Creation of genetic modification rat visualizing senescent cell

Abstract

To provide a genetic modification rat platform which visualizes a senescent cell by using a rat to be a variety capable of reproducing a human disease state better than a mouse.SOLUTION: According to the current invention, a nonhuman mammal for visualizing a senescent cell by p16 gene expression, with a targeting vector including a gene encoding Cre recombinase and a targeting vector including one or more kinds of reporter genes introduced right after start codon of p16 gene locus exon 1 or right before termination codon of p16 gene locus exon 3, is provided.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to a series of genetically modified rat platforms for specifically expressing a reporter gene in cells that express the p16 gene, which is known as a senescent cell marker.

Background Art

[0002] Cellular senescence is a defense mechanism possessed by cells that changes the properties of damaged cells and prevents repeated cell proliferation from leading to canceration. Cellular senescence is caused by, for example, shortening of telomeres due to repeated cell division and accumulation of DNA damage caused by drugs, ultraviolet rays, or radiation, and cell proliferation stops. One of the marker genes expressed at this time is p16, which is expressed from the CDKN2A gene. Senescent cells that cause this cellular senescence accumulate in tissues with aging, and the secretion of inflammatory cytokines called SASP from senescent cells inhibits the function of normal tissues, which is considered to be one of the causes of the decline in tissue function associated with aging, that is, aging. In this regard, it has also been shown using mice that the senescent phenotype is alleviated when senescent cells are removed (Non-Patent Document 1, Non-Patent Document 2), and the process of cellular senescence has come to be noticed.

[0003] In mice, a large number of genetically modified mouse lines have been established because fertilized eggs are easy to handle and gene recombination techniques using ES cells have been widely popularized. By selecting a combination of genetically modified mice suitable for experimental purposes from such genetically modified mice established by a large number of researchers, it has become one of the great advantages of using mice in experiments that genetically modified mice that achieve the experimental purpose can be easily obtained.

[0004] As described above, due to the increasing importance of understanding cellular senescence, research results have been successively published on the combination of genetically modified mice expressing Cre-ERT2 under the p16 gene and various reporter mice whose fluorescence color changes or cell death is induced in response to Cre as tools for visualizing senescent cells (Non-Patent Document 3, Non-Patent Document 4). Although some cell senescence-removing drugs developed from research results on cell senescence using mice have advanced to clinical trials, no drug efficacy meeting the targeted criteria was observed in a Phase 2 trial targeting human osteoarthritis (Non-Patent Document 5). This result has led to the consideration that it may be due to the incompatibility of experimental animals (Non-Patent Document 6), and the importance of tools for analyzing the detailed molecular mechanisms of cell senescence on an experimental animal platform that better reproduces the human disease state has been increasing.

[0005] Rats are widely used as experimental animals in the same way as mice. They are larger in size than mice, easier to handle, have a larger sampling volume during sampling, and are more suitable for subsequent analysis, so they are frequently used in pharmaceutical companies' drug efficacy tests and the like. On the other hand, regarding genetic recombination technology, ES cells have not been established as early as in mice, the handling of fertilized eggs is more difficult than in mice, and the production efficiency of frozen embryos of fertilized eggs and the in vitro fertilization efficiency are also lower than in mice. Although the genome editing technology CRISPR / Cas9 has emerged and gene modification in rats has become easier than before, basic research using genetically modified mice is still the mainstream due to the abundance of accumulated types of gene-modified variants.

[0006] Rats are known not only for the experimental technical advantages due to their large body size but also as a species that exhibits a phenotype closer to human pathological conditions than mice (Non-Patent Document 7). For example, in Duchenne muscular dystrophy, which is characterized by progressive muscle tissue destruction and muscle strength decline caused by mutations in the dystrophin gene, Mdx mice, which are dystrophin gene-deficient mice, have long been widely used as a pathological model. However, similar to the human pathological condition, although the expression of dystrophin protein is lacking, partial muscle damage is observed in the juvenile stage, but then the muscle damage is repaired, and it has been recognized as an issue that it shows a very mild phenotype in which the pathological condition does not appear significantly. In mice lacking telomerase, even Mdx mice show a severe pathological condition (Non-Patent Document 8). Therefore, it is conceivable that mice with long-maintained telomere length have high regenerative ability and, unlike humans, do not show a severe pathological condition even under dystrophin pathological conditions. On the other hand, it has been clarified that by inducing dystrophin gene deficiency in rats, a more severe phenotype closer to humans than Mdx mice is shown (Non-Patent Document 9). It has also been clarified that in these dystrophin-deficient rats, p16 is induced to highly express, and at the same time, the appearance of senescent cells is observed (Non-Patent Document 10). From this, it becomes possible to conduct basic research in a pathological condition closer to humans by analyzing the process of cellular senescence using rats rather than mice.

Prior Art Documents

Non-Patent Documents

[0007]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Non-Patent Document 6

Non-Patent Document 7

Non-Patent Document 8

Non-Patent Document 9

Non-Patent Document 10

Summary of the Invention

Problems to be Solved by the Invention

[0008] As described above, in mice, there are multiple genetically modified mice expressing various reporters, but in rats, there are only limited ones. Even if it is a species suitable for analyzing cellular senescence, it has been difficult to obtain or produce genetically modified rats having the necessary reporters. Therefore, an object of the present invention is to provide a genetically modified rat platform for visualizing senescent cells using rats, which are a species that can better reproduce human pathological conditions than mice.

Means for Solving the Problems

[0009] In view of the above circumstances, the present inventors succeeded in producing a non-human mammal in which senescent cells are visualized by p16 gene expression by crossing a target animal in which a gene encoding Cre recombinase is knocked in at a predetermined position of an exon of the p16 locus with a target animal in which a reporter gene is knocked in, and thus completed the present invention.

[0010] That is, the present invention is as follows. [1] A targeting vector containing a gene encoding Cre recombinase immediately after the start codon of exon 1 of the p16 locus or immediately before the stop codon of exon 3 of the p16 locus, and a non-human mammal for visualizing senescent cells by p16 gene expression, into which a targeting vector containing one or more reporter genes has been introduced. [2] The non-human mammal according to [1], wherein exon 1 contains the nucleotide sequence shown in SEQ ID NO: 1. [3] The non-human mammal according to [1] or [2], wherein exon 3 contains the nucleotide sequence shown in SEQ ID NO: 2. [4] The non-human mammal according to any one of [1] to [3], wherein a gene encoding a nuclear localization protein is linked to the gene encoding Cre recombinase. [5] The non-human mammal according to [4], wherein the nuclear localization protein is ERT2, ERT, or GR. [6] The non-human mammal according to any one of [1] to [5], wherein the reporter gene is a gene encoding a fluorescent protein or a gene encoding a bioluminescent protein. [7] The non-human mammal according to [6], wherein one or more fluorescent proteins are selected from the group consisting of green fluorescent protein (GFP) and red fluorescent protein (RFP). [8] The non-human mammal according to [6], wherein one or more bioluminescent proteins are selected from the group consisting of luciferase, alkaline phosphatase, and β-galactosidase. [9] The non-human mammal according to any one of [1] to [8], wherein a suicide gene is linked to the reporter gene.

