Hepatic disorder-inhibiting composition

Live lactic acid bacteria from Leuconostoc lactis, Lentilactobacillus kefiri, or Lactococcus laudensis compositions address liver damage by reducing oxidative stress and lipid accumulation, providing a stable and safe treatment for NAFLD and NASH.

JP2025102646APending Publication Date: 2025-07-08MEGMILK SNOW BRAND CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
JP2024177222
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-12-26
Filing Date
2024-10-09
Publication Date
2025-07-08

AI Technical Summary

Technical Problem

Existing compositions and therapies for liver damage, particularly non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH), lack efficacy in reducing oxidative stress and lipid accumulation, and there is a need for stable and safe solutions.

Method used

Compositions containing live cells or cultures of lactic acid bacteria from Leuconostoc lactis, Lentilactobacillus kefiri, or Lactococcus laudensis, which reduce oxidative stress and lipid accumulation in hepatocytes by enhancing antioxidant enzyme expression and activity.

Benefits of technology

These compositions effectively suppress liver damage by reducing cell injury markers, oxidative stress, and lipid accumulation, offering a stable and safe means of treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025102646000001
    Figure 2025102646000001
  • Figure 2025102646000002
    Figure 2025102646000002
  • Figure 2025102646000003
    Figure 2025102646000003
Patent Text Reader

Abstract

To provide hepatic disorder-inhibiting compositions with excellent stability and safety; and hepatic disorder-inhibiting beverages and foods, hepatic disorder-inhibiting nutrient compositions, hepatic disorder-inhibiting feeds, or hepatic disorder-inhibiting pharmaceuticals, each including the hepatic disorder-inhibiting composition.SOLUTION: A hepatic disorder-inhibiting composition is provided, the composition including, as an active ingredient, at least one selected from the group consisting of lactic acid bacterial cells, cultures, bacterial cell processed products, and culture supernatants. The lactic acid bacteria include Leuconostoc lactis, Lentilactobacillus kefiri, or Lactococcus laudensis.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a composition for suppressing liver damage, a food or drink for suppressing liver damage, a nutritional composition for suppressing liver damage, a feed for suppressing liver damage, or a pharmaceutical for suppressing liver damage, which contains at least one selected from the group consisting of cells of lactic acid bacteria, cultures, cell-treated products, and culture supernatants as an active ingredient.

Background Art

[0002] Liver damage is a state in which hepatocytes are damaged and function abnormally due to drugs, alcohol, overnutrition, etc., and is detected by the amount of liver damage indicators leaked from the damaged cells in the blood. It has been reported that in Japanese adults, about 25% of men and about 10% of women have a high amount of liver damage indicators in the blood (Non-Patent Document 1). If liver damage progresses, some people will develop diseases such as liver cirrhosis and liver cancer, and ultimately die. Therefore, suppression of liver damage is one of the important issues for national health.

[0003] Fatty liver is a general term for diseases in which neutral fat accumulates excessively in the liver and causes liver damage. In particular, fatty liver not caused by alcohol is sometimes called non-alcoholic fatty liver disease (hereinafter sometimes simply referred to as NAFLD), and if left untreated, it is known to progress to non-alcoholic steatohepatitis (hereinafter sometimes simply referred to as NASH), liver cirrhosis, and liver cancer. In addition, NAFLD is considered to be a liver phenotype of metabolic syndrome. Metabolic syndrome refers to a state in which, in addition to the accumulation of visceral obesity, two or more of lipid metabolism disorder, hypertension, and hyperglycemia are applicable, and is known to cause various diseases including liver damage.

[0004] In all cells in the body, reactive oxygen species (hereinafter sometimes simply referred to as ROS) are constantly generated during the process of consuming oxygen such as in metabolism. Normally, ROS are removed by an antioxidant defense mechanism by antioxidant enzymes such as catalase, superoxide dismutase (hereinafter sometimes simply referred to as SOD), and heme oxygenase (hereinafter sometimes simply referred to as HO-1), and antioxidants such as glutathione. On the other hand, in an oxidative stress state where the production of ROS exceeds the antioxidant mechanism due to drugs, alcohol, overnutrition, etc., the ROS that could not be completely removed react with biological macromolecules such as lipids, proteins, and DNA, causing cell damage (Non-Patent Document 1).

