctgggctgcc tcgtgaagga ctacttcccc gagcccgtga cagtgtcttg gaactctggc 540 gccctgacca gcggcgtgca cacctttcca gctgtgctgc agtcctccgg cctgtactcc 600 ctgtcctccg tcgtgactgt gccctccagc tctctgggca cccagaccta catctgcaac 660 gtgaaccaca agccctccaa caccaaggtg gacaagcggg tggaacccaa gtcctgcgac 720 aagacccaca cctgtccccc ttgtcctgcc cctgaactgc tgggcggacc ttccgtgttc 780 ctgttccccc caaagcccaa ggacaccctg atgatctccc ggacccccga agtgacctgc 840 gtggtggtgg atgtgtccca cgaggaccct gaagtgaagt tcaattggta cgtggacggc 900 gtggaagtgc acaacgccaa gaccaagcct agagaggaac agtacaactc cacctaccgg 960 gtggtgtccg tgctgaccgt gctgcatcag gactggctga acggcaaaga gtacaagtgc 1020 aaggtgtcca acaaggccct gcctgccccc atcgaaaaga ccatctccaa ggccaagggc 1080 cagccccggg aaccccaggt gtacacactg ccccctagcc gggaagagat gaccaagaac 1140 caggtgtccc tgacctgtct cgtgaaaggc ttctacccct ccgatatcgc cgtggaatgg 1200 gagtccaacg gccagcctga gacaacac aagaccaccc cccctgtgct ggactccgac 1260 ggctcattct tcctgtacag caagctgaca gtggacaagt cccggtggca gcagggcac 1320 gtgttctcct gctccgtgat gcacgaggcc ctgcacaacc actacaccca gaagtccctg 1380 tccctgagcc ccggcaaa 1398 <210> 35 <211> 466 <212> PRT <213> Artificial Sequence <220> <223> Humanized Antibody <400> 35 Met Lys His Leu Trp Phe Phe Leu Leu Leu Val Ala Ala Ala Pro Arg Trp 1 5 10 15 Val Leu Ser Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln 20 25 30 Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe 35 40 45 Ser Asn Tyr Tyr Met Ala Trp Val Arg Gln Ala Pro Gly Lys Gly Leu 50 55 60 Glu Trp Val Ala Ser Ile Gly Thr Val Gly Gly Asn Thr Tyr Tyr Arg 65 70 75 80 Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Ser 85 90 95 Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val 100 105 110 Tyr Tyr Cys Ala Arg Glu Asp Tyr Gly Gly Phe Pro His Trp Gly Gln 115 120 125 Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val 130 135 140 Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala 145 150 155 160 Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser 165 170 175 Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val 180 185 190 Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro 195 200 205 Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys 210 215 220 Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Asp 225 230 235 240 Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly 245 250 255 Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile 260 265 270 Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu 275 280 285 Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His 290 295 300 Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg 305 310 315 320 Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys 325 330 335 Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu 340 345 350 Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr 355 360 365 Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu 370 375 380 Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp 385 390 395 400 Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val 405 410 415 Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp 420 425 430<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 435 440 445<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 450 455 460<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> Gly Lys<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> 465<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <210> 36<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <211> 702<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <212> DNA<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <213> Artificial