Methods for altering genomic sequences which specifically alter nucleobase of targeted DNA sequence, and molecular complex used for the same

Abstract

To provide novel genome editing techniques that modify the nucleobase of a specific sequence of a gene without double-stranded DNA cleavage, or with single-strand cleavage, as well as to provide nucleic acid sequence recognition modules therefor, and to provide complexes of nucleobase converting enzymes.SOLUTION: Provided is a method comprising: contacting a complex, in which a nucleic acid sequence recognition module specifically binding to a target nucleotide sequence in a selected double-stranded DNA and a nucleobase converting enzyme are bound, to the double-stranded DNA; converting or deleting one or more nucleotides at the targeted site to one or more other nucleotides without cutting both strands of the double-stranded DNA at the targeted site; or inserting one or more nucleotides at the targeted site, the nucleic acid sequence recognition module being a CRISPR-Cas system in which both DNA-cleaving abilities of Cas are deactivated.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a method for modifying a genome sequence, which enables modification of nucleic acid bases in specific regions of a genome without causing double-stranded DNA breaks (either without breaks or with single-stranded breaks) and without inserting a foreign DNA fragment, and to a complex of a nucleic acid sequence recognition module and a nucleic acid base conversion enzyme used in the method. [Background technology]

[0002] In recent years, genome editing has been attracting attention as a technique for modifying genes and genome regions of interest in various species. Conventionally, a method using artificial nucleases that combine a molecule with sequence-independent DNA cleavage ability and a molecule with sequence recognition ability has been proposed as a genome editing technique (Non-Patent Document 1). For example, there have been reported a method of using zinc finger nucleases (ZFNs) in which a zinc finger DNA binding domain is linked to a non-specific DNA cleavage domain to perform recombination at a target gene locus in DNA in a host plant cell or insect cell (Patent Document 1), a method of using a transcription activator-like (TAL) effector, which is a DNA binding module possessed by the plant pathogen Xanthomonas genus, linked to a DNA endonuclease, to cleave and modify a target gene at a site within or adjacent to a specific nucleotide sequence (Patent Document 2), and a method of utilizing the CRISPR-Cas9 system in which the DNA sequence CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), which functions in the adaptive immune system possessed by eubacteria and archaea, is combined with the nuclease Cas (CRISPR-associated) protein family, which plays an important role together with CRISPR (Patent Document 3). Furthermore, a method has been reported in which an artificial nuclease is linked to a nuclease and a PPR protein configured to recognize a specific nucleotide sequence through a series of PPR motifs consisting of 35 amino acids and recognizing a single nucleic acid base, and the target gene is cleaved near the specific sequence (Patent Document 4). [Prior art documents] [Patent documents]

[0003] [Patent Document 1] Patent No. 4968498 [Patent Document 2] Special Publication No. 2013-513389 [Patent Document 3] Special Publication No. 2010-519929 [Patent Document 4] JP 2013-128413 A [Non-patent literature]

[0004] [Non-Patent Document 1] Kelvin M Esvelt, Harris H Wang (2013) Genome-scale engineering for systems and synthetic biology, Molecular Systems Biology 9: 641 Summary of the Invention [Problem to be solved by the invention]

[0005] Genome editing techniques proposed so far basically involve DNA double-strand breaks. However, because it involves unexpected genome modification, it has common issues such as side effects such as strong cytotoxicity and chromosomal rearrangements, which undermine its reliability in gene therapy, extremely low numbers of surviving cells due to nucleotide modification, and the difficulty of gene modification itself in primate egg cells and single-celled microorganisms. Therefore, an object of the present invention is to provide a novel genome editing method for modifying a nucleic acid base of a specific sequence of a gene without DSB or insertion of a foreign DNA fragment, i.e., by non-cleavage or single-stranded cleavage of double-stranded DNA, and a complex of a nucleic acid sequence recognition module and a nucleic acid base conversion enzyme for the method. The purpose of this project is to provide [Means for solving the problem]

[0006] The present inventors have made extensive research to solve the above problems, and have come up with the idea of ​​adopting base conversion by DNA base conversion reaction without DSB. Although the base conversion reaction by DNA base deamination reaction itself is already known, it has not yet been realized to target any site by making this recognize a specific sequence of DNA and specifically modify the targeted DNA by base conversion of DNA base. Therefore, we used deaminase, which catalyzes a deamination reaction, as an enzyme that converts such nucleic acid bases, and by linking it to a molecule with DNA sequence recognition ability, we modified the genome sequence by converting the nucleic acid base in a region containing a specific DNA sequence. Specifically, the CRISPR-Cas system (CRISPR-mutant Cas) was used. That is, a DNA was prepared encoding an RNA molecule in which a genome-specific CRISPR-RNA:crRNA (gRNA) containing a sequence complementary to the target sequence of the gene to be modified was linked to an RNA (trans-activatingcrRNA:tracrRNA) for recruiting Cas proteins, and a DNA (dCas) encoding a mutant Cas protein that has lost the ability to cleave either or both strands of double-stranded DNA was linked to a deaminase gene, and these DNAs were introduced into host yeast cells containing the gene to be modified. As a result, we succeeded in randomly introducing mutations within a range of several hundred nucleotides of the target gene containing the target sequence. The efficiency of mutation introduction was higher when a mutant Cas protein that cleaves one of the strands was used than when a double mutant Cas protein that does not cleave either DNA strand of double-stranded DNA was used. It was also revealed that the breadth of the mutation region and the diversity of mutations change depending on which of the DNA double strands is cleaved. Furthermore, by targeting multiple regions in the target gene, we succeeded in introducing mutations very efficiently. That is, the host cells into which DNA was introduced were seeded on a non-selective medium, and the sequence of the target gene was examined for randomly selected colonies, and it was confirmed that mutations were introduced in almost all colonies. In addition, it was confirmed that genome editing at multiple sites can be performed simultaneously by targeting certain regions in two or more target genes. Furthermore, it was demonstrated that the method can simultaneously introduce mutations into alleles of a diploid or higher polyploid genome, and can introduce mutations not only in eukaryotic cells but also in prokaryotic cells such as E. coli, and is widely applicable regardless of biological species. In addition, it was found that essential genes, which have been inefficient until now, can be efficiently edited by transiently performing a nucleic acid base conversion reaction at a desired time. Based on these findings, the present inventors conducted further research and have completed the present invention.

[0007] That is, the present invention is as follows. [1] A method for modifying a targeted site of double-stranded DNA, comprising the steps of contacting a complex comprising a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in a selected double-stranded DNA and a nucleic acid base conversion enzyme, with the double-stranded DNA, and converting or deleting one or more nucleotides at the targeted site to another one or more nucleotides, or inserting one or more nucleotides at the targeted site, without cleaving at least one strand of the double-stranded DNA at the targeted site. [2] The method described in [1] above, wherein the nucleic acid sequence recognition module is selected from the group consisting of a CRISPR-Cas system in which at least one DNA cleavage ability of Cas has been inactivated, a zinc finger motif, a TAL effector, and a PPR motif. [3] The method described in [1] above, wherein the nucleic acid sequence recognition module is a CRISPR-Cas system in which at least one DNA cleavage ability of Cas is inactivated. [4] The method according to any one of [1] to [3] above, characterized in that two or more kinds of nucleic acid sequence recognition modules each specifically bind to a different target nucleotide sequence are used. [5] The method according to [4] above, wherein the different target nucleotide sequences are present in different genes. How to. [6] The method according to any one of [1] to [5] above, wherein the nucleic acid base conversion enzyme is a deaminase. [7] The method according to [6] above, wherein the deaminase is AID (AICDA). [8] The method according to any one of [1] to [7] above, wherein the contact between the double-stranded DNA and the complex is achieved by introducing a nucleic acid encoding the complex into a cell having the double-stranded DNA. [9] The method described in [8] above, wherein the cell is a prokaryotic cell.

[10] The method described in [8] above, wherein the cell is a eukaryotic cell.

[11] The method described in [8] above, wherein the cell is a microbial cell.

[12] The method described in [8] above, wherein the cell is a plant cell.

[13] The method described in [8] above, wherein the cell is an insect cell.

[14] The method described in [8] above, wherein the cell is an animal cell.

[15] The method described in [8] above, wherein the cell is a vertebrate cell.

[16] The method described in [8] above, wherein the cell is a mammalian cell.

[17] The method according to any one of [9] to

[16] above, wherein the cell is a polyploid cell, and the site in all targeted alleles on the homologous chromosome is modified.

[18] The method according to any one of [9] to

[16] above, further comprising the steps of: introducing into the cell an expression vector containing a nucleic acid encoding the complex in a form capable of controlling the expression period; inducing expression of the nucleic acid for a period of time necessary to fix the modification of the targeted site of the double-stranded DNA; The method according to any one of the above [8] to

[17] ,

[19] The method according to

[18] above, characterized in that the target nucleotide sequence in the double-stranded DNA is located within a gene essential for the cell.

[20] A nucleic acid modifying enzyme complex comprising a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in double-stranded DNA and a nucleic acid base conversion enzyme, which converts or deletes one or more nucleotides at a targeted site to one or more other nucleotides, or inserts one or more nucleotides at the targeted site, without cleaving at least one of the strands of the double-stranded DNA at the targeted site.