[0005] As a pathological mechanism of NAFLD, which is one of the diseases that cause liver damage, the two-hit hypothesis has been proposed. This is a hypothesis that when fat accumulates in the liver (1st hit) and the sensitivity to external stimuli increases, and the induction of cell damage such as oxidative stress is added (2nd hit), hepatocytes are damaged (Non-Patent Document 3). Therefore, liver damage can be suppressed by reducing oxidative stress, inhibiting fatty acid synthesis, or promoting β-oxidation to inhibit fatty acid accumulation.

[0006] By the way, lactic acid bacteria and Bifidobacterium are bacteria that have been used for the production of fermented foods since ancient times, and recent research has been revealing that they contribute to the enhancement of various health functions. Patent Document 1 discloses a lipid metabolism improver containing a cell disruption product of lactic acid bacteria as an active ingredient, and a method for enhancing the lactic acid bacteria metabolism improving effect, which is characterized by including a step of disrupting lactic acid bacteria. As its lipid metabolism improving effect, it mentions reduction of total cholesterol, LDL-cholesterol, triglyceride, arteriosclerosis index, visceral fat, and / or increase of HDL-cholesterol and / or adiponectin, but there is no description about liver dysfunction and oxidation stress suppression effect at all. Also, many genera and many species of lactic acid bacteria are mentioned, and Leuconostoc lactis species is included therein, but in the examples, the lipid metabolism improving effect has been confirmed only for Lactobacillus amylovorus species. Furthermore, the lipid metabolism improver uses a cell disruption product obtained by disrupting the lactic acid bacteria cells of Lactobacillus amylovorus after sterilization as an active ingredient, and it has been confirmed that the dead cells have no effect, and the live cells have not been studied either. Patent Document 2 discloses a therapeutic agent for NAFLD and / or NASH containing melanoidin contained in a fermentation extract obtained by symbiotic fermentation of lactic acid bacteria and yeast as an active ingredient. As a therapeutic agent for NAFLD and / or NASH, it uses melanoidin obtained by removing cells using a filter from the symbiotic fermentation broth of lactic acid bacteria Leuconostoc lactis and yeast and further eluting with methanol as an active ingredient, and there is no description about the improvement effect of NAFLD and / or NASH by single cells or cultures, etc. at all. Patent Document 3 discloses a novel antioxidant composition characterized by containing a milk fermentation product of Lentilactobacillus kefiri (formerly classified: Lactobacillus kefiri) or a processed product thereof as an active ingredient. The antioxidant composition uses Lentilactobacillus kefiri as an active ingredient, but in the examples, in addition to Lentilactobacillus kefiri, a heat-treated product of a fermentation culture obtained by fermenting a complex microorganism containing a plurality of bacteria as a starter is used, and the oxidation stress reduction effect of Lentilactobacillus kefiri alone or live cells is unclear. In addition, there is no description about Lactococcus laudenensis in any of the patent documents.

Prior Art Documents

Patent Documents

[0007]

Patent Document 1

Patent Document 2

Patent Document 3

Non-Patent Documents

[0008]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Summary of the Invention

Problems to be Solved by the Invention

[0009] An object of the present invention is to provide a composition for suppressing liver damage, which is excellent in stability and safety. Another object of the present invention is to provide a food or drink for suppressing liver damage, a nutritional composition for suppressing liver damage, a feed for suppressing liver damage, or a pharmaceutical for suppressing liver damage, which contains the composition for suppressing liver damage.

