Adeno-associated virus (AAV) producer cell line and related methods
Inducible promoter-controlled mammalian cell lines address the inefficiencies of current AAV production methods by enabling scalable and reproducible AAV manufacturing with reduced costs and contamination.
Patent Information
- Application Number
- JP2025039219
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2019-06-25
- Filing Date
- 2025-03-12
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2039-12-18
AI Technical Summary
Current methods for producing adeno-associated virus (AAV) are costly, labor-intensive, and require unstable helper viruses, posing contamination risks, necessitating the development of scalable and reproducible cell lines for AAV production.
Mammalian cell lines with inducible promoters control the expression of helper and AAV genes, using derepressible promoters and repression elements to regulate gene expression, minimizing contamination and reducing costs.
The method provides efficient, scalable, and cost-effective AAV production with reduced contamination risks, suitable for large-scale manufacturing and therapeutic applications.
Smart Images

Figure 2025102801000001_ABST
Abstract
Description
Technical Field
[0001] The present disclosure relates to mammalian cell lines for producing adeno-associated virus (AAV). The cells preferably contain nucleic acids encoding helper genes and AAV genes that are under the control of a derepressible promoter. The present disclosure also relates to isolated nucleic acid molecules encoding such genes, and methods of using mammalian cells for the production of AAV.
[0002] Sequence Listing This application includes a sequence listing that has been electronically submitted in ASCII format and is hereby incorporated by reference in its entirety. The above ASCII copy, created on December 17, 2019, is named 0132-0049WO1_SL.txt and is 364,567 bytes in size.
Background Art
[0003] Due to its safety profile and long-term expression ability, adeno-associated virus (AAV) is an excellent viral vector for gene therapy in humans. The wild-type AAV genome consists of 4.7 kb of single-stranded DNA containing regulatory genes for replication (Rep) and structural genes for the capsid (Cap) adjacent to the inverted terminal repeats (ITRs) for viral replication and packaging. As a dependent virus, AAV replication in host cells requires co-infection with helper viruses such as adenovirus (Ad) and herpes simplex virus. Alternatively, expression of cloning helper genes can also support AAV replication. For example, recombinant AAV can be produced in HEK293 cells by co-transfection of three plasmids: a pHelper plasmid expressing E2A, E4Orf6, and VA from adenovirus, a pRep-Cap plasmid for Rep and Cap proteins, and an AAV transfer plasmid carrying the desired gene of interest (GOI).
[0004] Currently, the production of AAV depends on several bridging platforms. In addition to the triple transfection in HEK293 cells described above, AAV can be produced by co-infecting insect cells with two baculoviruses that express Rep-Cap and GOI, respectively. However, these baculoviruses are unstable at higher passages and time-consuming to prepare (see, e.g., Urabe et al., “Insect Cells as a Factory to Produce Adeno-Associated Virus Type 2 Vectors,” Human Gene Therapy 13:1935-1943 (2002)). HeLa packaging cells with stably integrated Rep-Cap and GOI have also been developed. However, these systems still require wild-type adenovirus as a helper virus, which poses a risk of replication adenovirus contamination in AAV products (see, e.g., Robert et al., “Manufacturing of recombinant adeno-associated viruses using mammalian expression platforms,” Biotechnology Journal 12:1600193(1-16) (2017)).
[0005] There is a need for cell lines and related methods for producing AAV that are easily scalable to large-scale production in order to provide reproducible and stable results while limiting contamination and reducing costs. SUMMARY OF THE INVENTION
[0006] In some embodiments, provided herein are mammalian cells for producing adeno-associated virus (AAV) comprising a nucleic acid molecule encoding a viral helper gene under the control of a first inducible promoter, a nucleic acid molecule encoding an AAV gene under the control of a second inducible promoter, and a nucleic acid molecule encoding a repressor element for the first and second inducible promoters.
[0007] In a further embodiment, a mammalian cell for producing adeno-associated virus (AAV) is provided herein, the mammalian cell comprising a nucleic acid molecule encoding an adenovirus helper gene comprising the E2A gene and the E4Orf6 gene under the control of a first suppressible promoter, an AAV gene comprising the Rep gene and the Cap gene under the control of a second suppressible promoter, a virus-associated non-coding RNA under the control of a third suppressible promoter, two inverted terminal repeat (ITR) sequences, and suppressor elements for the first, second, and third suppressible promoters.
[0008] In a further embodiment, an isolated nucleic acid molecule is provided herein encoding an adenovirus helper gene comprising the E2A gene and the E4Orf6 gene under the control of a first suppressible promoter, an AAV gene comprising the Rep gene and the Cap gene under the control of a second suppressible promoter, a virus-associated non-coding RNA under the control of a third suppressible promoter, two inverted terminal repeat (ITR) sequences, and suppressor elements for the first, second, and third suppressible promoters.
[0009] In a further embodiment, a method of producing adeno-associated virus (AAV) in mammalian cells, comprising transfecting the mammalian cells with an isolated nucleic acid molecule encoding an adenovirus helper gene comprising an E2A gene and an E4Orf6 gene under the control of a first derepressible promoter, an AAV gene comprising a Rep gene and a Cap gene under the control of a second derepressible promoter, a viral-associated non-coding RNA under the control of a third repressible promoter, two inverted terminal repeat (ITR) sequences, and repression elements for the first, second, and third derepressible promoters; treating the mammalian cells with a binding partner of the repression element; activating the first, second, and third derepressible promoters; producing AAV; and recovering the AAV. A method is provided herein that includes the steps above.
[0010] In a further embodiment, a method of treating with adeno-associated virus (AAV), comprising transfecting the mammalian cells with an isolated nucleic acid molecule encoding an adenovirus helper gene comprising an E2A gene and an E4Orf6 gene under the control of a first derepressible promoter, an AAV gene comprising a Rep gene and a Cap gene under the control of a second derepressible promoter, a viral-associated non-coding RNA under the control of a third repressible promoter, two inverted terminal repeat (ITR) sequences, and repression elements for the first, second, and third derepressible promoters; treating the mammalian cells with a binding partner of the repression element; activating the first, second, and third derepressible promoters; producing AAV; recovering the AAV; and administering the AAV to a mammalian patient. A method is provided herein that includes the steps above.
