Methods for preparation of polynucleotide with multivalent cation salt composition

Abstract

To provide methods for the preparation of a polynucleotide with a multivalent cation salt composition.SOLUTION: Aspects of the disclosure include methods for the preparation of a polynucleotide. In some embodiments, the method includes: contacting a first polynucleotide composition including a polynucleotide that has a sequence of 7 or more nucleoside subunits and in which at least two of the nucleoside subunits are joined by a N3'→P5' thiophosphoramidate inter-subunit linkage, and including non-target synthetic products and reagents, with a multivalent cation salt, to precipitate a polynucleotide salt including at least one multivalent cation counterion; and separating the polynucleotide salt from the contacted first polynucleotide composition to produce a second polynucleotide composition including the polynucleotide salt.SELECTED DRAWING: Figure 2

Description

[Technical field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS Pursuant to 35 U.S.C. §119(e), this application claims priority to the filing date of U.S. Provisional Application No. 62 / 151,891, filed April 23, 2015, the disclosure of which is incorporated herein by reference. [Background technology]

[0002] Introduction Nucleic acid polymer chemistry is one of the many developing technologies in the pharmaceutical, diagnostic and analytical fields, more specifically in the subfields of antisense and antigene therapy, combinatorial chemistry, branched DNA signal amplification, and array-based DNA diagnostics and analysis. Part of this polymer chemistry is directed to improving the binding strength, specificity, and nuclease resistance of natural nucleic acid polymers, such as DNA. Peptide nucleic acid (PNA), phosphorothioate, methylphosphonate, and phosphoramidate internucleoside linkages are examples of some polymer chemistries that have been applied to polynucleotides to impart one or more desirable properties, such as nuclease resistance, cellular uptake, and solubility.

[0003] Polynucleotide N3'→P5' phosphoramidates can form stable duplexes with complementary DNA and RNA, and even triplexes with DNA duplexes, and are resistant to nucleases. Polynucleotide N3'→P5' thiophosphoramidates have found use as potent antisense agents both in vitro and in vivo. Because cancer cells express telomerase activity and normal human somatic cells do not have biologically meaningful levels of telomerase activity, polynucleotides containing compounds that inhibit telomerase activity can be used to treat telomerase-mediated disorders, such as cancer. Therefore, methods for preparing and isolating such polynucleotides are of great interest. Summary of the Invention [Means for solving the problem]

[0004] Aspects of the present disclosure include a method for preparing a polynucleotide. In some embodiments, the method includes contacting a first polynucleotide composition comprising a polynucleotide having a sequence of seven or more nucleoside subunits, at least two of the nucleoside subunits being linked by an N3'→P5' thiophosphoramidate intersubunit linkage; and non-target synthesis products and reagents with a polyvalent cation salt to precipitate a first polynucleotide salt comprising at least one polyvalent cation counterion; and separating the polynucleotide salt from the contacted first polynucleotide composition to produce a second polynucleotide composition comprising the first polynucleotide salt. In some embodiments, the method further includes contacting the first polynucleotide salt with a reversed-phase chromatography support; and eluting a third polynucleotide composition comprising the second polynucleotide salt from the chromatography support. Also provided are compositions comprising a salt of a polynucleotide comprising at least one polyvalent cation counterion. In some embodiments, the at least one polyvalent cation counterion is selected from the group consisting of magnesium, zinc, aluminum, and calcium.

[0005] Those skilled in the art will appreciate that the following drawings are for illustrative purposes only and are not intended to limit the scope of the present teachings in any way. In an embodiment of the present invention, for example, the following items are provided: (Item 1) a polynucleotide having a sequence of seven or more nucleoside subunits, at least two of said nucleoside subunits being linked by an N3'→P5' thiophosphoramidate intersubunit linkage; and non-targeted synthesis products and reagents; contacting a first polynucleotide composition comprising the polyvalent cation salt with a polyvalent cation salt to precipitate a first polynucleotide salt comprising at least one polyvalent cation counterion; and separating said first polynucleotide salt from said contacted first polynucleotide composition to produce a second polynucleotide composition comprising said first polynucleotide salt; A method for preparing a polynucleotide comprising: (Item 2) contacting said first polynucleotide salt with a reverse phase chromatography support; and eluting a third polynucleotide composition comprising the second polynucleotide salt from the chromatographic support; The method of claim 1, further comprising: (Item 3) 3. The method according to any one of items 1 to 2, wherein the polynucleotide comprises a sequence comprising 13 or more nucleoside subunits complementary to an RNA component of human telomerase. (Item 4) 4. The method according to any one of items 1 to 3, wherein the polynucleotide comprises 10 to 50 consecutive nucleoside subunits complementary to an RNA component of human telomerase. (Item 5) 5. The method according to any one of items 3 to 4, wherein the nucleoside subunits complementary to the RNA component of human telomerase are all linked by N3'→P5' thiophosphoramidate intersubunit linkages. (Item 6) 6. The method according to any one of items 1 to 5, wherein the polynucleotide comprises a sequence selected from the group consisting of GTTAGGGTTAG (SEQ ID NO: 4), TAGGGTTAGACAA (SEQ ID NO: 3) and CAGTTAGGGTTAG (SEQ ID NO: 5). (Item 7) 7. The method according to any one of items 1 to 6, wherein the polynucleotide is linked to a lipid moiety via an optional linker. (Item 8) the second polynucleotide salt having the structure: [ka] In the formula, each M x+is independently hydrogen or a cationic counterion, each x is independently 1, 2 or 3, and n is an integer from 5 to 13. (Item 9) 9. The method according to any one of items 2 to 8, wherein the second polynucleotide salt is a pharma- ceutically acceptable salt of the polynucleotide. (Item 10) 10. The method according to any one of items 2 to 9, wherein the second polynucleotide salt is a monovalent cation salt of the polynucleotide. (Item 11) 11. The method according to any one of items 2 to 10, wherein the second polynucleotide salt is a sodium salt of the polynucleotide. (Item 12) 6. The method of any one of items 1 to 5, further comprising cleaving the polynucleotides from the support to produce the first polynucleotide composition. (Item 13) 13. The method of any one of items 1 to 12, wherein the first composition comprises a monovalent cation salt of the polynucleotide. (Item 14) 14. The method of any one of items 1 to 13, wherein the contacting step comprises eluting the first polynucleotide composition from a cation exchange support. (Item 15) 15. The method of any one of items 1 to 14, wherein the separating step comprises centrifuging the contacted first polynucleotide composition to spin down the polynucleotide salt precipitate. (Item 16) 16. The method of any one of items 1 to 15, wherein the separating step comprises filtering the polynucleotide salts from the contacted first polynucleotide composition. (Item 17) 3. The method of claim 2, wherein the second polynucleotide composition is loaded directly onto the reverse phase chromatography support. (Item 18) 18. The method according to any one of items 1 to 17, further comprising dissolving the second polynucleotide composition in a solvent. (Item 19) 19. The method according to any one of items 1 to 18, wherein the at least one multivalent cation counterion is divalent. (Item 20) 20. The method of claim 19, wherein the at least one multivalent cation counterion is selected from the group consisting of magnesium, zinc, and calcium. (Item 21) 19. The method according to any one of items 1 to 18, wherein the at least one multivalent cation counterion is trivalent. (Item 22) 22. The method of claim 21, wherein the at least one multivalent cation counterion is aluminum. (Item 23) 23. The method according to any one of items 1 to 22, wherein the polynucleotide salt further comprises a monovalent cation counterion. (Item 24) Salts of polynucleotides containing at least one multivalent cationic counterion wherein the polynucleotide has a sequence of seven or more nucleoside subunits complementary to an RNA component of human telomerase, and at least two of the nucleoside subunits are linked by an N3'→P5' thiophosphoramidate intersubunit linkage. (Item 25) 26. The composition of claim 24, wherein the at least one multivalent cation counterion is divalent. 26. The composition of claim 25, wherein the at least one multivalent cation counterion is selected from the group consisting of magnesium, zinc and calcium. (Item 27) 27. The composition according to any one of items 24 to 26, wherein the at least one multivalent cation counterion is magnesium. (Item 28) 29. The composition of claim 24, wherein the at least one multivalent cation counterion is trivalent. 29. The composition of claim 28, wherein the at least one multivalent cation counterion is aluminum. (Item 30) 30. The composition according to any one of items 24 to 29, wherein the polynucleotide comprises 3 mol % or more of the polyvalent cation counterion relative to the polyanionic backbone of the polynucleotide. (Item 31) 30. The composition according to any one of items 24 to 29, wherein the polynucleotide comprises 1.0% by weight or more of the polyvalent cation counterion relative to the polynucleotide. (Item 32) 32. The composition according to any one of items 24 to 31, wherein the composition is a precipitate. (Item 33) 33. The composition of any one of items 24 to 32, wherein the polynucleotide comprises a sequence comprising 13 or more nucleoside subunits complementary to an RNA component of human telomerase. (Item 34) 34. The composition according to any one of items 24 to 33, wherein the polynucleotide comprises 10 to 50 consecutive nucleoside subunits complementary to the RNA component of human telomerase. (Item 35) 35. The composition according to any one of items 24 to 34, wherein the nucleoside subunits complementary to the RNA component of human telomerase are all linked by N3'→P5' thiophosphoramidate intersubunit linkages. (Item 36) 36. The composition according to any one of items 24 to 35, wherein the polynucleotide comprises a sequence selected from the group consisting of GTTAGGGTTAG (SEQ ID NO: 4), TAGGGTTAGACAA (SEQ ID NO: 3) and CAGTTAGGGTTAG (SEQ ID NO: 5). (Item 37) 37. The composition of any one of items 24 to 36, wherein the polynucleotide is linked to a lipid moiety via an optional linker. (Item 38) The polynucleotide has the structure: [ka] In the formula, each M x+ is independently a cationic counterion, each x is 1, 2 or 3, and n is 5 to 12. [Brief description of the drawings]

[0006] [Figure 1] HPLC chromatograms of Imetelstat-Mg in 1 M NaCl solutions at various pH values ​​are shown. [Diagram 2] 4 shows the results of elemental analysis of imetelstat sodium treated with various salts. [Diagram 3] 4 shows the results of elemental analysis of sodium imetelstat treated with increasing equivalents of magnesium chloride salt. [Figure 4] 1 shows the results of elemental analysis of Imetelstat TEA treated with increasing equivalents of magnesium chloride salt. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0007] definition Before describing exemplary embodiments in more detail, the following definitions are set forth to illustrate and define the meaning and scope of terms used herein.

[0008] The following terms have the following meanings unless otherwise specified: Any undefined terms have their art-recognized meaning.

[0009] As used herein, the terms polynucleotide and oligonucleotide are used interchangeably and refer to a compound containing multiple nucleoside moiety subunits or nucleoside residues linked by internucleoside bonds or linkages. Whenever a polynucleotide is represented by a sequence of letters, such as "ATGUCCTG," it is understood that the nucleotides are in 5' to 3' order from left to right, and "A" represents deoxyadenosine, "C" represents deoxycytidine, "G" represents deoxyguanosine, "T" represents thymidine, and "U" represents deoxyuridine, unless otherwise noted.

[0010] As used herein, "nucleoside" includes naturally occurring nucleosides, including 2'-deoxy and 2'-hydroxyl forms, e.g., as described in Kornberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992). "Analogs" with respect to nucleosides include synthetic nucleosides with modified base moieties and / or modified sugar moieties, e.g., as reviewed in Scheit, Nucleotide Analogs (John Wiley, New York, 1980). Such analogs include synthetic nucleosides designed to enhance binding properties, e.g., stability, specificity, etc., as disclosed by Uhlmann and Peyman (Chemical Reviews, 90:543-584, 1990). In some embodiments, the nucleoside or nucleoside analog includes a 3'-hydroxyl group or a 3'-amino group.

[0011] The terms "base" and "nucleobase" are used interchangeably and are defined herein to include (i) conventional DNA and RNA bases (uracil, thymine, adenine, guanine, and cytosine), and (ii) modified bases or base analogs (e.g., 5-methyl-cytosine, 5-bromouracil, or inosine). A base analog is a chemical whose molecular structure is similar to that of a conventional DNA or RNA base.

[0012] As used herein, "pyrimidine" refers to pyrimidines present in natural nucleosides, including cytosine, thymine, and uracil, as well as common analogs thereof, such as those containing substituents such as oxy, methyl, propynyl, methoxy, hydroxyl, amino, thio, halo, etc. As used herein, the term further includes pyrimidines to which common protecting groups have been added, such as N4-benzoylcytosine, etc. Additional pyrimidine protecting groups of interest include, but are not limited to, those disclosed by Beaucage and Iyer Tetrahedron 48: 2223-2311 (1992).

[0013] As used herein, "purine" refers to the purines present in natural nucleosides, including adenine, guanine, and hypoxanthine, as well as common analogs thereof, such as those containing substituents such as oxy, methyl, propynyl, methoxy, hydroxyl, amino, thio, halo, etc. As used herein, the term further includes purines to which common protecting groups have been added, such as N2-benzoylguanine, N2-isobutyrylguanine, N6-benzoyladenine, etc. Additional common purine protecting groups are disclosed by Beaucage and Iyer Tetrahedron 48: 2223-2311 (1992). As used herein, the term "protected" as part of a chemical name refers to an art-recognized protecting group for a particular portion of a compound, e.g., a "5'-protected hydroxyl" for a nucleoside includes triphenylmethyl (i.e., trityl), p-anisyldiphenylmethyl (i.e., monomethoxytrityl or MMT), di-p-anisylphenylmethyl (i.e., dimethoxytrityl or DMT), and the like; a protected nucleobase for a nucleobase includes a heteroatom protected with a group such as dimethylaminoformamidine (DMF), benzoyl (Bz), isobutyryl, and the like.Art-recognized protecting groups include those described in the following references: Gait, editor, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); Amarnath and Broom, Chemical Reviews, 77: 183-217, 1977; Pon et al., Biotechniques, 6:768-775, 1988; Ohtsuka et al., Nucleic Acids Research, 10:6553-6570, 1982; Eckstein, editor, Oligonucleotides. and Analogues: A Practical Approach (IRL Press, Oxford, 1991), Greene and Wuts, Protective Groups in Organic Synthesis, Second Edition, (John Wiley & Sons, New York, 1991), Narang, editor, Synthesis and Applications of. DNA and RNA (Academic Press, New York, 1987), Beaucage and Iyer Tetrahedron 48: 2223-2311 (1992), and similar references.

[0014] As used herein, "polynucleotide N3'→P5' thiophosphoramidate" means a typically linear oligomer of nucleoside subunits linked by at least one N3'→P5' thiophosphoramidate linkage. Generally, the nucleoside subunits include nucleosides or nucleoside analogs, but may also include more conventional chemically compatible moieties, such as abasic sugars and other carbohydrate moieties, such as those described in the following references: Newton et al., Nucleic Acids Research, 21: 1155-1162 (1993); Griffin et al., J. Am. Chem. Soc., 114: 7976-7982 (1992); Jaschke et al., Tetrahedron Letters, 34: 301-304 (1992); Ma et al., International Application No. PCT / CA92 / 00423; Zon et al., International Application No. PCT / US90 / 06630; Durand et al., Nucleic Acids Research, 18: 6353-6359 (1990); Salunkhe et al., J. Am. Chem. Soc., 114: 8768-8772 (1992), etc. In some cases, this term refers to a polynucleotide in which all internucleoside bonds are replaced by N3'→P5' thiophosphoramidate bonds. Thus, this term encompasses partially and fully "amidated" oligomers. In some cases, this term refers to a polynucleotide in which all internucleoside bonds are replaced by N3'→P5' thiophosphoramidate bonds, and the nucleoside subunits are natural nucleosides or their analogs. The present polynucleotide N3'→P5' thiophosphoramidate in which all bonds are N3'→P5' thiophosphoramidate bonds ("fully amidated") can be embedded or added to other oligonucleotides or polynucleotides to form larger "partially amidated" oligomers. The polynucleotide N3'→P5' thiophosphoramidates can comprise any convenient 3' and / or 5' terminal group. In some embodiments, the polynucleotide N3'→P5' thiophosphoramidates comprise a 3'-hydroxyl terminal group or a 3'-amino terminal group.

[0015] As used herein, the terms "phosphate" and "phosphate group" are meant to include thiophosphate and oxophosphate groups.

[0016] As used herein, the term "phosphoramidite amino group" refers to an amino group, -NR 4 R 5 and the term "phosphoramidite nitrogen" refers to the nitrogen atom of a phosphoramidite amino group.

[0017] "Alkyl" refers to monovalent saturated aliphatic hydrocarbyl groups having 1 to 10 carbon atoms, such as 1 to 6 carbon atoms (e.g., "alkyl of 1 to 6 carbon atoms"), or 1 to 5 (e.g., "alkyl of 1 to 5 carbon atoms"), or 1 to 4 (e.g., "alkyl of 1 to 4 carbon atoms"), or 1 to 3 carbon atoms (e.g., "alkyl of 1 to 3 carbon atoms"). This term includes, by way of example, methyl (CH 3 -), ethyl (CH 3 CH 2 -), n-propyl (CH 3 CH 2 CH 2 -), isopropyl ((CH 3 ) 2 CH-), n-Butyl (CH 3 CH 2 CH 2 CH 2 -), isobutyl ((CH 3 ) 2 CHCH 2 -), sec-butyl ((CH 3 )(CH 3 CH 2 )CH-), t-butyl ((CH 3 ) 3 C-), n-pentyl (CH 3 CH 2 CH 2 CH 2 CH 2 -), and neopentyl ((CH 3 ) 3 CCH 2 -), and other linear and branched hydrocarbyl groups.

