Novel external skin preparation, food, and pharmaceutical

Abstract

To provide a novel external or internal preparation exhibiting superior activity in inhibiting MMP, promoting collagen production, inhibiting melanin production, preventing oxidation, and promoting cell proliferation.SOLUTION: An external skin preparation comprises an extract of a fruit of the genus Rosa in the family Rosaceae, the extract being obtained by: a first step in which a fruit of the genus Rosa in the family Rosaceae is subjected to extraction with a pretreatment agent composed of liquid water and then filtration to separate it into the filtrate and the extraction residue; and a second step in which the extraction residue from the first step is subjected to further extraction with one or more extractants selected from the group consisting of water, lower alcohols, and liquid polyhydric alcohols, at an extraction temperature higher by at least 20°C than the extraction temperature in the first step. The extract is applicable not only to the cosmetic field including prevention of skin aging, but also to the medical field including suppression of age-related functional decline and cancer prevention and treatment, and is anticipated to find applications in cosmetics, foods, quasi-drugs, and pharmaceuticals.SELECTED DRAWING: None

Description

Technical Field

[0001] The present invention relates to a novel external preparation for skin, food, and pharmaceuticals.

Background Art

[0002] The skin is daily exposed to various physical and chemical stresses such as ultraviolet rays, dryness, cold, heat, and drugs. As a result, the function of the skin deteriorates, and various skin aging phenomena become apparent. One of the skin aging phenomena is wrinkles. It is known that there are two types of wrinkles: epidermal wrinkles and dermal wrinkles. Epidermal wrinkles are called fine wrinkles and are temporarily caused by a decrease in the water content in the epidermal keratin due to skin dryness. On the other hand, dermal wrinkles are formed by ultraviolet rays contained in sunlight or aging. As its formation mechanism, a decrease in collagen synthesis ability in dermal fibroblasts due to ultraviolet rays or aging, and promotion of collagen degradation due to an increase in matrix metalloproteinase (MMP) can be mentioned.

[0003] In the case of epidermal wrinkles and dermal wrinkles caused by dryness, the histological morphology, onset mechanism, and treatment methods are different, and it is difficult to improve dermal wrinkles caused by ultraviolet rays or aging by using cosmetics having a moisturizing effect.

[0004] Heretofore, for the purpose of improving dermal wrinkles caused by ultraviolet rays, a wrinkle formation prevention / improvement agent for skin containing hydrolyzed almond as an active ingredient (Patent Document 1), and an improvement agent for wrinkles caused by ultraviolet irradiation containing extracts of Ligusticum chuanxiong, Angelica acutiloba, and Centaurea cyanus as active ingredients (Patent Document 2) have been reported.

[0005] MMP plays a major role in the invasion of cancer cells into the stroma, intravascular invasion, and angiogenesis. The stroma is mainly composed of type I collagen, and the destruction of the substrate by stromal collagenase etc. is necessary for the movement of cancer cells. To complete metastasis, it is necessary to destroy the vascular endothelial basement membrane and move within the stroma, and MMP is also involved at this stage (Non-Patent Document 1). Therefore, substances having inhibitory activity against MMP are expected to have the effect of suppressing angiogenesis and cancer metastasis in cancer tissues, and are considered useful for the prevention and treatment of cancer diseases. In addition, the inhibition of MMP is useful for the prevention, treatment, and improvement of various diseases caused by the overproduction of MMP, such as ulcer formation, arteriosclerosis, rheumatoid arthritis, osteoporosis, and periodontitis.

[0006] Collagenase (MMP-1) belonging to MMP is an enzyme produced by fibroblasts, chondrocytes, etc., and is greatly involved in promoting the degradation of collagen. Collagen is a major structural protein that accounts for about 1 / 3 of mammalian tissues and is an essential component of many matrix tissues such as cartilage, bone, tendon, gingiva, and skin. When collagen is cleaved at one site by collagenase, the normally stable collagen molecule in tissue denatures into single-stranded gelatin and becomes susceptible to degradation by various other proteases. As a result, the structural integrity of the matrix tissue is lost, leading to wrinkles, cancer diseases, ulcer formation, osteoporosis, periodontitis, etc.

[0007] Gelatinase (MMP-2) belonging to MMP is an enzyme produced by fibroblasts, endothelial cells, cancer cells, etc., and degrades substrates such as collagen, gelatin, and elastin (a structural protein that forms a special component of elastic tissues such as arteries, tendons, and skin). Therefore, when elastin is degraded by gelatinase, the risk of diseases such as cancer diseases, arteriosclerosis, and rheumatoid arthritis, and injuries such as ligament rupture increases.

[0008] Fibroblasts and collagen exist in the dermis, and type I collagen accounts for 80% of the whole. In addition to type I collagen, the existence of types III, V, XII, and XIV collagen, etc. is known. A decrease in type I collagen is cited as one of the causes of wrinkles and sagging. Therefore, it is considered effective in preventing and improving wrinkles and sagging to promote the production of type I collagen. Also, promoting the production of type I collagen is effective in improving skin wound healing.

[0009] Generally, skin pigmentation seen in freckles, chloasma, sunburn, etc. is thought to be caused by abnormal hormones or ultraviolet stimulation, where melanin pigment-producing cells existing in the skin overproduce melanin pigment, which then deposits in the skin. One method of preventing such pigmentation is known as a method of suppressing the excessive production of melanin. Conventionally, for the treatment of pigmentation, ascorbic acid (vitamin C), etc. has been used as a whitening agent both internally and externally (Patent Document 3).

