Has3 expression promoter and hyaluronic acid production promoter

Abstract

To provide an HAS3 expression promoter and a hyaluronic acid production promoter.SOLUTION: The present invention provides an HAS3 expression promoter comprising a Jasmine sambac extract as an active ingredient. By promoting HAS3 expression, it is particularly effective in promoting hyaluronic acid production in the skin.SELECTED DRAWING: Figure 1

Description

Technical Field

[0001] The present invention relates to an HAS3 expression promoter and a hyaluronic acid production promoter. More specifically, it relates to an HAS3 expression promoter and a hyaluronic acid production promoter containing an extract of Jasminum sambac as an active ingredient.

Background Art

[0002] Hyaluronic acid is widely present in vivo in joints such as the skin and cartilage, and plays a role in moisturizing the skin, etc., but it is known to decrease due to ultraviolet rays and aging. Therefore, in order to increase hyaluronic acid, measures are taken to take it in from the outside by means such as external application and oral administration. It is desirable to be able to promote the synthesis of hyaluronic acid in the body, because various effects of hyaluronic acid can be exerted from the inside. For example, if the synthesis of hyaluronic acid in the skin can be promoted, it can be expected that the functions such as moisturizing will be improved not only on the skin surface but also from inside the skin.

Prior Art Documents

Patent Documents

[0003]

Patent Document 1

Patent Document 2

Patent Document 3

Patent Document 4

Summary of the Invention

Problems to be Solved by the Invention

[0004] An object of the present invention is to provide a novel HAS3 expression promoter and a hyaluronic acid production promoter.

Means for Solving the Problems

[0005] As a result of intensive research on the effect of promoting the expression of HAS3, which contributes to the promotion of hyaluronic acid production in the body, the inventors have found that the extract of Jasminum sambac has a particularly high effect as an agent for promoting HAS3 expression, and have completed the following invention. (1) A promoter for promoting hyaluronic acid production, comprising an extract of Jasminum sambac as an active ingredient. (2) A promoter for promoting HAS3 expression, comprising an extract of Jasminum sambac as an active ingredient. (3) The promoter for promoting HAS3 expression according to (2) for promoting hyaluronic acid production in keratinocytes.

Effects of the Invention

[0006] By administering the promoter for promoting HAS3 expression of the present invention, the expression of HAS3 can be promoted. By promoting the expression of HAS3, the production of hyaluronic acid can be promoted.

Brief Description of the Drawings

[0007]

Figure 1

Modes for Carrying Out the Invention

[0008] The present invention provides a promoter for promoting HAS3 expression and a promoter for promoting hyaluronic acid production, which contain an extract of Jasminum sambac as an active ingredient.

[0009] Hyaluronic acid is a high-molecular mucopolysaccharide in which disaccharides of N-acetylglucosamine and glucuronic acid are alternately bonded. It is widely distributed in mammalian skin, joints such as blood vessels and cartilage, and connective tissues, etc., playing a role in maintaining moisture between cells and lubrication, and fulfilling functions such as moisturizing in the skin. However, it is known that hyaluronic acid in the skin decreases due to ultraviolet rays and aging, which may cause skin dryness, loss of elasticity, and an increase in wrinkles. Therefore, it is required to increase hyaluronic acid in the skin. For example, since the epidermis is important for maintaining the skin's barrier function, it is desirable to be able to increase hyaluronic acid in the skin including the epidermis.

[0010] However, the molecular weight of hyaluronic acid is usually about 800,000 to 1.2 million, and in some large cases, it can reach 2 million. Therefore, it is difficult to penetrate the skin. Although it is possible to reduce the molecular weight of hyaluronic acid to about 411 to 80,000 by low-molecularization technology, measures are also desired not only to supplement hyaluronic acid from the outside but also to promote its synthesis from inside living organisms such as the skin.

[0011] Hyaluronic acid is produced by hyaluronan synthase (HAS). There are three types of HAS: HAS1, HAS2, and HAS3. HAS1 and HAS2 are present in the fibroblast membrane and contribute to the production of hyaluronic acid in the dermis, while HAS3 is present in the epidermal stem cell membrane and mainly contributes to the production of hyaluronic acid in the epidermis.

