Method for detecting target molecules

Abstract

To provide a technique for detecting target molecules present both inside and outside a structure.SOLUTION: A method for detecting a surface target molecule and an internal target molecule of a structure includes: an introduction step of bringing a liquid in which a structure is dispersed into contact with a well array having a plurality of wells, and introducing the structure into the wells; an encapsulation step of bringing a sealing liquid into contact with the well array and encapsulating the structure within the wells; an extraction step of extracting contents of the structure within the wells; a surface target molecule detection step of detecting at least one type of surface target molecule present on the surface of the structure within the wells; and an internal target molecule detection step of detecting at least one type of internal target molecule present inside the structure within the wells.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a method for detecting a target molecule, and more specifically, to a method for detecting a surface target molecule present on the surface of a structure and an internal target molecule present inside a structure, and a method and kit for evaluating a structure. This application claims priority to Japanese Patent Application No. 2019-095187, filed on May 21, 2019, the contents of which are incorporated herein by reference. [Background technology]

[0002] Quantitative detection of target molecules in biological samples is used for early detection of diseases and prediction of the effectiveness of medication. Traditionally, protein quantification has been performed using enzyme-linked immunosorbent assay (ELISA) and nucleic acid quantification has been performed using real-time PCR.

[0003] In recent years, there is an increasing need to detect target molecules with higher accuracy for the purpose of early detection of diseases, etc. As a method for detecting target molecules with higher accuracy, for example, Patent Document 1, Patent Document 2, and Non-Patent Document 1 disclose a technique for performing an enzyme reaction in a large number of microcompartments. These methods are called digital measurement.

[0004] In digital measurement, the sample solution is divided into an extremely large number of micro-solutions. Then, the signal from each micro-solution is binarized, and the number of target molecules is measured by determining only whether the target molecule is present or not. Digital measurement can significantly improve detection sensitivity and quantification compared to conventional ELISA and real-time PCR methods.

[0005] In digital PCR, a mixture of PCR reaction reagents and nucleic acids is diluted so that one microdroplet contains zero or one template nucleic acid. In digital PCR, in order to increase the sensitivity of nucleic acid amplification and to simultaneously amplify nucleic acids for a large number of microdroplets, it is preferable that the volume of each microdroplet is small. For example, Patent Document 3 discloses an array-shaped reaction vessel formed so that the volume of each well is 6 nL (nanoliter). Patent Document 1 also discloses a method in which a sample is introduced into each well by flowing the sample into a flow path formed with a large number of wells with a depth of 3 μm and a diameter of 5 μm, and then the excess reagent in the flow path is pushed out with oil to introduce the sample into each well. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] Patent No. 6183471 [Patent Document 2] Special Publication No. 2014-503831 [Patent Document 3] International Publication No. 2013 / 151135 [Non-patent literature]

[0007] [Non-Patent Document 1] Kim SH, et al., Large-scale femtoliter droplet array for digital counting of single biomolecules., Lab on a Chip, 12 (23), 4986-4991, 2012. Summary of the Invention [Problem to be solved by the invention]

[0008] An object of the present invention is to provide a technique for detecting target molecules present both outside and inside a structure. [Means for solving the problem]

[0009] The present invention includes the following aspects. [1] A method for detecting surface target molecules and internal target molecules of a structure, comprising: contacting a liquid in which structures are dispersed with a well array having a plurality of wells and introducing the structures into the wells; contacting the well array with a sealing liquid to seal the structures in the wells; extracting the contents of the structures within the wells; detecting at least one type of surface target molecule present on the surface of the structure within the wells; and detecting at least one type of internal target molecule present inside the structure within the wells. [2] The method according to [1], wherein extracting the contents of the structure, detecting the surface target molecule, and detecting the internal target molecule are performed after encapsulating the structure within the well. [3] The method according to [1] or [2], wherein detecting the surface target molecule and detecting the internal target molecule are performed after extracting the contents of the structure. [4] The method according to any one of [1] to [3], wherein the detection of the surface target molecule and the detection of the internal target molecule are carried out simultaneously. [5] The method according to any one of [1] to [4], wherein detecting the surface target molecule and detecting the internal target molecule are carried out under the same conditions. [6] The method according to any one of [1] to [5], wherein each of the surface target molecule and the internal target molecule is at least one type of molecule selected from the group consisting of nucleic acids, proteins, sugars, lipids, or complexes thereof. [7] The method according to any one of [1] to [6], wherein the surface target molecule comprises a protein and the internal target molecule comprises a nucleic acid. [8] The method according to any one of [1] to [7], wherein the internal target molecule is detected by a nucleic acid detection technique. [9] The method according to [8], wherein the nucleic acid detection technique is an Invasive Cleavage Assay.

[10] The method according to any one of [1] to [9], wherein a signal detected when detecting the surface target molecule and a signal detected when detecting the internal target molecule are distinguishable from each other.

[11] The method according to any one of [1] to

[10] , wherein the structure is any one selected from the group consisting of a virus, an exosome, a cell, and an endoplasmic reticulum.

[12] The method according to any one of [1] to

[11] , wherein the structure forms a complex with a capture substance, and the capture substance is a conjugate between a solid phase and a substance that specifically binds to the structure.

[13] The method according to

[12] , wherein the specific binding substance is an antibody.

[14] The method according to any one of [1] to

[13] , wherein the extracting of the contents of the structure comprises heating the structure in a liquid containing a surfactant.

[15] The method according to any one of [1] to

[14] , wherein in introducing the structures into the wells, not more than one structure is introduced per well.

[16] A method for evaluating a structure, comprising: detecting the presence or absence of the surface target molecule and the internal target molecule for each well by the method described in

[15] ; and evaluating the structure based on the detection results of the surface target molecule and the detection results of the internal target molecule.

[17] A kit for detecting surface target molecules and internal target molecules of a structure, comprising: a well array having a plurality of wells; a reagent for extracting contents from the structure; a reagent for detecting at least one surface target molecule present on the surface of the structure; and a reagent for detecting at least one internal target molecule present inside the structure. Effect of the Invention

[0010] According to the present invention, a technique for detecting target molecules present both outside and inside a structure can be provided. [Brief description of the drawings]

[0011] [Figure 1]FIG. 1 is a schematic cross-sectional view showing an example of a fluid device. [Diagram 2] FIG. 1 is a schematic cross-sectional view showing an example of a fluid device. [Diagram 3] FIG. 1 is a schematic cross-sectional view showing an example of a fluid device. [Figure 4] FIG. 1 is a schematic cross-sectional view showing an example of a fluid device. [Diagram 5] FIG. 1 is a schematic cross-sectional view showing an example of a fluid device. [Figure 6] FIG. 1 is a schematic cross-sectional view showing an example of a fluid device. [Figure 7A] FIG. 13 is a schematic diagram showing a state in which a structure is contained in a minute compartment formed by a well and sealing liquid L120. [Figure 7B] FIG. 13 is a schematic diagram showing the state in which the internal target molecule is extracted from the structure after the extraction step. [Figure 8A] FIG. 1 is a schematic diagram showing a state in which a structure is introduced and sealed in a well using a capture agent, and is contained in a microcompartment formed by the well and a sealing liquid. [Figure 8B] FIG. 13 is a schematic diagram showing the state in which the internal target molecule is extracted from the structure after the extraction step. [Figure 9] 6 is a photograph showing the results of fluorescence observation in Example 2. [Figure 10] 1 is a graph showing the results of measuring the change in fluorescent signal over time in Example 3. [Figure 11] 1 is a graph showing the results of measuring the change in fluorescent signal over time in Example 4. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] Hereinafter, an embodiment of the present invention will be described in detail with reference to the drawings as needed. In the drawings, the same or corresponding parts are denoted by the same or corresponding reference numerals, and duplicate explanations will be omitted. In addition, the dimensional ratios in each drawing are exaggerated for the purpose of explanation, and do not necessarily correspond to the actual dimensional ratios.