Sequence<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <220><h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <223> Humanized Antibody<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <400> 36<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> atggtgctgc agacccaggt gttcatctcc ctgctgctgt ggatctccgg cgcctacggc 60<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> aacatcgtga tgacccagtc ccccgactcc ctggctgtgt ctctgggcga gagagccacc 120<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> atcaactgca aggcctccca gaacgtggggc accaacgtgg actggtatca gcagaagccc 180<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ggccagtccc ctaagctgct gatctacggc gccagcaacc ggtacaccgg cgtgcccgat 240<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> agattctccg gctctggctc tggcaccgac tttaccctga caatcagctc tctgcaggcc 300 gaggacgtgg ccgtgtacga ctgcctgcag tacaagtaca acccctacac cttcggccag 360 ggcacaaagg tggaaatcaa gcggaccgtg gccgctccct ccgtgtttat cttcccaccc 420 tccgacgagc agctgaagtc cggcacagct tccgtcgtgt gcctgctgaa caacttctac 480 ccccgcgagg ccaaggtgca gtggaaggtg gacaacgccc tgcagtccgg caactcccag 540 gaatccgtga ccgagcagga ctccaaggac agcacctact ccctgtcctc caccctgacc 600 ctgtccaagg ccgactacga gaagcacaag gtgtacgcct gcgaagtgac ccaccagggc 660 ctgtctagcc ccgtgaccaa gtctttcaac cggggcgagt gc 702 <210> 37 <211> 234 <212> PRT <213> Artificial Sequence <220> <223> Humanized Antibody <400> 37 Met Val Leu Gln Thr Gln Val Phe Ile Ser Leu Leu Leu Trp Ile Ser 1 5 10 15 Gly Ala Tyr Gly Asn Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala 20 25 30 Val Ser Leu Gly Glu Arg Ala Thr Ile Asn Cys Lys Ala Ser Gln Asn 35 40 45 Val Gly Thr Asn Val Asp Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro 50 55 60 Lys Leu Leu Ile Tyr Gly Ala Ser Asn Arg Tyr Thr Gly Val Pro Asp 65 70 75 80 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser 85 90 95 Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Asp Cys Leu Gln Tyr Lys 100 105 110 Tyr Asn Pro Tyr Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg 115 120 125 Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln 130 135 140 Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr 145 150 155 160 Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser 165 170 175 Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr 180 185 190 Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys 195 200 205 His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro 210 215 220 Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 <210> 38 <211> 702 <212> DNA <213> Artificial Sequence <220> <223> Humanized Antibod <400> 38 atggtgctgc agacccaggt gttcatctcc ctgctgctgt ggatctccgg cgcctacggc 60 aacatcgtga tgacccagtc cccctccagc ctgtctgctt ccgtgggcga cagagtgacc 120 atcaactgca aggcctccca gaacgtgggc accaacgtgg actggtatca gcagaagccc 180 ggcaagtccc ccaagctgct gatctacggc gccagcaaca gatacaccgg cgtgcccgac 240 agattctccg gctctggctc tggcaccgac tttaccctga ccatcagctc cctgcagccc 300 gaggacttcg ccacctacga ctgcctgcag tacaagtaca acccctacac cttcggccag 360 ggcacaaagg tggaaatcaa gcggaccgtg gccgctccct ccgtgtttat cttcccaccc 420 tccgacgagc agctgaagtc cggcacagct tctgtcgtgt gcctgctgaa caacttctac 480 ccccgcgagg ccaaggtgca gtggaaggtg gacaacgccc tgcagtccgg caactcccag 540 gaatccgtga ccgagcagga ctccaaggac agcacctact ccctgtcctc caccctgacc 600 ctgtccaagg ccgactacga gaagcacaag gtgtacgcct gcgaagtgac ccaccagggc 660 ctgtctagcc ccgtgaccaa gtctttcaac cggggcgagt gc 702 <210> 39 <211> 234 <212> PRT <213> Artificial Sequence <220> <223> Humanized Antibody <400> 39 Met Val Leu Gln Thr Gln Val Phe Ile Ser Leu Leu Leu Trp Ile Ser 1 5 10 15 Gly Ala Tyr Gly Asn Ile Val Met Thr Gln Ser Pro Ser Ser