[0018] The term "substituted alkyl" refers to an alkyl group in which one or more carbon atoms in the alkyl chain are optionally substituted with a heteroatom, such as -O-, -N-, -S-, -S(O) n- (wherein n is 0-2), -NR- (wherein R is hydrogen or alkyl), and the like, as well as alkoxy, substituted alkoxy, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, acyl, acylamino, acyloxy, amino, aminoacyl, aminoacyloxy, oxyaminoacyl, azido, cyano, halogen, hydroxyl, oxo, thioketo, carboxyl, carboxyalkyl, thioaryloxy, thioheteroaryloxy, thioheterocyclooxy, thiol, thioalkoxy, substituted thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, hydroxyamino, alkoxyamino, nitro, -SO-alkyl, -SO-aryl, -SO-heteroaryl, -SO 2 -Alkyl, -SO 2 -Aryl, -SO 2 -heteroaryl, and -NR a R b (In the formula, R a and R b may be the same or different and are selected from hydrogen, optionally substituted alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, aryl, heteroaryl, and heterocycle. In some cases, "substituted alkyl" can be selected from alkoxy, cycloalkyl, cycloalkenyl, acyl, acylamino, acyloxy, amino, aminoacyl, aminoacyloxy, oxyaminoacyl, azido, cyano, halogen, hydroxyl, carboxyl, carboxyalkyl, thiol, thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, sulfonamide, and -NR a R b (In the formula, R a and R band R 1 to R 2 are the same or different and are selected from hydrogen, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, aryl, heteroaryl, and heterocycle.

[0019] "Alkoxy" refers to an -O-alkyl group, where alkyl is as defined herein. Alkoxy includes, by way of example, methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, t-butoxy, sec-butoxy, n-pentoxy, and the like. The term "alkoxy" also refers to alkenyl-O-, cycloalkyl-O-, cycloalkenyl-O-, and alkynyl-O- groups, where alkenyl, cycloalkyl, cycloalkenyl, and alkynyl are as defined herein.

[0020] The term "substituted alkoxy" refers to substituted alkyl-O-, substituted alkenyl-O-, substituted cycloalkyl-O-, substituted cycloalkenyl-O-, and substituted alkynyl-O- groups, where substituted alkyl, substituted alkenyl, substituted cycloalkyl, substituted cycloalkenyl, and substituted alkynyl are as defined herein.

[0021] "Acyl" means HC(O)-, alkyl-C(O)-, substituted alkyl-C(O)-, alkenyl-C(O)-, substituted alkenyl-C(O)-, alkynyl-C(O)-, substituted alkynyl-C(O)-, cycloalkyl-C(O)-, substituted cycloalkyl-C(O)-, cycloalkenyl-C(O)-, substituted cycloalkenyl-C(O)-, aryl-C(O)-, substituted aryl-C(O)-, hetero ... "C(O)-, heterocyclyl-C(O)-, and substituted heterocyclyl-C(O)- groups, where alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocycle, and substituted heterocycle are as defined herein. For example, acyl includes the "acetyl" group CH 3 C(O)-.

[0022] The term "substituted amino" refers to the group -NRR, where each R is independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, cycloalkyl, substituted cycloalkyl, alkenyl, substituted alkenyl, cycloalkenyl, substituted cycloalkenyl, alkynyl, substituted alkynyl, aryl, heteroaryl, and heterocyclyl, provided that at least one R is not hydrogen.

[0023] "Halo" or "halogen" refers to fluoro, chloro, bromo, and iodo.

[0024] "Hydroxy" or "hydroxyl" refers to the -OH group.

[0025] "Heteroaryl" refers to an aromatic group of 1-15 carbon atoms, such as 1-10 carbon atoms, and 1-10 heteroatoms selected from the group consisting of oxygen, nitrogen, and sulfur in the ring. Such heteroaryl groups can have a single ring (such as pyridinyl, imidazolyl, or furyl) or multiple fused rings in the ring system (such as in groups such as indolizinyl, quinolinyl, benzofuran, benzimidazolyl, or benzothienyl), where at least one ring in the ring system is aromatic, provided that the point of attachment is through an atom of the aromatic ring. In certain embodiments, the nitrogen and / or sulfur ring atom(s) of the heteroaryl group are optionally oxidized to the N-oxide (N→O), sulfinyl, or sulfonyl moieties. The term includes by way of example pyridinyl, pyrrolyl, indolyl, thiophenyl, and furanyl. Unless otherwise limited by the definition of the heteroaryl substituent, such heteroaryl groups can be any of the following: acyloxy, hydroxy, thiol, acyl, alkyl, alkoxy, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, substituted alkyl, substituted alkoxy, substituted alkenyl, substituted alkynyl, substituted cycloalkyl, substituted cycloalkenyl, amino, substituted amino, aminoacyl, acylamino, alkaryl, aryl, aryloxy, azido, carboxyl, carboxyalkyl, cyano, halogen, nitro, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, aminoacyloxy, oxyacylamino, thioalkoxy, substituted thioalkoxy, thioaryloxy, thioheteroaryloxy, -SO-alkyl, -SO-substituted alkyl, -SO-aryl, -SO-heteroaryl, -SO 2 -Alkyl, -SO 2 -substituted alkyl, -SO 2 -Aryl and -SO 2 -heteroaryl, and trihalomethyl, or 1 to 3 substituents selected from. In such cases, the heteroaryl group substituted with 1 to 5 substituents (e.g., those described herein) is referred to as a "substituted heteroaryl."

[0026] "Heterocycle", "heterocyclic", "heterocycloalkyl" or "heterocyclyl" refers to a saturated or unsaturated group having a single ring or multiple fused rings, including fused bridged and spiro ring systems, and having 3 to 20 ring atoms, including 1 to 10 heteroatoms. The ring atoms are selected from the group consisting of nitrogen, sulfur, or oxygen, where in fused ring systems, one or more of the rings can be cycloalkyl, aryl, or heteroaryl, provided that the point of attachment is through a non-aromatic ring. In certain embodiments, the nitrogen and / or sulfur atom(s) of the heterocycle group are optionally oxidized to N-oxide, -S(O)-, or -SO 2 - It is part.

[0027] Examples of heterocycles and heteroaryls include azetidine, pyrrole, imidazole, pyrazole, pyridine, pyrazine, pyrimidine, pyridazine, indolizine, isoindole, indole, dihydroindole, indazole, purine, quinolizine, isoquinoline, quinoline, phthalazine, naphthylpyridine, quinoxaline, quinazoline, cinnoline, pteridine, carbazole, carboline, phenanthridine, acridine, phenanthroline, isothiazole, phenazine, isoxazole, furan, and the like. These include, but are not limited to, phenoxazine, phenothiazine, imidazolidine, imidazoline, piperidine, piperazine, indoline, phthalimide, 1,2,3,4-tetrahydroisoquinoline, 4,5,6,7-tetrahydrobenzo[b]thiophene, thiazole, thiazolidine, thiophene, benzo[b]thiophene, morpholinyl, thiomorpholinyl (also called thiamorpholinyl), 1,1-dioxothiomorpholinyl, piperidinyl, pyrrolidine, tetrahydrofuranyl, and the like.

[0028] Unless otherwise limited by the definition of a heterocyclic substituent, such heterocyclic groups can be any of the following: alkoxy, substituted alkoxy, cycloalkyl, substituted cycloalkyl, cycloalkenyl, substituted cycloalkenyl, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aminoacyloxy, oxyaminoacyl, azido, cyano, halogen, hydroxyl, oxo, thioketo, carboxyl, carboxyalkyl, thioaryloxy, thioheteroaryloxy, thioheterocyclooxy, thiol, thioalkoxy, substituted thioalkoxy, aryl, aryloxy, heteroaryl, heteroaryloxy, heterocyclyl, heterocyclooxy, hydroxyamino, alkoxyamino, nitro, -SO-alkyl, -SO-substituted alkyl, -SO-aryl, -SO-heteroaryl, -SO 2 -Alkyl, -SO 2 -substituted alkyl, -SO 2 -Aryl, -SO 2 - optionally substituted with 1 to 5, or 1 to 3, substituents selected from heteroaryl, and fused heterocycle.

[0029] "Nitro" is -NO 2 It refers to the base.

[0030] "Oxo" refers to the atom (=O).

[0031] "Thiol" refers to the -SH group.

[0032] The term "thioxo" or "thioketo" refers to the atom (=S).

[0033] Further to the disclosure herein, the term "substituted," when used to modify a specified group or radical, can also mean that one or more hydrogen atoms of the specified group or radical are each independently replaced with the same or different substituents defined below.

[0034] In addition to the groups disclosed for each individual term herein, any two hydrogens on a carbon atom may be substituted with ═O, ═NR, or the like to replace one or more hydrogens on the specified group or radical. 70 , =N-OR 70 , =N 2 or ═S) substituents are, unless otherwise specified, -R 60 , halo, =O, -OR 70 , -SR 70 , -NR 80 R 80 , trihalomethyl, -CN, -OCN, -SCN, -NO, -NO 2 , =N 2 , -N 3 , -SO 2 R 70 , -SO 2 O - M + , -SO 2 OR 70 , -OSO 2 R 70 , -OSO 2 O - M + , -OSO 2 OR 70 , -P(O)(O - ) 2 (M + ) 2 , -P(O)(OR 70 )O - M + , -P(O)(OR 70 ) 2 , -C(O)R 70 , -C(S)R 70 , -C(NR 70 )R 70 , -C(O)O - M + , -C(O)OR 70 , -C(S)OR 70 , -C(O)NR 80 R 80 , -C(NR 70 )NR 80 R 80 , -OC(O)R 70 , -OC(S)R 70 , -O-C(O)O - M +, -OC(O)OR 70 , -OC(S)OR 70 , -NR 70 C(O)R 70 , -NR 70 C(S)R 70 , -NR 70 CO 2 - M + , -NR 70 CO 2 R 70 , -NR 70 C(S)OR 70 , -NR 70 C(O)NR 80 R 80 , -NR 70 C(NR 70 )R 70 and -NR 70 C(NR 70 )NR 80 R 80 where R 60 is selected from the group consisting of optionally substituted alkyl, cycloalkyl, heteroalkyl, heterocycloalkylalkyl, cycloalkylalkyl, aryl, arylalkyl, heteroaryl, and heteroarylalkyl; each R 70 are independently hydrogen or R 60 And each R 80 is independently R 70 or alternatively, two R 80 together with the nitrogen atom to which they are attached form a 5-, 6-, or 7-membered heterocycloalkyl, which may optionally contain 1 to 4 identical or different additional heteroatoms selected from the group consisting of O, N, and S, where N is -H or C 1 -C 3 may have alkyl substitution, and each M + is a counterion with a net positive charge. + are independently, for example, alkali ions, e.g., K + , Na + , Li + etc.; ammonium ions, e.g. + N(R 60 ) 4etc.; or alkaline earth ions, e.g. [Ca 2+ ] 0.5 , [Mg 2+ ] 0.5 , or [Ba 2+ ] 0.5 etc. (the subscript 0.5 means that one of the counterions to such divalent alkaline earth ions can be the ionized form of a compound of the invention and the other can be a counterion such as chloride, or a two-ionized compound disclosed herein can serve as the counterion to such divalent alkaline earth ions, or a doubly-ionized compound of the invention can serve as the counterion to such divalent alkaline earth ions). 80 R 80 is -NH 2 , -NH-alkyl, N-pyrrolidinyl, N-piperazinyl, 4N-methyl-piperazin-1-yl and N-morpholinyl.

[0035] Further to the disclosure herein, in certain embodiments a substituted group has 1, 2, 3, or 4 substituents, 1, 2, or 3 substituents, 1 or 2 substituents, or 1 substituent.

[0036] It is understood that for all of the substituted groups defined above, polymers obtained by defining the substituents to have further substituents thereon (e.g., substituted aryl having a substituted aryl group as a substituent, which is itself substituted with a substituted aryl group, which is further substituted with a substituted aryl group, etc.) are not intended to be encompassed herein. In such cases, the maximum number of such substitutions is 3. For example, the sequential substitution of substituted aryl groups specifically contemplated herein is limited to substituted aryl-(substituted aryl)-substituted aryl.

[0037] Unless otherwise indicated, the nomenclature of substituents not explicitly defined herein is derived from the terminal end of the functionality continuing the name of the adjacent functionality toward the point of attachment.

[0038] For any of the groups disclosed herein that contain one or more substituents, it is of course understood that such groups do not include any substitutions or substitution patterns that are sterically impractical and / or synthetically impractical. Moreover, the compounds include all stereochemical isomers arising from the substitution of these compounds.

[0039] The term "pharmaceutical acceptable salt" refers to a salt that is acceptable for administration to a patient, e.g., a mammal, that contains a counterion that has acceptable mammalian safety for a given method of administration. Such salts can be derived from pharmaceutical acceptable inorganic or organic bases and pharmaceutical acceptable inorganic or organic acids. "Pharmaceutical acceptable salt" refers to a pharmaceutical acceptable salt of a compound, which is derived from a variety of organic and inorganic counterions known in the art, including, by way of example only, sodium, and, where the molecule contains a basic functional group, an organic or inorganic acid salt, e.g., hydrochloride salt. Pharmaceutically acceptable salts of interest include, but are not limited to, aluminum, ammonium, arginine, barium, benzathine, calcium, cholinate, ethylenediamine, lysine, lithium, magnesium, meglumine, procaine, potassium, sodium, tromethamine, N-methylglucamine, N,N'-dibenzylethylene-diamine, chloroprocaine, diethanolamine, ethanolamine, piperazine, zinc, diisopropylamine, triethylamine, diisopropylethylamine and triethanolamine salts.

[0040] The term "salt thereof" refers to a compound formed when a proton of an acid is replaced by a cation, such as a metal cation or an organic cation. Where applicable, the salt is a pharma- ceutical acceptable salt, although this is not required for salts of intermediate compounds that are not intended for administration to a patient. By way of example, salts of the present compounds include those in which the compound is protonated with an inorganic or organic acid to form a cation, and the conjugate base of the inorganic or organic acid is the anionic component of the salt. Salts of interest include, but are not limited to, aluminum, ammonium, arginine, barium, benzathine, calcium, cesium, cholinate, ethylenediamine, lithium, magnesium, meglumine, procaine, N-methylglucamine, piperazine, potassium, sodium, tromethamine, zinc, N,N'-dibenzylethylene-diamine, chloroprocaine, diethanolamine, ethanolamine, piperazine, diisopropylamine, triethylamine, diisopropylethylamine, and triethanolamine salts. For any of the polynucleotide structures shown herein that include a backbone of internucleoside linkages, it is understood that such polynucleotides may also include any convenient salt form. In some embodiments, for simplicity, the acid form of the internucleoside linkages is shown. In some cases, the salt of the compound is a monovalent cation salt. In some cases, the salt of the compound is a divalent cation salt. In some cases, the salt of the compound is a trivalent cation salt.

[0041] "Solvate" refers to a complex formed by the combination of solvent molecules with molecules or ions of the solute. The solvent can be an organic compound, an inorganic compound, or a mixture of both. Some examples of solvents include, but are not limited to, methanol, N,N-dimethylformamide, tetrahydrofuran, dimethylsulfoxide, and water. When the solvent is water, the solvate formed is a hydrate.

[0042] "Stereoisomers" refer to compounds that have identical atomic bonds but different arrangements of the atoms in space. Stereoisomers include cis-trans isomers, E and Z isomers, enantiomers, and diastereomers.

[0043] "Tautomer" refers to alternative forms of molecules that differ only in the position of the electron bonds and / or protons of the atoms, such as enol-keto and imine-enamine tautomers, -NH-P(=S)(OH)-O- and -NH-P(=O)(SH)-O-, or tautomeric forms of heteroaryl groups containing the -N=C(H)-NH- ring atom configuration, such as pyrazole, imidazole, benzimidazole, triazole, and tetrazole. One of skill in the art will recognize that other tautomeric configurations of the groups described herein are also possible. For example, a polynucleotide depicted in the structure [ka] also encompasses the following structure, which illustrates one possible alternative tautomeric configuration of the linking group: [ka] In the formula, it is understood that "nps" represents a thiophosphoramidate bond (-NH-P(=O)(SH)-O- or -NH-P(=S)(OH)-O-) linking the 3'-carbon of one nucleoside to the 5'-carbon of the adjacent nucleoside. It is understood that all tautomeric forms of the compounds are encompassed by the structure depicted, even if not specifically designated, one possible tautomeric configuration of the groups of the compounds. Any convenient tautomeric configuration of the groups of the compounds may be used to describe the compounds.

[0044] It will be understood that the term "or a salt or solvate or stereoisomer thereof" is intended to include all variations of the salts, solvates, and stereoisomers, such as solvates of pharma- ceutically acceptable salts of a stereoisomer of the subject compound. The term "or a salt thereof" is understood to be intended to include all variations of the salts. The term "or a pharma- ceutically acceptable salt thereof" is understood to be intended to include all variations of the salts. The term "or a solvate thereof" is understood to be intended to include all variations of the solvates. The term "or a stereoisomer thereof" is understood to be intended to include all variations of the stereoisomers. The term "or a tautomer thereof" is understood to be intended to include all variations of the tautomers. Thus, for example, it will be understood to be intended to include solvates of pharma- ceutically acceptable salts of the tautomers of a stereoisomer of the subject compound.