[21] A nucleic acid encoding the nucleic acid-modifying enzyme complex described in

[20] above. Effect of the Invention

[0008] The genome editing technology of the present invention is safe because it does not involve the insertion of foreign DNA or DNA double-strand breaks, and may provide a solution to cases where conventional methods have been controversial biologically or legally because they involve genetic recombination. In addition, the range of mutation introduction can be theoretically set to a wide range, from a pinpoint of a single base to a range of several hundred bases, and it can also be applied to local evolution induction by random mutation introduction into a specific limited region, which was previously almost impossible. [Brief description of the drawings]

[0009] [Figure 1] FIG. 1 is a schematic diagram showing the mechanism of the gene modification method of the present invention using the CRISPR-Cas system. [Diagram 2] FIG. 1 shows the results of demonstrating the effect of the gene modification method of the present invention, which combines the CRISPR-Cas system and lamprey-derived PmCDA1 deaminase, using budding yeast. [Diagram 3] This figure shows the change in the number of surviving cells after expression induction when using a CRISPR-Cas9 system using the D10A mutant of Cas9 with nickase activity in combination with deaminase and PmCDA1 (nCas9D10A-PmCDA1), and when using a conventional Cas9 with DNA double-strand cleavage ability. [Figure 4] This figure shows the results of introducing an expression construct constructed to bind to dCas9 via the SH3 domain and its binding ligand using human AID deaminase into budding yeast together with two types of gRNA (targeting the target4 and target5 sequences). [Diagram 5] FIG. 1 shows that the efficiency of mutation introduction was increased by using Cas9 that cleaves either single strand of DNA. [Figure 6] FIG. 1 shows that the size and frequency of the mutation-introduced region change depending on whether the double-stranded DNA is not cleaved or whether one of the single strands of the DNA is cleaved. [Figure 7] FIG. 1 shows that extremely high efficiency of mutagenesis can be achieved by targeting two adjacent regions. [Figure 8] 1 shows that the gene modification method of the present invention does not require marker-based selection. Mutations were introduced into all sequenced colonies. [Figure 9]This is a diagram showing that the gene modification method of the present invention enables simultaneous editing of multiple sites in a genome. The upper row shows the nucleotide sequence and amino acid sequence of the target site of each gene, and the arrow above the nucleotide sequence indicates the target nucleotide sequence. The numbers on the arrowhead or arrowhead indicate the position on the ORF of the end of the target nucleotide sequence. The lower row shows the sequencing results of the target site in 5 clones each of red (R) and white (W) colonies. In the sequence, base conversion has occurred at the nucleotides shown in white letters. In addition, in response to canavanine (CanR), R indicates resistance and S indicates sensitivity. [Figure 10] This is a diagram showing that the gene modification method of the present invention can simultaneously introduce mutations into both alleles on homologous chromosomes of a diploid genome. Figure 10A shows the efficiency of homozygous mutation introduction for the ade1 gene (upper panel) and the can1 gene, respectively, and Figure 10B shows that homozygous mutations are actually introduced in red colonies (lower panel). It was also shown that heterozygous mutations occur in white colonies (upper panel). [Figure 11] This figure shows that the gene modification method of the present invention enables genome editing of Escherichia coli, a prokaryotic cell. Figure 11A is a schematic diagram of the plasmid used. Figure 11B shows that a mutation (CAA → TAA) was efficiently introduced by targeting a region in the galK gene. Figure 11C shows the results of sequence analysis of two colonies selected from non-selective medium (none), 25 μg / ml rifampicin (Rif25), and 50 μg / ml rifampicin (Rif50)-containing medium. It was confirmed that a mutation conferring rifampicin resistance had been introduced (upper panel). The frequency of rifampicin-resistant strains was estimated to be about 10% (lower panel). [Figure 12]This is a diagram showing the regulation of the edited base site depending on the length of the guide RNA. FIG. 12A shows a conceptual diagram of the edited base site when the target nucleotide sequence length is 20 bases and 24 bases. FIG. 12B shows the result of editing by varying the target nucleotide sequence length with the gsiA gene as the target. The mutation site is in bold, "T" and "A" indicate that the mutation (C→T or G→A) is completely introduced in the clone, "t" indicates that the mutation (C→T) is introduced at a rate of 50% or more in the clone (not completely cloned), and "c" indicates that the mutation (C→T) in the clone is introduced with an efficiency of less than 50%. [Figure 13] FIG. 1 is a schematic diagram of a temperature-sensitive plasmid for introducing mutations used in Example 11. [Figure 14] FIG. 1 shows the protocol for mutagenesis in Example 11. [Figure 15] FIG. 1 shows the results of introducing a mutation into the rpoB gene in Example 11. [Figure 16] FIG. 1 shows the results of introducing a mutation into the galK gene in Example 11. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0010] The present invention provides a method for modifying a targeted site in a double-stranded DNA by converting a target nucleotide sequence and its neighboring nucleotides in the double-stranded DNA to other nucleotides without cleaving at least one strand of the double-stranded DNA to be modified. The method is characterized by comprising a step of contacting the double-stranded DNA with a complex in which a nucleic acid sequence recognition module that specifically binds to a target nucleotide sequence in the double-stranded DNA is bound to a nucleic acid base conversion enzyme, thereby converting the targeted site, i.e., the target nucleotide sequence and its neighboring nucleotides, to other nucleotides.

[0011] In the present invention, a "modification" of a double-stranded DNA refers to a modification of a certain nucleotide (e.g., dC ) is converted to another nucleotide (e.g., dT, dA, or dG) or deleted, or a nucleotide or nucleotide sequence is inserted between certain nucleotides on a DNA strand. Here, the double-stranded DNA to be modified is not particularly limited, but is preferably genomic DNA. Furthermore, the "targeted site" of the double-stranded DNA means all or a part of the "target nucleotide sequence" that the nucleic acid sequence recognition module specifically recognizes and binds to, or the vicinity of the target nucleotide sequence (either one or both of the 5' upstream and 3' downstream), and the range can be appropriately adjusted between one base and several hundred bases in length depending on the purpose.

[0012] In the present invention, the term "nucleic acid sequence recognition module" refers to a molecule or molecular complex that has the ability to specifically recognize and bind to a specific nucleotide sequence (i.e., a target nucleotide sequence) on a DNA strand. The binding of the nucleic acid sequence recognition module to the target nucleotide sequence enables a nucleic acid base conversion enzyme linked to the module to act specifically on a targeted site in double-stranded DNA.

[0013] In the present invention, the term "nucleobase conversion enzyme" refers to an enzyme that can convert a target nucleotide into another nucleotide without cleaving the DNA chain by catalyzing a reaction that converts a substituent on the purine or pyrimidine ring of a DNA base into another group or atom.

[0014] In the present invention, the term "nucleic acid modifying enzyme complex" refers to a molecular complex having a nucleic acid base conversion enzyme activity to which a specific nucleotide sequence recognition ability is imparted, comprising a complex in which the above-mentioned nucleic acid sequence recognition module and a nucleic acid base conversion enzyme are linked. Here, the "complex" includes not only those composed of multiple molecules, but also those having a nucleic acid sequence recognition module and a nucleic acid base conversion enzyme in a single molecule, such as a fusion protein.

[0015] The nucleic acid base conversion enzyme used in the present invention is not particularly limited as long as it can catalyze the above reaction, and examples thereof include deaminases belonging to the nucleic acid / nucleotide deaminase superfamily that catalyze the deamination reaction that converts an amino group into a carbonyl group. Preferred examples include cytidine deaminase that can convert cytosine or 5-methylcytosine into uracil or thymine, respectively, adenosine deaminase that can convert adenine into hypoxanthine, and guanosine deaminase that can convert guanine into xanthine. More preferred examples of cytidine deaminase include activation-induced cytidine deaminase (hereinafter also referred to as AID), which is an enzyme that introduces a mutation into an immunoglobulin gene in the adaptive immunity of vertebrates.

[0016] The origin of the nucleic acid base conversion enzyme is not particularly limited, and for example, lamprey-derived PmCDA1 (Petromyzon marinus cytosinedeaminase 1) and mammalian (e.g., human, pig, cow, horse, monkey, etc.)-derived AID (Activation-induced cytidine deaminase; AICDA) can be used. The base sequence and amino acid sequence of the CDS of PmCDA1 are shown in SEQ ID NOs: 1 and 2, and the base sequence and amino acid sequence of the CDS of human AID are shown in SEQ ID NOs: 3 and 4, respectively.

[0017] The target nucleotide sequence in double-stranded DNA recognized by the nucleic acid sequence recognition module of the nucleic acid modification enzyme complex of the present invention is not particularly limited as long as the module can specifically bind, and may be any sequence in double-stranded DNA. The length of the target nucleotide sequence is sufficient for the nucleic acid sequence recognition module to specifically bind, and for example, when introducing a mutation into a specific site in a mammalian genome DNA, it is 12 nucleotides or more, preferably 15 nucleotides or more, more preferably 17 nucleotides or more depending on the genome size. The upper limit of the length is not particularly limited, but is preferably 25 nucleotides or less, more preferably 22 nucleotides or less.

[0018] The nucleic acid sequence recognition module of the nucleic acid modifying enzyme complex of the present invention may be, for example, a small number of Cas. In addition to CRISPR-Cas systems in which at least one DNA cleavage ability has been inactivated (CRISPR-mutant Cas), zinc finger motifs, TAL effectors, PPR motifs, etc., fragments that contain a DNA-binding domain of a protein capable of specifically binding to DNA, such as restriction enzymes, transcription factors, and RNA polymerases, and do not have the ability to cleave DNA double strands, etc., may be used, but are not limited to these. Preferable examples include CRISPR-mutant Cas, zinc finger motifs, TAL effectors, and PPR motifs.

[0019] The zinc finger motif is a combination of 3 to 6 different zinc finger units of Cys2His2 type (each finger recognizes about 3 bases), and can recognize a target nucleotide sequence of 9 to 18 bases. The zinc finger motif can be prepared by known methods such as the modular assembly method (NatBiotechnol (2002) 20: 135-141), the OPEN method (Mol Cell (2008) 31: 294-301), the CoDA method (NatMethods (2011) 8: 67-69), and the E. coli one-hybrid method (Nat Biotechnol (2008) 26: 695-701). For details on the preparation of the zinc finger motif, refer to the above-mentioned Patent Document 1.

[0020] TAL effectors have a repeating structure of modules each consisting of about 34 amino acids, and the binding stability and base specificity are determined by the 12th and 13th amino acid residues (called RVD) of each module. Since each module is highly independent, it is possible to prepare a TAL effector specific to a target nucleotide sequence simply by connecting modules. For TAL effectors, methods for preparing TAL effectors using open resources (REAL method (CurrProtocMolBiol (2012) Chapter 12: Unit 12.15), FLASH method (Nat Biotechnol (2012) 30: 460-465), GoldenGate method (Nucleic Acids Res (2011) 39: e82), etc.) have been established, and TAL effectors for target nucleotide sequences can be designed relatively easily. For details on the preparation of TAL effectors, refer to the above-mentioned Patent Document 2.

[0021] The PPR motif is composed of 35 amino acids and recognizes one nucleic acid base. Each motif is configured to recognize a specific nucleotide sequence, and only the 1st, 4th, and ii(-2)th amino acids of each motif recognize the target base. Since there is no dependency on the motif configuration and there is no interference from the motifs on both sides, it is possible to prepare a PPR protein specific to a target nucleotide sequence just by linking PPR motifs together, as with TAL effectors. For details on the preparation of PPR motifs, refer to the above-mentioned Patent Document 4.

[0022] Furthermore, when using fragments of restriction enzymes, transcription factors, RNA polymerases, etc., the DNA-binding domains of these proteins are well known, so fragments that contain the domains and do not have the ability to cleave DNA double strands can be easily designed and constructed.