[0010] Also, the skin is located on the outermost layer of the living body and is an organ where reactive oxygen species are easily generated due to the influence of ultraviolet rays, etc., and is constantly exposed to that oxygen stress. On the other hand, reactive oxygen species scavenging enzymes exist within skin cells, and they defend skin cells from damage by reactive oxygen species as long as reactive oxygen species exceeding their capacity are not generated. However, it is known that the activity of reactive oxygen species scavenging enzymes within skin cells decreases with aging, and when the damage by reactive oxygen species overwhelms its defense reaction, the skin is oxidized, cell functions deteriorate, and aging progresses. Also, in organs other than the skin, when exposed to reactive oxygen species exceeding their reactive oxygen species scavenging ability, it is thought that functional decline occurs, leading to aging, or various lifestyle diseases such as cancer and myocardial infarction develop. Therefore, reactive oxygen species scavengers and antioxidants have been studied for the purpose of defending the living body from damage by reactive oxygen species, and foods, cosmetics, quasi-drugs, and pharmaceuticals containing reactive oxygen species scavenging enzymes such as SOD and catalase, and reactive oxygen species scavengers and antioxidants such as SOD-like active substances have been developed (Patent Documents 4, 5).

[0011] Generally, with aging, the proliferation and division ability of epidermal keratinocytes decreases, and the epidermal layer itself becomes thinner (Non-Patent Document 2). Biological factors such as Epidermal Growth Factor (EGF / epidermal growth factor) and female hormones (estrogens) act on the proliferation of epidermal keratinocytes in the skin, but their secretion decreases with aging. Such a decrease in the metabolic function of epidermal keratinocytes due to aging slows down the skin turnover rate, causing rough skin and skin aging. In addition, the retention of stratum corneum cells that peel off from the surface of the stratum corneum makes the excretion of melanin in the epidermis not proceed smoothly, causing pigmentation and dullness of the skin. Furthermore, it is also known that the wound healing of the epidermis becomes slower. In order to prevent or improve the progression of these phenomena, many efforts have been made to search for components that promote the proliferation of epidermal keratinocytes and to propose topical skin preparations.

[0012] Conventionally, it has been known that pigment compounds rosacyanins present in plants of the Rosaceae family of the vine color system or blue color system have a collagen synthesis promoting effect (Patent Document 6), that Rosa rugosa of the genus Rosa in the Rosaceae family has an antibacterial effect (Non-Patent Document 3), and that Rosa roxburghii has an effect of relieving hangover (Patent Document 7).

Prior Art Documents

Patent Documents

[0013]

Patent Document 1

Patent Document 2

Patent Document 3

Patent Document 4

Patent Document 5

Patent Document 6

Patent Document 7

Non-Patent Literature

[0014]

Non-Patent Literature 1

Non-Patent Literature 2

Non-Patent Literature 3

Summary of the Invention

Problems to be Solved by the Invention

[0015] There is a demand for a material that is safe, has excellent stability, and is excellent in MMP inhibitory activity, collagen production promoting activity, wrinkle improvement activity, melanin production inhibitory activity, antioxidant activity, and cell growth promoting activity. However, at present, no material that can fully satisfy these requirements has been provided yet.

Means for Solving the Problems

[0016] Under such circumstances, as a result of intensive studies by the present inventors, in the first step, fruits of the genus Rosa of the Rosaceae family are extracted with a pretreatment agent consisting of liquid water, filtered, and separated into a filtrate and an extraction residue. In the second step, the extraction residue from the first step is further extracted with one or more extraction agents selected from the group consisting of water, lower alcohols, and liquid polyhydric alcohols at an extraction temperature 20°C or higher than the extraction temperature in the first step. It has been found that the extract of the fruits of the genus Rosa of the Rosaceae family thus obtained has excellent MMP inhibitory activity, collagen production promoting activity, melanin production inhibitory activity, antioxidant activity, and cell proliferation promoting activity, and is also excellent in stability. Furthermore, it has been found that an external preparation or an internal preparation containing the extract is safe and stable, and is excellent in MMP inhibitory activity, collagen production promoting activity, wrinkle improvement activity, melanin production inhibitory activity, antioxidant activity, and cell proliferation promoting activity, and can be a multifunctional beauty / health material or a pharmaceutical, thus completing the present invention.

[0017] That is, the present invention includes the following inventions. (1) A skin external preparation characterized by containing an extract of fruits of the genus Rosa of the Rosaceae family, which is obtained by, in the first step, extracting the fruits of the genus Rosa of the Rosaceae family with a pretreatment agent consisting of liquid water, filtering, and separating into a filtrate and an extraction residue, and in the second step, further extracting the extraction residue from the first step with one or more extraction agents selected from the group consisting of water, lower alcohols, and liquid polyhydric alcohols at an extraction temperature 20°C or higher than the extraction temperature in the first step. (2) The skin external preparation according to (1), characterized by having an MMP inhibitory activity. (3) The skin external preparation according to (1), characterized by having a collagen production promoting activity. (4) The skin external preparation according to (1), characterized by having a wrinkle improvement activity. (5) The skin external preparation according to (1), characterized by having a melanin production inhibitory activity. (6) The skin external preparation according to (1), characterized by having a whitening activity. (7) The skin external preparation according to (1), characterized by having an antioxidant activity. (8) The skin external preparation according to (1), characterized by having a cell proliferation promoting activity. (9) As the first step, fruits of the genus Rosa in the Rosaceae family are extracted with a pretreatment agent consisting of liquid water, filtered, and separated into a filtrate and extraction residue. As the second step, the extraction residue from the first step is further extracted with one or more extraction agents selected from the group consisting of water, lower alcohols, and liquid polyhydric alcohols at an extraction temperature that is 20°C or higher than the extraction temperature of the first step. A food composition for preventing and / or improving one or more diseases or symptoms selected from the group consisting of dermal wrinkles, cancer diseases, ulcer formation, arteriosclerosis, rheumatoid arthritis, osteoporosis, periodontitis, wounds, pigmentation, rough skin, skin aging, and dull skin, characterized by containing an extract of fruits of the genus Rosa in the Rosaceae family. (10) As the first step, fruits of the genus Rosa in the Rosaceae family are extracted with a pretreatment agent consisting of liquid water, filtered, and separated into a filtrate and extraction residue. As the second step, the extraction residue from the first step is further extracted with one or more extraction agents selected from the group consisting of water, lower alcohols, and liquid polyhydric alcohols at an extraction temperature that is 20°C or higher than the extraction temperature of the first step. A pharmaceutical for preventing and / or improving one or more diseases or symptoms selected from the group consisting of dermal wrinkles, cancer diseases, ulcer formation, arteriosclerosis, rheumatoid arthritis, osteoporosis, periodontitis, wounds, pigmentation, rough skin, skin aging, and dull skin, characterized by containing an extract of fruits of the genus Rosa in the Rosaceae family.

