Polyribonucleotides and cosmetic uses thereof

Abstract

To provide methods and compositions for delivering polyribonucleotides.SOLUTION: In some cases, methods and compositions provided herein are suitable for in vivo delivery of polyribonucleotides. Also disclosed herein is a cosmetic composition for delivery of the polyribonucleotide having cosmetic effects. The invention disclosed herein includes compositions, cosmetic compositions and methods for the delivery of the polyribonucleotide (e.g., cosmetic polyribonucleotide). In some embodiments, the compositions and cosmetic compositions comprises ethanol and the polyribonucleotide.SELECTED DRAWING: None

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application is a continuation of U.S. Provisional Patent Application No. 62 / 812,772, filed March 1, 2019. This application claims priority to and the benefit of US Pat. No. 6,399,433, the entire contents of which are incorporated herein by reference. Be absorbed. [Background technology]

[0002] Polyribonucleotides play an important role in biological processes such as gene expression, gene regulation, and cellular signaling. It is an important biomolecule for biological activity. Summary of the Invention [Means for solving the problem]

[0003] The invention described herein relates to polyribonucleotides (e.g., cosmetic polyribonucleotides). In some embodiments, the present invention includes compositions, cosmetic compositions, and methods for the delivery of a therapeutically effective amount of a medicament for treating a chronic condition. In another embodiment, the composition and the cosmetic composition include ethanol and a polyribonucleotide. In some embodiments, the composition and cosmetic composition include alcohol and polyribonucleotide. In an embodiment, the composition and cosmetic composition include a cell permeation agent and a polyribonucleotide. The method includes applying these compositions and cosmetic compositions to a surface area (e.g., an outer skin area) of a subject. This includes applying.

[0004] The invention described herein is a cosmetic polyribonucleotide that does not include any carrier. and a diluent. The cosmetic composition includes a cosmetic polyribonucleotide. The cosmetic composition may be applied to epithelial cells for delivery of the germicide to a surface area. It may then be applied to a surface area (eg, an outer skin portion).

[0005] In some embodiments, the cosmetic composition comprises a mixture of polyribonucleotides and ethanol. wherein ethanol comprises at least about 0.3% v / v to about 75% v / v of the mixture. In some embodiments, ethanol is at least about 0.3% v / v to about 7% v / v of the mixture. 0% v / v, at least about 0.3% v / v to about 60% v / v, at least about 0.3% v / v to about 50% v / v, at least about 0.3% v / v to about 40% v / v, at least about 30 %v / v to about 20%v / v, at least about 0.3%v / v to about 15%v / v, at least About 0.3% v / v to about 10% v / v, at least about 0.3% v / v to about 5% v / v, a little At least about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to about 0.5% In some embodiments, ethanol comprises at least about 0.5% of the mixture. %v / v to about 75%v / v, at least about 1%v / v to about 75%v / v, at least about 5 %v / v to about 75%v / v, at least about 10%v / v to about 75%v / v, at least about 15% v / v to about 75% v / v, at least about 20% v / v to about 75% v / v, at least At least about 30% v / v to about 75% v / v, at least about 40% v / v to about 75% v / v, At least about 50% v / v to about 75% v / v, at least about 60% v / v to about 75% v / v, Or at least about 70% v / v to about 75% v / v.

[0006] In some embodiments, the cosmetic composition comprises a mixture of polyribonucleotides and alcohol. wherein the alcohol comprises at least about 0.3% v / v to about 75% v / v of the mixture. In some embodiments, the alcohol comprises at least about 0.3% v / v to about 7% v / v of the mixture. 0% v / v, at least about 0.3% v / v to about 60% v / v, at least about 0.3% v / v to about 50% v / v, at least about 0.3% v / v to about 40% v / v, at least about 30 %v / v to about 20%v / v, at least about 0.3%v / v to about 15%v / v, at least About 0.3% v / v to about 10% v / v, at least about 0.3% v / v to about 5% v / v, a little At least about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to about 0.5% In some embodiments, the alcohol comprises at least about 0.5% of the mixture. %v / v to about 75%v / v, at least about 1%v / v to about 75%v / v, at least about 5 %v / v to about 75%v / v, at least about 10%v / v to about 75%v / v, at least about 15% v / v to about 75% v / v, at least about 20% v / v to about 75% v / v, at least At least about 30% v / v to about 75% v / v, at least about 40% v / v to about 75% v / v, At least about 50% v / v to about 75% v / v, at least about 60% v / v to about 75% v / v, Or at least about 70% v / v to about 75% v / v. Alcohols include methanol, ethanol, isopropanol, butanol, pentanol, Cetyl alcohol, ethylene glycol, propylene glycol, denatured alcohol, benzoyl Diethyl alcohol, specially denatured alcohol, glycol, stearyl alcohol, cetearyl Alcohol, menthol, polyethylene glycol (PEG)-400, ethoxylated fat Acid, hydroxyethyl cellulose, isopropyl alcohol, dimethylaminoethanol , Retinol, d-alpha-tocopherol, SD Alcohol, SD Alcohol 40 , C12-16, lauryl alcohol, myristyl alcohol, butylene glycol, and and propanediol.

[0007] In some aspects, the cosmetic composition comprises a mixture of polyribonucleotides and a cell permeation agent. wherein the cell permeabilization agent comprises at least about 0.3% v / v to about 75% v / v of the mixture. In some embodiments, the cell permeation agent is at least about 0.3% v / v to about 7% v / v of the mixture. 0% v / v, at least about 0.3% v / v to about 60% v / v, at least about 0.3% v / v to about 50% v / v, at least about 0.3% v / v to about 40% v / v, at least about 30 %v / v to about 20%v / v, at least about 0.3%v / v to about 15%v / v, at least About 0.3% v / v to about 10% v / v, at least about 0.3% v / v to about 5% v / v, a little At least about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to about 0.5% In some embodiments, the cell permeation agent comprises at least about 0.5% of the mixture. %v / v to about 75%v / v, at least about 1%v / v to about 75%v / v, at least about 5 %v / v to about 75%v / v, at least about 10%v / v to about 75%v / v, at least about 15% v / v to about 75% v / v, at least about 20% v / v to about 75% v / v, at least At least about 30% v / v to about 75% v / v, at least about 40% v / v to about 75% v / v, At least about 50% v / v to about 75% v / v, at least about 60% v / v to about 75% v / v, Or at least about 70% v / v to about 75% v / v. The cellular permeabilization agent is an alcohol. In some embodiments, the alcohol is methanol, Ethanol, isopropanol, butanol, pentanol, cetyl alcohol, ethyl Glycol, Propylene Glycol, Denatured Alcohol, Benzyl Alcohol, Specially Modified Alcohol, glycol, stearyl alcohol, cetearyl alcohol, menthol, Polyethylene glycol (PEG)-400, ethoxylated fatty acids, hydroxyethyl cell Lactose, isopropyl alcohol, dimethylaminoethanol, retinol, d-alf Artocopherol, SD alcohol, SD alcohol 40, c12-16, lauryl Alcohol, myristyl alcohol, butylene glycol, and propanediol In some embodiments, the polyribonucleotide is selected from the group consisting of: In some embodiments, the protein is a cosmetic protein. In some embodiments, the protein is a component of hair or eyelashes (e.g., keratin fibers), nails, or In some embodiments, the protein is a skin protein. In some embodiments, the cosmetic agent is a botulinum toxin, elastin, or a fragment thereof. The composition for use may be in the form of a liquid, gel, lotion, paste, cream, foam, serum, ointment, or spa. In some embodiments, the polyribonucleotide is a cosmetic polyribonucleotide. In some embodiments, the polyribonucleotide is a linear polyribonucleotide. In some embodiments, the polyribonucleotide is an mRNA. In some embodiments, the polyribonucleotide comprises a cap or a poly-A tail. In some embodiments, the polyribonucleotide is a cyclic polyribonucleotide. In some embodiments, the polyribonucleotide comprises modified ribonucleotides. In some embodiments, the cosmetic composition has a pH of about 7. In some embodiments, the cosmetic composition has a viscosity about the same as water. In some embodiments, the cosmetic composition is substantially free of hydrophobic or lipophilic groups. In some embodiments, the cosmetic composition is substantially free of cationic hydrocarbons. In some embodiments, the cosmetic composition is substantially free of fatty acid liposomes. Substantially free of lipids, liposomes, cholesterol, or any combination thereof. In some embodiments, the cosmetic composition comprises glycerin, propylene glycol, or a combination thereof. In some embodiments, the cosmetic composition is an anti-wrinkle composition. In some embodiments, the cell permeation agent is soluble in a polar solvent. In some embodiments, the cell permeation agent is insoluble in polar solvents.

[0008] In some aspects, the cosmetic composition comprises a polyribonucleotide and an alcohol, The alcohol is configured for topical administration. In some embodiments, the cosmetic composition comprises The cell-penetrating agent is configured for local administration. .

[0009] In some aspects, the cosmetic composition comprises a polyribonucleotide and an alcohol, The polyribonucleotide comprises a payload or a sequence encoding a payload and The load has a cosmetic effect on cells or tissue. In some embodiments, the cosmetic composition The polyribonucleotide comprises a payload and a cell penetrating agent. or a sequence encoding a payload, the payload having a cosmetic effect on a cell or tissue. In some embodiments, the payload is collagen, keratin, elastin, and a botulinum toxin, or any fragment thereof. Or a peptide.

[0010] In some aspects, the cosmetic composition comprises a polyribonucleotide and an alcohol, The polyribonucleotide is present in an amount effective to have a cosmetic effect on a cell or tissue. and the alcohol is present in an amount effective to have a cosmetic effect on the cell or tissue. In some aspects, the cosmetic composition comprises a polyribonucleotide and a cell permeation agent. the ribonucleotide is present in an amount effective to have a cosmetic effect on a cell or tissue; And the cell penetrating agent is present in an amount effective to have a cosmetic effect on a cell or tissue.

[0011] In some aspects, the cosmetic composition comprises a polyribonucleotide, an alcohol, and a topical agent. In some embodiments, the cosmetic composition comprises a delivery vehicle, and the topical delivery vehicle comprises a stabilizer. The article includes a polyribonucleotide, a cell penetrating agent, and a local delivery vehicle. In some embodiments, the stabilizer comprises glucose (4.5 g / L). include.

[0012] In some embodiments, the cosmetic composition is loaded with polyribonucleotides and alcohol. In some embodiments, the cosmetic composition comprises a biodegradable scaffold comprising a polyribonucleic acid. In some embodiments, the cell permeability agent comprises a biodegradable scaffold loaded with a cell permeability agent. The dispersing agent comprises an alcohol. In some embodiments, the alcohol is methanol, ethanol, or the like. Alcohol, isopropanol, butanol, pentanol, cetyl alcohol, ethylene glycol Recall, propylene glycol, denatured alcohol, benzyl alcohol, special denatured alcohol Cole, glycol, stearyl alcohol, cetearyl alcohol, menthol, poly Ethylene glycol (PEG)-400, ethoxylated fatty acids, hydroxyethyl cellulose Isopropyl alcohol, dimethylaminoethanol, retinol, d-alpha- Tocopherol, SD alcohol, SD alcohol 40, c12-16, lauryl alcohol The group consisting of choline, myristyl alcohol, butylene glycol, and propanediol In some embodiments, the alcohol is ethanol.

[0013] In some embodiments, the method of delivering cosmetic polyribonucleotides to a subject comprises the steps of: a) disinfecting the subject; b) applying the cosmetic polyribonucleic acid (PCA) to the outer skin area of ​​the subject; The method includes applying a cosmetic composition comprising a leotide and a diluent to the skin area. In embodiments, the disinfectant is alcohol, UV light, laser light, or heat.

[0014] In some embodiments, the method of delivering cosmetic polyribonucleotides to a subject comprises: a) administering to the subject an arsenic ion; b) applying a cosmetic polyriboflavin to the outer skin area of ​​a subject; The method includes applying a cosmetic composition comprising a nucleotide and a diluent to the skin area.

[0015] In some embodiments, the method of delivering polyribonucleotides to epithelial cells comprises any of the following: A cosmetic composition comprising a diluent and an unmodified cosmetic polyribonucleotide, the composition being free of any solvent. The method includes applying the composition to epithelial cells.

[0016] In some embodiments, the method of delivering polyribonucleotides to a subject comprises administering to a subject a cosmetic polyribonucleotide. applying a cosmetic composition comprising a mixture of nucleotides and ethanol to an outer skin area of ​​a subject; and wherein ethanol comprises at least about 0.3% v / v to about 75% v / v of the mixture. In an embodiment, the method of delivering polyribonucleotides to a subject comprises administering to a subject a cosmetic polyribonucleotide. applying a cosmetic composition comprising a mixture of leucine and alcohol to an outer skin area of ​​a subject; The alcohol comprises at least about 0.3% v / v to about 75% v / v of the mixture. In some embodiments, the method of delivering a polyribonucleotide to a subject comprises administering to a subject a cosmetic polyribonucleotide. applying a cosmetic composition comprising a mixture of a nucleotide and a cell-penetrating agent to an outer skin portion of a subject; wherein the cell permeabilization agent comprises at least about 0.3% v / v to about 75% v / v of the mixture. In some embodiments, the cosmetic composition comprises administering a cosmetic polyribonucleotide to the dermis of a subject. In some embodiments, the cosmetic composition is delivered to a cosmetic polyribonucleic acid (PCA) or epithelial tissue. The nucleotides are delivered non-iontophoretically to the dermal or epidermal tissue of a subject.

[0017] In some aspects, the method of delivering a cosmetic polyribonucleotide to a cell or tissue comprises: Contacting the cells or tissue with a mixture comprising a cosmetic polyribonucleotide and an alcohol. wherein the alcohol comprises at least about 0.3% v / v to about 75% v / v of the mixture. In some embodiments, a method for delivering cosmetic polyribonucleotides to a cell or tissue includes the steps of: The method comprises contacting a cell or tissue with a mixture comprising a cosmetic polyribonucleotide and a cell permeabilizing agent. wherein the cell permeabilizing agent comprises at least about 0.3% v / v to about 75% v / v of the mixture. occupies.

[0018] In some aspects, the method of delivering a cosmetic composition to a cell or tissue comprises administering to the cell or tissue a cosmetic composition comprising a cosmetic polyribonucleotide and an alcohol. In some embodiments, the cosmetic composition is The method of delivering to a cell or tissue comprises administering to the cell or tissue a cosmetic polyribonucleotide and a the cosmetic composition comprising a cell permeation agent, the cell permeation agent being configured for topical administration. It is done.

[0019] In some embodiments, the method of delivery of the cosmetic polyribonucleotide comprises administering the cosmetic polyribonucleotide to a subject. The method includes applying a mixture containing glycerol and alcohol to the outer skin area of ​​the subject. In some embodiments, the method of delivery of the cosmetic polyribonucleotide comprises administering the cosmetic polyribonucleotide to a subject. The method includes applying a mixture containing a tide and a cell permeation agent to an outer skin part of a subject. In embodiments, the cell permeation agent comprises an alcohol. is methanol, ethanol, isopropanol, butanol, pentanol, cetearyl alcohol Alcohol, ethylene glycol, propylene glycol, denatured alcohol, benzyl alcohol Cole, specially denatured alcohol, glycol, stearyl alcohol, cetearyl alcohol ethanol, menthol, polyethylene glycol (PEG-400), ethoxylated fatty acids, hydroxypropyl Hydroxyethylcellulose, isopropyl alcohol, dimethylaminoethanol, retinoic acid d-alpha-tocopherol, SD alcohol, SD alcohol 40, c12 -16, lauryl alcohol, myristyl alcohol, butylene glycol, and propane In some embodiments, the alcohol is selected from the group consisting of ethanol, In some embodiments, the ethanol, alcohol, or cell permeation agent is a mixture. At least about 0.3% v / v to about 70% v / v of the compound, at least about 0.3% v / v to about 60% v / v, at least about 0.3% v / v to about 50% v / v, at least about 0.3% v / v / v to about 40% v / v, at least about 30% v / v to about 20% v / v, at least about 0. 3% v / v to about 15% v / v, at least about 0.3% v / v to about 10% v / v, at least at least about 0.3% v / v to about 5% v / v, at least about 0.3% v / v to about 1% v / v, or In some embodiments, the enzyme comprises at least about 0.3% v / v to about 0.5% v / v. The ethanol, alcohol, or cell permeabilizing agent is at least about 0.5% v / v to about 7% v / v of the mixture. 5% v / v, at least about 1% v / v to about 75% v / v, at least about 5% v / v to about 7 5% v / v, at least about 10% v / v to about 75% v / v, at least about 15% v / v About 75% v / v, at least about 20% v / v to about 75% v / v, at least about 30% v / v v to about 75% v / v, at least about 40% v / v to about 75% v / v, at least about 50% v / v to about 75% v / v, at least about 60% v / v to about 75% v / v, or at least In some embodiments, the method further comprises: In some embodiments, the cosmetic polyribonucleotide is mixed with an alcohol. The method further includes mixing the cosmetic polyribonucleotide with a cell permeation agent. In some embodiments, the cosmetic polyribonucleotide is present in a solid form prior to mixing. In some embodiments, the cosmetic polyribonucleotide is lyophilized prior to mixing. In some embodiments, the cosmetic polyribonucleotide is present in liquid form prior to mixing. In some embodiments, the cosmetic polyribonucleotide is dissolved in a solvent prior to mixing. In some embodiments, the cosmetic polyribonucleotide is a payload or The payload comprises a sequence encoding a polypeptide that has a cosmetic effect on a cell or tissue. In some embodiments, the payload is selected from the group consisting of collagen, keratin, elastin, and bovine serum albumin. A cosmetic protein or peptide selected from the group consisting of turinum toxin, or any fragment thereof. In some embodiments, the cosmetic polyribonucleotide is a peptide that is capable of binding to cells. The composition is present in an amount effective to have a cosmetic effect, and the cell permeation agent is capable of imparting a cosmetic effect to a cell or tissue. In some embodiments, the cosmetic polyribonucleic acid is present in an amount effective to have a therapeutic effect. In some embodiments, the protein encodes a cosmetic tan. In some embodiments, the protein is a hair, skin, or nail protein. In some embodiments, the protein is collagen, keratin, elastin, botulinum toxin, or a fragment thereof. In some embodiments, the composition is a liquid, serum, , gel, lotion, paste, cream, foam, or stick. In form, the cosmetic polyribonucleotide is a linear polyribonucleotide. In some embodiments, the cosmetic polyribonucleotide is mRNA. In some embodiments, the cosmetic polyribonucleotide lacks a cap or a polyA tail. In embodiments, the cosmetic polyribonucleotide is immunogenic. In some embodiments, the cosmetic polyribonucleotide is non-immunogenic. In some embodiments, the polyribonucleotide is a cyclic polyribonucleotide. In some embodiments, the cosmetic polyribonucleotide comprises modified ribonucleotides. In some embodiments, the cosmetic composition has a pH of about 7. In some embodiments, the cosmetic composition comprises: In some embodiments, the cosmetic composition has a viscosity that is about the same as that of water. In some embodiments, the cosmetic composition is substantially free of a hydrophobic group. In some embodiments, the cosmetic composition is substantially free of cationic liposomes. In some embodiments, the cosmetic composition is substantially free of fatty acids, lipids, liposomes, In some embodiments, the composition is substantially free of glycerol, cholesterol, or any combination thereof. The cosmetic composition does not include glycerin, propylene glycol, or a combination thereof. In some embodiments, the cell permeation agent is soluble in a polar solvent. In some embodiments, the cell permeation agent is insoluble in a polar solvent. In some embodiments, the delivery is localized. In some embodiments, the integumentary portion includes skin, hair, or nails. In an embodiment, applying comprises placing a drop of the mixture directly onto the skin portion. In an embodiment, application involves applying the outer skin portion to a patch, gel, or film in which the mixture is embedded. In some embodiments, applying includes spraying the mixture onto the skin area. In some embodiments, the administering comprises administering the mixture to the subject by aerosolization. In some embodiments, the cells comprise epithelial cells. In the present study, cyclic polyribonucleotides have a higher molecular weight than their linear counterparts by at least 5% and at least 10%. %, at least 15%, at least 20%, at least 30%, at least 40%, at least at least 50%, at least 60%, at least 70%, at least 80%, at least 9 0%, at least 100%, at least 150%, at least 2x, at least 3x, less At least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, At least 9 times, at least 10 times, at least 20 times, at least 50 times, or at least In some embodiments, the circular polyribonucleotide has a translation efficiency that is 100 times higher. has at least 5-fold higher translation efficiency than its linear counterpart. The cosmetic polyribonucleotide has a short-term cosmetic effect. In some embodiments, Cosmetic polyribonucleotides have long-lasting cosmetic effects. In some embodiments, The concentration of the cosmetic polyribonucleotide in the mixture is at least about 50 ng / mL, and at least at least about 100 ng / mL, at least about 500 ng / mL, at least about 1 μg / mL, At least about 2 μg / mL, at least about 3 μg / mL, at least about 4 μg / mL, at least about 5 μg / mL, at least about 10 μg / mL, at least about 20 μg / mL, At least about 50 μg / mL, at least about 100 μg / mL, at least about 200 μg / mL, at least about 500 μg / mL, at least about 1 mg / mL, at least about 2 mg / mL g / mL, at least about 5 mg / mL, at least about 10 mg / mL, at least about 20 mg / mL, at least about 50 mg / mL, or at least about 100 mg / mL.

[0020] In some aspects, the kit comprises an application tool and a cosmetic product according to any one of the preceding embodiments. and an application tool configured to apply the cosmetic composition to an outer skin portion of a subject. can be.

[0021] In some embodiments, the kit comprises a first application tool, a second application tool, a fungicide, and A cosmetic composition comprising a cosmetic polyribonucleotide and a diluent, without any carrier. a first application tool configured to apply a fungicide to an outer skin portion of a target; and The application tool is configured to apply the composition to an outer skin portion of a subject. In embodiments, the disinfectant is alcohol, UV light, laser light, or heat. In an embodiment, the alcohol is methanol, ethanol, isopropanol, butanol, Pentanol, cetyl alcohol, ethylene glycol, propylene glycol, modified alkanol Alcohol, benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol , Cetearyl Alcohol, Menthol, Polyethylene Glycol (PEG-400), Ethoxylated fatty acids, hydroxyethyl cellulose, isopropyl alcohol, dimethyl a Aminoethanol, Retinol, d-Alpha-Tocopherol, SD Alcohol, SD Alcohol Alcohol 40, C12-16, Lauryl Alcohol, Myristyl Alcohol, Butylene In some embodiments, the carboxylic acid is selected from the group consisting of glycol, and propanediol. In some embodiments, the first application tool is a wipe. In some embodiments, the wipe contains a disinfectant. In some embodiments, the first application tool is a device that applies UV light or laser light. In some embodiments, the first application tool is a device for applying heat. be.

[0022] In some embodiments, the kit includes an application tool and a polyribonucleotide and cell permeabilization kit. and an application tool for applying the mixture to the outer skin portion of the subject, the application tool including a mixture containing an agent or alcohol. In some embodiments, the application tool or the second application tool is configured to In some embodiments, the application tool or the second application tool comprises a pipette. The method includes the steps of: (a) providing a substrate in which the mixture is embedded; and (b) providing a substrate in which the mixture is embedded. In some embodiments, the substrate is a natural or man-made fibers. In some embodiments, the application tool or the second application tool In some embodiments, the application tool or the second application tool comprises a patch. In some embodiments, the application tool or the second application tool includes a pipette. In some embodiments, the application tool or the second application tool comprises a tool pad. The skin is configured to release the mixture in a controlled manner. The part includes the skin, the nails, the eyelashes, or the hair.

[0023] In another aspect, the kit comprises a cosmetic composition described herein and an alcohol wipe. In another aspect, the kit comprises a cosmetic composition described herein and a surface area of ​​a subject. Includes a vial containing alcohol for application to the skin.

[0024] definition The present invention will be described with reference to specific embodiments and to certain drawings, but the present invention The present invention is not limited thereto, but only by the scope of the claims. Unless paragraphs are specified, they are to be understood in their general meaning.

[0025] As used herein, the term "polynucleotide" refers to one or more nucleic acid subunits. or a molecule containing nucleotides, interchangeably referred to as "nucleic acid" or "oligonucleotide" The polynucleotides may be used for the following: adenosine (A), cytosine (C), guanine ( one or more nucleotides selected from the group consisting of thymine (T) and uracil (U), or variants thereof; Nucleotides may include nucleosides and at least 1, 2, 3, 4, 5, It may contain 6, 7, 8, 9, 10 or more phosphate (PO3) groups. It consists of a nucleobase, a pentose sugar (either ribose or deoxyribose), and one or more ribosomal A ribonucleotide is a nucleotide in which the sugar is ribose. Ribonucleotides or ribonucleic acid, or RNA, are polymerized through phosphodiester bonds. Deoxyribonucleotides can refer to polymers that contain multiple ribonucleotides. A nucleotide whose sugar is deoxyribose. Polydeoxyribonucleotides Deoxyribonucleic acid, or DNA, is a set of nucleic acids that are polymerized through phosphodiester bonds. A nucleotide may refer to a polymer that contains oxyribonucleotides. The nucleotide may be a luminescent tag or marker (e.g., Deoxyadenosine triphosphate (dTPT) containing a detectable tag, such as a fluorophore. ATP), deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dG TP), uridine triphosphate (dUTP) and deoxythymidine triphosphate (dTTP) dN TP, such as deoxyribonucleoside triphosphates (dNTPs), The nucleotides may be deoxyribonucleoside polyphosphates. Such subunits may include any subunit that can be incorporated into the A, C, Specific for G, T, or U, or one or more of the complementary A, C, G, T, or U or a purine (i.e., A or G, or a variant thereof) or a pyrimidine (i.e., C, It may be any other subunit complementary to the ribozyme (T or U, or a variant thereof). In the examples, polynucleotides include deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or a derivative or variant thereof. To name a few, short interfering RNA (siRNA), microRNA (miRNA) , plasmid DNA (pDNA), short hairpin RNA (shRNA), small nuclear RNA A (snRNA), messenger RNA (mRNA), precursor mRNA (pre-mRNA) A) Antisense RNA (asRNA), which has a nucleotide sequence and a single-stranded or double-stranded structure. The present invention encompasses both the above-mentioned structural embodiments, including any of the above structural embodiments, such as triple-stranded, helical, hairpin, etc. In some cases, the polynucleotide molecule is circular. The nucleic acid molecule may have a length of at least 10 bases, 20 bases, 30 bases, 40 bases, 5 0 bases, 100 bases, 200 bases, 300 bases, 400 bases, 500 bases, 1 kilobases ( kb), 2kb, 3kb, 4kb, 5kb, 10kb, 50kb or longer The polynucleotide may be isolated from a cell or tissue. As described above, polynucleotide sequences may be derived from isolated and purified DNA / RNA molecules, synthetic This may include DNA / RNA molecules, as well as synthetic DNA / RNA analogues.

[0026] Polynucleotides, such as polyribonucleotides or polydeoxyribonucleotides The present invention relates to a method for the preparation of nucleic acids that include non-standard nucleotides, non-naturally occurring nucleotides, nucleotide analogs, and / or modified nucleotides. Modified nucleotides may include one or more nucleotide variants, including nucleotides such as are diaminopurine, 5-fluorouracil, 5-bromouracil, and 5-chlorouracil. , 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-( (carboxyhydroxymethyl)uracil, 5-carboxymethylaminomethyl-2-thio Uridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D -Galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylglucose inosine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylaminoguanine, Chiruguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methyl Guanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil Sil, beta-D-mannosylqueuosine, 5'-methoxycarboxymethyluracil , 5-Methoxyuracil, 2-Methylthio-D46-Isopentenyladenine, Uracil -5-oxyacetic acid (v), wybutoxocin, pseudouracil, queosine, 2-thiamine Ocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5 -Methyluracil, Uracil-5-oxyacetic acid methyl ester, Uracil-5-oxyacetic acid Acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxy propyl)uracil, (acp3)w, 2,6-diaminopurine, etc. In some cases, the nucleotide may include, but is not limited to, a modification to the triphosphate moiety. Non-limiting examples of such modifications include: For example, longer phosphate chains (e.g., 4, 5, 6, 7, 8, 9, 10 or more phosphate moieties) phosphate chains) and modifications with thiol moieties (e.g., alpha-thiotriphosphate and beta-thiotriphosphate). Nucleic acid molecules also include base moieties (e.g., usually complementary One or more atoms available to form hydrogen bonds with a suitable nucleotide and / or , one or more atoms that cannot form a hydrogen bond with a complementary nucleotide), sugar moiety or phosphate The nucleic acid molecule may also be modified at the backbone by N-hydroxysuccinimide esters (NHS Aminoallyl-dUTP (aa-dU) allows for the covalent attachment of amine-reactive moieties such as TP) and aminohexylacrylamide-dCTP (aha-dCTP) Modification groups may be included. Standard DNA base pairs or R Alternatives to NA base pairs offer higher density in bits per cubic mm, greater security ( Resistant to accidental or deliberate synthesis of natural toxins), light-programmed polymerase This may provide easier discrimination in enzymes or reduced secondary structure. Such alternative base pairs compatible with native and mutant polymerases for synthesis are Betz K, Malyshev DA, incorporated herein by reference for this purpose. , Lavergne T, Welte W, Diederichs K, Dwyer T J, Ordoukhanian P, Romesberg FE, Marx A. Nat .Chem.Biol.2012 Jul;8(7):612-4.

[0027] Polyribonucleotides can exist in either linear or circular form. When used, the terms "linear RNA" or "linear polyribonucleotide" are used interchangeably. It is used to mean a polyribonucleotide having free 5' and 3' ends. In embodiments, a linear RNA has a free 5' or 3' end. In this case, the term "circRNA" or "circular polyribonucleotide" or "circular RNA" is used. are used interchangeably to refer to polyribonucleic acid that forms a ring structure by covalent or non-covalent bonds. In some cases, a circular polyribonucleotide refers to a corresponding The typical free 5' and 3' ends of a linear polyribonucleotide are bound covalently or non-covalently. Either by bond or via a non-nucleic acid linker (e.g., a non-nucleic acid polymer or protein). In some cases, the present invention relates to a method for manufacturing a cellular membrane comprising the steps of: The provided circular polyribonucleotides are formed by contiguous loops linked together via covalent or non-covalent bonds. Two or more linear polyribonucleotides that are linked together to form a loop structure. Without being bound by theory, it is believed that multiple segments of RNA can be formed. The nucleotide can finally be circularized when only one 5' and one 3' free end remain. The DNA and their 5' and 3' strands are annealed to produce a "thread" of RNA. It can be generated from the free end.

[0028] As used herein, the term "cosmetic polypeptide of interest" refers to a cosmetic composition of the present disclosure. Any polypeptide selected to be encoded in the polyribonucleotide of the present invention may be As used herein, a "polypeptide" refers to a molecule that is most often made up of peptide bonds. This refers to a polymer of amino acid residues (natural or non-natural) linked together by As used herein, the term refers to a protein, polypeptide, or polypeptide of any size, structure, or function. Peptide means a gene product, a naturally occurring polypeptide, Peptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents; The polypeptide may be a single molecule. Alternatively, they may be multi-molecular complexes such as dimers, trimers or tetramers. It may comprise a single or multi-chain polypeptide, such as an antibody or insulin, and may be associated with The most common disulfide bonds are those found in multi-chain polypeptides. The term polypeptide refers to a polypeptide in which one or more amino acid residues are It may also be applied to amino acid polymers that are artificial chemical analogues of naturally occurring amino acids. do.

[0029] As used herein, the term "mixture" refers to a material made of two or more different substances that are mixed together. In some cases, the mixtures described herein refer to materials that are made up of two or more The mixture may be a homogenous mixture of the above different substances, e.g., the mixture may be any given mixture of A sample may have the same proportions of its components (e.g., two or more substances) throughout the sample. In some cases, a mixture as provided herein may comprise two or more different substances. It may be a heterogeneous mixture of substances, e.g., the components of the mixture (e.g., two or more substances) The proportion of may vary throughout the mixture. In some cases, the mixture comprises A liquid solution, e.g., the mixture is in the liquid phase. A solution may be considered to include a liquid solvent and a solute. Mixing a solute in a liquid solvent In some cases, a liquid solution may be a liquid solution in a liquid. Liquids (e.g., liquid solutes dissolved in a liquid solvent), solutions of solids in liquids (e.g., a solution of a gas in a liquid (e.g., a solid solute dissolved in a liquid solvent) or In some cases, more than one solvent and / or more than one solute is present. In some cases, the mixture may be a colloid, a liquid suspension, or an emulsion. In some cases, the mixture is a solid mixture, e.g., the mixture is It is present in the solid phase.