[0023] Any of the above nucleic acid sequence recognition modules can be provided as a fusion protein with the above nucleic acid base conversion enzyme, or a protein binding domain such as an SH3 domain, a PDZ domain, a GK domain, or a GB domain and its binding partner can be fused to the nucleic acid sequence recognition module and the nucleic acid base conversion enzyme, respectively, and provided as a protein complex via the interaction between the domain and its binding partner. Alternatively, an intein can be fused to each of the nucleic acid sequence recognition module and the nucleic acid base conversion enzyme, and the two can be linked by ligation after the synthesis of each protein.

[0024] Contact between the nucleic acid modifying enzyme complex of the present invention, which comprises a complex (including a fusion protein) in which a nucleic acid sequence recognition module and a nucleic acid base conversion enzyme are bound, and double-stranded DNA may be carried out as an enzymatic reaction in a cell-free system, but in line with the main object of the present invention, it is desirable to carry out the contact by introducing a nucleic acid encoding the complex into a cell having the desired double-stranded DNA (e.g., genomic DNA). Therefore, the nucleic acid sequence recognition module and the nucleic acid base conversion enzyme are fused proteins thereof. Alternatively, it is preferable to prepare the nucleic acid encoding each of them in a form capable of forming a complex in a host cell after translation into a protein using a binding domain, intein, etc. Here, the nucleic acid may be DNA or RNA. In the case of DNA, it is preferably double-stranded DNA, and is provided in the form of an expression vector placed under the control of a functional promoter in the host cell. In the case of RNA, it is preferably single-stranded RNA. The complex of the present invention in which the nucleic acid sequence recognition module and the nucleic acid base conversion enzyme are bound does not cause DNA double strand breaks (DSB), making genome editing with low toxicity possible, and the gene modification method of the present invention can be applied to a wide range of biological materials. Therefore, the cells into which the nucleic acid encoding the nucleic acid sequence recognition module and / or the nucleic acid base conversion enzyme is introduced can include cells of all biological species, from cells of bacteria such as Escherichia coli, which is a prokaryotic organism, and cells of microorganisms such as yeast, which is a lower eukaryotic organism, to cells of higher eukaryotic organisms such as vertebrates, including mammals such as humans, insects, and plants.

[0025] DNA encoding a nucleic acid sequence recognition module such as a zinc finger motif, a TAL effector, or a PPR motif can be obtained by any of the methods described above for each module. DNA encoding a sequence recognition module such as a restriction enzyme, a transcription factor, or an RNA polymerase can be cloned, for example, by synthesizing an oligo DNA primer based on the cDNA sequence information thereof so as to cover a region encoding a desired portion of the protein (a portion including a DNA binding domain), and amplifying the portion by RT-PCR using total RNA or an mRNA fraction prepared from a cell that produces the protein as a template. Similarly, DNA encoding a nucleic acid base conversion enzyme can be cloned by synthesizing an oligo DNA primer based on the cDNA sequence information of the enzyme to be used, and amplifying the DNA by RT-PCR using total RNA or mRNA fraction prepared from cells producing the enzyme as a template. For example, DNA encoding lamprey PmCDA1 can be cloned from lamprey-derived mRNA by RT-PCR, by designing suitable primers for the upstream and downstream of the CDS based on the cDNA sequence (accession No. EF094822) registered in the NCBI database. Furthermore, DNA encoding human AID can be cloned from, for example, human lymph node-derived mRNA by RT-PCR, by designing suitable primers for the upstream and downstream of the CDS based on the cDNA sequence (accession No. AB040431) registered in the NCBI database. The cloned DNA may be used as is, or optionally digested with restriction enzymes or digested with an appropriate After adding a linker and / or a nuclear localization signal (if the double-stranded DNA of interest is mitochondrial or chloroplast DNA, each organelle localization signal) to the DNA encoding the nucleic acid sequence recognition module, the DNA can be ligated to prepare a DNA encoding a fusion protein. Alternatively, the DNA encoding the nucleic acid sequence recognition module and the DNA encoding the nucleic acid base conversion enzyme can be fused to DNA encoding a binding domain or its binding partner, respectively, or both DNAs can be fused to DNA encoding a separate intein, so that the nucleic acid sequence recognition conversion module and the nucleic acid base conversion enzyme can form a complex after translation in the host cell. In these cases, too, a linker and / or a nuclear localization signal can be linked to an appropriate position in one or both DNAs as desired.

[0026] It is also possible to construct DNA encoding the entire length of the DNA encoding the nucleic acid sequence recognition module or the DNA encoding the nucleic acid base conversion enzyme by chemically synthesizing the DNA strand or by connecting synthesized partially overlapping oligo DNA short strands using PCR or Gibson Assembly. The advantage of constructing the entire length of DNA by chemical synthesis or a combination of PCR or Gibson Assembly is that the codons used can be designed over the entire length of the CDS to suit the host into which the DNA is introduced. When expressing heterologous DNA, an increase in the amount of protein expressed can be expected by converting the DNA sequence to a codon that is frequently used in the host organism. Data on the codon usage frequency in the host used can be obtained from, for example, the genetic code usage frequency database published on the website of the Kazusa DNA Research Institute (http: / / www.kazusa.or.jp / codon / index.html), or by referring to literature listing the codon usage frequency in each host. By referring to the available data and the DNA sequence to be introduced, codons used in the DNA sequence that are less frequently used in the host can be converted to codons that code for the same amino acid and are more frequently used.

[0027] An expression vector containing DNA encoding a nucleic acid sequence recognition module and / or a nucleic acid base conversion enzyme can be produced, for example, by ligating the DNA downstream of a promoter in an appropriate expression vector. Examples of expression vectors that can be used include plasmids derived from Escherichia coli (e.g., pBR322, pBR325, pUC12, pUC13); plasmids derived from Bacillus subtilis (e.g., pUB110, pTP5, pC194); yeast-derived plasmids (e.g., pSH19, pSH15); insect cell expression plasmids (e.g., pFast-Bac); animal cell expression plasmids (e.g., pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo); bacteriophages such as λ phage; insect virus vectors such as baculovirus (e.g., BmNPV, AcNPV); and animal virus vectors such as retrovirus, vaccinia virus, and adenovirus. The promoter may be any promoter suitable for the host used for gene expression. In the conventional method involving DSB, the survival rate of the host cell may be significantly reduced due to toxicity, so it is desirable to increase the number of cells before the start of induction using an inducible promoter, but since sufficient cell growth can be obtained even when the nucleic acid modifying enzyme complex of the present invention is expressed, a constitutive promoter can also be used without limitation. For example, when the host is an animal cell, the SRα promoter, SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (Rous sarcoma virus) promoter, MoMuLV (Moloney murine leukemia virus) LTR, HSV-TK (herpes simplex virus thymidine kinase) promoter, etc. are used. Among them, the CMV promoter, SRα promoter, etc. are preferred. When the host is Escherichia coli, the trp promoter, lac promoter, recA promoter, λPL promoter, lpp promoter, T7 promoter, and the like are preferred. When the host is a bacterium of the genus Bacillus, the SPO1 promoter, the SPO2 promoter, the penP promoter, and the like are preferred. When the host is a yeast, the Gal1 / 10 promoter, the PHO5 promoter, the PGK promoter, the GAP promoter, the ADH promoter, and the like are preferred. When the host is an insect cell, the polyhedrin promoter, P10 promoter, etc. are preferred. It is nice. When the host is a plant cell, the CaMV35S promoter, CaMV19S promoter, NOS promoter, A rotor or the like is preferred.

[0028] In addition to the above, expression vectors that contain, if desired, an enhancer, a splicing signal, a terminator, a polyA addition signal, a selection marker such as a drug resistance gene or an auxotrophy complementing gene, a replication origin, etc. can be used.

[0029] RNA encoding a nucleic acid sequence recognition module and / or a nucleic acid base conversion enzyme can be prepared, for example, by using a vector encoding DNA encoding the above-mentioned nucleic acid sequence recognition module and / or nucleic acid base conversion enzyme as a template and transcribing it into mRNA in a known in vitro transcription system.

[0030] By introducing an expression vector containing DNA encoding a nucleic acid sequence recognition module and / or a nucleic acid base conversion enzyme into a host cell and culturing the host cell, a complex of the nucleic acid sequence recognition module and the nucleic acid base conversion enzyme can be expressed within the cell. Examples of hosts that can be used include Escherichia bacteria, Bacillus bacteria, yeast, insect cells, insects, and animal cells. Examples of Escherichia bacteria include Escherichia coli K12·D Examples of strains that can be used include Escherichia coli H1 (Proc. Natl. Acad. Sci. USA, 60, 160 (1968)), Escherichia coli JM103 (Nucleic Acids Research, 9, 309 (1981)), Escherichia coli JA221 (Journal of Molecular Biology, 120, 517 (1978)), Escherichia coli HB101 (Journal of Molecular Biology, 41, 459 (1969)), and Escherichia coli C600 (Genetics, 39, 440 (1954)). Examples of the Bacillus bacteria that can be used include Bacillus subtilis MI114 [Gene, 24, 255 (1983)] and Bacillus subtilis 207-21 [Journal of Biochemistry, 95, 87 (1984)]. Examples of yeast include Saccharomyces cerevisiae AH22 and AH22R. - , NA87-11A, DKD-5D, 20B-12, Schizosaccharomyces pombe NCYC1913, NCYC2036, Pichia pastoris KM71, etc. are used.

[0031] Examples of insect cells that can be used when the virus is AcNPV include Spodoptera frugiperda cells (Sf cells) derived from the larvae of the night thief moth, MG1 cells derived from the midgut of Trichoplusiani, and HighFive cells derived from the eggs of Trichoplusiani. TM For example, insect cells, cells derived from Mamestra brassicae, and cells derived from Estigmena acrea are used. When the virus is BmNPV, the insect cells used are silkworm-derived cell lines (Bombyx moriN cells; BmN cells). For example, Sf cells used are Sf9 cells (ATCC CRL1711), Sf21 cells (In Vivo, 13, 213-217 (1977)). As insects, for example, silkworm larvae, fruit flies, crickets, etc. are used [Nature, 315, 592 (1985)].

[0032] Examples of animal cells that can be used include cell lines such as monkey COS-7 cells, monkey Vero cells, Chinese hamster ovary (CHO) cells, dhfr gene-deficient CHO cells, mouse L cells, mouse AtT-20 cells, mouse myeloma cells, rat GH3 cells, and human FL cells, pluripotent stem cells such as iPS cells and ES cells of humans and other mammals, and primary cultured cells prepared from various tissues. Furthermore, zebrafish embryos, Xenopus oocytes, etc. can also be used.

