Glycation inhibitor
Bacopa monnieri, either alone or combined with Ampelopsis glandulosa, serves as an effective glycation inhibitor by suppressing glycation product formation and promoting their decomposition, addressing the limitations of current technologies in managing glycation-related diseases.
Patent Information
- Application Number
- JP2023206568
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2023-12-07
- Publication Date
- 2025-06-19
AI Technical Summary
Current technologies lack effective solutions to inhibit glycation product formation and promote their decomposition, which are associated with various diseases such as osteoarthritis, reduced skin elasticity, and decreased bone strength.
The use of Bacopa monnieri, either alone or in combination with Ampelopsis glandulosa, as a glycation inhibitor to suppress the formation of glycation products and promote their decomposition.
Bacopa monnieri exhibits a significant inhibitory effect on glycation product formation and enhances the decomposition of these products, offering potential benefits in preventing and treating diseases related to glycation.
Smart Images

Figure 2025091439000001 
Figure 2025091439000002 
Figure 2025091439000003
Abstract
Description
Technical Field
[0001] The present invention relates to a glycation inhibitor characterized by containing Bacopa monnieri. More specifically, it relates to a glycation inhibitor based on the suppression of glycation product formation and the promotion of glycation product decomposition in Bacopa monnieri.
Background Art
[0002] Glycation, also known as the Maillard reaction, is a reaction in which amino acids or proteins non-enzymatically bind to reducing sugars such as glucose. In glycation, through a complex reaction system, various glycation products with different structures called Advanced Glycation End Products (AGEs) are generated. In particular, when collagen, a protein that accounts for a large proportion in the living body, undergoes glycation, cross-links are formed, which have an adverse effect on various tissues such as the skin, joints, and bones. In addition, the accumulation of glycation products in the body has been shown to be associated with many diseases such as diabetic complications, neuropathy, Alzheimer's disease, steatohepatitis, sarcopenia, and periodontal disease (Non-Patent Document 1).
[0003] In the skin, collagen and elastin are mainly present in the dermis layer and contribute to maintaining the elasticity of the skin. Glycation in the skin causes the accumulation of AGEs and cross-linking of collagen and elastin, leading to a decrease in skin elasticity (Non-Patent Document 2). To prevent the adverse effects of glycation on the skin and maintain an attractive appearance, it is important to suppress glycation.
[0004] Osteoarthritis is a disease in which degeneration and destruction of articular cartilage occur. The number of patients with osteoarthritis is extremely large, and it occupies a high position among the factors causing the elderly to require care or support. Articular cartilage is mainly composed of collagen and proteoglycan. Glycation in cartilage causes the accumulation of AGEs in collagen and proteoglycan, and further causes degeneration and destruction of cartilage, leading to osteoarthritis (Non-Patent Documents 3 and 4). Osteoarthritis is accompanied by joint pain and swelling, affecting the quality of life and healthy life expectancy. Therefore, to prevent osteoarthritis and maintain joint health, it is important to suppress glycation.
[0005] Bone mainly consists of a mineral component and collagen. Along with the decrease in bone density due to aging and the decline of female hormones, bone strength decreases and the risk of fracture increases. In addition to bone density, it is said that the decrease in "bone quality" is also involved in bone strength. When the collagen in bone is glycated and cross-links are formed by AGEs, it becomes brittle, resulting in a decrease in "bone quality" (Non-Patent Document 5). That is, it is considered that the suppression of glycation improves "bone quality" and leads to the prevention and improvement of the decrease in bone strength.
[0006] In the glycation reaction, in addition to the generation of glycated products and the denaturation of proteins, the generated glycated products cause further adverse effects. Therefore, in order to reduce the adverse effects of glycation in the living body, it is considered preferable to suppress the generation of glycated products and promote the decomposition of glycated products.
[0007] Regarding the decomposition of glycated products, the involvement of oxidized protein hydrolase (OPH) is known. OPH is a type of serine protease that releases the N-terminal acylamino group and is also called acylaminoacylpeptide hydrolase (APEH). OPH is known to have a decomposing action on proteins denatured by glycation or oxidation and has attracted attention as a treatment strategy for diseases caused by the accumulation of denatured proteins such as diabetes and Alzheimer's disease (Non-Patent Document 6). Therefore, increasing the production of OPH is considered to lead to the promotion of the decomposition of glycated products and the reduction of the adverse effects on the living body caused by denatured proteins.
