Methods and systems for detecting methylation changes in DNA samples

Abstract

To provide methods and systems for highly sensitive detection of methylation changes in DNA samples, particularly in DNA samples obtained from biological fluid such as plasma and urine.SOLUTION: A method for sensitive detection of methylation changes in a DNA sample is provided, the method comprising:(a) providing a DNA sample; and (b) subjecting the DNA sample to methylation ratio analysis by digesting the DNA sample with at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease, co-amplifying at least one restriction locus differentially methylated between normal DNA and disease DNA and at least one control locus in a single reaction mixture, and comparing a ratio between signal intensities of the amplification products to at least one reference ratio, thereby detecting methylation changes in the DNA sample at detection sensitivity of at least 1:100.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to methods and systems for sensitive detection of methylation changes in DNA samples, particularly DNA samples obtained from biological fluids such as plasma and urine. The systems and methods are useful in the diagnosis of disease. [Background technology]

[0002] DNA methylation changes are known to occur in many types of cancer, including isolated CpG hypomethylation and hypermethylation that occurs mainly in CpG islands. Specifically, hypermethylation of CpG islands in the promoter regions of tumor suppressor genes, which leads to gene silencing, has been widely studied and demonstrated in various types of cancer.

[0003] Tumors release DNA fragments or "cell-free DNA" into biological fluids, and as a result, methylation changes in tumor-derived DNA molecules can be detected in "liquid biopsies" obtained from biological fluids such as plasma and urine. In contrast to traditional biopsies, liquid biopsies are non-invasive and may better represent the full genetic spectrum of tumor subclones. As a result, detection of cancer-associated methylation changes in liquid biopsies holds great promise for early detection, prognosis, and therapeutic monitoring. However, detection of tumor-derived DNA in liquid biopsies requires ultrasensitive biochemical methods, as very small amounts of tumor DNA may be present in association with a large background of normal DNA.

[0004] Several techniques have been developed for the detection of methylated molecules in liquid biopsies, based on sodium bisulfite treatment of DNA followed by quantitative PCR, with analytical sensitivities of up to 1:10,000 (Cottrell et al., Nucleic Acids Res., 2004, 32(1):e10; Kristensen and Hansen, Clin Chem., 2009, 55(8):1471-83; Zou et al., Clin Chem., 2012, 58(2):375-83). Based on these assays, commercial products have been introduced for the detection of colorectal cancer in blood and stool, and for the detection of bladder cancer in urine (Young et al. Cancer Med., 2016, 5(10):2763-72; Imperiale et al., N Engl J Med., 2014, 370(14):1287-97; Van Kessel et al., J Urol., 2016, 195(3):601-7). Despite its popularity, conversion of DNA with sodium bisulfite is a cumbersome assay and has drawbacks, including degradation of template DNA and subsequent preferential amplification of methylated or unmethylated DNA in PCR.

[0005] Another study based on bisulfite sequencing is described in Moss et al., Nature Communications, vol. 9, Article number: 5068 (2018), where cell-free DNA in plasma samples was analyzed using bisulfite conversion and a commercially available methylation array. Moss et al. used plasma methylation patterns to identify cell type-specific cfDNA in healthy and diseased states. Moss et al. specifically evaluated the accuracy of cancer detection using deconvolution by performing a mixing experiment, mixing plasma from a patient with colon cancer with plasma from a healthy donor in various ratios and deconvoluting the methylome of the resulting mixture. The algorithm correctly identified the presence of colon DNA in the mixture, in the correct ratio, down to 3% (a 33-fold dilution of the original cancer plasma sample).

[0006] Non-bisulfite-based methods for DNA methylation analysis include affinity / antibody enrichment or methylation-sensitive and / or dependent restriction. Methylation-dependent restriction-based methods include differential methylation hybridization, methylated CpG island amplification and microarrays, HpaII small fragment enrichment by ligation-mediated PCR, multiplex bisulfite restriction analysis, and methylation-specific multiplex ligation-dependent probe amplification. These non-bisulfite-based methods are primarily used for genome-wide analysis.

[0007] Several methods have been developed that utilize methylation-sensitive and / or -dependent restriction enzymes for the analysis of specific loci. For example, a method was developed that combines methylation-sensitive restriction, methylation-dependent restriction, double digestion and mock digestion with subsequent quantitative PCR (Oakes et al., Epigenetics., 2006, 1(3): 146-52), but the need to perform four separate restriction and amplification reactions for each analyzed locus complicates the assay and limits its application in samples with limited amounts of input DNA. A similar but simpler approach employs a methylation-dependent restriction reaction followed by quantitative real-time PCR and comparison with the same DNA sample that has been mock-digested and PCR-amplified (Hashimoto et al., Epigenetics., 2007, 2(2): 86-95)). This approach was also used by another team for the quantitative analysis of methylation levels in hepatocellular carcinoma (Huang et al., Exp Mol Pathol., 2011, 91(3): 702-7). Although simpler, this approach still requires performing two separate digestions and PCRs for each analyzed locus. Another variation of this general technique was recently employed to detect methylation signatures in lung cancer, pulmonary fibrosis, and COPD patients (Wielscher et al., EBioMedicine., 2015, 2(8):929-36). In this variation, a single restriction reaction was performed using a methylation-sensitive enzyme, followed by two consecutive rounds of PCR amplification (a highly multiplexed first round followed by a round of single-locus PCR). The level of methylation at each locus was determined by comparing the signal obtained from that locus to that obtained from a control locus amplified in a separate well. Although this approach only used a single restriction reaction, the use of two consecutive rounds of PCR amplification would result in a rather complex assay. Moreover, the aforementioned restriction and subsequent amplification-based assays for methylation analysis rely on the comparison of signals from different PCR wells, and even if the assay is performed properly, each well may have slightly different reagent concentrations and thermal conditions, resulting in high levels of noise.

[0008] Another method for methylation analysis based on methylation-sensitive and / or dependent restriction endonucleases is disclosed in WO2011 / 070441, assigned to the present applicant. More specifically, WO2011 / 070441 discloses a method for classifying DNA samples based on methylation differences, which includes: (A) digesting a DNA sample with a methylation-sensitive and / or dependent restriction endonuclease; (B) performing PCR on the digested DNA to co-amplify at least two genomic loci, at least one of which is a differentially methylated restriction locus among different DNA categories; (C) determining the intensity of the signal of each amplification product; (D) calculating a signal ratio between the intensities of the signals generated by the loci; and (E) comparing the signal ratio with a reference value corresponding to a different category of DNA, where the category whose reference value best corresponds to the signal ratio is determined to be the category of the DNA sample. The category of DNA samples includes, for example, DNA from different tissues and / or physiological / pathological conditions.

[0009] WO2017 / 006317 and WO2019 / 142193, assigned to the present applicant, disclose methods for identifying bladder cancer and lung cancer, respectively, based on DNA methylation changes at selected genomic loci, which include calculating signal intensity ratios between selected loci co-amplified from a test DNA sample after digestion with at least one methylation-sensitive restriction enzyme and comparing these ratios to one or more reference ratios.

[0010] There is a need for improved methods for detecting methylation changes in DNA samples that are more sensitive and accurate than existing methods. For example, there is a need to improve the detection of low amounts of methylated DNA molecules within a large background of unmethylated DNA. Such methods are highly desirable in the field of disease diagnostics, especially cancer diagnostics based on circulating DNA from tumors. Summary of the Invention

[0011] The present invention provides methods and systems for detecting methylation changes in DNA samples with improved sensitivity.

[0012] The inventors of the present invention have previously developed a method for detecting methylation changes based on the calculation of a signal ratio corresponding to the methylation ratio between loci in a DNA sample. In particular, the method, according to some embodiments, includes digesting a DNA sample with a methylation-sensitive or methylation-dependent restriction endonuclease, co-amplifying at least one restriction locus and a control locus (the restriction locus contains a recognition sequence for the restriction endonuclease and is differentially methylated between normal and disease DNA) from the digested DNA, determining the signal intensity of the amplification product of each locus, and calculating the ratio of the signal intensities of the restriction locus and the control locus. The signal ratio is calculated between the restriction locus and the control locus amplified together from the same DNA sample (same template) in a single reaction mixture. The signal ratio can be compared to one or more reference ratios determined for the same restriction and control loci of a known source of DNA to detect methylation changes and determine whether the DNA sample is normal or derived from disease cells, such as tumor cells.

[0013] The present invention discloses improvements to the above methods that result in significantly higher sensitivity in detecting methylated DNA molecules. As disclosed herein, high sensitivity is obtained when the analyzed DNA sample (i.e., the DNA sample after extraction from the biological sample) is substantially devoid of single-stranded DNA. As exemplified below, the presence of ssDNA impairs the efficiency of digestion of the sample by the methylation-sensitive / dependent restriction enzyme used in the assay. Thus, the ability of the assay to accurately detect methylation changes is compromised. The sensitivity that can be achieved using the improved methods disclosed herein is exemplified below in an analysis setting where methylated and unmethylated DNA molecules are mixed in different ratios. The method demonstrated a methylation detection sensitivity as low as 1:200,000, i.e., detection of a single methylated DNA molecule in a background of 200,000 unmethylated molecules. Such sensitivity has not been described before.

[0014] The improvements disclosed herein therefore result in methods that are particularly suitable and beneficial for clinical applications that require the analysis of small amounts of methylated DNA, such as the analysis of circulating DNA from tumors.

[0015] In some embodiments, a DNA sample substantially devoid of ssDNA can be obtained by extracting DNA from a biological sample tested under non-denaturing conditions and using non-denaturing reagents.

[0016] According to the method and system of the present invention, DNA is extracted from a biological sample, e.g., a plasma sample, to obtain DNA substantially devoid of ssDNA. The DNA is then subjected to a methylation ratio analysis, in which the DNA is digested with at least one methylation-sensitive or at least one methylation-dependent restriction enzyme, followed by simultaneous amplification of restriction and control loci from the digested DNA. The restriction loci according to the present invention contain recognition sequences for at least one restriction enzyme used in the digestion step, and thus cut (digested) according to their methylation level. For example, in the case of a methylation-sensitive restriction enzyme that cuts its recognition sequence only if it is unmethylated, a highly methylated DNA sample is digested to a lesser extent compared to a low methylated DNA sample, since fewer recognition sequences are digested within the population of DNA molecules that make up the sample.

[0017] The restriction locus according to the present invention is differently methylated between normal DNA and disease DNA, for example between normal DNA and cancer DNA. Therefore, DNA samples from healthy subjects are cut to a different extent than DNA samples from cancer patients. Due to the difference in digestion efficiency, different amplification patterns are established in the subsequent amplification and quantification steps. The difference in amplification patterns allows the DNA of healthy subjects to be distinguished from the DNA of patients, such as cancer patients.

[0018] The amplification and quantification step according to the method and kit of the present invention includes the simultaneous amplification of at least one restriction locus and a control locus from the digested DNA. The control locus can be a locus that is not cut by the restriction enzyme used in the digestion step. The signal intensity of the amplified locus is then determined, and the ratio between the signal intensity of each restriction locus and the control locus is calculated. A clear signal ratio is generated for DNA from healthy individuals and DNA from patients, such as cancer patients.

[0019] The signal ratio calculated for the DNA from the test subject can be compared with one or more reference ratios determined for the same restriction and control locus in DNA samples from known sources, i.e., healthy individuals or patients, such as cancer patients.Based on this comparison, the test sample is identified as being derived from a cancer patient or a healthy individual.It should be noted that the method and system of the present invention do not require the determination of the methylation level of each locus per se.

[0020] According to one aspect, the present invention provides a method for sensitively detecting methylation changes in a DNA sample, the method comprising: (a) providing a DNA sample, the DNA sample containing less than 5% single-stranded DNA (ssDNA); (b) subjecting the DNA sample to methylation ratio analysis by digesting the DNA sample with at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease, co-amplifying from the digested DNA at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus, and comparing the ratio between the signal intensities of the respective amplification products of the at least one restriction locus and the control locus to at least one reference ratio; This includes detecting methylation changes in the DNA sample with a detection sensitivity of at least 1:100.

[0021] In some embodiments, the DNA is cell-free DNA extracted from a biological fluid sample.

[0022] In some embodiments, the biological fluid sample is plasma, serum, or urine.

[0023] In some embodiments, the DNA sample contains less than 1% ssDNA.

[0024] In some embodiments, the DNA sample contains less than 0.1% ssDNA.

[0025] In some embodiments, the DNA sample contains less than 0.01% ssDNA or no ssDNA.

[0026] In some embodiments, methylation changes are detected in a sample with a detection sensitivity of at least 1:500.

[0027] In additional embodiments, methylation changes are detected in the sample with a detection sensitivity of at least 1:1,000.

[0028] In some embodiments, detecting methylation changes comprises determining whether the DNA sample is a normal DNA sample or a disease DNA sample. In some particular embodiments, detecting methylation changes comprises determining whether the DNA sample is a normal DNA sample or a cancer DNA sample.

[0029] In some embodiments, the methylation ratio analysis in step (b) is carried out using real-time PCR.