[0033] As plant cells, suspension culture cells, calli, protoplasts, leaf segments, root segments, etc. prepared from various plants (e.g., grains such as rice, wheat, corn, etc., commercial crops such as tomato, cucumber, eggplant, etc., horticultural plants such as carnation and lisianthus, experimental plants such as tobacco and Arabidopsis thaliana, etc.) can be used.

[0034] Any of the above host cells may be haploid (haploid) or polyploid (e.g., diploid, triploid, tetraploid, etc.). In conventional mutation introduction techniques, in principle, a mutation is introduced only into one homologous chromosome, resulting in a heterogeneous genotype, and the desired trait is not expressed unless the mutation is dominant, and homogenization takes time and effort, resulting in many inconveniences. In contrast, according to the present invention, mutations can be introduced into all alleles on homologous chromosomes in the genome, so that even recessive mutations can be expressed in the same generation (Figure 10), which is extremely useful in that it overcomes the problems of conventional methods.

[0035] Introduction of an expression vector can be carried out according to known methods (e.g., the lysozyme method, the competent method, the PEG method, the CaCl2 co-precipitation method, the electroporation method, the microinjection method, the particle gun method, the lipofection method, the Agrobacterium method, etc.) depending on the type of host. E. coli can be transformed according to the methods described in, for example, Proc. Natl. Acad. Sci. USA, 69, 2110 (1972) or Gene, 17, 107 (1982). Vectors can be introduced into Bacillus bacteria, for example, according to the method described in Molecular & General Genetics, 168, 111 (1979). Yeast can be produced by, for example, the method described in Methods in Enzymology, 194, 182-187 (1991), Proc. Natl. Acad. Sci. The vector can be introduced according to the method described in, for example, USA, 75, 1929 (1978). Vectors can be introduced into insect cells and insects according to the methods described in, for example, Bio / Technology, 6, 47-55 (1988). Vectors can be introduced into animal cells according to the methods described in, for example, Saibo Kogaku Supplement 8, New Saibo Kogaku Jikken Protocol, 263-267 (1995) (published by Shujunsha) and Virology, 52, 456 (1973).

[0036] Cells into which a vector has been introduced can be cultured according to known methods depending on the type of host. For example, when culturing Escherichia coli or Bacillus bacteria, the medium used for the culture is preferably a liquid medium. In addition, the medium preferably contains a carbon source, a nitrogen source, inorganic substances, etc. necessary for the growth of the transformant. Here, examples of carbon sources include glucose, dextrin, soluble starch, sucrose, etc.; examples of nitrogen sources include inorganic or organic substances such as ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean meal, potato extract, etc.; examples of inorganic substances include calcium chloride, sodium dihydrogen phosphate, magnesium chloride, etc. In addition, yeast extract, vitamins, growth promoting factors, etc. may be added to the medium. The pH of the medium is preferably about 5 to about 8. A preferred medium for culturing E. coli is, for example, M9 medium containing glucose and casamino acids [Journal of Experiments in Molecular Genetics, 431-433, Cold Spring Harbor Laboratory, New York 1972]. If necessary, a drug such as 3β-indolylacrylic acid may be added to the medium to allow the promoter to function efficiently. E. coli is usually cultured at about 15 to about 43° C. If necessary, aeration or stirring may be performed. Bacillus bacteria are usually cultured at about 30 to about 40° C. If necessary, aeration or stirring may be performed. Examples of media for culturing yeast include Burkholder's minimal medium [Proc. Natl. Acad. Sci. USA, 77, 4505 (1980)] and SD medium containing 0.5% casamino acids [Proc. Natl. Acad. Sci. USA, 81, 5330 (1984)]. The pH of the medium is preferably about 5 to about 8. The culture is usually carried out at about 20°C to about 35°C. Aeration and stirring may be performed as necessary. As a medium for culturing insect cells or insects, for example, Grace's Insect Medium [Nature, 195, 788 (1962)] with additives such as 10% inactivated bovine serum, etc., is used. The pH of the medium is preferably about 6.2 to about 6.4. The culture is usually carried out at about 27°C. Aeration and stirring may be performed as necessary. Examples of media for culturing animal cells include Minimum Essential Medium (MEM) containing about 5 to about 20% fetal bovine serum [Science, 122, 501 (1952)], Dulbecco's Modified Eagle Medium (DMEM) [Virology, 8, 396 (1959)], RPMI 1640 medium [The Journal of the American Medical Association, 199, 519 (1967)], and 199 medium [Proceeding of the Society for the Biological Medicine, 73, 1 (1950)]. The pH of the medium is preferably about 6 to about 8. The culture is usually performed at about 30°C to about 40°C. Aeration and stirring may be performed as necessary. As a medium for culturing plant cells, MS medium, LS medium, B5 medium, etc. are used. The pH of the medium is preferably about 5 to about 8. The culture is usually carried out at about 20° C. to about 30° C. Aeration and stirring may be performed as necessary. In this manner, a complex of a nucleic acid sequence recognition module and a nucleic acid base conversion enzyme, i.e., a nucleic acid modification enzyme complex, can be expressed in a cell.

[0037] The introduction of RNA encoding a nucleic acid sequence recognition module and / or a nucleic acid base conversion enzyme into a host cell can be carried out by a microinjection method, a lipofection method, or the like. The RNA introduction can be carried out once or repeatedly multiple times (e.g., 2 to 5 times) at appropriate intervals. can.

[0038] From the expression vector or RNA molecule introduced into the cell, a nucleic acid sequence recognition module and a nucleic acid salt are When the complex with the group-converting enzyme is expressed, the nucleic acid sequence recognition module recognizes the target double-stranded DNA (e.g. Specifically recognizes and binds to a target nucleotide sequence in a nucleic acid sequence recognition model (e.g., genomic DNA), The action of the nucleic acid base conversion enzyme linked to the module causes base conversion in the sense or antisense strand of the targeted site (which can be appropriately adjusted within a range of several hundred bases including all or part of the target nucleotide sequence or their vicinity), resulting in a mismatch in the double-stranded DNA (for example, when cytidine deaminase such as PmCDA1 or AID is used as the nucleic acid base conversion enzyme, cytosine on the sense or antisense strand of the targeted site is converted to uracil, resulting in a U:G or G:U mismatch). If this mismatch is not repaired correctly, the base of the opposite strand is repaired to pair with the base of the converted strand (TA or AT in the above example), or further replaced with another nucleotide during repair (for example, U → A, G), or one to several tens of bases are deleted or inserted, resulting in various mutations.

[0039] It is not easy to create a large number of zinc finger motifs that actually function because the efficiency of creating zinc fingers that specifically bind to target nucleotide sequences is not high, and the selection of zinc fingers with high binding specificity is complicated. Effector and PPR motifs have higher autonomy in target nucleic acid sequence recognition than zinc finger motifs. Although this method offers great flexibility, it requires designing and constructing a large protein each time in response to the target nucleotide sequence, which leaves problems in terms of efficiency. In contrast, the CRISPR-Cas system recognizes a target double-stranded DNA sequence using a guide RNA that is complementary to the target nucleotide sequence, so any sequence can be targeted simply by synthesizing an oligo DNA that can specifically hybridize with the target nucleotide sequence. Therefore, in a more preferred embodiment of the present invention, a CRISPR-Cas system in which at least one DNA cleavage ability of Cas is inactivated (CRISPR-mutant Cas) is used as the nucleic acid sequence recognition module.

[0040] FIG. 1 shows a schematic diagram of the double-stranded DNA modification method of the present invention using CRISPR-mutated Cas as a nucleic acid sequence recognition module. The nucleic acid sequence recognition module of the present invention using CRISPR-mutant Cas is provided as a complex of an RNA molecule consisting of a guide RNA complementary to a target nucleotide sequence and a tracrRNA required for recruiting the mutant Cas protein, and the mutant Cas protein.

[0041] The Cas protein used in the present invention is not particularly limited as long as it belongs to the CRISPR system. There is no specific Cas9, but it is preferably Cas9. Examples of Cas9 include, but are not limited to, Cas9 (SpCas9) derived from Streptococcus pyogenes and Cas9 (StCas9) derived from Streptococcus thermophilus. SpCas9 is preferred. As the mutant Cas used in the present invention, either one in which the ability of the Cas protein to cleave both strands of double-stranded DNA is inactivated or one in which the ability to cleave only one strand is inactivated and has nickase activity can be used. For example, in the case of SpCas9, the D10A mutant in which the 10th Asp residue is converted to an Ala residue and lacks the ability to cleave the opposite strand of the strand that forms a complementary strand with the guide RNA, or the H840A mutant in which the 840th His residue is converted to an Ala residue and lacks the ability to cleave the complementary strand with the guide RNA, or even a double mutant thereof can be used, but other mutant Cas can also be used in the same way. The nucleic acid base conversion enzyme is provided as a complex with the mutant Cas by a method similar to the linkage with the zinc finger and the like described above. Alternatively, the nucleic acid base conversion enzyme and the mutant Cas can be linked using an RNA scaffold formed by RNA aptamers such as MS2F6 and PP7 and their binding proteins. The guide RNA forms a complementary strand with the target nucleotide sequence, and the subsequent tra Mutant Cas is recruited to crRNA and recognizes the DNA cleavage site recognition sequence PAM (protospacer adjacent motif) (when SpCas9 is used, PAM is a triplet of NGG (N is any base), and theoretically can be targeted anywhere in the genome), but is unable to cleave one or both DNAs. The action of the nucleic acid base conversion enzyme linked to the mutant Cas causes base conversion at the targeted site (which can be appropriately adjusted within a range of several hundred bases including all or part of the target nucleotide sequence), resulting in a mismatch in the double-stranded DNA. If this mismatch is not repaired correctly, the base of the opposite strand is repaired to pair with the base of the converted strand, or is further converted to another nucleotide during repair, or one to several tens of bases are deleted or inserted, resulting in various mutations (see, for example, Figure 2).