[0008] Since sugar and protein coexist in the living body and it is considered that glycation reactions and the accumulation of glycated products occur over a long period of time, it is desirable to suppress glycation with food materials that can be ingested daily. From this perspective, so far, sea buckthorn (Patent Document 1), coffee beans (Patent Document 2), chestnut tannin extract (Patent Document 3), etc. have been proposed as food materials having a glycation-suppressing effect, but the development of more effective food-derived glycation inhibitors is required.
[0009] As a result of investigations using various food materials, the inventors have found that Bacopa monnieri has an excellent inhibitory effect on glycation product formation and an accelerating effect on glycation product decomposition. Furthermore, it has been found that the combination of Bacopa monnieri and raisins significantly enhances the inhibitory effect on glycation product formation and the accelerating effect on glycation product decomposition. As prior art regarding Bacopa monnieri, an inducible nitric oxide synthase inhibitory effect (Patent Document 4), an anti-seizure effect, an antidepressant and anti-anxiety effect, and an antibacterial effect (Non-Patent Document 7) are known. However, there is no knowledge at all about the glycation inhibitory effect by Bacopa monnieri, and furthermore, there is no knowledge at all about the glycation inhibitory effect by the combination of Bacopa monnieri and raisins.
Prior Art Documents
Patent Documents
[0010]
Patent Document 1
Patent Document 2
Patent Document 3
Patent Document 4
Non-Patent Documents
[0011]
Non-Patent Document 1
Non-Patent Document 2
Non-Patent Document 3
Non-Patent Document 4
Non-Patent Document 5
Non-Patent Document 6
Non-Patent Document 7
Summary of the Invention
Problems to be Solved by the Invention
[0012] The present invention relates to a glycation inhibitor characterized by containing Bacopa monnieri. More specifically, it relates to a glycation inhibitor based on the suppression of glycation product formation and the promotion of glycation product decomposition by Bacopa monnieri.
Means for Solving the Problems
[0013] As a result of intensive research, the present inventors have found that Bacopa monnieri has excellent effects of suppressing the formation of glycation products and promoting the decomposition of glycation products. Furthermore, it has been found that the combined use of Bacopa monnieri and Ampelopsis glandulosa significantly enhances the effects of suppressing the formation of glycation products and promoting the decomposition of glycation products.
[0014] As the Bacopa monnieri used in the present invention, Bacopa monnieri (scientific name: Bacopa monnieri) of the family Scrophulariaceae can be used. Bacopa monnieri, also known as Ottome Azena, is a perennial aquatic plant distributed in tropical and subtropical regions. In traditional Indian medicine Ayurveda, it has been used to improve various symptoms such as mental anxiety. The part of Bacopa monnieri used in the present invention is not particularly limited, but it is preferably the whole plant, especially the leaves.
[0015] As the Ampelopsis glandulosa used in the present invention, Ampelopsis glandulosa (scientific name: Ampelopsis glandulosa) of the genus Ampelopsis in the family Vitaceae can be used. Ampelopsis glandulosa, also known as wild grape and snake grape, is a vine-like deciduous shrub native to Japan and East Asia. The part of Ampelopsis glandulosa used in the present invention is not particularly limited, and examples include the whole plant body and parts (above-ground parts such as flowers, leaves, stems, fruits, peels, seeds, and roots). In particular, it is preferable to use the above-ground part.
[0016] The Bacopa monnieri and grape used in the present invention can be used as they are, or, if necessary, those that have been subjected to treatments such as juicing, drying, pulverization, and mincing can also be used. Further, extracts obtained by extracting the Bacopa monnieri and grape as they are or after the above treatments can also be used. Examples of the solvent for extraction include water, lower alcohols (such as methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (such as 1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (such as acetone, methyl ethyl ketone, etc.), acetonitrile, esters (such as ethyl acetate, butyl acetate, etc.), hydrocarbons (such as hexane, heptane, petroleum ether, etc.), and ethers (such as ethyl ether, tetrahydrofuran, propyl ether, etc.). These solvents may be used alone or in combination of two or more. For the Bacopa monnieri used in the present invention, extraction with a polar solvent such as water or lower alcohol is preferred, and ethanol extraction is particularly preferred. Further, for the grape used in the present invention, extraction with a polar solvent such as water or lower alcohol is preferred, and hydrous ethanol is particularly preferred.