[0045] As used herein, the term "isolated" is intended to describe a compound of interest that is in an environment different from that which the compound naturally occurs in. "Isolated" refers to including a compound that is in a sample in which the compound of interest has been substantially enriched and / or in which the compound of interest has been partially or substantially purified.

[0046] As used herein, the term "substantially purified" refers to a compound that has been removed from its natural environment and is at least 60%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more than 99% free from other components with which it is naturally associated.

[0047] The term "physiological conditions" is meant to encompass conditions compatible with living cells, such as mostly aqueous conditions of temperature, pH, salinity, etc., compatible with living cells.

[0048] When a range of values ​​is specified, it is understood that, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, each value between the upper and lower limit of that range, and any other stated or intervening value in the stated range, is encompassed within the invention. The upper and lower limits of such smaller ranges may independently be included in the smaller ranges, and are also encompassed within the invention, provided that any limit in a stated range is specifically excluded. Where a stated range includes one or both of the limits, ranges excluding either or both of such included limits are also included in the invention.

[0049] It must be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. It should further be noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as a predicate for the use of exclusive terminology, such as "solely," "only," and the like in connection with the recitation of claim elements, or for the use of a "negative" limitation.

[0050] Other definitions of terms may appear throughout the specification.

[0051] Description of exemplary embodiments As summarized above, aspects of the disclosure include a method for preparing a polynucleotide. In some embodiments, the method includes contacting a first polynucleotide composition comprising a polynucleotide having a sequence of seven or more nucleoside subunits, at least two of the nucleoside subunits being linked by an N3'→P5' thiophosphoramidate intersubunit bond; and a non-target synthesis product and a reagent, with a polyvalent cation salt to precipitate a first polynucleotide salt comprising at least one polyvalent cation counterion; and separating the first polynucleotide salt from the contacted first polynucleotide composition to produce a second polynucleotide composition comprising the first polynucleotide salt. In some embodiments, the method further includes contacting the polynucleotide salt with a reversed-phase chromatography support; and eluting a third polynucleotide composition comprising the polynucleotide from the chromatography support. In some cases, the third polynucleotide composition comprises the second polynucleotide salt. Also provided are compositions comprising a salt of a polynucleotide comprising at least one polyvalent cation counterion. In some embodiments, the at least one polyvalent cation counterion is selected from the group consisting of magnesium, zinc, aluminum, and calcium.

[0052] Before describing various embodiments, it is to be understood that the teachings of the present disclosure are not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present teachings will be limited only by the appended claims.

[0053] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter in any way. While the present teachings are described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. Rather, the present teachings encompass various alternatives, modifications, and equivalents, as will be appreciated by those skilled in the art.

[0054] Unless otherwise defined, all scientific and technical terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of this invention, the methods and materials of interest are now described. All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials to which the cited publications relate.

[0055] The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present claims are not entitled to antedate the invention by virtue of such publications being prior invention. Further, the publication dates provided may be different from the actual publication dates, which may need to be independently confirmed.

[0056] It is understood that certain features of the present invention, although described in the context of separate embodiments for clarity, may also be provided in combination in a single embodiment. Conversely, various features of the present invention, although described in the context of a single embodiment for brevity, may also be provided separately or in any suitable subcombination. All combinations of the embodiments of the present invention, to the extent that such combinations include the subject matter of compounds that are, for example, stable compounds (i.e., compounds that can be made, isolated, identified, and tested for biological activity), are expressly included in the present invention and are disclosed herein exactly as if all combinations were individually and expressly disclosed. Furthermore, all subcombinations of the various embodiments and elements thereof (e.g., elements of chemical groups listed in the embodiments describing such variables) are also expressly included in the present invention and are disclosed herein exactly as if all such subcombinations were individually and expressly disclosed herein.

[0057] All patents and publications referred to herein, including all sequences disclosed in such patents and publications, are expressly incorporated by reference.

[0058] In further describing the invention, methods for preparing polynucleotides are first described in more detail, followed by a general description of polynucleotide compositions of interest for carrying out the methods.

[0059] Preparation method Aspects of the present disclosure include methods for preparing polynucleotides. In some embodiments, the methods include contacting a first polynucleotide composition, including a polynucleotide (e.g., as described herein) and non-target synthesis products and agents, with a polyvalent cation salt to precipitate a polynucleotide salt that includes at least one polyvalent cation counterion. Precipitation of the polynucleotide salt using the methods removes all soluble non-target synthesis products and agents. In some embodiments, the methods include separating the polynucleotide salt from the contacted first polynucleotide composition to produce a second polynucleotide composition that includes the polynucleotide salt. In some embodiments, the first polynucleotide composition, the polynucleotide salt, and the second polynucleotide composition each include a target polynucleotide having a sequence of seven or more nucleoside subunits, at least two of the nucleoside subunits being linked by N3'→P5' thiophosphoramidate intersubunit linkages (e.g., as described herein).

[0060] The second polynucleotide composition may have a reduced amount of non-target synthesis products and drugs compared to the first polynucleotide composition. By reduced amount of non-target synthesis products and drugs, it is meant that the non-target synthesis products and drugs in the second polynucleotide composition are reduced by 10% or more by weight compared to the first polynucleotide composition, for example, 15% or more by weight, 20% or more by weight, 25% or more by weight, 30% or more by weight, 35% or more by weight, 40% or more by weight, 45% or more by weight, 50% or more by weight, 55% or more by weight, 60% or more by weight, 65% or more by weight, 70% or more by weight, 75% or more by weight, 80% or more by weight, 85% or more by weight, 90% or more by weight, or 95% or more by weight. Thus, the method may result in selective precipitation of the target polynucleotide relative to the non-target synthesis products and drugs. In certain embodiments, the method provides improved selectivity of precipitation compared to control methods of polynucleotide precipitation using organic solvents, such as pure ethanol or ethanol solutions (see, e.g., Crouse J, Amorese D (1987). "Ethanol Precipitation: Ammonium Acetate as an Alternative to Sodium Acetate". Focus 9 (2): 3-5). Improved selectivity of precipitation means that 5% or more by weight of non-target synthesis products and agents are removed from the second polynucleotide composition compared to the control composition, such as 10% or more, 15% or more, 20% or more, 25% or more, 30% or more, 35% or more, 40% or more, 45% or more, 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, or 95% or more by weight of non-target synthesis products and agents are removed. The amount of non-target synthesis products and agents that is less abundant relative to the first polynucleotide composition can be determined using any convenient method, for example, using HPLC methods.

[0061] As used herein, the terms "target synthetic polynucleotide" and "target polynucleotide" are used interchangeably to refer to a polynucleotide having a specific desired sequence of nucleotides synthesized on a support by any convenient stepwise solid-phase polynucleotide synthesis method (e.g., as described herein), where the polynucleotide is free of any protecting groups that are used solely for the purpose of carrying out the target polynucleotide synthesis strategy. Such protecting groups may be removed from the polynucleotide during the final step of solid-phase synthesis, e.g., final deprotection and cleavage of the polynucleotide from the support to generate the target polynucleotide. As used herein, the term "non-target" refers to any convenient component, such as a compound that is not the desired target synthetic product, a polynucleotide or its derivative, a drug, etc., or a mixture thereof.

[0062] A target polynucleotide can include any convenient number of nucleoside subunits, such as, for example, from 7 to 500 nucleoside subunits, from 7 to 100 nucleoside subunits, from 7 to 75 nucleoside subunits, from 7 to 50 nucleoside subunits, from 7 to 40 nucleoside subunits, from 7 to 30 nucleoside subunits, from 7 to 20 nucleoside subunits, from 7 to 15 nucleoside subunits, from 10 to 15 nucleoside subunits, or from 13 to 15 nucleoside subunits. In some cases, the target polynucleotide has from 7 to 100 nucleoside subunits, e.g., from 7 to 50 nucleoside subunits, from 10 to 50 nucleoside subunits, from 10 to 40 nucleoside subunits, from 10 to 30 nucleoside subunits, from 10 to 25 nucleoside subunits, from 10 to 20 nucleoside subunits, from 12 to 18 nucleoside subunits, or from 12 to 16 nucleoside subunits, etc. In some cases, the target polynucleotide has 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleoside subunits.

[0063] As used herein, the term "non-target synthesis products and agents" collectively refers to various non-target components that may be present in the crude synthesis products of solid phase polynucleotide synthesis, including, but not limited to, non-target polynucleotide products of synthesis, such as truncated polynucleotides, capped polynucleotide fragments (i.e., sequences capped after a failed subunit ligation), polynucleotides containing deletion(s) (i.e., lacking a target nucleoside monomer or dimer, e.g., as described herein), and derivatized polynucleotides (e.g., polynucleotide sequences that have undergone undesired side reactions during synthesis or cleavage); as well as agents, such as cleaved linkers, products of deprotection, such as removed protecting group products, e.g., phosphorus protecting group products and base protecting group products (e.g., exocyclic amine protecting group products), cleavage reagents and / or cleavage scavengers, and remaining synthesis reagents, such as monomer, dimer, coupling, capping or deprotection reagents, etc.

[0064] In certain embodiments, the method results in the selective precipitation of target polynucleotides relative to non-target synthesis products and agents, including polynucleotides having 6 or fewer nucleoside subunits, e.g., 5 or fewer, 4 or fewer, 3 or fewer, or 2 nucleoside subunits. In some cases, all non-target synthesis products and agents that are not polynucleotides remain soluble during the selective precipitation step of the method and therefore can be easily removed from the resulting polynucleotide salt precipitate.

[0065] The methods can include precipitation and separation from crude synthesis preparations to produce polynucleotide compositions that have several desirable properties, such as low amounts of non-target synthesis products and agents (e.g., synthesis reagents, cleavage reagents, scavengers, removed protecting groups, cleavage by-products (linkers, capping groups, etc.), and small polynucleotide fragments).

[0066] In some embodiments, the method includes precipitating the polynucleotide as a polyvalent cation salt from the crude synthesis preparation prior to chromatographic purification. In some cases, the method is a method of purification of a target polynucleotide. Precipitation of the crude polynucleotide composition with a polyvalent cation salt results in a polynucleotide salt precipitate that includes at least one polyvalent cation counterion. In some cases, the polynucleotide salt precipitate includes a mixture of monovalent and polyvalent cation counterions that ion-pair with the polyanionic polynucleotide backbone. As used herein, the terms "polyvalent cation salt" and "polyvalent salt" are used interchangeably with respect to polynucleotides and refer to polynucleotide salts that include at least one polyvalent cation counterion that ion-pairs with an anionic intersubunit linking group of the polynucleotide backbone. In some cases, the polyvalent cation salt of the polynucleotide includes a mixture of monovalent and polyvalent cations. In some embodiments, the polyvalent cation can cause aggregation of the target polynucleotide by ion-pairing with anionic intersubunit linking groups of two or more polynucleotide backbones. In some cases, divalent cations ion-pair with two different polynucleotides to form dimers. In some cases, further aggregation of polynucleotides can be achieved through additional multivalent interactions mediated by additional multivalent cations, and thus in some cases the method can result in selective aggregation and precipitation of target polynucleotides relative to non-target synthesis products and agents.

[0067] In some embodiments of this method, at least one multivalent cation counterion is divalent. In some embodiments, at least one multivalent cation counterion is selected from the group consisting of magnesium, zinc, and calcium. In some embodiments, at least one multivalent cation counterion is trivalent. In some embodiments, at least one multivalent cation counterion is aluminum. In some embodiments, the polynucleotide salt further comprises a monovalent cation counterion. In such cases, the polynucleotide salt is a mixed salt, e.g., a salt comprising two or more different cation counterions.

[0068] Any convenient method of precipitating polynucleotides can be useful in the method. The step of contacting the first polynucleotide composition with a polyvalent cation salt to precipitate a polynucleotide salt comprising at least one polyvalent cation counterion can be accomplished using any convenient method. Any convenient polyvalent cation and its salt (e.g., as described herein) can be used in the contacting step to form a precipitate. In some cases, the polynucleotide salt comprising at least one polyvalent cation counterion is formed in the solution phase, for example, by adding a polyvalent cation salt to a solution comprising the polynucleotide. Once the polyvalent cation salt is added to the solution, a precipitate can form. In some cases, the polynucleotide salt comprising at least one polyvalent cation counterion can be formed on an ion exchange carrier. Any convenient ion exchange carrier can be used in the contacting step. In some cases, the ion exchange carrier is a strong cation exchange resin. In some embodiments of the method, the contacting step comprises eluting the first polynucleotide composition from the cation exchange carrier comprising the polyvalent cation counterion. As used herein, the term "cation exchange carrier" refers to a carrier that is itself anionic and capable of ion-pairing with a cationic analyte, such as a multivalent cation of interest. Any convenient eluent may be used for the step of eluting from the cation exchange carrier. In some cases, a precipitate forms in the eluate after eluting the polynucleotide salt from the cation exchange carrier.

[0069] The method can be carried out on any convenient crude synthetic preparation of target synthetic polynucleotide. In some cases, the first polynucleotide composition is a crude synthetic preparation of target synthetic polynucleotide. In some embodiments, the first polynucleotide composition is a composition that is a product of cleaving target polynucleotide from carrier after synthesis. Therefore, the first polynucleotide composition can contain various non-target synthetic products and drugs. The method provides selective precipitation of target polynucleotide salts against non-target synthetic products and drugs, which remain in solution and can be easily removed from the resulting precipitate.

[0070] Any convenient synthesis method (e.g., as described herein) can be used to synthesize the target polynucleotide. After synthesis, the target polynucleotide is cleaved from the support on which the stepwise synthesis was performed. After cleavage, the full-length target polynucleotide can be purified to remove undesired synthesis and cleavage reagents, as well as to remove non-target polynucleotide fragments and derivatives thereof. The method, which involves precipitation of a polynucleotide salt comprising at least one multivalent cation counterion, can be performed at any convenient stage of the preparation of the target polynucleotide, such as after synthesis and before reversed-phase chromatography purification.

[0071] As used herein, the terms "crude synthesis preparation", "crude composition" and "crude polynucleotide" refer to a composition comprising a synthesis product of solid-phase polynucleotide synthesis recovered by cleavage from a solid-phase synthesis support after synthesis, and the composition is unpurified, i.e., no chromatographic purification has been performed on the composition. Chromatographic purification refers to any convenient purification method involving adsorption of a target polynucleotide to a chromatographic support and subsequent elution and separation of the target polynucleotide from non-target polynucleotides. In some cases, chromatographic purification refers to reversed-phase chromatographic purification.

[0072] In some embodiments, the method further comprises providing a first polynucleotide composition, where the composition is produced by cleavage from a solid-phase synthesis support after synthesis. Any convenient additional steps, such as evaporation, dilution, or concentration steps, may be performed on the crude synthesis preparation before the resulting composition is used in the method. In some cases, the method further comprises synthesizing the target polynucleotide (e.g., on a solid-phase synthesis support as described herein). In some embodiments, the method further comprises cleaving the polynucleotide from the support to produce the first polynucleotide composition.

[0073] The solid precipitate containing the polynucleotide salt can be separated from the first polynucleotide composition that has been contacted with the multivalent salt (i.e., the contacted first polynucleotide composition) using any convenient method, including, but not limited to, centrifugation, filtration, decanting, and the like.

[0074] In some cases, separation of the precipitate containing polynucleotide salt is accomplished by centrifugation, where the precipitate forms a pellet, for example, at the bottom of a container, by applying centrifugal force to the contacted first polynucleotide composition, for example, in a centrifuge. Forming a pellet by centrifugation is sometimes referred to as spinning down the precipitate. In some embodiments of this method, the separation step includes centrifuging the contacted first polynucleotide composition to spin down the polynucleotide salt precipitate. The supernatant liquid can then be decanted from the tube without disturbing the precipitate, or removed from the container, for example, with a Pasteur pipette. The centrifugation process can be repeated with a washing solution.

[0075] In some cases, separation of the precipitate containing polynucleotide salt is achieved by filtration. In some embodiments of this method, the separation step comprises filtering polynucleotide salt from the contacted first polynucleotide composition. Any convenient filter and filter medium can be used in this method. In some cases, separation is achieved by depth filtration using a filter medium selected according to the target polynucleotide.

[0076] In some embodiments, the method includes contacting a first polynucleotide composition comprising a polynucleotide having a sequence of seven or more nucleoside subunits, at least two of the nucleoside subunits being linked by an N3'→P5' thiophosphoramidate intersubunit linkage; and a non-target synthesis product and an agent, with a polyvalent cation salt to precipitate a first polynucleotide salt comprising at least one polyvalent cation counterion; and separating the first polynucleotide salt from the contacted first polynucleotide composition to produce a second polynucleotide composition comprising the polynucleotide salt.

[0077] The precipitate is separated from the contacted first polynucleotide composition to produce a second polynucleotide composition comprising the first polynucleotide salt. In some cases, selective precipitation of the first polynucleotide salt with a multivalent cation salt according to the present method produces a second polynucleotide composition that contains reduced amounts of non-target synthesis products and drugs.