[0042] Even when CRISPR-mutated Cas is used as the nucleic acid sequence recognition module, as in the case of using zinc fingers or the like as the nucleic acid sequence recognition module, it is desirable to introduce the nucleic acid sequence recognition module and the nucleic acid base conversion enzyme in the form of the nucleic acids that encode them into a cell having the desired double-stranded DNA. DNA encoding Cas can be cloned from cells producing the enzyme by the same method as described above for DNA encoding a nucleic acid base conversion enzyme. Mutant Cas can be obtained by introducing a mutation into the cloned DNA encoding Cas using a site-directed mutagenesis method known per se, so that an amino acid residue at a site important for DNA cleavage activity (for example, in the case of Cas9, this includes, but is not limited to, the 10th Asp residue and the 840th His residue) is converted to another amino acid. Alternatively, the DNA encoding the mutant Cas can be constructed as a DNA having a codon usage suitable for expression in the host cell to be used, by chemical synthesis or in combination with PCR or Gibson Assembly, in the same manner as described above for the DNA encoding the nucleic acid sequence recognition module or the DNA encoding the nucleic acid base conversion enzyme. For example, the CDS sequence and amino acid sequence optimized for expression of SpCas9 in eukaryotic cells are shown in SEQ ID NOs: 5 and 6. DNA encoding the D10A mutant can be obtained by converting the "A" at base number 29 in the sequence shown in SEQ ID NO: 5 to "C," and DNA encoding the H840A mutant can be obtained by converting the "CA" at base numbers 2518-2519 to "GC." The DNA encoding the mutant Cas and the DNA encoding the nucleic acid base conversion enzyme may be linked so as to be expressed as a fusion protein, or they may be expressed separately using a binding domain, intein, etc., and designed to form a complex within the host cell via protein-protein interaction or protein ligation. The DNA encoding the obtained mutant Cas and / or nucleic acid base conversion enzyme can be inserted downstream of a promoter of an expression vector similar to that described above, depending on the host. On the other hand, DNA encoding the guide RNA and tracrRNA can be chemically synthesized using a DNA / RNA synthesizer by designing an oligo DNA sequence linking a guide RNA sequence complementary to the target nucleotide sequence with a known tracrRNA sequence (e.g., gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtggtgctttt; SEQ ID NO: 7). The length of the guide RNA sequence is preferably as long as it can specifically bind to the target nucleotide sequence. There is no limitation, but it is, for example, 15 to 30 nucleotides, preferably 18 to 24 nucleotides. DNA encoding the guide RNA and tracrRNA can also be inserted into an expression vector similar to that described above depending on the host. As a promoter, it is preferable to use a pol III promoter (e.g., SNR6, SNR52, SCR1, RPR1, U6, H1 promoter, etc.) and a terminator (e.g., T6 sequence).

[0043] RNA encoding a mutant Cas and / or a nucleic acid base conversion enzyme can be prepared, for example, by using a vector encoding DNA encoding the above-mentioned mutant Cas and / or a nucleic acid base conversion enzyme as a template and transcribing it into mRNA in a known in vitro transcription system. Guide RNA-tracrRNA is designed by linking a sequence complementary to the target nucleotide sequence with a known tracrRNA sequence, and chemically synthesizing it using a DNA / RNA synthesizer. This can be done.

[0044] DNA or RNA encoding mutant Cas and / or nucleic acid base conversion enzyme, guide RNA-tracrRNA or DNA encoding same can be introduced into host cells by methods similar to those described above, depending on the host.

[0045] Conventional artificial nucleases are accompanied by DNA double-strand breaks (DSB), and when they target sequences within the genome, they cause growth inhibition and cell death, which is thought to be due to random chromosomal cleavage (off-target cleavage). This effect is particularly fatal in many microorganisms and prokaryotes, preventing their applicability. In the present invention, mutations are introduced not by DNA cleavage but by a conversion reaction (particularly a deamination reaction) of the substituents on the DNA bases, which makes it possible to significantly reduce toxicity. In fact, as shown in the examples below, in a comparative test using budding yeast as a host, it was found that conventional artificial nucleases had a higher DSB activity than When Cas9, which has a specific function, is used, the number of viable cells decreases upon expression induction, whereas with the technology of the present invention, which combines mutant Cas and a nucleic acid base conversion enzyme, cells continue to grow and survive. We have confirmed that the number of surviving cells is increasing (Figure 3). In the modification of double-stranded DNA of the present invention, the targeted site (the entire target nucleotide sequence) or a portion thereof, can be appropriately adjusted within a range of several hundred bases) However, one of the greatest advantages of the present invention is that it prevents off-target cleavage. Considering that the objective of the present invention is to avoid toxicity caused by the cleavage of a selected organism and that the present invention is applicable to any organism, in a preferred embodiment, the modification of the double-stranded DNA of the present invention is carried out by The double-stranded DNA is not subjected to DNA strand breaks at the targeted site or at any other site.

[0046] In addition, as shown in the examples below, when a Cas with nickase activity capable of cleaving only one strand of double-stranded DNA is used as a mutant Cas (FIG. 5), the efficiency of mutation introduction is increased compared to when a mutant Cas that cannot cleave both strands is used. Therefore, for example, by linking a protein with nickase activity to a nucleic acid sequence recognition module and a nucleic acid base conversion enzyme, and cleaving only a single strand of DNA near the target nucleotide sequence, it is possible to improve the efficiency of mutation introduction while avoiding the strong toxicity of DSB. Furthermore, when the effects of mutant Cas with two types of nickase activity that cleave different strands were compared, in one case, the mutation sites were concentrated near the center of the target nucleotide sequence, while in the other case, various mutations were randomly introduced in a region extending several hundred bases from the target nucleotide sequence (Figure 6). Therefore, by selecting the strand to be cleaved by the nickase, it is possible to introduce pinpoint mutations into a specific nucleotide or nucleotide region, or to randomly introduce various mutations into a relatively wide range, and it can be used according to the purpose. For example, if the former technology is applied to iPS cells for genetic diseases, it is possible to create a cell transplantation therapy with a reduced risk of rejection by repairing mutations in pathogenic genes in iPS cells created from the patient's own cells and then differentiating them into the desired somatic cells.

[0047] In the following Example 7 and onwards, it has been shown that a mutation can be introduced almost pinpoint at a specific nucleotide. In this way, in order to introduce a mutation at a desired nucleotide pinpoint, the target nucleotide sequence may be set so that the positional relationship between the nucleotide to be mutated and the target nucleotide sequence has a certain regularity. For example, when the CRIPR-Cas system is used as the nucleic acid sequence recognition module and AID is used as the nucleic acid base conversion enzyme, the target nucleotide sequence can be designed so that the C (or G of the opposite strand) to be mutated is located 2 to 5 nucleotides from the 5' end of the target nucleotide sequence. As described above, the length of the guide RNA sequence can be appropriately set between 15 to 30 nucleotides, preferably 18 to 24 nucleotides. Since the guide RNA sequence is a sequence complementary to the target nucleotide sequence, the length of the target nucleotide sequence also changes by changing the length of the guide RNA sequence, but the regularity that a mutation is easily introduced into C or G located 2 to 5 nucleotides from the 5' end is maintained regardless of the nucleotide length (Figure 12). Therefore, the target nucleotide By appropriately selecting the length of the sequence (and its complementary strand, the guide RNA), it is possible to shift the site of the base where the mutation can be introduced. This also removes the restriction imposed by the DNA cleavage site recognition sequence PAM (NGG), further increasing the degree of freedom in introducing mutations.

[0048] As will be shown in the Examples below, by preparing sequence recognition modules for multiple adjacent target nucleotide sequences and using them simultaneously, the efficiency of mutagenesis is significantly increased compared to targeting a single nucleotide sequence (Figure 7). This effect is evident even when the two target nucleotide sequences overlap in part, or when they are about 600 bp apart, and mutagenesis can be achieved in the same way. In addition, the target nucleotide sequences are expressed in two ways: when they are in the same direction (the target nucleotide sequences are present on the same strand) (Figure 7), and when they are in opposite directions (the target nucleotide sequences are present on each strand of a double-stranded DNA). This can occur in either case (wherein a nucleotide sequence is present) (Figure 4).

[0049] As shown in the examples below, the method for modifying a genome sequence of the present invention can introduce mutations into almost all cells expressing the nucleic acid modifying enzyme complex of the present invention by selecting an appropriate target nucleotide sequence (Figure 8). Therefore, the insertion and selection of a selection marker gene, which was essential in conventional genome editing, is not necessary. This dramatically simplifies genetic manipulation, and at the same time, since it is no longer a recombinant organism of foreign DNA, it greatly expands the applicability to crop breeding and other fields. In addition, since the efficiency of mutagenesis is extremely high and selection using a marker is not required, the method for modifying a genome sequence of the present invention targets multiple DNA regions at completely different positions. It is possible to modify the nucleic acid sequence by using the nucleic acid sequence recognition module (FIG. 9). Therefore, in a preferred embodiment of the present invention, two or more types of nucleic acid sequence recognition modules can be used, each of which specifically binds to a different target nucleotide sequence (which may be in one target gene or in two or more different target genes. These target genes may be located on the same chromosome or on separate chromosomes). In this case, each of these nucleic acid sequence recognition modules and a nucleic acid base conversion enzyme form a nucleic acid modification enzyme complex. Here, a common nucleic acid base conversion enzyme can be used. For example, when the CRISPR-Cas system is used as the nucleic acid sequence recognition module, a complex of a Cas protein and a nucleic acid base conversion enzyme (a fusion protein) is formed. The guide RNA-tracrRNA can be prepared by preparing two or more chimeric RNAs each consisting of two or more guide RNAs that form complementary strands with different target nucleotide sequences and the tracrRNA. On the other hand, when a zinc finger motif or a TAL effector is used as the nucleic acid sequence recognition module, for example, a nucleic acid base conversion enzyme can be fused to each nucleic acid sequence recognition module that specifically binds to a different target nucleotide.

[0050] In order to express the nucleic acid modifying enzyme complex of the present invention in a host cell, as described above, an expression vector containing DNA encoding the nucleic acid modifying enzyme complex or RNA encoding the nucleic acid modifying enzyme complex is introduced into the host cell. In order to efficiently introduce a mutation, it is desirable to maintain the expression of the nucleic acid modifying enzyme complex at a certain level or higher for a certain period of time. From this perspective, it is certain to introduce an expression vector (plasmid, etc.) capable of autonomous replication in the host cell, but since the plasmid, etc. is a foreign DNA, it is preferable to remove it promptly after successfully achieving mutation introduction. Therefore, although it varies depending on the type of host cell, it is desirable to remove the introduced plasmid from the host cell, for example, 6 hours to 2 days after the introduction of the expression vector, using various plasmid removal methods well known in the art. Alternatively, as long as sufficient expression of the nucleic acid-modifying enzyme complex for introducing a mutation can be obtained, it is also preferable to introduce a mutation into the double-stranded DNA of interest by transient expression using an expression vector that does not have the ability to autonomously replicate in the host cell (e.g., a vector that lacks a replication origin that functions in the host cell and / or a gene that encodes a protein required for replication) or RNA.