[0011] In still further embodiments, a method of producing adeno-associated virus (AAV) is provided herein. The method comprises transfecting mammalian cells that stably express one or more nucleic acids encoding TetR and / or TetR-KRAB with a first nucleic acid encoding adenoviral helper genes including an E2A gene, an E4Orf gene, and a viral-associated non-coding RNA under the control of a first inducible promoter, a second nucleic acid encoding AAV genes including a Rep gene and a Cap gene under the control of a second inducible promoter, and optionally, a third nucleic acid encoding a gene of interest under the control of a third inducible promoter; treating the mammalian cells with a binding partner of TetR and / or TetR-KRAB; activating the first, second, and third inducible promoters; producing AAV; and recovering the AAV.
[0012] In still further embodiments, a method of producing adeno-associated virus (AAV) is provided herein. The method comprises stably transfecting mammalian cells with a nucleic acid encoding a TetR and / or TetR-KRAB repressor, a chicken hypersensitive site-4 (cHS4) sequence adjacent to the TetR and / or TetR-KRAB repressor, and a selectable gene; transfecting the stably transfected mammalian cells with a first nucleic acid encoding adenoviral helper genes including an E2A gene, an E4Orf gene, and a viral-associated non-coding RNA under the control of a first inducible promoter, a second nucleic acid encoding AAV genes including a Rep gene and a Cap gene under the control of a second inducible promoter, and optionally, a third nucleic acid encoding a gene of interest under the control of a third inducible promoter; treating the mammalian cells with a binding partner of TetR; activating the first, second, and third inducible promoters; producing AAV; and recovering the AAV.
Brief Description of the Drawings
[0013]
Figure 1
Figure 2A
Figure 2B
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7A
Figure 7B
Figure 8A
Figure 8B
Figure 9A
Figure 9B
Figure 10A
Figure 10B
Figure 10C
Figure 10D
Figure 11A
Figure 11B
Figure 11C
Figure 11D
Figure 11E
Figure 12A
Figure 12B
Best Mode for Carrying Out the Invention
[0014] The use of the words "a" or "an", when used in conjunction with the term "comprising" in the claims and / or the specification, may mean "one", but may also be consistent with the meaning of "one or more", "at least one", and "more than one".
[0015] Throughout this application, the term "about" is used to indicate that a value includes the inherent variability of error for the method / device used to determine that value. Typically, the term means including variations of less than about 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, or 20% depending on the circumstances.
[0016] The use of the term "or" in the claims is used to mean "and / or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, but this disclosure supports definitions that refer to alternatives only and "and / or".
[0017] As used in this specification and the claims, the terms "comprising" (and any form of "comprising", such as "comprise" and "comprises"), "having" (and any form of "having", such as "have" and "has"), "including" (and any form of "including", such as "includes" and "include"), or "containing" (and any form of "containing", such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed herein can be implemented with respect to any method, system, host cell, expression vector, and / or composition of the present invention. Further, the compositions, systems, cells, and / or nucleic acids of the present invention can be used to achieve any of the methods described herein.
[0018] Adeno-associated virus (AAV) has been used as a choice vector for gene therapy in over 120 clinical trials worldwide. The rapidly growing demand for recombinant AAV requires a very efficient and robust manufacturing platform. However, current methods for producing AAV, including transient transfection and helper virus systems, are very costly and require a large amount of labor. Provided herein are AAV-producing cell lines that do not contain plasmid / helper virus and methods of using the same, which provide efficient AAV production for long-term solutions at significantly reduced costs. The AAV-producing cell lines described herein represent the next-generation platform for both clinical and commercial AAV manufacturing.
[0019] Accordingly, in an embodiment, mammalian cells for producing adeno-associated virus (AAV) are provided herein.
[0020] As used herein, the term "mammalian cell" includes cells derived from any member of the mammalian order, such as, for example, human cells, mouse cells, rat cells, monkey cells, hamster cells, etc. In some embodiments, the cells are mouse cells, human cells, Chinese hamster ovary (CHO) cells, CHOK1 cells, CHO-DXB11 cells, CHO-DG44 cells, CHOK1SV cells (including all variants, e.g., POTELLIGENT®, Lonza, Slough, UK), CHOK1SV GS-KO (glutamine synthetase knockout) cells (including all variants, e.g., XCEED™, Lonza, Slough, UK). Exemplary human cells include human embryonic kidney (HEK) cells such as HEK293, HeLa cells, or HT1080 cells.
[0021] Mammalian cells include mammalian cell cultures, which can be either adherent cultures or suspension cultures. An adherent culture refers to cells that grow on a substrate surface, such as a plastic plate, dish, or other suitable cell culture growth platform, and may be attachment-dependent. A suspension culture refers to cells that can be maintained, for example, in a culture flask or large suspension tank that allows for a large surface area for gas and nutrient exchange. Suspension cell cultures often utilize agitation or a stirring mechanism to provide appropriate mixing. The media and conditions for maintaining cells in suspension are generally known in the art. Exemplary suspension cell cultures include human HEK293 clone cells.
[0022] As used herein, the term "adeno-associated virus (AAV)" refers to a small-sized replication-defective non-enveloped virus containing single-stranded DNA of the Parvoviridae family and Dependoparvovirus genus. More than 10 AAV serotypes have been identified to date, and serotype AAV2 has been the most well-characterized. Other non-limiting examples of AAV serotypes are AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, and AAV11. In addition to these serotypes, AAV pseudotypes have been developed. An AAV pseudotype contains the capsid of a first serotype and the genome of a second serotype (e.g., pseudotype AAV2 / 5 corresponds to an AAV having the genome of serotype AAV2 and the capsid of AAV5).
[0023] As referred to herein, the term "adenovirus" refers to a non-enveloped virus having an icosahedral nucleocapsid containing double-stranded DNA of the Adenoviridae family. More than 50 adenovirus subtypes have been isolated from humans, and many additional subtypes have been isolated from other mammals and birds. See, e.g., Ishibashi et al., “Adenoviruses of animals,” The Adenoviruses, Ginsberg, ed., Plenum Press, New York, N.Y., pp. 497-562 (1984), Strauss, “Adenovirus infections in humans,” The Adenoviruses, Ginsberg, ed., Plenum Press, New York, N.Y., pp. 451-596 (1984). These subtypes belong to the Adenoviridae family, which is currently divided into two genera, Mastadenovirus and Aviadenovirus. All adenoviruses are morphologically and structurally similar. However, in humans, adenoviruses exhibit different immunological properties and are thus classified into serotypes. Two human adenovirus serotypes, AV2 and AV5, have been extensively studied and provide most of the general information regarding adenoviruses.
