External or internal preparation

Abstract

To provide a novel external or internal preparation exhibiting superior activity in inhibiting MMP, promoting hyaluronic acid production, and promoting cell proliferation.SOLUTION: It was found that an extract of giant kelp has superior activity in inhibiting MMP, promoting hyaluronic acid production, and promoting cell proliferation, and also has superior stability. The extract of giant kelp is applicable not only to the cosmetic field including prevention of skin aging, but also to the medical field including suppression of age-related functional decline and cancer prevention and treatment, and is anticipated to find applications in cosmetics, foods, quasi-drugs, and pharmaceuticals.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to external and internal preparations for the skin.

Background Art

[0002] The skin is exposed daily to various physical and chemical stresses such as ultraviolet rays, dryness, cold, heat, drugs, etc. As a result, the function of the skin deteriorates, and various skin aging phenomena become apparent. One of the skin aging phenomena is wrinkles. It is known that there are two types of wrinkles: epidermal wrinkles and dermal wrinkles. Epidermal wrinkles are called fine wrinkles and are temporarily caused by a decrease in the water content in the epidermal keratin due to skin dryness. On the other hand, dermal wrinkles are formed by ultraviolet rays contained in sunlight or aging. As its formation mechanism, a decrease in collagen synthesis ability in dermal fibroblasts due to ultraviolet rays or aging, and promotion of collagen degradation due to an increase in matrix metalloproteinase (MMP) can be mentioned.

[0003] In the case of epidermal wrinkles and dermal wrinkles caused by dryness, the histological morphology, onset mechanism, and treatment methods are different, and dermal wrinkles caused by ultraviolet rays or aging are difficult to improve by using cosmetics having a moisturizing effect.

[0004] Heretofore, for the purpose of improving dermal wrinkles caused by ultraviolet rays, a wrinkle formation prevention and improvement agent for the skin containing hydrolyzed almond as an active ingredient (Patent Document 1), and an improvement agent for wrinkles caused by ultraviolet irradiation containing extracts of Ligustrum lucidum, Centella asiatica and Chrysanthemum morifolium as active ingredients (Patent Document 2) have been reported.

[0005] MMP plays a major role in the invasion of cancer cells into the stroma, their entry into blood vessels, and angiogenesis. The stroma mainly consists of type I collagen, and the destruction of the substrate by stromal collagenase etc. is necessary for the movement of cancer cells. To complete metastasis, it is necessary to destroy the vascular endothelial basement membrane and move through the stroma, and MMP is also involved at this stage (Non-Patent Document 1). Therefore, substances having inhibitory activity against MMP are expected to have the effect of suppressing angiogenesis and cancer metastasis in cancer tissues, and are considered useful for the prevention and treatment of cancer diseases. In addition, the inhibition of MMP is useful for the prevention, treatment, and improvement of various diseases caused by the overproduction of MMP, such as ulcer formation, arteriosclerosis, rheumatoid arthritis, osteoporosis, and periodontitis.

[0006] Collagenase (MMP-1), which belongs to MMP, is an enzyme produced by fibroblasts, chondrocytes, etc., and is greatly involved in promoting the degradation of collagen. Collagen is a major structural protein that accounts for about 1 / 3 of mammalian tissues and is an essential component of many matrix tissues such as cartilage, bone, tendon, gum, and skin. When a single site is cleaved by collagenase, the normally stable collagen molecule in tissues denatures into single-stranded gelatin and becomes susceptible to degradation by various other proteases. As a result, the structural integrity of the matrix tissue is lost, leading to wrinkles, cancer diseases, ulcer formation, osteoporosis, periodontitis, etc.

[0007] As materials having inhibitory activity against collagenase, for example, cacao husk extract (Patent Document 3), Rosaceae wild strawberry extract (Patent Document 4), lactoferrin (Patent Document 5), etc. have been proposed. Under the circumstances where there is an increasing interest in skin aging and oral hygiene, there is a demand to find a material with no side effects, high safety, and excellent collagenase activity inhibitory effect.