[0051] During the nucleic acid base conversion reaction by expressing the nucleic acid modifying enzyme complex of the present invention in a host cell, the expression of the target gene is suppressed, so that the gene essential for the survival of the host cell is not modified by the target gene. It has been difficult to directly edit essential genes (side effects such as impaired growth of the host, destabilization of the efficiency of mutagenesis, and mutations at sites other than the target occur). In the present invention, the nucleic acid-modifying enzyme complex of the present invention is transiently expressed in a host cell for the period required for a nucleic acid base conversion reaction to occur at a desired time and for the modification of the targeted site to be fixed, thereby successfully realizing efficient direct editing of essential genes. The period required for a nucleic acid base conversion reaction to occur and for the modification of the targeted site to be fixed varies depending on the type of host cell and culture conditions, but is generally considered to require 2 to 20 generations. For example, when the host cell is yeast or bacteria (e.g., Escherichia coli), it is necessary to induce the expression of the nucleic acid-modifying enzyme complex for 5 to 10 generations. Those skilled in the art can appropriately determine a suitable expression induction period based on the doubling time of the host cell under the culture conditions used. For example, when budding yeast is liquid cultured in a 0.02% galactose induction medium, an expression induction period of 20 to 40 hours is exemplified. The expression induction period of the nucleic acid encoding the nucleic acid-modifying enzyme complex of the present invention may be extended beyond the above-mentioned "period required for the modification of the targeted site to be fixed" to the extent that no side effects are caused to the host cell. A method for transiently expressing the nucleic acid modifying enzyme complex of the present invention at a desired time for a desired period of time includes a method of preparing a construct (expression vector) containing a nucleic acid encoding the nucleic acid modifying enzyme complex (in the CRISPR-Cas system, a DNA encoding a guide RNA-tracrRNA and a DNA encoding a mutant Cas and a nucleic acid base substitution enzyme) in a form that allows control of the expression period, and introducing the construct into a host cell. Specific examples of the "form that allows control of the expression period" include a nucleic acid encoding the nucleic acid modifying enzyme complex of the present invention under the control of an inducible regulatory region. The "inducible regulatory region" is not particularly limited, and examples thereof include an operon of a temperature-sensitive (ts) mutant repressor and an operator controlled by the same in microbial cells such as bacteria (e.g., E. coli) and yeast. Examples of the ts mutant repressor include, but are not limited to, a ts mutant of the cI repressor derived from λ phage. In the case of the λ phage cI repressor (ts), it binds to the operator at temperatures below 30°C (e.g., 28°C) and suppresses downstream gene expression, but dissociates from the operator at high temperatures above 37°C (e.g., 42°C), inducing gene expression (Figures 13 and 14). Therefore, host cells into which a nucleic acid encoding a nucleic acid modification enzyme complex has been introduced are usually cultured at 30°C or less, and the temperature is raised to 37°C or more at an appropriate time and cultured for a certain period of time to allow the nucleic acid base conversion reaction to occur. After a mutation is introduced into the target gene, the temperature is quickly returned to 30°C or less, thereby minimizing the period during which the expression of the target gene is suppressed, and even when a gene essential to the host cell is targeted, efficient editing can be achieved while suppressing side effects (Figure 15). When temperature-sensitive mutation is used, for example, a temperature-sensitive mutant of a protein necessary for the autonomous replication of a vector is incorporated into a vector containing DNA encoding the nucleic acid modifying enzyme complex of the present invention, and after expression of the nucleic acid modifying enzyme complex, the complex is quickly unable to autonomously replicate, and the vector is naturally dropped off with cell division. Examples of such temperature-sensitive mutant proteins include, but are not limited to, a temperature-sensitive mutant of Rep101ori necessary for the replication of pSC101ori. Rep101ori (ts) acts on pSC101ori to enable autonomous replication of the plasmid at temperatures below 30°C (e.g., 28°C), but loses its function at temperatures above 37°C (e.g., 42°C), and the plasmid cannot autonomously replicate. Therefore, by using it in combination with the cI repressor (ts) of the λ phage, the transient expression of the nucleic acid modifying enzyme complex of the present invention and the removal of the plasmid can be performed simultaneously.

[0052] On the other hand, when higher eukaryotic cells such as animal cells, insect cells, or plant cells are used as host cells, DNA encoding the nucleic acid modified enzyme complex of the present invention is introduced into the host cells under the control of an inducible promoter (e.g., metallothionein promoter (induced by heavy metal ions), heat shock protein promoter (induced by heat shock), Tet-ON / Tet-OFF system promoter (induced by addition or removal of tetracycline or its derivatives), steroid responsive promoter (induced by steroid hormone or its derivatives), etc.), and an inducer is added to the medium (or removed from the medium) at an appropriate time to induce expression of the nucleic acid modified enzyme complex, and the cells are cultured for a certain period of time. Then, a nucleic acid base conversion reaction is carried out, and after a mutation is introduced into the target gene, transient expression of the nucleic acid modifying enzyme complex can be achieved. In addition, inducible promoters can also be used in prokaryotic cells such as E. coli, etc. Examples of such inducible promoters include, but are not limited to, the lac promoter (inducible by IPTG), the cspA promoter (inducible by cold shock), and the araBAD promoter (inducible by arabinose).

[0053] Alternatively, the above-mentioned inducible promoter can be used as a vector removal mechanism when higher eukaryotic cells such as animal cells, insect cells, plant cells, etc. are used as host cells. That is, by equipping a vector with a replication origin that functions in a host cell and a nucleic acid that encodes a protein required for the replication (for example, in the case of animal cells, SV40ori and large T antigen, or oriP and EBNA-1, etc.), and controlling the expression of the nucleic acid that encodes the protein with the above-mentioned inducible promoter, the vector can autonomously replicate in the presence of an inducer, but cannot autonomously replicate when the inducer is removed, and the vector is naturally dropped off with cell division (conversely, in the case of Tet-OFF vectors, autonomous replication is no longer possible with the addition of tetracycline or doxycycline).

[0054] The present invention will be described below with reference to examples, although the present invention is not limited to these examples. EXAMPLES

[0055] In Examples 1 to 6 described below, experiments were carried out as follows. <Cell lines, culture, transformation, expression induction> The budding yeast Saccharomyces cerevisiae BY4741 strain (leucine and uracil auxotrophic) was used and cultured in standard YPDA medium or SD medium with a dropout composition that matches the auxotrophy. Culture was performed at 25°C to 30°C, either by static culture on an agar plate or shaking culture in liquid medium. Transformation was performed using the lithium acetate method, and selection was performed in SD medium that matches the appropriate auxotrophy. For expression induction by galactose, the strain was pre-cultured overnight in the appropriate SD medium, then transferred to SR medium in which the carbon source was changed from 2% glucose to 2% raffinose and cultured overnight, and then transferred to SGal medium in which the carbon source was changed to 0.2-2% galactose and cultured for about 3 hours to two nights to induce expression. To measure the number of viable cells and the Can1 mutation rate, the cell suspension was appropriately diluted and plated on SD plate medium, SD-Arg + 60 mg / l Canavanine plate medium, or SD + 300 mg / l Canavanine plate medium, and the number of colonies that appeared after 3 days was counted as the number of viable cells. The number of viable colonies on the SD plate was taken as the total number of cells, and the number of viable colonies on the Canavanine plate was taken as the number of resistant mutant strains, and the mutation rate was calculated and evaluated. The site of mutation introduction was identified by amplifying DNA fragments containing the target gene region of each strain by colony PCR, followed by DNA sequencing, and performing alignment analysis based on the sequence of the SaccharomycesGenomeDatabase (http: / / www.yeastgenome.org / ).

[0056] <Nucleic acid manipulation> DNA was engineered and constructed by PCR, restriction enzyme digestion, ligation, Gibson Assembly, or artificial chemical synthesis. The plasmids used as yeast-E. coli shuttle vectors pRS315 for leucine selection and pRS426 for uracil selection were used as backbones. Plasmids were amplified in E. coli strains XL-10gold or DH5α and introduced into yeast by the lithium acetate method.

[0057] <Construct> For inducible expression, the budding yeast pGal1 / 10 (SEQ ID NO: 8), a galactose-inducible bidirectional promoter, was used. Downstream of the promoter, the Cas9 gene ORF derived from Streptococcus pyogenes was codon-optimized for eukaryotic expression (SEQ ID NO: 5) with a nuclear localization signal (cccaagaaga ag agg aaggtg; SEQ ID NO: 9 (PKKKRV; encoding SEQ ID NO: 10)) was added to the deaminase gene (lampere Petromyzonmarinus-derived PmCDA1 or human-derived hAID) ORF (SEQ ID NO: 1 or 3) was linked via a linker sequence to express it as a fusion protein. The linker sequence can be a GS linker (ggtggaggaggt tct; SEQ ID NO: 11 (GGGGS; encoding SEQ ID NO: 12) repeat) or a Flag tag (gac tat aag gac cacgacggagac tac aag gat cat gat att gat tac aaa gac gat gac gat aag; SEQ ID NO: 13 (DYKDHDGDYKDHDIDYKDDDDK; encoding SEQ ID NO: 14), Strep-tag (tggagccac ccg cagttc gaa aaa; SEQ ID NO: 15 (WSHPQFEK; encoding SEQ ID NO: 16), and other domains are selected and combined, but in this case, 2xGS, SH3 domains (SEQ ID NO: 17 and 18), and Flagtag are particularly used. As terminators, ADH1 terminator (SEQ ID NO: 19) and Top2 terminator (SEQ ID NO: 20) derived from budding yeast were linked. In the domain linking method, the Cas9 gene ORF was linked to the SH3 domain via a 2xGS linker as one protein, and the deaminase to which the SH3 ligand sequence (SEQ ID NO: 21 and 22) was added was linked to the Gal1 / 10 promoter in both directions as another protein and expressed simultaneously. These were incorporated into the pRS315 plasmid. In Cas9, a mutation that converts the 10th aspartic acid to alanine (D10A, corresponding DNA sequence mutation a29c) and a mutation that converts the 840th histidine to alanine (H840A, corresponding DNA sequence mutation ca2518gc) were introduced to eliminate the ability to cleave one of the DNA strands. The gRNA was placed between the SNR52 promoter (SEQ ID NO: 23) and the Sup4 terminator (SEQ ID NO: 24) as a chimeric structure with tracrRNA (derived from Streptococcus pyogenes; SEQ ID NO: 7) and incorporated into the pRS426 plasmid. The gRNA target base sequence used was 187-206 (gatacgttctctatggagga; SEQ ID NO: 25) (target1), 786-805 (ttggagaaacccaggtgcct; SEQ ID NO: 26) (target3), 793-812 (aacccaggtgcctggggtcc; SEQ ID NO: 27) (target4), 563-582 (ttggccaagtcattcaattt; SEQ ID NO: 28) (target2) and the complementary strand sequence of 767-786 (ataacggaatccaactgggc; SEQ ID NO: 29) (target5r) ​​of the CAN1 gene ORF. When multiple targets were expressed simultaneously, the sequences from the promoter to the terminator were combined into one set and incorporated into the same plasmid. The set was then introduced into cells together with a plasmid for expressing Cas9-deaminase, and expressed intracellularly to form a complex between gRNA-tracrRNA and Cas9-deaminase.