[0024] In an embodiment, the mammalian cell provided herein preferably comprises a nucleic acid molecule encoding a viral helper gene under the control of a first derepressible promoter, a nucleic acid molecule encoding an AAV gene under the control of a second derepressible promoter, and a nucleic acid molecule encoding repression elements of the first and second derepressible promoters.
[0025] In an exemplary embodiment, nucleic acid molecules encoding various components for producing AAV are contained within a mammalian cell in separate nucleic acid molecules, such as separate plasmids or vectors. In other embodiments, nucleic acid molecules encoding various components for producing AAV are contained within the same plasmid or vector. In a further embodiment, certain components are contained within the same nucleic acid molecule (e.g., the helper gene and the AAV gene), and other genes are contained within separate nucleic acid molecules (e.g., the gene encoding the repression element).
[0026] "Nucleic acid", "nucleic acid molecule", or "oligonucleotide" means a polymeric compound containing covalently linked nucleotides. The term "nucleic acid" includes polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), both of which can be single-stranded or double-stranded. DNA includes, but is not limited to, complementary DNA (cDNA), genomic DNA, plasmid or vector DNA, and synthetic DNA. RNA includes, but is not limited to, mRNA, tRNA, rRNA, snRNA, microRNA, miRNA, or MIRNA.
[0027] In various embodiments described herein, the nucleic acid molecule can encode various genes. That is, the nucleic acid molecule, when transcribed, produces the mRNA of the genes described herein, which is then translated into the desired or necessary protein.
[0028] As described herein, preferably, the mammalian cell comprises a nucleic acid molecule encoding a viral helper gene. Viral helper genes include a variety of adenoviral genes, herpesviral genes, and bocaviral genes (e.g., Guido et al., “Human bocavirus: Current knowledge and future challenges,” World J. Gastroenterol 22:8684 - 8697, the disclosure of which is incorporated herein by reference in its entirety). In an exemplary embodiment, the viral helper gene is an adenoviral helper gene. As used herein, the term “adenoviral helper gene” or “AV helper gene” refers to a gene composed of one or more nucleic acid sequences derived from one or more adenoviral subtypes or serotypes that contribute to the replication and packaging of adeno - associated virus. In some embodiments, the adenoviral helper gene is E1A, E1B, E2A, E4 (including E4Orf6), VA, or a combination thereof, or any other adenoviral helper gene. In an exemplary embodiment, the adenoviral helper gene comprises both the E2A gene and the E4Orf6 gene. Preferably, an internal ribosome entry site (IRES) element is included between the E2A gene and the E4Orf6 gene. The IRES element initiates the translation of the E4Orf6 gene after the E2A gene in a single expression cassette and provides stability to the construct.
[0029] The various nucleic acid molecules encoding the various genes described herein are preferably under the control of a derepressible promoter. As used herein, "under the control of" refers to a gene being regulated by a "promoter", "promoter sequence", or "promoter region", which is a DNA regulatory region / sequence capable of binding RNA polymerase and initiating transcription of downstream coding or non-coding gene sequences. In other words, the promoter and the gene are in an operable combination or are operably linked. As referred to herein, the terms "in an operable combination", "in an operable order", and "operably linked" refer to the linkage of nucleic acid sequences in such a manner that a promoter capable of directing the transcription of a given gene and / or the synthesis of a desired protein molecule is produced. This term also refers to the linkage of amino acid sequences in such a manner that a functional protein is produced.
[0030] In some examples of the present disclosure, the promoter sequence includes the transcription start site and extends upstream to include the minimum number of bases or elements necessary to initiate transcription at a detectable level above background. In some embodiments, the promoter sequence includes the transcription start site and a protein binding domain involved in the binding of RNA polymerase. Eukaryotic promoters often, but not necessarily, contain a "TATA" box and a "CAT" box. Various promoters, including inducible promoters, can be used, for example, to drive gene expression in the host cells or vectors of the present disclosure. In some embodiments, the promoter is not a leaky promoter, i.e., the promoter does not constitutively express any of the gene products described herein. In other embodiments described herein, the promoter is a constitutive promoter that initiates mRNA synthesis independent of external regulation.
[0031] Suitably, the promoter used to control the transcription of various genes for producing the AAVs described herein is a derepressible promoter. As used herein, a "derepressible promoter" refers to a structure comprising a functional promoter and additional elements or sequences that can bind to a repressor element and cause repression of the functional promoter. "Repression" refers to a reduction or inhibition of the initiation of transcription of downstream coding or non-coding gene sequences by the promoter. A "repressor element" refers to a protein or polypeptide that can bind to the promoter (or near the promoter) to reduce or inhibit the activity of the promoter. The repressor element can interact with a substrate or binding partner of the repressor element such that the repressor element undergoes a conformational change. This conformational change of the repressor element results in "derepression" of the promoter by eliminating the ability of the repressor element to reduce or inhibit the promoter, thereby enabling the promoter to proceed with transcription initiation. A "functional promoter" refers to a promoter that is capable of initiating transcription in the absence of the action of a repressor element. Various functional promoters that can be used in the practice of the present invention are known in the art and include, for example, P CMV , P H1 , P19, P5, P40, and the promoters of adenoviral helper genes (e.g., E1A, E1B, E2A, E4Orf6, and VA).
[0032] Exemplary repression elements that can be used as inducible promoters and their corresponding binding partners are known in the art and include systems such as the cumate gene switch system (CuO operator, CymR repressor, and cumate binding partner) (e.g., Mullick et al., “The cumate gene-switch: a system for regulated expression in mammalian cells,” BMC Biotechnology 6:43 (1-18) (2006) (the disclosure of which is incorporated herein by reference in its entirety), including the disclosure of the inducible promoter system described therein), and the TetO / TetR system described herein (e.g., Yao et al., “Tetracycline Repressor, TetR, rather than the tetR-Mammalian Cell Transcription Factor Fusion Derivatives, Regulates Inducible Gene Expression in Mammalian Cells,” Human Gene Therapy 9:1939-1950 (1998) (the disclosure of which is incorporated herein by reference in its entirety).