Effects of the Invention

[0018] According to the present invention, there are provided an MMP inhibitor, a collagen production promoter, a wrinkle improver, a melanin production inhibitor, a whitening agent, an antioxidant, and a cell proliferation promoter that contain an extract of fruits of the genus Rosa in the Rosaceae family extracted by a specific method as an active ingredient.

Modes for Carrying Out the Invention

[0019] The species of plants of the genus Rosa in the family Rosaceae used in the present invention are not particularly limited. For example, Rosa roxburghii, Rosa canina, Rosa acicularis, Rosa amblyotis, Rosa uchiyamana, Rosa multiflora, Rosa rugosa, Rosa banksiae, Rosa jasminoides, Rosa sambucina, Rosa gallica, Rosa carolina, Rosa chinensis, Rosa gentiliana, Rosa damascena, Rosa pimpinellifolia, Rosa minutifolia, or variants, hybrids, etc. of these Rosa plants can also be used. Many cultivated varieties are known for these Rosa plants, and the fruits of these cultivated varieties of roses can be used, but Rosa roxburghii is most preferred.

[0020] As the fruit of the genus Rosa in the family Rosaceae, it is preferable to use those with a major axis length in the range of 1 to 10 cm. In addition, it is particularly preferable to use those with a major axis length in the range of 1 to 4 cm. Moreover, the fruit to be used can be raw, or dried products such as natural dried products or sun-dried products can also be used.

[0021] [Step 1: Extraction with a pretreatment agent] As the pretreatment agent, liquid water is used. Also, an acid or an alkali can be added to the pretreatment agent to use a pH-adjusted pretreatment agent. There is no particular limitation on the amount of the pretreatment agent used. For example, it may be 3 times or more, preferably 5 times or more, and particularly preferably 10 times or more, based on the fruit (fresh weight) of the genus Rosa of the Rosaceae family. The extraction temperature and extraction time with the pretreatment agent can be appropriately selected depending on the pressure during extraction and the like. The extraction temperature is preferably 0 to 20°C, more preferably 2 to 15°C, and most preferably 5 to 10°C. The fruit of the genus Rosa of the Rosaceae family used for extraction with the pretreatment agent may be used as it is, but it is preferable to perform treatments such as pulverization and fine cutting in terms of the efficiency of pretreatment. After extraction, filtration can be performed using filter paper, a mesh, a sieve, or the like. The extraction residue recovered here is used in the next second step.

[0022] [Second step: Extraction with an extractant] As the extractant, one or more selected from the group consisting of water, lower alcohols (such as methanol, ethanol, 1-propanol, 2-propanol, 1-butanol, 2-butanol, etc.) and liquid polyhydric alcohols (such as 1,3-butylene glycol, propylene glycol, glycerin, etc.) are used. Preferably, water, ethanol, 1,3-butylene glycol and propylene glycol are good, and particularly preferably, water, a mixed polar solvent of water-ethanol or a mixed polar solvent of water-1,3-butylene glycol is good. Among them, water or a mixed polar solvent of water-ethanol is most preferable, but it can be selected according to the purpose such as the yield and effectiveness of the extract. Also, an acid or an alkali can be added to the above extractant to use an extractant with adjusted pH. Regarding the usage amount of the extractant, there is no particular limitation. For example, it may be 5 times or more, preferably 10 times or more, based on the fruit (dry weight) of the genus Rosa of the Rosaceae family, but it is preferably 100 times or less for the convenience of operations when concentrating or isolating after extraction. Also, the extraction time can be appropriately selected according to the type of the extractant used, the pressure during extraction, etc., but the extraction temperature needs to be 20°C or higher than the extraction temperature with the pretreatment agent. Among them, when using water, it is preferably 70°C or higher, more preferably 80°C or higher, and most preferably 90°C or higher than the extraction temperature with the pretreatment agent. Filtration can be performed in the same manner as in the first step.

[0023] Note that the extraction residue with the pretreatment agent may be extracted with the extractant after drying, or may be directly extracted with the extractant without drying. In that case, it is advisable to select the extraction solvent considering the influence of the water remaining in the extraction residue. The extraction method with the extractant is not particularly limited, and it can be carried out, for example, by a method such as stirring extraction or column extraction.

[0024] The extract obtained with the above extractant may be used as the extracted solution as it is, but if necessary, within the range where the effects of the present invention are achieved, it may be used after performing treatments such as concentration (concentration by reduced pressure concentration, membrane concentration, etc.), dilution, filtration, decolorization with activated carbon, etc., deodorization, ethanol precipitation. Furthermore, the extracted solution may be subjected to treatments such as concentration to dryness, spray drying, freeze drying, etc., and used as a dried product.

[0025] The present invention may use the above extract as it is, and within the range that does not impair the effects of the extract, it may contain components used in cosmetics, quasi-drugs, pharmaceuticals, foods, etc., such as fats and oils, waxes, hydrocarbons, fatty acids, alcohols, esters, surfactants, metal soaps, pH adjusters, preservatives, fragrances, moisturizers, powders, ultraviolet absorbers, thickeners, pigments, antioxidants, whitening agents, chelating agents, excipients, film-forming agents, sweeteners, acidulants, etc.