[0013] [Method for detecting surface and internal target molecules of a structure] In one embodiment of the present invention, a method for detecting surface target molecules and internal target molecules of a structure is provided, comprising: contacting a liquid in which structures are dispersed with a well array having a plurality of wells and introducing the structures into the wells; contacting a sealing liquid with the well array to seal the structures within the wells; extracting the contents of the structures within the wells; detecting at least one type of surface target molecule present on the surface of the structure within the wells; and detecting at least one type of internal target molecule present inside the structure within the wells. Incidentally, introducing the structure may be expressed as an introduction step. Similarly, extracting the contents of the structure may be expressed as an extraction step. Detecting the surface target molecule may be expressed as a surface target molecule detection step. Detecting the internal target molecule may be expressed as an internal target molecule detection step.

[0014] As described later in the Examples, the method of this embodiment makes it possible to detect at least one type of surface target molecule present on the surface of a structure, and at least one type of internal target molecule present inside the structure.

[0015] In this specification, the term "surface target molecule" refers to a molecule that is exposed on the surface of a structure and is a detection target. The term "internal target molecule" refers to a molecule that is contained inside a structure and is not exposed on the surface and is a detection target. In order to detect an internal target molecule, it is necessary to extract the contents from the structure and expose the internal target molecule.

[0016] According to the method of this embodiment, it is also easy to detect surface target molecules and internal target molecules at the single structure level.

[0017] (structure) The structure is not particularly limited as long as it has a surface on which the surface target molecule is exposed and an internal structure containing an internal target molecule, and any structure can be used. Specific examples of the structure include viruses, exosomes, cells, and endoplasmic reticulum. Examples of the cell include eukaryotic cells and prokaryotic cells. Examples of the eukaryotic cells include animal cells, plant cells, insect cells, yeast cells, and fungal cells. Examples of the prokaryotic cells include bacteria. Examples of the endoplasmic reticulum include the endoplasmic reticulum, which is an intracellular organelle, and natural or artificial membrane vesicles composed of lipid membranes. The structure may be present in a biological sample. Examples of the biological sample include serum, plasma, and urine.

[0018] (Well) The well array has a plurality of wells, and the shape and arrangement of each well are not particularly limited as long as the wells have a size that allows them to accommodate the structures described above and reagents used in extracting the contents of the structures, detecting surface target molecules, and detecting internal target molecules, as described below.

[0019] Furthermore, the wells may be used without any treatment, or, depending on the purpose, an extraction reagent for extracting the contents of the structure, an antibody, a substance that specifically binds to the structure, etc. may be immobilized in advance on the inner wall of the well.

[0020] (Fluid Devices) FIG. 1 is a schematic cross-sectional view showing an example of a fluidic device. As shown in FIG. 1, a well array 140 may be disposed adjacent to a channel 130 of a fluidic device 100 having the channel 130. As shown in FIG. 1, the fluidic device 100 includes a substrate 110 and a cover member 120 (which may be simply described as a cover 120) disposed opposite the substrate 110. The cover member 120 has a protrusion 121. The tip of the protrusion 121 is in contact with the substrate 110. In the fluidic device 100, the well array 140 is integrally molded with the substrate 110 on one side of the substrate 110 and faces the cover member 120. The well array 140 has a plurality of wells 141. The plurality of wells are connected to the channel 130. The cover member 120 may be welded or bonded to the substrate 110.

[0021] The well 141 has an opening on the surface of the substrate 110. The shape, size, and arrangement of the well 141 are not particularly limited, but it is preferable that one structure is introduced into one well 141. The well 141 is preferably a microwell with a small volume. For example, the volume of one well 141 may be about 10 fL to 100 pL. In the fluidic device 100, a plurality of wells 141 of the same shape and size constitute a well array 140. The same shape and size means that the wells have the same shape and the same volume to the extent required for digital measurement, and variations of the order of manufacturing error are acceptable.

[0022] The diameter of well 141 may be, for example, about 1 to 10 μm. The depth of well 141 may be, for example, about 1 to 10 μm. The arrangement of wells 141 is not particularly limited, and may be, for example, arranged in a triangular lattice pattern, a square lattice pattern, or randomly arranged.

[0023] In the fluidic device 100, a space is formed between the well array 140 and the cover member 120 due to the presence of the convex portion 121. This space constitutes the flow path 130. The flow path 130 functions as a path for transporting the liquid in which the structures are dispersed and the sealing liquid. The shape, structure, capacity, and the like of the flow path 130 are not particularly limited, but the height of the flow path 130, that is, the distance between the surface of the substrate 110 and the surface of the cover member 120 facing the substrate 110, may be, for example, 500 μm or less, for example, 300 μm or less, for example, 200 μm or less, or for example, 100 μm or less.

[0024] The convex portion 121 may be molded integrally with the cover member 120. The cover member 120 can be molded into a plate shape having the convex portion 121, for example, by molding a thermoplastic resin fluid using a molding die. Furthermore, the cover member 120 may be formed with an inlet port 122 and an outlet port 123 for a reagent.

[0025] When the lid member 120 has a protrusion 121, the lid member 120 and the substrate 110 are overlapped so that the protrusion 121 contacts the surface of the substrate 110 where the well 141 opens. As a result, the space between the lid member 120 and the substrate 110 becomes a flow path. The lid member 120 and the substrate 110 may be welded by laser welding or the like.

[0026] (Variation 1 of Fluidic Device) The fluidic device used in the method of this embodiment is not limited to the above-mentioned fluidic device 100. Fig. 4 is a schematic cross-sectional view showing an example of a fluidic device. As shown in Fig. 4, fluidic device 200 includes substrate 110 and wall member 210 (which may be simply referred to as wall portion 210). In fluidic device 200, well array 140 is integrally formed with substrate 110 on one side of substrate 110. Well array 140 has a plurality of wells 141.

[0027] The fluidic device 200 differs from the above-described fluidic device 100 mainly in that it does not have a cover member 120. Therefore, the fluidic device 200 does not have a flow path.

[0028] (Variation 2 of Fluidic Device) In the above-described fluidic device 100, the cover member 120 and the protrusion 121 are integrally molded. However, the cover member 120 and the protrusion 121 may be molded as separate bodies.

[0029] Furthermore, in the above-described fluidic device 100 and fluidic device 200, the well array 140 is integrally molded with the substrate 110 on one side of the substrate 110. However, the well array does not have to be integrally molded with the substrate 110. For example, the well array 140 molded separately from the fluidic device 100 may be disposed on the substrate 110 of the fluidic device. Alternatively, a resin layer may be laminated on the surface of the substrate 110, and the well array may be formed in the resin layer by etching or the like.