[0033] In an exemplary embodiment, the inducible promoter comprises a functional promoter and two tetracycline operator sequences (TetO2). A schematic diagram showing an exemplary repressible promoter system is provided in FIG. 1. P CMV An inducible promoter comprising a promoter, and P H1 An inducible promoter comprising a promoter is shown, both of which include two TetO sequences (TetO2). As shown, when two tetracycline repressor proteins (the repression element of the TetR-TetO2 sequence) bind to the TetO2 sequence, P CMV The promoter and P H1Both promoters are repressed. That is, transcription from these promoters hardly or not at all occurs. When the binding partner of TetR (preferably doxycycline (Dox)) binds, the TetR protein changes conformation, is released from the TetO2 sequence, and the functional promoters initiate their normal transcription process as they do naturally. As schematically illustrated in FIG. 1, this results in a change in the whole system from the "off" position (preferably P CMV promoter and P H1 promoter, from which transcription is not occurring) to the "on" position when Dox is added, and P CMV promoter and P H1 promoter can return to their natural state of transcribing the genes under their control.
[0034] For example, as shown in FIG. 1, the P CMV promoter having a TetO2 sequence (preferably the pcDNA4 / TO promoter; INVITROGEN®) is in the "off" position when bound by TetR. When Dox is added, TetR changes conformation and is released from the TetO2 sequence of the repressible promoter, and the P CMV promoter proceeds to transcribe adenovirus helper genes (such as E2A and E4).
[0035] As described herein and as illustrated in FIG. 1, mammalian cells can further comprise a nucleic acid encoding a virus-associated (VA) non-coding RNA under the control of a fourth derepressible promoter. As shown in FIG. 1, this derepressible promoter is the functional promoter P H1and can include a TetO2 sequence that controls the expression of non-coding RNA (see, for example, Wiederschain et al., “Single-vector inducible lentiviral RNAi system for oncology target validation, Cell Cycle 8:498-504 (2009) (the disclosure of which, including the disclosure of the promoter system and sequences, is incorporated herein by reference in its entirety)). As shown in FIG. 1, the P H1 promoter is in the “off” position when bound by TetR. When Dox is added, TetR changes conformation and releases from the TetO2 sequence of the suppressible promoter, and the P H1 promoter proceeds to transcribe VA1 non-coding RNA.
[0036] FIG. 2A shows exemplary nucleic acid molecules that can be utilized in the various mammalian cells and methods described herein. As illustrated, the CMV promoter is used upstream of both the E2A gene and the E4Orf6 gene linked via an IRES element. The CMV promoter includes a CMV enhancer and a tet operator (TetO2) for control by derepression. An exemplary position of the H1 promoter, which also includes a TetO2 sequence that controls the expression of VA non-coding RNA, is also illustrated in FIG. 2A.
[0037] Figures 1 and 2A also illustrate that, in an embodiment, a mammalian cell can include a repression element under the control of a constitutive promoter. As described herein, preferably, the repression element encoded is the tetracycline repressor protein (TetR). As illustrated in Figures 1 and 2A, a promoter suitable for expression of the repression element is the hPGK promoter. By placing the repression element under the control of a constitutive promoter, production of the repression element, preferably TetR, is always active. That is, TetR is produced when a nucleic acid molecule is introduced into a mammalian cell. This provides tight control of various derepressible promoters that are repressed by binding of TetR to the TetO2 sequence.
[0038] As shown in Figure 2A, in an exemplary embodiment, a nucleic acid encoding a tetracycline repressor protein and a nucleic acid encoding a transcriptional repression domain in-frame therewith can be derived. In Figure 2A, this transcriptional repression domain is a Krueppel-associated box (KRAB) sequence fused in-frame to the C-terminus of TetR (see, for example, Szulc et al., “A versatile tool for conditional gene expression and knockdown,” Nature Methods 3:109-116 (2006)). Use of the KRAB sequence or other transcriptional repression domains improves the repression activity of TetR when bound to TetO2, thereby minimizing leakage or the amount of basal gene expression before derepression (i.e., before addition of Dox). Figures 2B and 12A show exemplary nucleic acid molecules lacking the KRAB sequence.
[0039] As shown in FIG. 12A, in an exemplary embodiment, the nucleic acid encoding the tetracycline repressor protein can be contained within or stably expressed in mammalian cells. In FIGS. 2A and 12B, this transcriptional repression domain is a Krueppel-associated box (KRAB) sequence fused in-frame to the C-terminus of TetR (see, e.g., Szulc et al., “A versatile tool for conditional gene expression and knockdown,” Nature Methods 3:109-116 (2006)). The use of the KRAB sequence or other transcriptional repression domains improves the repression activity of TetR when bound to TetO2, thereby minimizing read-through or basal gene expression levels prior to derepression (i.e., prior to addition of Dox). FIGS. 2B and 12A show exemplary nucleic acid molecules lacking the KRAB sequence.
[0040] In embodiments, the AAV genes encoded by the nucleic acid molecule include the Rep gene and the Cap gene. Other AAV genes that can be encoded by the nucleic acid molecule include any gene from any AAV serotype. In some embodiments, the AAV genes are Rep78, Rep68, Rep52, Rep40, VP1, VP2, VP3, or combinations thereof. In some embodiments, the AAV genes are from adeno-associated virus type 2. In some embodiments, the AAV genes are from adeno-associated virus Anc80.
[0041] As used herein, the term "Rep" gene refers to an AAV genomic region recognized in the art that encodes viral replication proteins required together to replicate the viral genome, or a functional homolog thereof, e.g., the human herpesvirus 6 (HHV-6) rep gene, which is also known to mediate AAV-2 DNA replication. Thus, the rep coding region can include genes encoding AAV Rep78 and Rep68 ("long forms of Rep") and Rep52 and Rep40 ("short forms of Rep"), or functional homologs thereof. The rep coding region, as used herein, can be derived from any viral serotype, such as the AAV serotypes described herein. The region need not include all of the wild-type gene, but may be modified (e.g., by nucleotide insertion, deletion, or substitution) so long as the rep gene present provides sufficient integration function when expressed in a suitable target cell. See, e.g., Muzyczka, N., Current Topics in Microbiol. and Immunol. 158:97-129 (1992) and Kotin, R.M., Human Gene Therapy 5:793-801 (1994).