[0030] In some embodiments, the methylation ratio analysis of step (b) is performed using next generation sequencing (NGS).

[0031] In some embodiments, the method comprises in step (b) amplifying multiple restriction loci that are differentially methylated between normal and disease DNA and a single control locus.

[0032] According to another aspect, the present invention provides a method for measuring a methylation ratio of DNA from a human subject, the method comprising: (a) providing a DNA sample from a human subject, the DNA sample containing less than 5% single-stranded DNA (ssDNA); (b) subjecting the DNA sample to methylation ratio analysis by digesting the DNA sample with at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease, co-amplifying from the digested DNA at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus, and calculating a ratio between the signal intensities of the respective amplification products of the at least one restriction locus and the control locus using software stored in a non-transitory memory and executed on a computer processor; Thereby, measuring the methylation ratio of DNA from a human subject with a methylation detection sensitivity of at least 1:100.

[0033] According to a further aspect, the present invention provides a system for detecting methylation changes in a DNA sample, the system comprising: (a) a DNA sample, the DNA sample containing less than 5% single-stranded DNA (ssDNA); (b) components for performing a methylation ratio analysis, the components including: (i) at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease for digesting the DNA sample; (ii) a plurality of primer pairs for co-amplifying a plurality of genomic loci from the DNA sample after digestion, the plurality of genomic loci including at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus; and (iii) computer software stored on a non-transitory computer readable medium, the computer software instructing a computer processor to determine methylation changes in the DNA sample based on a comparison of a ratio of signal intensities of the restriction locus and the control locus after amplification to a reference ratio; Methylation changes are determined with a detection sensitivity of at least 1:100.

[0034] In some embodiments, the DNA is cell-free DNA extracted from a biological fluid sample.

[0035] In some embodiments, the biological fluid sample is plasma, serum, or urine.

[0036] In some embodiments, the DNA sample contains less than 1% ssDNA.

[0037] In some embodiments, the DNA sample contains less than 0.1% ssDNA.

[0038] In some embodiments, the DNA sample contains less than 0.01% ssDNA or no ssDNA.

[0039] In some embodiments, methylation changes are determined with a detection sensitivity of at least 1:500.

[0040] In additional embodiments, the methylation changes are determined with a detection sensitivity of at least 1:1,000.

[0041] In some embodiments, the multiple loci include multiple restriction loci that are differentially methylated between normal and disease DNA and a single control locus.

[0042] In some embodiments, methylation changes are determined by performing the following steps: calculating the signal intensities of the amplification products of the restriction locus and the control locus, calculating a ratio between the signal intensities of the amplification products, and comparing the calculated ratio to one or more reference ratios obtained from DNA samples of known source.

[0043] In some embodiments, determining the methylation changes in the DNA sample comprises providing an indication of whether the DNA sample is a normal DNA sample or a disease DNA sample. In some particular embodiments, determining the methylation changes in the DNA sample comprises providing an indication of whether the DNA sample is a normal DNA sample or a cancer DNA sample.

[0044] In some embodiments, the components for performing methylation ratio analysis further comprise a plurality of fluorescent probes for detecting the amplification products of at least one restriction locus and at least one control locus.

[0045] In some embodiments, the components for performing a methylation ratio analysis further comprise a plurality of fluorescent probes for detecting the amplification products of at least one restriction locus and at least one control locus.

[0046] In some embodiments, the system further comprises a DNA extraction reagent for extracting DNA from the biological sample, wherein the extracted DNA contains less than 5% ssDNA.

[0047] These and further aspects and features of the present invention will become apparent from the following detailed description, examples and claims. [Brief description of the drawings]

[0048] [Figure 1] Effect of single-stranded DNA on digestion efficiency. [Figure 2A] Bisulfite sequencing of the test locus in HCT-15 (methylated) and plasmid (unmethylated) DNA samples. The recognition sites for the endonucleases used in the assay are indicated. [Figure 2B]Amplification plot of a mixture of methylated and unmethylated DNA. Plots of six separate PCR reactions are overlaid. The internal standard ("control") is amplified at approximately the same cycle in all reactions. This primarily reflects amplification from 4,000,000 unmethylated DNA template molecules. As the amount of methylated DNA decreases, the test locus ("control") is amplified with increasing ΔCQ compared to the control locus. [Diagram 3] Linear regression fit of expected and calculated ΔCQ between test and internal reference loci. [Figure 4] Amplification plots of a 1:200,000 methylated:unmethylated DNA sample (A) and a pure unmethylated DNA sample (B). Plots of 34 replicate PCRs are overlaid. [Diagram 5] Relative copy number and KRAS mutation status of four cancer methylation markers in eight control and nine cancer samples using NGS-based assays. Con=control, CRC=colorectal cancer, Ovar=ovarian cancer, Pan=pancreatic cancer, AML=acute myeloid leukemia, Uter=uterine cancer, Lung=lung cancer. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0049] The present invention relates to systems and methods for detecting methylation changes in DNA samples with high sensitivity.

[0050] As used herein, "detecting methylation changes" refers to detecting whether a tested DNA sample contains methylation changes compared to a reference DNA sample, detecting whether the DNA sample is characterized by a different methylation profile (represented herein by signal ratios between selected genomic loci) at selected genomic loci, and / or determining whether the methylation profile of the DNA sample (represented herein by signal ratios between selected genomic loci) is normal or contains methylation changes indicative of the presence of disease.

[0051] The methods and systems of the present invention detect methylation (and subsequent methylation changes) with exceptionally high detection sensitivity.

[0052] As used herein, "sensitivity" or "detection sensitivity" refers to the ability to detect (identify) methylated DNA molecules in a sample containing both methylated and unmethylated DNA molecules. Detection sensitivity is expressed as the ratio of the number of methylated molecules to unmethylated molecules. For example, a detection sensitivity of 1:1,000 indicates the ability to detect one methylated DNA molecule in a background of 1,000 unmethylated DNA molecules.

[0053] In some embodiments, the detection sensitivity of methods and systems of the present invention is at least 1:100, preferably at least 1:500, and more preferably at least 1:1,000. Each possibility represents a separate embodiment of the present invention.

[0054] Example 3 below shows an exemplary assay for determining the detection sensitivity (analytical sensitivity) in an analytical setting, in which DNA molecules methylated at a selected genomic locus of interest are mixed with unmethylated DNA molecules in different ratios and the ability to detect the methylated DNA molecules is tested. The methylated DNA molecules can be obtained, for example, from a cell line in which the selected genomic locus is methylated. The unmethylated DNA molecules can be artificial DNA molecules that are completely unmethylated, for example, DNA molecules obtained by cloning the selected genomic locus into a plasmid.

[0055] As exemplified below, the method according to the invention is capable of detecting methylated DNA with a detection sensitivity as low as 1:200,000, i.e., the detection of a single methylated DNA molecule in a background of 200,000 unmethylated molecules.

[0056] In some embodiments, the analytical sensitivity of the methods and systems of the invention in detecting methylated DNA molecules (e.g., as determined in an assay such as that described in Example 3 below) is at least 1:50,000, preferably at least 1:100,000, and more preferably at least 1:200,000. Each possibility represents a separate embodiment of the present invention.

[0057] The present invention provides significantly increased sensitivity by providing a DNA sample for analysis that is substantially devoid of single-stranded DNA.

[0058] The high sensitivity obtained by the present invention is valuable, for example, for analyzing liquid biopsy samples containing circulating DNA from tumors, where tumor DNA is usually present in very small amounts compared to the background of normal DNA. High analytical sensitivity is important not only when performing actual clinical trials, but also during the development phase when searching for potential biomarkers. The most recent published data on methylation levels in samples from normal and diseased subjects were obtained using methods with high genome coverage but relatively low analytical sensitivity. As a result, genomic loci with very low methylation levels cannot be picked out. Thus, the methods and systems disclosed herein are also useful in biomarker development to identify biomarkers that are "under the radar" of conventional methylation assays.

[0059] The methods and systems of the present invention are particularly advantageous because they provide a highly sensitive and specific means for screening and / or diagnosing a variety of diseases, including cancer, that is non-invasive and user independent.

[0060] Moreover, unlike conventional methods that utilize methylation analysis to distinguish between tumor-derived and normal DNA and require the determination of actual methylation levels at specific genomic loci, the methods described herein do not require the assessment of absolute methylation levels. Thus, the methods disclosed herein eliminate the need for standard curves and / or additional laborious steps involved in the determination of the methylation level itself, thereby providing a simple and cost-effective procedure. An additional advantage over known approaches for analyzing methylation is given by the signal ratio obtained by the method of the present invention, which is calculated between loci amplified from the same DNA template in the same reaction mixture (i.e., under the same reaction conditions). This makes it insensitive to various "noise" factors, such as changes in template DNA concentration, PCR conditions, the presence of inhibitors, etc. Such noise is inherent in existing methods that are based on quantifying the methylation level of a locus by comparing signals from separate amplification reactions.

[0061] Methylation in the human genome occurs in the form of 5-methylcytosine and is restricted to cytosine residues that are part of CG sequences, also called CpG dinucleotides (cytosine residues that are part of other sequences are unmethylated). Some CG dinucleotides in the human genome are methylated and others are not. Furthermore, methylation is cell and tissue specific, so that a particular CG dinucleotide can be methylated in a particular cell and simultaneously unmethylated in another cell, or methylated in a particular tissue and simultaneously unmethylated in another tissue. DNA methylation is an important regulator of gene transcription.

[0062] The terms "DNA from," "DNA derived from," and the like are used interchangeably and refer to DNA obtained (e.g., extracted or isolated) from a sample, such as a plasma sample.

[0063] According to the present invention, DNA is obtained from an available sample without the need for a biopsy, hi some embodiments, DNA is obtained from plasma or serum.

[0064] As used herein, the term "identifying a disease (e.g., cancer) in a subject" includes any one or more of screening for the disease, detecting the presence of the disease, detecting the recurrence of the disease, detecting susceptibility to the disease, detecting a response to treatment, determining the effectiveness of treatment, determining the stage (severity) of the disease, determining the prognosis and early diagnosis of the disease in a subject. Each possibility represents a separate embodiment of the present invention.

[0065] The term "subject" as used herein is interchangeable with "individual" and refers to a human subject. The subject may be suspected of a particular disease. In some embodiments, the subject may be at risk of developing a disease, for example, based on a previous medical history, genetic predisposition, and / or family history of the disease, and / or the subject exhibits suspicious clinical signs of the disease. In some embodiments, the subject may exhibit at least one symptom or characteristic of the disease. In other embodiments, the subject may be asymptomatic.

[0066] The term "plurality" as used herein refers to "at least two" or "two or more."

[0067] In some embodiments, provided herein is a method for sensitive detection of methylation changes in a DNA sample, the method comprising: (a) providing a DNA sample, the DNA sample comprising less than 5% single-stranded DNA (ssDNA); and (b) digesting the DNA sample with at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease, and co-amplifying from the digested DNA at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus, and subjecting the DNA sample to a methylation ratio analysis by comparing the ratio between the signal intensities of the respective amplification products of the at least one restriction locus and the control locus using software stored in a non-transitory memory and executed on a computer processor, thereby detecting methylation changes in the DNA sample with a detection sensitivity of at least 1:100.

[0068] In some embodiments, provided herein is a method for detecting methylation changes in a DNA sample using methylation ratio analysis, comprising digesting a DNA sample with at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease, co-amplifying from the digested DNA at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus, and comparing a ratio between signal intensities of the respective amplification products of the at least one restriction locus and the control locus with at least one reference ratio, characterized in that the DNA sample contains less than 5% ssDNA and the detection sensitivity is at least 1:100.

[0069] Collection of plasma samples The term "plasma" refers to the liquid remaining after a whole blood sample has undergone a separation process to remove blood cells. A plasma sample can be a sample that has been separated from whole blood using any separation method, including, for example, by centrifugation and / or filtration. Plasma samples can be collected using conventional collection containers or tubes.

[0070] DNA extraction According to the present invention, the DNA sample on which the methylation analysis is performed is substantially free of ssDNA. As used herein, "substantially free of ssDNA" or "substantially devoid of ssDNA" refers to a DNA sample in which less than 7% of the DNA is ssDNA, preferably less than 5% of the DNA is ssDNA, more preferably less than 1% of the DNA is ssDNA (i.e., at least 99% of the DNA is double-stranded). In some embodiments, the DNA sample contains less than 1% ssDNA. In some embodiments, the DNA sample contains less than 0.1% ssDNA. In some embodiments, the DNA sample contains less than 0.01% ssDNA. In some embodiments, the DNA sample is completely free of ssDNA (no ssDNA). Commercially available kits are available for quantifying single-stranded DNA in a sample. One example is the Promega QuantiFluor® kit.

[0071] In some embodiments, the DNA sample is a DNA sample that has been extracted so that it is substantially devoid of ssDNA. In some embodiments, to avoid single-stranded DNA, the extraction procedure should not include reagents that denature DNA and / or are performed under conditions that denature DNA. Examples of DNA denaturing reagents include dimethylsulfoxide (DMSO) and formamide. Conditions that denature DNA include chemical (e.g., harsh alkaline treatment), physical (e.g., sonication), and thermal (e.g., temperatures above 60°C).