[0008] Matrix metalloproteinase (MMP-2), which belongs to the MMP family, is an enzyme produced by fibroblasts, endothelial cells, cancer cells, etc., and degrades substrates such as collagen, gelatin, and elastin (a structural protein that forms a special component of elastic tissues such as arteries, tendons, and skin). Therefore, when elastin is degraded by gelatinase, the risks of diseases such as cancer, arteriosclerosis, and rheumatoid arthritis, as well as injuries such as ligament rupture, increase.

[0009] In addition, fibroblasts produce proteins such as collagen and glycosaminoglycans such as hyaluronic acid to form dermal connective tissue and maintain the firmness of the skin. It is considered that wrinkles and sagging of the skin occur as a result of this connective tissue losing its contractile force and further losing its elastic force.

[0010] In particular, hyaluronic acid is known as a high-molecular polysaccharide widely distributed in connective tissue, presents a gel-like form in the dermis, and maintains the elasticity of the skin. Therefore, alteration and decrease of hyaluronic acid are considered to be important in skin aging. In addition, since hyaluronic acid is a high-molecule, there has been a problem that it is difficult to be absorbed even when a cosmetic containing it is directly applied to the skin. Therefore, heretofore, topical skin preparations that can promote the production of collagen and hyaluronic acid by the cells themselves by activating fibroblasts have been explored (Patent Document 6). Furthermore, hyaluronic acid is known to suppress MMP production (Non-Patent Document 2) and is also involved in the metabolism of collagen.

[0011] Hyaluronic acid is also present in joints and is known to function in reducing the impact of joint loading and smoothing joint movement. The hyaluronic acid concentration in the synovial fluid of normal humans is about 2.3 mg / mL, but in the case of rheumatoid arthritis, the hyaluronic acid concentration in the synovial fluid decreases to about 1.2 mg / mL, and at the same time, the viscosity of the synovial fluid also significantly decreases (Non-Patent Document 3). Also, in cases of septic arthritis, gouty arthritis, etc., it is known that a decrease in hyaluronic acid content occurs as in the case of rheumatoid arthritis (Non-Patent Document 4). In these diseases, it is considered to increase the amount of hyaluronic acid in the synovial fluid in order to improve lubricating function, coat and protect articular cartilage, suppress pain, and improve pathological synovial fluid. For example, it is known that when sodium hyaluronate is injected into the joints of patients with rheumatoid arthritis, improvement of the above symptoms is observed (Non-Patent Document 5). However, the treatment of the above diseases takes a long time. Therefore, skin external preparations, foods, and pharmaceuticals containing a hyaluronic acid production promoter are desired so that prevention, treatment, etc. can be easily carried out in daily life.

[0012] Floaters refer to a symptom in which thin shadows that look like threads or mosquitoes appear within the visual field, and are caused by turbidity in the vitreous body that fills the inside of the eye casting a shadow on the retina. Floaters can be roughly divided into two types: physiological floaters that occur due to the effects of aging, ultraviolet rays, reactive oxygen species, etc., and pathological floaters that appear as a symptom of diseases such as retinal detachment, retinal hole, vitreous hemorrhage, and uveitis. Physiological floaters are caused by the liquefaction due to the decrease in hyaluronic acid, which is the main component of the vitreous body, and the accompanying decomposition of collagen fibers, resulting in turbidity in the vitreous body. As treatment methods, there are vitrectomy and laser treatment, but in Japan, these procedures are not often performed from the perspective of safety, and a large amount of money is required for treatment overseas. Therefore, foods and pharmaceuticals containing a hyaluronic acid production promoter that can be used daily are desired to prevent and improve physiological floaters.