[0042] As used herein, the term "Cap" gene refers to an AAV genomic region recognized in the art that encodes the viral capsid proteins. Exemplary (non-limiting) examples of these capsid proteins are the AAV capsid proteins VP1, VP2, and VP3. The Cap gene used in the present disclosure can be derived from any AAV serotype or combination of AAV serotypes.
[0043] Figure 4A shows the native location and promoter drive of the Rep and Cap genes. As is known in the art, in order to successfully produce AAV, it is necessary to maintain the ratio of the Rep78 gene and the Rep52 gene at an optimal level. For example, as discussed in “Role for Highly Regulated rep Gene Expression in Adeno-Associated Virus Vector Production,” Journal of Virology 71:5236-5243 (1997) (the disclosure of which is incorporated herein by reference in its entirety), DNA replication can be inhibited by controlling the production level of Rep78. Furthermore, Rep78 can be toxic when overproduced in mammalian cells. See, for example, Clark et al., “Cell Lines for the Production of Recombinant Adeno-Associated Virus,” Human Gene Therapy 6:1329-1341 (1995) (the disclosure of which is incorporated herein by reference in its entirety), which discusses that high rep protein levels can be associated with cytotoxicity. The position of the promoter (p19) for Rep52 expression is also located within the coding region of Rep78. As described herein, various modifications are made to the native location of the Rep gene and the promoter to overcome these problems.
[0044] In an exemplary embodiment, the mammalian cell can comprise a nucleic acid encoding a Rep78 gene under the control of a second inducible promoter and a Rep52 gene under the control of a third inducible promoter. As shown in FIG. 4B, one way to achieve this arrangement is to remove the Rep52 gene from within the Rep78 gene and place it downstream of the Rep78 gene and the Cap gene. The Rep78 gene can be under the control of an inducible promoter (p5) that includes a TetO2 sequence. In such an embodiment, the native p19 promoter within Rep78 is modified or mutated to be silenced. The removed Rep52 gene is also placed under the control of an inducible promoter (p19) that includes a TetO2 sequence.
[0045] FIG. 5 shows three potential positions for each of the TetO sequences relative to the TATA box, rep binding element (RBE), and initiation element (INR) for modifying the p5 promoter of Rep78. The wild-type P5 promoter is also schematically illustrated. FIG. 6 shows three potential positions for each of the TetO sequences relative to the TATA box and the Sp1 transcription factor of the p19 promoter of Rep52. The wild-type P19 promoter is also illustrated. Additional positions of the TetO sequence are also included herein and can be readily envisioned by one of ordinary skill in the art.
[0046] In yet further embodiments, the Rep78 gene can be under the control of a derepressible promoter, and the Rep52 gene can be under the control of a derepressible promoter contained within an artificial intron. Such an embodiment is illustrated in FIG. 4C. As illustrated, a derepressible p5 promoter (e.g., including the TetO2 sequence described herein) is positioned upstream of the Rep78 gene. A derepressible p19 promoter (e.g., including the TetO2 sequence) contained within an intron (designated In-i-p19) controls the expression of Rep52. A schematic of this embodiment is provided in FIG. 7A, where two tet operator sequences are illustrated within the chimeric intron. This chimeric intron can be inserted at various positions relative to the components of the p19 promoter. For example, as shown in FIG. 7B, the intron sequence is preferably positioned downstream of TATA-2 of the p19 promoter. The spacing can be, for example, about 1 to 25 base pairs downstream from the TATA-2 sequence.
[0047] As described herein, in an exemplary embodiment, the Cap gene encoded by the nucleic acid molecule is preferably under the control of a native promoter. That is, the Cap gene need not be under the control of a derepressible promoter, but a derepressible promoter can be used if desired. In a preferred embodiment, the Cap gene is under the control of the p40 promoter.
[0048] In an exemplary embodiment, the nucleic acid molecule includes two inverted terminal repeat (ITR) sequences. As is known in the art, these ITR sequences (i.e., AAV2 ITRs) have, following a single-stranded sequence of nucleotides, its reverse complement downstream. The ITR sequences represent the minimal sequences required for replication, rescue, packaging, and integration of the AAV genome. Preferably, these ITR sequences flank the gene of interest. Thus, in an embodiment, the nucleic acid molecule further encodes a gene of interest. This gene of interest can be, for example, a reporter gene, a selectable gene, or a gene for therapeutic purposes.
[0049] For example, as shown in FIG. 10C, a target gene such as a gene encoding green fluorescent protein (EGFP) is adjacent to two ITR sequences.
[0050] "Gene" refers to an assembly of nucleotides encoding a polypeptide and includes cDNA and genomic DNA nucleic acid molecules. "Gene" also refers to a nucleic acid fragment that can function as regulatory sequences before (5' non-coding sequence) and after (3' non-coding sequence) the coding sequence. In some embodiments, the gene is integrated in multiple copies. In some embodiments, the gene is integrated at a predetermined copy number.
[0051] As used herein, the terms "target gene" or "GOI" are used to describe a heterologous gene. As used herein, the terms "heterologous gene" or "HG" refer to a nucleic acid sequence, such as a coding sequence or a control sequence, that is not normally ligated together and / or is not normally associated with a particular cell when related to the nucleic acid sequence. In some embodiments, the heterologous gene is a construct (e.g., a synthetic sequence having codons different from a natural gene) in which the coding sequence itself is not found in nature. Allelic mutations or naturally occurring mutational events do not give rise to heterologous DNA as used herein.
[0052] As used herein, a "reporter gene" is a gene whose expression confers a phenotype on a cell that can be easily identified and measured. In some embodiments, the reporter gene includes a fluorescent protein gene. In some embodiments, the reporter gene includes a selectable gene.
[0053] As used herein, the term "selectable gene" refers to the use of a gene encoding an enzymatic activity that confers the ability to grow in a medium lacking what would otherwise be an essential nutrient, and further, a selectable gene can confer resistance to an antibiotic or drug to the cell in which the selectable gene is expressed. A selectable gene may be used to confer a particular phenotype on a host cell. When a host cell needs to express a selectable gene in order to grow in a selective medium, the gene is said to be a positive selectable gene. A selectable gene can also be used to select against host cells containing a particular gene. A selectable gene used in this manner is referred to as a negative selectable gene.