[10] The non-human mammal according to [7], for visualizing senescent cells as a change in luminescence color from RFP to GFP accompanied by the expression of the p16 gene.

[11] The non-human mammal according to any one of [1] to

[10] , wherein the non-human mammal is a rat.

[12] A method for producing a non-human mammal in which senescent cells are visualized by p16 gene expression, comprising mating a target animal in which a gene encoding Cre recombinase is knocked in immediately after the start codon of exon 1 of the p16 gene locus or immediately before the stop codon of exon 3 of the p16 gene locus with a target animal in which one or more reporter genes are knocked in.

[13] The method according to

[12] , wherein exon 1 contains the nucleotide sequence shown in SEQ ID NO: 1.

[14] The method according to

[12] or

[13] , wherein exon 3 contains the nucleotide sequence shown in SEQ ID NO: 2.

[15] The method according to any one of

[12] to

[14] , wherein the knock-in is performed using CRISPR / Cas9.

[16] The method according to any one of

[12] to

[15] , wherein a gene encoding a nuclear translocation protein is linked to the gene encoding Cre recombinase.

[17] The method according to

[16] , wherein the nuclear translocation protein is ERT2, ERT, or GR.

[18] The method according to any one of

[12] to

[17] , wherein the reporter gene is a gene encoding a fluorescent protein or a gene encoding a bioluminescent protein.

[19] The method according to

[18] , wherein one or more fluorescent proteins are selected from the group consisting of green fluorescent protein (GFP) and red fluorescent protein (RFP).

[20] The method according to

[18] , wherein one or more bioluminescent proteins are selected from the group consisting of luciferase, alkaline phosphatase, and β-galactosidase.

[21] The method according to any one of

[12] to

[20] , wherein a suicide gene is linked to the reporter gene. The method described in

[19] for visualizing senescent cells as a change in luminescence color from RFP to GFP accompanied by the expression of the p16 gene. The method according to any one of

[12] to

[22] , wherein the non-human mammal is a rat. A method for evaluating aging, comprising using a non-human mammal for visualizing senescent cells as defined in any one of [1] to

[11] . A method for removing senescent cells, comprising administering ganciclovir to a non-human mammal as defined in [9].

Advantages of the Invention

[0011] The present invention can provide a series of gene-modified rat platforms for specifically expressing a reporter gene in cells expressing the p16 gene known as a senescent cell marker.

Brief Description of the Drawings

[0012]

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Best Mode for Carrying Out the Invention

[0013] Unless otherwise defined, all technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terms used in the detailed description of this specification are for the purpose of describing particular embodiments only and are not intended to be limiting.

[0014] <Definition> The following terms are used in this disclosure. The term "CDS" is an abbreviation for coding sequence. In this specification, "coding sequence" is used interchangeably with "coding region" and means any nucleotide sequence for encoding a polypeptide that is a gene product. On the other hand, the term "non-coding sequence" means any nucleotide sequence that does not encode a polypeptide product of a gene.

[0015] The term "fragment" should be understood to mean a nucleotide sequence that is shorter in length than a reference nucleic acid and contains the same nucleotide sequence as the reference nucleic acid in a common portion. Appropriately, such a nucleic acid fragment according to this disclosure may be contained in a larger polynucleotide, and the fragment is a constituent of the larger polynucleotide. Such a fragment includes oligonucleotides having a length within a continuous nucleotide range of at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 95% of the nucleic acid of this disclosure, or alternatively is composed of such oligonucleotides.

[0016] As used herein, the term "corresponding" means that (a) a polynucleotide has a nucleotide sequence that is substantially identical or complementary to all or a portion of a reference nucleotide sequence, or that a polynucleotide encodes an amino acid sequence that is identical to the amino acid sequence in a peptide or polypeptide; or (b) a peptide or polypeptide has an amino acid sequence that is substantially identical to the amino acid sequence in a reference peptide or polypeptide.

[0017] As used herein, the term "upstream" means a nucleotide sequence located at the 5' end of a reference nucleotide sequence. In particular, upstream nucleotides typically relate to sequences located 5' of a coding sequence or a transcription start point. For example, most promoters are located upstream of the transcription start site.

[0018] As used herein, the term "downstream" means a nucleotide sequence located at the 3' end of a reference nucleotide sequence. In particular, downstream nucleotide sequences typically relate to sequences after the transcription start point. For example, the translation initiation codon of a gene is located downstream of the transcription start site.

[0019] As used herein, the term "expression cassette" includes any type of genetic construct that contains a nucleic acid encoding a gene product, where some or all of the coding sequence can be transcribed and translated (i.e., is under the control of a promoter).

[0020] The term "promoter" means a DNA sequence capable of regulating the expression of a coding sequence or a functional RNA. Generally, the promoter sequence is located at the 5' end of the coding sequence. A promoter can generally consist of elements derived from a natural gene or from different promoters found in nature, or can even contain a synthetic DNA segment. As will be understood by those skilled in the art, different promoters can be induced to cause a gene to be expressed in different tissues or cell types, or at different stages of development (ontogeny), or in response to different environmental or physiological conditions. In most cell types, the promoter that causes a gene to be expressed most of the time is usually called a "constitutive promoter". A promoter that causes a gene to be expressed in a specific cell type is usually called a "cell-specific promoter" or a "tissue-specific promoter". A promoter that causes a gene to be expressed at a specific stage of development or cell differentiation is usually called a "development-specific promoter" or a "cell differentiation-specific promoter". A promoter that is induced to cause a gene to be expressed after exposing a cell to an agent, biomolecule, chemical, ligand, light or the like that induces the promoter, or treating the cell with these substances, is usually called an "inducible promoter" or a "regulated promoter". Furthermore, in most cases, since the exact limits of the regulatory sequences are not fully defined, DNA segments of different lengths may have the same promoter activity.

[0021] Examples of promoters include, but are not limited to, CAG (an artificial promoter formed by linking the cytomegalovirus enhancer and the chicken β-actin promoter), the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter, the Rous sarcoma virus long terminal repeat, the rat insulin promoter, and viral promoters such as glyceraldehyde-3-phosphate dehydrogenase. The use of other viral or mammalian cell or bacteriophage promoters well known in the art to achieve expression of the target coding sequence is also contemplated when the expression level is sufficient for a given purpose. As will be understood by those skilled in the art, by using a promoter with well-known characteristics, the expression level and pattern of the target protein after transfection or transformation can be optimized. Furthermore, the selection of a promoter that is regulated in response to specific physiological signals can enable inducible expression of the gene product.