[0078] After selective precipitation, the polynucleotide salt of interest can then be converted to a soluble polynucleotide salt by cation exchange, which removes at least one multivalent cation counterion from the polynucleotide and replaces it with another cation counterion of interest (e.g., as described herein). Thus, the method results in the reversible formation of a first polynucleotide salt comprising at least one multivalent cation counterion. As used herein, the terms "reversible formation" and "reversible exchange" are used interchangeably to refer to the preparation of a polynucleotide salt, e.g., by selective precipitation (e.g., as described herein), in which the formed salt may subsequently dissociate and at least one multivalent cation salt may be exchanged and removed from the salt. In some cases, a polynucleotide salt that is insoluble in any solvent may be referred to as an irreversibly formed salt. In some embodiments, the method includes exchanging at least one multivalent cation counterion from the first polynucleotide salt to generate a soluble second polynucleotide salt, which exchange includes dissociating the multivalent cation counterion and ion-pairing it with a soluble salt cation of interest. In some cases, the soluble second polynucleotide salt is a monovalent salt. In some cases, the soluble second polynucleotide salt is a sodium salt. In some cases, the soluble second polynucleotide salt is a triethylammonium salt. In some cases, the first and second polynucleotides are different from each other, i.e., contain different cation counterions. The dissociation of the polynucleotide salt of interest and the exchange of at least one multivalent cation counterion can be achieved using any convenient method. In some cases, the dissociation is achieved using reverse phase chromatography, for example as described herein. In some cases, ion exchange chromatography can be used to achieve the dissociation. In some embodiments, the dissociation of the first polynucleotide salt is achieved by dissolving the salt in a solvent containing the cation counterion of interest.

[0079] After separation, the second polynucleotide composition may be subjected to further purification steps. In some embodiments, the method further comprises contacting the first polynucleotide salt with a reversed-phase chromatography support; and eluting a third polynucleotide composition comprising the polynucleotide from the chromatography support. In some embodiments, the third polynucleotide composition comprises the second polynucleotide salt. Any convenient reversed-phase chromatography method may be used to purify the polynucleotide salt. Reverse-phase chromatography methods and supports of interest include ion-pair reversed-phase chromatography, C18 reversed-phase chromatography, and the methods described in Chen et al., Journal of Chromatography A, Volume 1288, 3 May 2013, Pages 73-81; and Zimmermann et al., Journal of Chromatography A, Volume 1354, 8 August 2014, Pages 43-55. In some embodiments, the second polynucleotide composition is added directly onto the reversed-phase chromatography support. By directly onto the support, it is meant that the second polynucleotide composition produced using the method is added directly to the reversed-phase chromatography support, for example as an isolated solid precipitate. In some cases, the reversed-phase chromatography support is a resin configured as a column, and the polynucleotide composition is added to the top of the resin bed. In some embodiments, the method further comprises dissolving the second polynucleotide composition in a solvent. Any convenient solvent may be used, including, but not limited to, aqueous buffers, water-miscible organic solvents, and mixtures thereof. In such cases, a solution of the second polynucleotide composition is contacted with the reversed-phase chromatography support, and the polynucleotides can be adsorbed onto the support before elution.

[0080] In some cases, the contacting includes adsorbing the polynucleotide onto the reversed-phase chromatography support and then eluting the polynucleotide to chromatographically separate the target polynucleotide from non-target polynucleotides and residual synthesis agents present in the composition. The eluate containing the target polynucleotide is collected. Any convenient elution liquid may be used to elute the polynucleotide from the reversed-phase chromatography support. The elution liquid may be selected depending on various factors, such as the nature of the reversed-phase chromatography support, the target oligonucleotide, the particular desired salt of the target polynucleotide, etc. In some cases, at least one polyvalent cation counterion of the first polynucleotide salt is ion-exchanged on the reversed-phase chromatography support with another cation counterion of interest contained in the elution liquid. In such cases, the polynucleotide is in a different salt form (i.e., a second polynucleotide salt) when eluted from the reversed-phase chromatography support than when added, since at least one polyvalent cation counterion has been exchanged and removed from the polynucleotide. In some cases, the salt form of the polynucleotide eluted from the support in the third polynucleotide composition is more water-soluble than the first polynucleotide salt containing at least one polyvalent cation counterion.

[0081] In some embodiments, the third polynucleotide composition comprises a second polynucleotide salt that is a pharma- ceutically acceptable salt of the polynucleotide. In some cases, the third composition comprises a second polynucleotide salt that is a monovalent cation salt of the polynucleotide. In some cases, the third composition comprises a second polynucleotide salt that is a triethylammonium salt of the polynucleotide. In some cases, the third composition comprises a second polynucleotide salt that is a sodium salt of the polynucleotide. It is understood that after purifying the polynucleotide by reverse phase chromatography, any number of additional cation counterion exchange steps can be performed on the polynucleotide salt to generate the desired salt form of the polynucleotide. In some embodiments, the method further comprises ion exchanging the cation counterion from the second polynucleotide salt to generate a third polynucleotide salt. In some embodiments, the third polynucleotide salt is a pharma- ceutically acceptable salt of the polynucleotide. In some cases, the third polynucleotide salt is a monovalent cation salt of the polynucleotide. In some cases, the third polynucleotide salt is a sodium salt of the polynucleotide (e.g., as described herein).

[0082] In some cases, the first composition comprises a monovalent cation salt of the polynucleotide. In some cases, the monovalent cation salt is selected from the group consisting of sodium, ammonium, and alkylammonium. In some cases, the alkylammonium is selected from the group consisting of dimethylammonium, methylammonium, ethylammonium, and triethylammonium. In some cases, the first composition comprises an ammonium salt of the polynucleotide. In some cases, the first composition comprises an alkylammonium salt of the polynucleotide. In some cases, the first composition comprises a triethylammonium salt of the polynucleotide. In some cases, the first composition comprises a sodium salt of the polynucleotide. The first polynucleotide composition can be contacted with a polyvalent cation salt to precipitate a first polynucleotide salt comprising at least one polyvalent cation counterion. Thus, in some embodiments, the contacted first polynucleotide composition comprises a first polynucleotide salt comprising at least one polyvalent cation counterion.

[0083] It is contemplated that any of the above described method embodiments in which the polynucleotide is as described herein are included within the scope of the present invention.

[0084] Synthesis method Any convenient polynucleotide synthesis method, strategy and chemistry can be used to prepare the crude synthesis product polynucleotide composition that is useful in the present preparation method.The polynucleotide synthesis chemistry and method of interest that can be adapted for use in the present method include, but are not limited to, phosphoramidite method, H-phosphonate method, phosphodiester method, phosphotriester method, phosphite triester method.The polynucleotide component of the compound of the present invention can be synthesized by adapting any conventional procedure to the type of chemistry selected. Methods of interest for the synthesis of oligonucleotides having N3'→P5' thiophosphoramidate chemistry include, but are not limited to, those described in US 5,824,793, McCurdy et al., (1997) Tetrahedron Letters, 38:207-210; Pongracz & Gryaznov, (1999) Tetrahedron Letters, 49:7661-7664; US 6,835,826, US 7,494,982, US 7,485,717 and US 5,684,143.

[0085] In some cases, the polynucleotide of interest is synthesized by sequential coupling starting from the 5' end of the target polynucleotide sequence and continuing to the 3' end. In some cases, the polynucleotide of interest is synthesized by sequential coupling starting from the 3' end of the target polynucleotide sequence and continuing to the 5' end. In some embodiments, the polynucleotide is synthesized by sequential coupling of monomeric phosphoramidites to the extending end of the polynucleotide. The 5'-terminal nucleoside subunit can be attached to any convenient solid support via an optional linking group or 5'-terminal group. Once the first subunit is attached to the solid support, the subunit can be deprotected to generate a free, immobilized 3'-terminal group. Subunit coupling to the extending oligonucleotide chain can then be accomplished. In some cases, the method includes coupling the 3'-terminal group attached to the support with a 3'-protected nucleotide-5'-phosphoramidite monomer. In some embodiments, the 3'-terminal group is a 3'-hydroxyl group. In some embodiments, the 3'-terminal group is a 3'-amino group.

[0086] In some cases, the method of polynucleotide synthesis includes (a) deprotecting a protected 3'-amino group of a terminal nucleoside attached to a solid support to form a free 3'-amino group; (b) contacting the free 3'-amino group with a 3'-protected amino-nucleoside-5'-phosphoramidite monomer in the presence of a nucleophilic catalyst to form an internucleoside N3'→P5' phosphoramidite linkage; and (c) oxidizing the linkage to generate an N3'→P5' thiophosphoramidate linkage. In some embodiments, the method includes (d) repeating steps (a)-(c) until a polynucleotide is synthesized.

[0087] In some cases, the method includes coupling the 3'-terminal group attached to the support with a 3'-protected dinucleotide-5'-phosphoramidite dimer. Polynucleotide synthesis methods of interest include, but are not limited to, methods of solid-phase synthesis including at least one coupling of a dinucleotide dimer, as described in PCT Publication No. WO2015 / 168310, which application claims the benefit of U.S. Provisional Application No. 61 / 987,396. The target polynucleotide sequence can be synthesized by a reverse synthesis strategy including sequential coupling of both dimer and monomer subunits to the 3'-terminal group of an extending oligonucleotide chain. In some embodiments, the polynucleotide is synthesized using a method including at least one coupling of a dinucleotide dimer to the free 3'-terminal group of an extending polynucleotide chain.

[0088] In some cases, the method of polynucleotide synthesis includes (a) deprotecting a protected 3'-amino group of a terminal nucleoside attached to a solid support to form a free 3'-amino group; (b) contacting the free 3'-amino group with a 3'-protected amino-dinucleotide thiophosphoramidate or phosphoramidite-5'-phosphoramidite dimer in the presence of a nucleophilic catalyst to form an internucleoside N3'→P5' phosphoramidite linkage; and (c) oxidizing the linkage to an N3'→P5' thiophosphoramidate linkage. In some embodiments, the method includes repeating steps (a)-(c) until (d) a polynucleotide is synthesized, where step (b) may use a 3'-protected amino-dinucleotide thiophosphoramidate-5'-phosphoramidite dimer or a 3'-protected aminonucleotide-5'-phosphoramidite monomer.

[0089] Any convenient protecting group strategy can be used in the present method to protect the 5', 2' and / or 3' groups of bases, phosphoramidites, phosphoramidates, polynucleotides.Protecting groups of interest include, but are not limited to, those described by Ohkubo et al., Org. Lett., 2010, 12 (11), pp 2496-2499; and Beaucage and Iyer, Tetrahedron 48: 2223-2311 (1992).

[0090] As used herein, the term "phosphate protecting group" refers to a protecting group that can be added to a phosphorus-containing intersubunit bond of an oligonucleotide. When present, the phosphate protecting group can prevent (i.e., block) reaction of the phosphorus-containing bond at the position where the phosphate protecting group is added. Any convenient phosphorus-containing intersubunit bond (e.g., P(III) and P(V) bond) can be protected by the phosphate protecting group, including, but not limited to, phosphoramidite, oxophosphoramidate, thiophosphoramidate, phosphate ester, thiophosphate ester, phosphodiester bond, and the like. The phosphate protecting group can be added to the available oxygen atom of the phosphorus-containing intersubunit bond. Any convenient protecting group can be used as the phosphate protecting group. In some embodiments, the phosphate protecting group is methyl, or β-cyanoethyl.

[0091] In some cases, the 3'-terminal group of the extending polynucleotide chain may include a 3'-hydroxyl, a 3'-amino group, or protected versions thereof. Any convenient hydroxyl and / or amino protecting group may be used for the 3'-terminal group during polynucleotide synthesis. In some embodiments, the 3'-terminal group is a protected 3'-amino group, and the method includes deprotecting or removing the protecting group to generate a free 3'-amino group. As used herein, the term "free amino group" refers to an amino group available for reaction with a phosphoramidite group of a newly attached monomer or dimer. In some embodiments, the free amino group is a primary amine. After the deprotection (e.g., detritylation) step, the amino group may be in the form of a salt (e.g., a salt of the conjugate base of the acid used for detritylation). The salt may be optionally neutralized with a basic solution, such as 2% triethylamine or pyridine in acetonitrile, after the detritylation step.

[0092] 3'-protection of the phosphoramidite of the newly attached subunit prevents undesired polymerization of the chain. In some embodiments, the 3'-terminal group is a protected 3'-hydroxyl group, and the method includes deprotecting or removing the protecting group to generate a free 3'-hydroxyl group. In some embodiments, the 3'-terminal group is a protected 3'-amino group, and the method includes deprotecting or removing the protecting group to generate a free 3'-amino group. The protected 3'-amino or 3'-hydroxyl group may be protected with a trityl protecting group. In certain embodiments, the trityl protecting group is triphenylmethyl (Tr or Trt, Ph 3C-). In certain embodiments, the trityl protecting group is 4,4'-dimethoxytrityl (DMT). Deprotection of the 3'-terminal amino or hydroxyl group can be accomplished using any convenient method. Methods of interest include, but are not limited to, those described by Beaucage and Iyer, Tetrahedron 48: 2223-2311 (1992). In some cases, deprotection of the protected 3'-amino group of the terminal nucleoside comprises detritylation, e.g., acid-catalyzed detritylation, to generate a free 3'-terminal group. In some cases, the dimer or monomer subunit phosphoramidite comprises a protected 3'-hydroxyl or 3'-amino group that is the same as the 3'-terminal group of the terminal nucleoside that is attached to the solid support.

[0093] Any convenient solid support may be used for the synthesis of polynucleotides according to the present method.Solid supports of interest include microparticles made of controlled pore glass (CPG), highly cross-linked polystyrene (e.g., NittoPhase HL 400 or GE Primer 350), acrylic copolymers, cellulose, nylon, dextran, latex, polyacrolein, and the like, as described, for example, in the following exemplary references: Meth. Enzymol., Section A, pages 1-147, vol.44 (Academic Press, New York, 1976); U.S. Patent Nos. 4,678,814; 4,413,070; and 4,046;720; and Pon, Chapter 19, in Agrawal, editor, Methods in Molecular Biology, Vol.20, (Humana Press, Totowa, NJ, 1993), and the like. Additional supports of interest include polystyrene beads; polyethylene glycol grafted polystyrene (TentaGel™, Rapp Polymere, Tubingen Germany); and the like. The choice of the properties of the support, such as material, porosity, size, shape, and the like, and the type of linking moiety used, depends on various factors, such as the protecting group used, the length of the final product, and the amount of the final product. Exemplary linking moieties are disclosed in Pon et al., Biotechniques, 6:768-775 (1988); Webb, U.S. Pat. No. 4,659,774; Barany et al., International Patent Application No. PCT / US91 / 06103; Brown et al., J. Chem. Soc. Commun, 1989: 891-893; Damha et al., Nucleic Acids Research, 18: 3813-3821(1990); Beattie et al., Clinical Chemistry, 39: 719-722 (1993); Maskos and Southern, Nucleic Acids Research, 20: 1679-1684 (1992), and others.

[0094] In some embodiments, a solid support useful in the present methods is polystyrene grafted with CPG and polyethylene glycol and having terminal amino groups (e.g., TentaGel-NH 2 (trademark, Rapp Polymere, Tubingen Germany). An aminopropyl group can be used as a spacer between the CPG and nucleoside linkages. In some cases, the linkage to the 5'-hydroxyl of the first nucleoside is a succinyl group resulting in a base-labile ester bond that can be cleaved with aqueous ammonia after synthesis.

[0095] After deprotection, the support-bound nucleoside can react with a dimeric or monomeric subunit phosphoramidite to form an internucleoside linkage. It is understood that a support-bound nucleoside can refer to a single residue attached to a solid support or to the terminal residue of an oligonucleotide chain attached to a support. Any convenient coupling chemistry, coupling reagents and methods can be used in the present method. Any convenient selection of coupling conditions, protecting groups, solid phase supports, linking groups, deprotection reagents, reagents for cleaving the product from the solid phase support, purification of the product, and the like can be found in, for example, Gait, editor, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); Amarnath and Broom, Chemical Reviews, Vol. 77, pgs. 183-217 (1977); Pon et al. ... al., Biotechniques, Vol. 6, pgs. 768-775 (1988); Ohtsuka et al., Nucleic Acids Research, Vol. 10, pgs. 6553-6570 (1982); Eckstein, editor Oligonucleotides, and In connection with the present method, the teachings of Analogues: A Practical Approach (IRL Press, Oxford, 1991), Greene and Wuts "Protective Groups in Organic Synthesis", Third edition, Wiley, New York 1999, Narang, editor, Synthesis and Applications of DNA and RNA (Academic Press, New York, 1987), Beaucage and Iyer, Tetrahedron 48: 2223-2311 (1992), and similar references are followed.

[0096] In some cases, after coupling, the unreacted 3'-amino groups of the support-bound polynucleotide extension strand can be optionally capped with a convenient capping agent to render it inert to the subsequent coupling step before the next deprotection step (e.g., detritylation step). This capping step may improve the HPLC profile of the preparation, making it easier to purify, and may also improve the overall yield of the product. Capping reagents useful in the present method include electrophiles such as acetic anhydride and isobutyric anhydride, acid chlorides such as adamantylcarbonyl chloride, pivaoyl chloride, isothiocyanates, chloroformates, and the like. Phosphoramidites in combination with activating agents and then oxidized, and H-phosphonates such as triethylammonium isopropyl-H-phosphonate with acid chlorides such as pivaoyl chloride or adamantylcarbonyl chloride are also useful.