[0026] The present invention can be used in any of cosmetics, quasi-drugs, pharmaceuticals, and foods. As its dosage form, for example, lotion, cream, emulsion, gel agent, aerosol agent, essence, pack, detergent, bath agent, foundation, face powder, lipstick, ointment, poultice, tablet confectionery, chocolate, gum, candy, beverage, powder, granule, tablet, sugar-coated tablet, capsule, syrup, pill, suspension, liquid, emulsion, suppository, injection solution, etc. can be mentioned.

[0027] In the case of external use, the content of the above extract used in the present invention is preferably 0.00001% by weight or more in terms of solid content, more preferably 0.0001 - 10% by weight. Further, 0.01 - 5% by weight is most preferable. If it is less than 0.00001% by weight, it is difficult to expect sufficient effects. If it exceeds 10% by weight, it is difficult to recognize an enhancement of the effect and it is uneconomical.

[0028] In the case of internal use, the intake amount varies depending on age, body weight, symptoms, treatment effect, administration method, treatment time, etc. Usually, as the daily intake amount per adult, 5 mg or more is preferable, 10 mg - 5 g is more preferable. Further, 20 mg - 2 g is most preferable.

[0029] Next, in order to explain the present invention in detail, production examples, formulation examples, and experimental examples of the extract used in the present invention are given as examples, but the present invention is not limited thereto. The % shown in the production examples indicates % by weight, and the parts of the content shown in the formulation examples indicate parts by weight.

Examples

[0030] Production Example of Extract of Fruit of Rosa roxburghii Tratt The extract of the fruit of Rosa roxburghii Tratt of the present invention was produced as in Production Examples 1 to 4. The extracts of the fruits of conventional Rosa roxburghii Tratt were produced as in Comparative Production Examples 1 to 4. As the extraction material, a pulverized product of the fruit of Rosa roxburghii Tratt was used.

[0031] (Production Example 1) Preparation of Hot Water Extract of Pretreated Fruit of Rosa roxburghii Tratt To 10 g of fresh fruit of Rosa roxburghii Tratt, 10 times the weight of water was added, and extraction was carried out at 5°C for 24 hours (the increase in the solid content concentration of the extract stopped within 6 hours and no further extraction occurred). The obtained extract was filtered through filter paper No. 5C, and then the residue was dried. To the obtained dried residue, 20 times the weight of water was added, and extraction was carried out at 95°C for 2 hours. The obtained extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 0.3 g of a hot water extract of the fruit of Rosa roxburghii Tratt.

[0032] (Comparative Production Example 1) Preparation of Hot Water Extract of Conventional Fruit of Rosa roxburghii Tratt 10 g of fresh fruit of Rosa roxburghii Tratt was dried, and to the obtained dried product of the fruit of Rosa roxburghii Tratt, 20 times the weight of water was added, and extraction was carried out at 95°C for 2 hours. The obtained extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 1.2 g of a hot water extract of the fruit of Rosa roxburghii Tratt.

[0033] (Production Example 2) Preparation of 50% Ethanol Extract of Pretreated Fruit of Rosa roxburghii Tratt To 10 g of fresh fruit of Rosa roxburghii Tratt, 10 times the weight of water was added, and extraction was carried out at 5°C for 24 hours (the increase in the solid content concentration of the extract stopped within 6 hours and no further extraction occurred). The obtained extract was filtered through filter paper No. 5C, and then the residue was dried. To the obtained dried residue, 20 times the weight of a 50% ethanol aqueous solution was added, and extraction was carried out by immersing at 25°C for 7 days. The obtained extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 0.4 g of a 50% ethanol extract of the fruit of Rosa roxburghii Tratt.

[0034] (Comparative Production Example 2) Preparation of 50% Ethanol Extract of Conventional Fruit of Rosa roxburghii Tratt 10 g of fresh Rosa multiflora Thunb. fruits were dried, and 20 times the weight of a 50% ethanol aqueous solution was added to the obtained dried Rosa multiflora Thunb. fruits, followed by immersion at 25°C for 7 days for extraction. The obtained extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 1.7 g of a 50% ethanol extract of Rosa multiflora Thunb. fruits.

[0035] (Production Example 3) Preparation of an ethanol extract of pretreated Rosa multiflora Thunb. fruits To 20 g of fresh Rosa multiflora Thunb. fruits, 10 times the weight of water was added, and extraction was carried out at 5°C for 24 hours (the increase in the solid content concentration of the extract stopped within 6 hours, and no further extraction occurred). The obtained extract was filtered through filter paper No. 5C, and then the residue was dried. 20 times the weight of ethanol was added to the obtained dried residue, followed by immersion at 25°C for 7 days for extraction. The obtained extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 0.2 g of an ethanol extract of Rosa multiflora Thunb. fruits.

[0036] (Comparative Production Example 3) Preparation of a conventional ethanol extract of Rosa multiflora Thunb. fruits 20 g of fresh Rosa multiflora Thunb. fruits were dried, and 20 times the weight of ethanol was added to the obtained dried Rosa multiflora Thunb. fruits, followed by immersion at 25°C for 7 days for extraction. The obtained extract was filtered, and the filtrate was concentrated and freeze-dried to obtain 0.3 g of an ethanol extract of Rosa multiflora Thunb. fruits.