[0017] The above extract may be used as the extracted liquid as it is, or, if necessary, it may be used after treatments such as concentration, dilution, filtration, decolorization with activated carbon, deodorization, ethanol precipitation, and fermentation. Further, the extracted solution may be subjected to treatments such as concentration to dryness, spray drying, and freeze drying, and used as a dried product.
[0018] The dosage of Bacopa monnieri and Vitis vinifera used in the present invention can be appropriately adjusted according to the dosage form, purpose of use, age, body weight, etc. Bacopa monnieri can be orally administered once to several times a day in the range of 0.05 to 2,000 mg, preferably 0.5 to 100 mg per day as an extract. Vitis vinifera can be orally administered once to several times a day in the range of 0.1 to 2,000 mg, preferably 1 to 100 mg per day as an extract. In some cases, an amount less than the above dosage range may be sufficient, and in other cases, it may be necessary to ingest beyond the range. Also, regarding the method of adding the active ingredient in formulation, it may be added in advance or during the manufacturing process, and it may be appropriately selected considering workability.
[0019] The glycation inhibitor of the present invention can be used as a food, a cosmetic, a quasi-drug, or a pharmaceutical. As a food, it can be used as tablets, soft capsules, hard capsules, granules, tablets, gummies, beverages, jelly, etc., and as a cosmetic, it can be used as lotion, cream, emulsion, facial wash, foundation, lipstick, etc. Also, in quasi-drugs and pharmaceuticals, it can be used as oral capsules, powders, granules, tablets, sugar-coated tablets, syrups, pills, suspensions, solutions, emulsions, etc., and parenteral external preparations, injections, etc. In order to achieve the object of the present invention, ingestion by oral administration is more preferable.
[0020] The glycation inhibitor of the present invention can also contain components such as excipients, stabilizers, lubricants, preservatives, binders, disintegrants, hydrocarbons, fatty acids, alcohols, esters, pH adjusters, antiseptics, fragrances, etc. that are usually used in foods, cosmetics, quasi-drugs, or pharmaceuticals within a range that does not impair the effect. Furthermore, it can also contain components such as plant materials, polyphenols, vitamins, saccharides, proteins, oils and fats, etc.
Effects of the Invention
[0021] The glycation inhibitor characterized by containing Bacopa monnieri exhibits an excellent glycation inhibitory effect based on the inhibition of glycation product formation and the promotion of glycation product decomposition of Bacopa monnieri. Further, the glycation inhibitor characterized by containing Bacopa monnieri and grape is extremely excellent in glycation inhibitory effect based on the inhibition of glycation product formation and the promotion of glycation product decomposition. The glycation inhibitor of the present invention is useful for the prevention, treatment, improvement, etc. of various symptoms and diseases involving glycation, such as reduced skin elasticity, osteoarthritis, reduced bone strength, diabetes, diabetic complications, Alzheimer's disease, periodontal disease, and the like.
Mode for Carrying Out the Invention
[0022] The following examples are for illustrative purposes and the claims of the present invention are not limited to these examples in any way. The % of the content shown in the examples indicates % by weight.
Examples
[0023] Production Example 1 Bacopa monnieri hot water extract After adding 2 kg of purified water to 100 g of Bacopa monnieri and performing heat extraction, the extract was concentrated and dried to obtain 9.5 g of a solid.
[0024] Production Example 2 50% ethanol extract of Bacopa monnieri After adding 2 kg of 50% ethanol to 100 g of Bacopa monnieri and extracting at room temperature for 7 days, the extract was concentrated and dried to obtain 5.6 g of a solid.
[0025] Production Example 3 Ethanol extract of Bacopa monnieri After adding 2 kg of ethanol to 100 g of Bacopa monnieri and extracting at room temperature for 7 days, the extract was concentrated and dried to obtain 3.5 g of a solid.
[0026] Production Example 4 Grape hot water extract After adding 2 kg of purified water to 100 g of grape and performing heat extraction, the extract was concentrated and dried to obtain 7.2 g of a solid.
[0027] Production Example 5 30% ethanol extract of grape 2 kg of 30% ethanol was added to 100 g of grapes and extracted at room temperature for 7 days. Then, the extract was concentrated and dried to obtain 4.8 g of solid matter.