[0058] Example 1 Modification of genome sequence by linking the DNA sequence recognition ability of CRISPR-Cas to deaminase PmCDA1 In order to test the effect of the genome sequence modification technique of the present invention using deaminase and the nucleic acid sequence recognition ability of CRISPR-Cas, we attempted to introduce a mutation into the CAN1 gene, which encodes a canavanine transporter that causes canavanine resistance by gene deletion. A sequence complementary to 187-206 (target1) of the CAN1 gene ORF was used as gRNA, and a chimeric RNA expression vector was linked to Streptococcus pyogenes-derived tracrRNA, and a vector was constructed that expresses a protein in which lamprey-derived PmCDA1 was fused to dCas9, which had lost its nuclease activity by introducing mutations (D10A and H840A) into Streptococcus pyogenes-derived Cas9 (SpCas9), as a deaminase, and introduced it into budding yeast by the lithium acetate method and co-expressed. The results are shown in Figure 2. When cultured on a canavanine-containing SD plate, only cells that had been introduced and expressed with gRNA-tracrRNA and dCas9-PmCDA1 formed colonies. Resistant colonies were picked up and the sequence of the CAN1 gene region was sequenced, confirming that a mutation had been introduced within or near the target nucleotide sequence (target1).

[0059] Example 2 Significant reduction in side effects and toxicity Conventional Cas9 and other artificial nucleases (ZFN, TALEN) target sequences in the genome, leading to growth inhibition and cell death, likely due to random chromosome cleavage, which is particularly lethal in many microorganisms and prokaryotes, hindering their applicability. Therefore, to verify the safety and toxicity of the genome sequence modification technology of the present invention to cells, a comparative experiment was carried out with the conventional CRISPR-Cas9. Using galactose as a target, surviving cells were measured by colony formation ability on SD plates immediately after the start of galactose expression induction and 6 hours after induction. The results are shown in Figure 3. With conventional Cas9, proliferation was inhibited and cell death was induced, resulting in a decrease in the number of surviving cells, whereas with this technology (nCas9D10A-PmCDA1), cells were able to continue proliferating and the number of surviving cells increased significantly.

[0060] Example 3 Use of different binding modes We investigated whether it is possible to introduce mutations into targeted genes by forming a nucleic acid modification enzyme complex via a binding domain and its ligand, rather than by using Cas9 and deaminase as a fusion protein. As Cas9, dCas9 used in Example 1 was used, and as deaminase, human AID was used instead of PmCDA1. The former was fused with an SH3 domain, and the latter with its binding ligand to prepare various constructs shown in FIG. 4. In addition, the sequence in the CAN1 gene (target4,5r) was used as a gRNA target. These constructs were introduced into budding yeast. As a result, even when dCas9 and deaminase were bound via a binding domain, mutations were efficiently introduced into the targeted site of the CAN1 gene (FIG. 4). By introducing multiple binding domains into dCas9, the efficiency of mutation introduction was significantly improved. The main mutation introduction site was the 782nd position (g782c) of the ORF.

[0061] Example 4: High efficiency and change in mutation pattern by using Nickase Instead of dCas9, D10A mutant nCas9 (D10A), which cuts only the strand complementary to gRNA, or H840A mutant nCas9 (H840A), which cuts only the strand opposite to the strand complementary to gRNA, was used. Mutations were introduced into the CAN1 gene in the same manner as in Example 1, and the sequence of the CAN1 gene region of the colonies that appeared on the canavanine-containing SD plate was examined. It was found that the former (nCas9 (D10A)) had a higher efficiency than dCas9 (Figure 5) and that the mutations were concentrated in the center of the target sequence (Figure 6). Therefore, this method enables pinpoint mutation introduction. On the other hand, it was found that the latter (nCas9 (H840A)) had a higher efficiency than dCas9 (Figure 5) and that multiple random mutations were introduced in a region spanning several hundred bases from the targeted nucleotide (Figure 6). Even if the target nucleotide sequence is changed, it has been confirmed that the introduction of a significant mutation is similarly achieved. However, in this genome editing system using the CRISPR-Cas9 system and cytidine deaminase, as shown in Table 1, it has been confirmed that cytosines present within a range of about 2 to 5 bp from the 5' side of the target nucleotide sequence (20 bp) are preferentially deaminated. Therefore, by setting the target nucleotide sequence based on this regularity and further combining it with nCas9 (D10A), precise genome editing in units of one nucleotide is possible. On the other hand, by using nCas9 (H840A), multiple mutations can be simultaneously inserted within a range of about several hundred bp near the target nucleotide sequence. Furthermore, by changing the binding mode of the deaminase, it is possible to further change the site specificity. These results indicate that different types of Cas9 proteins can be used depending on the purpose.

[0062] [Table 1]

[0063] Example 5 Targeting multiple adjacent DNA sequences synergistically increases efficiency Using multiple targets in close proximity at the same time is much more effective than using a single target The level of canavanine increased (Figure 7). Indeed, 10-20% of the cells had canavanine-resistant mutations (target 3, 4). In the figure, gRNA1 and gRNA2 target target 3 and target 4, respectively. PmCDA1 was used as the deaminase. It was confirmed that this effect occurred not only when the sequences overlapped (target 3, 4), but also when they were approximately 600 bp apart (target 1, 3). It also occurred when the DNA sequences were in the same direction (target 3, 4) and when they were in opposing directions (target 4, 5) (Figure 4).

[0064] Example 6 Genetic modification without the need for a selection marker In Example 5, for cells (Target 3, 4) targeted to target 3 and target 4, 10 colonies were randomly selected from those grown on a non-selective (canavanine-free) plate (SD plate not containing Leu and Ura) and the sequence of the CAN1 gene region was sequenced. As a result, mutations were introduced into the targeted site of the CAN1 gene in all colonies examined (Figure 8). In other words, according to the present invention, if an appropriate target sequence is selected, editing can be expected in almost all expressed cells. Therefore, the insertion and selection of marker genes, which were essential in conventional genetic manipulation, is not necessary. This dramatically simplifies genetic manipulation, and at the same time, since it is no longer a recombinant organism of foreign DNA, its applicability to crop breeding and the like is greatly expanded.

[0065] In the following examples, the experimental procedures common to Examples 1 to 6 were carried out in the same manner as described above.

[0066] Example 7 Simultaneous editing of multiple sites (separate genes) In conventional gene manipulation techniques, due to various constraints, only one mutation can be obtained per manipulation. Therefore, we tested whether the method of the present invention allows mutation manipulation at multiple sites simultaneously. The 3-22 positions of the Ade1 gene ORF of the budding yeast strain BY4741 were used as the first target nucleotide sequence (Ade1 target5: GTCAATTACGAAGACTGAAC; SEQ ID NO: 30), and the 767-786 positions (complementary strand) of the Can1 gene ORF were used as the second target nucleotide sequence (Can1 target8 (786-767; ATAACGGAATCCAACTGGGC; Both DNAs encoding chimeric RNAs of two types of gRNAs and tracrRNA (SEQ ID NO: 7), each containing a nucleotide sequence complementary to these, were placed on the same plasmid (pRS426), and were introduced into the BY4741 strain together with the plasmid nCas9D10A-PmCDA1, which contains a nucleic acid encoding a fusion protein of mutant Cas9 and PmCDA1, and expressed to verify the introduction of mutations into both genes. Cells were cultured on SD dropout medium (uracil and leucine deficient; SD-UL) that retains the plasmid. The cells were appropriately diluted and plated on SD-UL and canavaine-supplemented medium to form colonies. Colonies were observed after 2 days of culture at 28 ° C, and the incidence of red colonies due to ade1 mutation and the survival rate in canavanine medium were counted. The results are shown in Table 2.

[0067] [Table 2]

[0068] In terms of phenotype, the proportion of mice with mutations in both the Ade1 and Can1 genes was high, at approximately 31%. Next, colonies on SD-UL medium were amplified by PCR and sequenced. Regions including the ORFs of Ade1 and Can1 were amplified, and sequence information for approximately 500b of the sequence around the target sequence was obtained. Specifically, five red colonies and five white colonies were analyzed, and the fifth C in the Ade1 gene ORF was converted to G in all red colonies, and the fifth C in all white colonies was converted to T (Figure 9). Although the mutation rate of the target was 100%, the aim of gene disruption was to obtain sequence information for approximately 500b around the target sequence. The desired mutation rate in the ORF was 50%, because the 5th C had to be changed to G to become a stop codon. Similarly, for the Can1 gene, a mutation was confirmed at G at position 782 of the ORF in all clones (Figure 9), but only the mutation to C confers canavanine resistance, so the desired mutation rate is 70%. For both genes, 40% (4 out of 10 clones) of the clones examined simultaneously had the desired mutations, indicating a high practical efficiency.