Means for Solving the Problems

[0010] In order to solve the above problems, the present inventors conducted intensive studies and found that cells of lactic acid bacteria belonging to Leuconostoc lactis, Lentilactobacillus kefiri, or Lactococcus laudensis and / or cultures thereof can reduce oxidative stress in cells and suppress liver damage, thus completing the present invention. That is, the present invention includes the following aspects. (1) A composition for suppressing liver damage, comprising at least one selected from the group consisting of cells of lactic acid bacteria, cultures, cell-treated products, and culture supernatants as an active ingredient. (2) The composition for suppressing liver damage according to (1), wherein the lactic acid bacteria are at least one lactic acid bacterium belonging to a genus selected from the group consisting of the genus Leuconostoc, the genus Lentilactobacillus, and the genus Lactococcus. (3) The composition for suppressing liver damage according to (2), wherein the lactic acid bacterium belonging to the genus Leuconostoc is Leuconostoc lactis. (4) The composition for suppressing liver damage according to (2), wherein the lactic acid bacterium belonging to the genus Leuconostoc is Leuconostoc lactis strain SBT2561 (NITE P-02990). (5) The composition for suppressing liver damage according to (2), wherein the lactic acid bacterium belonging to the genus Lentilactobacillus is Lentilactobacillus kefiri. (6) The composition for suppressing liver damage according to (2), wherein the lactic acid bacterium belonging to the genus Lentilactobacillus is Lentilactobacillus kefiri strain SBT2022 (NITE P-04023). (7) The composition for suppressing liver injury according to (2), wherein the lactic acid bacterium belonging to the genus Lactococcus is Lactococcus laudensis. (8) The composition for suppressing liver injury according to (2), wherein the lactic acid bacterium belonging to the genus Lactococcus is Lactococcus laudensis SBT11178 strain (NITE P-03333). (9) The composition for suppressing liver injury according to any one of (1) to (8), wherein the suppression of liver injury is characterized by a reduction in the cell injury index. (10) The composition for suppressing liver injury according to any one of (1) to (8), wherein the suppression of liver injury is characterized by a reduction in oxidative stress. (11) The composition for suppressing liver injury according to any one of (1) to (8), wherein the suppression of liver injury is characterized by suppressing the accumulation of peroxides. (12) The composition for suppressing liver injury according to any one of (1) to (8), wherein the suppression of liver injury is at least one selected from the group consisting of enhancement of gene expression of antioxidant-related enzymes, enhancement of antioxidant-related enzyme activity, and increase in the amount of antioxidant substances. (13) The composition for suppressing liver injury according to (12), wherein the antioxidant substance is glutathione. (14) The composition for suppressing liver injury according to any one of (1) to (8), wherein the suppression of liver injury is characterized by suppressing the accumulation of lipids in hepatocytes. (15) The composition for suppressing liver injury according to any one of (1) to (8), wherein the suppression of liver injury is characterized by suppressing the expression of lipid synthesis-related genes. (16) The composition for suppressing liver injury according to any one of (1) to (8), wherein the suppression of liver injury is characterized by enhancing the expression of lipid oxidation-related genes. (17) A food or drink for suppressing liver damage, a nutritional composition for suppressing liver damage, a feed for suppressing liver damage, or a pharmaceutical for suppressing liver damage, which comprises the composition for suppressing liver damage according to any one of the above (1) to (8).

Advantages of the Invention

[0011] The present invention provides, as a new means for suppressing liver damage, a composition for suppressing liver damage, a food or drink for suppressing liver damage, a nutritional composition for suppressing liver damage, a feed for suppressing liver damage, or a pharmaceutical for suppressing liver damage, which contains at least one selected from the group consisting of cells, cultures, cell-treated products, and culture supernatants of lactic acid bacteria as an active ingredient. In particular, as the lactic acid bacteria, the present invention provides the above composition, food or drink, nutritional composition, feed, or pharmaceutical using lactic acid bacteria belonging to Leuconostoc lactis, Lentilactobacillus kefiri, or Lactococcus laudensis. Therefore, by ingesting the above composition, food or drink, nutritional composition, feed, or pharmaceutical of the present invention, suppression of liver damage can be expected in an easy and safe manner.

Modes for Carrying Out the Invention

[0012] "Suppression of liver damage" in the present invention means "reducing cell damage indicators", "reducing oxidative stress", or "suppressing lipid accumulation in hepatocytes". In addition, "reducing cell damage indicators" in the present invention specifically means reducing the numerical values of markers for evaluating cell damage typified by LDH, ALT, and AST. In addition, "reducing oxidative stress" in the present invention includes "suppressing the accumulation of peroxides". Further, "suppressing the accumulation of peroxides" includes at least one selected from the group consisting of "enhanced gene expression of antioxidant-related enzymes", "enhanced antioxidant-related enzyme activity", and "increased amount of antioxidants". Examples of antioxidants include proteins produced by antioxidant enzymes, such as glutathione and thioredoxin. In addition, "suppressing lipid accumulation in hepatocytes" in the present invention includes "suppressing the expression of lipid synthesis-related genes" or "enhancing the expression of lipid oxidation-related genes".