[0030] As used herein, the term "cell permeation agent" refers to an agent that, when contacted with a cell, penetrates into the cell. In some cases, a cell permeation agent refers to an agent that promotes cell migration. Direct electrostatic interactions with negatively charged phospholipids of the membrane or with membrane proteins or phospholipids through transient pore formation by inducing conformational changes in the plasma bilayer. In some cases, cell penetrating agents promote direct penetration of endocytosis. For example, under certain circumstances, cell penetration agents can be used to Cells can be stimulated to undergo the process of endocytosis, which results in The membrane can fold inwardly within the cell. In certain embodiments, the cell penetrating agent is Helps form transient structures that transport across cell membranes. Without the need for a cell permeation agent, the cell permeation agent as provided herein increases the permeability of the cell membrane. or increased internalization of molecules into cell membranes, resulting in Delivery into cells is not associated with a cell-penetrating agent when the cells are simultaneously contacted with the cell-penetrating agent. It may be more efficient compared to other identical deliveries.

[0031] As used herein, the term "payload" refers to a polysaccharide as disclosed herein. It refers to any molecule delivered by ribonucleotides. The payload may be a nucleic acid, a protein, a chemical, a ribonucleoprotein, or any combination thereof. In some cases, the payload is a polynucleotide as disclosed herein. In some cases, a payload is a nucleic acid sequence that is directly contained within a polynucleotide. Loading can be achieved by, for example, complementary hybridization or protein-nucleic acid interactions. via a polyribonucleotide as disclosed herein or In certain cases, the payload is contained within a polyribonucleotide. A protein encoded by a nucleic acid sequence that is attached to, bound to, or associated with the protein. In some cases, a "bond" refers to a covalent or non-covalent bond between two molecules. In some cases, the interaction between the payload and the polyribonucleic acid When used in the context of interactions between octides, "association" refers to the interaction between a payload and a It means that it is indirectly linked to a polyribonucleotide via one or more other molecules. In some cases, the binding or association may be transient. In this case, the payload may be responsive to, for example, the pH conditions of the environment or the presence or absence of a stimulus or binding partner. Depending on the type of protein, it may be bound to or associated with polyribonucleotides under certain conditions. , but not under other conditions.

[0032] As used herein, the term "alcohol" refers to a compound having a hydroxyl functional group (-OH) attached to a carbon atom. Alcohols as discussed herein refer to any organic compound that is bonded to an alkyl group. The alcohols are monohydric alcohols, polyhydric alcohols, unsaturated aliphatic alcohols, and alicyclic alcohols. In some cases, the alcohol may include, but is not limited to, ethanol. In some cases, the alcohol may be methanol, ethanol, etc. alcohol, isopropanol, butanol, pentanol, cetyl alcohol, ethylene glycol Coal, propylene glycol, denatured alcohol, benzyl alcohol, special denatured alcohol ethanol, glycol, stearyl alcohol, cetearyl alcohol, menthol, polyethylene Polyethylene glycol (PEG)-400, ethoxylated fatty acids, hydroxyethyl cellulose , isopropyl alcohol, dimethylaminoethanol, retinol, d-alpha-tolyl Copherol, SD alcohol, SD alcohol 40, c12-16, lauryl alcohol may include alcohol, myristyl alcohol, butylene glycol, and propanediol. , but not limited to these.

[0033] As used herein, the term "surface area" of a subject's body refers to the area that is exposed to the external environment. "Any area of ​​a subject that is exposed to or has the potential to be exposed to the body of a subject, e.g., an animal Surface areas of an animal's body, such as the human body, include the skin, nails, hair, eyelashes, and ear canal. In some cases, the surface area of ​​the subject's body includes multiple In many cases, the term may refer to the outer region in which epithelial cells are aligned. For example, skin is referred to herein as The dermis may be one type of surface region as discussed in , and may be composed of the epidermis and the dermis. The former form the outermost layer of a kind of organized epithelial cell among many other cell types. The aggregate may include a plurality of aggregates.

[0034] As used herein, the term "localized delivery" refers to delivery of a drug to a skin that is accessible through non-invasive means. Topical delivery of a cosmetic composition generally refers to the delivery of a substance to the skin or epidermal layer of a subject. For example, a topically delivered cosmetic composition may have a localized effect that is similar to that of a topical cosmetic composition. The therapeutic agent has a pharmacodynamic effect at or near a particular part of the body (e.g., the skin) where it is administered.

[0035] As used herein, the term "cosmetic effect" refers to a change in the appearance of a part of the outer skin of a subject. The integumentary parts of a subject may include, but are not limited to, skin, nails, hair, eyelashes, and other tissues. The cosmetic benefits described herein include, but are not limited to, improving the appearance of skin, Enhancement of rejuvenation of the skin, moisturization and / or elasticity, prevention or reduction of wrinkles lightening or darkening the skin or hair; hair colour Such modifications may include altering the density of the skin and / or providing other anti-aging care. These may include, but are not limited to, a change in the appearance of the subject's outer skin part.

[0036] As used herein, the term "expressed sequence" refers to a sequence that is used to express a product, e.g., a peptide or polypeptide. A nucleic acid sequence encoding a peptide or polypeptide, or a regulatory nucleic acid. An exemplary expression sequence for loading may include multiple nucleotide triplets, each of which may include , which can code for an amino acid, and are called "codons."

[0037] As used herein, the term "modified ribonucleotide" refers to a ribonucleotide that has a modified sugar, nucleobase, or nucleotide. It means a nucleotide having at least one modification to the internucleotide bond.

[0038] As used herein, the term "substantially resistant" refers to a resistance to at least 50% of a standard. , 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96% , 97%, 98% or 99% resistance.

[0039] "Polypeptide" and "protein" are used interchangeably and are used to refer to any bond that is linked by a covalent bond (e.g., amino acid). The term "amino acid" refers to a polymer of two or more amino acids linked together by bond (a bond). The polypeptide as described herein is intended to mean a full-length protein (e.g., a fully processed protein). proteins) and shorter amino acid sequences (e.g., fragments of naturally occurring proteins or synthetic A polypeptide may contain naturally occurring amino acids (e.g., natural Commonly found in naturally synthesized peptides and have the one-letter abbreviations A, R, N, C, and D. 2 known by Q, E, G, H, I, L, K, M, F, P, S, T, W, Y and V 0 amino acids) and non-naturally occurring amino acids (e.g., synthetic amino acids, Natural and synthetic peptides containing amino acid analogs, modified amino acids, and amino acid mimetics (an amino acid that is not one of the 20 amino acids commonly found in .

[0040] As used herein, the term "carrier" refers to a covalently attached cyclic polyribonucleotide. The composition ( Compounds and compositions that promote the transport or delivery of cyclic polyribonucleotides (e.g., cyclic polyribonucleotides) into cells. Carriers refer to any substance, reagent, or molecule. Non-limiting examples of carriers include carbohydrate carriers (e.g., anhydride-modified phytoglycogen or glycogen-type materials), nanoparticles (e.g. Nanoparticles encapsulating or covalently attached to circular polyribonucleotides, vesosomes, fusosomes, ex vivo differentiated reticulocytes, exosomes, protein carriers (e.g., proteins covalently bound to a circular polyribonucleotide), or cationic A carrier (eg, a cationic lipopolymer or a transfection reagent).

[0041] As used herein, the term "naked delivery" or "naked RNA" refers to delivery of a nucleic acid molecule to a host cell without the aid of a carrier. and without covalent modification to moieties that aid in delivery to cells. Naked delivery formulations refer to formulations of RNA for delivery to the host cell. It does not include cationic carriers, carbohydrate carriers, nanoparticle carriers, or protein carriers. A naked delivery formulation of a cyclic polyribonucleotide is a cyclic polyribonucleotide that does not have any covalent modifications. A formulation containing a polynucleotide and no carrier.

[0042] As used herein, the term "diluent" refers to a diluent that is used in the compositions described herein (e.g., A composition containing a cyclic polyribonucleotide may be diluted or dissolved in an inert solvent. Diluents refer to any cosmetically acceptable medium, including any suitable solvent, such as an RNA solubilizer, buffer, isotonic acid, or the like. The cosmetically acceptable diluent may be a liquid diluent or a solid diluent, or a mixture thereof. Non-limiting examples of liquid diluents include water or other solvents, solubilizing agents and emulsifying agents. agents, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol ethanol, dimethylformamide, oils (especially cottonseed oil, peanut oil, corn oil, germ oil, oil, olive oil, castor oil, and sesame oil), glycerol, tetrahydrofurfuryl alkanol Cholesterol, polyethylene glycol and fatty acid esters of sorbitan, and 1,3-butadiene Non-limiting examples of solid diluents include calcium carbonate, sodium carbonate, Thorium, calcium phosphate, dibasic calcium phosphate, calcium sulfate, calcium hydrogen phosphate Sodium phosphate, lactose, sucrose, cellulose, crystalline cellulose, calcium Olin, mannitol, sorbitol, inositol, sodium chloride, dry starch, corn starch, or powdered sugar.

[0043] As used herein, the term "bactericide" refers to a bacteriostatic, bacteriocidal, and / or active Any agent that effectively kills, inactivates, or prevents the growth of microorganisms. The germicide that kills microorganisms may be an antibacterial agent and / or an antiseptic. In form, germicides are liquids such as alcohol, iodine, or hydrogen peroxide. In some embodiments, the germicidal agent is UV light or laser light. The sterilizing agent is heat, delivered electrically or by other means (eg, steam, contact).

[0044] The following detailed description of the embodiments of the present invention is better understood when read in conjunction with the accompanying drawings. It will be understood that, for purposes of illustrating the invention, the embodiments illustrated herein are shown in the drawings. However, the present invention does not depend on the precise arrangement and construction of the embodiment shown in the drawings. It should be understood that the present invention is not limited to the above embodiment. [Brief description of the drawings]

[0045] [Figure 1] Exemplary linear and circular RNAs, both of which were delivered topically to the skin of mouse ears, and their RNA levels in ear tissue were examined over a period ranging from 6 hours to 3 days after delivery. [Diagram 2] Figures 2A and 2B are plots summarizing qPCR results from mouse ear punches 6 hours, 1 day, 3 days, or 12 days after localized delivery of linear or circular RNA with the aid of Boost (ethanol). Figure 2A shows results from a qPCR assay using primers for detection of both linear and circular RNA. Figure 2B shows results from a qPCR assay using primers for detection of circular RNA but not linear RNA. [Diagram 3] Figures 3A and 3B are plots summarizing qPCR results from mouse ear punches 6 hours, 1 day, 3 days, or 12 days after localized delivery of linear or circular RNA with the aid of both Boost (ethanol) and TransIT mRNA Reagent (Mirus Bio, LLC), a cationic, non-liposomal polymer / lipid transfer agent. Figure 3A shows results from a qPCR assay using primers for detection of both linear and circular RNA. Figure 3B shows results from a qPCR assay using primers for detection of circular RNA but not linear RNA. [Figure 4] Protein expression from RNA administered locally using DMSO gel (RNA) or DMSO gel alone (vehicle) is shown. [Diagram 5] 1 shows protein expression from topically administered RNA formulated in Johnson & Johnson Baby Lotion (RNA) or Johnson & Johnson Baby Lotion alone (solvent). [Figure 6]Protein expression from RNA administered locally with ethanol (RNA) or ethanol alone (vehicle) is shown. [Figure 7] Fluorescence images (B / W) show that local administration of circRNA-Cy5 results in RNA delivery to tissues. [Figure 8] Quantification of fluorescent images shows that local administration of circRNA-Cy5 results in RNA delivery to tissues. [Figure 9] Fluorescence images (B / W) show that local administration of mRNA-Cy5 results in RNA delivery to tissues. [Figure 10] Quantification of fluorescent images shows that local administration of mRNA-Cy5 results in RNA delivery to tissues. [Figure 11] 1 shows that topical administration of mRNA results in RNA delivery to tissues on days 1 and 4 after administration when the tissues are wiped with an ethanol wipe prior to application. [Figure 12] 1 shows that topical administration of mRNA results in RNA delivery to tissues on days 1 and 4 after administration when the tissues are wiped with an isopropyl alcohol wipe prior to application. [Figure 13] 1 shows that topical administration of circular RNA results in RNA delivery to tissues on days 1 and 4 after administration when the tissues are wiped with an ethanol wipe prior to application. [Figure 14] 1 shows that local administration of circular RNA mixed with 10% ethanol results in RNA delivery to tissues on days 1 and 4 after administration. [Figure 15] 1 shows that local administration of circular RNA mixed with 10% isopropyl alcohol results in RNA delivery to tissues on days 1 and 4 after administration. [Figure 16] 1 shows that topical administration of circular RNA results in RNA delivery to tissues on days 1 and 4 after administration when the tissues are wiped with an isopropyl alcohol wipe prior to application. [Figure 17]We show that topical administration of linear mRNA mixed with PBS, PBS and 10% ethanol, or PBS and 10% isopropyl alcohol results in RNA delivery to tissues on the 1st day after administration, and that topical administration of linear mRNA mixed with PBS and 10% ethanol or PBS and 10% isopropyl alcohol results in RNA delivery to tissues on the 4th day after administration. [Figure 18] We show that topical administration of circRNA results in functional protein expression in tissues when the tissue is wiped with an ethanol wipe prior to application. [Figure 19] We show that local administration of circRNA results in RNA delivery to tissues when circRNA is administered with 10% ethanol. [Figure 20] We show that local administration of circRNA results in RNA delivery to tissues when circRNA is administered with 10% isopropyl alcohol. [Figure 21] 1 shows that topical administration of mRNA results in RNA delivery to tissues when the skin is wiped with an ethanol wipe prior to application. [Figure 22] 1 shows that local administration of mRNA results in RNA delivery to tissues when the mRNA is administered with PBS alone. [Diagram 23] We show that local administration of mRNA results in RNA delivery to tissues when the mRNA is administered with 10% isopropyl alcohol. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0046] The present disclosure generally relates to compositions, preparations, and compositions of polyribonucleotides for cosmetic use. The polyribonucleotide includes linear polyribonucleotides, The polyribonucleotide may be a circular polyribonucleotide (circRNA), or a combination thereof. The nucleotide may include a payload. The payload may be any protein that has a cosmetic effect. The polypeptide may be a cosmetic payload, such as a sequence encoding a protein or peptide. The payload may be collagen, keratin, elastin, and / or botulinum toxin. The cosmetic protein or peptide is selected from the group consisting of any of the fragments. In an embodiment of the present invention, for example, the following items are provided: (Item 1) A cosmetic composition comprising a mixture of cyclic polyribonucleotide and ethanol, the ethanol being: (i) at least about 0.3% v / v to about 75% v / v of the mixture; or (ii) at least about 0.3% v / v to about 70% v / v, at least about 0.3% v / v to about 60% v / v, at least about 0.3% v / v to about 50% v / v, at least about 0.3% v / v to about 40% v / v, at least about 30% v / v to about 20% v / v, at least about 0.3% v / v to about 15% v / v, at least about 0.3% v / v to about 10% v / v, at least about 0.3% v / v to about 5% v / v, at least about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to about 0.5% v / v of the mixture; or (iii) A cosmetic composition comprising at least about 0.5% v / v to about 75% v / v, at least about 1% v / v to about 75% v / v, at least about 5% v / v to about 75% v / v, at least about 10% v / v to about 75% v / v, at least about 15% v / v to about 75% v / v, at least about 20% v / v to about 75% v / v, at least about 30% v / v to about 75% v / v, at least about 40% v / v to about 75% v / v, at least about 50% v / v to about 75% v / v, at least about 60% v / v to about 75% v / v, or at least about 70% v / v to about 75% v / v of the mixture. (Item 2) 2. The cosmetic composition according to claim 1, wherein the cyclic polyribonucleotide encodes a cosmetic protein or peptide selected from the group consisting of collagen, keratin, elastin, and botulinum toxin, or any fragment thereof. (Item 3) 3. The cosmetic composition according to item 1 or 2, wherein the cosmetic composition is a liquid, gel, lotion, paste, cream, foam, serum, ointment, or stick. (Item 4) 4. The cosmetic composition according to any one of items 1 to 3, wherein the cyclic polyribonucleotide lacks a cap or a poly A tail. (Item 5) Any of items 1 to 3, wherein the cyclic polyribonucleotide contains modified ribonucleotides. 3. The cosmetic composition according to claim 1. (Item 6) The cosmetic composition comprises: (i) having a pH of about 7; and / or (ii) has approximately the same viscosity as water; and / or (iii) is substantially free of hydrophobic or lipophilic groups; and / or (iv) is substantially free of hydrocarbons; and / or (v) substantially free of cationic liposomes; and / or (vi) is substantially free of fatty acids, lipids, liposomes, cholesterol, or any combination thereof; and / or (vii) The cosmetic composition according to any one of items 1 to 5, which is substantially free of glycerin, propylene glycol, or a combination thereof. (Item 7) 7. The cosmetic composition according to any one of items 1 to 6, wherein the cosmetic composition is an anti-wrinkle composition. (Item 8) A method for delivering a polyribonucleotide to a subject, comprising applying a cosmetic composition comprising a mixture of cosmetic polyribonucleotide and ethanol to an outer skin portion of the subject, wherein the ethanol comprises at least about 0.3% v / v to about 75% v / v of the mixture, and the cosmetic polyribonucleotide is a cyclic polyribonucleotide. (Item 9) 1. A method for delivering a cosmetic polyribonucleotide to a subject, comprising: a) applying a fungicide to an outer skin portion of said object; b) applying to said skin area a cosmetic composition comprising said cosmetic polyribonucleotide and a diluent, without any carrier, wherein said cosmetic polyribonucleotide is a cyclic polyribonucleotide. (Item 10) 10. The method of claim 9, wherein the disinfectant is alcohol, UV light, laser light, or heat. (Item 11) 1. A method for delivering a cosmetic polyribonucleotide to a subject, comprising: a) applying alcohol to an outer skin portion of said subject; b) applying to said skin area a cosmetic composition comprising said cosmetic polyribonucleotide and a cosmetically acceptable diluent, without any carrier, wherein said cosmetic polyribonucleotide is a cyclic polyribonucleotide. The method includes: (Item 12) 12. The method of claim 11, wherein the alcohol is selected from the group consisting of methanol, ethanol, isopropanol, butanol, pentanol, cetyl alcohol, ethylene glycol, propylene glycol, denatured alcohol, benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol, cetearyl alcohol, menthol, polyethylene glycol (PEG)-400, isopropyl alcohol, dimethylaminoethanol, retinol, d-alpha-tocopherol, SD alcohol, SD alcohol 40, c12-16, lauryl alcohol, myristyl alcohol, butylene glycol, and propanediol. (Item 13) A method for delivering polyribonucleotides to epithelial cells, comprising applying to said epithelial cells a cosmetic composition comprising a diluent and an unmodified cosmetic polyribonucleotide, without any carrier, wherein said cosmetic polyribonucleotide is a cyclic polyribonucleotide. (Item 14) A method for delivering a polyribonucleotide to a subject, comprising applying to an outer skin portion of the subject a cosmetic composition comprising a mixture of a cosmetic polyribonucleotide and an alcohol, wherein the alcohol comprises at least about 0.3% v / v to about 75% v / v of the mixture, and wherein the cosmetic polyribonucleotide is a cyclic polyribonucleotide. (Item 15) A method for delivering a polyribonucleotide to a subject, comprising applying to an outer skin portion of the subject a cosmetic composition comprising a mixture of a cosmetic polyribonucleotide and a cell-penetrating agent, wherein the cell-penetrating agent comprises at least about 0.3% v / v to about 75% v / v of the mixture, and wherein the cosmetic polyribonucleotide is a cyclic polyribonucleotide. (Item 16) Item 16. The method of item 15, wherein the cosmetic composition delivers the cosmetic polyribonucleotide to the dermis or epidermis tissue of the subject, optionally without iontophoresis. (Item 17) 8. A kit comprising an application tool and the cosmetic composition according to any one of items 1 to 7, wherein the application tool is configured to apply the cosmetic composition to an outer skin part of a subject. (Item 18) A kit comprising a first application tool, a second application tool, a bactericide, and a cosmetic composition comprising the cosmetic polyribonucleotide and a diluent, without any carrier, wherein the first application tool is configured to apply a bactericide to an outer skin portion of a subject, and the second application tool is configured to apply the composition to the outer skin portion of the subject, and wherein the cosmetic polyribonucleotide is a cyclic polyribonucleotide. (Item 19) 19. The kit of claim 18, wherein the disinfectant is alcohol, UV light, laser light, or heat. (Item 20) 20. The kit of claim 19, wherein the alcohol is selected from the group consisting of methanol, ethanol, isopropanol, butanol, pentanol, cetyl alcohol, ethylene glycol, propylene glycol, denatured alcohol, benzyl alcohol, special denatured alcohol, glycol, stearyl alcohol, cetearyl alcohol, menthol, polyethylene glycol (PEG)-400, isopropyl alcohol, dimethylaminoethanol, retinol, d-alpha-tocopherol, SD alcohol, SD alcohol 40, c12-16, lauryl alcohol, myristyl alcohol, butylene glycol, and propanediol. (Item 21) 21. The kit according to any one of items 17 to 20, wherein the first application tool is a wipe. (Item 22) 22. The kit of claim 21, wherein the wipe comprises the disinfectant. (Item 23) 19. The kit according to item 17 or 18, wherein the first application tool is (i) a device that applies UV light or laser light; or (ii) a device that applies heat. (Item 24) 11. A kit comprising an application tool and a mixture comprising a cyclic polyribonucleotide and a cell permeation agent or an alcohol, wherein the application tool is configured to apply the mixture to an outer skin portion of a subject. (Item 25) 25. The kit according to any one of items 17 to 24, wherein the application tool or the second application tool comprises a pipette. (Item 26) 26. The kit according to any one of items 17 to 25, wherein the application tool or the second application tool comprises a substrate, and the substrate is embedded with the mixture, and optionally the substrate is made of natural or artificial fibers. (Item 27) 27. The kit according to any one of items 17 to 26, wherein the application tool or the second application tool comprises: (i) a patch; (ii) a sprayer; or (iii) a peel pad, and optionally, the application tool or the second application tool is configured to release the mixture in a controlled manner. (Item 28) 28. The kit according to any one of items 17 to 27, wherein the outer skin part comprises skin, nails, eyelashes or hair. (Item 29) A cosmetic composition comprising a mixture of a cyclic polyribonucleotide and an alcohol, the alcohol being: (i) at least about 0.3% v / v to about 75% v / v of the mixture; or (ii) at least about 0.3% v / v to about 70% v / v, at least about 0.3% v / v to about 60% v / v, at least about 0.3% v / v to about 50% v / v, at least about 0.3% v / v to about 40% v / v, at least about 30% v / v to about 20% v / v, at least about 0.3% v / v to about 15% v / v, at least about 0.3% v / v to about 10% v / v, at least about 0.3% v / v to about 5% v / v, at least about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to about 0.5% v / v of the mixture; or (iii) A cosmetic composition comprising at least about 0.5% v / v to about 75% v / v, at least about 1% v / v to about 75% v / v, at least about 5% v / v to about 75% v / v, at least about 10% v / v to about 75% v / v, at least about 15% v / v to about 75% v / v, at least about 20% v / v to about 75% v / v, at least about 30% v / v to about 75% v / v, at least about 40% v / v to about 75% v / v, at least about 50% v / v to about 75% v / v, at least about 60% v / v to about 75% v / v, or at least about 70% v / v to about 75% v / v of the mixture. (Item 30) 30. The cosmetic composition of claim 29, wherein the alcohol is selected from the group consisting of methanol, ethanol, isopropanol, butanol, pentanol, cetyl alcohol, ethylene glycol, propylene glycol, denatured alcohol, benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol, cetearyl alcohol, menthol, polyethylene glycol (PEG)-400, isopropyl alcohol, dimethylaminoethanol, retinol, d-alpha-tocopherol, SD alcohol, SD alcohol 40, c12-16, lauryl alcohol, myristyl alcohol, butylene glycol, and propanediol. (Item 31) A cosmetic composition comprising a mixture of a cyclic polyribonucleotide and a cell-penetrating agent, the cell-penetrating agent being: (i) at least about 0.3% v / v to about 75% v / v of the mixture; or (ii) at least about 0.3% v / v to about 70% v / v, at least about 0.3% v / v to about 60% v / v, at least about 0.3% v / v to about 50% v / v, at least about 0.3% v / v to about 40% v / v, at least about 30% v / v to about 20% v / v, at least about 0.3% v / v to about 15% v / v, at least about 0.3% v / v to about 10% v / v, at least about 0.3% v / v to about 5% v / v, at least about 0.3% v / v to about 1 % v / v, or at least about 0.3% v / v to about 0.5% v / v; or (iii) A cosmetic composition comprising at least about 0.5% v / v to about 75% v / v, at least about 1% v / v to about 75% v / v, at least about 5% v / v to about 75% v / v, at least about 10% v / v to about 75% v / v, at least about 15% v / v to about 75% v / v, at least about 20% v / v to about 75% v / v, at least about 30% v / v to about 75% v / v, at least about 40% v / v to about 75% v / v, at least about 50% v / v to about 75% v / v, at least about 60% v / v to about 75% v / v, or at least about 70% v / v to about 75% v / v of the mixture. (Item 32) Item 32. The cosmetic composition according to item 31, wherein the cell permeation agent is an alcohol. (Item 33) Item 33. The cosmetic composition of item 32, wherein the alcohol is selected from the group consisting of methanol, ethanol, isopropanol, butanol, pentanol, cetyl alcohol, ethylene glycol, propylene glycol, denatured alcohol, benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol, cetearyl alcohol, menthol, polyethylene glycol (PEG)-400, isopropyl alcohol, dimethylaminoethanol, retinol, d-alpha-tocopherol, SD alcohol, SD alcohol 40, c12-16, lauryl alcohol, myristyl alcohol, butylene glycol, and propanediol. (Item 34) 34. The cosmetic composition according to any one of items 31 to 33, wherein the cell permeation agent is (i) soluble in a polar solvent; or (ii) insoluble in a polar solvent.

[0047] In some aspects, the present disclosure provides compositions for delivery of polyribonucleotides to cells. In some cases, the compositions and methods provided herein include In one embodiment, polyribonucleotides are delivered intracellularly to a surface region of a subject, e.g., the integumentary system of a subject. In certain embodiments, the compositions and methods provided herein modulate the appearance of a part. , are particularly useful for localized delivery of polyribonucleotides into cells of a subject.

[0048] The compositions disclosed herein comprise a cosmetic polyribonucleotide and an alcohol (e.g. The method disclosed herein may include a mixture of polyribonucleic acid (PAA) and ethanol. Polyribonucleotides are delivered in a composition containing a mixture of leucine and alcohol. In some aspects, the present disclosure provides a method for the delivery of polyribonucleotides into a cell. The present invention provides a kit for cosmetic use, comprising a cosmetic polyribonucleotide and alcohol. In some embodiments, the kit comprises a disinfectant.

[0049] The compositions disclosed herein comprise a mixture of cosmetic polyribonucleotides and a cell permeation agent. The method disclosed herein may include a cosmetic polyribonucleotide and a cell permeation agent. The method may include delivering the polyribonucleotide in a composition comprising a mixture of In one aspect, the present disclosure provides a cosmetic polyribonucleotide for intracellular delivery of polyribonucleotides. In some embodiments, the kit includes a polynucleotide and a cell permeation agent. The composition includes a fungicide.

[0050] In some embodiments, the cosmetic compositions described herein are intended to be used to treat a surface area (e.g., In some embodiments, the composition is administered directly to the skin (a localized surface area or an epidermal area). The cosmetic composition described in is applied to the surface area of ​​the subject after application of the germicide.

[0051] The compositions, methods, and kits provided herein include methods for delivering polyribonucleotides into cells. Polyribonucleotides can provide a simple and effective solution for delivery. is greater in the presence of alcohol or a cell permeabilizing agent than in the absence of alcohol or a cell permeabilizing agent. In some cases, the alco- The alcohol or cell permeabilizing agent is used to measure the delivery of polynucleotides in the absence of alcohol or cell permeabilizing agents. At least about 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 120%, 150%, 200%, 250% , 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000 %, 2000%, 5000%, 8000%, 10,000%, 20,000%, or 50 ,000% the efficiency of polynucleotide delivery can be increased.

[0052] Compositions for polyribonucleotide delivery In some aspects, the present disclosure provides compositions or cosmetic compositions for delivery of polyribonucleotides. The polyribonucleotides include a payload, such as a cosmetic payload. The cosmetic payload can be any protein or peptide that has a cosmetic effect. In some embodiments, the cosmetic payload is collagen, keratin, elastin, and and botulinum toxin, or any fragment thereof; The composition or cosmetic composition is a peptide for delivery of polyribonucleotides to cells. The composition or cosmetic composition may contain alcohol (e.g., ethanol) for cell permeabilization. The cell permeation agent may be used to enhance delivery of the polyribonucleotide into cells. Polyribonucleotides can exist in either a linear or circular form.

[0053] In some cases, the compositions or cosmetic compositions provided herein are suitable for cosmetic applications. For example, the polyribonucleotides may be suitable for cosmetic purposes when the composition is administered to a subject. In some cases, the polyribonucleotides are cosmetic polyribonucleotides that have the following effects: Cleotide is a cosmetic formulation for use in the treatment or care of the skin, hair, nails, or eyelashes. It codes for proteins.

[0054] In an aspect, the present disclosure provides a cosmetic composition and a composition or cosmetic composition described herein. In some embodiments, the compositions described herein are administered in a manner that is consistent with the present invention. Alternatively, the cosmetic composition may be applied directly to a surface area (e.g., a topical surface area or an area of ​​the skin). In some embodiments, the compositions or cosmetic compositions described herein are disinfecting. After application of the agent, the agent is applied to a surface area (eg, an outer skin area) of the subject.

[0055] The composition or cosmetic composition may include a cell permeation agent and a polyribonucleotide. The additive is configured to enhance delivery of the polyribonucleotide into a cell. In some cases, the compositions provided herein are suitable for cosmetic applications, e.g., polylysine. The polyribonucleotide is a cosmetic polyribonucleic acid that has a cosmetic effect when the composition is administered to a subject. In an embodiment, the present disclosure relates to a cosmetic composition and a compound as described herein. The present invention provides a method for administering a cosmetic composition comprising administering a polyribonucleotide having either a linear or cyclic structure. It may exist in any form.

[0056] alcohol Alcohols as described herein can be used in the preparation of polyribonucleotides (e.g., cosmetic Alcohols can be used to deliver polyribonucleotides (polyribonucleotides) into cells. For intracellular delivery of polyribonucleic acid, polyribonucleic acid as described herein can be used. The mixture may be in a mixture with leutidine. The mixture may contain at least about 0.3% v / v alcohol. The alcohol may comprise from about 75% v / v to about 75% v / v. In embodiments, the mixture is applied to a surface area of ​​a subject. is a cosmetic composition.

[0057] The alcohol can be any alcohol that contains one or more hydroxyl functional groups. In some cases, the alcohol may be a monohydric alcohol, a polyhydric alcohol, or an unsaturated aliphatic alcohol. The alcohol may be, but is not limited to, a methyl alcohol or an alicyclic alcohol. Alcohol, ethanol, isopropanol, butanol, pentanol, cetyl alcohol Alcohol, ethylene glycol, propylene glycol, denatured alcohol, benzyl alcohol , special denatured alcohol, glycol, stearyl alcohol, cetearyl alcohol, methyl pentole, polyethylene glycol (PEG)-400, ethoxylated fatty acids, or hydrochloric acid. In certain embodiments, the composition may include one or more of the following: alcohol, ethyl cellulose ... is ethanol.

[0058] In other cases, the compositions, cosmetic compositions, and methods provided herein include, but are not limited to, alco The present invention is not limited to the use of any other drug that enhances the delivery of polyribonucleotides into cells. In some cases, the alcohol is ethanol. The compositions, cosmetic compositions, and methods enhance the delivery of polyribonucleotides into cells. In some cases, alcohol is not used. is a cell permeation agent. In some cases, alcohol is not a cell permeation agent.

[0059] The compositions disclosed herein include a mixture of alcohol and polyribonucleotides. In some cases, the polyribonucleotide is premixed with alcohol. In some cases, the polyribonucleotide is present in a mixture. In these cases, the polyribonucleotide is provided separately from the alcohol. When applied to cells, it is in contact with alcohol and induces the incorporation of polyribonucleotides into the cells. Without being bound to any particular theory, the alcohols in the mixture are mixed together for delivery. The concentration of alcohol may contribute to the efficiency of delivery. The alcohol is provided in a mixture at a predetermined concentration. Cole and polyribonucleotides, initially separate, have been applied for delivery When mixed together, the alcohol is dissolved in sufficient amounts to form polyribonucleotides. to ensure that a minimum predetermined concentration is reached in the mixture.