[0030] (Variation 3 of Fluidic Device) Furthermore, in the above-described fluidic device 100, the well array is formed in the substrate 110. However, the well array may be provided in the cover member 120. As another aspect, a well array molded separately from the fluidic device 100 may be disposed on the cover member 120 of the fluidic device 100. Alternatively, a resin layer may be laminated on the surface of the cover member 120, and the well array may be formed in the resin layer by etching or the like. Alternatively, the well array may be formed directly on the surface of the cover member 120.

[0031] (Fluid device material) The substrate 110 is formed using, for example, a resin. The type of resin is not particularly limited, but is preferably a resin that is resistant to reagents and sealing liquid. In addition, when the signal to be detected is fluorescence, it is preferable to use a resin that has little autofluorescence. Examples of the resin include, but are not limited to, cycloolefin polymer, cycloolefin copolymer, silicon, polypropylene, polycarbonate, polystyrene, polyethylene, polyvinyl acetate, fluororesin, and amorphous fluororesin.

[0032] A plurality of wells 141 may be formed on one surface in the thickness direction of the substrate 110. In other words, a plurality of wells 141 having a depth in the thickness direction may be formed on one surface of the substrate 110. Methods for forming wells using a resin include injection molding, thermal imprinting, and photoimprinting.

[0033] Alternatively, for example, a fluororesin may be laminated on the substrate 110, and the fluororesin may be processed by etching or the like to form a well array. As the fluororesin, for example, CYTOP (registered trademark) (Asahi Glass) or the like can be used.

[0034] Furthermore, when the fluidic device has a lid member 120, the material of the lid member 120 is preferably a resin with low autofluorescence, and may be, for example, a thermoplastic resin such as a cycloolefin polymer or a cycloolefin copolymer.

[0035] The cover member 120 may be made of a material that does not transmit light of wavelengths near the wavelength detected during fluorescence observation of the signal, or may be made of a material that does not transmit light at all. For example, the cover member 120 may be made of a thermoplastic resin to which carbon or metal particles or the like are added.

[0036] (Conventional methods for detecting target molecules) A conventional method for detecting target molecules by digital measurement will be described with reference to Figs. 1 to 3, taking the case where a fluidic device 100 is used as an example.

[0037] First, as shown in Fig. 1, a reagent liquid L110 is introduced from an introduction port 122 of the fluidic device 100 and sent to a flow channel 130. The reagent liquid L110 contains target molecules. The concentration of the target molecules contained in the reagent liquid L110 is adjusted to a concentration such that one or less target molecules are contained in each well 141. The reagent liquid L110 sent to the flow channel 130 is contained inside the multiple wells 141.

[0038] 2, a sealing liquid L120 is sent from the introduction port 122 of the cover member 120 to the flow path 130 between the substrate 110 and the cover member 120 to individually seal the multiple wells 141. For example, an oil-based oil can be used as the sealing liquid. The sealing liquid L120 pushes away and replaces the reagent liquid L110 sent to the flow path 130 that is not contained in the wells 141. As a result, the sealing liquid L120 individually seals each of the multiple wells 141 that contain the reagent liquid L110 containing the target molecules, and the wells 141 become independent reaction spaces, that is, microcompartments 142.

[0039] 3, a predetermined reaction is carried out in well 141, and the generated signal is observed. Well 142R is a well in which a signal is detected, and well 142 is a well in which a signal is not detected.

[0040] In the conventional detection method, when detecting a target molecule such as a nucleic acid or a protein contained in a structure such as a cell or a virus, the target molecule is extracted from the structure in advance, mixed with the reagent liquid L110, and then sent. Therefore, the target molecule may be lost or reduced in the step of extracting the target molecule from the structure and in the sending step. In addition, the target molecule may not be accommodated in the well 141, but may remain inside the flow channel 130 and be swept away by the sealing liquid L120, and the signal amplification reaction may not be observed in the reaction step, and the presence of the target molecule may not be detected. As a result, the target molecule contained in the structure may not be accurately detected. In addition, even if the target molecule can be detected, the structure and the detected target molecule may not be associated.

[0041] 4 to 6, a conventional method for detecting target molecules by digital measurement will be described using the fluidic device 200 as an example. In this case, the detection can be performed using the method disclosed in WO2016 / 006208.

[0042] First, as shown in Fig. 4, a reagent liquid L110 is introduced into the fluidic device 200. The reagent liquid L110 contains target molecules. The concentration of the target molecules contained in the reagent liquid L110 is adjusted so that one or less target molecules are contained in each well 141. The reagent liquid L110 is contained inside the multiple wells 141.

[0043] 5, a sealing liquid L120 is introduced into the fluidic device 200. The specific gravity of the sealing liquid L120 is greater than that of the reagent liquid L110. Therefore, the sealing liquid L120 sinks below the reagent liquid L110 that is not contained in the wells 141, and comes into contact with the well array 140. The sealing liquid L120 then individually seals each of the multiple wells 141 that contain the reagent liquid L110 that includes the target molecules, and the wells 141 become independent reaction spaces, that is, microcompartments 142.

[0044] 6, a predetermined reaction is carried out in well 141, and the generated signal is observed. Well 142R is a well in which a signal is detected, and well 142 is a well in which a signal is not detected.

[0045] (Detection method of this embodiment) Next, the method of this embodiment will be described by taking the case of using a fluidic device 100 as an example, with reference to Figures 1 to 3 as the case may be. The method of this embodiment is a method for detecting surface target molecules and internal target molecules of a structure, and includes contacting a liquid in which structures are dispersed with a well array having a plurality of wells, introducing the structures into the wells, contacting a sealing liquid with the well array to seal the structures in the wells, extracting the contents of the structures in the wells, detecting at least one type of surface target molecule present on the surface of the structures in the wells, and detecting at least one type of internal target molecule present inside the structures in the wells.

[0046] According to the method of the present embodiment, the structure, the surface target molecule, and the internal target molecule can be detected in association with each other. That is, the surface target molecule and the internal target molecule can be detected at the level of one structure. When the surface target molecule and the internal target molecule are detected by the method of the present embodiment, it can be said that the surface target molecule and the internal target molecule are present on the surface and inside of one structure.

[0047] According to the method of the present embodiment, it is possible to detect two or more types of target molecules including surface target molecules and internal target molecules. It is also possible to detect multiple types of surface target molecules. Furthermore, it is also possible to detect multiple types of internal target molecules.

[0048] Introduction of structures into the well In this step, as shown in Fig. 1, a reagent liquid L110 is introduced from an introduction port 122 of the fluidic device 100 and sent to the flow channel 130. The reagent liquid L110 is a liquid in which structures are dispersed. The reagent liquid L110 also contains a reagent for detecting surface target molecules and internal target molecules. At the time when the reagent liquid L110 is sent to the flow channel 130, the reagent for detecting the surface target molecules may or may not be bound to the surface target molecules.

[0049] In the conventional method, the reagent solution L110 contains target molecules extracted from the structures in advance. On the other hand, in the method of the present embodiment, the reagent solution L110 is different from the conventional technology in that it contains the structures themselves. In other words, the reagent solution L110 contains the structures.

[0050] The reagent liquid L110 sent to the flow channel 130 comes into contact with the well array 140. Then, the reagent liquid L110 is contained inside the wells 141. As a result, the structures are introduced into the wells 141.