[0022] The terms "restriction endonuclease" and "restriction enzyme" mean an enzyme that specifically recognizes and binds to a specific nucleotide sequence within double-stranded DNA and cleaves it.

[0023] The term "vector" means a nucleic acid molecule capable of transferring a nucleic acid molecule to which it is ligated into a host. Examples of types of vectors include, but are not limited to, "plasmids", which can be circular double-stranded DNA loops capable of ligating other DNA segments. Another type of vector is exemplified by viral vectors, which can ligate DNA segments into the viral genome. In some vectors, the vector can self-replicate in the host cell into which it is introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of the host cell after being introduced into the host cell and thus replicate with the host genome. Note that some vectors can be induced to express the genes to which they are operably linked.

[0024] Some vectors, when described in the present disclosure as "recombinant expression vectors" (sometimes simply referred to as "expression vectors"), mean vectors, plasmids or vehicles designed such that the inserted nucleic acid sequence can be expressed after the host is transformed. Expression vectors used in recombinant DNA technology are usually in plasmid form. Herein, "plasmid" and "vector" are used interchangeably, and plasmid is the most commonly used form of vector. However, the present disclosure can utilize expression vectors in other forms such as viral vectors (e.g., replication-defective retroviruses, adenoviruses and adeno-associated virus vectors) that perform equivalent functions.

[0025] The term "plasmid" refers to an extrachromosomal element, always having genes that are not part of the central metabolism of the cell, and having a morphology of a circular double-stranded DNA molecule. Such elements can be single-stranded or double-stranded DNA or RNA, such as autonomously replicating sequences, genomic integration sequences, phage or nucleotide sequences of any origin, linear, circular or supercoiled. In particular, many nucleotide sequences have already been ligated or recombined into a unique structure that can introduce into the cell a promoter and DNA sequence for the selected gene product and an appropriate 3'-end untranslated sequence.

[0026] The term "targeting vector" or "target vector" refers to a DNA construct that contains sequences "homologous" to endogenous chromosomal nucleic acid sequences adjacent to the desired genetic modification. Homologous flanking sequences for homologous recombination (also simply called "homologous recombination arms" or "homology arms") induce the targeting vector to be positioned at a specific chromosomal location in the genome by virtue of the homology that exists between the homologous flanking sequences and the corresponding endogenous sequences, and introduce the desired genetic modification by a process called "homologous recombination". "Targeting vector" and "targeting" can be used interchangeably. Generally, a targeting vector can be employed to introduce an inserted nucleic acid (transgene) into a target locus of nucleic acids of rats, eukaryotes, non-rat eukaryotes, mammals, non-human mammals, humans, rodents, non-rat rodents, mice or hamsters. A targeting vector contains an inserted nucleic acid and further contains a 5' homology arm and a 3' homology arm, with the inserted nucleic acid being flanked. The homology arms flanking the inserted nucleic acid correspond to regions within the target locus of nucleic acids such as rats. For ease of explanation, in this specification, the corresponding homologous genomic region within the target genomic locus may be referred to as the "target site". For example, a targeting vector can contain a first inserted nucleic acid flanked by a first homology arm and a second homology arm complementary to a first target site and a second target site. Thus, the targeting vector serves to integrate the inserted nucleic acid into the target locus of nucleic acids such as rats via a homologous recombination event that occurs between the homology arm and the complementary target site within the genome of the cell.

[0027] In one embodiment, the target locus of nucleic acids such as rats can contain a first nucleic acid sequence complementary to the 5' homology arm and a second nucleic acid sequence complementary to the 3' homology arm.

[0028] The vector can be introduced into the desired host cell by methods well known in the art, such as, but not limited to, transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosome fusion), gene gun, or use of a DNA vector transporter (see, for example, Wu et al., 1992, J. Biol. Chem., 267: 963-967; and Wu and Wu, 1988, J. Biol. Chem., 263: 14621-14624).

[0029] The term "transfection" means that a cell takes up RNA or DNA that is exogenous or heterologous to itself. When exogenous or heterologous RNA or DNA is introduced into a cell, the cell is "transfected" by such RNA or DNA. If the transfected RNA or DNA affects a phenotypic change, the cell is "transformed" by the exogenous or heterologous RNA or DNA. The transforming RNA or DNA can be integrated into the chromosomal DNA that constitutes the genome of the cell.

[0030] The terms "homology" or "homologous" mean that two sequences of a sequence, such as a nucleotide or amino acid sequence, are at least about 75% nucleotides or amino acids, at least about 80% nucleotides or amino acids, at least about 90-95% nucleotides or amino acids, for example, more than 97% nucleotides or amino acids are identical when optimally aligned and compared. As will be understood by those skilled in the art, for optimal gene targeting, the targeting construct should contain arms (i.e., "homology arms") that are homologous to the endogenous DNA sequence. Thereby, homologous recombination can occur between the targeting construct and the targeted endogenous sequence.

[0031] As used herein, when two regions have a sufficient level of sequence identity to each other, the homology arm and the target site (i.e., homologous genomic region) are complementary to each other, thereby functioning as a substrate for a homologous recombination reaction. "Homology" means that a DNA sequence corresponds to or is identical to or shares sequence identity with a "complementary" sequence. The sequence identity between a given target site and the corresponding homology arm found on the targeting vector can be any degree of sequence identity that allows for the occurrence of homologous recombination. For example, the amount (proportion or ratio) of sequence identity shared by the homology arm (or a fragment thereof) of the targeting vector and the target site (or a fragment thereof) can be at least 51%, 53%, 57%, 60%, 65%, 70%, 75%, 80%, 83%, 85%, 87%, 89%, 91%, 93%, 95%, 97%, 98%, 99% or 100% sequence identity. Note that the complementary homologous region between the homology arm and the complementary target site can have any length sufficient to promote homologous recombination at the cleaved recognition site. Thus, the homology arm has sufficient homology to perform homologous recombination with the corresponding target site within the genome of the cell. Briefly, the homology arms are referred to herein as the 5' homology arm and the 3' homology arm. The term relates to the relative position of the homology arm in the targeting vector and the inserted nucleic acid.