[0060] In some cases, the alcohol is at least about 0.01% of the mixture, at least At least about 0.02%, at least about 0.03%, at least about 0.04%, at least about 0. 05%, at least about 0.06%, at least about 0.07%, at least about 0.08%, At least about 0.09%, at least about 0.1%, at least about 0.2%, at least about 0.3%, at least about 0.4%, at least about 0.5%, at least about 0.6%, at least about 0.7%, at least about 0.9%, at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 20% , at least about 30%, at least about 40%, at least about 50%, at least about 60% , at least about 70%, at least about 80%, at least about 90%, at least about 95% or at least about 98% volume per volume (v / v). In this case, alcohol may be present in a maximum of about 0.01%, a maximum of about 0.02%, or a maximum of about 0.03% of the mixture. , maximum approximately 0.04%, maximum approximately 0.05%, maximum approximately 0.06%, maximum approximately 0.07%, maximum approximately 0.08%, maximum approximately 0.09%, maximum approximately 0.1%, 0.2%, 0.3%, 0.4%, 0. 5%, 0.6%, 0.7%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8% %, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 9 In some cases, the alcohol comprises about 10%, about 20%, or about 30% of the mixture. 0%, approx. 30%, approx. 40%, approx. 50%, approx. 60%, approx. 70%, approx. 80%, approx. 90%, approx. 5%, about 98%, or about 100% v / v.

[0061] In some cases, the alcohol is at least about 0.01% of the mixture, at least At least about 0.02%, at least about 0.03%, at least about 0.04%, at least about 0. 05%, at least about 0.06%, at least about 0.07%, at least about 0.08%, At least about 0.09%, at least about 0.1%, at least about 0.2%, at least about 0.3%, at least about 0.4%, at least about 0.5%, at least about 0.6%, at least about 0.7%, at least about 0.9%, at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 20% , at least about 30%, at least about 40%, at least about 50%, at least about 60% , at least about 70%, at least about 80%, at least about 90%, at least about 95% or at least about 98% weight per weight (w / w). In this case, alcohol may be present in a maximum of about 0.01%, a maximum of about 0.02%, or a maximum of about 0.03% of the mixture. , maximum approximately 0.04%, maximum approximately 0.05%, maximum approximately 0.06%, maximum approximately 0.07%, maximum approximately 0.08%, maximum approximately 0.09%, maximum approximately 0.1%, 0.2%, 0.3%, 0.4%, 0. 5%, 0.6%, 0.7%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8% %, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 9 In some cases, the cell permeation agent comprises about 10%, about 20%, or about 30% of the mixture. 0%, approx. 30%, approx. 40%, approx. 50%, approx. 60%, approx. 70%, approx. 80%, approx. 90%, approx. 5%, or about 98% w / w. In some cases, the alcohol comprises It accounts for approximately 10% v / v.

[0062] In some embodiments, the alcohol comprises at least about 0.5% v / v to about 7% v / v of the mixture. 5% v / v, at least about 1% v / v to about 75% v / v, at least about 5% v / v to about 7 5% v / v, at least about 10% v / v to about 75% v / v, at least about 15% v / v About 75% v / v, at least about 20% v / v to about 75% v / v, at least about 30% v / v v to about 75% v / v, at least about 40% v / v to about 75% v / v, at least about 50% v / v to about 75% v / v, at least about 60% v / v to about 75% v / v, or less About 70% v / v to about 75% v / v, or any percentage v / v therebetween In some embodiments, the alcohol comprises at least about 0.3% v / v of the mixture. ~ about 70% v / v, at least about 0.3% v / v~ about 60% v / v, at least about 0.3 %v / v to about 50%v / v, at least about 0.3%v / v to about 40%v / v, at least About 30% v / v to about 20% v / v, at least about 0.3% v / v to about 15% v / v, a little At least about 0.3% v / v to about 10% v / v, at least about 0.3% v / v to about 5% v / v , at least about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to It comprises about 0.5% v / v, or any percentage v / v therebetween.

[0063] In some cases, the mixtures described herein are liquid solutions. For example, The alcohol is the liquid substance itself. In these cases, polyribonucleotides may also be dissolved in a liquid solution.

[0064] In some cases, ethanol is at least about 0.1% of the mixture, at least About 0.2%, at least about 0.3%, at least about 0.4%, at least about 0.5%, At least about 0.6%, at least about 0.7%, at least about 0.9%, at least about 1% , at least about 2%, at least about 3%, at least about 4%, at least about 5%, At least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 1 0%, at least about 20%, at least about 30%, at least about 40%, at least about 5 0%, at least about 60%, at least about 70%, at least about 80%, at least about 9 occupying 0%, at least about 95%, or at least about 98% of the volume per volume (v / v) In some cases, ethanol may be present in a mixture at up to about 0.1%, 0.2%, or 0. .3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.9%, 1%, 2%, 3%, 4% ,5%,6%,7%,8%,9%,10%,20%,30%,40%,50%,60%, In some cases, the ethanol comprises 70%, 80%, or 90% v / v. About 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about In some cases, the composition may comprise 80%, about 90%, about 95%, about 98%, or about 100% v / v. In this case, ethanol makes up about 10% v / v of the mixture.

[0065] In some embodiments, ethanol is at least about 0.5% v / v to about 7% v / v of the mixture. 5% v / v, at least about 1% v / v to about 75% v / v, at least about 5% v / v to about 7 5% v / v, at least about 10% v / v to about 75% v / v, at least about 15% v / v About 75% v / v, at least about 20% v / v to about 75% v / v, at least about 30% v / v v to about 75% v / v, at least about 40% v / v to about 75% v / v, at least about 50% v / v to about 75% v / v, at least about 60% v / v to about 75% v / v, or less About 70% v / v to about 75% v / v, or any percentage v / v therebetween In some embodiments, ethanol comprises at least about 0.3% v / v of the mixture. ~ about 70% v / v, at least about 0.3% v / v~ about 60% v / v, at least about 0.3 %v / v to about 50%v / v, at least about 0.3%v / v to about 40%v / v, at least About 30% v / v to about 20% v / v, at least about 0.3% v / v to about 15% v / v, a little At least about 0.3% v / v to about 10% v / v, at least about 0.3% v / v to about 5% v / v , at least about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to It comprises about 0.5% v / v, or any percentage v / v therebetween.

[0066] Cell permeabilization agents The cell penetration agents described herein enhance delivery of polyribonucleotides into cells. The cell permeation agent may include any substance. The cell permeation agent may include an organic compound or an inorganic molecule. In some cases, the cell permeation agent is an alkane, an alkene, or an arene; a halogen-substituted alkane , alkenes, and allenes; alcohols, phenols (derivatives of benzene), ethers, azobenzenes, These include, but are not limited to, aldehydes, ketones, and carboxylic acids; amines and nitriles. In some embodiments, the compound is an organic compound having one or more functional groups that are not capable of penetrating cells. In some embodiments, the cell permeation agent is soluble in the polar solvent. Polyribonucleotides can exist in either linear or circular form.

[0067] Cell permeabilization agents include organic compounds such as alcohols that have one or more hydroxyl functional groups. In some cases, the cell permeation agent may include a monohydric alcohol, a polyhydric alcohol, Alcohols such as, but not limited to, unsaturated aliphatic alcohols, and alicyclic alcohols. Cell permeabilizing agents include methanol, ethanol, isopropanol, and butanol. , Pentanol, Cetyl Alcohol, Ethylene Glycol, Propylene Glycol, Modified Alcohol, benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol , Cetearyl Alcohol, Menthol, Polyethylene Glycol (PEG)-400 , ethoxylated fatty acids, hydroxyethyl cellulose, isopropyl alcohol, dimethyl Aminoethanol, Retinol, d-alpha-tocopherol, SD Alcohol, SD Alcohol 40, C12-16, Lauryl Alcohol, Myristyl Alcohol, Butyrate In certain embodiments, the composition may include one or more of: glycol, propanediol, or propanediol. Cellular permeabilization agents include ethanol.

[0068] In other cases, the compositions and methods provided herein include an alcohol-based cell permeabilization agent. The present invention is not limited to the use of any other drug that enhances the delivery of polyribonucleotides into cells. In some cases, the cell permeation agent is ethanol or and any other alcohol that can enhance the delivery of polyribonucleotides into cells. In some cases, the cell permeation agent includes ethanol and polyribonucleotides. Any other organic or inorganic molecule that can enhance delivery into a cell. In this case, the cell permeation agent is ethanol, as well as The brochure of International Publication No. 2013006825 and the brochure of International Publication No. 2016036 No. 735, International Publication No. 2018112282A1, and International Liposomal materials such as those described in Publication No. 2012031043A1 In some cases, the cell permeation agent includes ethanol, as well as Bechara et al., Cell -penetrating peptides:20 years later,whe re do we stand?FEBS Letters 587(12):1693 -1702(2013);Langel,Cell-Penetrating Pept ides:Processes and Applications(CRC Pres s, Boca Raton FL, 2002);El-Andaloussi et a l.,Curr.Pharm.Des.11(28):3597-611(2003); Deshayes et al,Cell.Mol.Life Sci.62(16): 1839-49 (2005), U.S. Patent Application Publication No. 20130129726, U.S. US Patent Application Publication No. 20130137644 and US Patent Application Publication No. 201301 and cell-penetrating peptides or proteins such as those described in US Pat. No. 6,4219. In some cases, the ratio of ethanol to other cell permeabilizing agents is about 1:0.001, 1:0.002, 1:005, 1:008, 1:0.01, 1:0.02, 1:0.05 ,1:0.08,1:0.1,1:0.2,1:0.3,1:0.4,1:0.5,1: 0.6, 1:0.7, 1:0.8, 1:0.9, 1:1, 1:1.2, 1:1.5, 1: 1.8, 1:2, 1:2.5, 1:3, 1:3.5, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:15, 1:20, 1:30, 1:40, 1:50, 1: 60, 1:70, 1:80, 1:90, 1:100, 1:120, 1:150, 1:20 0, 1:250, 1:500, or 1:1000. In some cases, The ratio of Nol to other cell permeabilizing agents is at least about 1:0.001, 1:0.002, 1:0 05, 1:008, 1:0.01, 1:0.02, 1:0.05, 1:0.08, 1:0 .1, 1:0.2, 1:0.3, 1:0.4, 1:0.5, 1:0.6, 1:0.7, 1 :0.8, 1:0.9, 1:1, 1:1.2, 1:1.5, 1:1.8, 1:2, 1:2 .5, 1:3, 1:3.5, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, 1:1 0, 1:15, 1:20, 1:30, 1:40, 1:50, 1:60, 1:70, 1:8 0, 1:90, 1:100, 1:120, 1:150, 1:200, 1:250, or 1 :500.

[0069] The compositions disclosed herein include a mixture of a cell permeabilizing agent and a polyribonucleotide. In some cases, the polyribonucleotide is premixed with a cell permeabilizing agent. In some cases, the polyribonucleotide is present in a mixture. In these cases, the polyribonucleotide is provided separately from the cell permeation agent. When applied to cells, the compound is contacted with a cell permeabilizing agent, which induces the intracellular entry of polyribonucleotides. Without being bound to any particular theory, the cell permeability of the mixture is The concentration of the permeabilizing agent may contribute to the efficiency of delivery. The agent is provided in the mixture at a predetermined concentration. The penetrant and polyribonucleotide are initially separate but are applied for delivery When mixed together, the cell permeabilizing agent is in sufficient quantity to the polyribonucleotide. to ensure that a minimum predetermined concentration is reached in the mixture.

[0070] In some cases, the cell permeabilization agent comprises at least about 0.01% of the mixture, At least about 0.02%, at least about 0.03%, at least about 0.04%, at least about 0. 05%, at least about 0.06%, at least about 0.07%, at least about 0.08%, At least about 0.09%, at least about 0.1%, at least about 0.2%, at least about 0.3%, at least about 0.4%, at least about 0.5%, at least about 0.6%, at least about 0.7%, at least about 0.9%, at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 20% , at least about 30%, at least about 40%, at least about 50%, at least about 60% , at least about 70%, at least about 80%, at least about 90%, at least about 95% or at least about 98% volume per volume (v / v). In this case, the cell permeabilizing agent may be up to about 0.01%, up to about 0.02%, or up to about 0.03% of the mixture. , maximum approximately 0.04%, maximum approximately 0.05%, maximum approximately 0.06%, maximum approximately 0.07%, maximum approximately 0.08%, maximum approximately 0.09%, maximum approximately 0.1%, 0.2%, 0.3%, 0.4%, 0. 5%, 0.6%, 0.7%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8% %, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 9 In some cases, the cell permeabilizing agent comprises about 10%, about 20%, or about 30% of the mixture. 0%, approx. 30%, approx. 40%, approx. 50%, approx. 60%, approx. 70%, approx. 80%, approx. 90%, approx. 5%, about 98%, or about 100% v / v.

[0071] In some cases, the cell permeabilization agent comprises at least about 0.01% of the mixture, At least about 0.02%, at least about 0.03%, at least about 0.04%, at least about 0. 05%, at least about 0.06%, at least about 0.07%, at least about 0.08%, At least about 0.09%, at least about 0.1%, at least about 0.2%, at least about 0.3%, at least about 0.4%, at least about 0.5%, at least about 0.6%, at least about 0.7%, at least about 0.9%, at least about 1%, at least about 2%, at least about 3%, at least about 4%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 20% , at least about 30%, at least about 40%, at least about 50%, at least about 60% , at least about 70%, at least about 80%, at least about 90%, at least about 95% or at least about 98% weight per weight (w / w). In this case, the cell permeabilizing agent may be up to about 0.01%, up to about 0.02%, or up to about 0.03% of the mixture. , maximum approximately 0.04%, maximum approximately 0.05%, maximum approximately 0.06%, maximum approximately 0.07%, maximum approximately 0.08%, maximum approximately 0.09%, maximum approximately 0.1%, 0.2%, 0.3%, 0.4%, 0. 5%, 0.6%, 0.7%, 0.9%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8% %, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 9 In some cases, the cell permeation agent comprises about 10%, about 20%, or about 30% of the mixture. 0%, approx. 30%, approx. 40%, approx. 50%, approx. 60%, approx. 70%, approx. 80%, approx. 90%, approx. 5%, or about 98% w / w. In some cases, the cell permeation agent comprises It accounts for approximately 10% v / v.

[0072] In some cases, the mixtures described herein are liquid solutions. For example, The cell permeation agent may be a liquid substance itself. Alternatively, the cell permeation agent may be a solid, liquid, or gas. The polyribonucleic acid is a substance that is dissolved in a liquid carrier, for example, water. The nucleotides may also be dissolved in a liquid solution.

[0073] In some cases, ethanol is at least about 0.1% of the mixture, at least About 0.2%, at least about 0.3%, at least about 0.4%, at least about 0.5%, At least about 0.6%, at least about 0.7%, at least about 0.9%, at least about 1% , at least about 2%, at least about 3%, at least about 4%, at least about 5%, At least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 1 0%, at least about 20%, at least about 30%, at least about 40%, at least about 5 0%, at least about 60%, at least about 70%, at least about 80%, at least about 9 occupying 0%, at least about 95%, or at least about 98% of the volume per volume (v / v) In some cases, ethanol may be present in a mixture at up to about 0.1%, 0.2%, or 0. .3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.9%, 1%, 2%, 3%, 4% ,5%,6%,7%,8%,9%,10%,20%,30%,40%,50%,60%, In some cases, the ethanol comprises 70%, 80%, or 90% v / v. About 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about In some cases, the composition may comprise 80%, about 90%, about 95%, about 98%, or about 100% v / v. In this case, ethanol makes up about 10% v / v of the mixture.

[0074] Polyribonucleotides Aspects of the present disclosure include methods for injecting polyribonucleotides, e.g., cosmetic polyribonucleotides, into cells. The present invention relates to compositions and methods for delivering polyribonucleotides into the body. It can be either a nucleotide or a cyclic polyribonucleotide. In the present invention, the cosmetic polyribonucleotide is applied to the outer skin of the subject to which the polyribonucleotide is administered. The integumentary parts of a subject include the skin, eyelashes, nails, and hair. Aspects of the present disclosure include, but are not limited to, the following: A compound comprising a cosmetic polyribonucleotide that has a cosmetic effect on a subject when delivered to the subject. Cosmetic compositions are provided. The polyribonucleotides as described herein can be used in cosmetic applications. The polyribonucleotide may be mixed with alcohol (e.g., ethanol) in the composition. , may be mixed with a cell permeation agent. It may be mixed with a cosmetically acceptable diluent in a cosmetic composition that does not include any carrier.

[0075] The polyribonucleotide may include a sequence for an expression product. Expression of the derived sequences and / or binding of polyribonucleotides to targets can result in a variety of cosmetic effects. In some cases, the polyribonucleotide may have a cellular function, e.g., In certain embodiments, the cosmetic cellular function is at least About 1 hour to about 30 days, or at least about 2 hours, 6 hours, 12 hours, 18 hours, or 24 hours 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 1 day, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 1 9 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 2 7 days, 28 days, 29 days, 30 days, 60 days, or more, or any time in between In certain embodiments, the modification is stably, such as a time-lasting modulation of a cosmetic cellular function. For example, about 30 minutes to about 7 days or less, or about 1 hour, 2 hours, 3 hours, 4 hours, or 5 hours , 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, 4 days, 5 days, 6 days, 7 The modification may be transient, such as a modulation lasting for days or less, or any time therebetween.

[0076] The polyribonucleotide may be at least about 20 nucleotides, at least about 30 nucleotides. tide, at least about 40 nucleotides, at least about 50 nucleotides, at least about 7 5 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, At least about 300 nucleotides, at least about 400 nucleotides, at least about 50 0 nucleotides, or at least about 1,000 nucleotides. In the present invention, polyribonucleotides are used to express sequences derived from polyribonucleotides. The nucleic acid is of a size sufficient to accommodate a binding site for a ribosome that is to be bound by the nucleic acid. The maximum size of a linear or circular polyribonucleotide is Within the technical constraints of producing and / or using circular polyribonucleotides It may be appreciated that in some cases, the magnitude of the The maximum size of a linear or circular polyribonucleotide is sufficient to package an RNA and target it. In some cases, the ability to deliver polyribonucleotides to a target site may be limited. The size of the DNA is sufficient to encode a useful polypeptide and is therefore approximately Less than about 0,000 nucleotides, less than about 15,000 nucleotides, less than about 10,000 nucleotides less than about 7,500 nucleotides, or less than about 5,000 nucleotides, Less than 2,000 nucleotides, less than about 3,000 nucleotides, about 2,000 nucleotides less than about 1,000 nucleotides, less than about 500 nucleotides, less than about 400 nucleotides less than about 300 nucleotides, less than about 200 nucleotides, about 100 nucleotides Lengths of less than 100 μm may be useful.

[0077] The polyribonucleotides provided herein are intended to be identical to a reference sequence, in particular a parent polyribonucleotide. Substitutions, insertions and / or additions, deletions, and covalent modifications, etc., may be present as compared to the For example, a polyribonucleotide may have one or more post-transcriptional modifications, such as These include capping, cleavage, polyadenylation, splicing, polyA sequences, methylation, and adenylation. Sylation, phosphorylation, methylation of lysine and arginine residues, acetylation, and thiols Polyribonucleotides contain pyridine- 4-one ribonucleosides, 5-aza-uridine, 2-thio-5-aza-uridine, 2 -Thio-pseudouridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydro 3-Methyluridine, 5-Carboxymethyl-uridine, 1-Carboxyuridine Dimethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine Lysine, 5-taurinomethyluridine, 1-taurinomethyl-pseudouridine, 5-taurinomethyl- Urinomethyl-2-thio-uridine, 1-taurinomethyl-4-thio-uridine, 5-methyl Thiol-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine Lysine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouridine, di Hydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine Lysine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-prop and 4-methoxy-2-thio-pseudouridine. In some cases, the mRNA may include at least one nucleoside that is 5-Aza-cytidine, ploidy isocytidine, 3-methyl-cytidine, N4-acetylcytidine Cytidine, 5-formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine , 1-methyl-ploid isocytidine, pyrrolo-cytidine, pyrrolo-ploid isocytidine 2-thio-cytidine, 2-thio-5-methyl-cytidine, 4-thio-ploid isocytidine Cytidine, 4-thio-1-methyl-ploid isocytidine, 4-thio-1-methyl-1-de Aza-ploid isocytidine, 1-methyl-1-deaza-ploid isocytidine, zebra Phosphorus, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine 2-Methoxy-cytidine, 2-Methoxy-5-methyl-cytidine 4-Methoxy-1-methyl-isocytidine, 4-Methoxy-1-methyl-isocytidine, and 4-Methoxy-1-methyl-isocytidine It contains at least one nucleoside selected from the group consisting of isocytidine. In this case, the mRNA is -adenine, 7-deaza-8-aza-adenine, 7-deaza-2-aminopurine, 7-de Aza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza -8-Aza-2,6-diaminopurine, 1-methyladenosine, N6-methyladenosine , N6-isopentenyl adenosine, N6-(cis-hydroxyisopentenyl)adenosine Adenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, N 6-Glycinylcarbamoyl adenosine, N6-Threonylcarbamoyl adenosine, 2 -Methylthio-N6-threonylcarbamoyl adenosine, N6,N6-dimethyladenosine adenine, 7-methyladenine, 2-methylthio-adenine, and 2-methoxy-adenine In some cases, the compound includes at least one nucleoside selected from the group consisting of: , mRNA is inosine, 1-methyl-inosine, wyosine, wybutosine, 7-dea aza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio -7-Deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl -Guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy -Guanosine, 1-methylguanosine, N2-methylguanosine, N2,N2-dimethyl Guanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl N2-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, and N2,N2-dithio At least one nucleoside selected from the group consisting of methyl-6-thio-guanosine In some embodiments, the polyribonucleotide lacks a cap. In some embodiments, the polyribonucleotide lacks a polyA tail. In some embodiments, the polyribonucleotide is non-immunogenic. The nucleotides are immunogenic.

[0078] Polyribonucleotides are composed of sugars, nucleobases, or internucleoside linkages (e.g., linked together). any of the above for the phosphate / phosphodiester bond / phosphodiester backbone Useful modifications may include: one or more atoms of the pyrimidine nucleobase are optionally substituted. optionally substituted amino, optionally substituted thiol, optionally substituted alkyl( methyl or ethyl), or halo (e.g., chloro or fluoro). In certain embodiments, the modification (e.g., one or more modifications) may be: The modifications occur in both the sugar and the internucleoside linkages. ), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), Modification of ribonucleic acid (RNA) to locked nucleic acid (LNA) or its hybrids. Further modifications are described herein.

[0079] Different sugar modifications, nucleotide modifications, and / or internucleoside linkages (e.g., backbone structures ) may be present at various sites in the polyribonucleotides provided herein. The present invention relates to a method for the preparation of polyribonucleotides comprising the steps of: It should be recognized that the ribonucleotide may be located at any site in the polyribonucleotide such that Polyribonucleotides are composed of approximately 1% to approximately 100% modified nucleotides (total nucleotides). With respect to nucleotide content, or the number of one or more types of nucleotides, e.g., A, G, U, or for any one or more of C) or any percentage in between (e.g., 1% to 2 0%>, 1%~25%, 1%~50%, 1%~60%, 1%~70%, 1%~80%, 1 %~90%, 1%~95%, 10%~20%, 10%~25%, 10%~50%, 10% ~60%, 10%~70%, 10%~80%, 10%~90%, 10%~95%, 10% ~100%, 20%~25%, 20%~50%, 20%~60%, 20%~70%, 20 %~80%, 20%~90%, 20%~95%, 20%~100%, 50%~60%, 5 0%~70%, 50%~80%, 50%~90%, 50%~95%, 50%~100%, 70%~80%, 70%~90%, 70%~95%, 70%~100%, 80%~90% , 80%~95%, 80%~100%, 90%~95%, 90%~100%, and 95% ~100%).

[0080] In some cases, the concentration of polyribonucleotides in the mixture is at least about 0. 0.1 ng / mL, at least about 0.2 ng / mL, at least about 0.5 ng / mL, at least at least about 1 ng / mL, at least about 5 ng / mL, at least about 10 ng / mL, at least about 20 ng / mL, at least about 50 ng / mL, at least about 100 ng / mL , at least about 200 ng / mL, at least about 500 ng / mL, at least about 1 μg / mL, at least about 2 μg / mL, at least about 3 μg / mL, at least about 4 μg / mL mL, at least about 5 μg / mL, at least about 10 μg / mL, at least about 20 μg / mL, at least about 30 μg / mL, at least about 40 μg / mL, at least about 50 μg / mL, at least about 100 μg / mL, at least about 200 μg / mL, at least At least about 300 μg / mL, at least about 400 μg / mL, at least about 500 μg / mL , at least about 1 mg / mL, at least about 2 mg / mL, at least about 5 mg / mL, At least about 10 mg / mL, at least about 20 mg / mL, at least about 50 mg / m In some cases, the polysaccharide in the mixture is at least about 100 mg / mL. The concentration of ribonucleotides is up to about 0.1ng / mL, up to about 0.2ng / mL, up to Approximately 0.5ng / mL, maximum approximately 1ng / mL, maximum approximately 5ng / mL, maximum approximately 10ng / mL , maximum approximately 20ng / mL, maximum approximately 50ng / mL, maximum approximately 100ng / mL, maximum approximately 20 0ng / mL, maximum approximately 500ng / mL, maximum approximately 1μg / mL, maximum approximately 2μg / mL, maximum Largest approximately 3μg / mL, maximum approximately 4μg / mL, maximum approximately 5μg / mL, maximum approximately 10μg / mL, Maximum of approximately 20μg / mL, maximum of approximately 30μg / mL, maximum of approximately 40μg / mL, maximum of approximately 50μg / mL, maximum approximately 100μg / mL, maximum approximately 200μg / mL, maximum approximately 300μg / mL, Maximum approximately 400μg / mL, maximum approximately 500μg / mL, maximum approximately 1mg / mL, maximum approximately 2mg / mL, maximum approximately 5 mg / mL, maximum approximately 10 mg / mL, maximum approximately 20 mg / mL, maximum approximately 5 0 mg / mL, or up to about 100 mg / mL.

[0081] In some cases, the concentration of polyribonucleotide in the mixture is about 0.1 ng / mL, approx. 0.2ng / mL, approx. 0.5ng / mL, approx. 1ng / mL, approx. 5ng / mL, approx. 10ng / mL, approx. 20ng / mL, approx. 50ng / mL, approx. 100ng / mL, approx. 200 ng / mL, approximately 500ng / mL, approximately 1μg / mL, approximately 2μg / mL, approximately 3μg / mL, Approximately 4μg / mL, approximately 5μg / mL, approximately 10μg / mL, approximately 20μg / mL, approximately 30μg / mL, approx. 40μg / mL, approx. 50μg / mL, approx. 100μg / mL, approx. 200μg / mL , approx. 300μg / mL, approx. 400μg / mL, approx. 500μg / mL, approx. 1mg / mL, approx. 2mg / mL, approx. 5mg / mL, approx. 10mg / mL, approx. 20mg / mL, approx. 50mg / m L, or about 100 mg / mL.

[0082] The composition may include a polyribonucleotide and an alcohol (eg, ethanol). In certain particular embodiments, the composition comprises a linear polyribonucleotide and an alcohol. In certain particular embodiments, the composition comprises a circular polyribonucleotide (circR Due to their circular structure, circRNAs are similar to their linear counterparts. Compared to RNA, improved stability, increased half-life, reduced immunogenicity, and / or functionality ( For example, the improved functionality described herein.

[0083] The composition may include a polyribonucleotide and a cell permeation agent. In one embodiment, the composition comprises a linear polyribonucleotide and a cell penetrating agent. In an embodiment, the composition comprises a circular polyribonucleotide (circRNA) and a cell penetrating agent. Due to their circular structure, circRNAs are more stable than their linear counterparts. improved activity, increased half-life, reduced immunogenicity, and / or functionality (e.g., as described herein) The improved functionality will be

[0084] In some cases, the circular polyribonucleotides provided herein are linear. At least one of the corresponding linear expression sequences or linear circular polyribonucleotides In some cases, the circular polyribonucleotide has a half-life of In some cases, the half-life is about 5 %, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or In some cases, the circular polyribonucleotide is at least For about 1 hour to about 30 days, or for at least about 2 hours, 6 hours, 12 hours, 18 hours, 24 hours, Time, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19th day, 20th day, 21st day, 22nd day, 23rd day, 24th day, 25th day, 26th day, 27 days, 28 days, 29 days, 30 days, 60 days, or more, or any period therebetween In certain embodiments, the circular polyribonucleotide has a half-life or persistence in cells of any length of time. The nucleotide may be incubated for about 10 minutes to about 7 days or less, or for about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, or less. hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 1 4 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 2 2 hours, 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, 4 days, 5 days, 6 days , 7 days or less, or any time therebetween.

[0085] Payload and cosmetic effects In some cases, the polyribonucleotide is delivered to The polyribonucleotide comprises at least one payload capable of having a cosmetic effect on a subject. The payload can be in either linear or cyclic form. The cosmetic payload may be a cosmetic payload that has a cosmetic effect after administration to a cell, tissue, or skin area. The payload may be any payload having a polyribonucleic acid sequence that may be involved in the expression product. In some embodiments, the payload may be one or more sequences in the nucleotide sequence. The group consisting of collagen, keratin, elastin, and botulinum toxin, or any fragment thereof. The cosmetic protein or peptide is selected from the group consisting of

[0086] A cosmetic payload is any protein or peptide that has a cosmetic effect upon administration. For example, the cosmetic payload may be collagen or a fragment thereof, elastin or a fragment thereof. , fibronectin or a fragment thereof, keratin or a fragment thereof, botulinum toxin or a fragment thereof It may be a fragment of α-melanocyte stimulating hormone. The erode can be any extracellular matrix protein or fragment thereof. In embodiments, the cosmetic payload is palmitoyl-KTTKS peptide, GEKG peptide. Any bioactive peptide having a cosmetic effect, such as a peptide containing a ketotide or a KEK motif. Bioactive peptides are endogenous proteins found throughout the body (e.g., in the skin). The amino acids (5-20) derived from the enzymatic processing of the extracellular matrix A peptide that contains a short sequence of 10 amino acids. , any of the following that modulate cosmetic cell functions, e.g., collagen or melanin homeostasis; In some embodiments, the cosmetic payload can be a peptide of manganese or copper. Copper peptides carrying trace elements such as Myocept or X-50 carrier peptides The cosmetic effect regulated by the carrier peptide may be anti-aging of the skin. In some embodiments, the cosmetic payload is XEP-30, a palmitoyl tripeptide. -38, palmitoyl tetrapeptide-28 argirrine, and syn-ake Neurotransmitter inhibitor peptides. The benefit can be a reduction in the appearance of expression lines. In some embodiments, the cosmetic payload comprises , Trilagen, Trifluoroacetyl Tripeptide-2, Silk Fibroin Peptide, and and enzyme inhibitor peptides such as soybean peptides. The benefit can be anti-aging. In some embodiments, the cosmetic payload is palmitoyl. yl oligopeptide-7, copper peptide, palmitoyl pentapeptide-4, and matrix peptide The signal peptides that regulate the expression of IL-3000 and IL-3000 are known to be important. The effect may be anti-aging.

[0087] In some cases, the payload has a cosmetic effect on the subject after administration. The cosmetic effects of ribonucleotides include improving the appearance of the skin and enhancing skin rejuvenation. increasing elasticity; preventing or reducing wrinkles; lightening or darkening the skin or hair, hair colour or density These include, but are not limited to, altering the appearance of the skin and / or providing other anti-aging care. The present invention may include an alteration in the appearance of an outer skin part of a subject, which may not be caused by a particular condition.

[0088] Expression sequence In some cases, the polyribonucleotide as described herein is The nucleic acid sequence includes at least one expressible sequence encoding a peptide or polypeptide. Polyribonucleotides as described above can be used to produce peptides or polypeptides having cosmetic effects. The peptide comprises at least one expression sequence encoding a protein, a small peptide, , peptide mimetics (e.g., peptoids), amino acids, and amino acid analogs, Peptides can be linear or branched. Peptides can be one molecule. molecular weight less than about 500,000 grams per molecule, and less than about 200,000 grams per mole less than about 100,000 grams per mole; less than about 50,000 grams per mole Less than about 20,000 grams, molecular weight per mole Less than about 20,000 grams, molecular weight per mole Less than about 10,000 grams per mole Less than about 5,000 grams per mole Molecular weight less than about 2,000 grams per mole, Molecular weight less than about 1,000 grams per mole or less than about 500 grams, as well as the salts, esters, and other pharmaceutical forms of such compounds. The polypeptide of interest may be in any form that is commercially acceptable. It may be independently encoded by a fragment of any of the above nucleic acids or variants, for example: It may comprise an entire polypeptide, multiple polypeptides or fragments of a polypeptide. The nucleotides can exist in either linear or cyclic form.

[0089] In some cases, polyribonucleotides are found in the skin, hair, eyelashes, nails, and other tissues. Cosmetic applications that can contribute to altering the appearance of parts of the subject's skin, such as, but not limited to, tissue. Cosmetic proteins include those expressed in the form of protein sequences. Protein replacement (e.g., replacement of proteins whose expression is reduced due to aging), protein supplementation These may include hormones, cytokines, cell reprogramming / transdifferentiation factors, and transcription factors. In some embodiments, the protein is a hair, skin, or nail protein. It is a cosmetic protein such as collagen.