[0051] The number of structures introduced into one well in the introduction step is not particularly limited, but preferably one or less structures are introduced into one well, i.e., 0 or 1 structure is introduced. This allows detection of structures on a one-by-one basis, i.e., digital measurement is possible. In addition, it is not necessary to introduce structures into all wells of the well array.

[0052] The means for introducing the structure into the well is not particularly limited, and an appropriate means can be selected according to the selected structure. For example, a method can be used in which the structure is allowed to settle in the fluid device (in the flow channel) by its own weight and distributed to the well. Alternatively, a substance (capturer) that captures the structure can be used by the method described below, and the capturer can be bound to the structure that does not easily settle by its own weight to form a complex and then delivered. In addition, the efficiency of introducing the structure into the well can be improved by immobilizing the capturer in advance in the well, and capturing the delivered structure to form a complex.

[0053] The structures may be introduced into the well by binding a capture substance having a smaller specific gravity than the reagent liquid L110 to the structures and then feeding the reagent liquid L110. In this case, the structures can be introduced into the well by feeding the reagent liquid L110 in a state in which the fluidic device 100 is turned upside down so that the substrate 110 is on the upper side and the cover member 120 is on the lower side. Furthermore, when the fluidic device described in the third modified example of the fluidic device is used, the structures can be introduced into the well formed in the cover member 120. Note that when the structures have a smaller specific gravity than the reagent liquid L110, the structures can be introduced into the well by a similar method.

[0054] The step of binding the capture object to the structure can be performed at any time in the method of this embodiment. For example, this step may be performed by contacting the structure with the capture object in a sample tube before introducing the structure into the well. The contact between the structure and the capture object may be performed by adding the capture object to a reagent solution L110 containing the structure. Alternatively, the structure and the capture object may be contacted and then mixed with a solution containing a reagent for detecting the surface target molecule and the internal target molecule. Alternatively, the capture object may be introduced into the well, and then the structure may be introduced into the well, and the capture object and the structure may be contacted in the well to form a complex.

[0055] The capture substance is a substance capable of capturing the structure. The capture substance may be, for example, a conjugate of a solid phase and a substance that specifically binds to the structure. The specific binding substance may also be an antibody.

[0056] Examples of the solid phase include particles, membranes, and substrates. The substance that specifically binds to the structure may be at least one type. For example, it may be three types, four types, or five or more types.

[0057] The particles are not particularly limited, and examples thereof include polymer particles, magnetic particles, and glass particles. The particles are preferably surface-treated to avoid non-specific adsorption. In addition, particles having functional groups such as carboxyl groups on the surface are preferable to immobilize specific binding substances. More specifically, products such as "Magnosphere LC300" manufactured by JSR Corporation can be used.

[0058] Alternatively, for example, when a virus is used as the structure, a cell to which the virus can attach (ie, a cell having a virus receptor) may be used as the capture entity.

[0059] Examples of specific binding substances include antibodies, antibody fragments, aptamers, and lectins. Examples of antibody fragments include Fab, F(ab')2, Fab', single-chain antibodies (scFv), disulfide-stabilized antibodies (dsFv), dimerized V region fragments (diabodies), and peptides containing CDRs. The antibodies may be monoclonal or polyclonal. They may also be commercially available antibodies.

[0060] The method of immobilizing a specific binding substance on the particle surface is not particularly limited, and includes a method based on physical adsorption, a method based on chemical binding, a method using avidin-biotin binding, and a method using binding between protein G or protein A and an antibody. The method based on physical adsorption includes a method of immobilizing a specific binding substance on the particle surface by hydrophobic interaction or electrostatic interaction. The method based on chemical binding includes a method using a crosslinking agent. For example, when the surface of the particle has a hydroxyl group, the specific binding substance can be immobilized on the particle surface by reacting a crosslinking agent with the carboxyl group of the specific binding substance to form an active ester, and then reacting the hydroxyl group with the ester group. In addition, it is preferable to provide a spacer between the specific binding substance and the particle surface so as not to inhibit the ability of the specific binding substance to recognize a target molecule.

[0061] As described above, the structure may be introduced into the well by using a capture substance. For example, a complex of the capture substance and the structure may be sent to a flow channel and introduced into the well.

[0062] Here, it is preferable to form a complex between the capture object and the structure under conditions where 0 or 1 structure is captured per capture object. Furthermore, it is preferable to configure so that 0 or 1 capture object is introduced into one well. This enables digital measurement. That is, in this embodiment, detection of the structures may be performed on a unit basis. In that case, the surface target molecule and the internal target molecule are detected at the level of one structure.

[0063] Encapsulating the structure in a well 2, a sealing liquid L120 is sent from an introduction port 122 of the cover member 120 to a flow path 130 between the substrate 110 and the cover member 120. The sealing liquid L120 sent to the flow path 130 comes into contact with the well array 140. The sealing liquid L120 then pushes away and replaces the reagent liquid L110 that is not contained in the wells 141 out of the reagent liquid L110 sent to the flow path 130. As a result, the sealing liquid L120 individually seals each of the multiple wells 141 that contain the reagent liquid L110 including the structures, and the wells 141 become independent reaction spaces, that is, microcompartments 142.

[0064] The sealing liquid is a liquid capable of individually sealing the liquids introduced into the multiple wells so as not to mix with each other, thereby forming droplets, i.e., microdroplets, and is preferably an oily solution, more preferably an oil. As the oil, fluorine-based oil, silicone-based oil, hydrocarbon-based oil, or a mixture thereof, etc., can be used. More specifically, Sigma's product name "FC-40" and the like can be used. FC-40 (CAS number: 86508-42-1) is a fluorinated aliphatic compound, and has a specific gravity of 1.85 g / mL at 25°C.

[0065] Extracting the contents of a structure In this step, the contents of the structure are extracted in well 141. In this step, the contents including the internal target molecule are extracted from the structure. In extracting the contents, all the target molecules may be extracted from the structure, or only a portion of the target molecules contained in the structure may be extracted.

[0066] The method for extracting the target molecule from the structure is not particularly limited, and any known method can be used, including physical methods using heat, ultrasound, light, magnetic force, electromagnetic waves, etc., chemical methods using extractants such as surfactants, antibiotics, osmotic pressure inducers, or necrosis / apoptosis inducers, and combinations of these methods.

[0067] The surfactant is preferably one that destabilizes the structure. Specific examples of the surfactant include Triton-X100 (also called polyethylene glycol mono-4-octylphenyl ether (n=about 10)), sodium dodecyl sulfate, Nonidet P-40 (also called octylphenoxypoly(ethyleneoxy)ethanol), and Tween 20 (also called polyoxyethylene sorbitan monolaurate). A reagent containing a surfactant may also be used as the extractant. Examples of the reagent containing a surfactant include BugBuster (manufactured by Merck Millipore).

[0068] More specifically, when heat is used as an extraction method, the structure may be heated to a temperature sufficient to destabilize the structure. The target molecule can be extracted from the structure by heating the fluidic device at preferably 70° C. to 90° C., more preferably 75° C. to 85° C., for example, about 80° C., for at least 5 minutes, preferably at least 10 minutes, for example, about 15 minutes or about 30 minutes.

[0069] When heat is used as an extraction method, the contents of the structure may be extracted by heating the structure in a liquid containing a surfactant.