[0013] (Active ingredient) The active ingredient of the composition for suppressing liver damage of the present invention is at least one selected from the group consisting of lactic acid bacteria cells, cultures, cell-treated products, and culture supernatants. As the lactic acid bacteria, it is preferably at least one lactic acid bacterium belonging to a genus selected from the group consisting of the genus Leuconostoc, the genus Lentilactobacillus, and the genus Lactococcus. The lactic acid bacteria used in the composition for suppressing liver damage of the present invention are particularly preferably lactic acid bacteria belonging to Leuconostoc lactis, Lentilactobacillus kefiri, or Lactococcus laudensis. The lactic acid bacteria belonging to Leuconostoc lactis, Lentilactobacillus kefiri, or Lactococcus laudensis used in the composition for suppressing liver damage of the present invention are lactic acid bacteria classified as Leuconostoc genus lactis species, Lentilactobacillus genus kefiri species, or Lactococcus genus laudensis species by general classification methods such as 16S ribosomal RNA gene sequence analysis, and any lactic acid bacteria that exhibit a liver damage-suppressing effect can be used. In the present invention, particularly, Leuconostoc lactis SBT2561 (NITE P-02990), Lentilactobacillus kefiri SBT2022 (NITE P-04023), or Lactococcus laudensis SBT11178 (NITE P-03333) are preferred, and strains substantially equivalent to these strains are also preferred, but are not particularly limited. In addition, the lactic acid bacteria strains showing a liver injury inhibitory effect used in the present invention can also be obtained by screening for strains showing a liver injury inhibitory effect from lactic acid bacteria belonging to Leuconostoc lactis, Lactobacillus kefiri, or Lactococcus laudenensis by methods such as those evaluated in the examples described below. Hereinafter, as a representative example of the lactic acid bacteria used in the composition for inhibiting liver injury of the present invention, lactic acid bacteria belonging to any of Leuconostoc lactis, Lactobacillus kefiri, or Lactococcus laudenensis will be described as an example.

[0014] (Method for adjusting active ingredient) The lactic acid bacteria belonging to Leuconostoc lactis, Lactobacillus kefiri, or Lactococcus laudenensis, which are the active ingredients of the composition for inhibiting liver injury of the present invention, can be cultured according to conventional methods of lactic acid bacteria culture. As the culture medium, various media such as milk medium or a medium containing milk components, and a semi-synthetic medium not containing this can be used. The cells separated from the obtained culture by means of cell collection such as centrifugation can be used as they are as the active ingredient of the composition for inhibiting liver injury of the present invention. As the cells, concentrated, dried, freeze-dried cells, etc. can also be used, or they may be made into dead cells by heat drying or the like. Also, not only purely separated cells, but also cultures, suspensions, and other cell-containing substances can be used. Furthermore, cell-treated products such as cytoplasm and cell wall fractions obtained by treating the cells with enzymes or physical means can also be used as the active ingredient of the present invention. As forms such as cultures, not only cultures using media generally used for culturing lactic acid bacteria such as MRS medium (manufactured by Difco), lactose-containing M17 medium (Difco), and reduced skim milk medium, which are synthetic media, but also dairy products such as cheese, fermented milk, and lactic acid bacteria beverages for dairy products can be exemplified, and it is not particularly limited. Furthermore, culture supernatants prepared by removing milk protein precipitates and bacterial cell components from the obtained cultures using methods such as centrifugation and filtration can also be used as the active ingredient of the present invention. For example, a culture supernatant can be prepared by centrifuging a reduced-fat milk culture at 5000 rpm for 10 minutes.

[0015] (Composition for suppressing liver damage) The composition for suppressing liver damage of the present invention may contain bacterial cells of lactic acid bacteria belonging to Leuconostoc lactis, Lentilactobacillus kefiri, or Lactococcus laudenesis, which are the above-mentioned active ingredients, and may contain only the active ingredients, or may contain other ingredients as long as they do not interfere with the liver damage-suppressing effect. The composition for suppressing liver damage of the present invention may be either an oral composition or a parenteral composition, but is preferably an oral composition. Examples of the other ingredients include food and beverage compositions suitable for oral administration, oral pharmaceutical compositions, feed compositions, etc. Furthermore, it may contain probiotics such as other lactic acid bacteria as long as they do not interfere with the liver damage-suppressing effect.