[0090] In some cases, the polyribonucleotide may be a regulatory element, e.g., a circular polyribonucleotide. Sequences that modify the expression of expression sequences in a ribonucleotide or linear polyribonucleotide Regulatory elements include sequences that are located adjacent to an expression sequence that codes for an expression product. The regulatory element may be operably linked to an adjacent sequence. , the amount of product expressed compared to the amount of product expressed without the presence of the regulatory element. In addition, one regulatory element can be used to increase the number of genes that are linked in series. It is possible to increase the amount of product expressed relative to the expression sequence. A nodal element can enhance expression of one or more expression sequences. It is well known to businesses.

[0091] In some cases, the polyribonucleotide may include a translation initiation sequence, e.g., an initiation codon. In some cases, the translation initiation sequence includes a Kozak or Shine-Dalger sequence. It is an arrangement.

[0092] In some cases, the polyribonucleotide begins at a codon that is not the first initiation codon. , for example, AUG. Translation of polyribonucleotides begins with ACG, AGG, AAG , CTG / CUG, GTG / GUG, ATA / AUA, ATT / AUU, TTG / UUG In some cases, the translation may begin at an alternative translation initiation sequence, such as, but not limited to, In this case, translation is initiated by eukaryotic initiation factor 4A (eIF4A). In an embodiment, translation is initiated by the inclusion of an internal ribosome entry site (IRES) end of a polyribonucleotide. The IRES element is an RNA molecule capable of binding eukaryotic ribosomes. In some cases, the IRES element may comprise at least about 5n A sequences. t, at least about 8 nt, at least about 9 nt, at least about 10 nt, at least about 1 5 nt, at least about 20 nt, at least about 25 nt, at least about 30 nt, At least about 40 nt, at least about 50 nt, at least about 100 nt, at least about 200 nt nt, at least about 250 nt, at least about 350 nt, or at least about 500 nt In one embodiment, the IRES element is selected from viral, mammalian, and Drosophila genes. Derived from the DNA of organisms including, but not limited to, Drosophila Such viral DNA includes encephalomyocarditis virus (EMCV) cDNA and poliovirus It can be derived from picornavirus complementary DNA (cDNA), as well as viral cDNA. In one embodiment, the IRES element is derived from Drosophila (Drosophila) DNA was melanogaster stomach.

[0093] In some cases, the polyribonucleotide comprises one or more expression sequences, each of which The current sequence may or may not have a termination element. In accordance with the present invention, the polyribonucleotide comprises one or more expression sequences, the expression sequences being preferably terminated with a termination element. In some embodiments, the polyribonucleotide is a cyclic polyribonucleotide. It is a circular polyribonucleotide that lacks a termination element so that translation can continue. In some cases, the polyribonucleotide may include a terminating element at the end of one or more of the expression sequences. In some cases, one or more of the expression sequences lacks a termination element. Generally, a termination element is an in-frame nucleotide triplet that signals the end of translation. Includes let, e.g., UAA, UGA, UAG.

[0094] Polyribonucleotides can be used, for example, to modify the expression of endogenous and / or foreign genes. In some cases, the polyribonucleotide may include a regulatory nucleic acid. As a regulatory nucleic acid, it includes one or more expression sequences that encode (e.g., are complementary to) tRNA, lncRNA, miRNA, rRNA, snRNA, microRNA, s iRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, YR Examples of non-coding RNA include, but are not limited to, NA, and hnRNA. However, it is not limited to these.

[0095] In one example, the regulatory nucleic acid targets a host gene. A nucleic acid that hybridizes to the nucleic acid sequence (e.g., a miR as described elsewhere herein) NA, siRNA, mRNA, lncRNA, RNA, DNA, antisense RNA, g RNA), nucleic acid that hybridizes to foreign nucleic acid such as viral DNA or RNA, RNA nucleic acids that hybridize to nucleic acids that interfere with gene transcription, nucleic acids that interfere with RNA translation, Nucleic acids that stabilize RNA or destabilize RNA, such as through targeting for resolution. These may include, but are not limited to, nucleic acids that regulate DNA or RNA binding factors. In one embodiment, the sequence is an miRNA.

[0096] Polyribonucleotides may comprise all or part of an endogenous gene or gene product (e.g., mRNA). The fragment may encode a regulatory nucleic acid that is substantially complementary or completely complementary to the fragment. The nodal nucleic acid is the site of transcription of newly generated nuclear RNA transcripts of a specific gene into mRNA. Interactions with intron-exon boundaries, between exons, or adjacent sequences that prevent maturation A regulatory nucleic acid that is complementary to a particular gene can be a nucleic acid that encodes the mRNA for that gene. and can prevent its translation. The nucleic acid may be DNA, RNA, or a derivative or hybrid thereof. In this case, the regulatory nucleic acid is a protein involved in regulating the expression of an endogenous or foreign gene. It contains a protein binding site that binds to the protein.

[0097] In some cases, the cyclic polyribonucleotide as provided herein The translation efficiency can be measured using a reference, e.g., a linear counterpart, a linear expression sequence, or a linear circular polyribonucleic acid (PNAS). In some cases, the cyclic polynucleotides as provided herein are higher than the nucleotides. The ribonucleotides are at least about 5%, 10%, 15%, 20%, 25%, %, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75 %, 80%, 85%, 90%, 95%, 100%, 125%, 150%, 175%, 20 0%, 250%, 300%, 350%, 400%, 450%, 500%, 600%, 70 %, 800%, 900%, 1000%, 2000%, 5000%, 10000%, 100 In some cases, the circular polyribonuclease has a translation efficiency of 000% or higher. Nucleotides have a translation efficiency 10% higher than that of their linear counterparts. In Escherichia coli, circular polyribonucleotides have a translation efficiency 300% higher than that of their linear counterparts. has.

[0098] In some cases, the cyclic polyribonucleotides produce a stoichiometric ratio of expression products. Rolling circle translation produces expression products continuously in substantially the same ratio. In some cases, the circular polyribonucleotide has a stoichiometric translation efficiency, As a result, the expression products are produced in substantially the same ratio. Ribonucleotides can be used to express multiple expression products, e.g., 2, 3, 4, 5, 6, 7, 8, 9, 1 It has a stoichiometric translation efficiency of the product from 0, 11, 12 or more expressed sequences.

[0099] In some cases, when translation of a circular polyribonucleotide is initiated, a circular polyribonucleotide is produced. The ribosome bound to the ribonucleotide is a ribosome that is attached to at least one of the circular polyribonucleotides. It does not leave the circular polyribonucleotide before the translation of the round is complete. In some cases In the present invention, a circular polyribonucleotide as described herein is In some cases, during rolling circle translation, When translation of a polyribonucleotide is initiated, the linker attached to the circular polyribonucleotide The ribosomal ribonucleotides are synthesized by merging at least two rounds of the circular polyribonucleotides. , at least 4 rounds, at least 5 rounds, at least 6 rounds, at least 7 rounds, at least 8 rounds, at least 9 rounds, at least 10 rounds, At least 11 rounds, at least 12 rounds, at least 13 rounds, at least 14 rounds, at least 15 rounds, at least 20 rounds, at least 30 rounds at least 40 rounds, at least 50 rounds, at least 60 rounds, At least 70 rounds, at least 80 rounds, at least 90 rounds, at least 100 rounds, at least 150 rounds, at least 200 rounds, at least 2 50 rounds, at least 500 rounds, at least 1000 rounds, at least 1 500 rounds, at least 2000 rounds, at least 5000 rounds, at least Even 10,000 rounds, at least 10 5 Round, or at least 10 6 Round Translation It does not leave the circular polyribonucleotide before translation is complete.

[0100] In some cases, rolling circle translation of a circular polyribonucleotide A polypeptide product translated from two or more rounds of translation of a contiguous polyribonucleotide ("contiguous"). In some cases, this results in the production of a circular polyribonucleoside ("polyribonucleoside"). Tides are also known as alternating elements (e.g., elements that cause ribosome pausing during translation). The rolling circle translation of the circular polyribonucleotide Polypeptide products produced from one or less than one round of translation of a nucleotide In some cases, this results in the production of a "distinct" expression product. Circular polyribonucleotides are synthesized by rolling circle translation of circular polyribonucleotides. At least 10%, 20%, 30%, 40%, 50% of all polypeptides produced during , at least 60%, at least 70%, at least 80%, at least 90%, at least At least 95%, at least 96%, at least 97%, at least 98%, at least 99% %, or 100% (molar / molar) of the mixture is a separate polypeptide. In some cases, the ratio of the amount of a separate product to the total polypeptide is In some cases, it is used to test the ratio of amounts A commonly used in vitro translation system includes rabbit reticulocyte lysate. The ratio of the amounts is determined for an in vivo translation system such as a eukaryotic cell or a prokaryotic cell, a cultured cell, or a cell in an organism. The test is carried out in the following order:

[0101] In some cases, the polyribonucleotide comprises an untranslated region (UTR). The UTRs of genomic regions that contain genes can be transcribed but not translated. In some cases, the UTR may be upstream of the translation initiation sequence of the expressed sequences described herein. In some cases, a UTR may be included downstream of the expression sequences described herein. In some cases, a UTR for a first expressed sequence may be a UTR for a second expressed sequence. It may be identical to, contiguous with, or overlap with another UTR. In some cases In some cases, the intron is a human intron. A full length human intron, for example ZKSCAN1.

[0102] In some cases, polyribonucleotides are embedded with adenosines and uridines. These AU-rich features are important in the circulating expression product. The conversion rate can be increased.

[0103] The introduction, removal, or modification of AU-rich elements (AREs) in the UTRs results in the synthesis of polyribonucleic acid (PNA)-derived ribonuclease (PNA). It may be useful to regulate the stability or immunogenicity of certain polyribonucleic acid analogs. When designing a polypeptide, one or more copies of an ARE may be introduced into the polyribonucleotide. In addition, copies of the ARE may regulate the translation and / or production of the expression product. , can be identified and removed, or their intracellular stability can be modulated, thus resulting in The ribonucleotides are designed to affect the translation and production of proteins that cause obtain.

[0104] Any UTR from any gene may be expressed as a sequence of polyribonucleotides, each of which may be flanked by It should be understood that the following may be incorporated: TR or a fragment thereof is incorporated herein by reference in its entirety. Patent applications 61 / 775,509 and 61 / 829,372, or The UTs listed in International Patent Application No. PCT / US2014 / 021522 In addition, multiple wild-type UTRs of any known gene can be utilized. It is also within the scope of the present invention to provide artificial UTRs that are not gene variants. These UTRs or portions thereof may be selected or modified in their orientation or location. Thus, the 5' or 6' sequences may be arranged in the same orientation as in the transcript that may be The 3'UTR may be inverted, shortened, extended, or modified with one or more other 5' As used herein, the term "modified" refers to a chimera with a 3' UTR or 3' UTR. "is" refers to a UTR sequence, which means that the UTR is aligned in some way with respect to the reference sequence. For example, the 3' or 5' UTR is altered as taught above. The UTRs may be modified relative to the wild-type or native UTRs by changes in the orientation or position of the Alternatively, the inclusion of additional nucleotides, deletion of nucleotides, exchange or rearrangement of nucleotides may be used. These methods, which generate "modified" UTRs (3' or 5'), Any of the alterations include a variant UTR.

[0105] In one embodiment, double, triple, or quadruple UTRs, such as 5' or 3' UTRs, are used. As used herein, a "double" UTR refers to two copies of the same UTR in sequence. For example, the double beta-globin 3' UTRs are disclosed in U.S. Patent Application Publication No. 2010012, the contents of which are incorporated herein in their entirety. It may be used as described in the 9877 patent.

[0106] In some cases, the polyribonucleotide may include a polyA sequence. In one embodiment, the length of the polyA sequence is more than 10 nucleotides long. In the present invention, the polyA sequence is more than 15 nucleotides in length (e.g., at least about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1,000, 1,100, 1,200, 1, 300, 1,400, 1,500, 1,600, 1,700, 1,800, 1,900, 2,000, 2,500, and 3,000 or more nucleotides). In some cases, the polyA sequence may be from about 10 to about 3,000 nucleotides (e.g., 3 0~50, 30~100, 30~250, 30~500, 30~750, 30~1,00 0, 30~1,500, 30~2,000, 30~2,500, 50~100, 50~2 50, 50~500, 50~750, 50~1,000, 50~1,500, 50~2, 000, 50~2,500, 50~3,000, 100~500, 100~750, 10 0~1,000, 100~1,500, 100~2,000, 100~2,500, 10 0~3,000, 500~750, 500~1,000, 500~1,500, 500~ 2,000, 500~2,500, 500~3,000, 1,000~1,500, 1, 000~2,000, 1,000~2,500, 1,000~3,000, 1,500~ 2,000, 1,500~2,500, 1,500~3,000, 2,000~3,00 0, 2,000-2,500, and 2,500-3,000).

[0107] In one embodiment, the polyA sequence is designed relative to the overall polyribonucleotide length. The design may include the length of the coding region, specific features or regions (such as the first region or adjacent regions), The length of the polyribonucleotide may be based on the length of the final product expressed from the polyribonucleotide. In this context, a polyA sequence may be a cyclic polyribonucleotide or a Lengths 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% longer than the feature The polyA sequence may also be part of the polyribonucleotide to which it belongs. In this context, the polyA sequence may be designed to be either the full length of the construct or a portion of the construct. The total length of the construct was 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 190, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 5 In addition, the circular polyribonucleotide for polyA binding protein may be 80 or 90% or more. Engineered binding sites and conjugation of nucleotides can enhance expression.

[0108] In one embodiment, the polyribonucleotide is designed to contain poly-AG quartets. G-quartets are formed by G-rich sequences in both DNA and RNA. In one embodiment, the nucleotide sequence may be a cyclic hydrogen-bonded sequence of four guanine nucleotides that In some cases, a G quartet is incorporated at the end of the polyA sequence. Although AG quartets are seen using the 120 nucleotide polyA sequence alone, This results in at least 75% equivalent protein production.

[0109] In some cases, the polyribonucleotide may contain polyA or may lack polyA. or a modified polyA to modulate one or more characteristics of the polyribonucleotide. In some cases, polyribonucleic acid lacking polyA or having a modified polyA may be used. The nucleotides are designed to improve one or more functional characteristics, e.g., immunogenicity, half-life, expression efficiency, etc. To raise.

[0110] Encryptogen As described herein, polyribonucleotides reduce cellular innate immune responses. Polyribonucleotides may contain encryptogens that allow or prevent the formation of ribonucleotides. It can be in either a linear or cyclic form. The cyclic polyribonucleotides provided have a potent inhibitory effect on the response elicited by the reference compound, compared to the response elicited by the reference compound. This results in a reduced immune response from the host. For example, cyclic polyribonucleotides can be used to Compared to a linear polynucleotide or a linear polynucleotide containing an encryptogen A corresponding linear polyribonucleic acid molecule lacking the encryptogen results in a reduced immune response. In some embodiments, the polyribonucleic acid The polypeptides are less immunogenic than their counterparts lacking the cryptogen.

[0111] In some embodiments, the polyribonucleotide is In some embodiments, the polyribonucleotide is expressed in a mammalian cell, For example, it is capable of replicating in human cells.

[0112] In some embodiments, the polyribonucleotide comprises a sequence or an expression product.

[0113] In some embodiments, the polyribonucleotide comprising the encryptogen is In some embodiments, the half-life of the polysaccharide is at least as long as that of its counterpart lacking the saccharide. Ribonucleotides have increased half-lives over their counterparts. The half-life is approximately 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 4 In some embodiments, the polyribonucleic acid is increased by 5%, 50%, or more. The dose is at least about 1 hour to about 30 days, or at least about 2 hours, 6 hours, 12 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days 26 days, 27 days, 28 days, 29 days, 30 days, 60 days or more or any time in between. The polyribonucleotide may be incubated for about 10 minutes to about 7 days, or for about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 1 3 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 2 1 hour, 22 hours, 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, 4 days, 5 days 5 days, 6 days, 7 days or less, or any time in between. do.

[0114] In some embodiments, the polyribonucleotide comprising the encryptogen is a cosmetic agent. In certain embodiments, the cell function is modulated, for example, transiently or long term. The cell function is at least about 1 hour to about 30 days, or at least about 2 hours, 6 hours, 12 hours 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 1 7 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 2 5 days, 26 days, 27 days, 28 days, 29 days, 30 days, 60 days, or any In certain embodiments, the modification is stably altered, such as a modulation lasting for a period of time greater than or equal to 100 μg / mL, or any period therebetween. The cosmetic cell function may last, for example, from about 30 minutes to about 7 days or less, or from about 1 hour, 2 hours, 3 hour, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 o'clock 13:00, 14:00, 15:00, 16:00, 17:00, 18:00, 19:00, 20:00 21 hours, 22 hours, 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, 4 days Transient improvements, such as adjustments lasting less than 1, 2, 3, 4, 5, 6, or 7 days, or any time in between. It will be changed.

[0115] In some embodiments, the polyribonucleotide comprising the encryptogen comprises at least At least about 20 base pairs, at least about 30 base pairs, at least about 40 base pairs, at least about 50 base pairs, at least about 75 base pairs, at least about 100 base pairs, at least about 200 base pairs at least about 300 base pairs, at least about 400 base pairs, at least about 500 base pairs In some embodiments, the length of the encryptogen is at least about 1,000 base pairs. Polyribonucleotides containing ribonucleotides have sufficient fragment length to accommodate binding sites for ribosomes. Those skilled in the art can determine the maximum size of the polyribonucleotide containing the encryptogen. Size determines the degree of freedom in producing and / or using polyribonucleotides It will be appreciated that the dimensions may be within the technical constraints of the present invention.

[0116] In some embodiments, the cyclic polyribonucleotide comprising the encryptogen is a linear polyribonucleotide. The half-life of the linear expression sequence or linear circular polyribonucleotide is slightly different from that of its linear counterpart, e.g. In some embodiments, the circular polyribonucleotide is a linear polyribonucleotide. In some embodiments, the half-life is about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, or In some embodiments, the circular polyribonucleotide is at least In either case, the time is about 1 hour to about 30 days, or at least about 2 hours, 6 hours, 12 hours, 18 hours, or 2 4 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days , 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days , 19th day, 20th day, 21st day, 22nd day, 23rd day, 24th day, 25th day, 26th day , 27 days, 28 days, 29 days, 30 days, 60 days, or more, or any period therebetween In certain embodiments, the cyclic polysaccharide has a half-life or persistence in cells of any length of time. The polynucleotide may be used for about 10 minutes to about 7 days or less, or for about 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, 4 days, 5 days, 6 days The compound has a half-life or persistence in cells of 10 to 20 minutes, 7 days or less, or any time therebetween.

[0117] In some embodiments, the cyclic polyribonucleotide comprising the encryptogen is In certain embodiments, the therapeutic agent modulates a cosmetic cellular function, for example, transiently or long term. The cell function is maintained for at least about 1 hour to about 30 days, or for at least about 2 hours, 6 hours, or 1 2 hours, 18 hours, 24 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days , 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days , 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, 60 days, or The modification is stable, such as a modification that lasts for a period of time greater than or equal to any period therebetween. In this embodiment, the cosmetic cell function can be maintained for, for example, about 30 minutes to about 7 days or less, or for about 1 hour, 2 hours, or less. , 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 1 2 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 2 0 hours, 21 hours, 22 hours, 24 hours, 36 hours, 48 ​​hours, 60 hours, 72 hours, 4 Transient, such as adjustment lasting less than a day, 5 days, 6 days, or 7 days, or any time in between. will be changed to.

[0118] In some embodiments, the cyclic polyribonucleotide comprising the encryptogen comprises at least at least about 20 base pairs, at least about 30 base pairs, at least about 40 base pairs, at least about 50 base pairs, at least about 75 base pairs, at least about 100 base pairs, at least about 200 base pairs, at least about 300 base pairs, at least about 400 base pairs, at least about 500 base pairs In some embodiments, the circular polyribonucleotide has at least about 1,000 base pairs. The polynucleotide is of sufficient size to accommodate a binding site for a ribosome. Those skilled in the art will appreciate that the maximum size of a circular polyribonucleotide is Within the technical constraints of producing and / or using circular polyribonucleotides Without being bound by theory, it can be appreciated that the RNA The multiple segments are maximally cleaved when only one 5' and one 3' free end remain. DNA that is annealed to produce a "thread" of RNA that can eventually be circularized, and In some embodiments, the cyclic nucleotides may be generated from the 5' and 3' free ends of the cyclic nucleotides. The maximum size of a polyribonucleotide is the capacity to package and deliver RNA to a target. In some embodiments, the size of the circular polyribonucleotide may be limited by a force. is long enough to code for a useful polypeptide, and therefore is approximately 20,000 Less than 0 base pairs, less than about 15,000 base pairs, less than about 10,000 base pairs, about 7,500 base pairs less than about 5,000 base pairs, less than about 4,000 base pairs, or less than about 3,000 base pairs less than about 2,000 base pairs, less than about 1,000 base pairs, less than about 500 base pairs, less than about 40 The length is less than 0 base pairs, less than about 300 base pairs, less than about 200 base pairs, or less than about 100 base pairs. Could be useful.

[0119] Cleavage sequence In some embodiments, the polyribonucleotide comprises at least one cleavage sequence. Polyribonucleotides can exist in either linear or circular form. In embodiments, the cleavage sequence is adjacent to the expression sequence. The nucleotide may be a disrupted polyribonucleotide, a cleavable polyribonucleotide, or a self-cleavable polyribonucleotide. In some embodiments, the nucleic acid sequence includes a cleavage sequence, such as in a truncated polyribonucleotide. The polyribonucleotide may contain two or more cleavage sequences, resulting in multiple production of polyribonucleotides. to products such as miRNA, linear RNA, smaller circular polyribonucleotides, etc. Brings about separation.

[0120] Other Reagents In some cases, the composition or cosmetic composition comprises an alcohol or a cell-penetrating agent and In addition to the polyribonucleotide, the composition or cosmetic composition further comprises a reagent. In addition to the polyribonucleotide, the composition may contain one or more active agents, e.g., cosmetic agents. In some cases, a composition comprising one or more active agents, e.g., cosmetic agents, For example, excipients, diluents, etc., that facilitate processing of one or more active agents into a formulation that can be administered; and / or adjuvants. Polyribonucleotides can exist in either linear or circular form.

[0121] In some cases, the cosmetic composition further comprises a subject matter as described herein. The cosmetic agent includes a cosmetic agent that causes a change in the appearance of the outer skin portion of the , Ricinus Communis (Castor) Seed Oil, Olive Fatty Acids Cetearyl, Lecithin, Caprylic / Capric Triglyceride, Olive Fatty Acid Sorbita , Cetearyl Alcohol, Dimethicone, Ergothioneine, Isosorbide Dicaprylate , Glyceryl Behenate, Ethyl Linoleate, Ethylhexyl Palmitate, Dimethylsilyl Silica, Butylene Glycol, Sodium Hyaluronate, Magnolia Officinalis Magnolia Officinalis Bark Extract, Ectoin, Ascorbic Acid Tetrahexyldecyl Phosphate, Pentenol, Hydrogenated Castor Oil, Cera Alba, Carnaubaya Copernicia Cerifera (Carnauba) Wax, Sodium PCA , urea, trehalose, triacetin, polyquaternium-51, methylglucosidrin Acid, Copper Lysinate / Prolinate, Ceteareth-20, Magnesium Aspartate, Glyceryl Stearate, Zinc gluconate, copper gluconate, C8-22 alkyl acrylate / methacrylate crosspolymer Mar, Persea Gratissima (Avocado) Oil , Squalane, Oenothera Biennis (Evening Primrose) Oil, Fragrance, allantoin, stearyl glycyrrhetinate, maltodextrin, tocopherol Vitis Vinifera (Grape) Seed Extract , xanthan gum, arginine, aloe vera juice, macadamia nut oil, phenoxyethanol Alcohol, Ethylhexylglycerin, Sodium Phytate, and Tricholoma matsutake (Tricholoma Matsutake) Extract, Cyclopentasiloxane, CI 2-15 alkyl benzoate, titanium dioxide, zinc oxide, dimethicone, polyglyceryl- 3 Polydimethylsiloxyethyl Dimethicone, Dimethicone / PEG-10 / 15 Crosspo Rimer, stearic acid, aluminum hydroxide, sodium chloride, glycerin, magnolia Magnolia Officinalis Bark Extract, Ectoy Caprylyl Glycol, Teprenone, Sodium Hyaluronate, Vitis Vinifera Vitis Vinifera (Grape) Seed Extract, Tetrahydrofuran Ascorbic Acid xyldecyl, ergothioneine, tocopherol acetate, tocopherol, malt Todextrin, lecithin, ethylhexyl palmitate, caprylic / capric triglyceride Lyceride, PEG / PPG-18 / 18 Dimethicone, Polyglycerin-3 Crosspolymer , hexyl laurate, cyclohexasiloxane, triethoxysilylethylpolydimethyl Thiylsiloxyethylhexyl Dimethicone, Dimethicone / Vinyl Dimethicone Crosspolymer , Polyglyceryl-4 Isostearate, Cetyl PEG / PPG-10 / 1 Dimethicone, Dimethylsilylated silica, triethoxycaprylylsilane, phenoxyethanol, ethyl Hexylglycerin, Butylene Glycol, Hexylene Glycol, Fragrance, Mica and Silica, Potassium Azeroyl Diglycinate, Hamamelis virginiana (Hamame lis virginiana (witch hazel) extract, glycerin, methylglucose Seth-20, Magnolia Officinalis ) Bark Extract, Ergothioneine, Ectoine, Pentylene Glycol, Salic Nigra (Salix Nigra) (Willow) Bark Extract, Magnesium Aspartate, Glu Zinc Conate, Copper Gluconate, Microcitrus Australasica Austraiasica Fruit Extract, Mucor Miehei ei) Extract, Glucosamine HCl, Urea, Phenoxyethanol, Ethylhexylglycerin Serine, Polysorbate 20, Magnolia Glauca ) Petal water, sodium PCA, potassium sorbate, allantoin, diglycyrrhizinate Potassium, Alcohol Denat., Disodium EDTA, Lactic Acid, Maltodextrin, Lecithin Tocopherol, Vitis Vinifera (Brown) Dou (Aloe) Seed Extract, Sodium Hydroxide, Caprylic / Capric Triglyceride, Jasminum Jasminum Officinale (Jasmine) Extract, Rosa Damascena Petal Extract, Pelargonium Graveolens Pelargonium Graveolens Oil, Citrus Medica Citrus Medica Limonum (Lemon) Peel Oil, Camellia Camellia Sinensis Leaf (Green Tea) Extract, Mentha bilirubin Mentha Viridis (Spearmint) Leaf Oil, and Juniperus officinalis (Juniperus officinalis) Leaf Oil Juniperus Virginiana Oil may be included, but is not limited to. Not determined.

[0122] In some cases, the cosmetic agent is pentapeptide-18, acetyl hexapeptide Tide-8, Caprylyl Methicone, Glycerin, Butylene Glycol, Beta Glucan (O at), isosorbide caprylate, dimethicone, isostearyl alcohol, butylene glycol Licorice Cocoate, Polyacrylate-13, Magnolia Officinalis (Magn olia officinalis) bark extract, ergothioneine, ectoine, pal Mitoyl tetrapeptide-7, acetyl tetrapeptide-5, tetrahexyl ascorbate Sildecyl, Tyrosine, Hesperidin Methyl Chalcone, Tricholoma matsutake (Tric holoma Matsutake Extract, Coralina Officinalis (Coral lina Officinalis Extract, Sodium Hyaluronate, Sodium Silicate Aluminum potassium, silica, pullulan, steareth-20, dipeptide-2, ethyl Cellulose, Polysorbate 20, Polyisobutene, Dimethiconol, Panthenol, Oryza Sativa (Rice) Bran Oil, Lecithin, Allantoin , Xanthan Gum, Elaeis Guineensis Oil , Tocotrienol, Tocopherol, Phenoxyethanol, Maltodextrin, Vitamin B Vitis Vinifera (Grape) Seed Extract, Phytin Contains sodium hydroxide, fragrance, ethylhexylglycerin, mica, and titanium dioxide. Not limited to these.

[0123] In some embodiments, the polypeptides as described herein are used in cosmetic formulations. Cosmetic formulations are formulated with silicones, aerosols, antioxidants, cleaning agents, colorants, and agents, additional conditioning agents, deposition agents, electrolytes, emollients and oils, stripping agents, foam boosters, Fragrances, humectants, occlusives, lice killing agents, pH control agents, pigments, preservatives, biocides, other solvents Solvents, stabilizers, sunscreens, suspending agents, tanning agents, other surfactants, thickeners, vitamins, botanicals Physical agents, waxes, rheology modifiers, anti-pityloides capitis agents, anti-acne agents, anti-tooth decay agents and wound care agents In some embodiments, the cosmetic formulation may include one or more of the following additional agents: Additional adjuvants and additives include abrasives, anti-acne agents, agents against skin aging, anti-cellulite agent, anti-pityle agent, anti-inflammatory agent, irritant inhibitor, irritant inhibitor, antioxidant, astringent, sweat inhibitor agents, antiseptic agents, antistatic agents, binding agents, buffers, carrier materials, chelating agents, cell stimulants, Cleansing agents, care agents, hair removal agents, surfactants, deodorants, antiperspirants, softeners, emulsifiers, enzymes, essential oils, Fibers, film formers, fixatives, foam formers, foam stabilizers, substances for preventing foaming, foam boosters , gelling agents, gel forming agents, hair care agents, hair setting agents, hair straighteners, moisture imparting agents, humidifiers Quality, moisture retaining material, bleaching agent, strengthening agent, stain remover, fluorescent whitening agent, penetrating agent, stain prevention agent, abrasion Antifriction agents, lubricants, moisturizing creams, ointments, opacifying agents, plasticizers, coatings, polishing powders, illuminating agents lubricants, polymers, powders, proteins, re-oiling agents, abrasives, silicones, skin soothing agents, skin cleansers Cleansing agents, skin care agents, skin healing agents, skin whitening agents, skin protection agents, skin softeners, hair growth agents, cooling agents , skin cooling agents, warming agents, skin warming agents, stabilizers, UV absorbers, UV filters, detergents, fabrics Conditioning agents, suspending agents, skin tanning agents, thickening agents, vitamins, oils, waxes, fats , phospholipids, saturated fatty acids, mono- or polyunsaturated fatty acids, α-hydroxy acids, polyhydric fatty acids, liquefaction agents, colouring agents, colour inhibitors, pigments, anticorrosive agents, fragrances, flavouring substances, aromatic substances The liquid may include a material, a polyol, a surfactant, an electrolyte, an organic solvent, or a silicon derivative.

[0124] In some cases, the compositions or cosmetic compositions described herein further comprise a solvent. Medium, aqueous solvent, non-aqueous solvent, dispersion medium, diluent, dispersion, suspension aid, surfactant, isotonic agent , thickeners or emulsifiers, preservatives, lipids, lipidoid liposomes, lipid nanoparticles, core-shell Nanoparticles, polymers, lipoplexes, peptides, proteins, cells, hyaluronidase Cosmetically acceptable excipients include, but are not limited to, The composition or cosmetic composition may further include salt concentration, osmolality, pH, hydrophobicity / philicity, etc. Suitable physical or chemical properties, such as, but not limited to, aqueous and solubility, For example, the composition may contain stabilizers, such as stabilizers at appropriate concentrations, e.g. , and glucose at about 4.5 g / L. In some embodiments, the polyribonucleotide In some embodiments, the polyribonucleotide is non-immunogenic. The composition or cosmetic composition may further enhance the immunogenicity of polyribonucleotides. The adjuvant may include a suitable adjuvant or other agent that may enhance or inhibit the absorption of the glycerol. and lipophilic gelling agents, hydrophilic and lipophilic active agents, preservatives, antioxidants, solvents, fragrances, injection agents The additive may be an additive, a screening agent, a pigment, an odor absorber, a dye, or any combination thereof.

[0125] Non-limiting examples of cosmetically acceptable carriers include starch, glucose, lactose. , sucrose, gelatin, saline, acacia gum, keratin, urea, malt, rice flour, hu Powder, Silica Gel, Sodium Stearate, Glycerol Monostearate, Talc, Salt Sodium chloride, dried skim milk, glycerol, propylene, glycol, humectants (e.g. urea), glycols (e.g., propylene glycol), fatty acids (e.g., oleyl acid), surfactants (e.g., isopropyl myristate and sodium lauryl sulfate) , pyrrolidone, glycerol monolaurate, sulfoxides, terpenes (e.g., menthol, alcohol), amines, amides, alkanes, alkanols, water, calcium carbonate, calcium phosphate Ums, various sugars, starches, cellulose derivatives, gelatin, polyethylene glycols, etc. and water. If necessary, the carrier may also contain a small amount of a wetting agent or emulsion. The composition may contain a pH adjusting agent or a pH buffer.