[0037] (Production Example 4) Preparation of a 30% 1,3-butylene glycol extract of pretreated Rosa multiflora Thunb. fruits To 20 g of fresh Rosa multiflora Thunb. fruits, 10 times the weight of water was added, and extraction was carried out at 5°C for 24 hours (the increase in the solid content concentration of the extract stopped within 6 hours, and no further extraction occurred). The obtained extract was filtered through filter paper No. 5C, and then the residue was dried. 20 times the weight of a 30% 1,3-butylene glycol aqueous solution was added to the obtained dried residue, followed by immersion at 25°C for 7 days for extraction. The obtained extract was filtered through filter paper No. 5C to obtain 61.5 g of a 30% 1,3-butylene glycol extract of Rosa multiflora Thunb. fruits.

[0038] (Comparative Production Example 4) Preparation of 30% 1,3-Butylene Glycol Extract of Conventional Rosa multiflora Thunb. Fruits 20 g of fresh Rosa multiflora Thunb. fruits were dried, and 20-fold by weight of a 30% 1,3-butylene glycol aqueous solution was added to the obtained dried Rosa multiflora Thunb. fruits. The mixture was immersed at 25°C for 7 days for extraction. The obtained extract was filtered to obtain 73.2 g of a 30% 1,3-butylene glycol extract of Rosa multiflora Thunb. fruits.

Example

[0039] (Formulation Example 1) Lotion Formulation Content (parts) 1. Hot water extract of pretreated Rosa multiflora Thunb. fruits (Production Example 1) 0.1 2. 1,3-Butylene glycol 8.0 3. Glycerin 2.0 4. Xanthan gum 0.02 5. Citric acid 0.01 6. Sodium citrate 0.1 7. Ethanol 5.0 8. Methyl paraben 0.1 9. Polyoxyethylene hydrogenated castor oil (40 E.O.) 0.1 10. Perfume Appropriate amount 11. Make up the total amount to 100 with purified water [Production method] Components 1 to 6 and 11, and components 7 to 10 are each uniformly dissolved, and the two are mixed and filtered to obtain a product.

[0040] (Comparative Formulation Example 1) Conventional lotion In Formulation Example 1, the hot water extract of pretreated Rosa multiflora Thunb. fruits was replaced with the hot water extract of conventional Rosa multiflora Thunb. fruits to obtain a conventional lotion.

[0041] (Formulation Example 2) Cream Formulation Content (parts) 1. 50% Ethanol extract of pretreated Rosa multiflora Thunb. fruits (Production Example 2) 1.0 2. Squalane 5.5 3. Olive oil 3.0 4. Stearic acid 2.0 5. Beeswax 2.0 6. Octyldodecyl myristate 3.5 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Behenyl alcohol 1.5 9. Glyceryl monostearate 2.5 10. Fragrance 0.1 11. Methyl paraben 0.2 12. 1,3-Butylene glycol 8.5 13. Make the total amount 100 with purified water [Manufacturing method] Ingredients 2 - 9 are heated and dissolved, mixed, and kept at 70°C to form an oil phase. Ingredients 1 and 11 - 13 are heated and dissolved, mixed, and kept at 75°C to form an aqueous phase. The aqueous phase is added to the oil phase and emulsified, cooled while stirring, ingredient 10 is added at 45°C, and further cooled to 30°C to obtain the product.

[0042] (Formulation Example 3) Emulsion Formulation Content (parts) 1. Ethanol extract of pre-treated Rosa multiflora fruit (Production Example 3) 0.01 2. Squalane 5.0 3. Olive oil 5.0 4. Jojoba oil 5.0 5. Cetyl alcohol 1.5 6. Glyceryl monostearate 2.0 7. Polyoxyethylene cetyl ether (20 E.O.) 3.0 8. Polyoxyethylene sorbitan monooleate (20 E.O.) 2.0 9. Fragrance 0.1 10. Propylene glycol 1.0 11. Glycerin 2.0 12. Methyl paraben 0.2 13. Make the total amount 100 with purified water 13. Make the total amount 100 with purified water [Manufacturing Method] Heat and dissolve Components 1 to 8 and mix them, then maintain at 70°C to obtain an oil phase. Heat and dissolve Components 10 to 13 and mix them, then maintain at 75°C to obtain an aqueous phase. Add the aqueous phase to the oil phase and emulsify, then cool while stirring, add Component 9 at 45°C, and further cool to 30°C to obtain the product.

[0043] (Formulation Example 4) Gel Formulation Content (parts) 1. 30% 1,3-Butylene Glycol Extract of Pretreated Rosa multiflora Thunb. Fruit (Production Example 4) 1.0 2. Ethanol 5.0 3. Methyl Paraben 0.1 4. Polyoxyethylene Hydrogenated Castor Oil (60 E.O.) 0.1 5. Perfume Appropriate amount 6. 1,3-Butylene Glycol 5.0 7. Glycerin 5.0 8. Xanthan Gum 0.1 9. Carboxyvinyl Polymer 0.2 10. Potassium Hydroxide 0.2 11. Make the total amount 100 with purified water [Manufacturing Method] Dissolve Components 2 to 5 and Components 1 and 6 to 11 uniformly respectively, and mix the two to obtain the product.

[0044] (Formulation Example 5) Pack Formulation Content (parts) 1. Hot Water Extract of Pretreated Rosa multiflora Thunb. Fruit (Production Example 1) 1.0 2. 30% 1,3-Butylene Glycol Extract of Pretreated Rosa multiflora Thunb. Fruit 3. Polyvinyl Alcohol 12.0 4. Ethanol 5.0 5. 1,3-Butylene Glycol 8.0 6. Methyl Paraben 0.2 7. Polyoxyethylene Hydrogenated Castor Oil (20 E.O.) 0.5 8. Citric Acid 0.1 ​​9. Sodium citrate 0.3 10. Perfume Appropriate amount 11. Make the total amount 100 with purified water [Manufacturing method] Dissolve components 1 to 11 uniformly to obtain a product