[0013] Generally, as people age, the proliferative and mitotic abilities of epidermal keratinocytes decline, and the epidermal layer itself becomes thinner (Non-Patent Document 6). Biological factors such as Epidermal Growth Factor (EGF / epidermal growth factor) and estrogen (female hormone) act on the proliferation of epidermal keratinocytes in the skin, but their secretion declines with age. Such a decline in the metabolic function of epidermal keratinocytes due to aging slows down the skin turnover rate, causing rough skin and skin aging. In addition, the retention of stratum corneum cells that peel off from the surface of the stratum corneum makes it impossible for the excretion of melanin in the epidermis to proceed smoothly, causing pigmentation and dullness of the skin. Furthermore, it is also known that the wound healing of the epidermis becomes slower. It is also known that hyaluronic acid is produced in epidermal keratinocytes (Non-Patent Document 7), and it is considered that the production amount of hyaluronic acid also increases by promoting the proliferation of epidermal keratinocytes, and it can be said that it is also indirectly involved in the metabolism of collagen. Therefore, many studies have been conducted to search for components that promote the proliferation of epidermal keratinocytes and to propose skin external preparations.

[0014] Giant kelp (scientific name: Macrocystis pyrifera, Japanese name: Ōukiimo) is a seaweed (brown algae) belonging to the genus Macrocystis of the family Laminariaceae in the order Laminariales. So far, it has been known that the extract of giant kelp has a whitening effect (Patent Document 7), an effect of suppressing inflammatory cytokines (Patent Document 8), and an effect of suppressing lipase activity (Patent Document 9). However, it has not been known that the extract of giant kelp has an MMP inhibitory effect, a hyaluronic acid production promoting effect, and a cell proliferation promoting effect.

Prior Art Documents

Patent Documents

[0015]

Patent Document 1

Patent Document 2

Patent Document 3

Patent Document 4

Patent Document 5

Patent Document 6

Patent Document 7

Patent Document 8

Patent Document 9

Non-Patent Document

[0016]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-Patent Document 4

Non-Patent Document 5

Non-Patent Document 6

Non-Patent Document 7

Summary of the Invention

Problems to be Solved by the Invention

[0017] There is a demand for a material that is safe, has excellent stability, and is excellent in MMP inhibitory activity, hyaluronic acid production promoting activity, and cell growth promoting activity. However, at present, no material that can fully satisfy these requirements has been provided.

Means for Solving the Problems

[0018] Under such circumstances, as a result of intensive studies, the present inventors have found that the extract of giant kelp has excellent MMP inhibitory activity, hyaluronic acid production promoting activity, and cell growth promoting activity, and is also excellent in stability. Furthermore, it has been found that an external preparation or an internal preparation containing the extract is safe, stable, excellent in MMP inhibitory activity, hyaluronic acid production promoting activity, and cell growth promoting activity, and can be a multifunctional beauty / health material or a pharmaceutical, and thus the present invention has been completed.

[0019] That is, the present invention includes the following inventions. (1) An MMP inhibitor characterized by containing an extract of giant kelp. (2) A wrinkle-improving agent characterized by containing the MMP inhibitor of (1). (3) An external preparation for skin characterized by containing the MMP inhibitor of (1). (4) A food composition for preventing and improving various diseases caused by the enhancement of MMP, characterized by containing the MMP inhibitor of (1). (5) A hyaluronic acid production promoter characterized by containing an extract of giant kelp. (6) A cell growth promoter characterized by containing an extract of giant kelp.

Effects of the Invention

[0020] According to the present invention, there are provided an MMP inhibitor, a hyaluronic acid production promoter, and a cell growth promoter containing an extract of giant kelp as an active ingredient.

Modes for Carrying Out the Invention

[0021] The giant kelp (scientific name: Macrocystis pyrifera, Japanese name: Ō-Ukimochi) used in the present invention is a seaweed (brown algae) belonging to the genus Macrocystis of the family Laminariaceae in the order Laminariales. It is mainly distributed in the northeastern Pacific Ocean from the Alaska Peninsula to the Gulf of California. The size of the thallus is 20 to 30 m, and the larger ones can reach 50 m. Since the stem part is attached with a floating bag for storing air, it can stand upright and float in the sea.