[0028] Production Example 6: Grape Ethanol Extract 2 kg of ethanol was added to 100 g of grapes and extracted at room temperature for 7 days. Then, the extract was concentrated and dried to obtain 2.9 g of solid matter.
[0029] Next, formulation examples using Bacopa monnieri and grapes are given, but the present invention is not limited thereto.
Example
[0030] Formulation Example 1: Tablet <Formulation> Component Content (%) 1. Hot water extract of Bacopa monnieri (Production Example 1) 1.0 2. Maltitol Added to make the total amount 100 3. Cellulose 5.0 4. Sucrose fatty acid ester 3.0 <Manufacturing method> Components 1 to 3 were mixed, 10% water was added as a binder, and fluidized bed granulation was performed. Component 4 was added to the formed granules and mixed, and then tabletted to obtain tablets of 300 mg per tablet. <Usage> Take 3 tablets per day.
[0031] Formulation Example 2: Beverage <Formulation> Component Content (%) 1. Ethanol extract of Bacopa monnieri (Production Example 3) 0.05 2. Maltitol 5.00 3. Malic acid 1.00 4. Flavor 0.50 5. Purified water 93.45 <Manufacturing method> Components 1 to 4 were stirred and dissolved in a part of Component 5. Then, the remaining part of Component 5 was added and mixed, heated to 90 °C, and filled into 30 mL glass bottles. <Usage> Take 1 stick (30 mL) per day.
[0032] Prescription Example 3 Granules <Prescription> Ingredient Content (%) 1. Bacopa monnieri 50% ethanol extract (Production Example 2) 1.5 2. Lactose 78.5 3. Cellulose 20.0 <Production Method> Ingredients 1 to 3 were granulated by the dry method to obtain granules. <Dosage> Take 1 packet (1 g) per day.
[0033] Prescription Example 4 Hard Capsules <Prescription> Ingredient Content (%) 1. Bacopa monnieri hot water extract (Production Example 1) 6.0 2. Grape 30% ethanol extract (Production Example 5) 6.0 3. Sucrose fatty acid ester 3.0 4. Corn starch Add to make the total amount 100. <Production Method> Ingredients 1 to 4 were mixed and filled into No. 2 hard capsules with 250 mg to obtain hard capsules. <Dosage> Take 2 capsules per day.
[0034] Prescription Example 5 Soft Capsules <Prescription> Ingredient Content (%) 1. Bacopa monnieri 50% ethanol extract (Production Example 2) 1.0 2. Grape ethanol extract (Production Example 6) 0.5 3. Medium-chain fatty acid oil Add to make the total amount 100. 4. Beeswax 5.0 5. Glycerin fatty acid ester 5.0 6. Vitamin E 3.0 <Production Method> Ingredients 1 to 6 were mixed, filled with 250 mg into a film composed of gelatin and glycerin, and after drying, a soft capsule preparation was obtained. <Dosage> Take 3 capsules per day.
[0035] Formulation Example 6 Beverage <Formulation> Ingredient Content (%) 1. Bacopa monnieri ethanol extract (Production Example 3) 0.02 2. Grape 30% ethanol extract (Production Example 5) 0.08 3. Maltitol 5.00 4. Malic acid 1.00 5. Flavor 0.50 6. Purified water 93.40 <Manufacturing method> Ingredients 1 to 5 were stirred and dissolved in a part of Ingredient 6. Then, the remaining part of Ingredient 6 was added and mixed, heated to 90 °C, and filled into 30 mL glass bottles. <Dosage> Take 1 bottle (30 mL) per day.
[0036] Formulation Example 7 Lotion <Formulation> Ingredient Content (%) 1. Bacopa monnieri hot water extract (Production Example 1) 0.5 2. Grape hot water extract (Production Example 4) 0.5 3. Glycerin 5.0 4. Polyoxyethylene sorbitan monolaurate 1.5 5. Ethanol 5.0 6. Preservative 0.5 7. Water 87.0 <Manufacturing method> Ingredients 1 to 6 were stirred and dissolved in the water of Ingredient 7. <Dosage> Apply 3 mL to the skin per day.