[0097] In some embodiments, the method includes oxidizing the internucleoside N3'→P5' phosphoramidite linkage. As used herein, the terms "oxidize", "oxidize", "oxidizing" and the like, with respect to phosphorus-containing internucleoside linkages, refer to a process or treatment for converting the phosphorus atom of the linkage from the phosphorus (III) form to the phosphorus (V) form. Oxidation of the internucleoside linkage can be performed at any convenient time during the synthesis using any convenient method. In some embodiments, oxidation is performed stepwise, for example, during each coupling cycle. In other embodiments, oxidation of multiple internucleoside linkages is performed at the end of the synthesis. In some cases, oxidizing the N3'→P5' phosphoramidite linkage (e.g., with an iodine / water-based oxidizing agent) produces an oxo-phosphoramidate linkage. In other cases, oxidizing the N3'→P5' phosphoramidite linkage includes sulfurization to produce an N3'→P5' thiophosphoramidate linkage. Sulfurization can be performed using any convenient method. Sulfurization methods of interest include those described by Gryazonov et al. in WO2001018015 and US6,114,519. Sulfurization agents of interest include, but are not limited to, elemental sulfur, thiuram disulfides such as tetraethylthiuram disulfide, acyl disulfides such as phenacyl disulfide, phenylacetyl disulfide, phosphinothioyl disulfides such as S-Tetra™, and 1,1-dioxo-3H-1,2-benzodithiol-3-one. In some embodiments, sulfurization may be carried out using phenylacetyl disulfide in 2,6-lutidine. In some embodiments, sulfurization may be carried out using Beaucage reagent, Iyer reagent, and the like. This can be carried out using the methods described in (E. et al., J. Organic Chemistry 55:4693-4699, 1990).

[0098] Cleavage of the polynucleotide from the solid phase synthesis support can be accomplished using any convenient method and reagents, which can be selected depending on a variety of factors, such as the nature of the support, the chemistry of the linker, and the protecting group strategy used during synthesis. Choices made in the synthesis and cleavage of the target polynucleotide can determine the identity of non-target synthesis products and agents present in the first polynucleotide composition.

[0099] In some embodiments, prior to cleavage, the phosphorus protecting groups of the polynucleotide are removed to avoid the formation of any potential undesired adducts of the cleaved protecting groups (e.g., β-cyanoethyl protecting groups) with the polynucleotide. Methods of interest that may be adapted for use in deprotecting and cleaving polynucleotides include those described in US 7,199,236. In some embodiments, the polynucleotide is cleaved from the support using an ammonia solution to remove any base protecting groups (e.g., exocyclic amino protecting groups) and any remaining phosphorus protecting groups. Any convenient conditions may be used in the polynucleotide cleavage reaction. In some cases, the cleavage is carried out at a temperature ranging from 40 to 60° C. In some cases, the cleavage is carried out for an extended period of time, such as a time ranging from 12 to 24 hours. After cleavage of the polynucleotide, the support may then be removed by filtration and rinsed. The mixture of the filtrate and rinse solution now contains the crude synthetic preparation of the polynucleotide and may be used in the preparation method before proceeding to further purification steps. In some cases, purification of the polynucleotide solution involves preparative reversed-phase high performance liquid chromatography (RP-HPLC) RP HPLC, for example, using Kromasil C18 at 45-55° C. In some cases, the polynucleotide composition of the present method may be subjected to any number of convenient desalting and concentration steps, for example, by using a tangential flow filtration (TFF) device with a polyethersulfone membrane having a pore diameter cutoff size of 1,000 Da.

[0100] Polynucleotide Compositions Aspects of the present disclosure include polynucleotide salt compositions comprising polyvalent cation counterions. In some embodiments, the compositions comprise a salt of a polynucleotide comprising at least one polyvalent cation counterion, the polynucleotide having a sequence of seven or more nucleoside subunits, at least two of the nucleoside subunits being linked by N3'→P5' thiophosphoramidate intersubunit linkages. In some embodiments, the polynucleotide has a sequence of seven or more nucleoside subunits that is complementary to the RNA component of human telomerase.

[0101] Multivalent cation counterions

[0102] Any convenient multivalent cation can be useful as counterion in the polynucleotide salt. Thus, the multivalent cation can ion-pair with anionic sites on the polynucleotide backbone in the polynucleotide composition. The polynucleotide can include nucleoside subunits linked by phosphorus-containing intersubunit bonds (e.g., P(V) bonds), such as phosphoramidate, thiophosphoramidate, phosphate, phosphodiester bonds, etc. It is understood that the intersubunit bonds of polynucleotides are negatively charged (e.g., in aqueous solution) and can ion-pair with cationic counterions. Such intersubunit bonds can be referred to as anionic groups of the polynucleotide backbone.

[0103] As used herein, the term multivalent cation refers to a cation capable of forming multiple ion pairs, e.g., a multiply charged cation, such as a di- or triply charged cation. Any convenient multivalent cation may be useful in the polynucleotide salt compositions. In some embodiments, the multivalent cation ion pairs with two or more adjacent anionic groups of the polynucleotide backbone. In some embodiments, the multivalent cation ion pairs with one anionic group of the polynucleotide backbone. In some embodiments, the multivalent cation counterion is divalent. Divalent cation counterions of interest include, but are not limited to, magnesium, zinc, and calcium. In some embodiments, the multivalent cation counterion is trivalent. Trivalent cation counterions of interest include, but are not limited to, aluminum. In some embodiments of the composition, at least one multivalent cation counterion is selected from the group consisting of magnesium, zinc, aluminum, and calcium. In some embodiments of the composition, at least one multivalent cation counterion is magnesium. In some embodiments of the composition, at least one multivalent cation counterion is zinc. In some embodiments of the composition, at least one multivalent cation counterion is aluminum. In certain embodiments of the composition, at least one multivalent cation counterion is calcium.

[0104] It is understood that the number of cationic counterions present in a polynucleotide salt depends on various factors, such as the length of the polyanionic backbone, the valency of the cations in the salt, the pH of the solution, aggregation of the polynucleotide in the composition, etc. The composition may include at least one polyvalent cationic counterion to the polyanionic polynucleotide backbone in the polynucleotide composition, such as 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 15 or more, 20 or more, 30 or more, 40 or more, 50 or more, 100 or more, or even more polyvalent cationic counterions. In certain embodiments, a polynucleotide having n nucleoside subunits may include 1 to (n-1) / 2 (if n is an odd number) divalent cationic counterion(s) or 1 to (n-2) / 2 (if n is an even number) divalent cationic counterion(s). In some cases, polynucleotide salts that include at least one multivalent cationic counterion can further include a variety of other cationic counterions, which can be monovalent, divalent, or trivalent. In some cases, n is in the range of 7 to 50, e.g., 7 to 40, 10 to 40, 10 to 30, 10 to 25, 10 to 20, etc., or in the range of 12 to 15 nucleoside subunits.

[0105] In some embodiments of the compositions, the polynucleotide salt can comprise 3 mol% or more of polyvalent cation counterions relative to the polyanionic backbone of the polynucleotide (i.e., relative to the theoretical maximum of cationic counterions included over the entire length of the polyanionic backbone), such as 4 mol% or more, 5 mol% or more, 6 mol% or more, 7 mol% or more, 8 mol% or more, 9 mol% or more, 10 mol% or more, 11 mol% or more, 12 mol% or more, 13 mol% or more, 14 mol% or more, 15 mol% or more, 16 mol% or more, 17 mol% or more, 18 mol% or more, 19 mol% or more, 20 mol% or more, 25 mol% or more, 30 mol% or more, 35 mol% or more, 40 mol% or more, 45 mol% or more, 50 mol% or more, 55 mol% or more, 60 mol% or more, etc., or even more of polyvalent cation counterions relative to the polyanionic backbone of the polynucleotide. In some embodiments of the composition, the polynucleotide may comprise 10 mol% or more of polyvalent cation counterions relative to the polyanionic backbone of the polynucleotide. For example, a polynucleotide salt comprising a polyanionic backbone of 10 internucleoside subunit linkages and one divalent cation ion-paired with two of these linkages is said to comprise 20 mol% of divalent cation counterions. If one divalent cation counterion ion-pairs with only one of the linkages but not two, the polynucleotide salt is said to comprise 10 mol% of divalent cation counterions. Thus, the mol% value refers to the level of occupancy of the polyanionic polynucleotide backbone by the multivalent cation counterions present in the polynucleotide salt. For example, one Mg in a 13-mer polynucleotide salt with 12 internucleoside subunit linkages is said to comprise 10 mol% of divalent cation counterions. 2+ The cations result in 16.7 mol% occupancy of the backbone. In some embodiments, the polynucleotide salts may contain additional ion-pairing sites at the termini of the polynucleotide (e.g., 5'-thiophosphate groups), but it is understood that such sites, when present, are included in the mol% value of the compound.

[0106] In some embodiments of the composition, the polynucleotide salt comprises 90 mol% or less multivalent cation counterions relative to the polyanionic backbone of the polynucleotide, e.g., 70 mol% or less, 65 mol% or less, 60 mol% or less, 50 mol% or less, or even less multivalent cation counterions.

[0107] In certain embodiments of the composition, the polynucleotide salt comprises 3 to 90 mol % of polyvalent cation counterions relative to the polyanionic backbone of the polynucleotide, for example, 3 to 65 mol % (e.g., 6 to 50 mol %, 10 to 50 mol %, or 10 to 40 mol %), 3 to 50 mol %, 3 to 40 mol %, 3 to 30 mol %, 3 to 20 mol %, or 3 to 15 mol % of polyvalent cation counterions relative to the polyanionic backbone of the polynucleotide.

[0108] In some compositions, the polynucleotide salt comprises 3-60 mol % of divalent cation counterion relative to the polyanionic backbone of the polynucleotide, such as 3-50 mol % (e.g., 5-50 mol %), 3-40 mol %, 3-30 mol %, 3-20 mol %, 3-15 mol %, etc., such as 3-12 mol % of divalent cation counterion.

[0109] In some compositions, the polynucleotide salt comprises 3-60 mol % magnesium cation counterion relative to the polyanionic backbone of the polynucleotide, such as 5-50 mol %, 5-40 mol %, 10-40 mol % or 20-40 mol % magnesium cation counterion.

[0110] In some compositions, the polynucleotide salt comprises 10-70 mol % of a trivalent cation counterion relative to the polyanionic backbone of the polynucleotide, such as 10-60 mol %, 20-60 mol %, 20-50 mol % or 30-50 mol % of a trivalent cation counterion. In some embodiments of the composition, the polynucleotide salt comprises 0.5% or more by weight of a polyvalent cation counterion (e.g., magnesium), such as 0.6% or more, 0.7% or more, 0.8% or more, 0.9% or more, 1.1% or more, 1.2% or more, 1.3% or more, 1.4% or more, 1.5% or more, 1.6% or more, 1.7% or more, 1.8% or more, 1.9% or more, 2.0% or more, 2.1% or more, 2.2% or more, 2.3% or more, 2.4% or more, 2.5% or more, 2.6% or more, 2.7% or more, 2.8% or more, 2.9% or more, 3.0% or more by weight of a polyvalent cation counterion, etc.

[0111] The polynucleotide salt is a mixed salt comprising a mixture of polyvalent and monovalent cation counterions. In some embodiments of the composition, the polynucleotide salt comprises a molar ratio of polyvalent cation counterions to monovalent cation counterions of at least 0.05 or more, such as a molar ratio of polyvalent cation counterions to monovalent cation counterions of at least 0.10, 0.15 or more, 0.20 or more, 0.25 or more, 0.30 or more, 0.35 or more, 0.40 or more, 0.45 or more, 0.50 or more, 0.55 or more, 0.60 or more, 0.65 or more, 0.70 or more, or even greater.

[0112] In some cases, the polynucleotide salt comprises a molar ratio of multivalent cation counterions to monovalent cation counterions of 1:12. In some cases, the polynucleotide salt comprises a molar ratio of multivalent cation counterions to monovalent cation counterions of 1:11. In some cases, the polynucleotide salt comprises a molar ratio of multivalent cation counterions to monovalent cation counterions of 1:10. In some cases, the polynucleotide salt comprises a molar ratio of multivalent cation counterions to monovalent cation counterions of 1:9. In some cases, the polynucleotide salt comprises a molar ratio of multivalent cation counterions to monovalent cation counterions of 1:8. In some cases, the polynucleotide salt comprises a molar ratio of multivalent cation counterions to monovalent cation counterions of 1:7. In some cases, the polynucleotide salt comprises a molar ratio of multivalent cation counterions to monovalent cation counterions of 1:6. In some cases, the polynucleotide salt comprises a molar ratio of multivalent cation counterions to monovalent cation counterions of 1:5. In some cases, the polynucleotide salt comprises a molar ratio of multivalent cation counterions to monovalent cation counterions of 1:4. In some cases, the polynucleotide salt comprises a molar ratio of multivalent cation counterions to monovalent cation counterions of 2:9. In some cases, the polynucleotide salt comprises a molar ratio of multivalent cation counterions to monovalent cation counterions of 3:7. In some cases, the polynucleotide salt comprises a molar ratio of multivalent cation counterions to monovalent cation counterions of 4:5. In some cases, the polynucleotide salt comprises a molar ratio of multivalent cation counterions to monovalent cation counterions of 5:3.

[0113] In some mixed polynucleotide salts, the polyvalent cation counterion is magnesium and the monovalent cation counterion is sodium. In some mixed polynucleotide salts, the polyvalent cation counterion is magnesium and the monovalent cation counterion is ammonium. In some mixed polynucleotide salts, the polyvalent cation counterion is magnesium and the monovalent cation counterion is triethylammonium. In some mixed polynucleotide salts, the polyvalent cation counterion is aluminum. In some mixed polynucleotide salts, the polyvalent cation counterion is zinc. In some mixed polynucleotide salts, the polyvalent cation counterion is calcium. In some mixed polynucleotide salts, the monovalent cation counterion is sodium. In some mixed polynucleotide salts, the monovalent cation counterion is ammonium. In some mixed polynucleotide salts, the monovalent cation counterion is triethylammonium. In some embodiments, the polynucleotide salt comprises one polyvalent cation counterion. In some embodiments, the polynucleotide salt comprises two polyvalent cation counterions. In some embodiments, the polynucleotide salt comprises three polyvalent cation counterions. In some embodiments, the polynucleotide salt comprises four multivalent cation counterions. In some embodiments, the polynucleotide salt comprises five multivalent cation counterions. In some embodiments, the polynucleotide salt comprises six multivalent cation counterions. In some embodiments, the polynucleotide salt comprises seven multivalent cation counterions. In some embodiments, the polynucleotide salt comprises eight multivalent cation counterions. In some embodiments, the polynucleotide salt comprises nine multivalent cation counterions. In some embodiments, the polynucleotide salt comprises ten multivalent cation counterions.

[0114] In addition to the target polynucleotide, various non-target polynucleotide synthesis products may be generated during polynucleotide synthesis. By-products that may be present in a polynucleotide preparation include, but are not limited to, deletion products (e.g., products that lack one or more nucleoside residues), products that contain one or more protecting groups, end-processed products (e.g., products that contain capped polynucleotide chains), products that lack one or more nucleobases, products that contain partially oxidized phosphoramidite bonds, and products that contain partially sulfurized bonds.

[0115] The method results in a composition comprising a target polynucleotide with an increased purity in the composition. In some embodiments, the composition comprises 20% or more by weight of the target polynucleotide, such as 25% or more by weight, 30% or more by weight, 35% or more by weight, 40% or more by weight, 45% or more by weight, 50% or more by weight, 60% or more by weight, 70% or more by weight, 80% or more by weight, 90% or more by weight, or even 95% or more by weight of the target polynucleotide. In some embodiments, the composition comprises 50% or more by weight of the target polynucleotide. In some embodiments, the composition comprises 55% or more by weight of the target polynucleotide. In some embodiments, the composition comprises 60% or more by weight of the target polynucleotide. In some embodiments, the composition comprises 65% or more by weight of the target polynucleotide. In some embodiments, the composition comprises 70% or more by weight of the target polynucleotide. In some embodiments, the composition comprises 75% or more by weight of the target polynucleotide. In some embodiments, the composition comprises 80% or more by weight of the target polynucleotide. In some embodiments, the composition comprises 85% or more by weight of the target polynucleotide. In some embodiments, the composition comprises 90% or more by weight of the target polynucleotide. In some embodiments, the composition comprises 95% or more by weight of the target polynucleotide.

[0116] The method results in a composition that contains a low amount of non-target synthesis products and agents. By low amount, it is meant that the weight of non-target synthesis products and agents in the composition is low relative to the control method. In some embodiments, the composition contains non-target synthesis products and agents in an amount of 50% or less of the total non-target polynucleotides in the composition, such as 40% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, or even 5% or less.

[0117] Any of a wide variety of polynucleotide compositions can be prepared using the methods described herein.Various classes and types of polynucleotides are subject to preparation using the methods (e.g., as described herein).Polynucleotides suitable for preparation according to the methods include, but are not limited to, antisense polynucleotides, RNA polynucleotides, siRNA polynucleotides, RNAi polynucleotides, DNA aptamers, microRNAs, etc.