Leu Ser 20 25 30 Ala Ser Val Gly Asp Arg Val Thr Ile Asn Cys Lys Ala Ser Gln Asn 35 40 45 Val Gly Thr Asn Val Asp Trp Tyr Gln Gln Lys Pro Gly Lys Ser Pro 50 55 60 Lys Leu Leu Ile Tyr Gly Ala Ser Asn Arg Tyr Thr Gly Val Pro Asp 65 70 75 80 Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser 85 90 95 Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Asp Cys Leu Gln Tyr Lys 100 105 110 Tyr Asn Pro Tyr Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg 115 120 125 Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln 130 135 140 Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr 145 150 155 160 Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser 165 170 175 Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr 180 185 190 Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys 195 200 205 His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro 210 215 220 Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 225 230 <210> 40 <211> 1407 <212> DNA <213> Artificial Sequence <220> <223> Humanized Antibody <400> 40 atgaagcacc tgtggttctt tctgctgctg gtggccgctc ccagatgggt gctgtctgaa 60 gtgcagctgg tggaatccgg cggaggcctc gtgaagcctt cccagaccct gtctctgacc 120 tgcaccgtgt ccggcttctc cctgacctcc ttccacgtgt catgggtgcg acagcctcca 180 ggcaagggcc tggaatggat cgccaccatc tcctctggcg gcggaaccta ctacaacccc 240 agcctgaagt ccagagtgac catctcccgg gacacctcca agaaccaggt gtccctgaag 300 ctgtcctccg tgaccgccgc tgataccgcc gtgtactact gcgccagaat ctccggctgg 360 ggccactact acgtgatgga cgtgtggggc cagggcaccc tcgtgacagt gtcctctgct 420 tccaccaagg gcccctccgt gtttcctctg gccccttcca gcaagtctac ctccggcgga 480 acagccgctc tgggctgcct cgtgaaagac tacttccccg agcccgtgac cgtgtcttgg 540 aactctggcg ctctgaccag cggcgtgcac acctttccag ctgtgctgca gtcctccggc 600 ctgtactccc tgtccagcgt cgtgactgtg ccctccagct ctctgggcac ccagacctac 660 atctgcaacg tgaaccacaa gccctccaac accaaggtgg acaagcgggt ggaacccaag 720 tcctgcgaca agacccacac ctgtccccct tgtcctgccc ctgaactgct gggcggacct 780 tccgtgttcc tgttcccccc aaagcccaag gacaccctga tgatctcccg gacccccgaa 840 gtgacctgcg tggtggtgga tgtgtcccac gaggaccctg aagtgaagtt caattggtac 900 gtggacggcg tggaagtgca caacgccaag accaagccta gagaggaaca gtacaactcc 960 acctaccggg tggtgtccgt gctgaccgtg ctgcaccagg attggctgaa cggcaaagag 1020 tacaagtgca aggtgtccaa caaggccctg cctgccccca tcgaaaagac catcagcaag 1080 gccaagggcc agccccggga accccaggtg tacacactgc cccctagccg ggaagagatg 1140 acaaaaaatc aggtgtcact gacctgtctc gtgaagggct tctacccctc cgatatcgcc 1200 gtggaatggg agtccaacgg ccagcctgag aacaactaca agaccacccc ccctgtgctg 1260 gactccgacg gctcattctt cctgtacagc aagctgacag tggacaagtc ccggtggcag 1320 cagggcaacg tgttctcctg ctccgtgatg cacgaggccc tgcacaacca ctacacccag 1380 aagtccctgt ccctgagccc cggcaaa 1407 <210> 41 <211> 469 <212> PRT <213> Artificial Sequence <220> <223> Humanized Antibody <400> 41 Met Lys His Leu Trp Phe Phe Leu Leu Leu Val Ala Ala Pro Arg Trp 1 5 10 15 Val Leu Ser Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys 20 25 30 Pro Ser Gln Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Phe Ser Leu 35 40 45 Thr Ser Phe His Val Ser Trp Val Arg Gln Pro Pro Gly Lys Gly Leu 50 55 60 Glu Trp Ile Ala Thr Ile Ser Ser Gly Gly Gly Thr Tyr Tyr Asn Pro 65 70 75 80 Ser Leu Lys Ser Arg Val Thr Ile Ser Arg Asp Thr Ser Lys Asn Gln 85 90 95 Val Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Val Tyr 100 105 110 Tyr Cys Ala Arg Ile Ser Gly Trp Gly His Tyr Tyr Val Met Asp Val 115 120 125 Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly 130 135 140 Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly 145 150 155 160 Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val 165 