[0045] (Formulation example 6) Foundation Formulation Content (parts) 1. 50% ethanol extract of the pretreated fruits of Rosa multiflora var. cathayensis (Production example 2) 1.0 2. Stearic acid 2.4 3. Polyoxyethylene sorbitan monostearate (20 E.O.) 1.0 4. Polyoxyethylene cetyl ether (20 E.O.) 2.0 5. Cetyl alcohol 1.0 6. Liquid lanolin 2.0 7. Liquid paraffin 3.0 8. Isopropyl myristate 6.5 9. Sodium carboxymethyl cellulose 0.1 10. Bentonite 0.5 11. Propylene glycol 4.0 12. Triethanolamine 1.1 13. Methyl paraben 0.2 14. Titanium dioxide 8.0 15. Talc 4.0 16. Cinnabar 1.0 17. Yellow iron oxide 2.0 18. Perfume Appropriate amount 19. Make the total amount 100 with purified water [Manufacturing method] Heat and dissolve components 2 to 8, keep at 80 °C to obtain an oil phase. Swell component 9 well in component 19, then add components 1 and 10 to 13 and mix uniformly. Add components 14 to 17 pulverized and mixed with a pulverizer, stir with a homomixer and keep at 75 °C to obtain a water phase. Add the water phase to the oil phase while stirring and emulsify. Then, cool, add component 18 at 45 °C, and cool to 30 °C while stirring to obtain a product

[0046] (Formulation Example 7) Bath Agent Formulation Content (parts) 1. Ethanol extract of pre-treated Rosa multiflora var. cathayensis fruits (Production Example 3) 1.0 2. Sodium bicarbonate 50.0 3. Yellow No. 202 (1) Appropriate amount 4. Perfume Appropriate amount 5. Make the total amount 100 with sodium sulfate [Manufacturing Method] Mix Components 1 to 5 uniformly to obtain a product.

[0047] (Formulation Example 8) Ointment Formulation Content (parts) 1. Hot water extract of pre-treated Rosa multiflora var. cathayensis fruits (Production Example 1) 5.0 2. 50% ethanol extract of pre-treated Rosa multiflora var. cathayensis fruits (Production Example 2) 1.0 3. Polyoxyethylene cetyl ether (30 E.O.) 2.0 4. Glyceryl monostearate 10.0 5. Liquid paraffin 5.0 6. Cetyl alcohol 6.0 7. Methyl paraben 0.1 8. Propylene glycol 10.0 9. Make the total amount 100 with purified water [Manufacturing Method] Heat and dissolve Components 3 to 6 and mix them, and keep at 70 °C to obtain an oil phase. Heat and dissolve Components 1, 2 and 7 to 9 and mix them, and keep at 75 °C to obtain an aqueous phase. Add the aqueous phase to the oil phase and emulsify, and cool to 30 °C while stirring to obtain a product.

[0048] (Formulation Example 9) Powder Formulation Content (parts) 1. Hot water extract of pre-treated Rosa multiflora var. cathayensis fruits (Production Example 1) 1.0 2. Dried corn starch 39.0 3. Microcrystalline cellulose 60.0 [Manufacturing Method] Mix Components 1 to 3 to obtain a powder.

[0049] ​​ (Formulation Example 10) Tablet Formulation Content (parts) 1. Ethanol extract of the pre-treated fruits of Rosa multiflora var. cathayensis (Production Example 3) 5.0 2. Dried corn starch 25.0 3. Calcium carboxymethyl cellulose 20.0 4. Microcrystalline cellulose 40.0 5. Polyvinylpyrrolidone 7.0 6. Talc 3.0 7. Talc 3.0 [Manufacturing Method] Mix Components 1 to 4, and then add an aqueous solution of Component 5 as a binder to form granules. Add Component 6 to the formed granules and tablet them. Each tablet weighs 0.52 g.

[0050] (Formulation Example 11) Tablet Candy Formulation Content (parts) 1. Ethanol extract of the pre-treated fruits of Rosa multiflora var. cathayensis (Production Example 3) 2.0 2. Dried corn starch 49.8 3. Erythritol 40.0 4. Citric acid 5.0 5. Sucrose fatty acid ester 3.0 6. Flavor 0.1 7. Purified water 0.1 8. Purified water 0.1 [Manufacturing Method] Mix Components 1 to 4 and 7, and form granules. Add Components 5 and 6 to the formed granules and tablet them. Each tablet weighs 1.0 g.

[0051] (Formulation Example 12) Beverage Formulation Content (parts) 1. Hot water extract of the pre-treated fruits of Rosa multiflora var. cathayensis (Production Example 1) 0.05 2. Stevia 0.05 3. Malic acid 5.0 4. Flavor 0.1 5. Make the total volume 100 with purified water [Manufacturing Method] Dissolve Components 1 to 3 in a small amount of water. Then, add Components 4 and 5 and mix.

[0052] Next, in order to explain the effects of the present invention in detail, experimental examples will be given.

Example

[0053] Experimental Example 1 Measurement of the expression levels of type I collagen (COL1A1), MMP-1 and MMP-2 mRNAs The expression levels of COL1A1, MMP-1 and MMP-2 mRNAs were measured. Human dermal fibroblasts were seeded at 1×10 5 cells in a φ60 mm dish and cultured in DMEM culture medium containing 10% FBS under the conditions of 37°C and 5% CO2. When the cells reached a confluent state, each sample was cultured for 24 hours in DMEM(-) culture medium added to the final concentrations shown in Tables 1 to 4, and then total RNA was extracted. The total RNA was extracted from the cells using RNAiso Plus (Takara Bio), and the total RNA amount was determined by the absorbance at 260 nm using a spectrophotometer (Nanodrop). The measurement of the mRNA expression level was performed by real-time RT-PCR based on the total RNA extracted from the cells. For the real-time RT-PCR method, High Capacity RNA-to-cDNA Kit (Applied Biosystems) and SYBR Select Master Mix (Applied Biosystems) were used. That is, after reverse transcription reaction of 500 ng of total RNA, a PCR reaction (95°C: 15 seconds, 60°C: 60 seconds, 40 cycles) was performed. Other operations were carried out according to the defined methods, and the expression levels of COL1A1, MMP-1 and MMP-2 mRNAs were determined as the ratio to the expression level of GAPDH mRNA, which is an internal standard (Tables 1 to 3). However, for the 50% ethanol extract of the fruits of Rosa multiflora Thunb. pretreated (Production Example 2) and the 50% ethanol extract of the fruits of conventional Rosa multiflora Thunb. (Comparative Production Example 2), β-actin was used as the internal standard (Table 4).