[0126] stability The polyribonucleotides provided herein are stable after delivery to a cell or tissue. and can provide a cosmetic effect on the cells or tissue to which the polyribonucleotides are delivered. Polyribonucleotides can be linear or circular. In some embodiments, the polyribonucleotide may be present in either form. It is a linear polyribonucleotide and has a short-term cosmetic effect, for example, at least 1 hour, 6 hours Cosmetic effects lasting for 12, 24, 48, 72 hours, or any time in between. In some embodiments, the polyribonucleotide is a circular polyribonucleotide. It is a nucleotide and has a long-term cosmetic effect, for example, at least 3 days, 4 days, 5 days, 6 days days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, or longer, or any time in between. In embodiments, the polyribonucleotide is resistant to degradation, e.g., exonucleases. In some embodiments, the polyribonucleotide is substantially resistant to autolysis. In some embodiments, the polyribonucleotide is resistant to an enzyme cleavage site, e.g. For example, it lacks a Dicer cleavage site.

[0127] In some embodiments, the polyribonucleotides remain in the cell during cell division. In some embodiments, the polyribonucleotides remain in daughter cells after mitosis. In some embodiments, the polyribonucleotide is replicated within the cell and passed to daughter cells. In some embodiments, the polyribonucleotide is an autologous polyribonucleotide. In some embodiments, the replication element comprises: A linear polyribonucleotide complementary to the circular polyribonucleotide of In some embodiments, the linear complementary The polyribonucleotides are synthesized in the cells into complementary circular polyribonucleotides. In some embodiments, the complementary polyribonucleotide may further comprise to another circular polyribonucleotide having the same or similar nucleotide sequence as the starting circular polyribonucleotide. An example of an autonomous replicating element is the HDV complex. Domains (Beeharry et al, Virol, 2014, 450-451: 165-173). In some embodiments, The cells express at least one polyribonucleotide at least 25%, 50%, 60%, They pass it to daughter cells with 70%, 80%, 85%, 90%, 95%, or 99% efficiency. In one embodiment, the cells undergoing meiosis contain at least two polyribonucleotides. 5%, 50%, 60%, 70%, 80%, 85%, 90%, 95% or 99% efficient In some embodiments, cells undergoing meiosis pass polyribonucleic acid (PNA) to daughter cells. Give the leotide to your daughter.

[0128] Delivery of cosmetic compositions The cosmetic compositions provided herein are formulated based in part on the intended route of administration of the composition. In certain aspects of the present disclosure, the compositions or cosmetic compositions provided herein may be formulated. The compositions may be administered locally at or near a particular site in a subject. The composition may be as described above and may further comprise cosmetically acceptable excipients. For example, viscous liquids, solutions, suspensions, gels, jellies, creams, lotions, ointments, foams Direct topical application of a solution, serum, or aerosol may be used for topical administration. Bonucleotides can exist in either linear or cyclic form.

[0129] The composition or cosmetic composition may contain alcohol (e.g., ethanol) and polyribonucleic acid. The composition or cosmetic composition may include a cell permeation agent and a polyribonucleotide. The composition or cosmetic composition may include a diluent and a polyribonucleotide. The composition or cosmetic composition does not include any carrier.

[0130] The cosmetic compositions provided herein have the effect of improving the appearance of skin, enhancing skin rejuvenation, and increasing elasticity; preventing or reducing wrinkles; lightening or darkening the skin or hair, hair colour or density These include, but are not limited to, altering the appearance of the skin and / or providing other anti-aging care. Used to alter, modify or change the appearance of the outer skin part of a subject, The methods provided herein include exfoliating the skin with a composition described herein. treating the skin with a composition as described herein; and / or treating the skin with a composition as described herein. The present invention relates to a method for reducing the visible signs of skin aging, the method comprising moistening the skin with a composition comprising the steps of: The methods provided herein can bleach skin. scalp, facial skin), nails, keratin fibers (e.g., hair or eyelashes), or any combination thereof. may be treated or cared for.

[0131] The cosmetic compositions provided herein can be applied to the forehead, scalp, hair follicles, hair, upper eyelids, lower eyelids, Eyebrows, eyelashes, infraorbital area, periorbital area, temples, nose, nasal bridge, cheeks, tongue, nasolabial folds, lips, periorbital area Area, jaw line, ear, neck, chest, forearm, upper arm, palm, hand, finger, nail, back, abdomen, flank, buttocks Surface areas of the subject, such as, but not limited to, the thighs, calves, feet, toes, gums, and tongue. The therapeutic agent may be formulated for administration directly to the area.

[0132] The cosmetic compositions described herein may be formulated as liquids such as suspensions, syrups, or elixirs. In some cases, the aqueous solution may be packaged for ready use. The lyophilized preparation is then combined with a sterile solution prior to administration. The cosmetic composition may be delivered as a solution or as a suspension. Formulations such as creams, lotions, and ointments provide a broader range of active agents for one or more active agents. While this can result in areas with exposure, formulations in solutions, e.g., sprays, are more effective. This can provide a more rapid, short-term exposure.

[0133] The composition or cosmetic composition as described herein may have a pH of about 7. In some embodiments, the composition or cosmetic composition has about the same viscosity as water. Or the cosmetic composition may be substantially free of hydrophobic or lipophilic groups. The composition or cosmetic composition is substantially free of hydrocarbons. substantially comprising fatty acids, lipids, liposomes, cholesterol, or any combination thereof. The composition or cosmetic composition may not contain glycerin, propylene glycol, or a combination thereof. It cannot substantially contain

[0134] In some embodiments, a polyribonucleotide (e.g., For example, a method of delivery of a cosmetic polyribonucleotide may include the use of a cosmetic polyribonucleotide and an enzyme. applying a cosmetic composition to the skin area of ​​a subject, the cosmetic composition comprising a mixture of ethanol and ethanol; The eluate comprises at least about 0.3% v / v to about 75% v / v of the mixture. In one embodiment, the method of delivery of a cosmetic polyribonucleotide as described herein comprises: A cosmetic composition comprising a mixture of cosmetic polyribonucleotides and alcohol is applied to the skin of a subject. The alcohol comprises at least about 0.3% v / v of the mixture and at least about 75% v / v of the mixture. In some embodiments, the cosmetic polymer as described herein comprises The method of delivery of ribonucleotides is a mixture of cosmetic polyribonucleotides and a cell permeation agent. The method includes applying a cosmetic composition to an outer skin portion of a subject, the cell permeation agent being at least one component of the mixture. In some embodiments, ethanol comprises at least about 0.3% v / v to about 75% v / v. The alcohol, alcohol, or cell permeabilizing agent is at least about 0.3% v / v to about 70% of the mixture. v / v, at least about 0.3% v / v to about 60% v / v, at least about 0.3% v / v to About 50% v / v, at least about 0.3% v / v to about 40% v / v, at least about 30% v / v to about 20% v / v, at least about 0.3% v / v to about 15% v / v, at least about 0 .3% v / v to about 10% v / v, at least about 0.3% v / v to about 5% v / v, at least Also about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to about 0.5% v / v, or any percentage v / v therebetween. The ethanol, alcohol, or cell permeabilizing agent is at least about 0.5% v / v of the mixture. ~ about 75% v / v, at least about 1% v / v~ about 75% v / v, at least about 5% v / v ~ about 75% v / v, at least about 10% v / v~ about 75% v / v, at least about 15% v / v to about 75% v / v, at least about 20% v / v to about 75% v / v, at least about 30 %v / v to about 75%v / v, at least about 40%v / v to about 75%v / v, at least about 50% v / v to about 75% v / v, at least about 60% v / v to about 75% v / v, or At least about 70% v / v to about 75% v / v, or any percentage therebetween Occupies / v.

[0135] In many cases, the compositions or cosmetic compositions as described herein are made of polyribonucleic acid. In some embodiments, the polyribonucleic acid is delivered to the dermis or epithelium of the subject. Reotide is delivered without iontophoresis.

[0136] Transdermal Administration Formulations for topical administration may be in liquid, semisolid dosage forms (e.g., pastes, creams, lotions, etc.). The formulation may be in the form of a cream, powder, ointment or gel, patch, film, or spray. In some cases, the topical composition can be applied to the affected area of ​​the skin of a subject in need thereof. The formulation may be a cream or gel that is administered intradermally or intradermally (e.g., for transdermal or dermal administration). The release may be, but is not limited to, controlled release, delayed release, extended release, or sustained release. This can be accomplished in different forms. Topical cosmetic compositions can be applied multiple times a day, once a day, or as needed. Polyribonucleotides can be either linear or circular. It may exist in the form

[0137] In some cases, the cosmetic composition is formulated for direct application onto an area of ​​skin. The cosmetic compositions provided herein can be administered intradermally or intradermally. The composition may contain a scientifically acceptable diluent. Such diluents may be used to treat skin, nails, mucous membranes, tissues, and and / or any dermatological diluent that is compatible with hair and meets these requirements. Such diluents can be readily selected by one of ordinary skill in the art. The cosmetic composition may include a dermatologically acceptable diluent. Any material that is compatible with and meets the requirements for skin, nails, mucous membranes, tissue, and / or hair. Such diluents may be readily selected by one of ordinary skill in the art. In formulating a skin ointment, one or more drugs may be mixed in an oily hydrocarbon base, an anhydrous absorption base, or a water-in-oil base. They may be formulated in an absorbent base of the oil-in-water type, a water-removable base of the oil-in-water type and / or a water-soluble base.

[0138] Ointments and creams may, for example, be aqueous or non-aqueous with the addition of suitable thickening and / or gelling agents. The lotion may be formulated with an aqueous or oily base. Generally, they will also contain one or more emulsifying agents, stabilizing agents, dispersing agents, suspending agents, thickening agents, or coloring agents. The construction and use of transdermal patches for the delivery of cosmetic agents is known in the art. Such patches may be used for continuous, pulsatile, or on-demand delivery of cosmetic agents. It can be constructed.

[0139] Lubricants that can be used to form the compositions and dosage forms include calcium stearate, stearate, and the like. Magnesium tearate, mineral oil, light mineral oil, glycerin, sorbitol, mannitol, poly Ethylene glycol, other glycols, stearic acid, sodium lauryl sulfate, talc , hydrogenated vegetable oils (e.g., peanut oil, cottonseed oil, sunflower oil, sesame oil, olive oil, tomato oil, Corn oil, and soybean oil), zinc stearate, ethyl oleate, ethyl laurate Additional lubricants may include ethyl laureate, agar, or mixtures thereof. Examples of the aerosol include syloid silica gel, solidified aerosol of synthetic silica, or mixtures thereof. The lubricant is optionally present in an amount of less than about 1 weight percent of the composition. may be added.

[0140] The compositions or cosmetic compositions provided herein may be in the form of emollients or emulsions, aqueous solutions, Water-alcoholic or oily solutions, lotions or serum dispersions, aqueous, anhydrous or oily gels emulsions (O / W or oil-in-water type) obtained by dispersion of a fatty phase in an aqueous phase or inverse (W / O or water in oil type), microemulsion or microcapsule, ion type and In any form suitable for topical administration, including non-ionic microparticles or lipid vesicle dispersions. In some embodiments, the composition or cosmetic composition may comprise at least one oil. In some embodiments, the composition or cosmetic composition is in the form of an emulsion comprising a water-soluble polymeric phase. The emulsifier may be an amphoteric, anionic, cationic, nonionic emulsifier, or any mixture thereof. It is in the form of an emulsion containing an emulsifier. The amounts of the various components of the compositions provided herein are in accordance with those used in the art. These compositions can be used for the face, hands, body and / or mucous membranes or for treating the skin. Constituting a cream, milk, lotion, gel or foam for protection, treatment or care to purify The composition may also consist of a solid preparation constituting a soap or cleansing bar. do.

[0141] In some embodiments, the composition or cosmetic composition may include various levels of fluidity. In some embodiments, the composition or cosmetic composition is a white or colored cream, It may be a balm, milk, lotion, serum, paste, or foam. In some embodiments, the composition or cosmetic composition may be applied as an aerosol. Alternatively, the composition or cosmetic composition may be applied in solid form, for example as a stick. do.

[0142] The composition or cosmetic composition may include a humectant. For example, the humectant may be steryl, cetyl, and urea in combination with polowax and pyrrolidone carboxylic acid It is.

[0143] The compositions or cosmetic compositions provided herein for local / topical administration include quaternary ammonium salts. nium compounds, organic mercury, p-hydroxybenzoates, aromatic alcohols, chlorobutanoates The composition may contain one or more antimicrobial preservatives such as ethanol.

[0144] Eye drops The compositions or cosmetic compositions provided herein may be administered ocularly, e.g. For example, the composition may be delivered in an eye drop or ointment. Cells in the eye, such as the retina, are treated with alcohol (e.g., ethanol) and polyribonucleic acid. The topical application of the composition to the eye can induce cell proliferation in the eye. For example, the retina can be contacted with a mixture of a cell permeabilizing agent and a polyribonucleotide. Polyribonucleotides can exist in either linear or circular form.

[0145] The eye drops contain the cell permeabilizing agent and the polyribonucleotide alone when the mixture is in the liquid phase itself. Alternatively, eye drops may be prepared by mixing the eye drops with a sterile aqueous solution such as saline, buffer solution, etc. by dissolving a solid mixture of the cell permeabilizing agent and the polyribonucleotide in a liquid; or It is prepared by combining powdered compositions that are to be dissolved prior to use. Eye drops should be prepared in a sterile aqueous solution such as saline or buffered solution with no alcohol (e.g., ethanol). By dissolving the solid mixture of ribonucleotides and polyribonucleotides or by dissolving before use. It will be understood that the composition is prepared by combining powders. As known in the art, balanced salt solutions, saline, polyethylene glycol water-soluble polyethers such as polyvinyl alcohol and povidone; cellulose derivatives such as cellulose acetate and hydroxypropylmethylcellulose; mineral oils and Petroleum derivatives such as white petrolatum, animal fats such as lanolin, carboxypolymethylene Gels and other polymers of acrylic acid, vegetable fats such as peanut oil, and dextran. polysaccharides, and glycosaminoglycans such as sodium hyaluronate, If necessary, additives commonly used in eye drops may be selected from those not limited to those. Such additives include ionizing agents (e.g., sodium chloride, etc. etc.), buffer solutions (e.g., boric acid, disodium hydrogen phosphate, sodium dihydrogen phosphate, etc. ), preservatives (e.g., benzalkonium chloride, benzethonium chloride, chlorobutanol, etc. thickeners (e.g., sugars such as lactose, mannitol, maltose; e.g., hyaluronic acid, Hyaluronic acid or its salts, such as sodium hyaluronate, potassium hyaluronate; for example, Mucopolysaccharides such as chondroitin sulfate; e.g., sodium polyacrylate, carboxybis Nyl polymers, cross-linked polyacrylates, polyvinyl alcohol, polyvinylpyrrolidone, Methylcellulose, Hydroxypropylmethylcellulose, Hydroxyethylcellulose , carboxymethylcellulose, hydroxypropylcellulose, or other cellulose derivatives known to those skilled in the art. Other drugs.

[0146] Other Administration In some embodiments, the compositions or cosmetic compositions described herein are administered to mucous membranes, e.g. For example, it is formulated for the lips. Polyribonucleotides are either circular or linear RNA. It could be.

[0147] In some cases, the composition or cosmetic composition is formulated for administration to an epithelial cell. The composition or cosmetic composition may not include any carrier, and may be used in the same manner as described herein. In some embodiments, the diluent and the polyribonucleotide are as described in The composition or cosmetic composition may comprise a polyribonucleotide (e.g., a cosmetic polyribonucleotide). Polyribonucleotides are applied directly to epithelial cells for delivery of ribonucleotides (ribonucleotides). The RNA may be polymorphic or linear.

[0148] Pretreatment The composition or cosmetic composition as described herein may be used in conjunction with the application of a disinfectant to the surface. (e.g., surface (e.g., outer skin portion) with a bactericide for delivery of polyribonucleotides) The surface may be a surface area of ​​a subject, for example a skin area, after a pretreatment step such as The surface region of the subject may include cells, such as epithelial cells. Surfaces include hair, nails, skin, etc. It may be any part of the skin.

[0149] Bactericides are bacteriocidal, bacteriostatic, and / or actively kill or inactivate microorganisms. The agent may be any agent that kills or prevents the growth of microorganisms. The germicide is alcohol, iodine, or hydrogen peroxide. The germicide is UV light or laser light. In some embodiments, the sterilizing agent can be applied electrically or by vapor or contact, etc. The heat delivered is via other means such as by

[0150] The disinfectant may be applied to the surface area (eg, outer skin area) of a subject by a variety of methods. For example, the disinfectant may be applied by a wipe or swab that contains the disinfectant. The swab may be a pad, a cotton ball, or a cotton bud. In some embodiments, the disinfectant is a spray. A variety of devices can be used to apply the disinfectant. For example, For example, devices that generate UV light or laser light may be used. A generating device may be used.

[0151] The composition or cosmetic composition applied to the surface area after pretreatment does not include any carrier. The polyribonucleotide may comprise a diluent. It may be a linear polyribonucleotide or a circular polyribonucleotide.

[0152] In some embodiments, the germicide, cosmetic composition, or a combination thereof is massaged into the skin. In some embodiments, the disinfectant may be applied by administering the cosmetic composition. It is dried before use.

[0153] Preservatives The compositions or cosmetic compositions provided herein may contain material for a single dose. Alternatively, the composition may contain material for multiple administrations (e.g., a "multi-dose" kit). The cosmetic composition may contain one or more preservatives, such as thiomersal or 2-phenoxyethanol. Preservatives may be used to prevent microbial contamination during use. Preservatives include benzalkonium chloride, thimerosal, chlorobutanol, and methylparaben. , propylparaben, phenylethyl alcohol, disodium edetate, sorbic acid , Onamer M, or other agents known to those skilled in the art. Thus, for example, such preservatives may be utilized at a level of from 0.004% to 0.02%. In the compositions or cosmetic compositions described herein, preservatives, such as benzal chloride, Cobalt should be between 0.001% and less than 0.01% by weight, e.g., 0.001% to 0.0 Polyribonucleotides may be utilized at a level of about 0.08%, preferably about 0.005%. It may exist in either a linear or cyclic form.

[0154] Polyribonucleotides can be susceptible to RNases, which can be abundant in the surrounding environment. The composition or cosmetic composition provided herein inhibits RNase activity, thereby In some cases, the composition may include a reagent that prevents degradation of the polyribonucleotide. Alternatively or additionally, the RNase inhibitors provided herein may include any RNase inhibitor known to one of skill in the art. The polyribonucleotides in the compositions provided herein, as well as cell permeation agents and / or pharma- ceutically acceptable Any diluents or carriers, vehicles, excipients, or other reagents used in the assay must be RNase-free. The composition may be formulated in an RNase-free environment. .

[0155] In some cases, the compositions provided herein may be sterile. The composition may be formulated as a sterile solution or suspension in a suitable vehicle as known in the art. The composition may be sterilized by conventional known sterilization techniques, for example, the composition may be sterilized by conventional sterilization techniques. It may be sterile filtered.

[0156] salt In some cases, the compositions or cosmetic compositions provided herein comprise one or more To control osmolality, physiological salts, such as sodium salts, are provided herein. Other salts that may be included in the compositions provided include potassium chloride, potassium dihydrogen phosphate, phosphate disodium, and / or magnesium chloride. The composition or cosmetic composition may be formulated with one or more pharma- ceutically acceptable salts. The pharma- ceutically acceptable salts include, for example, sodium, potassium, calcium, magnesium, and the like. Such salts may include those of inorganic ions such as sodium ions. Phosphoric acid, nitric acid, sulfuric acid, methanesulfonic acid, p-toluenesulfonic acid, acetic acid, fumaric acid, co Inorganic acids such as citric acid, lactic acid, mandelic acid, malic acid, citric acid, tartaric acid, or maleic acid or salts with organic acids. Polyribonucleotides may be in either linear or cyclic form. It can exist in a variety of forms.

[0157] Buffer / pH The composition or cosmetic composition provided herein may be prepared using a buffer such as Tris buffer; borate buffer; histidine buffer (e.g., with aluminum hydroxide adjuvant); or may include one or more buffers, such as a citrate buffer. In some cases, the buffer The range of the amount of the polyribonucleotide is 5 to 20 mM. It can exist in several forms.

[0158] The composition or cosmetic composition provided herein has a viscosity of about 5.0 to about 8.5, about 6.0 to about The composition or formulation may have a pH of about 8.0, about 6.5 to about 7.5, or about 7.0 to about 7.8. The cosmetic composition may have a pH of about 7.

[0159] Detergents / Surfactants The compositions or cosmetic compositions provided herein may be administered in one or more dosage forms, depending on the intended route of administration. The detergent and / or surfactant may include, for example, polyoxyethylene sorbitan ethylene glycol. Stellate surfactants (commonly called "Tweens"), such as polysorbates DOWFA such as Polysorbate 20 and Polysorbate 80; Linear EO / PO block copolymers Ethylene oxide (EO), propylene oxide ( PO), and / or butylene oxide (BO); repeating ethoxy (oxy 1, 2-ethanediyl) groups, e.g. octoxynol- 9 (Triton X100, or t-octylphenoxypolyethoxyethanol); (Octylphenoxy)polyethoxyethanol (IGEPAL CA-630 / NP- 40); phospholipids such as phosphatidylcholine (lecithin); Tergitol (trademark) Nonylphenol ethoxylates such as the NP series; triethylene glycol monolaurates Lauryl, cetyl, stearyl and oleyl ethers (Brij 30) Polyoxyethylene fatty ethers derived from coll (known as Brij surfactants) and sorbitan trioleate (Span 85) and sorbitan monolaurate Sorbitan esters (commonly known as "SPAN") such as octoxynol ( Octoxynol-9 (Triton X-100) or t-octylphenoxypolyether ethanol), cetyltrimethylammonium bromide ("CTAB"), or dextran. Sodium oxycholate. One or more detergents and / or surfactants are present only in trace amounts. In some cases, the composition may contain less than 1 mg / ml of octoxynol. -10 and polysorbate 80. Nonionic surfactants may be used as described herein. Surfactants can be classified according to their "HLB" (hydrophilic / lipophilic balance). In some cases, the surfactant may be at least 10, at least 15 and / or has an HLB of at least 16. Polyribonucleotides may be linear or cyclic. The compound may be present in any form.

[0160] oil The compositions or cosmetic compositions provided herein may include one or more oils. In one embodiment, the composition or cosmetic composition comprises an oil phase containing at least one oil. For example, the oil may be a hydrocarbon oil of animal origin, such as perhydrosqualene. Liquid fatty acids containing 4 to 10 carbon atoms, such as tanoic or octanoic acid triglycerides Triglycerides, or also from sunflower, corn, soybeans, pumpkin, grapes Seeds, sesame, hazelnut, apricot, macadamia, arara, avocado and castor Sheep oil, sold by the Stearineries Dubois company or Miglyol 810 by Dynamit Nobel company, Caprylic / capric triglycerides, such as those sold under the names 812 and 818 The oil may be a hydrocarbon oil of vegetable origin, such as jojoba oil, shea butter oil, etc. In this embodiment, the oil has the formula R1COOR2 and R1OR2, where R1 is a carboxylic acid having 8 to 29 carbon atoms. R2 represents a branched or unbranched fatty acid containing 3 to 30 carbon atoms. fatty acids such as oils having a hydroxyl group, e.g., Purcellin oil, isononane Isononyl myristate, isopropyl myristate, ethyl 2-hexyl palmitate, stearyl Octyl-2-dodecyl phosphate, octyl-2-dodecyl erucate, isostearate isostearyl lactate, octyl hydroxystearate, hydroxystearyl Octyldodecyl malate, diisostearyl malate malate), triisocetyl citrate, fatty alcohol heptanoate, octanoate hydroxyl esters such as carboxylate and decanoate; propylene glycol dioctanoate; ate, neopentyl glycol diheptanoate and diethylene glycol diisononanoate Polyol esters such as esters of tetraisostearate; and pentaerythrityl tetraisostearate. This includes synthetic esters and ethers, including pentaerythritol esters. In an embodiment, the oil is selected from volatile and non-volatile paraffin oils and their derivatives, petrolatum , Polydecene, Parleam (trademark) (Nippon Gel Fats Compa Linear or polyisobutenes of mineral or synthetic origin, such as hydrogenated polyisobutenes such as those sold by NY Contains branched hydrocarbons. The oil contains cetyl alcohol, stearyl alcohol and mixtures thereof ( Cetylstearyl alcohol), octyldodecanol, 2-butyloctanol, 2- Hexyldecanol, 2-undecylpentadecanol, oleic alcohol or linoleic acid Fatty alcohols having 8 to 26 carbon atoms, such as oleic acid alcohol; Alkyl fatty alcohols, including those which are ethoxylated; Document JP-A-2-2959 Partially hydrocarbon oils and / or silicon fluorinated oils such as those described in 12. In some embodiments, the fluorinated oil may include BNFL Fluorochem Registered trademarks of FLUTEC PC 1 and FL icals company Perfluoromethylcyclopentane and perfluoromethylcyclopentane sold under the trademark UTEC PC3 Fluoro-1,3-dimethylcyclohexane; Perfluoro-1,2-dimethylcyclobutane Trademarks PF 5050 and PF 5060 by 3M Company Dodecafluoropentane and tetradecafluorohexane sold under the trademark Sold by Atochem company under the registered trademark FORALKYL(TM) Perfluoroalkanes such as bromoperfluorooctyl; 3M Company Nonafluoromethoxybutadiene sold under the registered trademark MSX 4518 by and nonafluoroethoxyisobutane; registered trademark PF- 4-trifluoromethylperfluoromorpholine sold under the trademark 5052 perfluoromorpholine derivatives; cyclopolydimethylsilanes such as cyclohexasiloxane Contains cyclomethicone (cyclomethicone), which is liquid or paste-like at room temperature and is a linear or cyclic silicone. Silicon oil such as volatile or non-volatile polymethylsiloxane (PDMS) with silane chains 2 to 24 carbon atoms, pendant or at the end of the silicon chain, alkyl, alkoxy or polydimethylsiloxane containing a phenyl group; phenyl trimethicone, phenyl dimethicone Con, Phenyltrimethylsiloxydiphenyl-siloxane, Diphenyldimethicone, Di Phenylmethyldiphenyltrisiloxane, 2-phenylethyltrimethylsiloxysilane phenylated silicones, such as phenylsiloxanes, polymethylphenyl-siloxanes; mixtures thereof Includes.

[0161] Effective Delivery The compositions, cosmetic compositions, methods, and kits provided herein comprise polyribonucleic acid. can be easily engineered for intracellular delivery of peptides (e.g., cosmetic polyribonucleotides). In some cases, polyribonucleic acid can provide a more efficient solution. The delivery of otides into cells is of cosmetic use. In some cases, the efficiency of delivery is improved by Relative to delivery without cole in the presence of alcohol as described herein In some cases, the efficiency of delivery can be higher than delivery without a cell penetrating agent. In some cases, the concentration of the cytoplasmic endothelial cell may be relatively high in the presence of the cell permeation agents described herein. In this case, the delivery efficiency is greater than that of the bactericidal agents described herein compared to delivery without pretreatment. It may be relatively high after pretreatment with agents such as alcohol. Polyribonucleotides can exist in either linear or circular form. The payload, including the payload, may be a cosmetic payload. It can be any payload that has a cosmetic effect after administration to a cell, tissue, or epithelial area. The payload may be one or more sequences in a polyribonucleotide that may contribute to an expression product. In some embodiments, the payload is selected from collagen, keratin, elastin, and A cosmetic protein or peptide selected from the group consisting of botulinum toxin, or any fragment thereof. It's petite.

[0162] In some cases, the efficiency of delivery is determined by the amount of total polyribonucleotide that is contacted with the cells. It is expressed as the ratio of the amount of polyribonucleotide delivered into the cell to the amount of polyribonucleotide delivered into the cell. In some cases, the efficiency of delivery is determined by the amount of total polyribonucleotide (e.g., For example, polyribonucleotides are delivered into skin cells when applied directly to a skin area. The amount of polyribonucleotide delivered to the cell is expressed as the ratio of the amount of polyribonucleotide delivered to the cell (the amount of polyribonucleotide delivered to the cell). The delivery efficiency of the methods provided herein is at least about 0.5%, 1%, 1.5%, 2%, 3%, %, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% In some cases, the delivery efficiency of the methods provided herein may be about 0. .5%, 1%, 1.5%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, It can be 80%, 85%, 90%, 95%, or 100%.

[0163] In some cases, the cosmetic benefits of the compositions and methods provided herein are achieved by the use of a composition or, The cosmetic effect may be due to the abundance of polyribonucleotides in the subject or in one or more cells of the subject. In other cases, the expression product is determined by determining whether the composition is expressed in the subject. The compositions and methods provided herein include, when the compositions and methods comprise an expression sequence encoding a corresponding protein. This can be measured as an indication of the delivery efficiency of the method.

[0164] The compositions and methods provided herein provide a method for producing circular, as compared to linear, polyribonucleotides. The delivery of circular polyribonucleotides to cells may be particularly effective. The amount of ribonucleotide was determined by comparing the amount of the linear polyribonucleotide and the cell permeation agent in the mixture. The amount of linear polyribonucleotide contacted with the cells should be at least 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.2, 2.4, 2.5, 2.6, 2.8, 3.0, 3.5, 4.0, 4.5, 5.0, 6.0, 7.0, 8.0, 9.0, or 10.0 times higher. In some cases, the cyclic The amount of polyribonucleotide is determined by the amount of the mixture containing the linear polyribonucleotide and the cell permeation agent. at least 1.1 times higher than the amount of linear polyribonucleotide contacted with the cells .

[0165] When administered in vivo, the polyribonucleotides can be synthesized in accordance with the methods provided herein. Thus, the compound can be delivered into any type of cell that is in close proximity to the surface area of ​​the subject, depending on the route of administration. For example, polyribonucleotides can be delivered to subcutaneous, intracavity, or ductal sites by the methods provided herein. The present invention can be delivered to epithelial cells located on the surface of the skin. Non-limiting types of epithelial cells include simple epithelial cells, Squamous epithelium, simple cuboidal epithelium, simple columnar epithelium, pseudostratified columnar epithelium, stratified squamous epithelium, stratified cuboidal epithelium, The polyribonucleotides provided herein include those of stratified columnar epithelium, and transitional epithelium. The method involves the differentiation of superficial regions, such as keratinocytes, Merkel cells, and melanocytes under the skin. These include alveoli, Langerhans cells, fibroblasts, macrophages, and adipocytes. The polyribonucleotides can be delivered to any type of cell, including, but not limited to, any of the cells described herein. The method provides for the treatment of any of the tissues beneath the skin, such as the epidermis, basement membrane, dermis, and subcutaneous tissue. The compositions, methods, and kits provided herein can be delivered to any part of the body. For example, polyribonucleotides and alcohols may be suitable for long-term delivery of nucleotides. (e.g., ethanol) may be formulated for extended, controlled, delayed, or sustained release. Polyribonucleotides may be modified so that a particular cosmetic effect can be achieved or the polyribonucleotides may be For example, polyribonucleotides and alcohol (e.g., For example, ethanol) may be used for an extended period of time, e.g., at least about 2 hours, 4 hours, 6 hours, 8 hours, 10 hours, 15 hours, 20 hours, 24 hours, 36 hours, 2 days, 3 days, 4 days, 5 days , 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 2 weeks , 3 weeks, 4 weeks, 5 weeks, 2 months, 3 months, 4 months or more on the target skin area The drug may be formulated in the form of a patch that is to be adhered to the skin. The polyribonucleotide and cell permeation agent in the patch can be, for example, Polyribonucleotides and cell permeation agents are delivered over a long period of time as long as the agent is in a suitable condition. The compositions may be formulated for controlled, delayed, or sustained release, resulting in certain cosmetic benefits. The effect can be achieved or the polyribonucleotide can be delivered to a desired location in a subject. For example, the polyribonucleotide and the cell permeation agent may be administered for an extended period of time, e.g., at least about 2 hours. 4 hours, 6 hours, 8 hours, 10 hours, 15 hours, 20 hours, 24 hours, 36 hours, 2 days , 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 1 2 days, 13 days, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 2 months, 3 months, 4 months, 1 or more, may be formulated in the form of a patch that is to be adhered to the skin area of ​​a subject. In some cases, the polyribonucleotide and cell permeation agent in the patch may be, for example, As long as the patch remains adhered to the area of ​​skin, delivery will occur over an extended period of time.