[0032] The identity of amino acid sequences or nucleotide sequences can be determined using the algorithms BLAST by Karlin and Altschul [Pro. Natl. Acad. Sci. USA, 90, 5873 (1993)] and FASTA [Methods Enzymol., 183, 63 (1990)]. Based on this algorithm BLAST, programs called BLASTN and BLASTX have been developed [J. Mol. Biol., 215, 403 (1990)]. When analyzing nucleotide sequences by BLASTN based on BLAST, the parameters can be, for example, Score = 100 and wordlength = 12. Also, when analyzing amino acid sequences by BLASTX based on BLAST, the parameters can be, for example, score = 50 and wordlength = 3. When using BLAST and the Gapped BLAST programs, the default parameters of each program can be used. The specific methods of these analysis methods are known (http: / / www.ncbi.nlm.nih.gov.).

[0033] In some embodiments, the homology arms of the targeting vector can have any length sufficient to promote homologous recombination events with the corresponding target site. The length is not limited, but examples include 5 - 100 kb, for example, at least 5 - 10 kb, 5 - 15 kb, 10 - 20 kb, 20 - 30 kb, 30 - 40 kb, 40 - 50 kb, 50 - 60 kb, 60 - 70 kb, 70 - 80 kb, 80 - 90 kb, or 90 - 100 kb, or a length greater than that.

[0034] In the present disclosure, genetic engineering and gene modification techniques used to create non - mammals for visualizing senescent cells by p16 gene expression include, but are not limited to, for example, genome editing, antisense, RNAi, and mutagenesis.

[0035] "Genome editing" refers to a technique for introducing mutations so as to specifically modify (for example, suppress, decrease, improve, or increase) the expression of a target gene. More specifically, it is a technique that uses site-specific nucleases to cleave at a target position in the genomic sequence of a target gene, thereby generating a single-stranded or double-stranded break at a specific position within the genome. The breaks generated in the genome in this way are usually repaired by processes such as homologous recombination (HDR) and non-homologous end joining (NHEJ). Random deletion or insertion of several bases in the target gene causes gene mutations such as nonsense mutations, missense mutations, and / or frameshift, resulting in the failure to produce a normal (biologically functional) protein. Examples of genome editing techniques include, but are not limited to, CRISPR / Cas9, TALEN, ZFN, meganuclease, and other techniques. General techniques for genome editing are outlined, for example, in Cox et al., Nat. Med. 21: 121-131 (2015); Zhang et al., Genome Biol. 19: 210 (2018). Introducing mutations into target genes using genome editing is excellent in that it can specifically introduce mutations into specific genes and more efficiently create varieties with desired properties than conventional mutagenesis methods or methods involving repeated mating.

[0036] When introducing mutations into genes by genome editing, methods using complexes such as CRISPR / Cas9, where the part involved in binding to the target DNA is RNA and the part involved in DNA cleavage is protein, or TALEN, ZFN, etc., where both the part involved in binding to the target DNA and the part involved in DNA cleavage are proteins, can be mentioned. For example, in the method using CRISPR / Cas9, Cas9, guide RNA, etc. are introduced into target cells, and in the method using TALEN or ZFN, a fusion protein in which a DNA binding domain and a nuclease are fused is introduced into target cells, whereby mutations can be introduced into the genome. Examples of methods for introducing into target cells include the Agrobacterium method, the RNA virus vector method, the plasma treatment method, the particle gun (bombardment) method, the PEG method, the electroporation method, etc.

[0037] As a preferred method for introducing mutations into the genome by genome editing, a method may be used in which mutations are generated when the cleavage site is naturally repaired after cleaving the target base sequence, or a DNA fragment having one or several base mutations in a sequence homologous to the target base sequence is introduced into the cell, and after cleaving the target base sequence, one or several base mutations are inserted when the cleavage site is repaired using the introduced DNA fragment as a template. Note that the number of bases is usually 2 to 6 bases.

[0038] The CRISPR / Cas9 system consists of three factors: CRISPR RNA (crRNA), trans-activating crRNA (tracrRNA), and Cas9 protein. The Cas9 protein derived from the Streptococcus pyogenes strain recognizes NGG (where N is any of G, A, T, or C), which are three bases downstream of the target genomic sequence, as a PAM sequence (Proto-spacer Adjacent Motif), and cleaves three bases upstream thereof. A general technique in the art is to introduce a double-strand break in the target site on genomic DNA by expressing guide RNA (gRNA) in which tracrRNA is ligated to the 3' end of crRNA complementary to the target gene sequence and Cas9.

[0039] The ZFN (Zinc Finger Nuclease) system is a system that utilizes an artificial restriction enzyme consisting of a zinc finger domain (ZF) that recognizes and binds to target DNA and a FokI domain that cleaves DNA. In this system, the zinc finger domain recognizes a specific gene sequence on the genome, and the FokI domain cleaves the DNA in this region, resulting in a double-strand break of the DNA.

[0040] The TALEN (Transcription Activator-Like Effector Nucleases) system is a system that uses an artificial nuclease having the transcription factor TAL effector (TALE) of the genus Xanthomonas as a DNA binding domain. The mechanism of action of genome editing by TALEN is similar to that of ZFN. It recognizes and binds to target DNA, and the FokI domain cleaves the DNA in this region, resulting in a double-strand break of the DNA. The DNA binding domain of TALE has a repeat structure with 34 amino acids as one unit (module), and it is known that one module recognizes one base. The 12th and 13th amino acid residues in the module are called Repeat variable di-residue (RVD), and RVD contributes to the binding specificity and stabilization of the base.

[0041] The term "knock-in method" is a type of gene replacement technology developed as a tool for developmental research and is a variant of the target gene inactivation (knock-out method). "Knock-in" refers to the addition of a DNA sequence or a fragment thereof to the genome. Such a DNA sequence to be knocked in may contain an entire gene or multiple genes, and may also contain regulatory sequences related to a gene or any part or fragment thereof.

[0042] <Specific Embodiments> According to the present invention, there are provided a method for producing a non-human mammal in which senescent cells are visualized by p16 gene expression, which includes crossing a target animal in which a gene encoding Cre recombinase is knocked in immediately after the start codon of exon 1 of the p16 locus or immediately before the stop codon of exon 3 of the p16 locus, with a target animal in which one or more reporter genes are knocked in, and a non-human mammal produced by the method.

[0043] (1) The p16 gene The p16 gene is one of the factors that regulate the cell cycle and is known to regulate the progression of the cell cycle by inhibiting the function of cyclin-dependent kinases. Mutations have been detected in many cancers and it is also one of the tumor suppressor genes.

[0044] From the perspective of the tumor suppressor gene product (ARF; alternative reading frame), for example, the human ARF protein is encoded by the ARF / p16INK4A locus located on chromosome 9p21. This locus encodes different tumor suppressor gene products of ARF and p16. Here, the p16 gene is composed of three exons, but exon 1 of the ARF gene ( "exon 1β") exists upstream of exon 1 of p16 ( "exon 1α"). By alternative splicing, the mRNA composed of "exon 1β", "exon 2" and "exon 3" common to the p16 gene produces an ARF protein that does not show homology with p16 by using a translation frame different from that of p16. Thus, ARF and p16 are each independently located upstream of the tumor suppressor gene products p53 and Rb and have been shown to be involved in their activation, and the ARF / p16INK4A locus plays a very important role in suppressing cell carcinogenesis.