[0070] When an extractant is used, the structure and the extractant can be contacted at any time during the method of this embodiment. For example, the structure and the extractant can be mixed before the introduction step, and then the mixed liquid can be pumped to introduce the mixture into the well. Then, the encapsulation step is performed.

[0071] In this case, the extraction conditions may be designed so that the target molecule is extracted from the structure in the well after the well is sealed, for example by adjusting the mixture ratio of the structure and the extractant. Alternatively, the extractant may be introduced into the well, and then the liquid in which the structure is dispersed may be delivered and brought into contact with the structure in the well. Then, the sealing step is performed.

[0072] After sealing the wells, an extractant is applied within the wells, disrupting the structure and extracting the internal target molecules.

[0073] The extraction step is performed in the well after the well is sealed, which can suppress loss of the target molecule. As a result, the target molecule can be detected with higher accuracy than in the conventional method in which the target molecule is extracted from the structure and then distributed to each well of the microarray using a flow channel.

[0074] FIG. 7A is a schematic diagram showing a structure 700 including a surface target molecule 710 and an internal target molecule 720 contained in a microcompartment 142 formed by a well 141 and a sealing liquid L120.

[0075] Fig. 7B is a schematic diagram showing the state after the extraction process is performed on the structure in the state of Fig. 7A. As shown in Fig. 7B, after the extraction process, the internal target molecule 720 is extracted from the structure 700'.

[0076] 8A is a schematic diagram showing a state in which a structure 700 including a surface target molecule 710 and an internal target molecule 720 is introduced and sealed into a well using a capture object 800, and is contained in a microcompartment 142 formed by a well 141 and a sealing liquid L120. A specific binding substance 810 for the structure 700 is bound to the capture object 800.

[0077] Fig. 8B is a schematic diagram showing the state after the extraction process is performed on the structure in the state of Fig. 8A. As shown in Fig. 8B, after the extraction process, the internal target molecule 720 is extracted from the structure 700'.

[0078] Surface target molecule detection process In this step, at least one type of surface target molecule present on the surface of the structure in well 141 is detected.

[0079] The surface target molecule may be at least one molecule selected from the group consisting of nucleic acids, proteins, sugars, glycoproteins, lipids, or complexes thereof. The nucleic acids may be DNA, RNA, miRNA, and mRNA. The proteins may be structural proteins, membrane proteins, and enzymes.

[0080] The structure includes a target molecule. In the present specification, when a structure "includes" a target molecule, this can mean that the structure contains the target molecule, or that a part or all of the target molecule is present on the surface of the structure.

[0081] The method for detecting the surface target molecule can be any known detection method according to the characteristics of the target molecule to be detected. For example, first, a reaction (signal amplification reaction) is performed to amplify the signal derived from the target molecule to a detectable level as necessary, and then the amplified signal is detected using an appropriate means. In this embodiment, the step of detecting the surface target molecule can be performed by a nucleic acid detection method.

[0082] Examples of signals that can be used in the detection method according to this embodiment include fluorescence, chemiluminescence, color development, potential change, and pH change.

[0083] The signal amplification reaction may be, for example, a biochemical reaction, more specifically, an enzyme reaction. As an example, the signal amplification reaction is an isothermal reaction in which a reagent solution containing an enzyme for signal amplification is contained in a well, and the fluidic device is maintained under a constant temperature condition at which a desired enzyme activity is obtained, for example, at a constant temperature of 60° C. to 75° C., preferably about 66° C., for a predetermined time, for example, at least 10 minutes, preferably about 15 minutes.

[0084] Specific examples of the signal amplification reaction, when a nucleic acid detection technique is used, include the Invasive Cleavage Assay (ICA) method, the Loop-Mediated Isothermal Amplification (LAMP) method (registered trademark), the 5'→3' nuclease method (TaqMan (registered trademark) method), the fluorescent probe method, etc. It is particularly preferable to use the ICA reaction.

[0085] The ICA reaction is based on the principle that signal amplification proceeds through cycles of two reactions: (1) complementary binding between nucleic acids and (2) recognition and cleavage of the triple-stranded structure by an enzyme.

[0086] In the ICA reaction, the effect of reaction cycle inhibition by impurities other than the target molecule is small. Therefore, even if various components other than the target molecule present in the structure are released into the microcompartments during extraction of the contents from the structure, the target molecule can be detected with high accuracy by using the ICA reaction. For example, when the ICA reaction is used for the signal amplification reaction, the reagent liquid L110 (liquid for dispersing the structure) contains the reaction reagent and template nucleic acid necessary for the ICA reaction.

[0087] When an ICA reaction is used, specifically, the reagent solution L110 may contain ICA reaction reagents such as an allele probe, an ICA oligo, flap endonuclease-1 (FEN-1), and a fluorescent substrate.

[0088] The reagent liquid L110 may be a general liquid used in biochemical analysis performed using a fluid device, and is preferably an aqueous solution. The reagent liquid L110 may contain a surfactant or the like to facilitate sealing the liquid in the well. The reagent liquid L110 may also contain an extractant used to extract the contents of the structure. However, since the extractant may inactivate the enzyme that performs the biochemical reaction, it is not easy to make the reagent liquid L110 contain an extractant.

[0089] When the biochemical reaction for detecting a surface target molecule is an ICA reaction, if the target molecule is present in the well, an isothermal enzyme reaction causes the fluorescent substance to be released from the quencher, and a predetermined fluorescent signal is emitted in response to the excitation light.

[0090] Alternatively, detection of surface target molecules can be achieved by binding a specific binding substance for the surface target molecule to the target molecule and detecting the bound specific binding substance.

[0091] For example, when the surface target molecule is a protein, it can be detected by using an ELISA method. More specifically, it may be performed by sandwich ELISA using the principle of fluorescence resonance energy transfer (FRET).

[0092] When performing the sandwich method using the principle of FRET, first prepare a first specific binding substance (e.g., an antibody) labeled with a first fluorescent substance (donor) and a second specific binding substance labeled with a second fluorescent substance (acceptor) that has an absorption wavelength that overlaps with the fluorescent wavelength of the first fluorescent substance. Then, a surface target molecule (e.g., an antigen) is contacted with both the first specific binding substance and the second specific binding substance to form a complex. When the complex is formed, the distance between the donor and the acceptor is reduced, and the fluorescent wavelength of the acceptor can be detected by irradiation with the excitation wavelength of the donor.

[0093] Alternatively, the specific binding substance may be labeled with a nucleic acid fragment, and the nucleic acid fragment may be detected by an ICA reaction. For example, an antibody, an antibody fragment, or an aptamer may be used as the specific binding substance. In order to detect the specific binding substance bound to the target molecule, the specific binding substance may be directly or indirectly labeled with an enzyme such as horseradish peroxidase (HRP). When two or more specific binding substances are used, each specific binding molecule may be labeled so as to be distinguishable from the others.

[0094] The method for observing the signal can be selected from known appropriate methods depending on the type of signal to be observed. For example, when performing bright field observation, white light is irradiated perpendicularly onto the substrate on which the well array is provided. When observing a fluorescent signal, excitation light corresponding to the fluorescent substance is irradiated into the well, and the fluorescence emitted by the fluorescent substance is observed.