[0166] In some cases, the compositions, cosmetic compositions, methods, and kits are delivered intracellularly. The present invention provides a polyribonucleotide that is effective in treating a variety of conditions and has a long-term cosmetic effect. Ribonucleotides have little or no susceptibility to RNases or They have a very long half-life inside the cell. As a result, polyribonucleotides For an extended period of time, e.g., at least about 24 hours, 36 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months for 10, 8, 9, 10 months, 1, 2, 3 or more years. In some cases, polyribonucleic acid may be present and potentially active. The duration is approximately 24 hours, 36 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, and 8 days. 9 days, 10 days, 11 days, 12 days, 13 days, 2 weeks, 3 weeks, 4 weeks, 5 weeks 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months The half-life may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 10, 12, 14, 16, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 3

[0167] Kits and Application Tools Depending on the different intended routes of administration, the compositions provided herein can be administered in different ways. and / or in some cases, administering the composition to a subject via a desired route. The kits may be packaged in different kits that include one or more application tools configured to As discussed above, the compositions provided herein can be administered topically (e.g., The compositions may be formulated for administration through different routes, including via the skin, for example, or the eye. The present disclosure relates to a method for administering a composition comprising a polyribonucleotide and a cell penetrating agent. In an aspect, the present disclosure provides a cosmetic polyribonucleotide and an alcohol In an embodiment, the present disclosure provides a kit for administering a cosmetic composition comprising a cosmetic po A kit for administering a cosmetic composition comprising a ribonucleotide and ethanol is provided. In an embodiment, the present disclosure provides a method for preparing a carrier comprising the steps of: A method for administering a cosmetic composition comprising a cosmetic polyribonucleotide and a diluent, the method comprising the steps of: Polyribonucleotides can exist in either linear or circular form. The polyribonucleotide may comprise a payload. The payload may be a cosmetic payload. The cosmetic payload may be a compound that has a cosmetic effect after administration to a cell, tissue, or skin area. The payload may be any polyribonucleic acid that may be involved in the expression product. In some embodiments, the payload may be one or more sequences in the collab. from the group consisting of keratin, elastin, and botulinum toxin, or any fragment thereof. The cosmetic protein or peptide of choice.

[0168] The kit may be configured for direct topical administration, e.g., for application directly to the skin. In some cases, the kit comprises a composition as provided herein. The substrate or scaffold allows for direct application of the composition onto the skin surface of a subject. The wipe or the like may be in the form of a patch, wipe, Q-tip, or any other form. The swab may be a pad, a cotton ball, or a cotton tip. The substrate or scaffold may be a disposable material, or It may be made of biodegradable materials.

[0169] In some cases, the present invention relates to a peel pad and a composition as described herein. In some cases, the peel pad has a In some cases, the present invention includes a composition described herein that has been administered or absorbed. The substrate described in the specification is a facial pad. In some cases, the substrate is a fibrous layer. For example, a non-elastomeric material is used and the material is made to have at least one-way stretchability. The fiber layer may be made of, for example, cotton, eucalyptus, or biocellulose. The fibrous layer is hydrophilic and has a liquid retaining property. The fibrous layer may be made of hydrophilic materials and may be made of non-elastomeric materials or other materials. In some cases, the fibers may be made of hydrophilic fibers obtained from fibers formed therefrom. The kits include the liquid compositions provided herein and a method for transferring or dispensing the liquid compositions. The migration tool may be a straw, ear brush, or migration peptide. The transition tool can also be something as simple as a scale, trigger, alarm system, or automatic. It may be designed with additional features such as a dynamic dispensing system.

[0170] The kits provided herein may further include a bottle, box, capsule, or other container that contains the formulated composition. The containers disclosed may also be application tools, such as a dispenser, a dispenser, or the like. In some cases, the dispenser contains a liquid of the composition described herein. or a solid formulation is provided for dispensing, for example, a transfer pipette onto the skin surface. Or the liquid can be instilled into the eye for intraocular delivery. Sterility, humidity, and / or temperature may be optionally maintained in a container as described herein. In the above-discussed inhaler, the liquid, solid or aerosol may be dispensed as required. It may be a container for storing the composition in sol form. Indeed, alternatively, the container and application tool may be The rules may be provided separately.

[0171] The kits provided herein include a first application tool, a second application tool, a fungicide, and A cosmetic composition comprising a cosmetic polyribonucleotide and a diluent, without any carrier. a first application tool for applying a fungicide to a surface area (e.g., an outer skin portion) of a target; and a second application tool configured to apply the cosmetic composition to a surface area of ​​a subject (e.g., The sterilizing agent is configured to be applied to the skin (e.g., the outer skin). The sterilizing agent is alcohol, iodine, peroxide, etc. The radiation may be hydrogen, UV light, laser light, or heat. In some embodiments, the alcohol is , methanol, ethanol, isopropanol, butanol, pentanol, cetylar Coal, ethylene glycol, propylene glycol, denatured alcohol, benzyl alcohol alcohol, specially denatured alcohol, glycol, stearyl alcohol, cetearyl alcohol , menthol, polyethylene glycol (PEG)-400, ethoxylated fatty acids, hydrochloride Hydroxyethylcellulose, isopropyl alcohol, dimethylaminoethanol, retinol , d-alpha-tocopherol, SD alcohol, SD alcohol 40, c12- 16, lauryl alcohol, myristyl alcohol, butylene glycol, and propane The first application tool may be a wipe or a swab. Preferably, the wipe or swab contains a sterilizing agent. Alternatively, the first application tool is a UV light or laser. The second application tool may be a device for applying laser light or a device for applying heat. In some embodiments, the second application tool may comprise a pipette. The substrate includes a substrate in which the mixture is embedded. In many cases, the substrate is made of natural or synthetic fibers. In some embodiments, the second application tool is a patch, a sprayer, or a peel pad. In some cases, the second application tool releases the mixture in a controlled manner. The surface region is configured to include integumentary parts, such as hair, eyelashes, nails, and skin (e.g. For example, the skin on the face, the skin on the scalp, etc.) as well as any combination thereof.

[0172] How to generate In some cases, the polyribonucleic acid in the compositions or cosmetic compositions provided herein may be Nucleotides are not naturally occurring and can be synthesized using recombinant DNA techniques (methods described in detail below; For example, it may be produced in vitro using a DNA plasmid or produced using chemical synthesis. Polyribonucleotides include deoxyribonucleic acid sequences that can be synthesized. It may exist in either form.

[0173] The DNA molecule used to generate the RNA loop is a naturally occurring original nucleic acid sequence. DNA sequences, modified versions thereof, or synthetic polypeptides not normally found in nature (e.g. It is understood that the present invention may include a DNA sequence encoding a chimeric molecule or a fusion protein. DNA molecules are subject to site-directed mutagenesis, a chemical treatment of nucleic acid molecules that induces mutations. DNA synthesis, restriction enzyme digestion of nucleic acid fragments, ligation of nucleic acid fragments, polymerase chain reaction (PC R) Amplification and / or mutagenesis of selected regions of nucleic acid sequences, using oligonucleotide mixtures Ligation of mixed populations of synthetic and "constructed" mixtures of nucleic acid molecules, and combinations thereof Various techniques, including but not limited to classical mutagenesis techniques and recombinant DNA techniques, It can be modified using techniques.

[0174] Polyribonucleotides can be synthesized by any method, including but not limited to chemical synthesis and enzymatic synthesis. In some cases, linear polyribonucleic acid may be prepared according to available techniques. The nucleic acid may be synthesized from ribonucleotides or transcribed from a DNA construct. Transcription from the DNA construct can be performed in cells using techniques available to those of skill in the art. This can occur intracellularly or in vitro.

[0175] In some cases, the linear initial construct or linear mRNA is The polyribonucleotides may be circularized to produce the circular polyribonucleotides described herein, or may be conjugated to produce the circular polyribonucleotides described herein. The mechanism of cyclization or concatemerization can be chemical, enzymatic, splint laminating, or the like. methods such as, but not limited to, igation, or ribozyme catalyzed methods. The newly formed 5'- / 3'-bonds can occur via intramolecular or intermolecular bonds. It may be the same.

[0176] Methods for making the circular polyribonucleotides described herein are described, for example, in Khud et al. Yakov & Fields,Artificial DNA:Methods an d Applications,CRC Press(2002);Zhao,Synt hetic Biology:Tools and Applications,(Fi rst Edition), Academic Press(2013); and Egli & Herdewijn,Chemistry and Biology of Ar tificial Nucleic Acids,(First Edition),W Described in iley-VCH (2012).

[0177] Various methods for synthesizing circular polyribonucleotides have also been described in the art. (For example, U.S. Pat. No. 6,210,931, U.S. Pat. No. 5,773,244, U.S. Patent No. 5,766,903, U.S. Patent No. 5,712,128, U.S. Patent No. No. 426180, U.S. Patent Application Publication No. 20100137407, International Publication Brochure No. 1992001813 and Brochure No. WO 2010084371 (see, for example, US Pat. No. 6,393,311; the contents of each of which are incorporated herein by reference in their entireties).

[0178] All references and publications cited herein are hereby incorporated by reference. do.

[0179] Embodiment In some aspects, the cosmetic composition of the present disclosure comprises a polyribonucleotide and a cell penetrating agent. wherein the cell permeation agent comprises at least about 0.3% v / v of the mixture.

[0180] In some aspects, the cosmetic composition of the present disclosure comprises a polyribonucleotide and a cell penetrating agent. wherein the cell penetrating agent is configured for local administration.

[0181] In some aspects, the cosmetic composition of the present disclosure comprises a polyribonucleotide and a cell penetrating agent. wherein the polyribonucleotide comprises a payload or a sequence encoding a payload; And the payload has a biological effect on a cell or tissue.

[0182] In some aspects, the cosmetic composition of the present disclosure comprises a polyribonucleotide and a cell penetrating agent. wherein the polyribonucleotide is in an amount effective to have a cosmetic effect on a cell or tissue. and the cell permeation agent is present in an amount effective to have a cosmetic effect on a cell or tissue. There is.

[0183] In some aspects, the cosmetic composition of the present disclosure comprises a polyribonucleotide, a cell penetrating agent, and a topical delivery vehicle, the topical delivery vehicle including a stabilizer or other carrier.

[0184] In some aspects, the cosmetic composition of the present disclosure comprises a polyribonucleotide and a cell penetrating agent. The present invention relates to a biodegradable scaffold loaded with

[0185] In some aspects, the method of delivering a cosmetic polyribonucleotide to a cell or tissue comprises: Contacting the cell or tissue with a mixture comprising a cosmetic polyribonucleotide and a cell permeabilization agent. wherein the cell permeabilization agent comprises at least about 0.3% v / v of the mixture.

[0186] In some aspects, the method of delivering a cosmetic composition to a cell or tissue comprises administering to the cell or tissue a cosmetic composition comprising a cosmetic polyribonucleotide and a cell permeation agent. In some embodiments, the cell penetration agent is configured for local administration. In some embodiments, the alcohol is methanol, ethanol, or the like. Alcohol, isopropanol, butanol, pentanol, cetyl alcohol, ethylene glycol alcohol, propylene glycol, denatured alcohol, benzyl alcohol, special denatured alcohol Glycol, Stearyl Alcohol, Cetearyl Alcohol, Menthol, Polyethylene Polyethylene glycol (PEG)-400, ethoxylated fatty acids, hydroxyethyl cellulose, Isopropyl alcohol, dimethylaminoethanol, retinol, d-alpha-tocopherol Ferrol, SD alcohol, SD alcohol 40, c12-16, lauryl alcohol from the group consisting of alcohol, myristyl alcohol, butylene glycol, and propanediol In some embodiments, the alcohol comprises ethanol. In embodiments, the cell permeation agent is at least about 10%, at least about 20%, or at least about 10% of the mixture. At least about 30%, at least about 40%, at least about 50%, at least about 60%, At least about 70%, at least about 80%, at least about 90%, at least about 95%, In some embodiments, the cell permeability agent comprises about 98% or about 100% v / v. In some embodiments, the method further comprises the step of: In some embodiments, the cosmetic comprises mixing the ribonucleotide with a cell permeation agent. The polyribonucleotide for use is present in solid form prior to mixing. The cosmetic polyribonucleotide is lyophilized prior to mixing. In some embodiments, The cosmetic polyribonucleotide is present in liquid form prior to mixing. In some embodiments, In the present invention, the cosmetic polyribonucleotide is dissolved in a solvent prior to mixing.

[0187] In some aspects, the method comprises applying a cosmetic composition to an outer skin portion of a subject; The composition comprises a mixture comprising a cosmetic polyribonucleotide and a cell permeation agent. In embodiments, the cell permeation agent comprises an alcohol. is methanol, ethanol, isopropanol, butanol, pentanol, cetearyl alcohol Alcohol, ethylene glycol, propylene glycol, denatured alcohol, benzyl alcohol Cole, specially denatured alcohol, glycol, stearyl alcohol, cetearyl alcohol ethanol, menthol, polyethylene glycol (PEG-400), ethoxylated fatty acids, hydroxypropyl Hydroxyethylcellulose, isopropyl alcohol, dimethylaminoethanol, retinoic acid d-alpha-tocopherol, SD alcohol, SD alcohol 40, c12 -16, lauryl alcohol, myristyl alcohol, butylene glycol, and propane In some embodiments, the alcohol is selected from the group consisting of ethanol, In some embodiments, the delivery is localized. In some embodiments, the delivery is , the cell permeabilizing agent is at least about 1%, at least about 5%, at least about 10% of the mixture, At least about 20%, at least about 30%, at least about 40%, at least about 50%, At least about 60%, at least about 70%, at least about 80%, at least about 90%, At least about 95%, at least about 98%, or about 100% v / v. In embodiments, the cell permeation agent comprises about 10% v / v of the mixture. In some embodiments, the integumentary portion includes skin, nails, or hair. In some embodiments, the application comprises placing a drop of the composition directly onto the skin portion. This involves wiping the area with a patch, gel, or film in which the mixture is embedded. In some embodiments, applying comprises spraying the mixture onto the skin portion. In some embodiments, the cell comprises an epithelial cell. In some embodiments, the cosmetic polyribonucleotide comprises a linear polyribonucleotide. In some embodiments, the nucleotide comprises a circular polyribonucleotide. The nucleotides are at least 5%, at least 10%, at least 15% %, at least 20%, at least 30%, at least 40%, at least 50%, at least at least 60%, at least 70%, at least 80%, at least 90%, at least 1 00%, at least 150%, at least 2 times, at least 3 times, at least 4 times, at least At least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, at least At least 10 times, at least 20 times, at least 50 times, or at least 100 times higher translation In some embodiments, the circular polyribonucleotide has a higher efficiency than its linear counterpart. In some embodiments, the polyribonucleic acid has a translation efficiency at least 5 times higher than that of the In some embodiments, the polyribonucleotide has a short-term cosmetic effect. In some embodiments, the polyribonucleotide is a linear polyribonucleotide. In some embodiments, the polyribonucleotide is a cyclic In some embodiments, the cosmetic polyribonucleotides in the mixture The concentration of leutidine is at least about 1 ng / mL, at least about 5 ng / mL, at least About 10 ng / mL, at least about 50 ng / mL, at least about 100 ng / mL, at least about 500 ng / mL, at least about 1 μg / mL, at least about 2 μg / mL, At least about 3 μg / mL, at least about 4 μg / mL, at least about 5 μg / mL, at least about 10 μg / mL, at least about 20 μg / mL, at least about 50 μg / mL, At least about 100 μg / mL, at least about 200 μg / mL, at least about 500 μg / mL g / mL, at least about 1 mg / mL, at least about 2 mg / mL, at least about 5 mg / mL, at least about 10 mg / mL, at least about 20 mg / mL, at least about 50 mg / mL, or at least about 100 mg / mL.

[0188] In some aspects, the kits of the present disclosure include an application tool as well as a cosmetic polyribonucleic acid. and a cosmetic composition comprising a mixture comprising a dye and a cell permeation agent, and an application tool for the composition includes the mixture. The application tool is configured to be applied to an outer skin portion of a subject. In some embodiments, the application tool comprises a substrate, the substrate comprising a cosmetic The composition is embedded in. In some embodiments, the substrate is made of natural or man-made fibers. In some embodiments, the application tool comprises a patch. The tool comprises a peel pad. In some embodiments, the application tool comprises a sprayer. In some embodiments, the application tool is configured to release the mixture in a controlled manner. In some embodiments, the integumentary portion comprises skin, nails, or hair.

[0189] Numbered embodiments [1] A cosmetic composition comprising a mixture of polyribonucleotide and ethanol, A cosmetic composition in which ethanol comprises at least about 0.3% v / v to about 75% v / v of the mixture. Composition.

[0190] [2] Ethanol should be at least about 0.3% v / v to about 70% v / v of the mixture, or at least At least about 0.3% v / v to about 60% v / v, at least about 0.3% v / v to about 50% v / v v, at least about 0.3% v / v to about 40% v / v, at least about 30% v / v to about 20 %v / v, at least about 0.3%v / v to about 15%v / v, at least about 0.3%v / v ~ about 10% v / v, at least about 0.3% v / v~ about 5% v / v, at least about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to about 0.5% v / v; A cosmetic composition according to paragraph [1].

[0191] [3] Ethanol should be at least about 0.5% v / v to about 75% v / v of the mixture, or at least At least about 1% v / v to about 75% v / v, at least about 5% v / v to about 75% v / v, at least At least about 10% v / v to about 75% v / v, at least about 15% v / v to about 75% v / v, At least about 20% v / v to about 75% v / v, at least about 30% v / v to about 75% v / v v, at least about 40% v / v to about 75% v / v, at least about 50% v / v to about 75% v / v v / v, at least about 60% v / v to about 75% v / v, or at least about 70% v / v The cosmetic composition of paragraph [1], comprising about 75% v / v.

[0192] [4] A cosmetic composition comprising a mixture of polyribonucleotides and an alcohol, A cosmetic composition in which alcohol comprises at least about 0.3% v / v to about 75% v / v of the mixture. Composition.

[0193] [5] The alcohol should be at least about 0.3% v / v to about 70% v / v of the mixture, or at least At least about 0.3% v / v to about 60% v / v, at least about 0.3% v / v to about 50% v / v v, at least about 0.3% v / v to about 40% v / v, at least about 30% v / v to about 20 %v / v, at least about 0.3%v / v to about 15%v / v, at least about 0.3%v / v ~ about 10% v / v, at least about 0.3% v / v~ about 5% v / v, at least about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to about 0.5% v / v; A cosmetic composition according to paragraph [4].

[0194] [6] Alcohol should be at least about 0.5% v / v to about 75% v / v of the mixture, or at least At least about 1% v / v to about 75% v / v, at least about 5% v / v to about 75% v / v, at least At least about 10% v / v to about 75% v / v, at least about 15% v / v to about 75% v / v, At least about 20% v / v to about 75% v / v, at least about 30% v / v to about 75% v / v v, at least about 40% v / v to about 75% v / v, at least about 50% v / v to about 75% v / v v / v, at least about 60% v / v to about 75% v / v, or at least about 70% v / v The cosmetic composition of paragraph [4], comprising about 75% v / v.

[0195] [7] Alcohol is methanol, ethanol, isopropanol, butanol, pentane, Alcohol, cetyl alcohol, ethylene glycol, propylene glycol, modified alcohol Cole, benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol , Cetearyl alcohol, Menthol, Polyethylene glycol (PEG)-400, E Toxoxylated fatty acids, hydroxyethyl cellulose, isopropyl alcohol, dimethylamine Noethanol, Retinol, d-alpha-tocopherol, SD Alcohol, SD Alcohol Cole 40, C12-16, Lauryl Alcohol, Myristyl Alcohol, Butylene Glycol Any of paragraphs [4] to [6], wherein the A cosmetic composition.

[0196] [8] A cosmetic composition comprising a mixture of a polyribonucleotide and a cell penetrating agent, The cell permeation agent comprises at least about 0.3% v / v to about 75% v / v of the mixture. Composition.

[0197] [9] The cell permeabilizing agent is at least about 0.3% v / v to about 70% v / v of the mixture, at least At least about 0.3% v / v to about 60% v / v, at least about 0.3% v / v to about 50% v / v v, at least about 0.3% v / v to about 40% v / v, at least about 30% v / v to about 20 %v / v, at least about 0.3%v / v to about 15%v / v, at least about 0.3%v / v ~ about 10% v / v, at least about 0.3% v / v~ about 5% v / v, at least about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v to about 0.5% v / v; A cosmetic composition according to paragraph [8].

[0198]

[10] The cell permeabilizing agent comprises at least about 0.5% v / v to about 75% v / v of the mixture, At least about 1% v / v to about 75% v / v, at least about 5% v / v to about 75% v / v, At least about 10% v / v to about 75% v / v, at least about 15% v / v to about 75% v / v , at least about 20% v / v to about 75% v / v, at least about 30% v / v to about 75% v / v / v, at least about 40% v / v to about 75% v / v, at least about 50% v / v to about 75 % v / v, at least about 60% v / v to about 75% v / v, or at least about 70% v / v The cosmetic composition of paragraph [8], wherein the cosmetic composition comprises about 75% v / v.

[0199]

[11] Any one of paragraphs [8] to

[10] , wherein the cell permeation agent is an alcohol. Cosmetic composition.

[0200]

[12] Alcohols include methanol, ethanol, isopropanol, butanol, Pentanol, cetyl alcohol, ethylene glycol, propylene glycol, modified alkanol Alcohol, benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol , Cetearyl Alcohol, Menthol, Polyethylene Glycol (PEG-400), Ethoxylated fatty acids, hydroxyethyl cellulose, isopropyl alcohol, dimethyl a Aminoethanol, Retinol, d-Alpha-Tocopherol, SD Alcohol, SD Alcohol Alcohol 40, C12-16, Lauryl Alcohol, Myristyl Alcohol, Butylene The cosmetic composition according to paragraph

[11] , Composition.

[0201]

[13] Polyribonucleotides encode proteins or peptides, or fragments thereof. The cosmetic composition according to any one of paragraphs [1] to

[12] .

[0202]

[14] The protein or peptide is a cosmetic protein or peptide, or A cosmetic composition according to paragraph

[13] which is a fragment.

[0203]

[15] The protein is a component of hair or eyelashes (e.g., keratin fibers), nails, or skin. The cosmetic composition of paragraph

[13] or

[14] , which is a protein.

[0204]

[16] The protein is collagen, keratin, elastin, botulinum toxin, or A cosmetic composition as set forth in paragraph

[13] or

[14] which is a fragment thereof.

[0205]

[17] The cosmetic composition may be a liquid, gel, lotion, paste, cream, foam, serum, The cosmetic composition according to any one of paragraphs [1] to

[15] , which is an ointment, a cream, or a stick. .

[0206]

[18] Paragraph [1], in which the polyribonucleotide is a cosmetic polyribonucleotide. ~A cosmetic composition according to any one of

[16] .

[0207]

[19] Paragraph [1], in which the polyribonucleotide is a linear polyribonucleotide. ~

[18] Any one of the cosmetic compositions.

[0208]

[20] Any of paragraphs [1] to

[19] , wherein the polyribonucleotide is mRNA. or one cosmetic composition.

[0209]

[21] The polyribonucleotide lacks a cap or a polyA tail,

[20] Any one of the cosmetic compositions.

[0210]

[22] Paragraphs [1] to [3], wherein the polyribonucleotide is a cyclic polyribonucleotide.

[18] Any one of the cosmetic compositions.

[0211]

[23] The cosmetic composition of any one of paragraphs [1] to

[0022] , wherein the polyribonucleotide comprises a modified ribonucleotide.

[0212]

[24] Any one of paragraphs [1] to

[23] , wherein the cosmetic composition has a pH of about 7. A cosmetic composition.

[0213]

[25] Paragraphs [1] to

[24] , wherein the cosmetic composition has a viscosity approximately the same as that of water. 13. The cosmetic composition of claim 12,

[0214]

[26] The cosmetic composition of any one of paragraphs [1] to

[0025] , wherein the cosmetic composition is substantially free of hydrophobic or lipophilic groups.

[0215]

[27] Any of paragraphs [1] to

[26] , wherein the cosmetic composition is substantially free of hydrocarbons. Any one of the cosmetic compositions.

[0216]

[28] Paragraphs [1] to [3], wherein the cosmetic composition is substantially free of cationic liposomes.

[27] Any one of the cosmetic compositions.

[0217]

[29] The cosmetic composition comprises a fatty acid, a lipid, a liposome, cholesterol, or any of the above. The cosmetic composition of any one of paragraphs [1] to

[28] , which does not substantially contain any arbitrary combination.

[0218]

[30] The cosmetic composition comprises glycerin, propylene glycol, or a combination thereof. A cosmetic composition according to any one of paragraphs [1] to

[29] , except that it does not qualitatively include

[0219]

[31] Any one of paragraphs [1] to

[30] , wherein the cosmetic composition is an anti-wrinkle composition. A cosmetic composition comprising:

[0220]

[32] Any of paragraphs [4] to

[31] , wherein the cell permeabilizing agent is soluble in a polar solvent. 1 cosmetic composition.

[0221]

[33] Any of paragraphs [4] to

[32] , wherein the cell permeabilizing agent is insoluble in a polar solvent. 1 cosmetic composition.

[0222]

[34] A cosmetic composition comprising a polyribonucleotide and an alcohol, The cosmetic composition is adapted for topical administration.

[0223]

[35] A cosmetic composition comprising a polyribonucleotide and an alcohol, The polynucleotide comprises a payload or a sequence encoding a payload, and A cosmetic composition having a cosmetic effect on cells or tissue.

[0224]

[36] A cosmetic composition comprising a polyribonucleotide and an alcohol, the polynucleotide is present in an amount effective to have a cosmetic effect on a cell or tissue; and A cosmetic composition in which the alcohol is present in an amount effective to have a cosmetic effect on cells or tissue. Composition.

[0225]

[37] A cosmetic composition comprising a polyribonucleotide, an alcohol, and a topical delivery vehicle. 13. A cosmetic composition comprising a topical delivery vehicle comprising a stabilizer.

[0226]

[38] A cosmetic composition comprising a polyribonucleotide and a cell-penetrating agent, A cosmetic composition in which the cosmetic agent or alcohol is adapted for topical administration.

[0227]

[39] A cosmetic composition comprising a polyribonucleotide and a cell permeation agent, The polynucleotide comprises a payload or a sequence encoding a payload, and A cosmetic composition having a cosmetic effect on cells or tissue.

[0228]

[40] A cosmetic composition comprising a polyribonucleotide and a cell permeation agent, the polynucleotide is present in an amount effective to have a cosmetic effect on a cell or tissue; and A cosmetic composition in which the cell permeation agent is present in an amount effective to have a cosmetic effect on cells or tissue. Composition.

[0229]

[41] Cosmetic compositions comprising polyribonucleotides, cell-penetrating, and topical delivery vehicles. wherein the topical delivery vehicle comprises a stabilizer.

[0230]

[42] Paragraphs

[37] or

[41] , in which the stabilizer comprises glucose (4.5 g / L). A cosmetic composition comprising:

[0231]

[43] Any one of paragraphs

[38] to

[42] , wherein the cell permeation agent comprises an alcohol. A cosmetic composition comprising:

[0232]

[44] Alcohols include methanol, ethanol, isopropanol, butanol, Pentanol, cetyl alcohol, ethylene glycol, propylene glycol, modified alkanol Alcohol, benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol , Cetearyl Alcohol, Menthol, Polyethylene Glycol (PEG-400), Ethoxylated fatty acids, hydroxyethyl cellulose, isopropyl alcohol, dimethyl a Aminoethanol, Retinol, d-Alpha-Tocopherol, SD Alcohol, SD Alcohol Alcohol 40, C12-16, Lauryl Alcohol, Myristyl Alcohol, Butylene Paragraphs

[34] to

[43] , wherein the diol is selected from the group consisting of glycol and propanediol. 13. The cosmetic composition of claim 12,

[0233]

[45] The cosmetic composition of paragraph

[44] , wherein the alcohol is ethanol.

[0234]

[46] A method for delivering a cosmetic polyribonucleotide to a subject, comprising: a) applying a fungicide to the outer skin portion of the target; b) A cosmetic composition comprising a cosmetic polyribonucleotide and a diluent, without any carrier. A method comprising applying the substance to an outer skin portion.

[0235]

[47] Paragraph

[46] , where the disinfectant is alcohol, UV light, laser light, or heat. How to.

[0236]

[48] ​​A method for delivering a cosmetic polyribonucleotide to a subject, comprising: a) applying alcohol to the outer skin area of ​​a subject; b) A cosmetic composition comprising a cosmetic polyribonucleotide and a diluent, without any carrier. A method comprising applying the substance to an outer skin portion.

[0237]

[49] A method for delivering polyribonucleotides to epithelial cells, comprising the steps of: Cosmetic composition comprising a diluent and an unmodified cosmetic polyribonucleotide, to an epithelial cell.

[0238]

[50] A method for delivering polyribonucleotides to a subject, comprising administering to a subject a cosmetic polyribonucleotide comprising the steps of: applying a cosmetic composition comprising a mixture of leucine and ethanol to the outer skin area of ​​a subject; and ethanol comprises at least about 0.3% v / v to about 75% v / v of the mixture. Law.

[0239]

[51] A method for delivering polyribonucleotides to a subject, comprising administering to a subject a cosmetic polyribonucleotide. applying a cosmetic composition comprising a mixture of leucine and alcohol to an outer skin area of ​​a subject; The alcohol comprises at least about 0.3% v / v to about 75% v / v of the mixture. Law.

[0240]

[52] A method for delivering polyribonucleotides to a subject, comprising administering to a subject a cosmetic polyribonucleotide comprising the steps of: applying a cosmetic composition comprising a mixture of a leutidine and a cell permeation agent to an outer skin area of ​​a subject; The cell permeabilizing agent comprises at least about 0.3% v / v to about 75% v / v of the mixture. Law.

[0241]

[53] A cosmetic composition comprising a cosmetic polyribonucleotide delivered to a dermis or epithelium of a subject. Serving the matter may be effected in any one of the manners set out in paragraphs

[49] to

[52] .

[0242]

[54] A cosmetic composition comprising a cosmetic polyribonucleotide delivered to a dermis or epidermis of a subject. The method of paragraph

[53] , wherein the delivery is without iontophoresis.

[0243]

[55] A method for delivering a cosmetic polyribonucleotide to a cell or tissue, comprising: or contacting the tissue with a mixture containing cosmetic polyribonucleotide and alcohol. wherein the alcohol comprises at least about 0.3% v / v to about 75% v / v of the mixture. method.

[0244]

[56] A method for delivering a cosmetic composition to a cell or tissue, comprising: contacting the cosmetic composition with a cosmetic polyribonucleotide and an alcohol; The method wherein the alcohol is configured for topical administration.

[0245]

[57] A method for in vivo delivery of cosmetic polyribonucleotides, comprising: applying a mixture comprising a leutidine and a cell permeation agent or an alcohol to the outer skin area of ​​the subject; The method includes:

[0246]

[58] A method for delivering cosmetic polyribonucleotides, comprising: applying a mixture comprising leutidine and an alcohol to the outer skin area of ​​the subject.

[0247]

[59] A method for delivering a cosmetic polyribonucleotide to a cell or tissue, comprising: or contacting the tissue with a mixture comprising a cosmetic polyribonucleotide and a cell permeabilizing agent. wherein the cell permeabilizing agent or alcohol is at least about 0.3% v / v to about 75% of the mixture. How to account for v / v.

[0248]

[60] A method for delivering a cosmetic composition to a cell or tissue, comprising: contacting the cosmetic composition comprising a cosmetic polyribonucleotide and a cell permeation agent; The method wherein the cell permeation agent or alcohol is configured for topical administration.

[0249]

[61] A method for delivering cosmetic polyribonucleotides, comprising: applying a mixture comprising a leotide and a cell permeation agent to an outer skin area of ​​a subject.

[0250]

[62] Any one of paragraphs

[59] to

[61] , wherein the cell permeation agent comprises an alcohol. How to.

[0251]

[63] Alcohols include methanol, ethanol, isopropanol, butanol, Pentanol, cetyl alcohol, ethylene glycol, propylene glycol, modified alkanol Alcohol, benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol , Cetearyl Alcohol, Menthol, Polyethylene Glycol (PEG-400), Ethoxylated fatty acids, hydroxyethyl cellulose, isopropyl alcohol, dimethyl a Aminoethanol, Retinol, d-Alpha-Tocopherol, SD Alcohol, SD Alcohol Alcohol 40, C12-16, Lauryl Alcohol, Myristyl Alcohol, Butylene Paragraphs

[47] to

[62] , wherein the diol is selected from the group consisting of glycol and propanediol. Either one of the methods.

[0252]

[64] Any one of paragraphs

[47] to

[63] , where alcohol includes ethanol. How to.

[0253]

[65] Ethanol, alcohol, or a cell permeabilizing agent is at least about 0.3% of the mixture. %v / v to about 70%v / v, at least about 0.3%v / v to about 60%v / v, at least About 0.3% v / v to about 50% v / v, at least about 0.3% v / v to about 40% v / v, a little At least about 30% v / v to about 20% v / v, at least about 0.3% v / v to about 15% v / v v, at least about 0.3% v / v to about 10% v / v, at least about 0.3% v / v to about 5 % v / v, at least about 0.3% v / v to about 1% v / v, or at least about 0.3% v / v The method of any one of paragraphs

[55] to

[64] , wherein the v / v is about 0.5% v / v.

[0254]

[66] Ethanol, alcohol, or a cell permeabilizing agent is at least about 0.5% of the mixture. %v / v to about 75%v / v, at least about 1%v / v to about 75%v / v, at least about 5 %v / v to about 75%v / v, at least about 10%v / v to about 75%v / v, at least about 15% v / v to about 75% v / v, at least about 20% v / v to about 75% v / v, at least At least about 30% v / v to about 75% v / v, at least about 40% v / v to about 75% v / v, At least about 50% v / v to about 75% v / v, at least about 60% v / v to about 75% v / v, or at least about 70% v / v to about 75% v / v, Either one way.