[0022] Giant kelp can be obtained from the above growth areas. In the present invention, as the extraction raw material of the above seaweed, it is preferable to use the whole seaweed (whole alga), but a part thereof, for example, the leaf part (thallus, mature leaf), the stem part (midrib, midvein), the sporophyll part, the root part, etc. may also be used. Further, for the extraction, the seaweed body may be used as it is, or treatments such as desalting, drying, pulverization, and mincing may be performed.

[0023] The extraction method using a solvent is not particularly limited. For example, it can be carried out by heating extraction (e.g., 40 to 100 °C), normal temperature extraction (e.g., 15 to 25 °C), low temperature extraction (e.g., 0 to 15 °C), stirring extraction, column extraction, or the like. Examples of the extraction solvent include water, lower alcohols (such as methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.), liquid polyhydric alcohols (such as 1,3-butylene glycol, propylene glycol, glycerin, etc.), ketones (such as acetone, methyl ethyl ketone, etc.), acetonitrile, esters (such as ethyl acetate, butyl acetate, etc.), hydrocarbons (such as hexane, heptane, liquid paraffin, etc.), and ethers (such as ethyl ether, tetrahydrofuran, propyl ether, etc.). Preferably, polar solvents such as water, lower alcohols, and liquid polyhydric alcohols are good, and particularly preferably, water, ethanol, 1,3-butylene glycol, and propylene glycol are good. These solvents may be used alone or in combination of two or more. The most preferred extraction solvents include water, a mixed polar solvent of water-ethanol, or a mixed polar solvent of water-1,3-butylene glycol. Among them, it is preferable to contain 20 to 100% by weight of ethanol or 1,3-butylene glycol, and most preferably 50 to 100% by weight. In addition, an acid or an alkali can be added to the above extraction solvent to use a solvent with adjusted pH.

[0024] There is no particular limitation on the amount of the solvent used. For example, it may be 5 times or more, preferably 10 times or more, based on the total algae (dry weight) of giant kelp, but it is preferably 100 times or less for the convenience of operations when concentrating or isolating after extraction. In addition, the extraction temperature and time can be appropriately selected according to the type of the solvent used, the pressure during extraction, and the like.

[0025] The above extract may be used as the extracted solution as it is, but if necessary, within the range where the effects of the present invention can be achieved, it may be used after performing treatments such as concentration (concentration by reduced pressure concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon or the like, deodorization, and ethanol precipitation. Furthermore, the extracted solution may be subjected to treatments such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product.

[0026] The present invention may use the above extract as it is, and within the range that does not impair the effect of the extract, it may contain components such as oils and fats, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metallic soaps, pH adjusters, preservatives, fragrances, humectants, powders, ultraviolet absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, film-forming agents, sweeteners, acidulants, etc., which are components used in cosmetics, quasi-drugs, pharmaceuticals, foods, etc.

[0027] The present invention can be used in any of cosmetics, quasi-drugs, pharmaceuticals, and foods. As its dosage form, for example, lotion, cream, emulsion, gel agent, aerosol agent, essence, pack, detergent, bath agent, foundation, face powder, lipstick, ointment, poultice, tablet confectionery, chocolate, gum, candy, beverage, powder, granule, tablet, sugar-coated tablet, capsule, syrup, pill, suspension, liquid, emulsion, suppository, injection solution, etc. can be mentioned.

[0028] In the case of external use, the content of the above extract used in the present invention is preferably 0.00001% by weight or more in terms of solids, more preferably 0.0001 - 10% by weight. Further, 0.001 - 5% by weight is most preferable. If it is less than 0.00001% by weight, it is difficult to expect sufficient effects. If it exceeds 10% by weight, it is difficult to recognize the enhancement of the effect and it is uneconomical.