[0054] Primer set for COL1A1 AGGACAAGAGGCATGTCTGGTT (SEQ ID NO: 1) TTGCAGTGGTAGGTGATGTTCTG (SEQ ID NO: 2) Primer set for MMP-1 GGGAGATCATCGGGACAACTC (SEQ ID NO: 3) TGAGCATCCCCTCCAATACC (SEQ ID NO: 4) Primer set for MMP-2 CCGTCGCCCATCATCAA (SEQ ID NO: 5) CTTCTGCATCTTCTTTAGTGTGTCCTT (SEQ ID NO: 6) Primer set for GAPDH TGCACCACCAACTGCTTAGC (SEQ ID NO: 7) TCTTCTGGGTGGCAGTGATG (SEQ ID NO: 8) Primer set for β-actin CACTCTTCCAGCCTTCCTTCC (SEQ ID NO: 9) GTGTTGGCGTACAGGTCTTTG (SEQ ID NO: 10)

[0055] These experimental results are shown in Tables 1 to 4. As a result, the extract of the fruits of Rosa multiflora Thunb. var. cathayensis Rehd. et Wils. subjected to the pretreatment of the present invention showed excellent COL1A1 expression promoting effect (collagen production promoting action), MMP-1 expression inhibitory effect (MMP-1 inhibitory action), and MMP-2 expression inhibitory effect (MMP-2 inhibitory action). Furthermore, in any of the effects, the extract of the fruits of Rosa multiflora Thunb. var. cathayensis Rehd. et Wils. subjected to the pretreatment of the present invention was significantly higher than the extract of the fruits of conventional Rosa multiflora Thunb. var. cathayensis Rehd. et Wils. In particular, regarding the MMP inhibitory action, since some of the extracts of the fruits of conventional Rosa multiflora Thunb. var. cathayensis Rehd. et Wils. show the opposite action (expression promoting action), it was found that the effect of the extract of the fruits of Rosa multiflora Thunb. var. cathayensis Rehd. et Wils. subjected to the pretreatment of the present invention is different.

[0056]

Table 1

[0057]

Table 2

[0058]

Table 3

[0059]

Table 4

[0060] Experimental Example 2 Melanin production inhibition test using B16 mouse melanoma B16 mouse melanoma cells were seeded at 3×10 4 cells in a φ60 mm dish and cultured for 5 days at 37 °C under 5% CO2 conditions in MEM culture medium containing 10% FBS with each sample added to reach the final concentration shown in Table 5. After culturing, the cells were detached, and the pellet obtained by centrifugation was dissolved in PBS(-) by ultrasonic disruption. Protein quantification was performed using the Lowry method (J. Biol. Chem., 193, 265 - 275, 1951). When measuring the amount of melanin, 4N NaOH was added to the remaining cell disruption solution taken for protein quantification, and after heating at 60 °C for 2 hours, the absorbance at 475 nm was measured using a spectrophotometer (Shimadzu Corporation), and the amount of melanin was determined from the calibration curve, and the amount of melanin per 1 mg of protein was calculated. The melanin production inhibition rate was calculated from the ratio of the decrease in the amount of melanin in the sample-added group to that in the control (sample-untreated) group.

[0061] These experimental results are shown in Table 5. As a result, it was confirmed that the extract of the fruits of Rosa multiflora Thunb. var. cathayensis Rehd. et Wils. subjected to the pretreatment of the present invention has an excellent melanin production inhibitory effect. Furthermore, compared with the extract of the fruits of conventional Rosa multiflora Thunb. var. cathayensis Rehd. et Wils., the extract of the fruits of Rosa multiflora Thunb. var. cathayensis Rehd. et Wils. subjected to the pretreatment of the present invention was significantly higher. In particular, it was found that the 50% ethanol extract of the fruits of Rosa multiflora Thunb. var. cathayensis Rehd. et Wils. subjected to the pretreatment of the present invention (Production Example 2) exhibits an effect far superior to that of arbutin, which is the positive control.

[0062]

Table 5

[0063] Experimental Example 3 Reactive oxygen species scavenging effect The free radical scavenging and removal effect was evaluated. As a model of free radicals, α,α-diphenyl-β-picrylhydrazyl (hereinafter referred to as DPPH), a stable free radical, was used. It was reacted with the sample at a certain ratio for a certain period of time, and the amount of radicals that decreased was measured from the decrease in absorbance at 517 nm.

[0064] Measurement method of free radical scavenging and removal effect To 2 mL of 1.0 M acetic acid buffer (pH 5.5) to which each sample was added to a final concentration of 1 μg / mL, 2 mL of ethanol (99.5) and 1 mL of 0.5 mM DPPH ethanol solution were added to obtain a reaction solution. In the case of an oil-soluble sample, the sample was added to 2 mL of ethanol (99.5) to obtain a reaction solution. Then, it was reacted at 37 °C for 30 minutes, and the absorbance (A) at 517 nm was measured with water as a control. Also, the absorbance (B) was measured using purified water instead of the sample as a blank. The free radical scavenging and removal rate was calculated from the formula shown below. Free radical scavenging and removal rate (%) = (1 - A / B) × 100

[0065] These test results are shown in Table 6. It was confirmed that the extract of the fruits of Rosa multiflora Thunb. var. cathayensis Rehd. et Wils. subjected to the pretreatment of the present invention has a stable and excellent free radical scavenging and removal effect (antioxidant effect). Furthermore, compared with the extract of the fruits of conventional Rosa multiflora Thunb. var. cathayensis Rehd. et Wils., the extract of the fruits of Rosa multiflora Thunb. var. cathayensis Rehd. et Wils. subjected to the pretreatment of the present invention was significantly higher.