[0255]

[67] The method further comprising mixing the cosmetic polyribonucleotide with alcohol. Drop one of the following methods:

[55] ~

[66]

[0256]

[68] The method further comprising mixing the cosmetic polyribonucleotide with a cell permeabilizing agent. Drop one of the following methods:

[55] ~

[66]

[0257]

[69] The method of paragraph

[0067] or

[68] , wherein the cosmetic polyribonucleotide is present in a solid form prior to mixing.

[0258]

[70] The cosmetic polyribonucleotide is lyophilized prior to mixing, paragraph

[69] How to.

[0259]

[71] The method of paragraph

[0067] or

[68] , wherein the cosmetic polyribonucleotide is present in liquid form prior to mixing.

[0260]

[72] The method of paragraph

[0067] or

[68] , wherein the cosmetic polyribonucleotide is dissolved in a solvent prior to mixing.

[0261]

[73] The cosmetic polyribonucleotide comprises a payload or a sequence encoding a payload. Paragraph

[46] to

[47] , wherein the payload has a cosmetic effect on cells or tissue.

[72]

[0262]

[74] Paragraph

[46] , in which the payload is a cosmetic protein or a cosmetic peptide. ~

[73]

[0263]

[75] Cosmetic polyribonucleotides are effective in having a cosmetic effect on cells. and the cell permeation agent is present in an amount effective to have a cosmetic effect on a cell or tissue. Any one of the methods described in paragraphs

[46] to

[73] exists.

[0264]

[76] The cosmetic polyribonucleotide is a protein or peptide, or a fragment thereof. A method according to any one of paragraphs

[46] to

[74] for encoding a fragment.

[0265]

[77] The protein or peptide is a cosmetic protein or a cosmetic peptide. The method in paragraph

[76] .

[0266]

[78] The method of paragraph

[76] or

[0077] , wherein the protein is a hair, skin, or nail protein.

[0267]

[79] The protein is collagen, keratin, elastin, botulinum toxin, or The method of paragraph

[76] or

[77] , which is a fragment thereof.

[0268]

[80] The composition is a liquid, serum, gel, lotion, paste, cream, foam, or Stick, any one of the methods described in paragraphs

[46] to

[78] .

[0269]

[81] Paragraph 1, wherein the cosmetic polyribonucleotide is a linear polyribonucleotide. One of the following methods:

[46] ~

[80]

[0270]

[82] Paragraphs

[46] to

[81] , wherein the cosmetic polyribonucleotide is mRNA. Either one of the methods.

[0271]

[83] The method of any one of paragraphs

[0046] to

[82] , wherein the cosmetic polyribonucleotide lacks a cap or a polyA tail.

[0272]

[84] The method of any one of paragraphs

[0046] to

[80] , wherein the cosmetic polyribonucleotide is a cyclic polyribonucleotide.

[0273]

[85] The method of any one of paragraphs

[0046] to

[84] , wherein the cosmetic polyribonucleotide comprises a modified ribonucleotide.

[0274]

[86] Any of paragraphs

[46] to

[85] , wherein the cosmetic composition has a pH of about 7. One way.

[0275]

[87] The method of any one of paragraphs

[46] to

[0086] , wherein the cosmetic composition has a viscosity that is approximately the same as water.

[0276]

[88] Paragraphs

[46] to

[47] , wherein the cosmetic composition is substantially free of hydrophobic or lipophilic groups.

[87]

[0277]

[89] The cosmetic composition according to paragraphs

[46] to

[88] , wherein the cosmetic composition is substantially free of hydrocarbons. Either one of the methods.

[0278]

[90] Paragraph

[46] , wherein the cosmetic composition is substantially free of cationic liposomes. ~

[89] One of the following methods.

[0279]

[91] The cosmetic composition comprises a fatty acid, a lipid, a liposome, cholesterol, or any of the above. The method of any one of paragraphs

[46] to

[90] , which does not substantially include any arbitrary combination.

[0280]

[92] A cosmetic composition comprising glycerin, propylene glycol, or a combination thereof. or one of the methods described in paragraphs

[46] to

[91] .

[0281]

[93] Any of paragraphs

[55] to

[92] , wherein the cell permeation agent is soluble in a polar solvent. Or one way.

[0282]

[94] Any of paragraphs

[55] to

[93] , wherein the cell permeation agent is insoluble in a polar solvent. Or one way.

[0283]

[95] Paragraphs

[46] to

[95] , wherein the cosmetic composition further comprises a cosmetically acceptable excipient.

[94]

[0284]

[96] The method of any one of paragraphs

[46] to

[95] , wherein delivery is local.

[0285]

[97] Any of paragraphs

[46] to

[96] in which the integumentary part includes skin, hair, or nails Or one way.

[0286]

[98] Paragraph

[46] , in which the application involves placing droplets of the mixture directly on the skin portion. ~One of the following methods:

[54] ,

[57] ,

[61] , or

[62] ~

[97] .

[0287]

[99] The application is by applying to the epidermis a patch, gel or film in which the mixture is embedded. The method described in any one of paragraphs

[46] to

[54] ,

[57] ,

[61] , or

[62] to

[0097] , including wiping the surface.

[0288]

[0100] The method of any one of paragraphs

[46] to

[0054] ,

[57] ,

[61] , or

[62] to

[97] , wherein applying comprises spraying the mixture onto the skin portion.

[0289]

[0101] Any of paragraphs

[49] or

[62] to

[0100] , wherein the cells include epithelial cells. One way.

[0290]

[0102] Circular polyribonucleotides are at least 5% less abundant than their linear counterparts. At least 10%, at least 15%, at least 20%, at least 30%, at least 40% %, at least 50%, at least 60%, at least 70%, at least 80%, at least at least 90%, at least 100%, at least 150%, at least twice as much, at least 3x, at least 4x, at least 5x, at least 6x, at least 7x, at least 8-fold, at least 9-fold, at least 10-fold, at least 20-fold, at least 50-fold, or Any one of paragraphs

[84] to

[0101] having at least 100 times higher translation efficiency method.

[0291]

[0103] Circular polyribonucleotides have at least 5-fold higher translation than their linear counterparts. Any one of the methods described in paragraphs

[84] to

[0102] having efficiency.

[0292]

[0104] Any one of the methods of paragraphs

[0046] to

[0103] , wherein the cosmetic polyribonucleotide has a short-term cosmetic effect.

[0293]

[0105] Any one of the methods of paragraphs

[0046] to

[0104] , wherein the cosmetic polyribonucleotide has a long-lasting cosmetic effect.

[0294]

[0106] The concentration of cosmetic polyribonucleotide in the mixture is at least about 50 ng. / mL, at least about 100 ng / mL, at least about 500 ng / mL, at least about 1 μg / mL, at least about 2 μg / mL, at least about 3 μg / mL, at least about 4 μg / mL, at least about 5 μg / mL, at least about 10 μg / mL, at least about 2 0 μg / mL, at least about 50 μg / mL, at least about 100 μg / mL, at least At least about 200 μg / mL, at least about 500 μg / mL, at least about 1 mg / mL, at least about 2 mg / mL, at least about 5 mg / mL, at least about 10 mg / mL, at least about 20 mg / mL, at least about 50 mg / mL, or at least about 100 mg Any one of the methods described in paragraphs

[46] to

[0105] , wherein the

[0295]

[0107] A cosmetic composition comprising an application tool and any one of paragraphs [1] to

[33] . a cosmetic composition for applying to an outer skin portion of a subject, the cosmetic composition comprising: The kit will be.

[0296]

[0108] The first application tool, the second application tool, the fungicide, and any carriers are included. A kit including a cosmetic composition comprising a cosmetic polyribonucleotide and a diluent, a first application tool configured to apply a fungicide to an outer skin portion of a target, and a second application tool configured to apply a fungicide to an outer skin portion of a target, wherein the application tool is configured to apply the composition to an outer skin portion of a subject.

[0297]

[0109] The kit of paragraph

[0108] , wherein the disinfectant is alcohol, UV light, laser light, or heat.

[0298]

[0110] The alcohol is methanol, ethanol, isopropanol, butanol. , Pentanol, Cetyl Alcohol, Ethylene Glycol, Propylene Glycol, Modified Alcohol, benzyl alcohol, specially denatured alcohol, glycol, stearyl alcohol , Cetearyl Alcohol, Menthol, Polyethylene Glycol (PEG)-400 , ethoxylated fatty acids, hydroxyethyl cellulose, isopropyl alcohol, dimethyl Aminoethanol, Retinol, d-alpha-tocopherol, SD Alcohol, SD Alcohol 40, C12-16, Lauryl Alcohol, Myristyl Alcohol, Butyrate The kit of paragraph

[0109] is selected from the group consisting of ethylene glycol, and propanediol. to.

[0299]

[0111] Any of paragraphs

[0108] to

[0110] in which the first application tool is a wipe One kit.

[0300]

[0112] The kit of paragraph

[0111] , wherein the wipe contains a disinfectant.

[0301]

[0113] The first application tool is a device that applies UV light or laser light. A kit as set forth in paragraph

[0108] or

[0109] .

[0302]

[0114] Paragraph

[0108] , in which the first application tool is a device for applying heat; or

[0109] Kit.

[0303]

[0115] Application tool and polyribonucleotide and cell permeabilizing agent or alcohol and an application tool adapted to apply the mixture to an outer skin portion of a subject. A kit configured as follows.

[0304]

[0116] Paragraphs

[0107] to

[0118] , in which the application tool or the second application tool includes a pipette

[0115] Any one of the kits.

[0305]

[0117] The application tool or the second application tool includes a substrate, the substrate having the mixture embedded therein. The kit of any one of paragraphs

[0107] to

[0115] .

[0306]

[0118] A kit according to paragraph

[0117] , wherein the substrate is made of natural or artificial fibers.

[0307]

[0119] The kit of any one of paragraphs

[0107] to

[0118] , wherein the application tool or the second application tool includes a patch.

[0308]

[0120] The kit of any one of paragraphs

[0107] to

[0118] , wherein the application tool or the second application tool includes a sprayer.

[0309]

[0121] The kit of any one of paragraphs

[0107] to

[0118] , wherein the application tool or the second application tool includes a peel pad.

[0310]

[0122] The application tool or the second application tool releases the mixture in a controlled manner. The kit according to any one of paragraphs

[0107] to

[0121] ,

[0311]

[0123] Any one of the kits of paragraphs

[0107] to

[0122] , wherein the outer skin part includes skin, nails, eyelashes, or hair. EXAMPLES

[0312] The following examples are provided to further illustrate some embodiments of the present invention. It is not intended to limit the scope of the present invention; other procedures, methods known to those skilled in the art are also within the scope of the present invention. It is understood that the theories, theories, or techniques described herein may be used alternatively by virtue of their exemplary nature. It becomes.

[0313] Example 1: Formulation of RNA for localized delivery This example demonstrates the formulation of RNA for localized delivery.

[0314] To determine the local effects of RNA, RNA was formulated for delivery to epithelial tissue. .

[0315] As described herein, RNA is formulated with a cell permeation agent according to the following: Ta. 10 ng EGF ORF-containing RNA, linear or circular 5uL 80% ethanol 35uL PBS + glucose (4.5g / L)

[0316] Example 2: Localized delivery of linear RNA This example demonstrates localized delivery of RNA.

[0317] To determine the effect of local delivery, RNA was formulated and delivered to epithelial tissue. As described, linear RNA formulated with a cell-penetrating agent was able to be locally delivered to ear tissue. Delivered.

[0318] Linear RNA samples were formulated as in Example 1 (50 μL) and applied to mouse ears. Prior to application of the samples to the ears, the ears were wiped with an isopropyl alcohol wipe. The ears were then dried by briefly exposing them to infrared lights and a fan in a sterile hood. Mice were returned to their cages under standard conditions.

[0319] At selected time points (6 h, 1 day, 3 days, or 12 days after application), ear tissue (single ear pan) was A 100-ml sample was collected for each RNA sample and stored in tissue storage reagent (e.g., (permeates tissue to stabilize and protect circular RNA in unfrozen samples).

[0320] Example 3: Localized delivery of circular RNA This example demonstrates localized delivery of RNA.

[0321] To determine the effect of local delivery, RNA was formulated and delivered to epithelial tissue. As described, RNA is formulated with a cell-penetrating agent and delivered locally to ear tissue. It was.

[0322] Circular RNA samples were formulated as in Example 1 (50 μL) and applied to both ears of mice. Prior to application of the samples to the ears, the ears were wiped with an isopropyl alcohol wipe. on the ear by briefly exposing the ear to an infrared light and a fan in a sterile hood. The mice were then allowed to dry. They were then returned to their cages under standard conditions. At selected time points (6 days after application), At each day (time, 1 day, 3 days, or 12 days), ear tissue (by single ear punch) was extracted for each RNA sample. were collected for.

[0323] Example 4: Persistence of RNA after local delivery This example demonstrates the persistence of RNA following local delivery.

[0324] To determine the persistence of RNA, tissue samples were analyzed for delivered RNA. As described herein, ear punches were persistent at various time points following localized delivery of RNA. was analyzed.

[0325] Ear punch samples from Example 3 and unprocessed ear punch samples were collected in RNA stabilization reagent The RNA was extracted using a standard RNA tissue extraction kit (Maxwell RSC simpl y RNA) was extracted using

[0326] A volume of 200 μl of 1-thioglycerol / homogenization solution was added to each sample. The solution was homogenized by adding 20 μl of 1-thioglycerol per milliliter of homogenized solution. Alternatively, 600 μl of 1-thioglycerol was added to a 30 ml bottle. Before use, the 1-thioglycerol / homogenization solution was kept on ice or It was cooled to 2-10°C.

[0327] The tissue samples were washed with 200 μl of chilled 1-thioglycerol until no tissue fragments were visible. Homogenized in the homogenization solution using a handheld homogenizer and a sterile pestle. Each sample was homogenized for an additional 15-30 s for complete homogenization.

[0328] To examine the presence of RNA at different time points, samples were analyzed for RNA via q-PCR. qPCR was used to measure the presence of both linear and circular RNA in ear punches. To detect linear and circular RNA, the Nluc ORF was amplified. The primers used were: (F:AGATTTCGTTGGGGACTGGC (sequence Sequence number 7), R: CACCGCTCAGGACAATCCTT (SEQ ID NO: 8). Cyclic R To detect only NA, the primers that amplified the 5'-3' junction were not linear but circular. This allows detection of the .ALPHA.-shaped RNA construct (F:CTGGAGACGTGGAGGAG AAC (SEQ ID NO: 9), R: CCAAAAGACGGCAATATGGT (SEQ ID NO: 10 )).

[0329] Linear and circular RNA were detected 6, 24, and 72 hours after local delivery. Higher levels of circular RNA compared with linear RNA were detected in mice 3 days after injection. was detected in the ears of

[0330] As shown in this example, locally administered linear and circular RNAs was detectable in vivo.

[0331] Example 5: Protein expression of mRNA following local delivery This example describes the presence of a protein after local delivery.

[0332] To determine whether locally delivered RNA can be translated, tissue samples were cultured in Western The ear punches were analyzed for protein expression at different time points by RNA blot. Protein expression is analyzed following local delivery of A.

[0333] Briefly, ear punches were collected and stored in RNA stabilization reagent (Invitrogen). The tissue was homogenized in RIPA buffer using a microtube homogenizer (Fis Her Scientific) and the proteins were extracted. The mixture is centrifuged at 14k x g for 15 minutes.

[0334] The supernatant was removed and the pellet was washed with 2× SDS sample buffer (0.125 M Tris-H Cl, pH 6.8, 4% SDS, 30% glycerol, 5% 2-mercaptoethanol, The cells are dissolved in 0.01% bromophenol blue at 70° C. for 15 minutes.

[0335] Commercially available standards (BioRad) are used as size markers. Electrophoresis onto polyvinylidene fluoride (PVDF) membranes (Millipore) using After transfer with , the blots were visualized using a chemiluminescence kit (Rockland). can be.

[0336] GFP protein was visualized in ear punch samples and expressed in circular and linear RNA. It is expected that detection will be possible.

[0337] Example 6: Local administration of RNA enhances RTP to tissue when ethanol is included in the RNA solution Resulting in NA delivery This example demonstrates the efficacy of ethanol in RNA synthesis via topical administration in vivo when ethanol is included in the RNA solution. The present invention demonstrates the ability to deliver RNA to cells and tissues using siRNA.

[0338] In this example, the circular RNA contains the EMCV IRES and nanoluciferase (N It was designed with an ORF encoding the ribosomal gene (Luc).

[0339] Circular RNA was generated in vitro. Unmodified linear RNA was synthesized from a DNA template. The transcribed RNA was purified using an RNA purification kit according to the manufacturer's instructions. The RNA 5' was purified using a 5' Phosphohydrolase (RppH) (New England Biolabs, M035 6) and purified again using an RNA purification column. RppH-treated linear RNA were obtained from splint DNA and T4 RNA ligase 2 (New England Biol. The circular RNA was then purified by urea-PAGE. It was prepared in a buffer (0.5 M sodium acetate, 0.1% SDS, 1 mM EDTA). The RNA was eluted with 0.1% ethanol, precipitated, and stored in RNA storage solution (ThermoFisher Science). The cells were resuspended in 100 mL of 100% ethanol (Centific, cat# AM7000). The RNA was also HPLC purified.

[0340] In this example, the linear mRNA encodes nanoluciferase (NLuc). In this example, the modified linear mRNA was designed with an ORF that The linear RNA was generated in-house by in vitro transcription. -Fully substituted with uridine and 5-methyl-C, capped with CleanCap™ AG It is polyadenylated and contains the 5' and 3' human alpha-globin UTRs. do.

[0341] The RNA was then dissolved in PBS / glucose (4.5 g / L) and ethanol (10% v / v ) so that the total sample volume for each sample was 50 uL. The total RNA for the sample was 3.5 pmol. All reagents were brought to room temperature before mixing. The mixture is prepared immediately prior to use.

[0342] At time point = 0, a 50 μL volume of each sample was delivered to a BALB / c mouse using a pipette tip. The drug was applied topically to the ears of mice. Untreated mice served as negative controls. The material was dried by briefly exposing the ears to an infrared light and fan in a sterile hood. Mice were returned to their cages under standard conditions.

[0343] To determine the persistence of RNA in tissues, tissue samples are delivered using RT-qPCR. RNA was analyzed at various time points after administration: 6 hours, 1, 3, and 12 days after administration. A 2 mm ear punch was taken from each animal and then lysed in RNAlater solution (ThermoFish Total RNA was stored in a 50-ml tube (E. coli, Cat# AM7020, ELISA Kit ... The cells were isolated from ear punches using Trizol extraction. The aqueous phase was precipitated with isopropanol. The pellet was washed with 70% ETOH according to the manufacturer's instructions. , synthesized from total RNA, and RT-PCR was performed using primers specific for the NLuc ORF. All samples were run on cDNA templates using a Bio-rad CFX384 server. The RNA levels were then assayed in triplicate on a multicycler. and relative to the untreated negative control.

[0344] Circular and linear RNA were mixed at 6 hours and 1, 3, and 12 days after local administration. was detected in tissue samples, showing a signal greater than that of the solvent-only control (Figures 2A and 2B). .

[0345] This example demonstrates that circular and linear RNAs are It has been successfully delivered via local administration to tissues and demonstrated to persist in the tissues for extended periods of time. I testify.

[0346] Example 7: Local administration of RNA enhances RNA delivery to tissues when formulated in TransIT Bringing about This example demonstrates the in vivo mechanism of action of RNA when formulated in solution using TransIT. We demonstrate the ability to deliver RNA to cells and tissues via local administration of the compound.

[0347] In this example, the circular RNA contains the EMCV IRES and nanoluciferase (N It was designed with an ORF encoding the ribosomal gene (Luc).

[0348] Circular RNA was generated in vitro. Unmodified linear RNA was synthesized from a DNA template. The transcribed RNA was purified using an RNA purification kit according to the manufacturer's instructions. The RNA 5' was purified using a 5' Phosphohydrolase (RppH) (New England Biolabs, M035 6) and purified again using an RNA purification column. RppH-treated linear RNA were obtained from splint DNA and T4 RNA ligase 2 (New England Biol. The circular RNA was then purified by urea-PAGE. It was prepared in a buffer (0.5 M sodium acetate, 0.1% SDS, 1 mM EDTA). The RNA was eluted with 0.1% ethanol, precipitated, and stored in RNA storage solution (ThermoFisher Science). The cells were resuspended in 100 mL of 100% ethanol (Centific, cat# AM7000). The RNA was also HPLC purified.

[0349] In this example, the linear mRNA encodes nanoluciferase (NLuc). In this example, the modified linear mRNA was designed with an ORF that The linear RNA was generated in-house by in vitro transcription. -Fully substituted with uridine and 5-methyl-C, capped with CleanCap™ AG It is polyadenylated and contains the 5' and 3' human alpha-globin UTRs. do.

[0350] The RNA was diluted in PBS / glucose (4.5 g / L) and in 10 uL of solution The RNA solution was then diluted with TransIT (Mirus Bio, M IR5700)(10uL), Boost(Mirus Bio, MIR5700)(5 Each sample was added to 25 uL of PBS / glucose (4.5 g / L). The total sample volume for each was 50 uL, and the total RNA for each sample was 3.5 pM. All reagents were brought to room temperature before mixing, and the mixtures were prepared immediately prior to use. .

[0351] At time point = 0, a 50 μL volume of each sample was delivered to a BALB / c mouse using a pipette tip. The drug was applied topically to the ears of mice. Untreated mice served as negative controls. The material was dried by briefly exposing the ears to an infrared light and fan in a sterile hood. Mice were returned to their cages under standard conditions.

[0352] To determine the persistence of RNA in tissues, tissue samples are delivered using RT-qPCR. RNA was analyzed at various time points after administration: 6 hours, 1, 3, and 12 days after administration. A 2 mm ear punch was taken from each animal and then lysed in RNAlater solution (ThermoFish Total RNA was stored in a 50-ml tube (E. coli, Cat# AM7020, ELISA Kit ... The cells were isolated from ear punches using Trizol extraction. The aqueous phase was precipitated with isopropanol. The pellet was washed with 70% ETOH according to the manufacturer's instructions. , synthesized from total RNA, and RT-PCR was performed using primers specific for the NLuc ORF. All samples were run on cDNA templates using a Bio-rad CFX384 server. The RNA levels were then assayed in triplicate on a multicycler. and relative to the untreated negative control.

[0353] Circular and linear RNA were administered to tissue samples 6 hours, 1, 3, and 12 days after local administration. The antibody was detected in the samples and showed a signal greater than that of the solvent-only control (FIGS. 3A and 3B).

[0354] This example demonstrates that circular and linear RNA can be delivered with TransIT. It can be successfully delivered via local administration to tissues and persist in the tissues for extended periods of time. Demonstrate the following.

[0355] Example 8: Modified IgG1-derived ... Local administration of linear RNA This example demonstrates the efficacy of linear β-lactam agonists in vivo upon topical administration when formulated in a DMSO gel. Demonstrate the ability to deliver RNA.

[0356] For this example, the RNA encodes Gaussia luciferase (GLuc). RF included.

[0357] In this example, modified linear RNA was ordered from Trilink Biotech. It was synthesized by echnologies and contains all the motifs listed above. In one embodiment, the RNA is fully substituted with pseudo-uridine and 5-methyl-C. , capped with CleanCap™ AG and polyadenylated (120A). DMSO Medi Gel (21 st Century Chemical Inc. ) is commercially available.

[0358] RNA was diluted in RNA storage solution to a concentration of 1 pmol / μL. 5 pmol of RNA Add 19 μL of DMSO Medi Gel (21 s t Century Chemical Inc.) and 1 μL of Rnasin Plus s Combined with RNase inhibitor (Promega). RNA-free formulations were was used as a reference.

[0359] At time point = 0, a 25 μL volume of each sample was topically applied to the mouse ear using a pipette tip. The samples were administered by briefly exposing the ears to infrared lights and fans in a sterile hood. The mice were then returned to their cages under standard conditions.

[0360] To determine RNA expression in tissues, tissue samples were analyzed for RNA expression at various time points after local delivery. Ear punches were taken from mice 24 and 48 hours after delivery. Tissue samples were lysed on ice in 1x luciferase cell lysis buffer (Thermo Scientific The plates were placed in a 350° C. immersion centrifuge for 30 minutes and then frozen.

[0361] Gaussia luciferase activity was measured using the Gaussia luciferase activity assay (Therm The samples were thawed and briefly The plate was then rotated for 20 min to remove any tissue debris. 20 μL of buffer solution was added to a 96-well plate (Co Briefly, 1× coelenterazine substrate was added to each well. The plates were incubated with substrate and then incubated in a luminometer (Promega). Readings were taken immediately after mixing.

[0362] Gaussia luciferase activity was detected in tissue samples 24 and 48 hours after topical application. and were observed to be higher than the solvent-only control (Figure 4).

[0363] In this example, linear RNA was dissolved in DMSO Medi Gel (21 st Centu Successfully delivered via topical administration when formulated by Pharmacy Chemical Inc. demonstrated that the cells were able to express detectable functional protein in tissues for extended periods of time. Ta.

[0364] Example 9: Topical administration of modified linear RNA formulated in a cream-based ointment in vivo Administration This example is a cream-based ointment, Johnson & Johnson's Baby Lotion. demonstrated the ability to deliver linear RNA in vivo by local administration when formulated in do.

[0365] For this example, the RNA encodes Gaussia luciferase (GLuc). RF included.

[0366] In this example, modified linear RNA was ordered from Trilink Biotech. It was synthesized by echnologies and contains all the motifs listed above. In one embodiment, the RNA is fully substituted with pseudo-uridine and 5-methyl-C. , capped with CleanCap™ AG and polyadenylated (120A). Baby lotion (Johnson & Johnson) was available over the counter.

[0367] RNA was diluted to a concentration of 1 pmol / μL. 5 pmol of RNA was used per application. For a total volume of 19 μL, add 19 μL of Johnson's Baby Lotion (unscented; son & Johnson) and 1 μL of Rnasin Plus RNase inhibitor (Promega). A formulation without RNA was used as a control.

[0368] At time point = 0, a 25 μL volume of each sample was topically applied to the mouse ear using a pipette tip. The samples were administered by briefly exposing the ears to infrared lights and fans in a sterile hood. The mice were then returned to their cages under standard conditions.

[0369] To determine RNA expression in tissues, tissue samples were analyzed for RNA expression at various time points after local delivery. Ear punches were taken from mice 24 and 48 hours after delivery. Tissue samples were lysed on ice in 1x luciferase cell lysis buffer (Thermo Scientific The plates were placed in a 350° C. immersion centrifuge for 30 minutes and then frozen.

[0370] Gaussia luciferase activity was measured using the Gaussia luciferase activity assay (Therm The samples were thawed and briefly The plate was then rotated for 20 min to remove any tissue debris. 20 μL of buffer solution was added to a 96-well plate (Co Briefly, 1× coelenterazine substrate was added to each well. The plates were incubated with substrate and then incubated in a luminometer (Promega). Readings were taken immediately after mixing.

[0371] Gaussia luciferase activity was detected in tissue samples 24 and 48 hours after topical application. and was observed to be higher than the solvent-only control (Figure 5).

[0372] This example demonstrates that linear RNA can be administered via topical administration when formulated in a cream-based ointment. They can be successfully delivered to tissues and express detectable functional proteins for extended periods of time. This demonstrated that

[0373] Example 10: Localized administration of modified linear RNA in vivo This example demonstrates the use of ethanol to deliver linear RNA in vivo via topical administration. Demonstrate the ability to:

[0374] For this example, the RNA encodes Gaussia luciferase (GLuc). RF included.

[0375] In this example, modified linear RNA was ordered from Trilink Biotech. It was synthesized by echnologies and contains all the motifs listed above. In one embodiment, the RNA is fully substituted with pseudo-uridine and 5-methyl-C. , capped with CleanCap™ AG and polyadenylated (120A). Ethanol (Sigma Aldrich) was commercially available.

[0376] RNA was diluted to a concentration of 1 pmol / μL in RNA storage solution. 5 pmol of RNA was , 19 µL ethanol and 1 µL Rnasin for a total volume of 25 µL per application Plus RNase inhibitor (Promega) was used. Solvent-only controls were also used. The solution was prepared in a 30 ml tube and contained no RNA.

[0377] At time point = 0, a 25 μL volume of each sample was topically applied to the mouse ear using a pipette tip. The samples were administered by briefly exposing the ears to infrared lights and fans in a sterile hood. The mice were then returned to their cages under standard conditions.

[0378] To determine RNA expression in tissues, tissue samples were analyzed for RNA expression at various time points after local delivery. Ear punches were taken from mice 24 and 48 hours after delivery. Tissue samples were lysed on ice in 1x luciferase cell lysis buffer (Thermo Scientific The plates were placed in a 350° C. immersion centrifuge for 30 minutes and then frozen.

[0379] Gaussia luciferase activity was measured using the Gaussia luciferase activity assay (Therm The samples were thawed and briefly The plate was then rotated for 20 min to remove any tissue debris. 20 μL of buffer solution was added to a 96-well plate (Co Briefly, 1× coelenterazine substrate was added to each well. The plates were incubated with substrate and then incubated in a luminometer (Promega). Readings were taken immediately after mixing.

[0380] Gaussia luciferase activity was detected in tissue samples 24 and 48 hours after topical application. and was observed to be higher than the solvent-only control (Figure 6).

[0381] This example demonstrates that linear RNA can be successfully delivered via topical administration with ethanol. We demonstrated that it was possible to express detectable functional protein in tissues for an extended period of time.

[0382] Example 11: Local administration of circular RNA results in RNA delivery to tissue This example demonstrates the ability to deliver circular RNA to cells and tissues via local administration in vivo. Demonstrate power.

[0383] In this example, the circular RNA encodes the erythropoietin protein (EPO). It was designed with an ORF that

[0384] Circular RNA was generated in vitro. Linear RNA was generated using all of the motifs listed above. from a DNA template containing a T7 RNA polymerase promoter driving transcription. In this example, Cy5-UTP was used to generate the Cy5-labeled Transcribed RNA was purified using an RNA purification kit according to the manufacturer's instructions. (New England Biolabs, T2050) and Sulfohydrolase (RppH) (New England Biolabs, M0356 ) and purified again on an RNA purification column. The RppH-treated linear RNA was , splint DNA and T4 RNA ligase 2 (New England Biolab Circularized RNA was purified by urea-PAGE. , eluted in buffer (0.5M sodium acetate, 0.1% SDS, 1mM EDTA) The RNA was then ethanol precipitated and stored in RNA storage solution (ThermoFisher Scientific The mixture was resuspended in 100 mM NaCl (Frequency Immunosorbent Assay, cat# AM7000).

[0385] Circular RNA was diluted in PBS / glucose (4.5 g / L) containing 5% ethanol. As a result, the total sample volume for each sample was 25 uL. The total RNA was 12 pmol. All reagents were brought to room temperature before mixing, and the mixture was Prepared immediately before use.

[0386] At time point = 0, mouse ears were wiped with isopropyl alcohol wipes, dried, and then incubated for 25 min. A μL volume of each sample was administered topically to the ear of a BALB / c mouse using a pipette tip. The samples were applied to the ears by briefly exposing them to infrared lights and fans in a sterile hood. The mice were then returned to their cages under standard conditions.

[0387] To determine circular RNA delivery to tissues, tissue samples were examined under fluorescent microscopy at various time points after administration. At 6 hours, 1 day, and 3 days after dosing, 2 mm ear punches were taken at each site. Tissue samples were harvested from the animals and stored in ice-cold PBS. The images were then quantified for fluorescence using ImageJ. It was.

[0388] Cy5 signals were detected in tissue samples at 6 hours, 1 and 3 days after topical administration. The signal was greater than that of the negative control, which did not show any fluorescence (Figures 7 and 8). demonstrate that circular RNA is successfully delivered to tissues.

[0389] This example demonstrates that circular RNA can be successfully delivered to the skin via topical administration and has long-term efficacy. and demonstrate that it persists in the organization.

[0390] Example 12: Localized administration of mRNA results in RNA delivery to tissues This example demonstrates the ability to deliver mRNA to cells and tissues via local administration in vivo. Demonstrate the following.

[0391] In this example, the mRNA is an ORF encoding green fluorescent protein (eGFP). In this example, the modified linear mRNA was ordered with T All of the above listed compounds were synthesized by Rilink Biotechnologies. In this example, the RNA contained the motifs pseudo-uridine and 5-methyl The 5' and 3' ends of the 5' capped nucleotides were replaced with CleanCap™ AG. Human alpha-globin contains UTR and is polyadenylated. The mRNA is It contained a Cy5 fluorophore label covalently attached at the end.