[0118] In some embodiments, the polynucleotide is described by formula (I): [ka] During the ceremony, each B is independently a purine, a protected purine, a pyrimidine, or a protected pyrimidine, or an analog thereof; each X is independently oxygen or sulfur; Each R 3 is independently hydrogen, fluoro, hydroxyl, alkoxy, substituted alkoxy, or protected hydroxyl; R 6 is amino, hydroxyl, protected amino, protected hydroxy, -OTZ or -NH-TZ; each T is independently an optional linker; each Z is independently H, a lipid, a carrier, an oligonucleotide, a polymer, a polypeptide, a detectable label, or a tag; n is an integer between 1 and 1000. It is understood that the oligonucleotides of formula (I) may exist in salt form. Thus, the internucleoside linkages of formula (I) may be in salt form with any convenient counterion. Such forms are intended to be included within the scope of the present disclosure. It is understood that other tautomeric configurations of the internucleoside linkages of the polynucleotides described by formula (I) may be possible. Such forms are intended to be included within the scope of the present disclosure.

[0119] In some embodiments of Formula (I), each R 3 is hydrogen. In some embodiments of Formula (I), each R 3 In some embodiments of Formula (I), each R 3 is hydroxyl. In some embodiments of Formula (I), R 6 is amino. In certain embodiments of Formula (I), R 6 is hydroxyl. In some embodiments of Formula (I), Z is H. In some embodiments of Formula (I), Z is a lipid (e.g., as described herein). In some cases, the lipid is a fatty acid (e.g., as described herein). In some embodiments of Formula (I), Z is a carrier. In some embodiments of Formula (I), Z is an oligonucleotide. In some embodiments of Formula (I), Z is a polymer. In some cases, the polymer is PEG. In some embodiments of Formula (I), Z is a polypeptide. In some embodiments of Formula (I), Z is a detectable label. In some embodiments of Formula (I), Z is a tag. In some embodiments of Formula (I), T is absent. In some embodiments, each B is independently selected from A, C, G, T, and U.

[0120] In some embodiments of formula (I), n is an integer from 7 to 500, such as 7 to 100, 7 to 75, 7 to 50, 7 to 40, 7 to 30, 7 to 20, 7 to 15, 10 to 15, or 13 to 15. In some embodiments, n is an integer from 7 to 100, such as 7 to 50, 10 to 50, 10 to 40, 10 to 30, 10 to 25, 10 to 20, 12 to 18, or 12 to 16. In some embodiments, n is 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25.

[0121] Polynucleotides complementary to the RNA component of telomerase

[0122] Aspects of the present disclosure include compounds and compositions comprising polynucleotides complementary to the RNA component of human telomerase, and methods for their preparation, which compounds can inhibit telomerase activity in cells with high potency and have cellular uptake properties.

[0123] In some cases, the polynucleotide includes a sequence of 7 or more nucleoside subunits complementary to the RNA component of human telomerase, e.g., 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 20 or more, 30 or more, 50 or more, etc. nucleoside subunits complementary to the RNA component of human telomerase.

[0124] In some embodiments, the polynucleotide comprises 3-50 contiguous nucleoside subunits complementary to the RNA component of human telomerase, e.g., 5-40, 7-40, 10-40, 10-30, 10-25, 10-20, or 12-15, etc., nucleoside subunits. In certain embodiments, the polynucleotide comprises a sequence of 7 or more contiguous nucleoside subunits complementary to the RNA component of human telomerase, e.g., 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 20 or more, 30 or more, 50 or more, etc., contiguous nucleoside subunits complementary to the RNA component of human telomerase.

[0125] In some embodiments, the polynucleotide is a compound described by the formula: O-(xL) n wherein O represents a polynucleotide comprising a sequence of nucleoside subunits complementary to the RNA component of human telomerase, x is an optional linker group, L represents a lipid moiety, and n is an integer from 1 to 5. In some cases, n is 5. In some cases, n is 4. In some cases, n is 3. In some cases, n is 2. In some cases, n is 1. Thus, the design of a compound requires the selection of two elements, O and L, and the determination of the structural linkage(s) between these elements that may involve the optional linker group x.

[0126] In some embodiments, the polynucleotide compound may be described by the formula: O-(xL) n wherein O represents a polynucleotide comprising a sequence of nucleoside subunits complementary to the RNA component of human telomerase, x is an optional linker group, L represents a lipid moiety, and n is 1, such as a polynucleotide of formula (I) in which Z is a lipid moiety, T is an optional linker (e.g., as described herein), and the B group corresponds to a sequence of nucleoside subunits complementary to the RNA component of human telomerase, or a salt thereof.

[0127] The polynucleotide component O may be considered the "effector" component of the compound in that it is this component that effects inhibition of the telomerase enzyme by binding to the RNA component of telomerase. Thus, the sequence of O was selected to include a region that is complementary to the sequence of the telomerase RNA, and is shown in SEQ ID NO:1. Although the region complementary to the telomerase RNA component could in theory be targeted to any portion of the telomerase RNA, certain regions of the telomerase RNA are preferred targets for the inhibitory polynucleotides. One preferred target region is the region spanning nucleotides 30-67 of SEQ ID NO:1, including the "template region," which is an 11 nucleotide region of the sequence 5'-CUAACCCUAAC-3' (SEQ ID NO:21), spanning nucleotides 46-56 of SEQ ID NO:1. The template region functions to define the telomeric repeat sequences that telomerase adds to chromosomal ends and that are essential for the activity of the telomerase enzyme (see Chen et al., Cell 100:503-514, 2000; Kim et al., Proc. Natl. Acad. Sci., USA 98(14):7982-7987, 2001). Thus, compounds of interest are of interest that contain a polynucleotide portion that includes a sequence complementary to all or a portion of the template region. Another target region of interest is the region spanning nucleotides 137-179 of hTR (Pruzan et al., Nucl. Acids Research, 30:559-588, 2002). Within this region, the sequence spanning 141-153 is a preferred target. PCT Publication No. WO 98 / 28442 describes the use of polynucleotides of at least 7 nucleotides in length to inhibit telomerase, which polynucleotides are designed to be complementary to accessible portions of the hTR sequence outside the template region, including nucleotides 137-196, 290-319, and 350-380 of hTR.

[0128] The region of O targeted to the hTR sequence is optionally exactly complementary to the corresponding hTR sequence. Mismatches may be tolerated in some cases, but are expected to reduce the specificity and activity of the resulting polynucleotide conjugate. Thus, in some embodiments, the base sequence of polynucleotide O is selected to include at least 5 nucleotides exactly complementary to the telomerase RNA, and telomerase inhibition may be enhanced when longer lengths of complementary sequence are used, such as at least 6, at least 7, at least 8, at least 10, at least 12, at least 13 or at least 15 nucleotides exactly complementary to the telomerase RNA. In other embodiments, the sequence of the polynucleotide includes at least 7-20, at least 8-20, at least 10-20 or at least 10-15 nucleotides exactly complementary to the telomerase RNA sequence. Maximum telomerase inhibitory activity may be obtained when the entire length of polynucleotide O is selected to be complementary to the telomerase RNA. However, it is not essential that the entire length of the polynucleotide component be exactly complementary to the target sequence, and the polynucleotide sequence may include regions that are not complementary to the target sequence. For example, such regions may be added to confer other properties to the compound, such as sequences that facilitate purification. When the polynucleotide component O contains a region that is not complementary to the target sequence, such regions may be located at either or both of the 5' or 3' ends. When exactly complementary regions are targeted to the template region, effective telomerase inhibition may be achieved with a short (5-8 nucleotide) region of exact complementarity linked at the 5' end to a telomerase-like (G-rich) sequence.

[0129] Exemplary sequences that are complementary to human telomerase RNA and that may be included as part of or used as the entire polynucleotide component O include the following: hTR complementary sequence (polynucleotide sequence of U.S. Patent Publication No. 2012329858, region of SEQ ID NO:1); GGGUUGCGGAGGGUGGGCCUGGGAGGGGUGGUGGCCAUUUUUUGUCUAACCCUAACUGAGAAGGGCGUAGGCGCCGUGCUUUUGCUCCCCGCCGCUGUUUUUCUCGCUGACUU UCAGCGGGCGGAAAAGCCUCGGCCUGCCGCCUUCCACCGUUCAUUCUAGAGCAAACAAAAAAUGUCAGCUGCUGGCCCGUUCGCCCCUCCCGGGACCUGCGGCGGGUCGCCUGC CCAGCCCCCGAACCCCGCCUGGAGGCCGCGGUCGGCCCGGGGCUUCUCCGGAGGCACCCACUGCCACCGCGAAGAGUUGGGCUCUGUUCAGCCGCGGGUCUCUCGGGGGCGAGGG CGAGGUUCAGGCCUUUCAGGCCGCAGGAAGAGGAACGGAGCGAGUCCCCGCGCGGCGCGAUUCCCUGAGCUGUGGGACGUGCACCCAGGACUCGGCUCACACAUGC (SEQ ID NO: 1) GCTCTAGAATGAACGGTGGAAGGCGGCAGG 137-166 (SEQ ID NO: 2) GTGGAAGGCGGCAGG 137-151 (SEQ ID NO: 6) GGAAGGCGGCAGG 137-149 (SEQ ID NO: 7) GTGGAAGGCGGCA 139-151 (SEQ ID NO: 8) GTGGAAGGCGG 141-151 (SEQ ID NO: 9) CGGTGGAAGGCGG 141-153 (SEQ ID NO: 10) ACGGTGGAAGGCG 142-154 (SEQ ID NO: 11) AACGGTGGAAGGCGGC 143-155 (SEQ ID NO: 12) ATGAACGGTGGAAGGCGG 144-158 (SEQ ID NO: 13) ACATTTTTTGTTTGCTCTAG 160-179 (SEQ ID NO: 14) TAGGGTTAGACAA 42-54 (SEQ ID NO: 3) GTTAGGGTTAG 46-56 (SEQ ID NO: 4) GTTAGGGTTAGAC 44-56 (SEQ ID NO: 15) GTTAGGGTTAGACAA 42-56 (SEQ ID NO: 16) GGGTTAGAC 44-52 (SEQ ID NO: 19) CAGTTAGGG 50-58 (SEQ ID NO: 20) CCCTTCTCAGTT 54-65 (SEQ ID NO: 17) CGCCCTTCTCAG 56-67 (sequence number 18).

[0130] In some embodiments, the polynucleotide comprises a sequence selected from the group consisting of GTTAGGGTTAG (SEQ ID NO: 4); TAGGGTTAGACAA (SEQ ID NO: 3); and CAGTTAGGGTTAG (SEQ ID NO: 5).

[0131] The type of internucleoside linkage used in the synthesis of the O component can be selected from any of the available polynucleotide chemistries, including, but not limited to, phosphodiester, phosphotriester, methylphosphonate, P3'→N5' phosphoramidate, N3'→P5' phosphoramidate, N3'→P5' thiophosphoramidate, and phosphorothioate linkages. In some embodiments, the polynucleotide component O has at least one N3'→P5' thiophosphoramidate linkage. In some embodiments, all of the nucleoside subunits complementary to the RNA component of human telomerase are linked by N3'→P5' thiophosphoramidate intersubunit linkages. In some cases, the N3'→P5' thiophosphoramidate intersubunit linkage has the following structure: 3'-HP(S)(OR)-O-5' where R is hydrogen, or a salt thereof. For any polynucleotide component O described herein that includes such an intersubunit bond, it is understood that such polynucleotide component O can also include any convenient salt form of that bond. Thus, the intersubunit bond can be in a salt form with any convenient counterion.

[0132] In some embodiments, at least two of the nucleoside subunits are linked by an N3'→P5' thiophosphoramidate intersubunit linkage, and each of the other intersubunit linkages is independently selected from an N3'→P5' oxo-phosphoramidate and an N3'→P5' thiophosphoramidate intersubunit linkage. In some embodiments, the nucleoside subunits are linked by an intersubunit linkage, each of which is independently selected from an N3'→P5' oxo-phosphoramidate and an N3'→P5' thiophosphoramidate intersubunit linkage. In some embodiments, the nucleoside subunits are linked by an intersubunit linkage, each of which is independently selected from an N3'→P5' oxo-phosphoramidate and an N3'→P5' thiophosphoramidate intersubunit linkage, with the proviso that at least two of the nucleoside subunits are linked by an N3'→P5' thiophosphoramidate intersubunit linkage. In some embodiments, the nucleoside subunits are all linked by N3'→P5' thiophosphoramidate intersubunit linkages.

[0133] In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3) and the nucleoside subunits are linked by intersubunit linkages that include at least one N3'→P5' thiophosphoramidate linkage. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3) and the nucleoside subunits are linked by intersubunit linkages that include at least two N3'→P5' thiophosphoramidate linkages. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3) and the nucleoside subunits are linked by intersubunit linkages that include at least three N3'→P5' thiophosphoramidate linkages. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3) and the nucleoside subunits are linked by intersubunit linkages that include at least four N3'→P5' thiophosphoramidate linkages. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3) and the nucleoside subunits are linked by intersubunit linkages that include at least five N3'→P5' thiophosphoramidate linkages. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3) and the nucleoside subunits are linked by intersubunit linkages that include at least six N3'→P5' thiophosphoramidate linkages. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3) and the nucleoside subunits are linked by intersubunit linkages that include at least seven N3'→P5' thiophosphoramidate linkages. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3) and the nucleoside subunits are linked by intersubunit linkages that include at least eight N3'→P5' thiophosphoramidate linkages.In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3) and the nucleoside subunits are linked by intersubunit linkages that include at least nine N3'→P5' thiophosphoramidate linkages. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3) and the nucleoside subunits are linked by intersubunit linkages that include at least ten N3'→P5' thiophosphoramidate linkages. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3) and the nucleoside subunits are linked by intersubunit linkages that include at least eleven N3'→P5' thiophosphoramidate linkages. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3), and the nucleoside subunits are each independently linked by intersubunit linkages selected from N3'→P5' oxo-phosphoramidate and N3'→P5' thiophosphoramidate intersubunit linkages. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3), and the nucleoside subunits are each independently linked by intersubunit linkages selected from N3'→P5' oxo-phosphoramidate and N3'→P5' thiophosphoramidate intersubunit linkages, with the proviso that at least two of the nucleoside subunits are linked by N3'→P5' thiophosphoramidate intersubunit linkages. In some embodiments, the polynucleotide component O has the sequence TAGGGTTAGACAA (SEQ ID NO:3), and all of the nucleoside subunits are linked by N3'→P5' thiophosphoramidate intersubunit linkages.

[0134] In all the above and below embodiments, the N3'→P5' thiophosphoramidate intersubunit linkage is particularly -NH-P(=O)(SH)-O- or a tautomer thereof, or a salt thereof, and the N3'→P5' oxo-phosphoramidate intersubunit linkage is particularly -NH-P(=O)(OH)-O- or a tautomer thereof, or a salt thereof. More specifically, in all the above and below embodiments, the N3'→P5' thiophosphoramidate intersubunit linkage is particularly -NH-P(=O)(SH)-O- or a tautomer thereof, or a sodium salt thereof, and the N3'→P5' oxo-phosphoramidate intersubunit linkage is particularly -NH-P(=O)(OH)-O- or a tautomer thereof, or a salt thereof.

[0135] In one embodiment, the present invention relates to any one of the specific structures described herein, optionally in which one or more, in particular one, N3'→P5' thiophosphoramidate intersubunit linkages are replaced with N3'→P5' oxo-phosphoramidate intersubunit linkages. In one embodiment, the present invention relates to any one of the specific structures described herein, optionally in which one or more, in particular one, N3'→P5' thiophosphoramidate intersubunit linkages are replaced with N3'→P5' oxo-phosphoramidate intersubunit linkages.

[0136] In some cases, the compounds are more effective in causing telomerase inhibition in cells than the same polynucleotide that is not bound to the lipid component. It is believed that the lipid component L functions to enhance cellular uptake of the compound, in particular by facilitating permeation of the cell membrane. The mechanism by which this occurs is not fully understood, but one possibility is that the lipid component may facilitate the binding of the compound to the cell membrane, either as a single molecule or in aggregate (micelle) form, followed by internalization. However, understanding of the exact mechanism is not required to use the compounds.

[0137] The lipid component can be any lipid or lipid derivative that results in enhanced cellular uptake compared to unmodified polynucleotides. Lipids of interest include, but are not limited to, hydrocarbons, fats (e.g., glycerides, fatty acids and fatty acid derivatives, such as fatty acid amides), and sterols. When the lipid component is a hydrocarbon, the L component can be a substituted or unsubstituted cyclic hydrocarbon or an aliphatic straight or branched chain hydrocarbon, which can be saturated or unsaturated. Examples include fully saturated or polyunsaturated straight chain unbranched hydrocarbons. The length of the hydrocarbon chain can vary from C2 to C30, although maximum telomerase inhibition can be obtained with a carbon chain of C8 to C22. Examples of saturated hydrocarbons (alkanes) of interest are listed below. Organization Name / Carbon Chain Tetradecane C 14 H 30 Pentadecane C 15 H 32 Hexadecane C 16 H 34 Heptadecane C 17 H 36 Octadecane C 18 H 38 Nonadecane C 19 H 40 Eicosan C 20 H 42

[0138] Mono- and polyunsaturated forms of hydrocarbons (alkenes and polyenes, such as alkadienes and alkatrienes) may be selected, with compounds having one to three double bonds being of interest, although compounds having more double bonds may also be used. Alkynes (containing one or more triple bonds) and alkenynes (triple bond(s) and double bond(s)) may also be used.