[0016] (Pharmaceutical for suppressing liver damage) When manufacturing a pharmaceutical, excipients, stabilizers, flavoring agents, etc. permitted in formulation can be appropriately mixed during formulation, followed by concentration, lyophilization, or heat drying to obtain dead bacterial cells. These dried products, concentrates, and paste-like substances are also included. In addition, within the range that does not interfere with the liver damage-suppressing effect of lactic acid bacteria belonging to Leuconostoc lactis, Lentilactobacillus kefiri, or Lactococcus laudenesis, excipients, binders, disintegrants, lubricants, flavoring and odor-correcting agents, suspending agents, coating agents, and other arbitrary drugs can be mixed to formulate an oral preparation. Dosage forms include tablets, capsules, granules, powders, dusting powders, syrups, etc., and it is desirable to administer these orally. In addition, it can also be administered parenterally in the form of gastric wax, injections, infusions, patches, etc.

[0017] (Food and beverage for suppressing liver damage) The composition for suppressing liver damage of the present invention can be blended into any food or drink, or added to the raw materials during the manufacturing process of food or drink. Examples of food or drink include dairy products such as cheese, fermented milk, lactic acid bacteria beverages made from dairy products, lactic acid bacteria beverages, butter, margarine, etc., milk beverages, fruit juice beverages, beverages such as soft drinks, processed egg products such as jelly, candy, pudding, mayonnaise, etc., confectionery and bread such as butter cake, and in addition to various powdered milk, infant foods, nutritional compositions, etc., but it is not particularly limited.

[0018] (Feed for suppressing liver damage) Furthermore, the composition for suppressing liver damage of the present invention can be blended into feed. Similar to the above-mentioned food or drink, it can be blended into any feed or added to the raw materials during the manufacturing process of feed.

[0019] (Dosage, intake amount) When lactic acid bacteria belonging to Leuconostoc lactis, Lentilactobacillus kefiri or Lactococcus lactis are used by being blended into materials such as food or drink, feed, or processed products of these materials, the blending ratio of lactic acid bacteria belonging to Leuconostoc lactis, Lentilactobacillus kefiri, or Lactococcus lactis is not particularly limited and can be appropriately adjusted according to the ease of production and the preferred daily dosage. Although it is determined individually considering the symptoms, age, etc. of the administration subject, in the case of an ordinary adult, the blending amount, etc. can be adjusted so that 10 to 200 g of a culture of lactic acid bacteria belonging to Leuconostoc lactis, Lentilactobacillus kefiri or Lactococcus lactis, or 0.1 to 5000 mg of the bacterial cells themselves can be ingested. By ingesting in this way, the desired effect can be exerted.

[0020] (Administration, intake subject) The administration or ingestion target of the composition for suppressing liver injury of the present invention is not particularly limited. Such targets include healthy individuals or those who may require an effect of suppressing liver injury, preferably those who require an effect of suppressing liver injury. Specifically, those who require an effect of suppressing liver injury are those with high values of markers for evaluating cytotoxicity typified by LDH, ALT, and AST, those with a large amount of liver injury indicators leaked from hepatocytes in the blood, those diagnosed with fatty liver such as NAFLD or NASH, those suffering from diseases such as liver cirrhosis or liver cancer, and the like. Furthermore, animals other than humans in a similar state can also be targets for administration or ingestion.

[0021] (Method for suppressing liver injury) Since the present invention can suppress liver injury by administering or causing the above composition for suppressing liver injury of the present invention to be ingested by the above target, in other words, it is an invention of a method for suppressing liver injury by administering or causing the composition to be ingested. It is also an invention of a method for treating liver injury by administering or causing the above pharmaceutical for suppressing liver injury to be ingested. The method of administration or ingestion may be either oral or parenteral, but preferably oral. Examples and test examples are shown below to explain the present invention in detail, but the present invention is not limited thereto.