[0045] Incidentally, the nucleotide sequences of exon 1 and exon 3 of the rat p16 gene are as follows: Exon 1 : atctccgagaggaaggcgaactcgaggagggcgatccggagcagc atg gagtcctctgcagatagactagccagggcagcggccctgggccgtgagcacgaggtgcgggcactgctggaagccggggcttcaccaaacgccccgaacactttcggtcgtaccccgatacag(SEQ ID NO: 1)(The underlined part is the start codon); Exon 3 : gtgcctaggatttcgaggccaacccccaaagcagcgc taa gttaggcctcagccctcctttttctccttggcttcacttctggcaacgcgagactagcatatggctttaaaaaaatacataatgctttttgcaatcacgcggggtgggtggggggaggttagcagagggagggagggacagagtggactattaaaaaagattaaatacttttt(SEQ ID NO: 2)(The underlined part is the stop codon)

[0046] As described above, two types of proteins, p16INK4A and ARF, are encoded at the CDKN2A locus. p16INK4A is a cyclin-dependent kinase (CDK) inhibitor molecule that inhibits the binding of CDK4 / 6 to cyclin D. Therefore, phosphorylation of RB by the cyclin D-CDK4 / 6 complex is suppressed, leading to inhibition of the transcription regulator E2F by RB. As a result, the expression of a group of genes involved in the transition from the G1 phase to the S phase under the control of E2F is suppressed, and the progression of the cell cycle is arrested. On the other hand, ARF has the function of promoting and maintaining the cell cycle arrest mechanism and induction of apoptosis of TP53 by inhibiting the degradation of TP53 by MDM2. As described above, both p16INK4A and ARF produced from the CDKN2A locus have functions as tumor suppressor genes. Genetic changes in tumors have been detected across cancer types, and deletions and short-type genetic changes account for most of them.

[0047] (2) Construction of the targeting vector According to the present invention, a non-human mammal in which senescent cells are visualized by p16 gene expression is obtained by crossing a target animal in which a gene encoding Cre recombinase is knocked in immediately after the start codon of exon 1 (for example, within 10 bp, within 7 bp, within 5 bp, within 4 bp, within 3 bp, within 2 bp, or within 1 bp), or immediately before the stop codon of exon 3 of the p16 gene locus (for example, within 10 bp, within 7 bp, within 5 bp, within 4 bp, within 3 bp, within 2 bp, or within 1 bp), with a target animal in which one or more reporter genes are knocked in. The present invention is typically characterized in that senescent cells are visualized by the disappearance of red fluorescence and the change to green fluorescence due to Cre expressed in association with p16 gene expression in cells derived from the above animals obtained by crossing, due to senescence.

[0048] The term "Cre recombinase" refers to a tyrosine recombinase that catalyzes site-specific recombination using a topoisomerase I-like mechanism between LoxP sites. The molecular weight of Cre recombinase is approximately 38 kDa, it consists of 343 amino acid residues, and is a member of the integrase family. Amino acid sequence of Cre recombinase: MSNLLTVHQNLPALPVDATSDEVRKNLMDMFRDRQAFSEHTWKMLLSVCRSWAAWCKLNNRKWFPAEPEDVRDYLLYLQARGLAVKTIQQHLGQLNMLHRRSGLPRPSDSNAVSLVMRRIRKENVDAGERAKQALAFERTDFDQVRSLMENSDRCQDIRNLAFLGIAYNTLLRIAEIARIRVKDISRTDGGRMLIHIGRTKTLVSTAGVEKALSLGVTKLVERWISVSGVADDPNNYLFCRVRKNGVAAPSATSQLSTRALEGIFEATHRLIYGAKDDSGQRYLAWSGHSARVGAARDMARAGVSIPEIMQAGGWTNVNIVMNYIRNLDSETGAMVRLLEDGD (SEQ ID NO: 3).

[0049] Among the Lox sequences, bacteriophage P 1A 34-base loxP sequence derived therefrom is a representative example, and the so-called Cre-LoxP system can be constructed. An example of the LoxP sequence is shown below. 5'-ataacttcgtatagcatacattatacgaagttat-3' (SEQ ID NO: 4) Thus, it can be seen that the 13 bases at both ends, which are the Cre binding sites, are symmetric, and the 8 bases in the central part are asymmetric.

[0050] Also, as will be understood by those skilled in the art, LoxP has a directionality. When a pair of Lox sequences are arranged in the same direction (the same orientation), the sequence between them is excised as circular DNA by Cre. It is rare for the excised circular DNA to return to its original state, and the above excision can be said to be substantially irreversible. On the other hand, when a pair of Lox sequences are arranged in the opposite direction (reverse orientation), the sequence between them is inverted (the orientation is switched). The above inversion can be said to be reversible.

[0051] In a first aspect, at least one pair of Lox sequences is preferably 1 to 4 pairs of Lox sequences, more preferably 1 to 3 pairs of Lox sequences, and even more preferably 1 or 2 pairs of Lox sequences. Examples of at least one pair of Lox sequences include not only the above-described LoxP sequence as a representative example, but also Lox2272 sequence, Lox511 sequence, LoxFAS sequence, LoxRE sequence, LoxLE sequence, etc., and two or more of these may be used in combination.

[0052] However, it is known that recombination occurs specifically between LoxP-LoxP, Lox2272-Lox2272, and Lox511-Lox511, while no recombination occurs between LoxP-Lox511 and LoxP-Lox2272.

[0053] By utilizing this specific recombination property, two or more pairs of Lox sequences (arranged in the reverse direction between each pair) can be used to arrange the target gene (a gene encoding a functional protein) in the reverse direction (inactive form), and a FLEx (Flip-excision) switch can be formed that "irreversibly" undergoes recombination by Cre and is activated by exon flipping. This can overcome the reversibility of inversion when a pair of Lox sequences are arranged in the reverse direction.

[0054] Separate from the FLEx switch, a morphological example using a pair of Lox sequences will be described below. In the above targeting vector (expression cassette), the target gene (a gene encoding a functional protein) can be arranged in the active orientation, and upstream of the target gene, a STOP sequence sandwiched (Floxed) between a pair of Lox sequences arranged in the same direction can be arranged. Since the pair of Lox sequences are arranged in the same direction, the STOP sequence is substantially irreversibly excised by Cre, and the target gene (a gene encoding a functional protein) can be expressed. The STOP sequence is not limited as long as it is a transcription termination sequence, and examples include the SV40 poly A signal sequence.