[0054] As used herein, the term "gene for therapeutic purposes" refers to any functionally related nucleotide sequence. Thus, the genes for therapeutic purposes of the present disclosure can include any desired gene that encodes a protein that is missing or lost from the target cell genome, or encodes a non-natural protein having a desired biological or therapeutic effect (e.g., an antiviral function), or the sequence can correspond to a molecule having an antisense or ribozyme function. Representative (non-limiting) examples of suitable genes for therapeutic purposes include inflammatory diseases, autoimmune diseases, chronic diseases, and infectious diseases, including disorders such as AIDS, cancer, neurological diseases, cardiovascular diseases, hypercholesterolemia, etc.; various blood disorders, including various anemias, thalassemia, and hemophilia; those used for the treatment of genetic defects such as cystic fibrosis, Gaucher's disease, adenosine deaminase (ADA) deficiency, and emphysema. Some antisense oligonucleotides useful for antisense therapy of cancer and viral diseases (e.g., short oligonucleotides complementary to sequences around the translation initiation site (AUG codon) of mRNA) have been described in the art and are also examples of suitable genes for therapeutic purposes.
[0055] In some embodiments, the mammalian cells provided herein are substantially free of helper virus. As used herein, "helper virus" is any non-AAV virus added to enable the replication and packaging of adeno-associated virus. Representative (non-limiting) examples of helper viruses are adenovirus and herpesvirus. In some embodiments, the term substantially free of helper virus refers to cells having less than 100, less than 10, or less than 1 helper virus per cell. In some embodiments, the term substantially free of helper virus refers to cells or cell populations in which no helper virus is present, as detected using methods known to those of skill in the art. In some embodiments, wild-type helper virus is not present in the cells. In some embodiments, the term wild-type virus refers to any fully non-AAV virus that can replicate in cells independently of any other virus.
[0056] The AAV-producing cells described herein provide a long-term and cost-effective solution for large-scale AAV production. Since constitutive expression of either the helper protein or the Rep protein can be cytotoxic, the strategies described herein enable the control of their expression by engineered inducible promoters.
[0057] In a further embodiment, provided herein is a mammalian cell for producing adeno-associated virus (AAV), which contains, in a single nucleic acid molecule, an adenovirus helper gene containing an E2A gene and an E4Orf6 gene under the control of a first derepressible promoter, an AAV gene containing a Rep gene and a Cap gene under the control of a second derepressible promoter, a viral-associated non-coding RNA under the control of a third suppressible promoter, two inverted terminal repeat (ITR) sequences, and repression elements for the first, second, and third derepressible promoters. In such an embodiment, this single nucleic acid molecule contains all the various sequences together with other necessary elements to enable the production of AAV within the cell.
[0058] Figures 10A and 10B show exemplary nucleic acid molecules containing these various sequences that can be utilized in mammalian cells for producing AAV.
[0059] As described herein, preferably, the mammalian cell is a mammalian cell culture, and in an embodiment, it can be a suspension culture. As described herein, the use of suspension cell cultures enables the scale-up and increased production of AAV.
[0060] As described herein and as shown in FIGS. 1, 2A - 2B, and 10A - 10B, preferably, the single nucleic acid molecule contains an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.
[0061] Various constructs for encoding Rep genes and Cap genes, including Rep78 and Rep52 genes, are described herein. In embodiments, the Rep78 gene is under the control of a second derepressible promoter, and the Rep52 gene is under the control of a fourth derepressible promoter (e.g., as shown in FIG. 4B, the Rep52 gene is separate from the Rep78 gene). In further embodiments, for example, as described herein with reference to FIGS. 4C and 7A-7B, the Rep78 gene can be placed under the control of a second derepressible promoter, and the Rep52 gene can be placed under the control of a fourth derepressible promoter contained within an artificial intron. Preferably, the Cap gene is under the control of a native promoter.
[0062] Various derepressible promoters are described herein. In embodiments, the derepressible promoter includes a functional promoter and two tetracycline operator sequences (TetO2). In embodiments, the functional promoter of the first derepressible promoter (i.e., controlling the expression of adenovirus helper genes including the E2A gene and the E4Orf6 gene) is the cytomegalovirus (CMV) promoter.
[0063] In an embodiment, as described herein and as illustrated in FIGS. 1, 2A-2B, and 10A-10D, preferably, the repressor element of the repressible promoter is under the control of the repressible promoter so as to always be produced and restrict the expression of other genes under the control of the constitutive promoter. Preferably, the encoded repressor element is a tetracycline repressor protein that binds to the TetO2 sequence and functions as a repressible promoter. In an embodiment, for example, as shown in FIGS. 2A, 10A, and 10C, a nucleic acid encoding a transcriptional repression domain (e.g., the KRAB sequence) is included in-frame with the nucleic acid encoding the tetracycline repressor protein. This transcriptional repression domain provides an improved repression activity of TetR when bound to TetO2, thereby minimizing the amount of read-through or basal gene expression prior to derepression.
[0064] Exemplary mammalian cells that can be used in the embodiments and methods described herein are described throughout and include, for example, Chinese hamster ovary (CHO) cells and human cells including human embryonic kidney (HEK, e.g., HEK293) cells.
[0065] As described herein, preferably, the mammalian cell further comprises a nucleic acid molecule encoding a gene of interest (GOI). Preferably, as shown in FIGS. 10C-10D, the GOI is included between two ITR sequences.
[0066] Also provided herein is an isolated nucleic acid molecule encoding an adenovirus helper gene comprising the E2A gene and the E4Orf6 gene under the control of a first repressible promoter, an AAV gene comprising the Rep gene and the Cap gene under the control of a second repressible promoter, a viral-associated non-coding RNA under the control of a third suppressible promoter, two inverted terminal repeat (ITR) sequences, and repressor elements of the first, second, and third repressible promoters.