[0072] Thus, in some embodiments, a DNA sample substantially devoid of ssDNA can be obtained by extracting DNA from a biological sample tested under non-denaturing conditions and using non-denaturing reagents. Exemplary methods are provided in the Examples section herein below.

[0073] As used herein, "non-denaturing" refers to DNA, i.e., reagents and / or conditions that are non-denaturing to DNA.

[0074] Another strategy that can be employed to obtain a DNA sample that is substantially devoid of ssDNA is to eliminate single strands of the extracted DNA, which can be done, for example, by treating the extracted DNA with the exonuclease I enzyme, which digests single stranded DNA.

[0075] DNA digestion According to the invention, following extraction, the DNA is subjected to digestion with at least one methylation-sensitive or at least one methylation-dependent restriction endonuclease. For example, one, two, or three methylation-sensitive or methylation-dependent restriction endonucleases can be used. Each possibility represents a separate embodiment of the invention.

[0076] In some embodiments, the entire extracted DNA is used in the digestion step. In some embodiments, the DNA is not quantified prior to undergoing digestion. In other embodiments, the DNA may be quantified prior to its digestion.

[0077] "Restriction endonucleases," which are used interchangeably herein with "restriction enzymes," refer to enzymes that cut DNA at or near specific recognition nucleotide sequences known as restriction sites.

[0078] A "methylation-sensitive" restriction endonuclease is one that cleaves its recognition sequence only if it is unmethylated (methylated sites remain intact). Thus, the extent of digestion of a DNA sample by a methylation-sensitive restriction endonuclease depends on the methylation level; higher methylation levels are protected from cleavage and therefore result in less digestion.

[0079] A "methylation-dependent" restriction endonuclease is a restriction endonuclease that cleaves its recognition sequence only if it is methylated (unmethylated sites remain intact). Thus, the extent of digestion of a DNA sample by a methylation-dependent restriction endonuclease depends on the methylation level, with higher methylation levels resulting in more extensive digestion.

[0080] In some embodiments, the at least one methylation sensitive restriction endonuclease is AatII, Acc65I, AccI, Acil, ACII, Afel, Agel, Apal, ApaLI, AscI, AsiSI, Aval, AvaII, BaeI, BanI, BbeI, BceAI, BcgI, BfuCI, BglI, BmgBI, BsaAI, BsaBI, BsaHI, BsaI, B seYI, BsiEI, BsiWI, BslI, BsmAI, BsmBI, BsmFI, BspDI, BsrBI, BsrFI, BssHII, BssKI, BstAPI, BstBI, BstUI , BstZl7I, Cac8I, ClaI, DpnI, DrdI, EaeI, EagI, Eagl-HF, EciI, EcoRI, EcoRI-HF, FauI, Fnu4HI, FseI, FspI , HaeII, HgaI, HhaI, HincII, HincII, Hinfl, HinPlI, HpaI, HpaII, Hpyl66ii, Hpyl88iii, Hpy99I, HpyCH4IV , KasI, MluI, MmeI, MspAlI, MwoI, NaeI, NacI, NgoNIV, Nhe-HFI, NheI, NlaIV, NotI, NotI-HF, NruI, Nt.BbvC The at least one methylation-sensitive restriction endonuclease may be selected from the group consisting of Nt.I, Nt.BsmAI, Nt.CviPII, PaeR7I, PleI, PmeI, PmlI, PshAI, PspOMI, PvuI, RsaI, RsrII, SacII, Sall, SalI-HF, Sau3AI, Sau96I, ScrFI, SfiI, SfoI, SgrAI, SmaI, SnaBI, TfiI, TscI, TseI, TspMI and ZraI. Each possibility represents a separate embodiment of the invention. In some particular embodiments, the at least one methylation-sensitive restriction endonuclease comprises HinP1I. In additional particular embodiments, the at least one methylation-sensitive restriction endonuclease comprises HhaI.

[0081] In some embodiments, the at least one methylation-dependent restriction endonuclease may be selected from the group consisting of McrBC, McrA, and MrrA, with each possibility representing a separate embodiment of the present invention.

[0082] In some embodiments, the DNA is subjected to digestion with a single methylation-sensitive restriction endonuclease. In some particular embodiments, the methylation-sensitive restriction endonuclease is HinP1I. In further particular embodiments, the methylation-sensitive restriction endonuclease can be HhaI.

[0083] In some embodiments, DNA digestion may be performed until complete digestion. In some embodiments, the methylation sensitive restriction endonuclease may be HinP1I and complete digestion may be achieved after 1-2 hours of incubation with the enzyme at 37° C. In additional embodiments, the methylation sensitive restriction endonuclease may be HhaI and complete digestion may be achieved after 1-2 hours of incubation with the enzyme at 37° C.

[0084] Amplification of genomic loci As used herein, the terms "genomic locus" or "locus" are interchangeable and refer to a DNA sequence at a specific location on a chromosome. A specific location can be identified by the location of the molecule, i.e., by the start and end base pair numbers on the chromosome. As used herein, these terms also encompass the DNA sequence at a specific location, along with the 5' and / or 3' flanking sequences, up to about 50 bases immediately upstream and / or downstream of the DNA sequence.

[0085] In some embodiments, the 5' flanking sequence may comprise 1-50 bases. In additional embodiments, the 5' flanking sequence is between 10-40 bases. For example, the 5' flanking sequence can comprise up to 10 bases, up to 15 bases, up to 20 bases, up to 25 bases, up to 30 bases, up to 35 bases, up to 40 bases, up to 45 bases, or up to 50 bases immediately upstream of the locus. Each possibility represents a separate embodiment of the present invention.

[0086] In some embodiments, the 3' flanking sequence may comprise 1-50 bases. In additional embodiments, the 3' flanking sequence is between 10-40 bases. For example, the 3' flanking sequence can comprise up to 10 bases, up to 15 bases, up to 20 bases, up to 25 bases, up to 30 bases, up to 35 bases, up to 40 bases, up to 45 bases, or up to 50 bases immediately downstream of the locus. Each possibility represents a separate embodiment of the present invention.

[0087] Variants of a DNA sequence at a given genomic location are called alleles. Alleles of a locus are located at the same site on homologous chromosomes. A locus includes gene sequences as well as other genetic elements (such as intergenic sequences).

[0088] "Restriction locus" is used herein to describe a locus that comprises at least one restriction site, i.e. at least one site with a recognition sequence for at least one restriction enzyme applied in the digestion step. The restriction locus according to the present invention is differentially methylated between normal and disease DNA, meaning that for a given disease, e.g., a particular type of cancer, that is being analyzed, the restriction locus has different methylation levels between normal DNA and DNA from cancer cells. For example, DNA from cancer cells may have increased methylation levels at the restriction locus compared to normal non-cancerous DNA. More specifically, the restriction locus contains CG dinucleotides that are more methylated in cancer DNA compared to normal non-cancerous DNA. According to the present invention, the differentially methylated CG dinucleotides are located within the recognition site of at least one restriction enzyme applied in the digestion step.

[0089] In some embodiments, the restriction locus according to the invention may comprise at least one restriction site for a methylation-sensitive restriction enzyme, where the CG dinucleotide is more methylated in DNA from the plasma of patients with a certain type of cancer than in DNA from the plasma of healthy individuals, meaning that more DNA molecules are methylated at this position in the plasma of cancer patients compared to the plasma of healthy individuals. A methylation-sensitive restriction enzyme will only cleave its recognition sequence if it is unmethylated. Thus, a DNA sample with a higher proportion of DNA molecules in which the CG dinucleotide of the restriction site is methylated will have a lower degree of digestion compared to a DNA sample with a higher proportion of DNA molecules in which the CG dinucleotide is unmethylated. DNA digestion by methylation-sensitive restriction enzymes is less extensive for DNA from plasma samples of cancer patients compared to DNA from normal (healthy) individuals. It has been found that differences in digestion efficiency establish different amplification patterns in the subsequent amplification and quantification steps, allowing the DNA of cancer patients to be distinguished from that of healthy individuals.

[0090] A restriction locus according to the invention may contain additional CG dinucleotides, the methylation state of which is not relevant or influential to the assay - only the methylation in the recognition sequence of the restriction enzyme applied in the digestion step is relevant.

[0091] "Control locus" and "internal reference locus" are used interchangeably herein to describe a locus, the digestion of which by the restriction enzyme applied in the digestion step is independent of the presence or absence of methylation. In some embodiments, the control locus is a locus that lacks a recognition sequence for at least one restriction enzyme applied in the digestion step, and the sequence of the control locus remains intact regardless of the methylation state when the DNA sample is digested. Thus, the sequence of the control locus shows the same digestion and amplification pattern in normal and disease DNA. Advantageously, the control locus is an internal locus, i.e., a locus within the analyzed DNA sample, thus eliminating the need for an external / additional control sample.

[0092] In some embodiments, the methods of the present invention include amplifying at least one restriction locus and at least one control locus after digestion of a DNA sample. As used herein, "at least one (restriction / control) locus" can encompass a single locus or multiple separate loci.

[0093] In some embodiments, the methods involve amplifying multiple restriction loci (ie, at least two restriction loci) and a single control locus.

[0094] As used herein, "amplification" refers to an increase in the copy number of one or more specific nucleic acid targets of interest. Amplification is typically carried out by polymerase chain reaction (PCR) in the presence of a PCR reaction mixture that may include a DNA template, a polymerase (usually Taq polymerase), dNTPs, primers and a suitable buffer supplemented with a probe (if necessary), as known in the art.

[0095] As used herein, the term "polynucleotide" includes polymeric forms of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. As used herein, the term "oligonucleotide" also includes polymeric forms of nucleotides, typically up to 100 bases in length.

[0096] "Amplification products" refers collectively to the nucleic acid molecules of a particular target sequence that are produced and accumulated in an amplification reaction. This term generally refers to nucleic acid molecules generated by PCR using a given set of amplification primers.

[0097] As used herein, "primer" defines an oligonucleotide that can anneal (hybridize with) a target sequence, thereby creating a double-stranded region that can be the initiation point of DNA synthesis under suitable conditions. The term "primer pair" refers to a pair of oligonucleotides that are selected to be used together in amplifying a selected nucleic acid sequence by one of several types of amplification processes, preferably PCR. As is generally known in the art, primers can be designed to bind to complementary sequences under selected conditions.

[0098] Primers can be of any suitable length, depending on the particular assay format and particular needs. In some embodiments, primers can comprise at least 15 nucleotides in length, preferably 19-25 nucleotides in length. Primers can be adapted to be particularly suitable for a selected nucleic acid amplification system. As is generally known in the art, oligonucleotide primers can be designed taking into account the melting temperature of their hybridization with the target sequence (Sambrook et al., supra).

[0099] In some embodiments, restriction and control loci can be amplified from the same DNA sample (digested sample) using pairs of reverse and forward primers designed as known in the art to specifically amplify each locus. In some embodiments, primers can be designed to amplify a locus along with its 5' and 3' flanking sequences.

[0100] In some embodiments, the 5' flanking sequence may comprise 1-60 bases. In additional embodiments, the 5' flanking sequence is between 10-50 bases. For example, the 5' flanking sequence can comprise 10 bases, 15 bases, 20 bases, 25 bases, 30 bases, 35 bases, 40 bases, 45 bases, or 50 bases immediately upstream of the locus. Each possibility represents a separate embodiment of the present invention.

[0101] In some embodiments, the 3' flanking sequence may comprise 1-60 bases. In additional embodiments, the 3' flanking sequence is between 10-50 bases. For example, the 3' flanking sequence may comprise 10 bases, 15 bases, 20 bases, 25 bases, 30 bases, 35 bases, 40 bases, 45 bases, or 50 bases immediately downstream of the locus. Each possibility represents a separate embodiment of the present invention.

[0102] In some embodiments, the primers may be designed to generate an amplification product between 60 and 150 bp in length. In some particular embodiments, the primers may be designed to generate an amplification product between 70 and 140 bp in length.

[0103] In some embodiments, the methods include a process known as multiplex amplification or coamplification, which is the simultaneous amplification of two or more target sequences (at least one restriction locus and one control locus) in the same reaction mixture. This process requires the simultaneous use of multiple primer pairs. As is well known in the art, primers can be designed so that they can function at the same annealing temperature during amplification. In some embodiments, primers with similar melting temperatures (Tm) are used in the methods disclosed herein. A Tm variation of about 3-5°C is considered acceptable for primers used in pools.

[0104] In some embodiments, all restriction loci and control loci can be amplified in a single reaction mixture.In other embodiments, for example due to technical limitations of a particular machine, the digested DNA sample can be divided into several aliquots, each of which is supplemented with primer pairs for the amplification of one or more restriction loci and control loci.Thus, even if the DNA sample is divided into several aliquots, the control loci are amplified in each aliquot, and the signal ratio calculation is performed for the control loci and the restriction loci amplified together, i.e. from the same aliquot.