[0012] By administering the HAS3 expression promoter of the present invention, the expression of HAS3 in the skin including the epidermis can be promoted. As described above, HAS3 has been reported to mainly contribute to the synthesis of hyaluronic acid in the epidermis. Therefore, if the expression of HAS3 can be promoted by the jasmine sambac extract discovered by the present inventors, the synthesis by epidermal keratinocytes will be promoted and an increase in the production of hyaluronic acid in the skin can be expected. If the production of hyaluronic acid in the skin is promoted, effects such as skin moisturization, improvement of elasticity, improvement of the barrier function, and anti-wrinkle effects can be expected.

[0013] The promotion of HAS3 expression can be confirmed, for example, by comparing the expression level of HAS3 when a HAS3 expression promoter is applied with that in a state where no HAS3 expression promoter is applied (control), and verifying that the expression level of HAS3 is enhanced with a statistically significant difference (e.g., T-test) with a significance level of 5%. Alternatively, it can also be confirmed by calculating the increase amount and having a statistically significant difference (e.g., T-test) with a significance level of 5%, or by obtaining an increase rate such as 5% or more, 10% or more, 20% or more, 30% or more, etc. The expression level of HAS3 can be measured by any known technique, for example, but not limited to, PCR and the like.

[0014] The increase in hyaluronic acid can be measured by, for example, an increase in the amount of hyaluronic acid in a skin sample when a hyaluronic acid production promoter is applied compared to a state where no hyaluronic acid production promoter is applied (control). Such an increase in the amount of hyaluronic acid can be confirmed, for example, by visually observing an increase in the amount of hyaluronic acid, or an increase in the amount of hyaluronic acid markers such as hyaluronic acid receptors (e.g., CD44, etc.) and hyaluronic acid-binding protein HABP, etc. Alternatively, it can also be confirmed by calculating the increase amount and having a statistically significant difference (e.g., T-test) with a significance level of 5%, or by obtaining an increase rate such as 5% or more, 10% or more, 20% or more, 30% or more, etc. The amount of hyaluronic acid markers can be measured by any known technique, for example, but not limited to, immunostaining, ELISA, etc. The amount of hyaluronic acid can be measured by any known technique, for example, but not limited to, HPLC, etc.

[0015] Such an action of promoting HAS3 expression and promoting hyaluronic acid production can be measured by various methods including in vivo, in vitro, ex vivo, etc. For example, the expression level of the HAS3 gene in skin cells such as cultured keratinocytes can be measured in vitro. As the skin cells, for example, skin cells collected from animals such as humans can be cultured, such as monolayer or multilayer cultured cells, cultured keratinocytes, cultured fibroblasts, or their passaged cells, established cells, etc. can be used. For example, the amount of hyaluronic acid or its marker in a skin sample can also be measured ex vivo. The skin sample may be a skin sample after collection, for example, a skin sample in an ex vivo state after being collected from an animal such as a human, or alternatively, an artificial skin sample such as a 3D skin model can be used.

[0016] Furthermore, the present invention provides a hyaluronic acid production promoter containing an extract of Jasminum sambac as an active ingredient and promoting the production of hyaluronic acid in the skin, for example, in the epidermis. The present invention also provides a composition containing a HAS3 expression promoter or a hyaluronic acid production promoter containing an extract of Jasminum sambac as an active ingredient. In one aspect of such an agent or composition, the production of hyaluronic acid in the skin is promoted by promoting the expression of HAS3 by keratinocytes.

[0017] The extract of Jasminum sambac is an extract obtained by extracting the flowers of Jasminum sambac (scientific name: Jasminum sambac). Jasminum sambac is a plant of the Oleaceae family that has a greener and fruitier fragrance than common jasmine (Jasminum officinale) and is often used as a fragrance. Although the extract of Jasminum sambac is known to have effects such as moisturizing by promoting ceramide production (Patent Document 1), improving blood flow (Patent Document 2), suppressing the increase in neutral fat (Patent Document 3), whitening (Patent Document 4), etc., the present inventor has discovered that the extract of Jasminum sambac has a high action of promoting HAS3 expression.

[0018] Jasmine sambac extract is an extract of the flower part of Jasmine sambac. As the Jasmine sambac extract, Jasmine sambac absolute (organic solvent extract), extract (water extract), essential oil (steam distillation, etc.), essential oil (hydrous ethanol extract), cold press oil (ground), etc. can be used. For example, Jasmine sambac absolute (Jasminum Sambac Absolute, CAS number: 91770-14-8) can be used. As the Jasmine sambac extract, for example, a commercially available Jasmine sambac absolute having the above CAS number may be used, or it may be obtained by extracting the flower part of Jasmine sambac.