[0067] As used herein, an "isolated nucleic acid molecule" can include vectors and plasmids that can contain the isolated nucleic acid molecule, as well as similar structures that can be manipulated, stored, shipped, and ultimately utilized in various cell transfection systems. The isolated nucleic acid molecules described herein can be used for the production of the AAVs described herein, but can also be utilized in a variety of non-AAV producing cell lines (including transient transfection systems). The isolated nucleic acid molecules described herein preferably further include various additional elements and sequences necessary to enable their use in cell lines, including the mammalian cells described herein.
[0068] For example, as shown in FIGS. 10A - 10B, two plasmid constructs are shown. As shown, in an embodiment, an internal ribosome entry site (IRES) element can be included between the E2A gene and the E4Orf6 gene. As described herein with reference to FIG. 4B, in an embodiment, the Rep78 gene is under the control of a second inducible promoter and the Rep52 gene is under the control of a fourth inducible promoter (i.e., separated from the Rep52 gene).
[0069] In a further embodiment, as shown with reference to FIGS. 10A - 10B, the Rep78 gene is under the control of an inducible promoter (the ip5 promoter shown in FIG. 5 and various repeats described in FIG. 5), and the Rep52 gene is under the control of a fourth inducible promoter contained within an artificial intron, illustrated as ip19 and described with reference to FIGS. 7A - 7B. The isolated nucleic acid preferably further includes a Cap gene under the control of a native promoter (i.e., p40).
[0070] As described herein, various inducible promoters can be included in an isolated nucleic acid molecule, preferably comprising a functional promoter and two tetracycline operator sequences (TetO2). As shown in FIGS. 10A and 10B, with respect to the helper genes E2 and E4, preferably, this functional promoter is a CMV promoter containing the TetO2 sequence. The inducible promoter for use with viral-related non-coding RNAs preferably comprises the H1 promoter and the TetO2 sequence.
[0071] As described herein, and as shown in FIGS. 10A and 10B, the repressor element (e.g., tetracycline repressor protein) is preferably under the control of a constitutive promoter, such as the hPGK promoter. As shown in FIGS. 10A and 12B, the isolated nucleic acid molecule can further comprise a nucleic acid encoding a transcriptional repression domain (e.g., the KRAB sequence) in-frame with a nucleic acid encoding a tetracycline repressor protein. As shown in FIGS. 10C - 10D and 11B, the isolated nucleic acid molecule can preferably further comprise a gene of interest (GOI, e.g., GFP) between two ITR sequences.
[0072] As described herein, and as shown in FIGS. 12A - 12B, the repressor element is preferably adjacent to an insulator, such as the chicken hypersensitive site - 4 (cHS4) sequence.
[0073] In an embodiment, a nucleic acid encoding a transcriptional repression domain (such as KRAB, etc.) is included in-frame with a nucleic acid encoding a tetracycline repressor protein (e.g., TetR - KRAB).
[0074] Additional genetic elements and sequence elements for inclusion in the isolated nucleic acid molecules described herein are known in the art and can be illustrated in FIGS. 10A - 10D and FIGS. 11A - 11E.
[0075] The term "sequence identity" or "% identity" in the context of the nucleic acid sequences described herein refers to the percentage of residues in a comparison sequence that are the same when the sequences are aligned in a specified comparison window. The comparison window can be a segment of at least 10 to over 1000 residues that can be aligned to compare the sequences. Alignment methods for determining sequence identity are well known and can be performed using publicly available databases such as BLAST (blast.ncbi.nlm.nih.gov / Blast.CGI.).
[0076] In some embodiments, the nucleic acid molecules each have at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity with a reference nucleic acid molecule (or a fragment of a reference polypeptide or reference nucleic acid molecule). In certain embodiments of the present disclosure, the polypeptide or nucleic acid molecule each has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99%, or 100% sequence identity with a reference nucleic acid molecule (or a fragment of a reference nucleic acid molecule). In some embodiments, the nucleic acid molecules each have about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5% sequence identity with a reference nucleic acid molecule.
[0077] "Vector" or "expression vector" refers to a replicon such as a plasmid, phage, virus, or cosmid to which the nucleic acid molecules described herein can be ligated to effect replication and / or expression of the ligated nucleic acid molecule in a cell. "Vector" includes episomes (e.g., plasmids) and non-episomal vectors. The term "vector" includes both viral and non-viral means for introducing nucleic acid molecules into cells in vitro, in vivo, or ex vivo. The term "vector" may include synthetic vectors. A vector may be introduced into a desired host cell by well-known methods including, but not limited to, transfection, transduction, cell fusion, and lipofection. A vector can include various regulatory elements including a promoter.
[0078] Also provided herein is a method for producing adeno-associated virus (AAV) in mammalian cells. Preferably, the method described herein comprises transfecting a mammalian cell with an isolated nucleic acid molecule encoding an adenovirus helper gene comprising the E2A gene and the E4Orf6 gene under the control of a first derepressible promoter, an AAV gene comprising the Rep gene and the Cap gene under the control of a second derepressible promoter, a viral-associated non-coding RNA under the control of a third suppressible promoter, two inverted terminal repeat (ITR) sequences, and repression elements for the first, second, and third derepressible promoters.
[0079] As used herein, "transfection" means introducing an exogenous nucleic acid molecule containing a vector into a cell. A "transfected" cell contains an exogenous nucleic acid molecule within the cell, and a "transformed" cell is one in which the exogenous nucleic acid molecule within the cell induces a phenotypic change within the cell. The transfected nucleic acid molecule can be integrated into the genomic DNA of the host cell and / or can be maintained transiently or extrachromosomally for an extended period by the cell. A host cell or organism that expresses an exogenous nucleic acid molecule or fragment is referred to as a "recombinant", "transformed", or "transgenic" organism. Many transfection techniques are generally known in the art. See, for example, Graham et al., Virology, 52:456 (1973), Sambrook et al., Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York (1989), Davis et al., Basic Methods in Molecular Biology, Elsevier (1986) and Chu et al., Gene 13:197 (1981). Using such techniques, one or more exogenous DNA moieties, such as an AAV vector cassette, an AAV helper construct, and other nucleic acid molecules, can be introduced into a suitable host cell.
[0080] Various methods for transfecting mammalian cells with the isolated nucleic acid molecules (i.e., vectors) described herein are known in the art and include various chemical and physical methods such as electroporation, cell injection, calcium phosphate exposure, liposome or polymer-based carrier systems, and the like.