Examples

[0022] [Example 1] Preparation of a composition containing lactic acid bacteria cells belonging to Leuconostoc lactis, Lactobacillus reuteri, or Lactococcus lactis For Leuconostoc lactis SBT2561 (NITE P-02990) and Lentilactobacillus kefiri SBT2022 (NITE P-04023), MRS medium was used, and for Lactococcus laudensis SBT11178 (NITE P-03333), M17 medium (Difco) containing 10% lactose was used. The above lactic acid bacteria were activated by culturing them in their respective media at 37°C for 16 hours for 3 generations or more. These activated lactic acid bacteria were each inoculated into the same medium, cultured at 37°C for 16 hours, and then collected by centrifugation. After washing and collecting with physiological saline and deionized water, they were freeze-dried to obtain a composition containing each lactic acid bacterium cell (hereinafter, the composition containing lactic acid bacterium cells may be simply referred to as a lactic acid bacterium composition).

[0023] [Test Example 1] The inhibitory effects of each of the above lactic acid bacterium compositions on cell damage induced by fatty acid loading in hepatocytes were examined. 1. Test method 1-1. Cell culture method Human hepatocellular carcinoma-derived cell line HepG2 was 2×10 5Cells were seeded in a 24-well plate at a density of cells / well and cultured overnight in DMEM (manufactured by Nacalai Tesque) containing 10% FBS (manufactured by Gibco) and 1% penicillin-streptomycin (manufactured by Nacalai Tesque). After washing three times with FBS-free DMEM, the above-mentioned lactic acid bacteria composition suspended in sterile water was added to a fatty acid-stimulated medium (FBS-free DMEM medium, 1.5 mM BSA-bound fatty acids (1 mM oleic acid (sodium oleate, manufactured by Sigma), 0.5 mM palmitic acid (sodium palmitate, manufactured by Sigma), 0.058% BSA (manufactured by Wako Pure Chemical Industries, Ltd.)) at a concentration of 10 μg / mL, 20 μg / mL, or 40 μg / mL and cultured for 48 hours. As a control, a mixture of 0.58% BSA and sterile water was used instead of BSA-bound fatty acids and the lactic acid bacteria composition in the FBS-free DMEM medium. Thereafter, the culture supernatant was collected, and the activity of LDH leaked into the culture supernatant due to cell damage was measured using an LDH cytotoxicity assay kit (manufactured by Nacalai Tesque).

[0024] 2. Test Results The results are shown in Table 1. Each lactic acid bacteria composition of Leuconostoc lactis SBT2561, Lentilactobacillus kefiri SBT2022, and Lactococcus laudensis SBT11178 significantly suppressed the leakage of LDH into the culture supernatant associated with cell damage induced by fatty acids in hepatocytes.

[0025] [Table 1]

[0026] [Test Example 2] The promoting effect of each of the above lactic acid bacteria compositions on the expression of antioxidant-related genes was examined when cell damage was induced by fatty acid loading in hepatocytes. 1. Test Method HepG2 cells were seeded in 24-well plates and cultured in the same manner as in Test Example 1. Then, the medium was changed, and each lactic acid bacteria composition and fatty acid were used to treat the cells for 24 hours or 48 hours. Thereafter, total RNA was extracted from the cells using the Maxwell® RSC simplyRNA Tissue Kit (manufactured by Promega). The reverse transcription reaction was performed using ReverTra Ace qPCR RT Master Mix (manufactured by Toyobo). Using the obtained cDNA, real-time PCR was carried out with THUNDERBIRD Next qPCR Mix (manufactured by Toyobo) to quantify the expression levels of antioxidant-related genes (Catalase, HO-1, SOD1), fatty acid β-oxidation-related gene (CPT-1), and fatty acid synthesis-related gene (FAS). In addition, the expression level of the Cyplophilin gene was used as an internal standard for evaluating the gene expression level, and the following primers were used for the analysis. Catalase-F; CGGACATGGTCTGGGACTTC (SEQ ID NO: 1 in the Sequence Listing) Catalase-R; AATCCCCCGATCACTGAACA (SEQ ID NO: 2 in the Sequence Listing) HO-1-F; GGCCAGCAACAAAGTGCAAG (SEQ ID NO: 3 in the Sequence Listing) HO-1-R; TGGCATAAAGCCCTACAGCA (SEQ ID NO: 4 in the Sequence Listing) SOD1-F; CGTGGCCTAGCGAGTTATGG (SEQ ID NO: 5 in the Sequence Listing) SOD1-R; CCTTCTGCTCGAAATTGATGATG (SEQ ID NO: 6 in the Sequence Listing) CPT-1-F; CTCAGTGGGAGCGGATGTTTA (SEQ ID NO: 7 in the Sequence Listing) CPT-1-R; TCCTCGATGGTACACGACGAT (SEQ ID NO: 8 in the Sequence Listing) FAS-F; GCAAATTCGACCTTTCTCAGAAC (SEQ ID NO: 9 in the Sequence Listing) FAS-R; GGACCCCGTGGAATGTCA (SEQ ID NO: 10 in the Sequence Listing) Cyclophilin-F; GCGTCTCCTTTGAGCTGTTTG (SEQ ID NO: 11 in the Sequence Listing) Cyclophilin-R; ATCCTTTCTCTCCAGTGCTCAGA (Sequence Listing Sequence No. 12)