[0055] In the method for producing a non-human mammal of the present invention, the Cre recombinase is preferably a fusion protein with a nuclear translocation protein, that is, the gene encoding the Cre recombinase is preferably directly or indirectly fused with the gene encoding the nuclear translocation protein. The nuclear translocation protein is not limited as long as it can translocate into the nucleus, and examples include proteins having a nuclear localization signal. Specifically, an estrogen receptor (ER) or a mutant thereof is preferred. In the present invention, although not limited, as mutants of the estrogen receptor, ERT2, ERT, etc. can be used, and as the nuclear translocation protein, GR (glucocorticoid receptor) or a mutant thereof can also be used.

[0056] Tamoxifen compounds (such as tamoxifen and 4-hydroxytamoxifen (4-OHT)) can bind to ER present in the cytoplasm and translocate into the nucleus. The above-mentioned ERT2 is known to be a protein modified to bind only to tamoxifen compounds and lacking a nuclear translocation signal. Cre-ERT2 is a fusion protein of the above-mentioned Cre and ERT2, which can translocate into the nucleus in the presence of a tamoxifen compound and can cause recombination by Cre. (Feil R, Brocard J, Mascrez B, LeMeur M, Metzger D and Chambon P (1996): Ligand-activated site-specific recombination in mice. Proc Natl Acad Sci U S A, 93: 10887-10890. 1996;Feil R, Wagner J, Metzger D and Chambon P (1997): Regulation of Cre recombinase activity by mutated estrogen receptor ligand-binding domains. Biochemical and Biophysical Research Communications, 237: 752-727. 1997).

[0057] In this specification, as a typical example, a targeting vector (expression cassette) prepared for knocking in the Cre recombinase gene into a non-mammal is specifically referred to as a "p16 Exon1 Cre-ERT2 targeting vector" when the Cre-ERT2 gene is incorporated immediately after the start codon of exon 1 of the p16 locus, and a "p16 Exon3 Cre-ERT2 targeting vector" when the Cre-ERT2 gene is incorporated immediately before the stop codon of exon 3, and they are used separately for distinction.

[0058] The "p16 Exon1 Cre-ERT2 targeting vector" is a vector composed of, in the 5'→3' order, a start codon, Cre gene, ERT2 gene, bGH polyA, and p16 CDS gene, sandwiched by homologous recombination arms on the 5' side and 3' side. On the other hand, the "p16 Exon3 Cre-ERT2 targeting vector" is a vector composed of, in the 5'→3' order, p16 CDS gene, T2A gene, Cre gene, ERT2 gene, and a stop codon, sandwiched by homologous recombination arms on the 5' side and 3' side (see Figure 1).

[0059] In addition, in this specification, a targeting vector (expression cassette) prepared for knocking in one or more reporter genes into an animal is referred to as "LoxP reporter". Also, this improved version is referred to as "improved LoxP reporter", etc. However, as long as it has a reporter gene and a LoxP gene for causing gene recombination along with the expression of the Cre in the targeting vector incorporating the above Cre, the types of genes incorporated into the vector, as well as the order, orientation, and number of genes are not limited. For example, as the genes constituting it, in addition to LoxP, a gene encoding a red protein (RFP), a gene encoding a green protein (GFP), appropriately, WPRE (stabilizing RFP mRNA), a promoter (e.g., CAG), an enhancer, etc. can be included. Regulatory sequences such as promoters need to be arranged so as to function operably with respect to the sequence encoding the protein. The targeting vector containing one or more reporter genes according to the present invention is typically described in Figure 3.

[0060] In another embodiment, the reporter gene may be a gene encoding a bioluminescent protein. The "bioluminescent protein" refers to any protein that can act on a suitable substrate to generate luminescence. Examples of bioluminescent proteins include, but are not limited to, luciferase, alkaline phosphatase, and β-galactosidase.

[0061] (3) Non-human mammal The non-human mammal of the present invention can be obtained by mating at least two target animals in which a predetermined gene has been knocked into the host animal's chromosome by the above-described targeting vector. "Non-human mammal" includes rodents (rats, mice, guinea pigs, hamsters), rabbits, dogs, cats, sheep, pigs, goats, cows, monkeys, etc., and preferably rats.

[0062] One of the knocked-in target animals is an animal in which a gene encoding Cre recombinase has been knocked in immediately after the start codon of exon 1 of the p16 gene locus on the host animal's chromosome or immediately before the stop codon of exon 3. Another knocked-in target animal is an animal in which a reporter gene has been knocked in between exon 1 and exon 2 of the ROSA26 gene on the host animal's chromosome. By mating these animals, the double-knocked-in non-human mammal of the present invention can be obtained (see Examples 3 and 4).

[0063] (4) Aging evaluation using cells derived from non-human mammals By using fibroblasts isolated from the non-human mammal prepared above, cell aging can be visualized. Specifically, this cell aging can be visualized based on the disappearance of red fluorescence and the change to green fluorescence by Cre expressed along with p16 gene expression (see Example 2).

[0064] (5) Method for removing senescent cells According to the present invention, by using a targeting vector in which a suicide gene is linked to a reporter gene and mating a target animal having the introduced suicide gene, senescent cells can be removed by the use of ganciclovir (GCV). Examples of suicide genes include, but are not limited to, the herpes simplex virus thymidine kinase gene (HSV-TK gene), which is the most common (see Example 2).

[0065] Hereinafter, the technical solutions of the present disclosure will be further described by specific examples. The specific examples do not limit the protection scope of the present disclosure. Some non-essential modifications and adjustments made by others based on the concept of the present disclosure still fall within the protection scope of the present invention.

Example

[0066] Example 1: Knock-in (KI) of the Cre-ERT2 gene into the p16 gene locus, a cell senescence marker To visualize and detect senescent cells in rats, we attempted to generate rats with Cre-ERT2 knocked into the locus encoding the p16 gene using CRISPR / Cas9. Cre-ERT2 is an enzyme that recognizes LoxP sites and causes DNA recombination. By incorporating ERT2, which is part of the estrogen receptor, it is an enzyme that translocates into the nucleus in response to an estrogen receptor agonist and induces DNA recombination. To examine whether Cre-ERT2 functions properly under the control of p16 gene expression, two types of homologous recombination vectors with homologous arms of more than 1 kb on each of the 5' and 3' sides were prepared for the production of those targeting Exon1 and those targeting Exon3, respectively. The schematic diagram of the prepared plasmid vector is as shown in Figure 1. For the knock-in into Exon1, Cre-ERT2 was incorporated immediately downstream of the start codon in the p16 protein coding region, and by including the polyA sequence, the design was such that the endogenous p16 protein would not be expressed and transcription would immediately terminate. For the knock-in into Exon3, the design was to express Cre-ERT2 with a 2A peptide immediately before the stop codon in the p16 protein coding region, leaving the expression of the endogenous p16 gene intact. The vectors were synthesized and obtained by commissioning Fasmac Co., Ltd.