[0105] In some embodiments, amplification of genomic loci may be performed using real-time PCR (RT-PCR), also known as quantitative PCR (qPCR), in which amplification and detection of the amplification product are performed simultaneously.

[0106] In some embodiments, detection of the amplification products in RT-PCR can be accomplished using polynucleotide probes, typically fluorescently labeled polynucleotide probes.

[0107] As used herein, "polynucleotide probe" or "oligonucleotide probe" are interchangeable and refer to a labeled polynucleotide that is complementary to a specific subsequence within the nucleic acid sequence of a locus of interest, e.g., within the sequence of a restriction locus or a control locus. In some embodiments, detection is achieved by using a TaqMan assay based on a combination of a reporter molecule and a quencher molecule (Roche Molecular Systems Inc.). In such an assay, the polynucleotide probes have a fluorescent moiety (fluorophore) attached to their 5' end and a quencher attached to their 3' end. During PCR amplification, the polynucleotide probes selectively hybridize to the target sequence on the template, and when the polymerase replicates the template, the 5'-nuclease activity of the polymerase also cleaves the polynucleotide probe. When the polynucleotide probe is intact, the close proximity between the quencher and the fluorescent moiety usually results in a low level of background fluorescence. When the polynucleotide probe is cleaved, the quencher is detached from the fluorescent moiety, resulting in an increase in fluorescence intensity. The fluorescent signal correlates with the amount of amplification product, ie, as amplification product accumulates, the signal increases.

[0108] As used herein, "selectively hybridize" (as well as "selective hybridization", "specifically hybridize", and "specific hybridization") refers to preferential binding, duplexing, or hybridization of a nucleic acid molecule (such as a primer or probe) to a specific complementary nucleotide sequence under stringent conditions. The term "stringent conditions" refers to conditions under which a nucleic acid molecule will hybridize preferentially to its target sequence and only to a lesser extent or not at all to other non-target sequences. As is well known in the art, "stringent hybridization" in the context of nucleic acid hybridization is sequence-dependent and is different under different conditions.

[0109] The polynucleotide probe may vary in length. In some embodiments, the polynucleotide probe may comprise 15-30 bases. In additional embodiments, the polynucleotide probe may comprise 25-30 bases. In some embodiments, the polynucleotide probe may comprise 20-30 bases, e.g., 20 bases, 21 bases, 22 bases, 23 bases, 24 bases, 25 bases, 26 bases, 27 bases, 28 bases, 29 bases, 30 bases. Each possibility represents a separate embodiment of the present invention.

[0110] The polynucleotide probe can be designed to bind to either strand of the template. Additional considerations include the Tm of the polynucleotide probe, which should preferably be compatible with the Tm of the primer. Computer software can be used to design primers and probes.

[0111] As described above, the methods disclosed herein may include simultaneous amplification of two or more target sequences (at least one restriction locus and one control locus) in the same reaction mixture. To distinguish the multiple target sequences amplified in parallel, polynucleotide probes labeled with different fluorescent colors may be used.

[0112] In some embodiments, the polynucleotide probes form fluorophore / quencher pairs known in the art, including, for example, FAM-TAMRA, FAM-BHQ1, Yakima Yellow-BHQ1, ATTO550-BHQ2, and ROX-BHQ2.

[0113] In some embodiments, the dye combination may be compatible with the RT-PCR thermocycler of choice.

[0114] In some embodiments, fluorescence may be monitored during each PCR cycle to provide an amplification plot showing the change in fluorescent signal from the probe as a function of cycle number.

[0115] With respect to real-time PCR, the following terms are used: "Quantification cycle" ("Cq") refers to the cycle number at which fluorescence increases above a threshold, either automatically by the software or manually by the user. In some embodiments, the threshold may be constant for all loci or may be pre-set prior to performing amplification and detection. In other embodiments, the threshold may be defined separately for each locus after a run based on the maximum fluorescence level detected for this locus during an amplification cycle.

[0116] "Threshold" refers to the value of fluorescence used for Cq measurement. In some embodiments, the threshold may be a value above baseline fluorescence and / or above background noise and within the exponential growth phase of the amplification plot.

[0117] "Baseline" refers to the early cycles of PCR where there is little or no change in fluorescence.

[0118] Computer software can be used to analyze the amplification plots and determine baseline, threshold and Cq.

[0119] In some embodiments, when using a methylation-sensitive restriction enzyme, loci in which the CG dinucleotide at the enzyme's recognition site is methylated after digestion with the restriction enzyme are amplified with high efficiency because the DNA molecule is protected from digestion. Detectable amplification products are shown after a relatively small (low) number of amplification cycles, resulting in a relatively low Cq value. Conversely, loci in which the CG dinucleotide at the enzyme's recognition site is not methylated are extensively cleaved during the digestion step, resulting in a high Cq value in the amplification and quantification step (i.e., detectable amplification products are shown after a relatively large number of amplification cycles).

[0120] In other embodiments, amplification and detection of the amplified products can be performed by conventional PCR using fluorescently labeled primers, followed by capillary electrophoresis of the amplified products. In some embodiments, after amplification, the amplified products are separated by capillary electrophoresis and the fluorescent signal is quantified. In some embodiments, an electropherogram can be generated that plots the change in fluorescent signal as a function of size (bp) or time from injection, with each peak in the electropherogram corresponding to the amplified product of a single locus. The height of the peak (e.g., provided using "relative fluorescent units", rFU) can represent the intensity of the signal from the amplified locus. Computer software can be used to detect the peaks and calculate the fluorescent intensity (peak height) of a series of loci whose amplified products were run on a capillary electrophoresis device, and then calculate the ratio between the signal intensities.

[0121] For DNA samples digested with a methylation-sensitive restriction enzyme, loci in which the CG dinucleotide at the enzyme's recognition site is methylated will produce a relatively strong signal (high peak) on the electropherogram, whereas loci in which the CG dinucleotide at the enzyme's recognition site is unmethylated will produce a relatively weak signal (low peak) on the electropherogram.

[0122] In some embodiments, the fluorescent label of the primer comprises any one of fluorescein, FAM, Lissamine, phycoerythrin, rhodamine, Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, FluorX, JOE, HEX, NED, VIC, and ROX.

[0123] In additional alternative embodiments, amplification and detection of the amplification products may be performed using next generation sequencing (NGS) technology.

[0124] Next-generation sequencing (NGS) refers to deep, high-throughput, parallel DNA sequencing technologies. Unlike previous Sanger sequencing methods, NGS technologies offer massively parallel analysis from multiple samples at a significantly higher throughput and at a significantly reduced cost. Next-generation sequencing generally includes three basic steps: library preparation by DNA / RNA fragmentation and addition of adapter sequences (e.g., ligation or PCR), sequencing, and data analysis. Parallelized sequencing-by-synthesis or sequencing-by-ligation platforms currently employed by Illumina, Life Technologies, Roche, and others. NGS methods can also include nanopore sequencing methods, or methods based on electronic detection, e.g., Ion Torrent technology commercialized by Life Technologies.

[0125] To perform methylation ratio analysis using NGS, in some embodiments, a sequencing library is prepared by digesting a DNA sample with at least one methylation-sensitive or methylation-dependent restriction enzyme, enriching DNA fragments corresponding to at least one restriction locus and a control gene, and introducing NGS adapter sequences into these DNA fragments. "NGS adapter sequences" are oligonucleotides at the 5' and 3' ends of each DNA fragment in a sequencing library. The adapters typically include platform-specific sequences for fragment recognition by a specific sequencer, e.g., sequences that allow library fragments to be bound to a flow cell of an Illumina platform. Each NGS equipment provider typically uses a specific set of sequences for this purpose.

[0126] NGS adapter sequences according to some embodiments further include a sample index. A "sample index" is a sequence that allows multiple samples to be sequenced together (i.e., multiplexed) on the same instrument flow cell or chip. Each sample index (usually 6-10 bases) is unique to a particular sample library and is used during data analysis to demultiplex and assign individual sequence reads to their correct sample. Adapters may include single or dual sample indexes depending on the number of libraries to be combined and the level of accuracy desired.

[0127] In some embodiments, the NGS adaptor sequence is introduced using a two-step PCR, where a first PCR is performed using a primer comprising a locus-specific sequence and an overhang sequence that introduces a first portion of the NGS adaptor sequence, and a second PCR is performed using a primer that introduces a second portion of the NGS adaptor sequence and optionally a sample index.

[0128] The locus-specific primers include a primer specific for each of at least one restriction locus and a primer specific for a control locus.

[0129] The amplification products of the second PCR can be purified and the resulting library can then be sequenced using an NGS instrument (e.g., using an Illumina instrument) to generate sequence reads corresponding to the restriction and control loci. The number of reads (also referred to herein as "copy number") for each locus represents the signal intensity of the locus.

[0130] In some embodiments, when a methylation-sensitive restriction enzyme is used, loci in which the CG dinucleotide at the enzyme's recognition site is methylated are protected from cleavage, resulting in a relatively high copy number of these loci, whereas loci in which the CG dinucleotide at the enzyme's recognition site is unmethylated are cleaved more extensively during the digestion step, resulting in a lower copy number.

[0131] Computer software can be used to analyze the sequence reads, assign them to target loci, and quantify the number of reads (copy number).

[0132] In some embodiments, a method for detecting methylation changes in a DNA sample is provided, comprising the steps of: (a) subjecting a DNA sample to digestion with at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease, thereby obtaining restriction endonuclease-treated DNA; (b) generating an NGS sequencing library from the restriction endonuclease-treated DNA, the library containing DNA fragments corresponding to at least one restriction locus and at least one control locus that are differentially methylated between normal and disease DNA; (c) subjecting the NGS sequencing library to next generation sequencing to determine the copy number of each of at least one restriction locus and a control locus; (d) comparing the ratio between the copy numbers of the at least one restriction locus and the control locus to at least one reference ratio; and detecting methylation changes in the DNA sample.

[0133] In some embodiments, a method is provided for sensitively detecting methylation changes in a DNA sample, the method comprising: (a) providing a DNA sample that is substantially devoid of single-stranded DNA (ssDNA); (b) digesting the DNA sample with at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease, generating an NGS sequencing library from the digested DNA, the library containing DNA fragments corresponding to at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus, and subjecting the DNA sample to methylation ratio analysis by comparing the ratio between the copy numbers of each of the at least one restriction locus and the control locus to at least one reference ratio; This includes detecting methylation changes in the DNA sample with a detection sensitivity of at least 1:100.

[0134] In some embodiments, an NGS sequencing library is generated by (i) co-amplifying at least one restriction locus that is differentially methylated between normal and disease DNA and at least one control locus from the digested DNA in a single reaction mixture using a locus-specific primer that includes a 5' overhang sequence that introduces a first portion of an NGS adapter sequence, (ii) purifying the amplification product, and (iii) performing a second PCR that introduces an NGS adapter (e.g., an Illumina adapter) and optionally a sample index.

[0135] In some embodiments, the DNA is not purified between the digestion and amplification steps.

[0136] In some embodiments, the NGS-based assays disclosed herein combine detection of methylation changes combined with mutation detection, all in one single assay, which advantageously allows for the combined analysis of small amounts of DNA in a single assay.

[0137] For combined methylation and mutation analysis, in some embodiments, a library of polynucleotides is prepared by digesting a DNA sample with at least one methylation-sensitive or methylation-dependent restriction enzyme, followed by enrichment of DNA fragments corresponding to at least one restriction locus, a control gene, and one or more loci for which mutation analysis is desired, and introducing NGS adapter sequences into these DNA fragments using the two-step PCR described above.

[0138] The locus-specific primers include a primer specific for at least one restriction locus, a primer specific for a control locus, and a primer specific for at least one locus of interest where mutation analysis is desired.

[0139] The amplification products of the second PCR can be purified and the resulting library can then be sequenced using an NGS instrument (e.g., using an Illumina instrument) to generate sequence reads corresponding to at least one restriction locus, a control locus, and at least one locus of interest for which mutation analysis is desired. Computer software can be used to detect sequence reads that contain one or more mutations at the locus of interest.

[0140] Signal Ratio As used herein, the term "ratio" or "signal ratio" refers to the ratio between the intensities of signals resulting from the co-amplification of a pair of genomic loci in a single DNA sample (in the same reaction mixture), in particular the co-amplification of a restriction locus and a control locus.

[0141] The term "signal intensity" as used herein refers to a measure reflecting the amount of locus-specific amplification product that corresponds to the initial amount of intact copies of the locus. However, signal intensity may not indicate the actual amount of amplification product / intact locus and may not include calculation of the absolute amount of amplification product / intact locus. Thus, when calculating the ratio of amplification product signals, a standard curve or reference DNA may not be required since the actual DNA concentration or DNA methylation level itself does not need to be calculated.

[0142] In some exemplary embodiments, amplification and detection of the amplification products is performed by RT-PCR, and the signal intensity of a particular locus can be represented by the Cq calculated for that locus. The signal ratio in this case can be expressed by the following calculation: (対照遺伝子座のCq-制限遺伝子座のCq) .