[0066] [Table 6]

[0067] Experimental Example 4 Cell growth promotion test Human-derived keratinocytes were placed in a 96-well plate at 1×10 per well in DMEM culture medium containing 0.1% FBS 3Seeds were sown, and after adding each sample to a final concentration of 0.1 μg / mL, they were cultured for 5 days under the conditions of 37°C and 5% CO₂. The cell count was measured by a staining method. That is, after the culture was completed, the culture medium was removed, and the cells were fixed with methanol. Subsequently, 0.1% methylene blue was added, and the cells were stained for 1 hour. After drying, 100 μL of 0.1 N HCl was added to each well and stirred well, and the absorbance at 650 nm was measured using a microplate reader. The cell growth rate was calculated as the ratio of the cell amount in the sample-added group to the cell amount in the control (sample-untreated) group.

[0068] The results of these experiments are shown in Table 7. As a result, the extract of the fruits of Rosa multiflora Thunb. var. cathayensis Rehd. pretreated according to the present invention showed an excellent cell growth promoting effect. Furthermore, compared with the extract of the fruits of conventional Rosa multiflora Thunb. var. cathayensis Rehd., the extract of the fruits of Rosa multiflora Thunb. var. cathayensis Rehd. pretreated according to the present invention was significantly higher.

[0069]

Table 7

[0070] Experimental Example 5 Use Test The use feelings of the lotion of Formulation Example 1 and Comparative Formulation Example 1 of the present invention were evaluated.

[0071] Five panelists were grouped together, and the lotions of Formulation Example 1 and Comparative Formulation Example 1 were used blindly to compare the use feelings, and in addition, the presence or absence of skin troubles was evaluated.

[0072] As a result, the lotion obtained in Formulation Example 1 had better use feelings than Comparative Formulation Example 1 and could be used safely without skin troubles or the like. Also, there was no problem with the deterioration of the formulation components.

Industrial Applicability

[0073] From the above, the extract of the fruit of the genus Rosa of the Rosaceae family of the present invention has excellent MMP inhibitory activity, collagen production promoting activity, melanin production inhibitory activity, antioxidant activity, and cell growth promoting activity, and also has excellent stability. Therefore, the extract of the fruit of the genus Rosa of the present invention can be used not only in the cosmetic field such as skin aging, but also in the medical field such as suppression of functional decline due to aging, prevention and treatment of cancer, etc., and is expected to be applied to cosmetics, foods, quasi-drugs, pharmaceuticals, etc.

Claims

1. As a first step, fruits of the genus Rosa in the Rosaceae family are extracted with a pretreatment agent consisting of liquid water, filtered, and separated into a filtrate and an extraction residue. As a second step, the extraction residue from the first step is further extracted using one or more extraction agents selected from the group consisting of water, lower alcohols, and liquid polyhydric alcohols, at an extraction temperature that is 20°C or higher than the extraction temperature in the first step. A skin external preparation characterized by containing an extract of fruits of the genus Rosa in the Rosaceae family.

2. The skin external preparation according to Claim 1, characterized by having an MMP inhibitory effect.

3. The skin external preparation according to Claim 1, characterized by having a collagen production promoting effect.

4. The skin external preparation according to Claim 1, characterized by having a wrinkle improvement effect.

5. The skin external preparation according to Claim 1, characterized by having a melanin production inhibitory effect.

6. The skin external preparation according to Claim 1, characterized by having a whitening effect.

7. The skin external preparation according to Claim 1, characterized by having an antioxidant effect.

8. The skin external preparation according to Claim 1, characterized by having a cell proliferation promoting effect.

9. As a first step, fruits of the genus Rosa in the Rosaceae family are extracted with a pretreatment agent consisting of liquid water, filtered, and separated into a filtrate and an extraction residue. As a second step, the extraction residue from the first step is further extracted using one or more extraction agents selected from the group consisting of water, lower alcohols, and liquid polyhydric alcohols, at an extraction temperature that is 20°C or higher than the extraction temperature in the first step. A food composition for preventing and / or improving one or more diseases or symptoms selected from the group consisting of dermal wrinkles, cancer diseases, ulcer formation, arteriosclerosis, rheumatoid arthritis, osteoporosis, periodontitis, wounds, pigmentation, rough skin, skin aging, and dull skin, characterized by containing an extract of fruits of the genus Rosa in the Rosaceae family.

10. As a first step, fruits of the genus Rosa of the Rosaceae family are extracted with a pretreatment agent consisting of liquid water, filtered, and separated into a filtrate and an extraction residue. As a second step, the extraction residue from the first step is further extracted using one or more extraction agents selected from the group consisting of water, lower alcohols, and liquid polyhydric alcohols, and the extraction temperature is 20 °C or higher than the extraction temperature of the first step. A pharmaceutical for preventing and / or improving one or more diseases or symptoms selected from the group consisting of dermal wrinkles, cancer diseases, ulcer formation, arteriosclerosis, rheumatoid arthritis, osteoporosis, periodontitis, wounds, pigmentation, rough skin, skin aging, and dullness of the skin, characterized by containing an extract of fruits of the genus Rosa of the Rosaceae family extracted at a temperature higher than the extraction temperature of the first step.

Images