[0067] Regarding the production of knock-in rats using CRISPR / Cas9, six male Iar:Wistar-Imamichi (9 weeks old) and six female Iar:Wistar-Imamichi (9 weeks old) for fertilized egg production were purchased and acclimatized for one week. Pregnant mare serum gonadotropin (PMSG) was intraperitoneally administered to female Iar:Wistar-Imamichi at 30 IU per animal, and 48 hours after PMSG administration, human chorionic gonadotropin (hCG) was intraperitoneally administered at 30 IU per animal. After hCG administration, they were mated one-on-one with male Iar:Wistar-Imamichi.

[0068] On the day after mating, fertilized eggs were collected from the oviducts of female Iar:Wistar-Imamichi in which plugs were confirmed. The collected fertilized eggs were microinjected with DNA for knock-in consisting of gRNA, Cas9 mRNA, Cas9 protein, homologous recombination arms of the target gene, and the gene to be knocked in. The fertilized eggs subjected to microinjection were transplanted into the oviducts of pseudopregnant rats.

[0069] DNA was extracted from the tail tips of the obtained offspring using sodium hydroxide, and genotyping PCR was performed. The sequences of the primers used and the results of electrophoresis of the PCR products are shown in Figure 2.

[0070] As a result of genotyping, rats with Cre-ERT2 knocked in at the target sites of both Exon1 and Exon3 were obtained.

[0071] Example 2: Production of reporter rats expressing a thymidine kinase mutant that causes fluorescence change, luciferase, and cell death induction by Cre Since rats specifically expressing Cre-ERT2 for the p16 gene and KI rats highly expressing p16 could be prepared, an attempt was made to produce reporter rats for fluorescent labeling of Cre recombinase. Knock-in by CRISPR was the same as the method described above. The homologous recombination vector used for rat production in this example is shown in Figure 3. The vector was synthesized and obtained by requesting Fasmac Co., Ltd.

[0072] When Cre is not expressed, it is red, and when Cre is expressed, the red fluorescence disappears and changes to green fluorescence. A reporter gene with the RFP gene flanked by LoxP was used. In addition, it was designed to express Nanoluc and thymidine kinase under GFP.

[0073] After injection into fertilized eggs and transplantation into foster parents, the resulting offspring were observed for fluorescence. As a result, F0 individuals showing RFP fluorescence were obtained. A male without this reporter gene was mated with an F0 female rat of this reporter KI to produce F1, and fluorescence was observed. As a result, since RFP fluorescence could also be confirmed in F1, it was concluded that this reporter rat could be subcultured (Figure 4).

[0074] Fibroblasts were isolated from this rat and evaluated by introducing Cre mRNA to determine whether reporter gene expression was functioning as designed. The distal 5 mm of the tail of WT and ROSA26 reporter KI F0 rats was cut off, minced with scissors, and then treated with collagenase and dispase at 37 °C for 30 minutes. Subsequently, tissue debris was removed with a filter, centrifuged, suspended in medium, and fibroblasts were prepared by culturing in a collagen-coated dish. Cre mRNA was prepared using the HiScribe T7 ARCA mRNA Kit (with Tailing) (NEB). Cre mRNA was transfected into these fibroblasts using Lipofectamine MessengerMAX (Invitrogen). After Cre transfection, the expression of the GFP gene was evaluated by immunostaining, and the expression of luciferase was evaluated using Nano-Glo and Vivazine (Promega). Rabbit @cometGFP antibody (DNA2.0) was used for immunostaining. The expression of thymidine kinase was evaluated by whether cell death was induced by adding ganciclovir (Tokyo Chemical Industry). Cell death was evaluated using AlamarBlue (Invitrogen). The results are shown in Figure 5. Three days after introducing Cre mRNA, the appearance of RFP signals and GFP-positive cells was confirmed in fibroblasts derived from ROSA26 reporter knock-in rats. It was also confirmed that GFP-positive cells were RFP-negative cells. The expression of luciferase could only be confirmed in fibroblasts derived from knock-in rats into which Cre mRNA had been introduced. Also, regarding cell death induction by ganciclovir, it was confirmed only in knock-in-derived cells for both Nanoluc and AlamarBlue, indicating that the reporter gene was expressed as designed.

[0075] Example 3: Mating of p16-Cre-ERT2 KI rats and RORA26 reporter KI rats and confirmation of p16-positive cells using fibroblasts The Rosa 26 reporter knock-in rats were crossed with p16 Cre-ERT2 knock-in rats, and fibroblasts were isolated and cultured from the tip of the tail in the same manner as in Example 2 from the obtained CAG v3 reporter / p16 Cre-ERT2 double knock-in rats (dKI) to examine a method for inducing p16 in vitro. The results are shown in Fig. 6.

[0076] The signals of Nanoluc and GFP could be confirmed by culturing fibroblasts derived from double knock-in (dKI) rats for a long time without subculturing and continuously adding tamoxifen. The measurement of Nanoluc was performed using the Nano-Glo Live cell system (Promega). After culturing for 31 days, the cells were fixed, and GFP-positive cells were confirmed by immunostaining against cometGFP.

[0077] Autofluorescence tended to increase when the cells were cultured for a long time, but in these cells, GFP-positive cells could be distinguished from autofluorescence by immunostaining after adding tamoxifen. At this time, the signal of GFP was weak, and the signal of GFP could not be confirmed by a fluorescence microscope without immunostaining.

[0078] Example 4: Improvement of reporter KI rats with enhanced GFP signal Following Example 3, in order to enhance the GFP signal after Cre recombination, an attempt was made to improve the CAG v3 reporter rats. Since the mRNA stabilization sequence WPRE was designed to act only on RFP, an attempt was made to produce a knock-in rat with a design that also increased WPRE on the GFP side. Also, since thymidine kinase causes infertility in males, a design was made in which it was changed to a thymidine kinase mutant, and an attempt was made to produce a knock-in rat. The vectors produced are shown in Fig. 7.

[0079] Therefore, the number of WPRE sequences with the function of stabilizing mRNA and increasing the expression level was set to one, and a new design was made in which WPRE acts on both RFP and GFP. Specifically, reverse cometGFP, Nanoluc, and thymidine kinase genes were inserted under fresnoRFP, and both before and after that were sandwiched by two LoxP sequences (LoxP and Lox2272). The WPRE sequence was placed outside LoxP. As a result, in cells expressing p16, when Cre-ERT2 was expressed, the portion sandwiched by the LoxP sequences was inverted, changing the expression from RFP to GFP-Nanoluc-thymidine kinase mutant, and a design was made such that WPRE acts on any reporter gene. Using this homologous recombination vector, injection into rat fertilized eggs was carried out in the same manner as described above, and an attempt was made to produce knock-in rats. This vector was prepared from the aforementioned vector by using a PCR-based plasmid construction kit by HiFi DNA assembly (NEB).