[0027] 2. Test Results The results are shown in Tables 2 to 6. Each lactic acid bacteria composition of Leuconostoc lactis SBT2561, Lentilactobacillus kefiri SBT2022, and Lactococcus laudensis SBT11178 significantly increased the expression of antioxidant-related genes (Catalase, HO-1, SOD1) when cell damage was induced by fatty acid loading in hepatocytes. In addition, the expression of the fatty acid β-oxidation-related gene (CPT-1) was also increased. Furthermore, the expression of the fatty acid synthesis-related gene (FAS) was suppressed.

[0028] [Table 2]

[0029] [Table 3]

[0030] [Table 4]

[0031] [Table 5]

[0032] [Table 6]

[0033] [Example 2] Using the same method as in Example 1, compositions containing cells of each of the lactic acid bacteria Leuconostoc lactis SBT2561, SBT0022, SBT0023, and Lentilactobacillus kefiri SBT2022, SBT2032, SBT1516 were obtained.

[0034] [Test Example 3] The inhibitory effects of each of the above lactic acid bacteria compositions on cell damage induced by fatty acid loading in hepatocytes were examined. 1. Test method HepG2 cells were cultured in the same manner as in Test Example 1, except that a fatty acid-stimulated medium containing each of the above lactic acid bacteria compositions at a concentration of 10 μg / mL, 25 μg / mL, or 50 μg / mL was used, and the activity of LDH leaked into the culture supernatant due to cell damage was measured.

[0035] 2. Test results The results are shown in Tables 7 and 8. Each of the lactic acid bacteria compositions of Leuconostoc lactis SBT2561, SBT0022, SBT0023, and Lentilactobacillus kefiri SBT2022, SBT2032, SBT1516 significantly suppressed the leakage of LDH into the culture supernatant associated with cell damage induced by fatty acids in hepatocytes.

[0036]

Table 7

[0037]

Table 8

[0038] [Test Example 4] The effects of each lactic acid bacterium composition of three strains of Leuconostoc lactis (SBT2561, SBT0022, SBT0023), three strains of Lentilactobacillus kefiri (SBT2022, SBT2032, SBT1516), and Lactococcus laudenensis SBT11178 on the amount of glutathione when cell damage was induced by fatty acid loading in hepatocytes were examined. 1. Test method HepG2 cells were cultured and cell damage was induced by the same method as in Test Example 1, except that a fatty acid-stimulated medium containing each of the above lactic acid bacterium compositions at a concentration of 50 μg / mL was used. Thereafter, a cell extract was prepared from the HepG2 cells in which cell damage was induced, and the amount of glutathione in the cells was measured using a glutathione quantification kit (manufactured by Dojindo Laboratories).

[0039] 2. Test results The results are shown in Table 9. Each lactic acid bacterium composition of three strains of Leuconostoc lactis (SBT2561, SBT0022, SBT0023), three strains of Lentilactobacillus kefiri (SBT2022, SBT2032, SBT1516), and Lactococcus laudenensis SBT11178 increased the amount of glutathione, which is an antioxidant, when cell damage was induced by fatty acid loading in hepatocytes.