170 175 Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe 180 185 190 Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val 195 200 205 Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val 210 215 220 Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys 225 230 235 240 Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu 245 250 255 Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 260 265 270 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 275 280 285 Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val 290 295 300 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser 305 310 315 320 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 325 330 335 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala 340 345 350 Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 355 360 365 Gln Val Tyr Thr Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln 370 375 380 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 385 390 395 400 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 405 410 415 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu 420 425 430 Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser 435 440 445 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 450 455 460 Leu Ser Pro Gly Lys 465 <210> 42 <211> 702 <212> DNA <213> Artificial Sequence <220> <223> Humanized Antibody <400> 42 atggtgctgc agacccaggt gttcatctcc ctgctgctgt ggatctccgg cgcctacggc 60 gacatccaga tgacccagag cccttccagc ctgtccgctt ccgtgggcga cagagtgacc 120 atcacctgtc aggcctccga ggacatctac tccggcctgg cctggtatca gcagaagccc 180 ggcaagtccc ccaagctgct gatctacggc gctggatctc tgcaggacgg cgtgccctct 240 agattctccg gctctggatc cggcacccac tacaccctga ccatctccag cctgcagccc 300 gaggacttcg ctacctactt ctgtcagcaa ggcctgaagt tccccctgac cttcggccag 360 ggcaccaagg tggaaatcaa gcggaccgtg gccgctccct ccgtgtttat cttcccaccc 420 tccgacgagc agctgaagtc cggcacagct tctgtcgtgt gcctgctgaa caacttctac 480 ccccgcgagg ccaaggtgca gtggaaggtg gacaacgccc tgcagtccgg caactcccag 540 gaatccgtga ccgagcagga ctccaaggac agcacctact ccctgtcctc taccctgacc 600 ctgtccaagg ccgactacga gaagcacaag gtgtacgcct gcgaagtgac ccaccagggc 660 ctgtctagcc ccgtgaccaa gtctttcaac cggggcgagt gc 702 <210> 43 <211> 234 <212> PRT <213> Artificial Sequence <220> <223> Humanized Antibody <400> 43 Met Val Leu Gln Thr Gln Val Phe Ile Ser Leu Leu Leu Trp Ile Ser 1 5 10 15 Gly Ala Tyr Gly Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser 20 25 30 Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Glu Asp 35 40 45 Ile Tyr Ser Gly Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ser Pro 50 55 60 Lys Leu Leu Ile Tyr Gly Ala Gly Ser Leu Gln Asp Gly Val Pro Ser 65 70 75 80 Arg Phe Ser Gly Ser Gly Ser Gly Thr His Tyr Thr Leu Thr Ile Ser 85 90 95 Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Phe Cys Gln Gln Gly Leu 100 105 110 Lys Phe Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg 115 120 125 Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln 130 135 140 Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr 145 150 155 160 Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser 165 170 175 Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr 180 185 190 Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys 195 200 205 His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro 210 215 220 Valid Thr Lys Ser PhE As An Arg Gly Glu Cys 225 230 <210> 44 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> Primary F <400> 44 cacggcaacc tgctggagcg gctgctgggg gagg 34 <210> 45 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Primary R <400> 45 caggctgttc caggctgtt cagg24