[0080] As a result of observing the tail tip pieces of the obtained offspring under a fluorescence microscope, an RFP signal could be confirmed in one tail tip piece. The results are shown in Fig. 8.

[0081] Since the improved GFP signal ROSA 26 reporter knock-in rats could not see the RFP fluorescence signal in the previously observed individuals, it is considered that the RFP signal intensity is low.

[0082] Fibroblasts were isolated from the improved ROSA26 reporter knock-in rats by the aforementioned method, and the expression of the reporter gene was confirmed by introducing Cre mRNA.

[0083] As a result, the GFP signal after Cre introduction could be confirmed by immunostaining. In addition, ganciclovir was added, and the Nanoluc signal and the expression of the thymidine kinase mutant were confirmed. As a result, a decrease in the Nanoluc signal dependent on the concentration of ganciclovir could be confirmed, and the expression of various reporter genes could also be confirmed as designed in the improved ROSA26 reporter knock-in rats. The results are shown in Fig. 9.

[0084] To confirm whether the GFP signal was enhanced in the improved form, rat fibroblasts after mRNA introduction were directly observed with a fluorescence microscope (Keyence BZ-800) without immunostaining. The results of taking pictures are shown in Fig. 10.

[0085] As a result, before improving the GFP signal, the GFP signal could not be detected without immunostaining, but by improving the GFP signal, it became possible to directly observe it without immunostaining.

[0086] The improved ROSA26 reporter knock-in rats with the GFP signal and p16 Cre-ERT2 knock-in rats were crossed, and fibroblasts were isolated from the tails of the obtained dKI rats by the above-described method, and the GFP signal was confirmed in vitro. The results are shown in Fig. 11.

[0087] Similar to the case of Cre mRNA introduction, GFP-positive cells could also be observed with a fluorescence microscope without immunostaining in the mating with p16 Cre-ERT2 knock-in rats. It was also revealed that only autofluorescence was observed when tamoxifen was not added.

[0088] Finally, the feasibility of sorting by a cell sorter was compared before and after improving the GFP signal. Cells detached with trypsin were analyzed using a cell sorter (Sony, MA-900), and the presence or absence of the appearance of GFP-positive cells was verified. The results are shown in Fig. 12. Although RFP-positive cells could be detected before improving the GFP signal, GFP-positive cells could not be detected by FACS. On the other hand, in the improved one, a GFP-positive fraction could be observed, and cell sorting was feasible. From this, it was shown that using this system, p16-positive cells could be isolated by cell sorting also in rats and could be used for various assays.

[0089] All publications, patent applications, patents, GenBank or other accession numbers, and other references mentioned in this specification are hereby incorporated by reference in their entirety.

Claims

**Claim 1** A non-human mammal for visualizing senescent cells by p16 gene expression, into which a targeting vector containing a gene encoding Cre recombinase is introduced immediately after the start codon of exon 1 of the p16 gene locus or immediately before the stop codon of exon 3 of the p16 gene locus, and a targeting vector containing one or more reporter genes is introduced. **Claim 2** The non-human mammal according to claim 1, wherein exon 1 contains the nucleotide sequence shown in SEQ ID NO:

1. **Claim 3** The non-human mammal according to claim 1, wherein exon 3 contains the nucleotide sequence shown in SEQ ID NO:

2. **Claim 4** The non-human mammal according to any one of claims 1 to 3, wherein a gene encoding a nuclear localization protein is linked to the gene encoding Cre recombinase. **Claim 5** The non-human mammal according to claim 4, wherein the nuclear localization protein is ERT2, ERT, or GR. **Claim 6** The non-human mammal according to claim 1, wherein the reporter gene is a gene encoding a fluorescent protein or a gene encoding a bioluminescent protein. **Claim 7** The non-human mammal according to claim 6, wherein one or more fluorescent proteins are selected from the group consisting of green fluorescent protein (GFP) and red fluorescent protein (RFP). **Claim 8** The non-human mammal according to claim 6, wherein one or more bioluminescent proteins are selected from the group consisting of luciferase, alkaline phosphatase, and β-galactosidase. **Claim 9** The non-human mammal according to claim 1, wherein a suicide gene is linked to the reporter gene. **Claim 10** The non-human mammal according to claim 7, for visualizing senescent cells as a change in luminescence color from RFP to GFP accompanied by the expression of the p16 gene. **Claim 11** The non-human mammal according to claim 1, wherein the non-human mammal is a rat. **Claim 12** A method for producing a non-human mammal in which senescent cells are visualized by p16 gene expression, comprising mating a target animal in which a gene encoding Cre recombinase is knocked in immediately after the start codon of exon 1 of the p16 gene locus or immediately before the stop codon of exon 3 of the p16 gene locus with a target animal in which one or more reporter genes are knocked in. **Claim 13** The method according to claim 12, wherein exon 1 contains the nucleotide sequence shown in SEQ ID NO:

1. **Claim 14** The method according to claim 12, wherein Exxon 3 comprises the nucleotide sequence shown in SEQ ID NO:

2.

15. The method according to any one of claims 12 to 14, wherein the knock-in is performed using CRISPR / Cas9.

16. The method according to claim 12, wherein a gene encoding a nuclear localization protein is linked to a gene encoding Cre recombinase.

17. The method according to claim 12, wherein the nuclear localization protein is ERT2, ERT, or GR.

18. The method according to claim 12, wherein the reporter gene is a gene encoding a fluorescent protein or a gene encoding a bioluminescent protein.

19. The method according to claim 18, wherein the fluorescent protein is selected from one or more of the group consisting of green fluorescent protein (GFP) and red fluorescent protein (RFP).

20. The method according to claim 18, wherein the bioluminescent protein is selected from one or more of the group consisting of luciferase, alkaline phosphatase, and β-galactosidase.

21. The method according to claim 12, wherein a suicide gene is linked to the reporter gene.

22. The method according to claim 12, for visualizing senescent cells as a change in luminescence color from RFP to GFP accompanied by the expression of the p16 gene.

23. The method according to claim 12, wherein the non-human mammal is a rat.

24. A method for evaluating aging, comprising using a non-human mammal for visualizing senescent cells as defined in claim 1.

25. A method for removing senescent cells, comprising administering ganciclovir to the non-human mammal as defined in claim 9.

Images