[0139] Substituted forms of the hydrocarbon may be used in the compounds, and are of interest for substituents that are inactive in vivo and in vitro. In some cases, the substituent is fluorine. An exemplary general structure for the hydrocarbon is CF 3 (CF 2 ) n -(CH 2 ) m - (wherein m is at least 1, and optionally 2, and n is 1 to 30), such as fluorotridecane: CF 3 (CF 2 ) 9 (CH 2 ) 3 etc.; and C.H. 3 (CH 2 ) a (CF 2 ) b (CH 2 ) c - (wherein a, b and c are independently 1 to 30).

[0140] Other suitable lipid components of interest include, but are not limited to, simple fatty acids and fatty acid derivatives, glycerides, and more complex lipids such as sterols, e.g., cholesterol. Fatty acids and their derivatives of interest can be fully saturated or mono- or polyunsaturated. Carbon chain lengths can vary from C2 to C30, although maximal telomerase inhibition may be obtained with carbon chains of C8 to C22. Examples of saturated fatty acids of interest are listed below: Organization name / Common name / Carbon chain Tetradecanoic acid / myristic acid / 14:0 Hexadecanoic acid / palmitic acid / 16:0 Octadecanoic acid / stearic acid / 18:0 Eicosanoic acid / arachidic acid / 20:0

[0141] Mono- and polyunsaturated forms of fatty acids may be used, with compounds having one to three double bonds being of interest, although compounds having more double bonds may also be used. Examples of common mono- and polyunsaturated fatty acids of interest that may be used include: Organization name / Common name / Carbon chain cis-9-hexadecanoic acid / palmitoleic acid / 16:1(n-7) cis-6-octadecanoic acid / petroselinic acid / 18:1(n-12) cis-9-octadecanoic acid / oleic acid / 18:1(n-9) 9,12-Octadecadienoic acid / Linoleic acid / 18:2(n-6) 6,9,12-Octadecatrienoic acid / gamma-linoleic acid / 18:3(n-6) 9,12,15-Octadecatrienoic Acid / Alpha-Linoleic Acid / 18:3(n-3) 5,8,11,14-Eicosatetraenoic acid / arachidonic acid / 20:4(n-6)

[0142] Fatty acids with one or more triple bonds in the carbon chain, and branched chain fatty acids may also be used in the compounds. Substituted forms of fatty acids may also be used in the compounds. As well as hydrocarbon groups, in vivo and in vitro inert substituents, such as fluorine, are of interest. An exemplary general structure of a polyfluorinated derivative of a fatty acid suitable for use in the present invention is CF 3 (CF 2 ) n -(CH 2 ) m CO- (wherein m is at least 1, preferably 2, and n is 1 to 30), and CH 3 (CH 2 ) a (CF 2 ) b (CH 2 ) c CO- (wherein a, b and c are independently 1 to 30).

[0143] In some cases, one to five L components (n is 1, 2, 3, 4 or 5) are covalently attached to the O component via an optional linker. In some cases, one or two L components are used (n=1 or 2). When more than one L component is attached to the O component, each L component is independently selected.

[0144] It will be understood that the compounds of the present invention described as having a specific hydrocarbon as the L moiety and the compounds described as having a specific fatty acid (having the same number of carbon atoms as the specific hydrocarbon) are closely related and differ in structure only in the nature of the bond linking the L moiety to the polynucleotide, and this is the result of the synthetic procedure used to generate the compounds. For example, as described in more detail below, when synthesizing a compound (having a phosphoramidate or thiophosphoramidate internucleoside bond) having an L moiety attached to the 3'-amino terminus of a polynucleotide, the use of an aldehyde form of a fatty acid (fatty aldehyde) as a starting material results in the formation of an amine bond between the lipid chain and the polynucleotide, so that the lipid group appears as a hydrocarbon. In contrast, the use of a carboxylic acid, anhydride or acid chloride form of the same fatty acid results in the formation of an amide bond, so that the lipid group appears as a fatty acid derivative, in this case specifically a fatty acid amide (as described in the definition section, for simplicity, the term "fatty acid" is used broadly herein to include fatty acid derivatives, including fatty acid amides, when talking about the attached L group). This is illustrated in the following diagrams, which depict the 3'-amino terminus of a phosphoramidate polynucleotide linked to a C14 lipid component. In diagram A, L is tetradecanoic acid (myristic acid) and the bond between the L group and the O group is an amide. In diagram B, L is tetradecane and the bond between the L group and the O group is an amine. [ka]

[0145] The bond between the O and L components may be a direct bond or may be via an optional linker moiety, such as x or the optional linker T of formula (I). The linker group may serve to facilitate chemical synthesis of the compound. Whether or not a linker group is used to mediate the bond between the O and L components, there are multiple sites on the polynucleotide component O to which the L component(s) may be conveniently attached. Suitable attachment points include the 5' and 3' termini of the polynucleotide, one or more sugar rings, the internucleoside backbone and the nucleobases. In some cases, the L moiety is attached to the 3' or 5' terminus of the polynucleotide.

[0146] When the L component is attached to the 3' terminus, the attachment may be direct to the 3' substituent, which is a 3'-amino group in the case of the preferred phosphoramidate and thiophosphoramidate polynucleotides, and a 3-hydroxy group in other cases, such as conventional phosphodiester polynucleotides. Alternatively, the L moiety may be linked through a 3'-linked phosphate group, with the hexadecane hydrocarbon being linked to the 3' phosphate of the thiophosphoramidate polynucleotide via an O-alkyl linker. When the L moiety is linked to the 5' terminus, it may be linked through a 5'-linked phosphate group. The attachment to the base on the O moiety may be through any suitable atom, such as the N2 amino group of guanosine. When multiple lipid moieties are attached to the O component, with n>1, the individually selected L components may be attached at any convenient site(s). For example, one L group may be attached to each terminus, various L groups may be attached to the base, or two or more L groups may be attached at one terminus.

[0147] An optional linker component x may be used to link the O and L components of the compound. It is understood that the optional linker (e.g., x or T in formula (I)) may be attached to the polynucleotide (e.g., O) via a terminal phosphate group, such as a 3'-linked or 5'-linked phosphate group. When a linker is used, it is incorporated during the synthetic procedures described herein. Examples of suitable linker groups include aminoglycerol and O-alkylglycerol-based linkers, each of which can be represented by the following general structure: [ka] In the formula, R' is H, OH, NH 2 or SH, Y is O, S or NR, R is H, alkyl or substituted alkyl, and n and m are each independently an integer from 1 to 18. An example of a suitable linker of interest is the following: an aminoglycerol linker where R' is OH, Y is O, m and n are each 1: [ka] A bisaminoglycerol linker where R' is OH, Y is NH, m and n are each 1: [ka] and O-alkylglycerol linkers where R is H: [ka]

[0148] Exemplary lipid-modified polynucleotides that can be prepared according to the present methods include those compounds described in Figure 1 (e.g., Figures 1A-1DD) of U.S. Patent Application No. US20120329858 to Gryaznov et al. "Modified oligonucleotides for telomerase inhibition," the entire disclosure of which is incorporated herein by reference.

[0149] In one embodiment, the composition comprises: [ka] or a salt thereof, where "nps" represents a thiophosphoramidate bond (e.g., -NH-P(=O)(SH)-O- or a tautomer thereof, or a salt thereof) linking the 3'-carbon of one nucleoside to the 5'-carbon of an adjacent nucleoside. It is understood that the compounds described by the above formula may exist in salt form. Such forms, to the extent they may exist, are intended to be included within the scope of this disclosure. In certain embodiments, the composition comprises a pharma- ceutically acceptable salt of the compound. In some cases, the composition comprises a sodium salt of the compound. In certain embodiments, the composition comprises a divalent cation salt of the compound, such as a magnesium salt of the compound. In certain embodiments, the composition comprises a trivalent cation salt of the compound, such as an aluminum salt of the compound.

[0150] In some embodiments, the composition comprises a compound described by the structure: [ka] In the formula, each M x+ is independently hydrogen or any convenient counterion of a salt, each x is independently 1, 2 or 3, and n is an integer from 5 to 13. In some cases, n is 5, 6, 7, 8, 9, 10, 11, 12 or 13. In some cases, each x is independently 1, 2 or 3, and n is an integer from 5 to 12. In some cases, n is 13. In some cases, each x is independently 1. In some cases, each x is independently 1 or 2. In some cases, each x is independently 1 or 3. In some cases, each M x+ is independently a cationic counterion. In certain instances, each M x+ is independently a cationic counterion, each x is independently 1, 2, or 3, and n is an integer from 5 to 12. x+is independently hydrogen or any convenient cationic counterion, each x is independently 1, 2 or 3, and n is an integer from 5 to 12. x+ is hydrogen. In some embodiments, (M x+ ) n (Mg 2+ )(M + ) 11 In some embodiments, (M x+ ) n (Mg 2+ ) 2 (M + ) 9 In some embodiments, (M x+ ) n (Mg 2+ ) 2 (M + ) 9 In some embodiments, (M x+ ) 3 (Mg 2+ ) 3 (M + ) 7 In some embodiments, (M x+ ) n (Mg 2+ ) 4 (M + ) 5 In some embodiments, (M x+ ) n (Mg 2+ ) 5 (M + ) 3 In some embodiments, (M x+ ) n (Mg 2+ ) 6 (M + In some embodiments, (M x+ ) n (Mg 2+ )(M + ) 12 and Mg 2+ The counterion may form additional ion pairs with the anionic backbone of another oligonucleotide. In some embodiments, (M x+ )n (Mg 2+ ) 2 (M + ) 11 and Mg 2+ The counterion may form two additional ion pairs with the anionic backbone(s) of one or two other oligonucleotide(s). In some cases, the M + The counter ion is sodium. In some cases, the M of the mixed magnesium salt + The counter ion is ammonium. In some cases, the M of the mixed magnesium salt + The counterion is triethylammonium.

[0151] In certain embodiments, the compositions include compounds described by the following structures, and may include any convenient cationic counterion of the salt: [ka]

[0152] In certain embodiments, the composition comprises a compound described by the following structure: [ka]

[0153] Lipid-modified polynucleotides

[0154] Depending on the nature of the linkage selected, various synthetic approaches can be used to attach the lipid moiety L to the polynucleotide, see Mishra et al., (1995) Examples of approaches include those described in Biochemica et Biophysica Acta, 1264:229-237, Shea et al., (1990) Nucleic Acids Res. 18:3777-3783, and Rump et al., (1998) Bioconj. Chem. 9:341-349. Synthesis of compounds in which lipid moieties are attached at the 5' or 3' end of a polynucleotide can be achieved by using a suitable functional group, optionally an amino or hydroxyl group, at the relevant terminus that can react with carboxylic acids, acid chlorides, anhydrides, and active esters. Thiol groups can also be used as functional groups (Kupihar et al., (2001) Bioorganic and Medicinal Chemistry 9:1241-1247). Both amino and thiol modifiers of various chain lengths are commercially available for polynucleotide synthesis. Polynucleotides with N3'→P5' thiophosphoramidate linkages contain a 3'-amino group (rather than the 3'-hydroxy found in most conventional polynucleotide chemistries) and therefore offer a unique opportunity to attach lipid groups to the 3'-terminus of the polynucleotide.

[0155] A variety of approaches can be used to attach lipid groups to the termini of polynucleotides with N3'→P5' thiophosphoramidate chemistry (e.g., palmitoylamido-1-O-(4,4'-dimethoxytrityl)-2-O-succinylpropanediol linkers). For attachment to the 3' terminus, the attached compound can be synthesized by reacting the free 3'-amino group of a fully protected solid support-bound polynucleotide with the corresponding acid anhydride, followed by deprotection with ammonia and purification. Alternatively, lipids can be attached using coupling of the carboxylic acid of the lipid to the free 3'-amino group of the support-bound polynucleotide using coupling agents such as carbodiimide, HBTU (N,N,N',N'-tetramethyl-O-(1H-benzotriazol-1-yl)uronium hexafluorophosphate) or 2-chloro-1-methylpyridinium iodide. These two methods form an amide bond between the lipid and the polynucleotide. Lipids can also be attached to polynucleotide chains using phosphoramidite derivatives of lipids that are attached to polynucleotides during chain elongation.This approach can produce phosphoramidate (e.g. thiophosphoramidate) bonds that link lipids and polynucleotides (exemplified by propyl-palmitoyl and 2-hydroxy-propyl-palmitoyl compounds).Yet another approach involves reacting the free 3'-amino group of fully protected carrier-bound polynucleotide with a suitable lipid aldehyde, followed by reduction with sodium cyanoborohydride, to produce amine bonds.

[0156] For attachment to the 5' end, polynucleotides can be synthesized by using modified lipid-containing solid supports as described in Pongracz & Gryaznov (1999) and then synthesizing the polynucleotide in the 5' to 3' direction. Examples of modified supports are shown below. For n=14, the fatty acid is palmitic acid and 3-amino-1,2-propanediol was reacted with palmitoyl chloride followed by dimethoxytritylation and succinylation to provide an intermediate for coupling to the solid support. In some cases, R can be a long chain alkylamine controlled pore glass. In some cases, R is a polymeric solid support. [ka]

[0157] utility For example, the methods and compositions of the invention, as described above, are useful in a variety of applications, including, but not limited to, therapeutic, diagnostic, research, and screening applications, as outlined in more detail below.

[0158] The compounds are useful in a variety of therapeutic applications. In some embodiments, the method for producing polynucleotides is applied to prepare polynucleotides that provide therapeutic effects. The types of diseases that can be treated using the compositions of the present invention are not limited. For example, the compositions can be used to treat a number of genetic diseases. In some embodiments, the methods and compositions have antisense applications. In some embodiments, the methods and compositions have antigene applications. In some embodiments, the methods and compositions have telomerase inhibition applications, such as those described in U.S. Patent No. 6,835,826 and U.S. Patent Publication No. 20120329858, the entire disclosures of which are incorporated herein by reference.

[0159] The present disclosure provides compounds that can specifically and potently inhibit telomerase activity and therefore can be used to inhibit the proliferation of telomerase-positive cells, such as tumor cells. A wide variety of cancer cells have been found to be telomerase-positive, including cells from skin, connective tissue, fat, breast, lung, stomach, pancreas, ovary, cervix, uterus, kidney, bladder, colon, prostate, central nervous system (CNS), retina cancers, and hematological tumors (such as myeloma, leukemia, and lymphoma). Cancers of interest include, but are not limited to, myelofibrosis, thrombocythemia, myelodysplastic syndrome, and myeloid leukemia.

[0160] The compounds can be used to treat hematological malignancies and myeloproliferative disorders, including, but not limited to, essential thrombocythemia (ET), polycythemia vera (PV), chronic myelogenous leukemia (CML), myelofibrosis (MF), chronic neutrophilic leukemia, chronic eosinophilic leukemia, and acute myelogenous leukemia (AML). The compounds can be used to treat myelodysplastic syndromes, including diseases such as refractory anemia, refractory anemia with blasts, refractory cytopenia with multilineage dysplasia, refractory cytopenia with single lineage dysplasia, and chronic myelomonocytic leukemia (CMML). The compounds can be used to treat hematological disorders, such as those described in PCT Patent Application No. PCT / US13 / 070437, filed November 15, 2013, the entire disclosure of which is incorporated herein by reference.

[0161] Thus, the compounds defined herein are broadly useful for treating a wide range of malignant diseases. In some cases, the compounds can be effective in providing a treatment that is highly discriminatory between malignant and normal cells and avoids many of the adverse side effects present in most current chemotherapy regimens that rely on agents that indiscriminately kill dividing cells. Moreover, in some cases, the lipid-modified compounds are more potent than comparable unconjugated oligonucleotides, meaning that they can be administered in smaller doses, resulting in improved safety and significantly reduced treatment costs. Telomerase inhibitors can be used in conjunction with other cancer treatment approaches, including surgical resection of the primary tumor, chemotherapy agents, and radiation therapy. Thus, the present invention relates to compounds and compositions defined herein for use as pharmaceuticals. The present invention also relates to compounds and compositions defined herein for use in treating or preventing any one of the above malignant diseases.

[0162] The compounds and methods are useful in a variety of diagnostic applications, including but not limited to the development of clinical diagnostics, such as in vitro diagnostics or in vivo tumor imaging agents. Such applications are useful for diagnosing a disease state or disease susceptibility or for confirming a diagnosis. The methods are also useful for monitoring disease progression and / or response to treatment in patients previously diagnosed with the disease. EXAMPLES

[0163] Example 1: Overview

[0164] These examples describe experiments to prepare various divalent or trivalent forms of Imetelstat, such as Ca, Ba, Mg, Al, Fe, Cu, and Zn, from the sodium salt form of Imetelstat. In these experiments, improvements in purity were evaluated using a preparation method that involves the formation and isolation of salts of bidentate or tridentate cations that can bind to one, two, or three phosphate groups of Imetelstat. The solubility and osmolality of the resulting salt forms were also examined.