[0029] In the case of internal use, the intake amount varies depending on age, body weight, symptoms, treatment effect, administration method, treatment time, etc. Usually, as the daily intake amount per adult, 5 mg or more is preferable, 10 mg - 5 g is more preferable. Further, 20 mg - 2 g is most preferable.

[0030] Next, in order to explain the present invention in detail, production examples, formulation examples, and experimental examples of the extract used in the present invention are given as examples, but the present invention is not limited thereto. The % shown in the production examples indicates % by weight, and the parts of the content shown in the formulation examples indicate parts by weight.

Examples

[0031] Production Example of Extract of Giant Kelp An extract of giant kelp was produced as follows. In Production Examples 1 to 4, the whole algae of giant kelp were used as the extraction material.

[0032] (Production Example 1) Preparation of Hot Water Extract of Giant Kelp 200 mL of water was added to 10 g of the dried giant kelp, and extraction was carried out at 95 to 100 °C for 2 hours. The obtained extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 0.41 g of the hot water extract of giant kelp.

[0033] (Production Example 2) Preparation of 50% Ethanol Extract of Giant Kelp 10 g of the dried giant kelp was immersed in 200 mL of 50% ethanol aqueous solution at room temperature for 7 days for extraction. After the obtained extract was filtered, it was concentrated to dryness with an evaporator to obtain 0.28 g of the 50% ethanol extract of giant kelp.

[0034] (Production Example 3) Preparation of Ethanol Extract of Giant Kelp 10 g of the dried giant kelp was immersed in 200 mL of ethanol at room temperature for 7 days for extraction. After the obtained extract was filtered, it was concentrated to dryness with an evaporator to obtain 0.12 g of the ethanol extract of giant kelp.

[0035] (Production Example 4) Preparation of 1,3-Butylene Glycol Extract of Giant Kelp 10 g of the dried giant kelp was immersed in 200 mL of 1,3-butylene glycol at room temperature for 7 days for extraction. The obtained extract was filtered to obtain 189 g of the 1,3-butylene glycol extract of giant kelp.

Example

[0036] (Formulation Example 1) Lotion Formulation Content (parts) 1. Hot Water Extract of Giant Kelp (Production Example 1) 0.1 2. 1,3-Butylene Glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl paraben 0.1 9. Polyoxyethylene hydrogenated castor oil (40 E.O.) 0.1 10. Perfume Appropriate amount 11. Make the total amount 100 with purified water [Manufacturing method] Components 1 to 6 and 11, and components 7 to 10 are each uniformly dissolved, and the two are mixed and filtered to obtain a product.

[0037] (Comparative formulation example 1) Conventional lotion In formulation example 1, a product obtained by replacing the hot water extract of giant kelp with purified water was used as the conventional lotion.

[0038] (Formulation example 2) Cream Formulation Content (parts) 1. 50% ethanol extract of giant kelp (Production example 2) 1.0 2. Squalane 5.5 3. Olive oil 3.0 4. Stearic acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10. Perfume 0.1 11. Methyl paraben 0.2 12. 1,3-Butylene glycol 8.5 13. Make the total amount 100 with purified water [Manufacturing Method] Heat and dissolve Components 2 to 9 and mix them, then maintain at 70°C to obtain an oil phase. Heat and dissolve Components 1 and 11 to 13 and mix them, then maintain at 75°C to obtain an aqueous phase. Add the aqueous phase to the oil phase for emulsification, cool while stirring, add Component 10 at 45°C, and further cool to 30°C to obtain the product.

[0039] (Formulation Example 3) Emulsion Formulation Content (parts) 1. Ethanol extract of giant kelp (Manufacturing Example 3) 0.01 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetyl alcohol 1.5 6. Glyceryl monostearate 2.0 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20 E.O.) 2.0 9. Perfume 0.1 10. Propylene glycol 1.0 11. Glycerin 2.0 12. Methyl paraben 0.2 13. Make the total amount 100 with purified water [Manufacturing Method] Heat and dissolve Components 1 to 8 and mix them, then maintain at 70°C to obtain an oil phase. Heat and dissolve Components 10 to 13 and mix them, then maintain at 75°C to obtain an aqueous phase. Add the aqueous phase to the oil phase for emulsification, cool while stirring, add Component 9 at 45°C, and further cool to 30°C to obtain the product.