Example
[0037] Test Example 1 Inhibitory effect of Bacopa monnieri on glycation The effectiveness of Bacopa monnieri was evaluated using a reaction system that generates glycation products by mixing sugar and protein and heating them. That is, to a solution containing 0.2 M glucose, 0.6 mg / mL collagen, and 50 mM phosphate buffer as the final concentrations, hot water extract of Bacopa monnieri (Production Example 1), 50% ethanol extract (Production Example 2), and ethanol extract (Production Example 3) were added so that the final concentrations were 0.01, 0.03, and 0.1 mg / mL, and the reaction was carried out at 60 °C for 10 days. As a positive control, aminoguanidine (final concentration 0.1 mg / mL) was used. Four reaction systems shown below, namely, (A) sample present·glucose present, (B) sample present·glucose absent, (C) sample absent·glucose present, (D) sample absent·glucose absent, were set according to the presence or absence of sample addition and the presence or absence of glucose. The fluorescence intensity (excitation wavelength 370 nm, fluorescence wavelength 440 nm) of the solution after the reaction was measured, and the inhibition rate of glycation product formation was calculated by applying it to the following formula. Note that the higher the numerical value of the inhibition rate, the higher the glycation product formation inhibitory effect. Inhibition rate (%) = {1 - (A - B) / (C - D)} × 100
[0038] The results of Test Example 1 are shown in Table 1. The hot water extract of Bacopa monnieri (Production Example 1), 50% ethanol extract (Production Example 2), and ethanol extract (Production Example 3) inhibited the formation of glycation products in a concentration-dependent manner. The inhibition rate at an added concentration of 0.1 mg / mL was higher than that of the positive control aminoguanidine. From the above results, it became clear that Bacopa monnieri has an excellent glycation product formation inhibitory effect.
[0039] [Table 1]
[0040] Test Example 2 Glycation product decomposition promoting effect of Bacopa monnieri (OPH gene expression) Human dermal fibroblasts were cultured in DMEM containing 10% fetal bovine serum. Subsequently, Bacopa monnieri hot water extract (Production Example 1), 50% ethanol extract (Production Example 2), and ethanol extract (Production Example 3) were added to serum-free DMEM at a final concentration of 30 μg / mL and cultured for 24 hours, followed by gene expression analysis. Gene expression was evaluated by real-time PCR for the gene expression variation of OPH. Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) was used as an internal standard. The gene expression without sample addition was set as 1, and the gene expression ratio was calculated.
[0041] Primer set for OPH TGGCAGCCCTCCAGATAAGA (SEQ ID NO: 1) GAACAGCATCCAGGCAGTGA (SEQ ID NO: 2) Primer set for GAPDH TGCACCACCAACTGCTTAGC (SEQ ID NO: 3) TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 4)
[0042] The results of Test Example 2 are shown in Table 2. Bacopa monnieri hot water extract (Production Example 1), 50% ethanol extract (Production Example 2), and ethanol extract (Production Example 3) promoted OPH gene expression. From the above, the promoting effect of Bacopa monnieri on OPH production, that is, the promoting effect on glycide decomposition, was clarified.
[0043]
Table 2
[0044] Test Example 3 Promoting effect of Bacopa monnieri on glycide decomposition (OPH protein expression) Human dermal fibroblasts were cultured in DMEM containing 10% fetal bovine serum. Subsequently, Bacopa monnieri hot water extract (Production Example 1), 50% ethanol extract (Production Example 2), and ethanol extract (Production Example 3) were added to serum-free DMEM at a final concentration of 30 μg / mL. After 24 hours, the supernatant was removed, the cells were fixed, and after permeabilization and blocking treatments, a primary antibody (Anti-APEH), a secondary antibody, and DAPI (a fluorescent dye used for nuclear staining) were added. Images were acquired using a fluorescence microscope, and the fluorescence intensity and the number of nuclei were analyzed using ImageJ software. The OPH protein expression was evaluated by calculating the fluorescence intensity per cell. The fluorescence intensity without sample addition was set to 1, and the fluorescence intensity ratio was calculated.
[0045] The results of Test Example 3 are shown in Table 3. Bacopa monnieri hot water extract (Production Example 1), 50% ethanol extract (Production Example 2), and ethanol extract (Production Example 3) promoted the expression of OPH protein. From the above, the effect of Bacopa monnieri in promoting OPH production, that is, the effect of promoting glycide decomposition, was clarified.