[0165] CaCl 2 , MgCl2 , BaCl 2 , CuCl 2 , ZnCl 2 , AlCl 3 , FeCl 2 , and FeCl 3 Using this method, the preparation of imetelstat calcium, imetelstat barium, imetelstat magnesium, imetelstat aluminum, Fe(II or III) imetelstat, and cupric imetelstat salts was investigated.

[0166] Three methods of salt exchange were investigated: use of a strong cation exchange resin (FINEX MFG 210), precipitation, and simple dissolution. Imetelstat sodium was replaced with CaCl 2 , BaCl 2 or MgCl 2 When the resin was passed through the resin, the eluate contained a fine powder, indicating that the sodium counterions from the Imetelstat backbone had been successfully exchanged and replaced with calcium, barium or magnesium counterions. 2 , ZnCl 2 , AlCl 3 , FeCl 2 , FeCl 3 ) when the Imetelstat solution was passed through it, the top of the resin in the column was aggregated, again indicating successful exchange of the sodium counter ion from the Imetelstat backbone.

[0167] The precipitation and dissolution method was also tested using an excess of salt reagent. When a large excess of salt reagent (e.g., 900 equivalents) was treated with sodium imetelstat, a precipitate formed. The precipitate was isolated by filtration. Subsequent testing indicates that 7-50 equivalents of inorganic salt reagent were required to convert all of the imetelstat to a precipitate.

[0168] Five equivalents of three inorganic salts (Mg, Ba or Ca) were treated with either Imetelstat TEA (triethylammonium) salt form or Imetelstat Na salt form, respectively. After ensuring that no precipitation occurred, the solutions were desalted and lyophilized. Analysis of the lyophilized powder by flame AA (atomic absorption spectrometry) showed that some of the sodium counterions of Imetelstat had been exchanged.

[0169] MgCl 2 Further experiments were carried out with 1 to 9 equivalents of magnesium cation relative to the imetelstat form in. The sodium counterion was partially exchanged for a Mg counterion, with 9 equivalents of MgCl. 2 The most exchange occurred at 0.05 wt.%, and the resulting composition showed 1.2 wt.% Na and 1.1 wt.% Mg.

[0170] Example 2: Materials and Equipment

[0171] Inorganic reagents, organic solvents, and other materials used in the study are listed in Table 1. Imetelstat sodium (CAS #1007380-31-5) provided by Geron, Lot #G163 / LG-13002, was used in the study. Imetelstat ammonium is a crude composition obtained by cleavage of imetelstat from a solid-phase synthesis support using ammonia and ethanol (e.g., as described by Gryaznov et al. in US 20120329858) and was obtained from manufacturer's stock. Imetelstat TEA (triethylammonium form) is a composition obtained from HPLC purification column eluate using triethylammonium acetate (TEAA)-containing mobile phase (e.g., as described by Gryaznov et al. in US 20120329858) and was obtained from manufacturer's stock obtained from various process development studies. Ultrafiltration was performed using a 1KD The purification was performed using a stirred ultrafiltration cell equipped with a PES membrane (Amicon 8400, Millipore). Lyophilization was performed using a high-speed vacuum concentrator (ScanSpeed ​​40, LaboGene).

[0172] Example 3: Procedure

[0173] Exchange by ion exchange resin column A column of strong cation exchange resin, FINEX MFG 210, was prepared to a column volume of 200 mL (4.6 cm x 12 cm) and the resin was washed with 1 M NaOH and water. The column was then equilibrated with 1 M solutions of each salt of interest. A total of eight 1 M salt solutions were prepared and used in these experiments (CaCl 2 , MgCl 2 , BaCl 2 , CuCl 2 , ZnCl 2 , AlCl 2 , FeCl 2 , and FeCl 3 50 mL of a 100 mg / mL solution of imetelstat sodium was added to the column.

[0174] CuCl 2 , ZnCl 2 , AlCl 2 , FeCl 2 and FeCl 3 In the case of the equilibrated column, when sodium imetelstat was added onto the column, aggregation of imetelstat on the resin was observed at the top of the column.

[0175] CaCl 2 , MgCl 2 and BaCl 2 In the three columns equilibrated with 1000 mL of ...

[0176] By precipitation

[0177] The crystallization or precipitation of the divalent or trivalent forms of Imetelstat was investigated using a large excess of the inorganic salt of interest (900 equivalents, by weight). 1M salt solution CaCl 2 , MgCl 2 , BaCl 2 , CuCl 2 , ZnCl 2 , AlCl 2 , FeCl 2 , and FeCl 3 Three types of imetelstat solutions were prepared: crude imetelstat solution (ammonium salt), purified imetelstat (triethylammonium (TEA) salt form), and imetelstat sodium (Na salt form) were mixed with each salt solution.

[0178] Precipitation of imetelstat was observed in all mixed solutions and was easily isolated by filtration through Advantec 2 filter paper, indicating successful precipitation and separation of the multivalent salt of imetelstat.

[0179] The solubility of the isolated precipitates under conditions of large excess of salt reagent was first investigated using the following solvents: water, acetonitrile, MeOH, EtOH, IPA (isopropyl alcohol), 0.1 M NaOH, 0.1 M HCl, 1 M NaCl, and NMP.

[0180] For salts precipitated in large excess salt reagents, calcium, barium, and magnesium salts of Imetelstat were soluble in 0.1 M NaOH and 1 M NaCl solutions (see Table 2). Solubility studies of Imetelstat precipitates obtained from large excess magnesium salt reagents were carried out in 1 M NaCl solutions at different concentrations (2 mg / mL to 6 mg / mL) and under different pH conditions (pH 8, 9, 10, 11, 12) and analyzed by HPLC (see chromatograms in Figure 1). Imetelstat precipitates were observed to be soluble at 6 mg / mL and pH 11 to pH 12. The compound also showed stability without precipitation up to pH 12 (Figure 1).

[0181] Dissolution

[0182] 30-50 equivalents of salt reagent

[0183] By adding the salt reagent in a stepwise manner, the number of equivalents of the target salt reagent at which complete precipitation of imetelstat could be achieved was investigated. For the eight salts listed in Table 3, complete formation of a precipitate was observed in the range of 7 to 50 equivalents of the salt reagent added. When larger equivalents of the salt reagent were added, a tendency towards gel formation due to precipitation was observed for all salts.

[0184] Three different imetelstat solutions were used and mixed with each salt solution: crude imetelstat ammonium (crude form), imetelstat triethylammonium (purified TEA salt form), and imetelstat sodium (Na salt form). The imetelstat ammonium salt is NH 4 The immersion ammonium and immersion TEA solutions were used as either OH or aqueous solutions. The immersion ammonium and immersion TEA solutions required approximately 50 or 30 equivalents of Mg salt reagent, respectively, to achieve complete precipitation.

[0185] The solubility of precipitates formed from Imetelstat TEA and Imetelstat ammonium solutions was investigated under various pH conditions from pH 8 to pH 12. After the mixed solutions were left at room temperature for 6 hours, the solubility of the Imetelstat-Mg precipitates was analyzed by UV absorbance at 260 nm. Both precipitates obtained from Imetelstat ammonium and Imetelstat TEA showed a similar trend in that more Imetelstat salt dissolved in 1 M NaCl solution at higher pH (see Table 3).

[0186] This result indicates that complete precipitation of the Imetelstat salt can be achieved by any convenient method, by controlling the number of equivalents of the salt reagent of interest relative to Imetelstat, to produce a precipitate that can be successfully redissolved.

[0187] 5 equivalents of salt reagent

[0188] Imetelstat sodium solution (100 mg in 1 mL water) was mixed with 5 equivalents of the eight salt reagents, and each solution was desalted by ultrafiltration using a stirred ultrafiltration cell and a 1 KD membrane. The ultrafiltrate solution was then freeze-dried. The resulting powder was analyzed by flame AA (atomic absorption spectroscopy) for Na and each metal counterion of interest. As shown in Figures 2 and 3, the maximum metal counterion content was 1.1 wt% for Zn, Al, and Mg, and the Na content was 2.6%, 1.7%, and 2.6%, respectively.

[0189] 6 to 9 equivalents of salt reagent

[0190] Six to nine equivalents of magnesium salt reagent were added to the imetelstat sodium solution, followed by ultrafiltration and lyophilization to obtain a completely water-soluble solid product. Analysis of sodium and magnesium content was performed (see results in Figure 3). Nine equivalents of MgCl were added to the imetelstat sodium solution. 2 The addition of produces a composition with Na and Mg counterion contents of 1.1% and 1.2% by weight, respectively.

[0191] 1 to 10 equivalents of salt reagent

[0192] Another series of experiments was designed and carried out to investigate the exchange of Mg with the TEA counterion in Imetelstat TEA salt compared to Imetelstat sodium salt. 2 was mixed with Imetelstat TEA salt solution (>90% purity by HPLC). Analysis of Mg counterion content was performed after ultrafiltration and lyophilization. The results are shown in Figure 4. Up to 10 equivalents of MgCl 2 The addition of reagents produced a composition having 1.6 wt % Mg.

[0193] Example 4: Conclusion

[0194] The preparation of divalent and trivalent salt forms of Imetelstat including calcium, magnesium, zinc, aluminum, barium, iron(II), iron(III) and copper salts has been achieved. When selected inorganic salt reagents were used in controlled excess to precipitate polynucleotides (see Figures 2 and 3), precipitates were formed that could then be redissolved and showed improved purity with respect to fast eluting impurities using HPLC analysis.

[0195] The use of magnesium salt reagents produced a soluble solid precipitate of Imetelstat after the exchange step. A precipitate was produced that achieved 1.2 wt. % magnesium counterion for 1.1 wt. % sodium counterion.

[0196] Precipitation of imetelstat with divalent or trivalent salts results in the removal of non-target synthesis products and reagents remaining in solution. Removal of such impurities present in the crude imetelstat solution provides several advantages to the subsequent chromatographic purification step of imetelstat, such as reduced column loading, improved resolution, reduced number of chromatographic purification steps and improved chromatographic column life, reduced purification costs and faster purification. [Table 1] [Table 2] [Table 3]

[0197] Notwithstanding the claims set forth below, the disclosure described herein is also defined by the following clauses.

[0198] a polynucleotide having a sequence of 1.7 or more nucleoside subunits, at least two of said nucleoside subunits being linked by an N3'→P5' thiophosphoramidate intersubunit linkage; and non-targeted synthesis products and reagents; contacting a first polynucleotide composition comprising the polyvalent cation salt with a polyvalent cation salt to precipitate a first polynucleotide salt comprising at least one polyvalent cation counterion; and separating said first polynucleotide salt from said contacted first polynucleotide composition to produce a second polynucleotide composition comprising said first polynucleotide salt; A method for preparing a polynucleotide comprising:

[0199] 2. The method of clause 1, further comprising contacting said first polynucleotide salt with a reverse phase chromatography support; and eluting a third polynucleotide composition comprising the second polynucleotide salt from the chromatography support.

[0200] 3. The method of any one of clauses 1 to 2, wherein the polynucleotide comprises a sequence comprising 13 or more nucleoside subunits that are complementary to the RNA component of human telomerase.

[0201] 4. The method of any one of clauses 1 to 3, wherein the polynucleotide comprises 10 to 50 consecutive nucleoside subunits complementary to the RNA component of human telomerase.

[0202] 5. The method of any one of clauses 3-4, wherein all of the nucleoside subunits complementary to the RNA component of human telomerase are linked by N3'→P5' thiophosphoramidate intersubunit linkages.

[0203] 6. The method of any one of clauses 1 to 5, wherein said polynucleotide comprises a sequence selected from the group consisting of GTTAGGGTTAG (SEQ ID NO: 4), TAGGGTTAGACAA (SEQ ID NO: 3) and CAGTTAGGGTTAG (SEQ ID NO: 5).

[0204] 7. The method of any one of clauses 1 to 6, wherein the polynucleotide is linked to a lipid moiety via an optional linker.

[0205] 8. The second polynucleotide salt has the structure: [ka] In the formula, each M x+ is independently hydrogen or a cationic counterion; each x is independently 1, 2 or 3; and n is an integer from 5 to 13.

[0206] 9. The method of any one of clauses 2 to 8, wherein said second polynucleotide salt is a pharma- ceutically acceptable salt of said polynucleotide.

[0207] 10. The method of any one of clauses 2 to 9, wherein the second polynucleotide salt is a monovalent cation salt of the polynucleotide.

[0208] 11. The method of any one of clauses 2 to 10, wherein the second polynucleotide salt is a sodium salt of the polynucleotide.

[0209] 12. The method of any one of clauses 1-5, further comprising cleaving said polynucleotides from the support to produce said first polynucleotide composition.

[0210] 13. The method of any one of clauses 1-12, wherein the first composition comprises a monovalent cation salt of the polynucleotide.

[0211] 14. The method of any one of clauses 1-13, wherein said contacting step comprises eluting said first polynucleotide composition from a cation exchange support.

[0212] 15. The method of any one of clauses 1-14, wherein said separating step comprises centrifuging said contacted first polynucleotide composition to spin down a precipitate of said polynucleotide salts.

[0213] 16. The method of any one of clauses 1-15, wherein said separating step comprises filtering said polynucleotide salts from said contacted first polynucleotide composition.

[0214] 17. The method of clause 2, wherein the second polynucleotide composition is loaded directly onto the reverse phase chromatography support.

[0215] 18. The method of any one of clauses 1-17, further comprising dissolving said second polynucleotide composition in a solvent.

[0216] 19. The method of any one of clauses 1-18, wherein the at least one multivalent cation counterion is divalent.

[0217] 20. The method of claim 19, wherein the at least one multivalent cation counterion is selected from the group consisting of magnesium, zinc and calcium.

[0218] 21. The method of any one of clauses 1-18, wherein the at least one multivalent cation counterion is trivalent.

[0219] 22. The method of claim 21, wherein the at least one multivalent cation counterion is aluminum.

[0220] 23. The method of any one of clauses 1-22, wherein the polynucleotide salt further comprises a monovalent cation counterion.

[0221] 24. A composition comprising a salt of a polynucleotide comprising at least one multivalent cation counterion, said polynucleotide having a sequence of seven or more nucleoside subunits complementary to an RNA component of human telomerase, at least two of the nucleoside subunits being linked by an N3'→P5' thiophosphoramidate intersubunit linkage.

[0222] 25. The composition of claim 24, wherein the at least one multivalent cation counterion is divalent.

[0223] 26. The composition of claim 25, wherein the at least one multivalent cation counterion is selected from the group consisting of magnesium, zinc and calcium.

[0224] 27. The composition of any one of clauses 24-26, wherein the at least one multivalent cation counterion is magnesium.

[0225] 28. The composition described in clause 24, wherein the at least one multivalent cation counterion is trivalent.

[0226] 29. The composition according to clause 28, wherein the at least one multivalent cation counterion is aluminum.

[0227] 30. The composition according to any one of clauses 24 to 29, wherein said polynucleotide comprises 3 mol % or more of said multivalent cation counterion relative to the polyanionic backbone of said polynucleotide.

[0228] 31. The composition of any one of clauses 24 to 29, wherein said polynucleotide comprises 1.0% by weight or more of said multivalent cation counterion relative to said polynucleotide.

[0229] 32. The composition of any one of clauses 24 to 31, which is a precipitate.

[0230] 33. The composition of any one of clauses 24 to 32, wherein the polynucleotide comprises a sequence comprising 13 or more nucleoside subunits that are complementary to the RNA component of human telomerase.

[0231] 34. The composition of any one of clauses 24 to 33, wherein the polynucleotide comprises 10 to 50 consecutive nucleoside subunits complementary to the RNA component of human telomerase.

[0232] 35. The composition of any one of clauses 24-34, wherein the nucleoside subunits complementary to the RNA component of human telomerase are all linked by N3'→P5' thiophosphoramidate intersubunit linkages.

[0233] 36. The composition of any one of clauses 24 to 35, wherein the polynucleotide comprises a sequence selected from the group consisting of GTTAGGGTTAG (SEQ ID NO: 4), TAGGGTTAGACAA (SEQ ID NO: 3) and CAGTTAGGGTTAG (SEQ ID NO: 5).

[0234] 37. The composition of any one of clauses 24 to 36, wherein the polynucleotide is linked to a lipid moiety via an optional linker.

[0235] 38. The polynucleotide having the following structure: [ka] In the formula, each M x+ is independently a cationic counterion, each x is 1, 2 or 3, and n is 5 to 12.

[0236] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those skilled in the art in light of the teachings of the invention that certain changes and modifications can be made without departing from the spirit or scope of the appended claims.

[0237] Thus, the foregoing merely illustrates the principles of the present invention. It will be appreciated that those skilled in the art can devise various adaptations that embody the principles of the present invention and are included within its spirit and scope, even though not expressly described or presented herein. Furthermore, all examples and conditional language described herein are intended primarily to aid the reader in understanding the principles of the present invention and the concepts provided by the inventors to advance the art, and should not be construed as being limited to such specifically described examples and conditions. Moreover, all statements herein that describe the principles, aspects, and embodiments of the present invention, as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. In addition, such equivalents are intended to include both currently known equivalents and equivalents developed in the future, i.e., any developed elements that perform the same function, regardless of structure. Thus, it is not intended that the scope of the present invention be limited to the embodiments shown and described herein. Rather, the scope and spirit of the present invention is embodied by the appended embodiments. It is believed that all possible combinations of the above embodiments are within the scope of the present invention.

Claims

[Claim 1] A method or composition as described in the specification.

Images