[0143] In additional exemplary embodiments, detection of the amplification products is performed by capillary electrophoresis, where the signal intensity of a particular locus is the number of relative fluorescence units (rfus) of its corresponding peak. The signal ratio can be calculated by dividing the peak height of each restriction locus by the peak height of the control locus.

[0144] In a further exemplary embodiment, the amplification and detection of the amplification products are performed by next generation sequencing (NGS), and the signal intensity of a particular locus can be represented by the number of reads (copy number) calculated for this locus. The signal ratio in this case can be expressed by the following calculation: Number of reads at restriction locus / number of reads at control locus

[0145] In some embodiments, calculating the ratio between the signal intensities of the amplification products of the restriction locus and the control locus in the DNA sample comprises (i) determining the signal intensity of the amplification product of the restriction locus, (ii) determining the signal intensity of the amplification product of the control locus, and (iii) calculating the ratio between the two signal intensities.

[0146] In some embodiments, calculating the ratio between the signal intensities of the amplification products of the restricted locus and the control locus in the DNA sample comprises determining the Cq of each locus and calculating the difference between the Cq of the control locus and the Cq of the restricted locus. In some embodiments, calculating further comprises applying the following formula: 2^(Cq of the control locus-Cq of the restricted locus).

[0147] In additional embodiments, calculating the ratio between the signal intensities of the amplification products of the restriction locus and the control locus in the DNA sample comprises determining the number of reads (copy number) for each locus and calculating the ratio between the number of reads of the control locus and the copy number of reads of the restriction locus.

[0148] In some embodiments, calculating the signal ratios may be calculating a plurality of signal ratios between each restriction locus and the control locus.

[0149] In some embodiments, computer software can be used to calculate ratios between the signal intensities of the amplification products.

[0150] Standard ratio The terms "reference ratio" or "reference signal ratio" are used interchangeably and refer to a signal intensity ratio determined in DNA from a known source. The reference ratio of a given pair of restriction and control loci can be expressed in several ways. In some embodiments, the reference ratio of a given pair of loci can be a single ratio. In some embodiments, the reference ratio of a given pair of loci can be a statistical value, for example, the average value of a large set of reference ratios obtained from a large set of DNA samples from a known source, for example, the average value determined in a large group of cancer patients, or the average value determined in a large group of healthy individuals.

[0151] In other embodiments, the reference ratio for a given pair of loci may be a plurality of ratios, such as a distribution of ratios determined for this pair of loci in a large set of DNA samples from a known source. In some embodiments, the reference ratio may be a reference scale.

[0152] In some embodiments, the reference scale for a given pair of loci may include signal ratios measured for this pair of loci in multiple DNA samples from the same reference source. For example, a reference scale for a reference cancer patient or a reference scale for a reference healthy individual. In other embodiments, the reference scale for a given pair of loci may include a single scale that combines signal ratios from both healthy and diseased individuals, i.e., reference ratios from both sources. In general, when a single scale is used, the values ​​are distributed such that values ​​from healthy individuals are at one end of the scale, e.g., below a cutoff value, and values ​​from patients are at the other end of the scale, e.g., above a cutoff value. In some embodiments, the signal ratios calculated for a test DNA sample of unknown origin can be compared to a reference scale of healthy and / or diseased reference ratios, and a score can be assigned to the calculated signal ratio based on its relative position in the scale. In some embodiments, the higher the value of the calculated signal ratio, the higher the score assigned to it.

[0153] The terms "disease reference ratio" (e.g., "cancer reference ratio") or "reference ratio in disease DNA" (e.g., "cancer DNA reference ratio") refer interchangeably to the signal intensity ratio measured between a given restriction locus and a given control locus in DNA from a sample (e.g., a plasma sample) of a subject with a disease for which analysis is being performed, e.g., a subject with a particular type of cancer. The disease reference ratio represents the signal intensity ratio in disease DNA, i.e., DNA from a sample of a subject with a disease. The disease reference ratio can be a single ratio, a statistic, or multiple ratios (e.g., a distribution), as detailed above.

[0154] The terms "healthy reference ratio", "normal reference ratio" or "healthy / normal DNA reference ratio" are interchangeable and refer to the signal intensity ratio measured between a given restriction locus and a given control locus in a plasma sample from a normal individual. "Normal" or "healthy" is defined with respect to the particular disease for which the analysis is performed. A "healthy" or "normal" individual is defined herein as an individual without detectable symptoms and / or pathological findings of disease as determined by conventional diagnostic methods. A healthy reference ratio represents a signal intensity ratio in normal DNA, i.e., DNA from a sample of a healthy subject. A healthy reference ratio can be a single ratio, a statistic, or multiple ratios (e.g., a distribution), as detailed above.

[0155] In some embodiments, the methods disclosed herein include pre-determination of a reference ratio from disease DNA. In some embodiments, the methods of the present invention include pre-determination of a reference ratio from normal DNA.

[0156] As mentioned above, signal ratio can be determined by various methods, including, for example, measuring peaks after capillary electrophoresis, calculating Cq after RT-PCR, or calculating copy number after NGS.It should be understood that the reference ratio and the ratio measured for the test sample of unknown origin are obtained using the methods disclosed herein to determine the presence of a particular disease.

[0157] Disease Diagnosis In some embodiments, the method of detecting methylation changes according to the present invention comprises identifying the presence of a particular disease in a subject based on evaluating a signal ratio calculated for DNA from a biological sample from the subject compared to a reference ratio.

[0158] In some embodiments, methods are provided for identifying the cell or tissue source of a DNA sample (eg, identifying whether the DNA is derived from normal or diseased cells / tissues).

[0159] One of skill in the art will appreciate that the comparison of the calculated signal ratios for a test sample to the corresponding reference signal ratios can be performed in a number of ways, using a variety of statistical means.

[0160] In some embodiments, comparing the calculated test signal ratio for a given pair of loci to a reference signal ratio comprises comparing the test signal ratio to a single reference value, which may correspond to a mean value obtained for the reference signal ratio from a large population of healthy subjects or subjects with a disease on which the analysis is performed. In other embodiments, comparing the calculated test signal ratio for a given pair of loci to a reference signal ratio comprises comparing the test signal ratio to a distribution or scale of multiple reference signal ratios.

[0161] Known statistical methods can be used to determine whether the calculated signal ratio between a given restriction locus and a control locus corresponds to a disease reference ratio or a normal reference ratio. In some embodiments, by detecting a close approximation between the calculated ratio and the disease reference ratio, the subject is identified as a subject with a disease. Conversely, in some embodiments, by detecting a close approximation between the calculated ratio and the normal reference ratio, the subject is identified as a subject without a disease.

[0162] In some embodiments, the diagnosis according to the present invention is based on the analysis of whether the signal ratio of the test DNA sample is a disease ratio, i.e., whether it is indicative of the disease in question. In some embodiments, the method comprises comparing the calculated signal ratio with its corresponding healthy reference ratio (i.e., the signal ratio determined for the same pair of loci in healthy individuals) to obtain a score (probability score) reflecting the likelihood that the calculated signal ratio is a disease ratio. In some embodiments, the method comprises comparing the calculated signal ratio with its corresponding disease reference ratio (i.e., the signal ratio determined for the same pair of loci in subjects with the disease in question) to obtain a score (probability score) reflecting the likelihood that the calculated signal ratio is a disease ratio. The better the fit between the calculated signal ratio and the disease reference ratio, the higher the score (probability score) and the more likely the calculated signal ratio is a disease ratio. In some embodiments, the probability score is based on the relative position of the calculated signal ratio within the distribution of disease reference ratios.

[0163] In some embodiments, the method comprises comparing a plurality of signal ratios calculated for a plurality of restriction loci with respect to a control locus to their corresponding healthy and / or disease reference ratios.

[0164] In some embodiments, the pattern of signal ratios can be analyzed using statistical means and computerized algorithms to determine whether it represents a pattern of the disease in question or a normal healthy pattern. Exemplary algorithms are disclosed, for example, in WO2011 / 070441, which is assigned to the applicant of the present invention. Algorithms include, but are not limited to, machine learning and pattern recognition algorithms.

[0165] In some exemplary embodiments, each calculated ratio (for each pair of restriction and control loci) can be compared to a scale of reference ratios generated for this pair from a large series of plasma samples from cancer patients, individuals without cancer, or both. This scale can represent the signal ratios calculated between pairs of restriction and control loci in a large number of samples from cancer patients and / or normals. The scale may indicate a threshold, hereinafter also referred to as a "cutoff" or "predefined threshold", above which the reference ratio corresponds to cancer and below which the reference ratio corresponds to healthy individuals, or vice versa.

[0166] In some embodiments, the lower ratios at the bottom of the scale and / or below the cutoff may be from normal (healthy, i.e., not affected by the cancer in question) samples, and the higher ratios at the top of the scale and / or above a pre-defined cutoff may be from cancer patients. Each ratio (between each restriction locus and the control locus) may be given a score based on its relative position in the scale, and the individual scores (for each locus) may be combined to give a single score. In some embodiments, the individual scores may be summed to give a single score. In other embodiments, the individual scores may be averaged to give a single score. In some embodiments, the single score may be used to determine whether a subject has the cancer in question, with a score above a pre-defined threshold being indicative of cancer.

[0167] In some embodiments, the score is a number between 0 and 100 reflecting the probability that the calculated signal ratio is a cancer ratio, with 0 being the lowest probability and 100 being the highest probability. In some embodiments, a threshold score is determined, with a score equal to or exceeding which is indicative of cancer. The threshold can be, for example, 60, 70, or 80. Each possibility represents a separate embodiment of the present invention.

[0168] In additional exemplary embodiments, for each calculated ratio (between each restriction locus and the control locus), the probability that it represents cancer DNA may be determined based on a comparison with the corresponding cancer and / or normal reference ratios and assigned a score (probability score). As a result, the individual probability scores calculated for each ratio (for each locus) are combined (summed or averaged) to give a composite score. The composite score can be used to determine whether a subject has cancer, with a composite score above a predefined threshold being indicative of cancer.

[0169] Thus, in some embodiments, a threshold or cut-off score is determined above (or below) which subjects are identified as having the disease in question, e.g., the type of cancer in question. The threshold score distinguishes between healthy and non-healthy populations.

[0170] In some embodiments, the methods of the invention include providing a threshold score.

[0171] In some embodiments, determining the threshold score involves measuring a signal ratio in a large population of subjects that are healthy or have the disease in question.

[0172] In some embodiments, the threshold is a statistically significant value. Often, statistical significance is determined by comparing two or more populations and determining a confidence interval (CI) and / or a p-value. In some embodiments, the statistically significant value refers to a confidence interval (CI) of about 90%, 95%, 97.5%, 98%, 99%, 99.5%, 99.9% and 99.99%, with preferred p-values ​​being less than about 0.1, 0.05, 0.025, 0.02, 0.01, 0.005, 0.001 or 0.0001. Each possibility represents a separate embodiment of the present invention. According to some embodiments, the p-value of the threshold score is at most 0.05.

[0173] As used herein, the term "about" when referring to a measurable value is meant to encompass a variation of + / - 10% from the stated value, more preferably + / - 5%, even more preferably + / - 1%, and even more preferably + / - 0.1%.

[0174] In some embodiments, the method further comprises comparing the signal ratio calculated between a given restriction locus and a control locus to its corresponding normal / healthy reference ratio to obtain a probability score, wherein detecting a low probability score for said ratio with respect to the corresponding healthy reference ratio indicates that the subject has the disease for which the analysis was performed.

[0175] In some embodiments, the diagnostic sensitivity of the methods disclosed herein may be at least about 75%. In some embodiments, the diagnostic sensitivity of the methods may be at least about 80%. In some embodiments, the diagnostic sensitivity of the methods may be at least about 85%. In some embodiments, the diagnostic sensitivity of the methods may be at least about 90%.

[0176] In some embodiments, the "diagnostic sensitivity" of a diagnostic assay as used herein refers to the percentage of diseased individuals who are diagnosed as positive (percent of "true positives"). Thus, diseased individuals not detected by the assay are "false negatives". Subjects who are not diseased and test negative in the assay are called "true negatives". The "specificity" of a diagnostic assay is 1 minus the false positive rate, where the "false positive" rate is defined as the proportion of those without the disease who are diagnosed as positive. While a particular diagnostic method cannot provide a definitive diagnosis of a condition, it is sufficient if the method provides a positive indication that aids in diagnosis.

[0177] In some embodiments, the diagnostic specificity of the methods disclosed herein may be at least about 65%. In some embodiments, the diagnostic specificity of the methods may be at least about 70%. In some embodiments, the diagnostic specificity of the methods may be at least about 75%. In some embodiments, the diagnostic specificity of the methods may be at least about 80%.

[0178] Establishing the Diagnosis In some embodiments, after identifying the disease in question according to the methods of the invention, the subject may undergo a definitive diagnosis of the disease, which may be performed, for example, by biopsy.

[0179] process In some embodiments, after identifying the disease in question according to the methods of the invention, the subject can be administered a suitable treatment for that disease. Thus, in some embodiments, a method of treatment is provided that includes identifying a disease in a human subject according to the methods of the invention and administering a suitable treatment to the subject.