[0095] Detection of internal target molecules In this step, at least one type of internal target molecule that was present inside the structure in well 141 is detected.

[0096] The internal target molecule is similar to the surface target molecule and includes at least one molecule selected from the group consisting of nucleic acids, proteins, sugars, glycoproteins, lipids, and complexes thereof. For example, the surface target molecule may include a protein, and the internal target molecule may include a nucleic acid.

[0097] The detection of the internal target molecule can be carried out in the same manner as the above-mentioned surface target molecule. Among them, the detection of the internal target molecule is preferably carried out by a nucleic acid detection method. As the nucleic acid detection method, the ICA method is preferable.

[0098] For example, the surface target molecule can be detected using a nucleic acid-labeled antibody, and the nucleic acid labeled by the nucleic acid-labeled antibody can be detected by the ICA method. In addition, when the internal target molecule is a nucleic acid, the nucleic acid can be detected by the ICA method.

[0099] In this way, even if the surface target molecule and the internal target molecule are different molecules, they can be detected by the same principle by labeling. In the above case, both the surface target molecule and the internal target molecule can be detected by the ICA method. Therefore, the surface target molecule and the internal target molecule can be detected simultaneously under the same conditions.

[0100] In the method of this embodiment, extraction of the contents of the structure, detection of the surface target molecule, and detection of the internal target molecule are preferably performed after sealing the structure in the well. This allows detection of the surface target molecule and the internal target molecule originating from one structure. In addition, the structure, the surface target molecule, and the internal target molecule can be detected in association with each other.

[0101] The surface target molecules and the internal target molecules may be detected in any order. Furthermore, when there are multiple types of surface target molecules, each surface target molecule may be detected in any order. Furthermore, when there are multiple types of internal target molecules, each internal target molecule may be detected in any order. Furthermore, the detection of the surface target molecules and the detection of the internal target molecules may be performed simultaneously or independently.

[0102] Furthermore, the detection of the surface target molecules and the detection of the internal target molecules may be performed under the same conditions. By simultaneously detecting the surface target molecules and the internal target molecules under the same conditions, the method of the present embodiment can be easily carried out.

[0103] In detecting surface target molecules and internal target molecules, when two or more types of target molecules are detected simultaneously, or when the target molecules are detected sequentially in a situation where they coexist in a detectable state even if not simultaneously, it is necessary to design a reaction system so that signals indicating the presence of each target molecule are not mixed up. In such cases, it is preferable that the signals detected by the detection of surface target molecules and the signals detected by the detection of internal target molecules are distinguishable from each other.

[0104] Furthermore, when multiple types of surface target molecules are present, it is preferable that the signals indicating the presence of each surface target molecule are distinguishable from each other.Similarly, when multiple types of internal target molecules are present, it is preferable that the signals indicating the presence of each internal target molecule are distinguishable from each other.

[0105] For example, when detection is performed by fluorescent signals, the signals can be made distinguishable from one another by using different wavelength bands of excitation light or fluorescence, or by using different signals, e.g., a fluorescent signal and a magnetic signal.

[0106] The method of this embodiment may be carried out in the following order: encapsulation of the structure in the well, detection of the surface target molecule, extraction of the contents of the structure, and detection of the internal target molecule. That is, after encapsulating the structure in the well, the surface target molecule present on the surface of the structure is detected. Then, the contents of the structure are extracted. This exposes the internal target molecule to the inside of the well. Then, detection of the internal target molecule may be carried out. In this case, even if the signal for detecting the surface target molecule and the signal for detecting the internal target molecule are the same, the surface target molecule and the internal target molecule can be distinguished depending on the timing of detection.

[0107] When the detection of the surface target molecules is performed before the extraction of the contents of the structure, the detection of the surface target molecules is performed under conditions that do not cause extraction of the internal target molecules, for example, at a temperature lower than the temperature at which the contents of the structure are extracted, more specifically, at a temperature in the range of room temperature to about 60°C.

[0108] Alternatively, detection of surface target molecules and detection of internal target molecules may occur following extraction of the contents of the structure.

[0109] Alternatively, the steps of sealing the structure in the well, extracting the contents of the structure, detecting the surface target molecule, and detecting the internal target molecule may be performed in a reverse order, or any two steps may be performed simultaneously. For example, after introducing the structure into the well, the extraction step may be performed before the sealing step of the structure into the well, in which case the introduction step and the extraction step may be performed simultaneously. Also, as described above, a part of the surface target molecule detection step or the internal target molecule detection step may be performed before the extraction step.

[0110] (Structure detection) The method of the present embodiment may further include a step of detecting the structures. Detection of the structures may be performed at any time during the method of the above embodiment, for example, after introduction of the structures into the well and before extraction of the contents of the structures. Alternatively, the structures may be detected after extraction of the contents of the structures.

[0111] Alternatively, detection of surface target molecules or internal target molecules and detection of structures may be performed simultaneously. When detection of surface target molecules, detection of internal target molecules, and detection of structures are performed simultaneously, the reaction system is configured so that the detection signals do not interfere with each other, as in the above case.

[0112] The structure may be directly detected by a method such as bright field observation. Alternatively, the structure may be indirectly detected by a method such as detecting a molecule contained in the structure by the same operation as that for a surface target molecule or an internal target molecule. Examples of the latter include detecting the structure using a fluorescent dye that stains a cell membrane or an antibody that recognizes a virus coat protein.

[0113] [Evaluation method of structure] One embodiment of the present invention provides a method for evaluating a structure, comprising: contacting a liquid in which structures are dispersed with a well array having a plurality of wells, and introducing one or less of the structures per well into the wells; contacting a sealing liquid with the well array to seal the structures within the wells; extracting the contents of the structures within the wells; detecting surface target molecules that detect at least one type of surface target molecule that was present on the surface of the structure within the well; detecting at least one type of internal target molecule that was present inside the structure within the well; and evaluating the structure based on the detection results of the surface target molecules and the detection results of the internal target molecules.

[0114] In the method of this embodiment, the presence or absence of the surface target molecule and the internal target molecule is detected for each well. As a result, the structure, the surface target molecule, and the internal target molecule can be detected in association with each other. In other words, the surface target molecule and the internal target molecule can be detected at the level of one structure. "Evaluating a structure" refers to detecting the structure, the surface target molecule, and the internal target molecule in association with each other in this manner. Furthermore, the origin or state of the structure may be analyzed by evaluating the structure.

[0115] [kit] One embodiment of the present invention provides a kit for detecting surface and internal target molecules of a structure, comprising a well array having a plurality of wells, a reagent for extracting contents from the structure, a reagent for detecting at least one surface target molecule present on the surface of the structure, and a reagent for detecting at least one internal target molecule present inside the structure.

[0116] The well array may comprise a fluidic device as described above, with the reagents for extracting contents from the structure (i.e., extractants), the reagents for detecting surface target molecules, and the reagents for detecting internal target molecules being the same as those described above.