[0019] When performing extraction, for example, solvent extraction can be adopted. In the case of solvent extraction, Jasmine sambac is dried as necessary, and further shredded or crushed as necessary, and then extracted with an aqueous extractant, water, for example, cold water, warm water, or hot water at or below the boiling point, or a water-containing organic solvent, for example, water-containing ethanol, water-containing methanol, water-containing ether, water-containing 1,3-butylene glycol, etc., or an organic solvent, for example, ethanol, methanol, ether, 1,3-butylene glycol, etc., selected appropriately according to the properties of the raw material and the use of the composition, at room temperature or with heating. However, the extraction method is not limited to solvent extraction, and may be a conventional method known in the art, and the extraction method and form of the extract used in the present invention are arbitrary as long as they do not impair the effects of the present invention. The form of the extract may be not only the extract itself, but also one that is appropriately diluted or concentrated by a conventional method, and may further be a powder or lump solid obtained by drying the extract, or a squeezed juice that is appropriately diluted or concentrated by a conventional method.

[0020] The HAS3 expression promoter or hyaluronic acid production promoter of the present invention (hereinafter sometimes collectively referred to as "the agent of the present invention") may be formulated into compositions such as cosmetics, pharmaceuticals, quasi-drugs, etc., and topically administered to animals such as humans, or may be formulated into compositions such as various foods, food and drink products, nutritional supplements such as supplements, etc., and orally administered to animals such as humans, or may be administered to animals such as humans as a pharmaceutical preparation. As the form of topical administration, for example, creams, emulsions, liquids, sheets, sprays, gels, etc. can be arbitrarily selected. For example, the mode of being formulated into cosmetics and applied to the skin can be mentioned. As the form of oral administration, for example, tablets, beverages, powders, etc. can be arbitrarily selected. However, the administration form is not limited to the above-mentioned ones.

[0021] The cosmetic composition of the present invention may be various cosmetics such as fragrances, perfumes, emulsions, creams, beauty liquids, lotions, packs, facial washes, soaps, body soaps, shampoos, etc., and may be in various forms such as liquid, emulsion, cream, solid, sheet, spray, gel, foam, powder, etc. Further, the food composition of the present invention may be a powder, a beverage, or a tablet, and may be in various forms such as powdery, liquid, solid, granular, pellet-like, paste-like, gel-like, etc.

[0022] The frequency of application can be arbitrarily selected, such as once every four weeks, once every two weeks, once a week, once every three days, once every two days, once a day, twice a day, three times a day, four times a day, five times a day, administration each time, etc., but is not limited thereto.

[0023] The agent or composition of the present invention preferably contains a jasmine sambac extract in an amount such that the effect of promoting HAS3 expression or promoting hyaluronic acid production is sufficiently exhibited, and can be appropriately determined according to their types, purposes, forms, usage methods, etc. For example, the blending amount (dry weight) of the jasmine sambac extract per total weight of the agent or composition of the present invention can be 0.0001 to 0.0005% by weight, 0.0005 to 0.001% by weight, 0.001 to 0.005% by weight, 0.005 to 0.01% by weight, 0.01 to 0.05% by weight, 0.05 to 0.1% by weight, 0.01 to 10.0% by weight, 0.01 to 5.0% by weight, 0.1 to 0.5% by weight, 0.1 to 1.0% by weight, 0.01 to 1.0% by weight, 0.5 to 1.0% by weight, 1.0 to 5.0% by weight, 5.0 to 10.0% by weight, 10.0 to 50.0% by weight, 50.0 to 100.0% by weight. Further, in certain embodiments, the agent of the present invention may contain a jasmine sambac extract as an active ingredient in an amount of, for example, 10% by weight or more, 20% by weight or more, 30% by weight or more, 40% by weight or more, 50% by weight or more, 60% by weight or more, 70% by weight or more, 80% by weight or more, 90% by weight or more, 95% by weight or more, or 99% by weight or more. In certain embodiments, the agent of the present invention may consist of a jasmine sambac extract.

[0024] Additives can be arbitrarily selected and used in combination with the agent or composition of the present invention as needed. Excipients and the like can be included as additives.

[0025] Any excipient can be used as long as it is usually used when the desired dosage form is obtained. For example, starches such as wheat starch, rice starch, corn starch, potato starch, dextrin, cyclodextrin, crystalline celluloses, sugars such as lactose, glucose, sucrose, reduced maltose, malt syrup, fructooligosaccharide, emulsified oligosaccharide, sugar alcohols such as sorbitol, erythritol, xylitol, lactitol, mannitol, etc. can be mentioned. These excipients can be used alone or in combination of two or more.