[0180] Systems and Kits In some embodiments, provided herein are systems for detecting methylation changes in a DNA sample. In some embodiments, provided herein are kits for detecting methylation changes in a DNA sample.

[0181] In some embodiments, the systems and kits are for detecting methylation changes in DNA samples according to the methods of the present invention.

[0182] In some embodiments, a system according to the invention includes (a) a DNA sample, where the DNA sample is substantially devoid of ssDNA (e.g., comprises less than 5% single stranded DNA (ssDNA), e.g., less than 1% ssDNA), and (b) components for performing a methylation ratio analysis.

[0183] As used herein, "components" for performing methylation ratio analysis include biochemical components (e.g., enzymes, primers, nucleotides), chemical components (e.g., buffers, probes), and technical components (e.g., PCR systems, equipment such as tubes, vials, plates, pipettes, and computer software stored on computer readable media, computer processors, etc.).

[0184] In some embodiments, the components for performing methylation ratio analysis include components including: (i) at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease for digesting the DNA sample; (ii) a plurality of primer pairs for co-amplifying a plurality of genomic loci from the DNA sample after digestion, wherein the plurality of genomic loci include at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus; and (iii) computer software stored on a non-transitory computer readable medium, wherein the computer software instructs a computer processor to determine methylation changes in the DNA sample based on a comparison of a ratio of signal intensities of the restriction loci and the control loci after amplification to a reference ratio.

[0185] In some embodiments, the components for performing methylation ratio analysis include machines for performing the amplification and detection steps, such as a PCR machine (e.g., a real-time PCR machine) and / or an NGS machine.

[0186] In some embodiments, the components for performing a methylation ratio analysis include a plurality of polynucleotide probes for detecting amplification products of at least one restriction locus and at least one control locus.

[0187] In some embodiments, the system comprises a processor configured to perform the following: determining a methylation change in the DNA sample based on a comparison of a ratio of signal intensities of said restriction loci and said control loci after amplification to a reference ratio, hi some embodiments, the processor is coupled to a memory device storing a plurality of reference ratios.

[0188] In some embodiments, a system according to the invention comprises: (a) at least one methylation-sensitive or at least one methylation-dependent restriction endonuclease for digesting a DNA sample, wherein the DNA sample is substantially devoid of ssDNA (e.g., contains less than 5% single-stranded DNA (ssDNA)); (b) a plurality of primer pairs for co-amplifying a plurality of genomic loci from the DNA sample following digestion with the restriction endonuclease of (a), wherein the plurality of genomic loci include at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus; and (c) computer software stored on a non-transitory computer readable medium, wherein the computer software instructs a computer processor to determine a methylation change in the DNA sample based on a comparison of a ratio of signal intensities of the restriction locus and the control locus following amplification to a reference ratio, wherein the methylation change is determined with a detection sensitivity of at least 1:100.

[0189] In some embodiments, a kit or system according to the invention comprises a DNA extraction reagent for extracting DNA from a biological sample such that the extracted DNA is substantially devoid of ssDNA, e.g., contains less than 5% ssDNA, e.g., less than 1% ssDNA.

[0190] In some embodiments, a kit or system according to the invention includes components necessary for DNA digestion, such as one or more buffers, in addition to a restriction enzyme.

[0191] In some embodiments, a kit or system according to the invention includes, in addition to primers, components necessary for amplification of a locus, such as a DNA polymerase, a nucleotide mixture, and buffers.

[0192] In some embodiments, a kit or system according to the invention comprises components necessary for detection of the amplification products, such as a polynucleotide probe, for example a fluorescently labeled polynucleotide probe.

[0193] In some embodiments, the kit or system according to the invention further comprises instructions for performing detection of methylation changes using computer software stored on a non-transitory computer readable medium, the computer software instructing the computer processor to perform the steps of determining signal intensities of the at least one restriction locus and the control locus after their amplification, calculating a signal ratio between the signal intensities of each of the at least one restriction locus and the control locus, comparing the calculated signal ratio with at least one reference ratio, and outputting based on the comparison whether the DNA sample is a normal DNA sample or a DNA sample derived from a diseased cell, such as a tumor cell.

[0194] In some embodiments, the kit or system further comprises a non-transitory computer readable medium storing computer software that instructs a computer processor to perform the steps of determining signal intensities of at least one restriction locus and a control locus after their amplification, calculating a signal ratio between the signal intensities of each of the at least one restriction locus and the control locus, comparing the calculated signal ratio with at least one reference ratio, and outputting, based on the comparison, whether the DNA sample is a normal DNA sample or a DNA sample derived from a diseased cell, such as a tumor cell.

[0195] In some embodiments, the computer software according to the invention receives input parameters or raw data of a real-time PCR run. In some embodiments, the computer software instructs a computer processor to analyze the real-time PCR run to determine signal intensities and signal ratios.

[0196] In some embodiments, the computer software according to the present invention receives as input the sequence reads of the NGS run. In some embodiments, the computer software instructs the computer processor to analyze the NGS run to determine signal intensities and signal ratios.

[0197] The computer software includes processor executable instructions stored on a non-transitory computer readable medium. The computer software may also include stored data. The computer readable medium is a tangible computer readable medium, such as a compact disc (CD), a magnetic storage device, an optical storage device, a random access memory (RAM), a read-only memory (ROM), or any other tangible medium of expression.

[0198] It will be understood that the computer-related methods, steps, and processes described herein are implemented using software stored in non-volatile or non-transitory computer-readable instructions that, when executed, are configured to perform or instruct a computer processor or computer to perform instructions.

[0199] Each of the systems, servers, computing devices, and computers described herein can be implemented in one or more computer systems and configured to communicate over a network. They can also all be implemented in a single computer system. In one embodiment, the computer system includes a bus or other communication mechanism for communicating information, and a hardware processor coupled with the bus for processing information.

[0200] The computer system also includes a main memory, such as a random access memory (RAM) or other dynamic storage device, coupled to the bus for storing information and instructions executed by the processor. The main memory may also be used to store temporary variables or other intermediate information during execution of instructions executed by the processor. Such instructions, when stored in a non-transitory storage medium accessible to the processor, render the computer system into a specialized device customized to perform the operations specified in the instructions.

[0201] The computer system further includes a read only memory (ROM) or other static storage device coupled to the bus for storing static information and instructions for the processor. A storage device, such as a magnetic disk or optical disk, is provided and coupled to the bus for storing information and instructions.

[0202] The computer system may be coupled via the bus to a display for displaying information to a computer user.

[0203] Input devices, including alphanumeric and other keys, are coupled to the bus for communicating information and command selections to the processor. Another type of user input device is a cursor control, such as a mouse, trackball, or cursor direction keys, for communicating directional information and command selections to the processor and for controlling cursor movement on a display.

[0204] According to one embodiment, the techniques herein are performed by a computer system in response to a processor executing one or more sequences of one or more instructions contained in a main memory. Such instructions may be read into the main memory from another storage medium, such as a storage device. Execution of the sequence of instructions contained in the main memory causes the processor to perform the process steps described herein. In alternative embodiments, hardwired circuitry may be used in place of or in combination with software instructions.

[0205] The term storage medium as used herein refers to any non-transitory medium that stores data and / or instructions that cause a machine to operate in a specific manner. Common forms of storage medium include, for example, floppy disks, flexible disks, hard disks, solid state drives, magnetic tapes or any other magnetic data storage medium, CD-ROMs, any other optical data storage medium, any physical medium with a pattern of holes, RAM, PROMs, and EPROMs, FLASH-EPROMs, NVRAMs, any other memory chips, or cartridges.

[0206] Storage media are distinct from but may be used in conjunction with transmission media, which participate in transferring information to and from the storage media. For example, transmission media include coaxial cables, copper wire and fiber optics, including the wires that comprise a bus.

[0207] The following examples are presented to more fully illustrate certain embodiments of the present invention. However, they should in no way be interpreted as limiting the broad scope of the present invention. Those skilled in the art can easily devise many variations and modifications of the principles disclosed herein without departing from the scope of the present invention. EXAMPLES

[0208] Example 1 - Effect of single-stranded DNA on digestion efficiency The detection of methylation changes according to the present invention is based on methylation-sensitive or methylation-dependent enzymatic digestion of DNA, followed by amplification of the target locus, and analysis of the amplified signal. In the next experiment, the variation in digestion efficiency was tested when variable amounts of single-stranded DNA were added to double-stranded DNA samples. The digestion efficiency was evaluated by the effect of various amounts of single-stranded DNA on the ΔCq between the test locus and the control locus using real-time PCR. The digestion efficiency reflects the ability of the assay to accurately detect methylation changes.

[0209] Experimental procedure Double-stranded DNA from the A-673 cell line was spiked with increasing proportions of synthetic single-stranded DNA oligonucleotides corresponding to the following lung cancer-associated genomic loci: [Table 1]

[0210] This lung cancer test locus was previously disclosed in commonly assigned WO2019 / 142193. It contains a recognition sequence for the methylation-sensitive restriction enzyme HhaI. Because DNA from the A-673 cell line is not methylated at this test locus, DNA from this cell line is expected to be extensively cleaved by HhaI at the test locus.

[0211] The spiked samples, as well as a sample of pure single-stranded DNA ("100% single-stranded DNA"), and a sample of DNA from A-673 cells not spiked with ssDNA ("100% double-stranded DNA"), were subjected to methylation-sensitive enzyme digestion. The enzyme digestion was carried out at 37°C for 2 hours, followed by heat inactivation of the enzyme at 65°C for 20 minutes.

[0212] Real-time PCR was then performed on the digested samples to amplify the test loci detailed above and the control loci shown below in each sample. [Table 2]

[0213] A control locus is a locus that does not contain the recognition sequence for HhaI and remains intact when a DNA sample is digested with HhaI, regardless of methylation status.

[0214] After digestion, each digested sample had a primer pair added to amplify the test and control loci. Each amplification reaction (total volume of 25 microliters) further contained dNTPs, DNA polymerase, and reaction buffer. Fluorescently labeled polynucleotide probes (one for each locus) were added to the reaction to allow detection of the amplified products during amplification. Real-time PCR reactions were performed on an ABI 7500 FastDx instrument using the following PCR program: 95°C, 10 min -> 45X (95°C, 15 s) -> 60°C, 1 min.

[0215] Following amplification, data regarding the level of fluorescent signal from the probe as a function of cycle number were analyzed to calculate the cycle of quantification (Cq) for each locus and ΔCq, i.e., the difference between the Cq of the test locus and the Cq of the control locus.

[0216] result The results are summarized in Table 1 and Figure 1. The ΔCq between the test and control loci in the 100% single-stranded DNA sample was 7.51 cycles, whereas there was no visible amplification at the test loci in the 100% double-stranded DNA sample. This corresponds to a ΔCq of over 18 cycles between the test and control loci. As the percentage of single-stranded DNA in the sample decreased, the ΔCq between the test and control loci increased.

[0217] An increase in ΔCq reflects more efficient digestion of the test locus when less ssDNA is present: when less ssDNA is present, more DNA is digested, resulting in an increase in the Cq of the test locus compared to the Cq of the control locus (an increase in the cycle number at which a detectable amplification product appears in the assay for the test locus compared to the cycle number at which a detectable amplification product appears for the control locus).

[0218] [Table 3]

[0219] This experiment shows that the presence of single-stranded DNA in the sample impairs the digestion efficiency. The digestion efficiency reflects the ability of the assay to accurately detect methylation changes. This effect is proportional to the amount of single-stranded DNA in the sample. This effect is observable from 6.25% of single-stranded DNA in the sample.

[0220] Example 2 - Detection of methylation changes at lung cancer-associated genomic loci In the next experiment, the effect of the presence of ssDNA in a DNA sample on the ability to detect methylation changes at lung cancer-associated genomic loci by the methylation ratio analysis described herein is tested. The lung cancer-associated restriction loci previously disclosed in WO2019 / 142193, assigned to the applicant of the present invention, comprise the sequences set forth below as SEQ ID NOs: 1-6.

[0221] [Table 4]

[0222] Plasma samples are taken from subjects without lung cancer. DNA in plasma samples from subjects without lung cancer is largely unmethylated at the six restriction loci mentioned above. DNA is extracted from the plasma samples using a QIAamp® Circulating Nucleic Acid Kit (QIAGEN, Hilden, Germany). This extraction procedure is carried out using non-denaturing reagents at temperatures below 60°C.

[0223] The extracted DNA is divided into aliquots, each spiked with a different percentage of synthetic single-stranded DNA oligonucleotides corresponding to each of the restriction loci listed above, as follows: "0 ssDNA" (no ssDNA), 0.1%, 1%, and 10% ssDNA. Each aliquot is then subjected to methylation ratio analysis, as follows: Each aliquot is digested with the methylation-sensitive restriction endonuclease HhaI. The digestion reaction (total volume 100 microliters) contains 80 microliters of extracted DNA (not quantified) and HhaI in digestion buffer. The digestion is carried out at 37°C for 2 hours.