[0069] Example 8 Editing polyploid genomes Many organisms have genome ploidy of diploid or higher, but in conventional methods of mutagenesis, a mutation is introduced in only one homologous chromosome in principle, resulting in a heterozygous genotype, and unless the mutation is dominant, the desired trait cannot be obtained, and it takes time and effort to homogenize. Therefore, we tested whether the technology of the present invention can introduce mutations into all target alleles on homologous chromosomes in the genome. In this study, we simultaneously edited the Ade1 and Can1 genes in the diploid strain of Saccharomyces cerevisiae YPH501. Because the phenotypes of these gene mutations (red colonies and canavanine resistance) are recessive, these phenotypes do not appear unless both mutations in the homologous genes (homozygous mutations) are introduced. The first target nucleotide sequence was the 1173-1154 position (complementary strand) of the Ade1 gene ORF (Ade1 target1: GTCAATAGGATCCCCTTTT; SEQ ID NO: 31) or the 3-22 position (Ade1 target5: GTCAATTACGAAGACTGAAC; SEQ ID NO: 30) and the second target nucleotide sequence was the 767-786 position (complementary strand) of the Can1 gene ORF (Can1 target8: ATAACGGAATCCAACTGGGC; SEQ ID NO: 29). Both DNAs encoding chimeric RNAs of two types of gRNAs and tracrRNA (SEQ ID NO: 7) containing nucleotide sequences complementary to these were placed on the same plasmid (pRS426), and were introduced into the BY4741 strain and expressed together with the plasmid nCas9D10A-PmCDA1 containing a nucleic acid encoding a fusion protein of mutant Cas9 and PmCDA1, to verify the introduction of mutations into each gene. Colony counting revealed that each phenotypic trait could be obtained with a high probability (40% to 70%) (Figure 10A). Furthermore, to confirm the mutation, the Ade1 target region of each of the white and red colonies was sequenced, and overlapping sequence signals indicating a heterozygous mutation at the target site were confirmed in the white colonies (upper panel of Figure 10B, overlapping G and T signals at ↓). It was confirmed that no phenotype was observed because it was a heterozygous mutation. On the other hand, it was confirmed that the red colonies were homozygous mutations with no overlapping signals (lower panel of Figure 10B, T signal at ↓).

[0070] Example 9 Genome editing in E. coli In this example, we demonstrate that this technology works effectively in Escherichia coli, a representative model organism of bacteria. In particular, the superiority of this technology is emphasized, since conventional nuclease-based genome editing technology is lethal and difficult to apply to bacteria. In addition, in combination with yeast, a model cell of eukaryotes, it is shown that this technology can be widely applied to all biological species, regardless of whether they are prokaryotic or eukaryotic. A construct was constructed in which the amino acid mutations D10A and H840A were introduced into the Streptococcus pyogenes Cas9 gene containing a bidirectional promoter region (dCas9), and the gene was expressed as a fusion protein with PmCDA1 via a linker sequence. A plasmid was also constructed containing a chimeric gRNA encoding a sequence complementary to each target nucleotide sequence (the full-length nucleotide sequence is shown in SEQ ID NO: 32). 20 We created a vector containing a sequence complementary to each target sequence (Figure 11A). First, various E. coli strains (XL10-gold, DH5a, MG1655, BW25113) were transformed with a plasmid containing the 426-445th position (T CAA TGG GCT AAC TAC GTT C; SEQ ID NO: 33) of the E. coli galK gene ORF as the target nucleotide sequence, using the calcium method or electroporation method. After overnight recovery culture with the addition of SOC medium, plasmid-containing cells were selected and allowed to form colonies in LB medium containing ampicillin. The transformed cells were identified by direct sequencing from colony PCR. The heterologous introduction was verified, and the results are shown in Figure 11B. Independent colonies (1 to 3) were randomly selected and sequenced, with more than 60% probability of It was confirmed that C at position 427 of the ORF was converted to T at the same rate (clones 2 and 3), resulting in gene disruption that generates a stop codon (TAA).

[0071] Next, we attempted to confer rifampicin resistance to E. coli by introducing specific point mutations into the complementary sequence (5'-GGTCCATAAACTGAGACAGC-3'; SEQ ID NO: 34) of the 1530-1549 nucleotide region of the ORF of the essential gene rpoB using the same method as above. As a result of sequencing of colonies selected on non-selective medium (none), 25 μg / ml rifampicin (Rif25), and 50 μg / ml rifampicin (Rif50)-containing medium, it was confirmed that the amino acid mutation Asp (GAC) to Asn (AAC) was introduced by converting G at position 1546 of the ORF to A, thereby conferring rifampicin resistance (Fig. 11C, upper panel). Ten-fold serial dilutions of the transformed cell suspension were spotted and cultured on nonselective medium (none), medium containing 25 μg / ml rifampicin (Rif25), and medium containing 50 μg / ml rifampicin (Rif50). As a result, it was estimated that rifampicin-resistant strains were obtained at a frequency of approximately 10% (Fig. 11C, lower panel). In this way, this technology can add new functions by specific point mutations, rather than simply disrupting genes. This technology also shows its superiority in that it directly edits essential genes.

[0072] Example 10: Adjustment of edited base position by gRNA length Conventionally, the gRNA length for the target nucleotide sequence was set to 20b as a base, and the mutation target was a cytosine (or a guanine on the opposite strand) located 2-5b from the 5' end (15-19b upstream of the PAM sequence). We investigated whether the position of the target base could be shifted by expressing a gRNA with a different length (Figure 12A). An example of an experiment conducted with E. coli is shown in Figure 12B. A site on the E. coli genome where many cytosines are lined up was searched for, and an experiment was conducted using the gsiA gene, a putative ABC-transporter. When the target length was changed to 24bp, 22bp, 20bp, and 18bp and the replaced cytosines were examined, it was found that in the case of 20bp (standard length), the 898th and 899th cytosines were replaced with thymine. When the target site was longer than 20bp, the 896th and 897th cytosines were also replaced, and when the target site was shorter, the 900th and 901st cytosines could also be replaced. It was found that it became possible to actually move the target site by changing the length of the gRNA.

[0073] Example 11 Development of temperature-dependent genome editing plasmid We designed a plasmid that induces the expression of the nucleic acid modifying enzyme complex of the present invention under high temperature conditions. By limiting and controlling the expression state, we aimed to optimize efficiency while reducing side effects (host growth disorder, destabilization of mutation introduction efficiency, mutation at a site other than the target). At the same time, we also aimed to simultaneously and easily remove the plasmid after editing by incorporating a mechanism to stop plasmid replication at high temperatures. The details of the experiment are shown below. Temperature-sensitive plasmid pSC101-Rep101 system (the sequence of pSC101 ori is shown in SEQ ID NO: 35, temperature-sensitive The backbone of the gene was the temperature-sensitive Rep101 (the sequence of which is shown in SEQ ID NO: 36), and the temperature-sensitive λ repressor (cI857) system was used for expression induction. For genome editing, the λ repressor was mutated with G113E, which makes it resistant to RecA, so that it could function normally even under the SOS response (SEQ ID NO: 37). dCas9-PmCDA1 (SEQ ID NO: 38) was connected downstream of RightOperator (SEQ ID NO: 39), and gRNA (SEQ ID NO: 40) was connected downstream of LeftOperator (SEQ ID NO: 41) to control expression (the entire nucleotide sequence of the constructed expression vector is shown in SEQ ID NO: 42). During culture at 30°C or lower, transcription and expression of gRNA and dCas9-PmCDA1 are suppressed, so that the cells can grow normally. When cultured at 37°C or higher, gRNA transcription and dCas9-PmCDA1 expression are induced, while at the same time plasmid replication is suppressed, so that the nucleic acid modification enzyme complex necessary for genome editing is transiently supplied, and the plasmid can be easily removed after editing (Figure 13).

[0074] A specific protocol for base substitution is shown in FIG. The incubation temperature for plasmid construction is set to around 28°C, and first, E. coli colonies carrying the desired plasmid are established. Next, the colonies are used as is, or if the strain is changed, the plasmid is extracted and then transformed again into the desired strain, and the resulting colonies are used for liquid culture at 28°C overnight. After that, the mixture is diluted with medium and induced culture is performed at 42°C for about one hour to overnight, and the cell suspension is appropriately diluted and spread or spotted on a plate to obtain single colonies.

[0075] As a proof-of-concept experiment, we introduced a point mutation into the essential gene rpoB. rpoB, one of the components of RNA polymerase, is lethal to E. coli if it is deleted or loses function. On the other hand, it is known that point mutations at specific sites can confer resistance to the antibiotic rifampicin (Rif). Therefore, we selected a target site for the introduction of such a point mutation and performed an assay. The results are shown in Figure 15. The left panel in the upper left corner is an LB (chloramphenicol-added) plate, and the right panel is an LB (chloramphenicol-added) plate with rifampicin added. Samples were prepared with and without chloramphenicol when cultured at 28°C and 42°C. When cultured at 28°C, the rate of Rif resistance was low, but when cultured at 42°C, rifampicin resistance was obtained with extremely high efficiency. As a result of sequencing eight colonies (non-selected) actually obtained on LB, it was found that the 1546th guanine (G) was replaced with adenine (A) in more than 60% of the strains cultured at 42°C (lower left and upper right panels). The actual sequence spectrum (lower right panel) also shows that the base has been completely replaced.

[0076] Similarly, we performed base substitutions in galK, one of the factors involved in galactose metabolism. Since E. coli becomes lethal when galK metabolizes 2-deoxy-galactose (2DOG), an analog of galactose, we used this as a selection method. The target sites were set so that target8 induces a missense mutation, and target 12 inserts a stop codon (Figure 16, bottom right). The results are shown in Figure 16. In the upper and lower left panels, the left is an LB (chloramphenicol-added) plate, and the right is an LB (chloramphenicol-added) plate with 2-DOG added, with and without chloramphenicol samples prepared during incubation at 28°C and 42°C. For target8, only a few colonies grew on the 2-DOG-added plate (upper left panel), but when three colonies (red frame) on LB were sequenced, the 61st cytosine (C) was replaced with thymine (T) in all colonies (upper right). It is presumed that this mutation does not lead to a loss of function of galK. On the other hand, for target12, colonies were obtained on the 2-DOG-added plate both when incubated at 28°C and 42°C (lower left panel). When three colonies on LB were sequenced, the 271st cytosine was replaced with thymine in all colonies (lower right). This demonstrates that mutations can be introduced more stably and efficiently even with different targets.

[0077] The contents of all publications, including patents and patent applications, mentioned herein are hereby incorporated by reference to the same extent as if fully set forth.

[0078] This application is based on Japanese Patent Applications No. 2014-43348 and No. 2014-201859, filed in Japan on March 5, 2014 and September 30, 2014, respectively, the contents of which are incorporated in their entirety herein by reference. [Industrial Applicability]

[0079] The present invention makes it possible to safely introduce site-specific mutations into any organism without inserting foreign DNA or causing DNA double-strand breaks. It is possible to set a wide range of length, from 10 to several hundred bases, and it is extremely useful because it can also be applied to localized evolutionary induction by randomly introducing mutations into specific, limited regions, which was previously almost impossible.

Claims

[Claim 1] The invention described in the examples.

Images