[0046]
Table 3
[0047] Test Example 4 Examination of the synergistic effect between Bacopa monnieri and grape in the glycide production inhibitory effect As the final concentration, Bacopa monnieri ethanol extract (Production Example 3) and grape 30% ethanol extract (Production Example 5) were added to a solution containing 0.2 M glucose, 8 mg / mL human serum albumin, and 50 mM phosphate buffer at final concentrations of 5 μg / mL each, and reacted at 60 °C for 40 hours. Four reaction systems as shown below, namely, (A) sample present·glucose present, (B) sample present·glucose absent, (C) sample absent·glucose present, (D) sample absent·glucose absent, were set according to the presence or absence of sample addition and the presence or absence of glucose. The fluorescence intensity (excitation wavelength 370 nm, fluorescence wavelength 440 nm) of the solution after the reaction was measured, and the inhibition rate of glycide production was calculated by applying it to the following formula. Note that the higher the inhibition rate value, the higher the glycide production inhibitory effect. Inhibitory rate (%) = {1 - (A - B) / (C - D)} × 100
[0048] The results of Test Example 4 are shown in Table 4. Bacopa monnieri ethanol extract (Production Example 3) exhibited an inhibitory effect on glycation product formation, and grape 30% ethanol extract (Production Example 5) also exhibited a slight inhibitory effect on glycation product formation. Furthermore, when the Bacopa monnieri ethanol extract and the grape 30% ethanol extract were added in combination, a remarkable inhibitory effect on glycation product formation was observed. From the above results, it was clarified that the combination of Bacopa monnieri and grape exhibits an extremely excellent synergistic effect in the inhibitory effect on glycation product formation.
[0049]
Table 4
[0050] Examination of the Synergistic Effect of Bacopa monnieri and Grape in the Promoting Effect of Glycated Product Degradation - Test Example 5 Human dermal fibroblasts were cultured in DMEM containing 10% fetal bovine serum. Subsequently, the 50% ethanol extract of Bacopa monnieri (Production Example 2) and the ethanol extract of grape (Production Example 6) were added to DMEM without serum at final concentrations of 10 μg / mL each, and cultured for 24 hours, followed by gene expression analysis. Gene expression was evaluated by real - time PCR for the gene expression variation of OPH. GAPDH was used as the internal standard. The gene expression without sample addition was set as 1, and the gene expression ratio was calculated.
[0051] The results of Test Example 5 are shown in Table 5. The 50% ethanol extract of Bacopa monnieri (Production Example 2) exhibited a promoting effect on OPH gene expression. On the other hand, the effect of the ethanol extract of grape (Production Example 6) was slight. However, when the above - mentioned 50% ethanol extract of Bacopa monnieri and the ethanol extract of grape were added in combination, the promoting effect on OPH gene expression was significantly enhanced. From the above results, it was clarified that the combination of Bacopa monnieri and grape exhibits an extremely excellent synergistic effect in the promoting effect of OPH production, that is, the promoting effect of glycated product degradation.
[0052]
Table 5
Industrial Applicability
[0053] From the above, the present invention can be used as an anti-glycation agent containing Bacopa monnieri. The anti-glycation agent containing Bacopa monnieri of the present invention is useful for preventing, treating, and improving various symptoms, diseases, and disorders involving glycation, such as decreased skin elasticity, osteoarthritis, decreased bone strength, diabetes, diabetic complications, Alzheimer's disease, periodontal disease, and the like, by suppressing the production of glycated products and promoting their degradation.
Claims
1. A glycation inhibitor characterized by containing Bacopa monnieri.
2. The glycation inhibitor according to Claim 1, wherein the glycation inhibition is inhibition of glycation product formation.
3. The glycation inhibitor according to Claim 1, wherein the glycation inhibition is promotion of glycation product decomposition.
4. The glycation inhibitor according to any one of Claims 1 to 3, characterized by containing grape.
5. A food composition for glycation inhibition, characterized by containing the glycation inhibitor according to any one of Claims 1 to 3.
6. A food composition for glycation inhibition, characterized by containing the glycation inhibitor according to Claim 4.
Citation Information
Patent Citations
Prism device for fingerprint collation and fingerprint collation device
JP2003004918A
Suspicious visitor handling system
JP2006155273A
Voltage fluctuation reduction circuit and semiconductor device
JP2011035271A
Polymer nanoparticles and their preparation process
JP2015525245A