[0224] Real-time PCR is then performed on the digested aliquots to amplify in each aliquot the six restriction loci detailed above and the control locus shown in SEQ ID NO:7. [Table 5]

[0225] A control locus is a locus that does not contain a recognition sequence for HhaI and remains intact when DNA samples are digested with the restriction enzyme, regardless of methylation status.

[0226] After digestion, each digested aliquot is divided into three subaliquots containing 12 microliters. Each subaliquot is supplemented with primer pairs to amplify two of the six restriction loci and a control locus (the control locus is amplified in all subaliquots). Amplicons of 77 to 139 bases are amplified. Each amplification reaction (total volume of 30 microliters) additionally contains dNTPs and reaction buffer. Fluorescently labeled polynucleotide probes (one for each locus) are added to the reaction to allow detection of the amplification products during amplification. The following fluorescent labels are used: FAM, JOE, ROX. Real-time PCR reactions are performed on an ABI 7500 FastDx instrument using the following PCR program: 95 °C, 10 min -> 45X (95 °C, 15 s) -> 60 °C, 1 min.

[0227] Following amplification, data regarding the level of fluorescent signal from the probe as a function of cycle number are analyzed to calculate the cycle of quantification (Cq) for each locus and the ΔCq (the difference between the Cq of the restriction locus and the Cq of the control locus) for each restriction locus.

[0228] For each sample, calculate the ratio between the signal intensity of each of the restriction loci 1-6 (SEQ ID NO: 1-6) and the signal intensity of the control locus (SEQ ID NO: 7) as follows: Determine Cq for each restriction locus and the control locus. Use the Cq values ​​in the following formula: 2 (対照遺伝子座のCq-制限遺伝子座のCq)。

[0229] The value obtained for each restriction locus with respect to the control locus represents the signal ratio (reflecting the methylation ratio) between this restriction locus and the control locus. In total, six signal ratios were calculated for each sample.

[0230] A score is then calculated for each locus for each sample. This score is the signal ratio normalized to the reference ratio, such that the highest signal ratio is "100" and the lowest signal ratio is "0". The six scores obtained for each sample are combined into one score, called "EpiScore", which is a number between 0 and 100 and reflects the overall relative methylation level of the sample at the panel of six restricted loci. If the EpiScore is equal to or greater than 70 (a threshold determined based on information from a series of previous samples), the sample is classified as "lung cancer" and if the EpiScore is less than 70, it is classified as "healthy".

[0231] The EpiScore calculated for the "0 ssDNA" sample represents the score of the original DNA sample after extraction. This sample is largely unmethylated at the restriction loci mentioned above, resulting in a very low EpiScore. The EpiScore calculated for the "0 ssDNA" sample is compared to the EpiScore calculated for the sample spiked with single-stranded DNA to show the impact of the presence of ssDNA in the DNA sample on the accuracy of the EpiScore and therefore on the ability of the assay to correctly distinguish between healthy and diseased DNA (in this case lung cancer DNA).

[0232] Example 3 - Analytical Sensitivity The analytical sensitivity of the assay was tested on a mixture of methylated and unmethylated DNA species.

[0233] material and method Unmethylated DNA The unmethylated DNA contained two DNA fragments (the test locus and an internal standard, control locus), each of which was amplified by PCR from human cell line HCT-15 DNA and cloned separately into pGEM-T Easy vector (Promega). Plasmid DNA was extracted using a QIAGEN Plasmid Mini Kit to obtain a DNA sample essentially free of single-stranded DNA (ssDNA) and quantified using a NanoDrop. Purified plasmid DNA was sequenced to confirm the inserted sequence. Equimolar amounts of both plasmid species were combined to create the sample of unmethylated DNA used in the experiments.

[0234] Methylated DNA Methylated DNA consisted of DNA extracted from the HCT-15 cell line. Cells were purchased from Sigma-Aldrich and cultured for 38 generations before harvesting. DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega) to obtain DNA samples essentially free of ssDNA. Extracted DNA was quantified using a NanoDrop.

[0235] Bisulfite sequencing Both methylated and unmethylated DNA samples were treated with sodium bisulfite using the EpiTect Bisulfite Kit (QIAGEN). Following bisulfite conversion, the test locus was amplified from both DNA species. PCR products were then purified using the QIAquick PCR Purification Kit (QIAGEN) and sequenced.

[0236] A mixture of methylated and unmethylated DNA Mixtures were constructed by adding appropriate amounts of methylated and unmethylated DNA to create the desired molar ratio.

[0237] DNA digestion 80 μl of each DNA sample was digested in a total volume of 100 μl with 5 μl HinP1I (New England Biolabs), 10 μl CutSmart buffer (New England Biolabs), and 5 μl DDW. Digestion was carried out at 37° C. for 2 hours followed by heat inactivation at 65° C. for 20 minutes.

[0238] Real-time PCR Each PCR well contained 0.6 μl AmpliTaq Gold (Thermo Fisher), 3 μl Buffer I (Thermo Fisher), 0.6 μl 10 mM dNTP mix (Sigma-Aldrich), 0.2 μM of each primer (test locus forward, test locus reverse, internal reference forward, internal reference reverse), 0.4 μM test probe, 0.2 μM internal reference probe, and 12 μl of digested DNA sample for a total of 30 μl. PCR was performed on a 7500 Fast Dx real-time PCR instrument (Thermo Fisher) using the following PCR program: 95°C for 10 min, followed by 45 cycles of 95°C for 15 s and 60°C for 1 min.

[0239] Signal Analysis The fluorescence data of the sds file output from the real-time PCR instrument was analyzed by a dedicated software. For each locus, a Cq (quantification cycle) value was calculated, which is equal to the cycle at which the fluorescence data of the locus crossed a threshold of 50,000 fluorescence units. For each well, a ΔCq value was calculated, which is equal to the Cq of the test locus minus the Cq of the internal reference locus.

[0240] result Assay description The assay involves three sequential steps: digestion, amplification, and analysis. In the first step, a DNA sample substantially free of ssDNA is digested with a methylation-sensitive restriction enzyme. An aliquot of the digested DNA is then subjected to real-time PCR amplification in which two genomic loci are co-amplified. The first locus for which methylation levels are analyzed is referred to as the "test locus" or "restriction locus" and contains at least one recognition sequence for the restriction enzyme used in the digestion step. The second locus is a control locus, referred to herein as the "internal reference," and does not contain a recognition sequence for the restriction enzyme used in the digestion step. The extent of digestion of the test locus in the digestion step is dependent on its methylation level: the higher the resulting level of methylation, the less digestion occurs. Thus, a higher level of methylation results in more template for real-time PCR, which in turn results in a lower Cq value (detectable amplification product is seen after a relatively small number of amplification cycles). In contrast, a low methylation level leads to more extensive digestion, less template for real-time PCR, and a higher Cq value (detectable amplification product is seen after more amplification cycles). The internal reference is not recognized by the restriction enzyme and therefore remains intact regardless of the methylation level. The amplification signals (Cq values) of the two loci are differentiated during PCR by using different fluorophores for the respective probes. In a third step, the signals are analyzed by dedicated software. This software determines the ΔCq between the test locus and the internal reference locus.

[0241] In the current experiments, the test locus was a human genomic locus on chromosome 5 that is differentially methylated between lung cancer tissue and normal lung tissue, and is largely unmethylated in normal human plasma. AGTAGCGCCCACTGAGCGGTTTTTCAGTTGCTGCACCGTTCTTAGCGCCCAACGGAACGTTTCCCGTACGCGGAGTCCATAAGTT (SEQ ID NO: 1)

[0242] A locus on human chromosome 7 was used as an internal reference: AGACTAACTTTTCTCTTGTACAGAATCATCAGGCTAAATTTTTGGCATTATTTCAGTCCT (SEQ ID NO: 7)

[0243] Analytical sensitivity of the assay To determine the analytical sensitivity of the assay, a mixture of methylated and unmethylated DNA samples in different ratios was analyzed. DNA from the human cell line HCT-15 was used as the source of methylated DNA samples because it is methylated at the test loci as determined by bisulfite sequencing (Figure 2A, upper panel).

[0244] The unmethylated DNA sample was constructed from a mixture of two bacterial plasmid DNA samples, containing the test locus and an internal reference locus as inserts. The fact that E. coli used to generate the plasmid DNA lacks CpG methyltransferase ensures that the plasmid DNA is completely unmethylated at the test locus, as verified by bisulfite sequencing (Figure 2A, lower panel). Methylated and unmethylated DNA species were then mixed in molar ratios of 1:8, 1:64, 1:512, 1:4096, 1:32768, and 1:200,000 methylated:unmethylated DNA, and these mixtures were analyzed using the assay described above. In each PCR well, the number of unmethylated DNA template molecules was 4,000,000, and the number of methylated DNA molecules varied from 500,000 in the 1:8 mixture to 20 molecules in the 1:200,000 mixture.

[0245] Figure 2B shows the amplification plots of the DNA mixtures. For a mixture of DNA with a molar ratio of 1:8, the ΔCq between the test locus and the internal reference locus is approximately 3 cycles. With increasing ratios between methylated and unmethylated DNA samples, the ΔCq also increases, reaching 18.75 cycles for a 1:200,000 mixture. The calculated ΔCqs were plotted against the expected ΔCqs (expected ΔCq for methylation level x=-log2(x)), assuming 100% PCR efficiency at both the test locus and the internal reference locus, and a linear regression was performed using the least squares method, with the resulting fit being an R of 0.9966. 2 values ​​(Figure 3), demonstrating that the actual methylation levels can be determined from ΔCqs.

[0246] In the next step, to show that the assay could consistently detect methylated molecules with a background of unmethylated molecules at a ratio of 1:200,000, a mixture of DNA samples in this ratio was tested in 34 separate PCR reactions (replicates). Each well contained 10 methylated (from HCT-15) and 2,000,000 unmethylated (from plasmid DNA) test locus template molecules, and the signal was compared to 34 PCR reactions containing only 2,000,000 unmethylated DNA molecules per well that did not contain any methylated DNA template molecules. Figure 4A-B shows the amplification plots of this experiment. In all 34 replicates containing a mixture of methylated and unmethylated DNA samples, the test locus was successfully amplified (Figure 4A), whereas in all 34 replicates containing only unmethylated DNA, no amplification of the test locus was observed (Figure 4B).

[0247] The overall detection rate was 100.0% (68 / 68). The lower limit of the one-sided exact binomial 95% confidence interval (CI) was 95.69%, which means we are 95% confident that the true overall detection rate is higher than 95.69%. The positive and negative detection rates were both 100.0% (34 / 34). The lower limit of the one-sided exact binomial 95% CI was 91.57%, which means we are 95% confident that the true positive and negative detection rates are higher than 91.5%.

[0248] In this work, we describe a simple and ultrasensitive assay that can detect methylation levels as low as 1:200,000. Such high sensitivity can be useful for liquid biopsy samples where tumor DNA is present in very small amounts compared to a background consisting mostly of normal DNA. The clinical utility of a methylation assay with extreme sensitivity is also limited by the amount of input DNA that can be analyzed, the level of background biological noise (i.e., the typical level of methylation obtained from control samples), and the level of biological signal (i.e., the proportion of patients whose tumors show abnormal methylation patterns). The amount of input DNA sets an upper limit for the practical sensitivity that can be achieved with the assay. For example, a typical sample of 10 ml of venous blood usually produces only about 35 ng of cell-free DNA from 3-4 ml of plasma, which corresponds to about 10,000 haploid genome copies. The average number of genome copies analyzed in each well according to the assay of the present invention is about 1,000, setting the highest level of sensitivity achievable with this configuration at about 1:1000, or 0.1%.

[0249] Example 4 - DNA extraction and detection of methylation changes at lung cancer-associated genomic loci Detection of methylation changes at lung cancer-associated genomic loci in DNA samples extracted from plasma samples is performed as described in Example 1. Extraction of DNA from plasma samples is performed by organic DNA extraction to obtain DNA samples containing less than 1% ssDNA as follows: - Place 1 ml of plasma into a tube (15 ml or 50 ml tube). -Add 500μl extraction buffer (300mM Tris pH 8.0, 30mM EDTA, 300mM NaCl, 6% SDS), 30μl proteinase K (20mg / ml) and 15μl 390nM DTT to the tube. - Seal the tube (e.g. with Parafilm) and incubate at 56°C for 2 hours. - In a chemical hood, add 1.5 ml of a mixture of phenol:chloroform:isoamyl alcohol (25:24:1) that has been equilibrated overnight to 2-8°C. - Seal the tube (e.g. with Parafilm) and shake (vortex) for 30 seconds. - Separate the phases (centrifuge, 3 min, 10,000 g). - In a chemical hood, transfer the aqueous phase to another tube and add an equal volume of a mixture of chloroform:isoamyl alcohol (24:1). - Seal the tube (e.g. with Parafilm) and shake (vortex) for 30 seconds. - Separate the phases (centrifuge, 3 min, 10,000 g). - Transfer the aqueous phase to another tube and add 0.1 volumes of 3M NaAc and 2-2.4 volumes of ethanol (absolute). - Incubate the tube at -20°C for 20 minutes. - Precipitate the DNA (centrifuge, 20 min, 17,000 g, 4°C). - Discard the ethanol / NaAc solution and wash the remaining sample with ethanol (70%). - Pellet the DNA (centrifuge, 15 min, 17,000 g, 4°C). - Discard the ethanol and dry the pellet. The pellet is resuspended in ddH2O or 0.04% NaN3 solution.