[0392] The mRNA was diluted in PBS / glucose (4.5 g / L) containing 5% ethanol. As a result, the total sample volume for each sample was 25 uL. The RNA was 12 pmol. All reagents were brought to room temperature before mixing, and the mixture was used. Prepared immediately before use.

[0393] At time point = 0, mouse ears were wiped with isopropyl alcohol wipes, dried, and then incubated for 25 min. A μL volume of each sample was administered topically to the ear of a BALB / c mouse using a pipette tip. The samples were applied to the ears by briefly exposing them to infrared lights and fans in a sterile hood. The mice were then returned to their cages under standard conditions.

[0394] To determine RNA delivery to tissues, tissue samples were examined under a fluorescent microscope at various time points post-injection. At 6 hours, 1 day, and 3 days after dosing, 2 mm ear punches were taken from each animal. Tissue samples were then visualized using an EVOS II fluorescence microscope. The images were then quantified for fluorescence using ImageJ. .

[0395] Cy5 signals were detected in tissue samples at 6 hours, 1 day, and 3 days after topical administration. The negative control showed a larger signal than the negative control, which did not show any fluorescence (Figures 9 and 10). ), indicating that the mRNA was successfully delivered to the tissue.

[0396] This example demonstrates that mRNA can be successfully delivered via topical administration to the skin and maintained for an extended period of time. and demonstrate that it persists in the organization.

[0397] Example 13: Topical administration of mRNA improves cellular function when tissue is wiped with ethanol wipes prior to application , resulting in RNA delivery to tissues This example demonstrates the ability to deliver mRNA to cells and tissues via local administration in vivo. Demonstrate the following.

[0398] In this example, the mRNA is an ORF encoding nanoluciferase (NLuc). In this example, the modified linear mRNA was synthesized in vitro In this example, the RNA was generated in-house by transcription. and 5-methyl-C, capped with CleanCap™ AG, The 5' and 6' human alpha-globin UTRs are included and are polyadenylated.

[0399] The RNA was then diluted in PBS alone or in PBS and 10% (v / v) ethanol. As a result, the total sample volume for each sample was 35 uL. Total RNA was 20 pmol. As a negative control, a solvent only control was run as above. All reagents were brought to room temperature before mixing, and the mixture was , prepared immediately prior to use.

[0400] At time point = 0, mouse ears were wiped with cotton swabs soaked in 70% ethanol and allowed to dry. A 35 μL volume of each sample was then instilled into the ear of a BALB / c mouse using a pipette tip. The samples were applied topically under the ear in a sterile hood, with the ear exposed to infrared light and air. The mice were then returned to their cages under standard conditions. .

[0401] To determine the persistence of RNA in tissues, tissue samples are delivered using RT-qPCR. At 1 and 4 days after administration, 2 mm ear pans were used for RNA analysis. Tissues were collected from each animal and purified using RNAlater solution (ThermoFisher Science Total RNA was frozen and stored in a glass The tissue was homogenized in liquid nitrogen using a mortar and pestle of 1000 μg / ml, and then extracted with Trizol (Th Fisher Scientific cat#15596026) The aqueous phase was precipitated with isopropanol and the pellet was purified by the manufacturer's The cDNA was purified using Superscript IV (Thermo Scientific, cat#11766500) was used to RT-PCR was performed using the iTaq Universal SYB R® Green Supermix (Bio-Rad, Catalog #17251 24) and NLuc ORF (F:CCGTATGAAGGTCTGAGCGG (SEQ ID NO: No. 12), R: specific for CAGTGTGCCATAGTGCAGGA (SEQ ID NO: 13) All samples were analyzed using Bio-Rad's d Assayed in triplicate on a CFX384 thermal cycler. RNA was then Levels were relativized to a housekeeping gene (28s).

[0402] The mRNA was measured on day 1 in PBS alone after topical administration, and on day 2 in PB mRNA in S+10% EtOH was detected in tissue samples on days 1 and 4. It showed a greater signal than the negative control (Figure 11).

[0403] This example demonstrates that mRNA can be administered topically when the skin is wiped with an ethanol wipe prior to administration. It is demonstrated that it is successfully delivered via administration and persists in tissues for extended periods of time.

[0404] Example 14: mRNA expression was significantly improved when tissue was wiped with an isopropyl alcohol wipe prior to application. Local administration of results in RNA delivery to tissues This example demonstrates the ability to deliver mRNA to cells and tissues via local administration in vivo. Demonstrate the following.

[0405] In this example, the mRNA is an ORF encoding nanoluciferase (NLuc). In this example, the modified linear mRNA was synthesized in vitro In this example, the RNA was generated in-house by transcription. and 5-methyl-C, capped with CleanCap™ AG, The 5' and 6' human alpha-globin UTRs are included and are polyadenylated.

[0406] The RNA was then diluted in PBS only, resulting in a total The sample volume was 35 uL and the total RNA for each sample was 20 pmoles. As a negative control, a solvent-only control was prepared as above but without RNA. All reagents are brought to room temperature prior to mixing, and the mixture is prepared immediately prior to use.

[0407] At time point = 0, mouse ears were wiped with commercially available isopropyl alcohol wipes (CVS, 2975 84), wiped dry, and a 35 μL volume of each sample was transferred to the BAL using a pipette tip. The samples were applied topically to the ears of B / c mice by drops. The ears were dried by brief exposure to infrared lights and a fan. Mice were kept in standard conditions. was returned to the lower cage.

[0408] To determine the persistence of RNA in tissues, tissue samples are delivered using RT-qPCR. At 1 and 4 days after administration, 2 mm ear pans were used for RNA analysis. Tissues were collected from each animal and purified using RNAlater solution (ThermoFisher Science Total RNA was frozen and stored in a glass The tissue was homogenized in liquid nitrogen using a mortar and pestle of 1000 μg / ml, and then extracted with Trizol (Th Fisher Scientific cat#15596026) The aqueous phase was precipitated with isopropanol and the pellet was purified by the manufacturer's The cDNA was purified using Superscript IV (Thermo Scientific, cat#11766500) was used to RT-PCR was performed using the iTaq Universal SYB R® Green Supermix (Bio-Rad, Catalog #17251 24) and NLuc ORF (F:CCGTATGAAGGTCTGAGCGG (SEQ ID NO: No. 12), R: specific for CAGTGTGCCATAGTGCAGGA (SEQ ID NO: 13) All samples were analyzed using Bio-Rad's d Assayed in triplicate on a CFX384 thermal cycler. RNA was then Levels were relativized to a housekeeping gene (28s).

[0409] mRNA was detected in tissue samples 1 and 4 days after topical administration and was greater than in the negative control. The signal was shown (Figure 12).

[0410] This example demonstrates that mRNA is administered to subjects whose skin has been wiped with an isopropyl alcohol wipe prior to administration. demonstrated that the drug can be successfully delivered via local administration and persists in tissues for extended periods of time when administered I testify.

[0411] Example 15: Topical administration of circular RNA when tissue is wiped with ethanol wipes prior to application leads to RNA delivery to tissues This example demonstrates the delivery of unmodified circular RNA to cells and tissues via local administration in vivo. Demonstrate ability to achieve.

[0412] In this example, the circular RNA contains an IRES and nanoluciferase (NLuc). It was designed with an ORF encoding

[0413] Circular RNA was generated in vitro. Unmodified linear RNA was generated using all of the methods listed above. DNA containing all of the motifs and the T7 RNA polymerase promoter driving transcription. The template was transcribed in vitro. The transcribed RNA was then purified using RNA synthesis kits according to the manufacturer's instructions. Purified with a purification kit (New England Biolabs, T2050) and R NA 5' phosphohydrolase (RppH) (New England Biolabs The RppH-treated DNA was then treated with 1000 kDa (M0356) and purified again using an RNA purification column. The stranded RNA was synthesized by splinting DNA (5'-TTTTTCGGCTATTCCCAATAG CCGTTTTG-3' (SEQ ID NO: 11)) and T4 RNA ligase 2 (New En Circular RNA was circularized using a urinary tract assay (Gland Biolabs, M0239). The purified fragments were analyzed by ELISA using a 100-μL gel electrophoresis gel (PE) and diluted with 100 μl of 1% sodium acetate (0.5 M sodium acetate, 0.1% SDS, 1 mM M EDTA), ethanol precipitated, and stored in RNA storage solution (ThermoFi The mixture was resuspended in 100 mM NaCl (Sherr Scientific, cat# AM7000).

[0414] The RNA was then incubated either in PBS alone or in PBS containing 10% (v / v) ethanol. The samples were then diluted with either 0.01% ethanol or 0.1% ethanol, so that the total sample volume for each sample was 35 uL. Total RNA for the sample was 20 pmoles. As a negative control, a solvent-only control was The kit was prepared as described above but without RNA. All reagents were brought to room temperature before mixing. The mixture is prepared immediately prior to use.

[0415] At time point = 0, mouse ears were wiped with ethanol wipes, dried, and a 35 μL dose of each Samples were applied topically to the ears of BALB / c mice using a pipette tip. The samples were prepared by briefly exposing the ears to infrared lights and a fan in a sterile hood. The mice were returned to their cages under standard conditions.

[0416] To determine the persistence of RNA in tissues, tissue samples are delivered using RT-qPCR. At 1 and 4 days after administration, 2 mm ear pans were used for RNA analysis. Tissues were collected from each animal and purified using RNAlater solution (ThermoFisher Science Total RNA was frozen and stored in a glass The tissue was homogenized in liquid nitrogen using a mortar and pestle of 1000 μg / ml, and then extracted with Trizol (Th Fisher Scientific cat#15596026) The aqueous phase was precipitated with isopropanol and the pellet was purified by the manufacturer's The cDNA was purified using Superscript IV (Thermo Scientific, cat#11766500) was used to RT-PCR was performed using the iTaq Universal SYB R® Green Supermix (Bio-Rad, Catalog #17251 24) and NLuc ORF (F:CCGTATGAAGGTCTGAGCGG (SEQ ID NO: No. 12), R: specific for CAGTGTGCCATAGTGCAGGA (SEQ ID NO: 13) All samples were analyzed using Bio-Rad's d Assayed in triplicate on a CFX384 thermal cycler. RNA was then Levels were relativized to a housekeeping gene (28s).

[0417] Circular RNA was detected in PBS alone after topical administration after wiping the skin with an ethanol wipe. Circular RNA in PBS + 10% EtOH on days 1 and 4 Signals detected in tissue samples on day 1 for globular RNA were greater than those in appropriate solvent-only controls. The results showed that the NALS was 100% (Figure 13).

[0418] This example demonstrates that circular RNA is locally It has been demonstrated that the compound is successfully delivered via oral administration and persists in tissues for extended periods of time.

[0419] Example 16: Local administration of circular RNA results in RNA delivery to tissue This example demonstrates the delivery of unmodified circular RNA to cells and tissues via local administration in vivo. Demonstrate ability to achieve.

[0420] In this example, the circular RNA contains an IRES and nanoluciferase (NLuc). It was designed with an ORF encoding

[0421] Circular RNA was generated in vitro. Unmodified linear RNA was generated using all of the methods listed above. DNA containing all of the motifs and the T7 RNA polymerase promoter driving transcription. The template was transcribed in vitro. The transcribed RNA was then purified using RNA synthesis kits according to the manufacturer's instructions. Purified with a purification kit (New England Biolabs, T2050) and R NA 5' phosphohydrolase (RppH) (New England Biolabs The RppH-treated DNA was then treated with 1000 kDa (M0356) and purified again using an RNA purification column. The stranded RNA was synthesized by splinting DNA (5'-TTTTTCGGCTATTCCCAATAG CCGTTTTG-3' (SEQ ID NO: 11)) and T4 RNA ligase 2 (New En Circular RNA was circularized using a urinary tract assay (Gland Biolabs, M0239). The purified fragments were analyzed by ELISA using a 100-μL gel electrophoresis gel (PE) and diluted with 100 μl of 1% sodium acetate (0.5 M sodium acetate, 0.1% SDS, 1 mM M EDTA), ethanol precipitated, and stored in RNA storage solution (ThermoFi The mixture was resuspended in 100 mM NaCl (Sherr Scientific, cat# AM7000).

[0422] The RNA was then diluted in PBS containing 10% (v / v) ethanol, resulting in The total sample volume for each sample was 35 uL and the total RNA for each sample was 2 As a negative control, a solvent-only control was used as above but without RNA. All reagents were brought to room temperature before mixing, and the mixture was prepared immediately prior to use. It was manufactured.

[0423] At time point = 0, a 35 μL volume of each sample was delivered to a BALB / c mouse using a pipette tip. The samples were applied topically by dropping onto the ears of subjects. The samples were then placed in a sterile hood and the ears were exposed to infrared light. The mice were dried by briefly exposing them to a fan and then to a 200°C oven. It was returned.

[0424] To determine the persistence of RNA in tissues, tissue samples are delivered using RT-qPCR. RNA was analyzed at various time points after administration. Punches were taken from each animal and incubated in RNAlater solution (ThermoFisher Sc Total RNA was frozen and stored in aliquots of 1000 ml ... The tissue was homogenized in liquid nitrogen using a Rath mortar and pestle, followed by Trizol extraction ( According to ThermoFisher Scientific cat#15596026 The aqueous phase was precipitated with isopropanol and the pellet was collected by The cDNA was purified by Superscript PCR using 70% ETOH according to the manufacturer's instructions. t IV (Thermo Scientific, cat#11766500) was used. RT-PCR was performed using the iTaq Universal S YBR® Green Supermix (Bio-Rad, Catalog #172 5124) and NLuc ORF (F:CCGTATGAAGGTCTGAGCGG (sequence Sequence number 12), R: CAGTGTGCCATAGTGCAGGA (sequence number 13) All samples were prepared using different primers on the cDNA template. The assays were performed in triplicate on a rad CFX384 thermal cycler. NA levels were relativized to the housekeeping gene (28s).

[0425] Circular RNA was detected in tissue samples 1 and 4 days after topical administration, with appropriate negative controls. The signal was greater than that of the control (Figure 14).

[0426] This example demonstrates that circular RNA can be successfully delivered to tissues via topical administration to the skin. Demonstrates persistence in tissues for extended periods of time.

[0427] Example 17: Local administration of circular RNA results in RNA delivery to tissue This example demonstrates the delivery of unmodified circular RNA to cells and tissues via local administration in vivo. Demonstrate ability to achieve.

[0428] In this example, the circular RNA contains an IRES and nanoluciferase (NLuc). It was designed with an ORF encoding

[0429] Circular RNA was generated in vitro. Unmodified linear RNA was generated using all of the methods listed above. DNA containing all of the motifs and the T7 RNA polymerase promoter driving transcription. The template was transcribed in vitro. The transcribed RNA was then purified using RNA synthesis kits according to the manufacturer's instructions. Purified with a purification kit (New England Biolabs, T2050) and R NA 5' phosphohydrolase (RppH) (New England Biolabs The RppH-treated DNA was then treated with 1000 kDa (M0356) and purified again using an RNA purification column. The stranded RNA was synthesized by splinting DNA (5'-TTTTTCGGCTATTCCCAATAG CCGTTTTG-3' (SEQ ID NO: 11)) and T4 RNA ligase 2 (New En Circular RNA was circularized using a urinary tract assay (Gland Biolabs, M0239). The purified fragments were analyzed by ELISA using a 100-μL gel electrophoresis gel (PE) and diluted with 100 μl of 1% sodium acetate (0.5 M sodium acetate, 0.1% SDS, 1 mM M EDTA), ethanol precipitated, and stored in RNA storage solution (ThermoFi The mixture was resuspended in 100 mM NaCl (Sherr Scientific, cat# AM7000).

[0430] The RNA was then diluted in PBS containing 10% (v / v) isopropyl alcohol. As a result, the total sample volume for each sample was 35 uL. RNA was 20 pmol. As a negative control, a solvent only control was used as above. All reagents were brought to room temperature before mixing, and the mixture was Prepared immediately before use.

[0431] At time point = 0, a 35 μL volume of each sample was delivered to a BALB / c mouse using a pipette tip. The samples were applied topically by dropping onto the ears of subjects. The samples were then placed in a sterile hood and the ears were exposed to infrared light. The mice were dried by briefly exposing them to a fan and then to a 200°C oven. It was returned.

[0432] To determine the persistence of RNA in tissues, tissue samples are delivered using RT-qPCR. RNA was analyzed at various time points after administration. Punches were taken from each animal and incubated in RNAlater solution (ThermoFisher Sc Total RNA was frozen and stored in aliquots of 1000 ml ... The tissue was homogenized in liquid nitrogen using a Rath mortar and pestle, followed by Trizol extraction ( According to ThermoFisher Scientific cat#15596026 The aqueous phase was precipitated with isopropanol and the pellet was collected by The cDNA was purified by Superscript PCR using 70% ETOH according to the manufacturer's instructions. t IV (Thermo Scientific, cat#11766500) was used. RT-PCR was performed using the iTaq Universal S YBR® Green Supermix (Bio-Rad, Catalog #172 5124) and NLuc ORF (F:CCGTATGAAGGTCTGAGCGG (sequence Sequence number 12), R: CAGTGTGCCATAGTGCAGGA (sequence number 13) All samples were prepared using different primers on the cDNA template. The assays were performed in triplicate on a rad CFX384 thermal cycler. NA levels were relativized to the housekeeping gene (28s).

[0433] Circular RNA was detected in tissue samples 1 and 4 days after topical administration, with appropriate negative controls. The signal was greater than that of the control (Figure 15).

[0434] This example demonstrates that circular RNA can be successfully delivered to tissues via topical administration to the skin. , demonstrating that it persists in tissues for extended periods of time.

[0435] Example 18: Cyclic RNase A was observed when tissue was wiped with an isopropyl alcohol wipe prior to application. Local administration of A results in RNA delivery to tissues This example demonstrates the delivery of unmodified circular RNA to cells and tissues via local administration in vivo. Demonstrate ability to achieve.

[0436] In this example, the circular RNA contains an IRES and nanoluciferase (NLuc). It was designed with an ORF encoding

[0437] Circular RNA was generated in vitro. Unmodified linear RNA was generated using all of the methods listed above. DNA containing all of the motifs and the T7 RNA polymerase promoter driving transcription. The template was transcribed in vitro. The transcribed RNA was then purified using RNA synthesis kits according to the manufacturer's instructions. Purified with a purification kit (New England Biolabs, T2050) and R NA 5' phosphohydrolase (RppH) (New England Biolabs The RppH-treated DNA was then treated with 1000 kDa (M0356) and purified again using an RNA purification column. The stranded RNA was synthesized by splinting DNA (5'-TTTTTCGGCTATTCCCAATAG CCGTTTTG-3' (SEQ ID NO: 11)) and T4 RNA ligase 2 (New En Circular RNA was circularized using urea cleavage (Gland Biolabs, M0239). -PAGE and buffer (0.5 M sodium acetate, 0.1% SDS, 1 mM EDTA), ethanol precipitated, and stored in RNA storage solution (ThermoFis The mixture was resuspended in 100 mM NaCl (Herber Scientific, cat# AM7000).

[0438] The RNA was then diluted in PBS only, resulting in a total The sample volume was 35 uL and the total RNA for each sample was 20 pmol. As a safety control, a solvent-only control was prepared as above but without RNA. All reagents are brought to room temperature before mixing, and the mixture is prepared immediately prior to use.

[0439] At time point = 0, mouse ears were wiped with isopropyl alcohol wipes (CVS, 297584). The tissue was wiped dry and a 35 μL volume of each sample was then transferred to a BALB / c The drug was applied topically to the ears of mice. Only the 100% 18-item type was used. The samples were prepared by exposing the ears to infrared light and a fan in a sterile hood. The mice were then allowed to dry for a short period of time and returned to their cages under standard conditions.

[0440] To determine the persistence of RNA in tissues, tissue samples are delivered using RT-qPCR. RNA was analyzed at various time points after administration. Punches were taken from each animal and incubated in RNAlater solution (ThermoFisher Sc Total RNA was frozen and stored in aliquots of 1000 ml ... The tissue was homogenized in liquid nitrogen using a Rath mortar and pestle, followed by Trizol extraction ( According to ThermoFisher Scientific cat#15596026 The aqueous phase was precipitated with isopropanol and the pellet was collected by The cDNA was purified by Superscript PCR using 70% ETOH according to the manufacturer's instructions. t IV (Thermo Scientific, cat#11766500) was used. RT-PCR was performed using the iTaq Universal S YBR® Green Supermix (Bio-Rad, Catalog #172 5124) and NLuc ORF (F:CCGTATGAAGGTCTGAGCGG (sequence Sequence number 12), R: CAGTGTGCCATAGTGCAGGA (sequence number 13) All samples were prepared using different primers on the cDNA template. The assays were performed in triplicate on a rad CFX384 thermal cycler. NA levels were relativized to the housekeeping gene (28s).

[0441] Circular RNA was detected in tissue samples 1 and 4 days after topical administration and was significantly higher than in vehicle-only controls. A larger signal was observed (Figure 16).

[0442] This example shows that circular RNA was topically administered after wiping the skin with an isopropyl alcohol wipe. Demonstration that the compound is successfully delivered to tissues via topical administration and persists in the tissues for extended periods of time. do.

[0443] Example 19: Local administration of linear mRNA results in RNA delivery to tissues This example demonstrates the ability to deliver mRNA to cells and tissues via local administration in vivo. Demonstrate the following.

[0444] In this example, the mRNA is an ORF encoding nanoluciferase (NLuc). In this example, the modified linear mRNA was synthesized in vitro In this example, the RNA was generated in-house by transcription. and 5-methyl-C, capped with CleanCap™ AG, The 5' and 6' human alpha-globin UTRs are included and are polyadenylated.

[0445] RNA was diluted in (1) PBS alone, (2) PBS containing 10% (v / v) ethanol, or (3 ) diluted in PBS containing 10% (v / v) isopropyl alcohol, resulting in The total sample volume for each sample was 35 uL, and the total RNA for each sample was 20 pM. As a negative control, a solvent-only control was performed as above but without RNA. All reagents were brought to room temperature before mixing, and the mixtures were prepared immediately prior to use. can be.

[0446] At time point = 0, a 35 μL volume of each sample was delivered to a BALB / c mouse using a pipette tip. The samples were applied topically by dropping onto the ears of subjects. The samples were then placed in a sterile hood and the ears were exposed to infrared light. The mice were dried by briefly exposing them to a fan and then to a 200°C oven. It was returned.

[0447] To determine the persistence of RNA in tissues, tissue samples are delivered using RT-qPCR. RNA was analyzed at various time points after administration. Punches were taken from each animal and incubated in RNAlater solution (ThermoFisher Sc Total RNA was frozen and stored in aliquots of 1000 ml ... The tissue was homogenized in liquid nitrogen using a Rath mortar and pestle, followed by Trizol extraction ( According to ThermoFisher Scientific cat#15596026 The aqueous phase was precipitated with isopropanol and the pellet was collected by The cDNA was purified by Superscript PCR using 70% ETOH according to the manufacturer's instructions. t IV (Thermo Scientific, cat#11766500) was used. RT-PCR was performed using the iTaq Universal S YBR® Green Supermix (Bio-Rad, Catalog #172 5124) and NLuc ORF (F:CCGTATGAAGGTCTGAGCGG (sequence Sequence number 12), R: CAGTGTGCCATAGTGCAGGA (sequence number 13) All samples were prepared using different primers on the cDNA template. The assays were performed in triplicate on a rad CFX384 thermal cycler. NA levels were relativized to the housekeeping gene (28s).

[0448] The mRNA was measured on day 1 in PBS alone after topical administration, and on day 2 in PB mRNA in S+10% EtOH and mRNA in PBS+10% iPrOH For both A, the mean mean mean 1 and 4 days were detected in tissue samples and were greater than the appropriate negative controls. The signal was shown (Figure 17).

[0449] This example demonstrates that mRNA can be successfully delivered to tissues via topical administration to the skin and has long-lasting therapeutic effects. demonstrate persistence in tissues over a period of time.

[0450] Example 20: Topical administration of circular RNA when tissue is wiped with ethanol wipes prior to application leads to protein expression in tissues This example demonstrates the delivery of unmodified circular RNA to cells and tissues via local administration in vivo. Demonstrate the ability to achieve transcriptional regulation and subsequent protein expression.

[0451] In this example, the circular RNA contains an IRES and nanoluciferase (NLuc). It was designed with an ORF encoding

[0452] Circular RNA was generated in vitro. Unmodified linear RNA was generated using all of the methods listed above. DNA containing all of the motifs and the T7 RNA polymerase promoter driving transcription. The template was transcribed in vitro. The transcribed RNA was then purified using RNA synthesis kits according to the manufacturer's instructions. Purified with a purification kit (New England Biolabs, T2050) and R NA 5' phosphohydrolase (RppH) (New England Biolabs The RppH-treated DNA was then treated with 1000 kDa (M0356) and purified again using an RNA purification column. The stranded RNA was synthesized by splinting DNA (5'-TTTTTCGGCTATTCCCAATAG CCGTTTTG-3' (SEQ ID NO: 11)) and T4 RNA ligase 2 (New En Circular RNA was circularized using a urinary tract assay (Gland Biolabs, M0239). The purified fragments were analyzed by ELISA using a 100-μL gel electrophoresis gel (PE) and diluted with 100 μl of 1% sodium acetate (0.5 M sodium acetate, 0.1% SDS, 1 mM M EDTA), ethanol precipitated, and stored in RNA storage solution (ThermoFi The mixture was resuspended in 100 mM NaCl (Sherr Scientific, cat# AM7000).

[0453] The RNA was then diluted in PBS only, resulting in a total The sample volume was 35 uL and the total RNA for each sample was 20 pmoles. A medium-only control sample was prepared similarly but without RNA. All reagents were mixed. The mixture was prepared immediately prior to use and brought to room temperature.

[0454] At time point = 0, mouse ears were wiped with ethanol wipes, dried, and a 35 μL dose of each Samples were applied topically to the ears of BALB / c mice using a pipette tip. The samples were prepared by briefly exposing the ears to infrared lights and a fan in a sterile hood. The mice were returned to their cages under standard conditions.

[0455] To determine RNA expression in tissues, tissue samples were collected from NLuc Ear punches were taken from the mice on day 4 after delivery and analyzed for activity. The samples were ground into fragments and lysed in 50 µL of ice-cold NLi containing 1x protease inhibitor cocktail. The samples were then placed in lysis assay buffer and placed on ice. The tissue was then isolated by incubation on a centrifuge at 700 rpm for 5 min on a centrifuge at room temperature. 50 μL of the supernatant was then transferred to a new tube without disturbing the tissue pellet. 50 μL of each sample was transferred to a 96-well plate and Nano-Glo filters were added. Luciferase Assay System (Promega, #N1110) assays were prepared according to the manufacturer's instructions. Briefly, 1 uL of furimazine substrate and 49 uL of PBS were added to each well. The plates were incubated for 10 minutes after substrate addition and mixing. The assay was performed using a luminometer (Promega) and then read in a luminometer instrument.

[0456] Nanoluciferase activity after topical application of circular RNA in PBS alone It was detected in tissue samples on day 4 and was observed to be higher than the appropriate vehicle-only controls (Figure 18).

[0457] This example demonstrates that circular RNA can be successfully delivered via local administration and detected in tissues for extended periods of time. It was demonstrated that a functional protein could be expressed.

[0458] Example 21: Localized administration of circular RNA results in protein expression in tissues This example demonstrates the delivery of unmodified circular RNA to cells and tissues via local administration in vivo. Demonstrate the ability to achieve transcriptional regulation and subsequent protein expression.

[0459] In this example, the circular RNA contains an IRES and nanoluciferase (NLuc). It was designed with an ORF encoding

[0460] Circular RNA was generated in vitro. Unmodified linear RNA was generated using all of the methods listed above. DNA containing all of the motifs and the T7 RNA polymerase promoter driving transcription. The template was transcribed in vitro. The transcribed RNA was then purified using RNA synthesis kits according to the manufacturer's instructions. Purified with a purification kit (New England Biolabs, T2050) and R NA 5' phosphohydrolase (RppH) (New England Biolabs The RppH-treated DNA was then treated with 1000 kDa (M0356) and purified again using an RNA purification column. The stranded RNA was synthesized by splinting DNA (5'-TTTTTCGGCTATTCCCAATAG CCGTTTTG-3' (SEQ ID NO: 11)) and T4 RNA ligase 2 (New En Circular RNA was circularized using a urinary tract assay (Gland Biolabs, M0239). The purified fragments were analyzed by ELISA using a 100-μL gel electrophoresis gel (PE) and diluted with 100 μl of 1% sodium acetate (0.5 M sodium acetate, 0.1% SDS, 1 mM M EDTA), ethanol precipitated, and stored in RNA storage solution (ThermoFi The mixture was resuspended in 100 mM NaCl (Sherr Scientific, cat# AM7000).

[0461] The RNA was then diluted in PBS containing 10% (v / v) ethanol, resulting in The total sample volume for each sample was 35 uL and the total RNA for each sample was 2 As a negative control, a solvent-only control was used as above but without RNA. All reagents were brought to room temperature before mixing, and the mixture was prepared immediately prior to use. It was manufactured.

[0462] At time point = 0, a 35 μL volume of each sample was delivered to a BALB / c mouse using a pipette tip. The samples were applied topically by dropping onto the ears of subjects. The samples were then placed in a sterile hood and the ears were exposed to infrared light. The mice were dried by briefly exposing them to a fan and then to a 200°C oven. It was returned.

[0463] To determine RNA expression in tissues, tissue samples were collected from NLuc Ear punches were taken from the mice on day 4 after delivery and analyzed for activity. The samples were ground into fragments and lysed in 50 µL of ice-cold NLi containing 1x protease inhibitor cocktail. The samples were then placed in lysis assay buffer and placed on ice. The tissue was then isolated by incubation on a centrifuge at 700 rpm for 5 min on a centrifuge at room temperature. 50 μL of the supernatant was then transferred to a new tube without disturbing the tissue pellet. 50 μL of each sample was transferred to a 96-well plate and Nano-Glo filters were added. Luciferase Assay System (Promega, #N1110) assays were prepared according to the manufacturer's instructions. Briefly, 1 uL of furimazine substrate and 49 uL of PBS were added to each well. The plates were incubated for 10 minutes after substrate addition and mixing. The assay was performed using a luminometer (Promega) and then read in a luminometer instrument.

[0464] Nanoluciferase activity was measured in cyclic PBS containing 10% ethanol (v / v). RNA was detected in tissue samples 4 days after topical application and was significantly higher than the appropriate solvent-only controls. was observed to be high (Figure 19).

[0465] This example demonstrates that circular RNA can be successfully delivered via local administration and detected in tissues for extended periods of time. It was demonstrated that a functional protein could be expressed.

[0466] Example 22: Localized administration of circular RNA results in protein expression in tissues This example demonstrates the delivery of unmodified circular RNA to cells and tissues via local administration in vivo. Demonstrate the ability to achieve transcriptional regulation and subsequent protein expression.

[0467] In this example, the circular RNA contains an IRES and nanoluciferase (NLuc). It was designed with an ORF encoding

[0468] Circular RNA was generated in vitro. Unmodified linear RNA was generated using all of the methods listed above. DNA containing all of the motifs and the T7 RNA polymerase promoter driving transcription. The template was transcribed in vitro. The transcribed RNA was then purified using RNA synthesis kits according to the manufacturer's instructions. Purified with a purification kit (New England Biolabs, T2050) and R NA 5' phosphohydrolase (RppH) (New England Biolabs The RppH-treated DNA was then treated with 1000 kDa (M0356) and purified again using an RNA purification column. The stranded RNA was synthesized by splinting DNA (5'-TTTTTCGGCTATTCCCAATAG CCGTTTTG-3' (SEQ ID NO: 11)) and T4 RNA ligase 2 (New En The circularized R NA was purified by urea-PAGE and purified in buffer (0.5 M sodium acetate, 0.1% S The RNA was eluted in RNA storage solution (Thermoplastic DS, 1 mM EDTA), ethanol precipitated, and stored in RNA storage solution (Thermoplastic DS, 1 mM EDTA). Resuspended in rmoFisher Scientific cat# AM7000 Ta.

[0469] The RNA was then diluted in PBS containing 10% (v / v) isopropyl alcohol. As a result, the total sample volume for each sample was 35 uL. RNA was 20 pmol. As a negative control, a solvent only control was used as above. All reagents were brought to room temperature before mixing, and the mixture was Prepared immediately before use.

[0470] At time point = 0, a 35 μL volume of each sample was delivered to a BALB / c mouse using a pipette tip. The samples were applied topically by dropping onto the ears of subjects. The samples were then placed in a sterile hood and the ears were exposed to infrared light. The mice were dried by briefly exposing them to a fan and then to a 200°C oven. It was returned.

[0471] To determine RNA expression in tissues, tissue samples were collected from NLuc Ear punches were taken from the mice on day 4 after delivery and analyzed for activity. The samples were ground into fragments and lysed in 50 µL of ice-cold NLi containing 1x protease inhibitor cocktail. The samples were then placed in lysis assay buffer and placed ...

Claims

[Claim 1] The invention described in this specification.

Images