[0117] The kit of this embodiment makes it possible to suitably detect surface target molecules and internal target molecules of a structure. EXAMPLES

[0118] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0119] [Example 1] (Detection of viral surface proteins and intraviral nucleic acids) The surface target molecule and the internal target molecule of the structure were detected. The structure was made of f1 phage (reagent name: Escherichia coli phage f1, National Institute of Technology and Evaluation, model number: NBRC20010), a type of virus. The surface target molecule was a coat protein, which is a surface protein of f1 phage (containing DNA with the base sequence 5'-ACGTTAAACAAAAAATCGTTTCTTATTTGGATTGGGATAAATAATATGGCTGTTTATTTTGTAACTGGCAAATTAGGCTCTGGAAAGACGCTCGTTAGCGTTGGTAAGATTCAGGATAAAATTGTAGCTGGGTGCAAAAT-3' (SEQ ID NO: 1)). The internal target molecule was a base sequence on the genome DNA of f1 phage (5'-GTAACTGGCAAATTAGGCTCTGGAAAGACGCTCGTTAGC-3', SEQ ID NO: 2). The structure was introduced into the wells using magnetic beads having an antibody as a specific binding substance as a capture substance.

[0120] Preparation of nucleic acid detection reagents An ICA reaction solution with the composition shown in Table 1 below was prepared. This reaction solution is for detecting nucleic acids by ICA reaction. In Table 1, Alexa488 and Redmond RED (referred to as RED in Table 1) are fluorescent dyes, and BHQ-1 (referred to as BHQ in Table 1) and Eclipse are quenchers.

[0121] [Table 1]

[0122] Next, the ICA reaction solution and a protein extraction reagent BugBuster (Merck Millipore) were mixed at a volume ratio of 1:1 to prepare a solution (Solution A).

[0123] Preparation of Capture Product A capture material for capturing f1 phage was prepared. Specifically, magnetic beads with anti-f1 phage antibodies immobilized thereon were prepared as the capture material.

[0124] First, anti-f1 phage antibody (type "Anti-M-13 Phage Coat Protein", Funakoshi) was added to a solution of carboxyl group-modified magnetic beads (Magnosphere, LC300, JSR Corporation) and reacted for 30 minutes on a rotator. Next, EDC (1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide), a condensation agent, was added and reacted for 3 hours to immobilize the anti-f1 phage antibody on the carboxyl group-modified magnetic beads.

[0125] Next, to remove unreacted antibodies and reagents, the antibody-immobilized magnetic beads were magnetically collected using a magnet stand. The beads were then washed three times with PBS-T (PBS (Phosphate-buffered saline) containing 0.1% Tween 20) to prepare antibody-immobilized magnetic beads. This produced a capture product for capturing f1 phage.

[0126] <<Preparation of nucleic acid-labeled anti-f1 phage antibodies>> A DNA fragment (5'-TTTGTCACTGTTCCTCCTTTTGTTTTCCTTTCTGTGAGCAATCTCACCCAAATTGGAACCATGCTGTATACAGTT-3', SEQ ID NO: 9) was bound to an anti-f1 phage antibody (type "Anti-M-13 Phage Coat Protein", Funakoshi Co., Ltd.) to prepare a nucleic acid-labeled anti-f1 phage antibody. A commercially available kit (product name "Protein-Oligo Conjugation Kit", Sollink Co., Ltd.) was used to bind the DNA fragment.

[0127] <Reaction of f1 phage and antibody-immobilized beads> The concentration of the f1 phage is expressed as a dilution rate when the concentration of the commercially available f1 phage suspension is taken as 100%. The f1 phage (final concentration 0% or 1%), 100 μg / mL of the above-mentioned antibody-immobilized magnetic beads, and 10 ng / mL of the above-mentioned nucleic acid-modified anti-f1 phage antibody were mixed in a total volume of 100 μL, and reacted on a rotator at room temperature for 1 hour. Here, if the f1 phage is present, the anti-f1 phage antibody recognizes and binds to the coat protein on the surface of the f1 phage to form a complex with the antibody-immobilized magnetic beads.

[0128] Next, the magnetic beads were magnetically collected using a magnetic stand, and the procedure of removing the supernatant and adding PBS-T was repeated three times for washing, and finally the supernatant was removed.

[0129] 《Introduction process》 Next, 20 μL of antibody-immobilized magnetic beads suspended in the above-mentioned solution A (a mixture of ICA reaction solution and BugBuster (Merck Millipore)) was delivered to the fluid device having the structure shown in Figure 1 and brought into contact with the well array. As a result, the antibody-immobilized magnetic beads were introduced into the wells.

[0130] The wells of the fluidic device used in this example had a diameter of 5 μm, a depth of 3 μm, and a height of the flow channel of 100 μm.

[0131] Encapsulation process Next, 150 μL of FC-40 (Sigma) was delivered as a sealing liquid and brought into contact with the well array. As a result, each well was individually sealed and the antibody-immobilized magnetic beads were enclosed. By the above operation, if the antibody-immobilized magnetic beads had formed a complex with the f1 phage, one or less f1 phage per well was sealed in the well.

[0132] 《Extraction process》 Next, the fluidic device was placed on a hot plate and reacted for 15 minutes at 66° C. This caused the capsid structure of the f1 phage to break down within the sealed well, and the genomic DNA contained in the f1 phage was extracted.

[0133] Surface target molecule detection process and internal target molecule detection process Subsequently, the above-mentioned fluidic device after the extraction step was placed on a hot plate and reacted for 15 minutes at 66° C. This allowed the surface target molecules and internal target molecules to be detected simultaneously.

[0134] More specifically, allele probe 1 and ICA oligo 1 hybridized to the base sequence (SEQ ID NO: 2) on the genomic DNA to form a flap structure. Then, FEN-1 recognized the flap structure and cleaved allele probe 1.

[0135] The released fragment of allele probe 1 then hybridized to RED-Eclipse to form a flap structure, which was then recognized by FEN-1 and cleaved RED-Eclipse, resulting in the separation of the fluorophore and quencher, and the generation of the Redmond RED fluorescent signal.

[0136] Similarly, allele probe 2 and ICA oligo 2 hybridized to the DNA fragment modified with the nucleic acid-labeled anti-f1 phage antibody, respectively, to form a flap structure. Then, FEN-1 recognized the flap structure and cleaved allele probe 2.

[0137] The released fragment of allele probe 2 then hybridized to Alexa488-BHQ to form a flap structure, which was then cleaved by FEN-1, which recognized the flap structure and cleaved Alexa488-BHQ, resulting in the separation of the fluorophore and quencher, and the generation of the Alexa488 fluorescent signal.

[0138] Fluorescence observation of wells After the surface target molecule detection step and the internal target molecule detection step, the fluorescent signal of each well of the fluidic device was photographed using a fluorescent microscope BZ-710 (Keyence Corporation). A 10x objective lens was used.

[0139] The exposure time was 3000 msec using a GFP fluorescent filter when observing Alexa488 fluorescence, and 2000 msec using a Texas Red fluorescent filter when observing Redmond RED fluorescence.

[0140] Figure 9 is a photograph showing the results of fluorescence observation. In Figure 9, "no phage" indicates the result for f1 phage at a virus concentration of 0%, and "with phage" indicates the result for f1 phage at a virus concentration of 1%.

[0141] In addition, "Alexa488" indicates the result of detecting Alexa488 fluorescence, "RED" indicates the result of detecting Redmond RED fluorescence, and "Overlay" indicates the result of overlaying the detection results of Alexa488 fluorescence and Redmond RED fluorescence. The number of wells in which fluorescence was detected is shown in Table 2 below.