[0040]

Table 9

[0041] (Deposit number) NITE P-02990 NITE P-04023 NITE P-03333

[0042] [Reference to deposited biological material] (1) SBT2561 (i) Name and address of the depository institution with which the biological material was deposited National Institute of Technology and Evaluation, Patent Microorganisms Depositary 2-5-8 Kazusa Kamashita, Kisarazu-shi, Chiba-ken 292-0818, Japan (ii) Date on which the biological material was deposited with the depository institution June 26, 2019 (iii) Accession number assigned by the depository institution for the deposit NITE-P 02990 (2)SBT2022 (i) Name and address of the depository institution with which the biological material was deposited National Institute of Technology and Evaluation, Patent Microorganisms Depositary 2-5-8 Kazusa Kamashita, Kisarazu-shi, Chiba-ken 292-0818, Japan (ii) Date on which the biological material was deposited with the depository institution November 29, 2023 (iii) Accession number assigned by the depository institution for the deposit NITE P-04023 (3)SBT11178 (i) Name and address of the depository institution with which the biological material was deposited National Institute of Technology and Evaluation, Patent Microorganisms Depositary 2-5-8 Kazusa Kamashita, Kisarazu-shi, Chiba-ken 292-0818, Japan (ii) Date on which the biological material was deposited with the depository institution December 1, 2020 (iii) Accession number assigned by the depository institution for the deposit NITE-P 03333

Claims

**Claim 1** A composition for suppressing liver injury, comprising at least one selected from the group consisting of lactic acid bacteria cells, cultures, cell-treated products, and culture supernatants as an active ingredient. **Claim 2** The composition for suppressing liver injury according to claim 1, wherein the lactic acid bacteria are at least one lactic acid bacteria belonging to a genus selected from the group consisting of the genus Leuconostoc, the genus Lentilactobacillus, and the genus Lactococcus. **Claim 3** The composition for suppressing liver injury according to claim 2, wherein the lactic acid bacteria belonging to the genus Leuconostoc is Leuconostoc lactis. **Claim 4** The composition for suppressing liver injury according to claim 2, wherein the lactic acid bacteria belonging to the genus Leuconostoc is Leuconostoc lactis SBT2561 strain (NITE P-02990). **Claim 5** The composition for suppressing liver injury according to claim 2, wherein the lactic acid bacteria belonging to the genus Lentilactobacillus is Lentilactobacillus kefiri. **Claim 6** The composition for suppressing liver injury according to claim 2, wherein the lactic acid bacteria belonging to the genus Lentilactobacillus is Lentilactobacillus kefiri SBT2022 strain (NITE P-04023). **Claim 7** The composition for suppressing liver injury according to claim 2, wherein the lactic acid bacteria belonging to the genus Lactococcus is Lactococcus laudenensis. **Claim 8** The composition for suppressing liver injury according to claim 2, wherein the lactic acid bacteria belonging to the genus Lactococcus is Lactococcus laudenensis SBT11178 strain (NITE P-03333). **Claim 9** The composition for suppressing liver injury according to any one of claims 1 to 8, wherein the suppression of liver injury is characterized by a reduction in cytotoxicity indicators. **Claim 10** The composition for suppressing liver injury according to any one of claims 1 to 8, wherein the suppression of liver injury is characterized by a reduction in oxidative stress. **Claim 11** The composition for suppressing liver injury according to any one of claims 1 to 8, wherein the suppression of liver injury is characterized by suppressing the accumulation of peroxides. **Claim 12** The liver injury inhibition is at least one selected from the group consisting of enhanced gene expression of antioxidant-related enzymes, enhanced activity of antioxidant-related enzymes, and increased amount of antioxidants, and the composition for inhibiting liver injury according to any one of claims 1 to 8.

13. The composition for inhibiting liver injury according to claim 12, wherein the antioxidant is glutathione.

14. The liver injury inhibition inhibits lipid accumulation in hepatocytes, and the composition for inhibiting liver injury according to any one of claims 1 to 8.

15. The liver injury inhibition inhibits the expression of lipid synthesis-related genes, and the composition for inhibiting liver injury according to any one of claims 1 to 8.

16. The liver injury inhibition enhances the expression of lipid oxidation-related genes, and the composition for inhibiting liver injury according to any one of claims 1 to 8.

17. A food or drink for inhibiting liver injury, a nutritional composition for inhibiting liver injury, a feed for inhibiting liver injury, or a pharmaceutical for inhibiting liver injury, comprising the composition for inhibiting liver injury according to any one of claims 1 to 8.

Citation Information

Patent Citations

  • Therapeutic agent of non-alcoholic fatty liver disease (NAFLD) and / or non-alcoholic steatohepatitis (NASH)

    JP2013133313A

  • Antioxidant composition

    JP2021147380A

  • Lipid metabolism-improving agent

    WO2011155518A1