[0040] (Formulation Example 4) Gel Formulation Content (parts) 1. 1,3-Butylene glycol extract of giant kelp (Manufacturing Example 4) 1.0 2. Ethanol 5.0 3. Methyl paraben 0.1 4. Polyoxyethylene hydrogenated castor oil (60 E.O.) 0.1 5. Perfume Appropriate amount 6. 1,3-Butylene glycol 5.0 7. Glycerin 5.0 8. Xanthan gum 0.1 9. Carboxyvinyl polymer 0.2 10. Potassium hydroxide 0.2 11. Make the total amount 100 with purified water [Manufacturing method] Dissolve components 2 - 5 and components 1 and 6 - 11 uniformly respectively, and mix the two to obtain the product.

[0041] (Formulation Example 5) Pack Formulation Content (parts) 1. Hot water extract of giant kelp (Production Example 1) 1.0 2. 50% ethanol extract of giant kelp (Production Example 2) 5.0 3. Polyvinyl alcohol 12.0 4. Ethanol 5.0 5. 1,3 - Butylene glycol 8.0 6. Methyl paraben 0.2 7. Polyoxyethylene hydrogenated castor oil (20 E.O.) 0.5 8. Citric acid 0.1 9. Sodium citrate 0.3 10. Perfume Appropriate amount 11. Make the total amount 100 with purified water [Manufacturing method] Dissolve components 1 - 11 uniformly to obtain the product.

[0042] (Formulation Example 6) Foundation Formulation Content (parts) 1. 50% ethanol extract of giant kelp (Production Example 2) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20 E.O.) 1.0 4. Polyoxyethylene cetyl ether (20 E.O.) 2.0 5. Cetyl alcohol 1.0 6. Liquid lanolin 2.0 7. Liquid paraffin 3.0 8. Isopropyl myristate 6.5 9. Sodium carboxymethyl cellulose 0.1 10. Bentonite 0.5 11. Propylene glycol 4.0 12. Triethanolamine 1.1 13. Methyl paraben 0.2 14. Titanium dioxide 8.0 15. Talc 4.0 16. Cinnabar 1.0 17. Ferric oxide yellow 2.0 18. Perfume Appropriate amount 19. Make the total amount 100 with purified water [Manufacturing method] Heat and dissolve components 2 - 8, keep at 80 °C to obtain the oil phase. Well swell component 9 in component 19, then add components 1 and 10 - 13 and mix uniformly. Add components 14 - 17 pulverized and mixed by a pulverizer thereto, stir with a homomixer and keep at 75 °C to obtain the water phase. Add the water phase to the oil phase while stirring, and emulsify. Then, cool, add component 18 at 45 °C, and cool to 30 °C while stirring to obtain the product.

[0043] (Formulation Example 7) Bath agent Formulation Content (parts) 1. Ethanol extract of giant kelp (Production Example 3) 1.0 2. Sodium hydrogen carbonate 50.0 3. Yellow No. 202 (1) Appropriate amount 4. Perfume Appropriate amount 5. Make the total amount 100 with sodium sulfate [Manufacturing method] Uniformly mix components 1 - 5 to obtain the product.

[0044] (Formulation Example 8) Ointment Formulation Content (parts) 1. Hot water extract of giant kelp (Production Example 1) 5.0 2. Ethanol extract of giant kelp (Production Example 3) 1.0 3. Polyoxyethylene cetyl ether (30 E.O.) 2.0 4. Glyceryl monostearate 10.0 5. Liquid paraffin 5.0 6. Cetanol 6.0 7. Methyl paraben 0.1 8. Propylene glycol 10.0 9. Make the total amount 100 with purified water [Manufacturing method] Heat and dissolve components 3 - 6 and mix them, keep at 70°C to form an oil phase. Heat and dissolve components 1, 2 and 7 - 9 and mix them, keep at 75°C to form an aqueous phase. Add the aqueous phase to the oil phase for emulsification, and cool to 30°C while stirring to obtain the product.