Claims

1. An antibody-drug immunoconjugate in which an antibody is bound to another drug, The antibody is an antibody characterized by having the following properties: Immunoconjugates; (1) Specific binding to Glycoprotein-A Repetitions Predominant (GARP) (2) having inhibitory activity against the immunosuppressive function of regulatory T cells; (3) having antibody-dependent cellular cytotoxicity (ADCC) activity, and (4) It has antitumor activity in vivo.

2. The immunoglobulin according to claim 1, wherein GARP is a molecule consisting of the amino acid sequence set forth in SEQ ID NO:

1. Conjugate.

3. The antibody, (1) The amino acid sequences set forth in SEQ ID NO:1, 366 to 377, 407 to 445, and 456 to 470 Amino acid sequence, (2) an amino acid sequence represented by amino acid numbers 54 to 112 and 366 to 392 in SEQ ID NO: 1; 、 (3) an amino acid sequence set forth in amino acid numbers 352 to 392 in SEQ ID NO: 1; or (4) an amino acid sequence set forth in amino acid numbers 18 to 112 in SEQ ID NO: 1; The immunoconjugate of claim 1 or 2, which binds to

4. the antibody binds to GARP (1) A heavy chain consisting of the amino acid sequence set forth in SEQ ID NO: 2 and a peptide consisting of the amino acid sequence set forth in SEQ ID NO: 3 A light chain consisting of a string of (2) a heavy chain consisting of the amino acid sequence set forth in SEQ ID NO: 4 and a heavy chain consisting of the amino acid sequence set forth in SEQ ID NO: 5 A light chain consisting of a string of (3) a heavy chain consisting of the amino acid sequence set forth in SEQ ID NO: 25 and a heavy chain consisting of the amino acid sequence set forth in SEQ ID NO: 27 a light chain consisting of a sequence of (4) a heavy chain consisting of the amino acid sequence set forth in SEQ ID NO: 29 and a heavy chain consisting of the amino acid sequence set forth in SEQ ID NO: 31 A light chain consisting of a string of The immunoconjugate according to any one of claims 1 to 3, which has a competitive inhibitory activity with an antibody having Njugate.

5. The immunoconjugate of claim 1 , wherein the tumor is a cancer.

6. Cancer: Lung cancer, renal cancer, urothelial cancer, colon cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer The cancer of claim 5 is selected from the group consisting of cancer, melanoma, liver cancer, bladder cancer, stomach cancer, esophageal cancer, and blood cancer. Munoconjugate.

7. The antibody, (1) CDRH1 consisting of the amino acid sequence set forth in amino acid numbers 26 to 35 in SEQ ID NO:2; CDRH2 consisting of the amino acid sequence set forth in amino acid numbers 50 to 66 in SEQ ID NO:2, and CDRH3 consisting of the amino acid sequence set forth in amino acid numbers 99 to 107 in No. 2, and the sequence CDRL1 consisting of the amino acid sequence set forth in amino acid numbers 23 to 36 in SEQ ID NO:3 and CDRL2 consisting of the amino acid sequence set forth in SEQ ID NO:

3. CDRL3 consisting of the amino acid sequence set forth in amino acid numbers 91 to 101 of (2) CDRH1 consisting of the amino acid sequence set forth in amino acid numbers 26 to 35 in SEQ ID NO: 4; CDRH2 consisting of the amino acid sequence set forth in amino acid numbers 50 to 66 in SEQ ID NO:4, and the sequence CDRH3 consisting of the amino acid sequence set forth in amino acid numbers 99 to 112 in No. 4, and the sequence CDRL1 consisting of the amino acid sequence set forth in amino acid numbers 23 to 36 in SEQ ID NO:5; and CDRL2 consisting of the amino acid sequence set forth in SEQ ID NO:5, CDRL3 consisting of the amino acid sequence set forth in amino acid numbers 91 to 100 of (3) CDRH1 consisting of the amino acid sequence set forth in amino acid numbers 45 to 54 in SEQ ID NO: 25; CDRH2 consisting of the amino acid sequence set forth in amino acid numbers 69 to 78 in SEQ ID NO:25, and CDRH3 consisting of the amino acid sequence set forth in amino acid numbers 118 to 125 in sequence number 25; CDRL1 consisting of the amino acid sequence set forth in amino acid numbers 44 to 54 in sequence number 27, SEQ ID NO:2 CDRL2 consisting of the amino acid sequence set forth in SEQ ID NO: 70 to 76 in SEQ ID NO: 27; a CDRL3 consisting of the amino acid sequence set forth in amino acid numbers 109 to 117 of (4) CDRH1 consisting of the amino acid sequence set forth in amino acid numbers 45 to 54 in SEQ ID NO: 29; CDRH2 consisting of the amino acid sequence set forth in amino acid numbers 69 to 77 in SEQ ID NO:29, and CDRH3 consisting of the amino acid sequence set forth in amino acid numbers 117 to 128 in sequence number 29; CDRL1 consisting of the amino acid sequence set forth in amino acid numbers 44 to 54 in sequence number 31, SEQ ID NO:3 CDRL2 consisting of the amino acid sequence set forth in SEQ ID NO: 70 to 76 in CDRL3 consisting of the amino acid sequence set forth in amino acid numbers 109 to 117 in The immunoconjugate of any one of claims 1 to 6, having the formula:

8. The antibody, (1) A heavy chain polypeptide having an amino acid sequence as set forth in amino acid numbers 1 to 118 in SEQ ID NO:

2. A light molecule comprising the variable region and the amino acid sequence set forth in amino acid numbers 1 to 112 in SEQ ID NO:

3. Chain variable region, (2) A heavy chain consisting of the amino acid sequence set forth in amino acid numbers 1 to 123 in SEQ ID NO:

4. A light molecule comprising the variable region and the amino acid sequence set forth in amino acid numbers 1 to 111 in SEQ ID NO:

5. Chain variable region, (3) A heavy chain variant consisting of the amino acid sequence set forth in amino acid numbers 20 to 136 in SEQ ID NO:

25. A light molecule comprising the variable region and the amino acid sequence set forth in amino acid numbers 21 to 129 in SEQ ID NO:

27. a chain variable region, or (4) A heavy chain variant consisting of the amino acid sequence set forth in amino acid numbers 20 to 139 in SEQ ID NO:

29. A light molecule comprising the variable region and the amino acid sequence set forth in amino acid numbers 21 to 129 in SEQ ID NO:

31. Chain variable region, The immunoconjugate of any one of claims 1 to 7, having the formula:

9. The antibody according to any one of claims 1 to 8, wherein the constant region of the antibody is a human-derived constant region. Immunoconjugates of.

10. The antibody, (1) A heavy chain consisting of the amino acid sequence set forth in SEQ ID NO: 2 and a peptide consisting of the amino acid sequence set forth in SEQ ID NO: 3 A light chain consisting of a string of (2) a heavy chain consisting of the amino acid sequence set forth in SEQ ID NO: 4 and a heavy chain consisting of the amino acid sequence set forth in SEQ ID NO: 5 A light chain consisting of a string of (3) a heavy chain consisting of the amino acid sequence set forth in amino acid numbers 20 to 466 in SEQ ID NO: 25; and a light chain consisting of the amino acid sequence set forth in amino acid numbers 21 to 234 in SEQ ID NO: 27; or (4) a heavy chain consisting of the amino acid sequence set forth in amino acid numbers 20 to 469 in SEQ ID NO: 29; and a light chain consisting of the amino acid sequence set forth in amino acid numbers 21 to 234 in SEQ ID NO: 31; The immunoconjugate of any one of claims 1 to 9, having the formula:

11. The immunoconjugate of any one of claims 1 to 10, wherein the antibody is humanized. gate.

12. The antibody, (a) an amino acid sequence set forth in amino acid numbers 20 to 136 in SEQ ID NO: 33; (b) an amino acid sequence set forth in amino acid numbers 20 to 136 in SEQ ID NO: 35; (c) an amino acid sequence set forth in amino acid numbers 20 to 139 in SEQ ID NO: 41; (d) a sequence of a framework region other than each CDR sequence in the sequences (a) to (c); an amino acid sequence having at least 95% identity to (e) In the sequences of the framework regions other than each CDR sequence in the sequences (a) to (c), and an amino acid sequence in which one or several amino acids are deleted, substituted or added. a heavy chain variable region consisting of an amino acid sequence selected from the group consisting of (f) an amino acid sequence set forth in amino acid numbers 21 to 129 in SEQ ID NO: 37; (g) an amino acid sequence set forth in amino acid numbers 21 to 129 in SEQ ID NO: 39; (h) an amino acid sequence set forth in amino acid numbers 21 to 129 in SEQ ID NO: 43; (i) In the sequences (f) to (h), a sequence of a framework region other than each CDR sequence is an amino acid sequence having at least 95% identity to (j) In the sequences of the framework regions other than each CDR sequence in the sequences (f) to (h), and an amino acid sequence in which one or several amino acids are deleted, substituted or added. a light chain variable region consisting of an amino acid sequence selected from the group consisting of The immunoconjugate of claim 11, having the formula:

13. The antibody, (1) A heavy chain variant consisting of the amino acid sequence set forth in amino acid numbers 20 to 136 in SEQ ID NO:

33. A light molecule comprising the variable region and the amino acid sequence set forth in amino acid numbers 21 to 129 in SEQ ID NO:

37. Chain variable region, (2) A heavy chain consisting of the amino acid sequence set forth in amino acid numbers 20 to 136 in SEQ ID NO:

35. A light molecule comprising the variable region and the amino acid sequence set forth in amino acid numbers 21 to 129 in SEQ ID NO:

39. a chain variable region, or (3) A heavy chain variant consisting of the amino acid sequence set forth in amino acid numbers 20 to 139 in SEQ ID NO:

41. A light molecule comprising the variable region and the amino acid sequence set forth in amino acid numbers 21 to 129 in SEQ ID NO:

43. Chain variable region, 13. The immunoconjugate of claim 11 or 12, having the formula:

14. The antibody, (1) a heavy chain having an amino acid sequence set forth in amino acid numbers 20 to 466 in SEQ ID NO: 33; A heavy chain having an amino acid sequence as set forth in amino acid numbers 20 to 466 in SEQ ID NO: 35, and a sequence A heavy chain having an amino acid sequence as set forth in amino acid numbers 20 to 469 in sequence number 41. a heavy chain selected from the group (2) a light chain having an amino acid sequence set forth in amino acid numbers 21 to 234 in SEQ ID NO: 37; A light chain having an amino acid sequence as set forth in amino acid numbers 21 to 234 in SEQ ID NO: 39, and a sequence a light chain having an amino acid sequence as set forth in amino acid numbers 21 to 234 of sequence number 43; a light chain selected from the group 14. The immunoconjugate of any one of claims 11 to 13, comprising:

15. The antibody, (1) a heavy chain having an amino acid sequence set forth in amino acid numbers 20 to 466 in SEQ ID NO: 33; and a light chain having the amino acid sequence set forth in amino acid numbers 21 to 234 in SEQ ID NO: 37; (2) a heavy chain having an amino acid sequence set forth in amino acid numbers 20 to 466 in SEQ ID NO: 35; and a light chain having the amino acid sequence set forth in amino acid numbers 21 to 234 in SEQ ID NO: 39; or (3) a heavy chain having an amino acid sequence set forth in amino acid numbers 20 to 469 in SEQ ID NO: 41; and a light chain having the amino acid sequence set forth in amino acid numbers 21 to 234 in SEQ ID NO: 43; 15. The immunoconjugate of any one of claims 11 to 14, comprising:

16. The antibody is characterized in that it has been subjected to glycosylation at an N-linkage, glycosylation at an O-linkage, N-terminal processing, C-terminal processing, deamidation, isomerization of aspartic acid, oxidation of methionine, N-terminal addition of a methionine residue to the carboxyl terminus, amidation of a proline residue, and a heavy chain having two amino acid deletions, 16. An immunoconjugate according to any one of claims 1 to 15.

17. 17. The method of claim 16, wherein one or two amino acids are deleted at the carboxyl terminus of the heavy chain. The immunoconjugate described herein.

18. 1, wherein each of the two heavy chains is deleted by one amino acid at the carboxyl terminus.

8. The immunoconjugate according to claim 7.

19. 19. The polypeptide of claim 16, wherein the proline residue at the carboxyl terminus of the heavy chain is further amidated. The immunoconjugate of any one of claims 1 to 4.

20. The glycosylation of the antibody according to claims 1 to 1 is regulated to enhance antibody-dependent cellular cytotoxicity.

10. The immunoconjugate according to any one of claims 9.

21. 21. The method according to claim 1, wherein the drug is a radioactive substance or a compound having a pharmacological action.

4. The immunoconjugate according to claim 3.

22. The radioactive material is indium ( １１１ In), technetium ( ９９ｍ Tc), yttrium ( ９０ Y), or iodine ( １３１ The immunoconjugate of claim 21, which is I).

23. Characterized in that it contains at least one immunoconjugate according to claims 1 to 22. The pharmaceutical composition according to claim 1,

24. 24. The pharmaceutical composition according to claim 23, which is for treating tumors.

25. 25. The pharmaceutical composition according to claim 24, wherein the tumor is cancer.

26. Cancer: Lung cancer, renal cancer, urothelial cancer, colon cancer, prostate cancer, glioblastoma multiforme, ovarian cancer, pancreatic cancer, breast cancer 26. The medicine according to claim 25, which is for cancer, melanoma, liver cancer, bladder cancer, stomach cancer, esophageal cancer, or blood cancer. composition.

Images