[0026] As other additives, known substances such as fragrance components other than Jasminum sambac, solvents, colorants, preservatives, thickeners, binders, disintegrants, dispersants, stabilizers, gelling agents, antioxidants, surfactants, preservatives, pH adjusters, oils, water, alcohols, chelating agents, silicones, ultraviolet absorbers, moisturizers, fragrances, various medicinal components, antiseptics, neutralizing agents, etc. can be appropriately selected and used.

[0027] In addition, the present invention also provides a method for promoting skin hyaluronic acid production by applying Jasminum sambac extract, the use of Jasminum sambac extract in the manufacture of a medicament for promoting skin hyaluronic acid production, and Jasminum sambac extract for use in promoting hyaluronic acid production. In one aspect, hyaluronic acid production in the skin such as the epidermis is promoted by promoting HAS3 expression by keratinocytes. One aspect of the method of the present invention is a method aimed only at beauty, excluding medical practices by doctors and medical staff.

Examples

[0028] Next, the present invention will be described in more detail by way of examples. It should be noted that the present invention is not limited thereby.

[0029] 1. Preparation of samples As the sample of Jasminum sambac extract, commercially available Jasminum Sambac Absolute (CAS No.: 91770-14-8) was used.

[0030] 2. Culture of normal human epidermal keratinocytes Human neonatal epidermal keratinocytes (Kurabo, product name: Frozen NHEK (NB), product number: KK-4009) were cultured in a T175 flask using EpiLife(TM) Medium; with 60 uM calcium (Life Technologies, product number MEPI500CA) and HuMedia-KG growth additive set (Kurabo, product number: KK-6150). After confirming that the cells had grown to sub-confluence, Trypsin / EDTA Solution (Gibco, product number: R-001-100) was added, and the cells were incubated at 37°C for 5 minutes to detach them. After stopping the reaction with Defined Trypsin Inhibitor (Gibco, product number: R-007-100), the cells were collected. After centrifugation, the cell count was determined, and the cells were seeded in a 24-well plate containing EpiLife(TM) Medium; with 60 uM calcium (Life Technologies) and HuMedia-KG growth additive set (Kurabo) at a cell concentration of 1×10 5 cells / well and cultured for 24 hours. After that, an ethanol solution of jasmine sambac extract was added, and the final concentration of jasmine sambac extract in the medium was adjusted to 10 ppm, and the cells were cultured for an additional 24 hours. The control was cultured in the same medium except that it contained the same amount of ethanol.

[0031] 3. Measurement of HAS3 expression After 24 hours of culture after adding the jasmine sambac extract, the entire amount of the medium was collected using RLT buffer. Then, mRNA was extracted using the RNeasy mini kit (QIAGEN), and cDNA was synthesized using SuperScript VILO (Invitrogen). Then, using the synthesized cDNA, quantitative PCR analysis was performed on the moisturizing-related genes using platinum SYBER green (Invitrogen). The primer set for the HAS3 gene and the sequence of the GAPDH gene as an endogenous control are as follows. GAPDH_F: TGGAAATCCCATCACCATCTTC (SEQ ID NO: 1) GAPDH_R: CGCCCCACTTGATTTTGG (SEQ ID NO: 2) HAS3_F: AGCACCTTCTCGTGCATCATGC (SEQ ID NO: 3) HAS3_R: TCCTCCAGGACTCGAAGCATCT (SEQ ID NO: 4) From the obtained results, the relative value of HAS3 / GAPDH was calculated, and a significant difference test against the control was performed by t-test (n = 3).

[0032] The results are shown in Figure 1. From Figure 1, it was confirmed that the jasmine sambac extract has a significant effect of promoting HAS3 expression compared to the control.

Industrial Applicability

[0033] If the expression of HAS3 is promoted by the jasmine sambac extract, an effect of hyaluronic acid production in the skin such as the epidermis is expected. If the production of hyaluronic acid in the skin is promoted, effects such as moisturizing of the skin, improvement of elasticity, improvement of barrier function, and anti-wrinkle effects are expected.

Claims

1. A hyaluronic acid production promoter containing jasmin sambac extract as an active ingredient.

2. A HAS3 expression promoter containing jasmin sambac extract as an active ingredient.

3. The HAS3 expression promoter according to claim 2, for promoting hyaluronic acid production in keratinocytes.

Images