[0045] (Formulation Example 9) Powder Formulation Content (parts) 1. Hot water extract of giant kelp (Production Example 1) 1.0 2. Dry corn starch 39.0 3. Microcrystalline cellulose 60.0 [Manufacturing method] Mix components 1 - 3 to obtain a powder.

[0046] (Formulation Example 10) Tablet Formulation Content (parts) 1. Ethanol extract of giant kelp (Production Example 3) 5.0 2. Dry corn starch 25.0 3. Calcium carboxymethyl cellulose 20.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 [Manufacturing method] Mix components 1 - 4, then add an aqueous solution of component 5 as a binder and granulate. Add component 6 to the formed granules and tableting. Make each tablet 0.52 g.

[0047] (Formulation Example 11) Chewable tablet Formulation Content (parts) 1. Ethanol extract of giant kelp (Production Example 3) 2.0 2. Dry corn starch 49.8 3. Erythritol 40.0 4. Citric acid 5.0 5. Sucrose fatty acid ester 3.0 6. Flavor 0.1 7. Purified water 0.1 [Manufacturing method] Mix components 1 to 4 and 7, and granulate. Add components 5 and 6 to the formed granules and tableting. Make it 1.0 g per tablet.

[0048] (Formulation Example 12) Beverage Formulation Content (parts) 1. Hot water extract of giant kelp (Production Example 1) 0.05 2. Stevia 0.05 3. Malic acid 5.0 4. Flavor 0.1 5. Make the total amount 100 with purified water [Manufacturing method] Dissolve components 1 to 3 in a small amount of water. Then, add components 4 and 5 and mix.

[0049] Next, in order to explain the effects of the present invention in detail, experimental examples are given.

Example

[0050] Experimental Example 1 Measurement of MMP-1, MMP-2 and hyaluronic acid synthase 2 (HAS2) mRNA expression levels The expression levels of MMP-1, MMP-2 and HAS2 mRNA were measured. Human skin fibroblasts were seeded in a φ60 mm dish at 1×10 5They were seeded and cultured in DMEM culture medium containing 10% FBS under the conditions of 37 °C and 5% CO2. When they reached a confluent state, each sample was cultured for 24 hours in DMEM(-) culture medium added so as to have a final concentration of 1 and 10 μg / mL, and then total RNA was extracted. The total RNA was extracted from the cells using RNAiso Plus (Takara Bio), and the total RNA amount was determined by the absorbance at 260 nm using a spectrophotometer (Nanodrop). The measurement of the mRNA expression level was performed by real-time RT-PCR based on the total RNA extracted from the cells. For the real-time RT-PCR method, High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used. That is, after reverse transcription reaction of 500 ng of total RNA, a PCR reaction (95 °C: 15 seconds, 60 °C: 60 seconds, 40 cycles) was performed. Other operations were carried out according to the defined methods, and the expression levels of MMP-1, MMP-2 and HAS2 mRNAs were determined as the ratio to the expression level of β-actin mRNA which is an internal standard. The MMP-1 expression rate was calculated as the ratio of the expression level of MMP-1 mRNA in the sample-added group to the expression level of MMP-1 mRNA in the control (sample-untreated) group. The MMP-2 expression rate and HAS2 expression rate were calculated in the same way. The primers used for measuring the expression level of each gene are as follows.