[0142] [Table 2]

[0143] As a result, it was found that the nucleic acid fragment of SEQ ID NO:2 was detected in 23 wells out of 32 wells into which the phage coat protein was released. In other words, the phage genomic DNA was detected in approximately 72% of the wells into which the phage coat protein was released. This result indicates that the surface target molecule and the internal target molecule of the structure can be associated and detected with high accuracy.

[0144] [Example 2] (Consideration of extraction reagent concentration) In the extraction process, the concentration of the reagent (extraction reagent) that extracts the contents from the structure was examined. The structure used was the f1 phage, a type of virus (reagent name: Escherichia coli phage f1, National Institute of Technology and Evaluation, model number: NBRC20010). In addition, the base sequence (sequence number 2) on the genome DNA of the f1 phage was detected as the internal target molecule.

[0145] Preparation of nucleic acid detection reagents An ICA reaction solution was prepared whose composition is shown in Table 3 below. In Table 3, Alexa488 is a fluorescent dye, and BHQ-1 (referred to as BHQ in Table 3) is a quencher.

[0146] [Table 3]

[0147] Next, the ICA reaction solution was mixed with BugBuster (Merck Millipore), a protein extraction reagent, at a volume ratio of ICA reaction solution:BugBuster = 9:1, 1:1, or 1:9 to prepare solutions. In addition, a sample not containing f1 phage was also prepared as a negative control.

[0148] Next, each sample was placed in a real-time PCR device (LightCycler480, Roche) and reacted at 65°C for 60 minutes, and the fluorescent signal of Alexa488 was measured over time.

[0149] Fig. 10 is a graph showing the results of measuring the change in the fluorescent signal over time. In Fig. 10, "9:1NC" indicates the result of a sample in which an ICA reaction solution not containing f1 phage was mixed with BugBuster (manufactured by Merck Millipore) at a volume ratio of ICA reaction solution:BugBuster = 9:1, "9:1phage" indicates the result of a sample in which an ICA reaction solution (containing f1 phage) was mixed with BugBuster (manufactured by Merck Millipore) at a volume ratio of ICA reaction solution:BugBuster = 9:1, and "1:1NC" indicates the result of a sample in which an ICA reaction solution not containing f1 phage was mixed with BugBuster (manufactured by Merck Millipore) at a volume ratio of ICA reaction solution:BugBuster = 1:1. "1:1 phage" indicates the result of a sample in which the ICA reaction solution (containing f1 phage) and BugBuster (Merck Millipore) were mixed in a volume ratio of ICA reaction solution:BugBuster = 1:1, "1:9NC" indicates the result of a sample in which the ICA reaction solution not containing f1 phage was mixed in a volume ratio of ICA reaction solution:BugBuster = 1:9, and "1:9 phage" indicates the result of a sample in which the ICA reaction solution (containing f1 phage) and BugBuster (Merck Millipore) were mixed in a volume ratio of ICA reaction solution:BugBuster = 1:9.

[0150] As a result, it became clear that if the volume ratio of Bugbuster was too high, the ICA reaction was inhibited.

[0151] [Example 3] (Extraction process review) In this example, the conditions for extracting the contents from the structure were examined. As the structure, f1 phage, a type of virus (reagent name: Escherichia coli phage f1, National Institute of Technology and Evaluation, model number: NBRC20010) was used. In addition, the base sequence (sequence number 2) on the genome DNA of f1 phage was detected as an internal target molecule.

[0152] Preparation of nucleic acid detection reagents An ICA reaction solution with the composition shown in Table 4 below was prepared. This reaction solution is for detecting nucleic acids by ICA reaction. In Table 4, Alexa488 is a fluorescent dye, and BHQ-1 (represented as BHQ in Table 4) is a quencher. In Table 4, "MOPS" stands for 3-morpholinopropanesulfonic acid.

[0153] [Table 4]

[0154] Next, extraction of the phage contents was attempted under various conditions, and the following samples 1 to 4 were prepared. Sample 1: Phage (10%) was sonicated for 1 minute using a probe-type ultrasonic generator. Sample 2: BugBuster (Merck Millipore) was added to the phage (10%) at a volume ratio of 50%, and the mixture was stirred at 37°C for 30 minutes. Sample 3: Phage (10%) was heated at 70°C for 30 minutes. Sample 4: BugBuster (Merck Millipore) was added to the phage (10%) at a volume ratio of 50%, and the mixture was stirred at 70°C for 30 minutes.

[0155] Next, the above-mentioned ICA reaction solution and Samples 1 to 4 were mixed in a sample tube to prepare a solution with a final phage concentration of 1% and a volume of 10 μL.

[0156] As negative controls, the ICA reaction solution alone (sample 5) and a mixed solution of the ICA reaction solution and phage (sample 6) were prepared. As a positive control, a solution was prepared in which a nucleic acid fragment having a base sequence (SEQ ID NO: 2) present on the genomic DNA of f1 phage was added to the ICA reaction solution to a final concentration of 30 pM (sample 7).

[0157] Next, these samples were placed in a real-time PCR device (LightCycler480, Roche) and reacted at 66°C for 60 minutes, and the fluorescent signal of Alexa488 was measured over time.

[0158] Figure 11 is a graph showing the results of measuring the change in fluorescent signal over time. In Figure 11, the horizontal axis shows reaction time (seconds) and the vertical axis shows fluorescence intensity (relative value). In Figure 11, "ICA" shows ICA solution, "phage" shows phage, and "bug" shows BugBuster (Merck Millipore).

[0159] As a result, increases in fluorescence intensity were detected in all of the following samples: sample 1, in which the phage was sonicated; sample 2, in which BugBuster (Merck Millipore) was added to the phage; sample 3, in which the phage was heat-treated at 70°C; sample 4, in which BugBuster (Merck Millipore) was added to the phage and then heat-treated at 70°C for 30 minutes; and the positive control sample 7.

[0160] Furthermore, a significant increase in fluorescence intensity was observed in Sample 1, in which the phage was ultrasonically treated, and Sample 4, in which BugBuster (Merck Millipore) was added to the phage and heat-treated at 70°C for 30 minutes. On the other hand, almost no increase in fluorescence intensity was observed in the negative control ICA reaction solution alone (Sample 5). An increase in fluorescence intensity was also observed over time in the mixed solution of the ICA reaction solution and phage (Sample 6), but the degree of increase was slower than in Samples 1 to 4. [Industrial Applicability]

[0161] According to the present invention, a technique for detecting target molecules present both outside and inside a structure can be provided. [Explanation of symbols]

[0162] 100,200...fluidic device, 110...substrate, 120...cover member, 121...protrusion, 122...inlet port, 123...ejection port, 130...flow path, 140...well array, 141...well, 142...microcompartment, L110...reagent solution, L120...sealing liquid, 142R...well in which signal is detected, 210...wall member, 700,700'...structure, 710...surface target molecule, 720...internal target molecule, 800...capture, 810...specific binding substance.

Claims

[Claim 1] bringing a liquid having structures dispersed therein into contact with a well array having a plurality of wells, and introducing the structures into the wells; contacting the well array with a sealing liquid to seal the structures within the wells; extracting the contents of the structure within the well; detecting at least one surface target molecule present on the surface of the structure within the well; detecting at least one internal target molecule that was present within the structure within the well; A method for detecting surface and internal target molecules of said structure, comprising:

Images