[0250] Example 5 - Next generation sequencing (NGS) based assays material and method Primer design for NGS library preparation - Part 1 の PCR To amplify cancer marker loci for NGS-based assays, primers were designed that contained the following overhang adapter sequences in addition to the locus-specific sequences: Forward primer overhang: 5'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG'3 (SEQ ID NO: 8) Reverse primer overhang: 5'GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG'3 (SEQ ID NO: 9)

[0251] The overhanging adapter sequence was 5' of the locus-specific sequence.

[0252] Either 0, 1, 2, or 3N nucleotides were added between the overhang adapter and the locus-specific sequence. This addition was done to ensure that all four bases were evenly distributed in each sequencing cycle. The addition of these N nucleotides was done in both the forward and reverse primers. Overall, there were four forward and four reverse primers for each locus.

[0253] In this experiment, four cancer methylation marker loci, a control locus, and the KRAS exon 2 locus were used.

[0254] The four cancer methylation marker loci are as follows: [Table 6]

[0255] These loci contain at least one recognition site for the methylation-sensitive restriction enzyme HhaI.

[0256] The control locus was the locus set forth above in SEQ ID NO: 7. This locus does not contain a recognition site for HhaI.

[0257] The primers for the KRAS locus are as follows: KRAS f: 5'TTAAAACAAGATTTACCTCTATTG'3 (SEQ ID NO: 10) KRAS r: 5'AAATGACTGAATATAAACTTGTGG'3 (SEQ ID NO: 11)

[0258] Sample selection and plasma preparation The study used eight healthy control plasma samples and nine cancer patient plasma samples.

[0259] Ten ml of blood was collected from each patient in EDTA blood tubes (Becton Dickinson). Each blood tube was centrifuged in a swinging bucket rotor at 1500 x g for 10 min at room temperature without brake. The plasma layer was then transferred to a new 15 ml tube and centrifuged again at 1500 x g for 10 min at room temperature without brake. Centrifugation was performed up to 4 h after blood collection to avoid lysis of lymphocytes (which would contaminate cell-free DNA).

[0260] DNA extraction DNA extraction from plasma samples was performed using an extraction kit (QIAamp Circulating Nucleic Acid Kit-Qiagen), which produces minimal single-stranded DNA during the extraction procedure, i.e., less than 5% ssDNA.

[0261] Plasma Separation Test Prior to proceeding to digestion, the extracted DNA was tested for contamination with lymphocyte DNA using a plasma separation assay, as described in co-pending application WO2019 / 162941, assigned to the present applicant. Such contamination may interfere with the signal of tumor cell-free DNA. Only samples that passed the plasma separation assay proceeded to library preparation.

[0262] DNA digestion The extracted cell-free DNA was subjected to methylation-sensitive digestion for 2 h at 37° C. The reaction was stopped by incubation at 65° C. for 20 min.

[0263] Library preparation for NGS analysis No. 1 の PCR-Locus Specific: The four cancer methylation marker loci, control loci, and KRAS locus were amplified from digested DNA samples in two multiplexes (three loci in each multiplex and a control locus amplified in each multiplex) using the 5' overhang adaptors described above and locus-specific primers containing 0-3 N nucleotides between the locus-specific sequence and the 5' overhang adaptor sequence. 10 μl of digested DNA was amplified in a 25-cycle PCR reaction using a high-fidelity DNA polymerase.

[0264] The DNA digested in this experiment contains high concentrations of magnesium. Magnesium is also usually present in the PCR reaction buffer for high-fidelity DNA polymerases. To avoid excess magnesium that may inhibit the PCR reaction, the magnesium concentration in the amplification reaction is adjusted according to the DNA polymerase used.

[0265] PCR purification: After locus-specific PCR, the PCR products were purified using AMPure XP beads (Beckman Coulter Genomics). After purification, the two multiplex PCR products for each sample were mixed.

[0266] Adding the second PCR-Illumina adapter and sample index: A second PCR was performed to add Illumina adaptors and sample indexes using primers from the Nextera NT Index Kit (Illumina).

[0267] Five μl from the mixture of two multiplex PCR products was used in an eight-cycle PCR reaction, which also contained 5 μl from each Nextera primer (N7 and S5) and 25 μl of KAPA HiFi HotStart Ready Mix (KAPA Biosystems).

[0268] PCR purification: After the second round of PCR, the PCR products were purified using AMPure XP beads (Beckman Coulter Genomics).

[0269] Quantification, dilution, and preparation of library pools: The purified products were quantified using a Qubit 3.0 fluorometer and a dsDNA High Sensitivity Assay Kit (Thermo Fisher Scientific). The PCR purified products were diluted to 1 nM.

[0270] 5 μl from each diluted purified product was polled together to create the polled library samples.

[0271] NGS execution DNA libraries were sequenced on an iSeq100 system (Illumina) using the iSeq100 reagent kit.

[0272] 45 pM of the polled library sample + 20% of the PhiX library (Illumina) was inserted into an iSeq100 flow cell.

[0273] Analysis of sequence reads For each sample, the read files were analyzed using the software as follows.

[0274] Target Assignment: The first 10 characters of each read were searched for an exact match to one of the targets. If such a match was found, the read's target score was increased by one.

[0275] The search action was repeated by shifting five letters in the read and searching the next 10 letters for an exact match to one of the targets. If such a match was found, the read's target score was increased by 1. This process was repeated until the read was terminated.

[0276] The target with the highest score (with minimum score=2) is the one selected for readout.

[0277] Locus determination: After the locus is assigned, the software examines the reads and detects reads that match the target perfectly, or that contain up to one point mutation, or an insertion / deletion of up to three consecutive nucleotides. These reads are moved to a folder with up to "One Mutation". All other reads assigned to this target locus are moved to a folder with "Two or more Mutations".

[0278] Mutation Analysis: In this experiment, a nucleotide substitution at the KRAS locus was defined as a “mutation” if ≥1% of reads in the “max 1 mutation” file contained a nucleotide substitution.

[0279] Relative copy number calculation: The relative copy number of each locus (from the "Maximum 1 mutation" folder) in each sample was calculated as follows: Relative copy number = number of reads at locus X / number of reads at control locus.

[0280] result NGS-based methylation assays can distinguish cancer from non-cancer patients Eight healthy control plasma samples and nine cancer patient plasma samples were analyzed for methylation using four cancer methylation markers and for KRAS mutations (G12, G13) with an NGS-based assay. The results are summarized in Figure 5. Methylation levels are expressed as the relative copy number of each marker (ratio of the number of reads of each methylation marker in each sample to the number of reads of the control locus in the sample). Figure 5 shows significant differences in the relative copy numbers of the four markers (corresponding to significant differences in methylation levels) between control and cancer samples. A mutation in KRAS was detected in one pancreatic cancer sample (G12->R). No KRAS mutations were detected in the control samples.

[0281] The results demonstrate that the NGS-based assay described herein can be used in combination with mutational analysis to detect methylation changes indicative of cancer.

[0282] The foregoing description of specific embodiments fully reveals the general nature of the present invention, so that others, by applying current knowledge, can easily modify and / or adapt to various uses of such specific embodiments without undue experimentation and without departing from the general concept, and therefore such adaptations and modifications should be understood within the meaning and range of equivalents of the disclosed embodiments, and are so intended. It should be understood that the expressions or terms used herein are for the purpose of description and not for the purpose of limitation. The means, materials, and steps for carrying out the various disclosed chemical structures and functions can take various alternative forms without departing from the present invention.

Claims

1. 1. A method for sensitively detecting methylation changes in a DNA sample, comprising: (a) providing a DNA sample, the DNA sample comprising less than 5% single-stranded DNA (ssDNA); (b) subjecting said DNA sample to methylation ratio analysis by digesting said DNA sample with at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease, co-amplifying from said digested DNA in a single reaction mixture at least one restriction locus that is differentially methylated between normal and disease DNA and at least one control locus, and comparing the ratio between the signal intensities of the respective amplification products of said at least one restriction locus and said control locus with at least one reference ratio; thereby detecting methylation changes in the DNA sample with a detection sensitivity of at least 1:

100.

2. 10. The method of claim 1, wherein the DNA is cell-free DNA extracted from a biological fluid sample.

3. The method of claim 2 , wherein the biological fluid sample is plasma, serum or urine.

4. 10. The method of claim 1, wherein the DNA sample contains less than 1% ssDNA.

5. 10. The method of claim 1, wherein the DNA sample contains less than 0.1% ssDNA.

6. 2. The method of claim 1, wherein the DNA sample contains less than 0.01% ssDNA or no ssDNA.

7. 2. The method of claim 1, wherein methylation changes are detected in the sample with a detection sensitivity of at least 1:

500.

8. 2. The method of claim 1, wherein methylation changes are detected in the sample with a detection sensitivity of at least 1:1,000.

9. 2. The method of claim 1, wherein detecting methylation changes comprises determining whether the DNA sample is a normal DNA or a diseased DNA sample.

10. 10. The method of claim 9, comprising determining whether the DNA sample is a normal DNA sample or a cancer DNA sample.

11. The method of claim 1, wherein the methylation ratio analysis in step (b) is performed using real-time PCR.

12. 2. The method of claim 1, wherein the methylation ratio analysis of step (b) is performed using next generation sequencing (NGS).

13. 2. The method of claim 1, comprising amplifying in step (b) a plurality of restriction loci that are differentially methylated between normal and disease DNA and a single control locus.

14. 1. A method for measuring the methylation ratio of DNA from a human subject, comprising: (a) providing a DNA sample from the human subject, the DNA sample comprising less than 5% single-stranded DNA (ssDNA); (b) subjecting the DNA sample to methylation ratio analysis by digesting the DNA sample with at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease, co-amplifying from the digested DNA at least one restriction locus that is differentially methylated between normal and disease DNA and at least one control locus in a single reaction mixture, and calculating a ratio between the signal intensities of the respective amplification products of the at least one restriction locus and the control locus using software stored in a non-transitory memory and executed on a computer processor; thereby measuring a methylation ratio of DNA from said human subject with a methylation detection sensitivity of at least 1:

100.

15. 1. A system for detecting methylation changes in a DNA sample, comprising: (a) a DNA sample, the DNA sample comprising less than 5% single-stranded DNA (ssDNA); (b) components for performing a methylation ratio analysis, the components including: (i) at least one methylation-sensitive restriction endonuclease or at least one methylation-dependent restriction endonuclease for digesting the DNA sample; (ii) a plurality of primer pairs for co-amplifying a plurality of genomic loci in a single reaction mixture from the DNA sample after digestion, the plurality of genomic loci including at least one restriction locus that is differentially methylated between normal DNA and disease DNA and at least one control locus; and (iii) computer software stored on a non-transitory computer readable medium, the computer software instructing a computer processor to determine methylation changes in the DNA sample based on a comparison of a ratio of signal intensities of the restriction loci and the control loci after amplification to a reference ratio; The methylation changes are determined with a detection sensitivity of at least 1:

100.

16. The system of claim 15 , wherein the DNA is cell-free DNA extracted from a biological fluid sample.

17. The system of claim 16 , wherein the biological fluid sample is plasma, serum or urine.

18. 16. The system of claim 15, wherein the DNA sample contains less than 1% ssDNA.

19. 16. The system of claim 15, wherein the DNA sample contains less than 0.1% ssDNA.

20. 16. The system of claim 15, wherein the DNA sample contains less than 0.01% ssDNA or no ssDNA.

21. 16. The system of claim 15, wherein the methylation changes are determined with a detection sensitivity of at least 1:

500.

22. 16. The system of claim 15, wherein the methylation changes are determined with a detection sensitivity of at least 1:1,000.

23. 16. The system of claim 15, wherein the plurality of loci comprises a plurality of restriction loci that are differentially methylated between normal and disease DNA and a single control locus.

24. 16. The system of claim 15, wherein the methylation changes are determined by performing the following steps: calculating signal intensities of the amplification products of the restriction loci and the control loci, calculating a ratio between the signal intensities of the amplification products, and comparing the calculated ratio to one or more reference ratios obtained from DNA samples of known source.

25. 16. The system of claim 15, wherein determining the methylation changes in the DNA sample comprises providing an indication of whether the DNA sample is a normal DNA or a diseased DNA sample.

26. 16. The system of claim 15, wherein determining the methylation changes in the DNA sample comprises providing an indication of whether the DNA sample is a normal DNA sample or a cancer DNA sample.

27. 16. The system of claim 15, wherein the components for performing a methylation ratio analysis further comprise a plurality of fluorescent probes for detecting the amplification products of the at least one restriction locus and the at least one control locus.

28. 16. The system of claim 15, further comprising a DNA extraction reagent for extracting DNA from a biological sample, wherein the extracted DNA comprises less than 5% ssDNA.

Images