[0051] Primer set for MMP-1 GGGAGATCATCGGGACAACTC (SEQ ID NO: 1) TGAGCATCCCCTCCAATACC (SEQ ID NO: 2) Primer set for MMP-2 CCGTCGCCCATCATCAA (SEQ ID NO: 3) CTTCTGCATCTTCTTTAGTGTGTCCTT (SEQ ID NO: 4) Primer set for HAS2 TGGATGACCTACGAAGCGATTA (SEQ ID NO: 5) GCTGGATTACTGTGGCAATGAG (SEQ ID NO: 6) Primer set for β-actin CACTCTTCCAGCCTTCCTTCC (SEQ ID NO: 7) GTGTTGGCGTACAGGTCTTTG (SEQ ID NO: 8)

[0052] These experimental results are shown in Tables 1 to 3. As a result, the extract of giant kelp of the present invention was found to have excellent MMP-1 expression inhibitory effect (MMP-1 inhibitory action), MMP-2 expression inhibitory effect (MMP-2 inhibitory action), and HAS2 expression promoting effect (hyaluronic acid production promoting action). In particular, the MMP-1 expression inhibitory effect and MMP-2 expression inhibitory effect of the 50% ethanol extract of giant kelp (Production Example 2) and the HAS2 expression promoting effect of the hot water extract of giant kelp (Production Example 1) were remarkably high.

[0053] [Table 1]

[0054] [Table 2]

[0055] [Table 3]

[0056] Experimental Example 2 Cell proliferation promotion test Human-derived keratinocytes were seeded at 2,500 cells per well in a 96-well plate with DMEM culture medium containing 0.5% FBS. After adding each sample to a final concentration of 0.1 μg / mL, the cells were cultured for 4 days at 37°C under 5% CO2 conditions. The cell count was measured by a staining method. That is, after the culture was completed, the culture medium was removed, and the cells were fixed with methanol. Subsequently, 0.1% methylene blue was added, and the cells were stained for 1 hour. After drying, 100 μL of 0.1 N HCl was added to each well and stirred well, and the absorbance at 650 nm was measured using a microplate reader. The cell growth rate was calculated as the ratio of the cell amount in the sample-added group to the cell amount in the control (sample-untreated) group.

[0057] These experimental results are shown in Table 4. As a result, the extract of giant kelp of the present invention showed an excellent cell growth promoting effect. In particular, the cell growth promoting effect of the ethanol extract of giant kelp (Production Example 3) was remarkably high.

[0058]

Table 4

[0059] Experimental Example 3 Use Test The usability of the lotion of Formulation Example 1 of the present invention and Comparative Formulation Example 1 was evaluated.

[0060] Five panelists were grouped together, and each sample was used blindly. The usability of Formulation Example 1 and Comparative Formulation Example 1 was compared, and in addition, the presence or absence of skin troubles was evaluated.

[0061] As a result, the lotion obtained in Formulation Example 1 had better usability than Comparative Formulation Example 1 and could be used safely without skin troubles or the like. Also, there was no problem with the deterioration of the formulation components.

Industrial Applicability

[0062] From the above, the extract of giant kelp of the present invention has excellent MMP inhibitory activity, hyaluronic acid production promoting activity, and cell growth promoting activity, and also has excellent stability. Therefore, the extract of giant kelp of the present invention can be used not only in the cosmetic field such as skin aging, but also in the medical field such as suppression of functional decline due to aging, prevention and treatment of cancer, etc., and is expected to be applied to cosmetics, foods, quasi-drugs, pharmaceuticals, etc.

Claims

**Claim 1** An MMP inhibitor characterized by containing an extract of giant kelp. **Claim 2** A wrinkle-improving agent characterized by containing the MMP inhibitor of Claim 1. **Claim 3** An external preparation for skin characterized by containing the MMP inhibitor of Claim 1. **Claim 4** A food composition for preventing and improving various diseases caused by the enhancement of MMP, characterized by containing the MMP inhibitor of Claim 1. **Claim 5** A hyaluronic acid production promoter characterized by containing an extract of giant kelp. **Claim 6** A cell growth promoter characterized by containing an extract of giant kelp.

Images