[0081] In an exemplary embodiment, for stable integration of these nucleic acid molecules, vectors such as the PIGGYBAC™ transposon can be used, whereby it becomes possible to randomly insert a large nucleic acid sequence into multiple copies in the cell genome in one step. This system consists of a PIGGYBAC™ vector and a Super PIGGYBAC™ transposase that recognize transposon-specific inverted terminal repeats (ITRs) and efficiently integrate the ITRs and intervening DNA into the genome at TTAA sites. The Super PIGGYBAC™ transposase is delivered to the cell via a Super PIGGYBAC™ transposase expression vector co-transfected with one or more PIGGYBAC™ vectors.
[0082] The method further comprises treating the mammalian cells with a binding partner of the repressor element. As described herein, in the presence of the repressor element, the functional promoter of an inducible promoter that controls the transcription of various genes encoded by the nucleic acid molecule is repressed. That is, the gene is not actively transcribed but instead awaits de-repression. As described herein, the repressor element of the inducible promoter is preferably under the control of a constitutive promoter such that the repressor element is produced immediately after transfection of the nucleic acid molecule into the mammalian cells. When treated with a binding partner of the repressor element, the repressor element binds to the binding partner, changes conformation, and no longer represses the inducible promoter. Thereby, the first, second, and third (and additional as needed) inducible promoters (i.e., the functional promoters of the inducible promoters) in the mammalian cells are activated.
[0083] After activation, various elements are transcribed and translated in the mammalian cells, resulting in the production of AAV. The AAV is then recovered using methods known in the art.
[0084] The method described herein can be utilized in any mammalian cells, including mammalian cell cultures, and preferably, the mammalian cell culture is a suspension culture containing human cells such as HEK suspension cell cultures.
[0085] As described throughout, the nucleic acid molecule may further comprise an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene. Exemplary constructs related to the Rep78 and Rep52 genes are described herein, including the case where the Rep78 gene is under the control of a second inducible promoter and the Rep52 gene is under the control of a fourth inducible promoter. In additional embodiments of the method, the Rep78 gene is under the control of a second inducible promoter and the Rep52 gene is under the control of a fourth inducible promoter contained within an artificial intron.
[0086] As described herein, the use of an artificial intron allows for the removal of the fourth inducible promoter after activation of the inducible promoter and prior to AAV production. As described herein, the inducible promoter within the intron ensures repression of Rep52 gene expression prior to activation and also allows for expression of the Rep78 protein after removal of the intron during mRNA splicing. In an exemplary embodiment of the method, the Cap gene is under the control of a native promoter such as p40.
[0087] In an embodiment, the functional promoter of the inducible promoter controlling the expression of the helper gene is the cytomegalovirus (CMV) promoter. Preferably, in the method described herein, the encoded repressor element is the tetracycline repressor protein, and preferably, the inducible promoter comprises a functional promoter and two tetracycline operator sequences (TetO2). In an embodiment, the repressor element is under the control of a constitutive promoter such as hPGK, for example, when the encoded repressor element is the tetracycline repressor protein.
[0088] As described herein, in embodiments utilizing TetR and / or TetR-KRAB repression elements, treatment of cells with doxycycline changes the conformation of TetR and activates the transcription of various genes.
[0089] In the methods described herein, various mammalian cells can be utilized, including human cells such as human embryonic kidney (HEK) cells or other mammalian cells including Chinese hamster ovary (CHO) cells.
[0090] As described throughout, in embodiments, AAV comprises a nucleic acid molecule encoding a gene of interest. This GOI can be any other gene of interest, including a reporter gene, a selectable gene, or a gene for therapeutic purposes.
[0091] The method for producing AAV can be used in a continuous manufacturing system. In an exemplary embodiment, the use of suspension cell cultures enables the large-scale production of AAV under high productivity and long-term culture conditions, and enables the multiple recovery of AAV for each batch of starting cells.
[0092] The manufacturing method can utilize any suitable reactor, including but not limited to a stirred tank, a bubble pump, fibers, microfibers, hollow fibers, a ceramic matrix, a fluidized bed, a fixed bed, and / or a spouted bed bioreactor. As used herein, a "reactor" can include a fermenter or fermentation unit, or any other reaction vessel, and the term "reactor" is used synonymously with "fermenter". The term fermenter or fermentation refers to both microbial cultures and mammalian cultures. For example, in some embodiments, an exemplary bioreactor unit can perform one or more or all of the following: supply of nutrients and / or carbon source, injection of a suitable gas (e.g., oxygen), inflow and outflow of the fermentation or cell culture medium, separation of the gas phase and the liquid phase, maintenance of temperature, maintenance of oxygen and CO2 levels, maintenance of pH level, agitation (e.g., stirring), and / or washing / sterilization. An exemplary reactor unit such as a fermentation unit may include a plurality of reactors within the unit. For example, the unit may have 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 or more bioreactors within each unit, and / or the facility may include a plurality of units having a single or multiple reactors within the facility. In various embodiments, the bioreactor may be suitable for batch, semi-batch, fed-batch, perfusion, and / or continuous fermentation processes. Any suitable reactor diameter can be used. In embodiments, the bioreactor can have a volume of about 100 mL to about 50,000 L.Non-limiting examples include volumes of 100 mL, 250 mL, 500 mL, 750 mL, 1 liter, 2 liters, 3 liters, 4 liters, 5 liters, 6 liters, 7 liters, 8 liters, 9 liters, 10 liters, 15 liters, 20 liters, 25 liters, 30 liters, 40 liters, 50 liters, 60 liters, 70 liters, 80 liters, 90 liters, 100 liters, 150 liters, 200 liters, 250 liters, 300 liters, 350 liters, 400 liters, 450 liters, 500 liters, 550 liters, 600 liters, 650 liters, 700 liters, 750 liters, 800 liters, 850 liters, 900 liters, 950 liters, 1000 liters, 1500 liters, 2000 liters, 2500 liters, 3000 liters, 3500 liters, 4000 liters, 4500 liters, 5000 liters, 6000 liters, 7000 liters, 8000 liters, 9000 liters, 10,000 liters, 15,000 liters, 20,000 liters, and / or 50,000 liters. Further, suitable reactors can be multi-use, single-use, disposable, or non-disposable and can be formed from any suitable material including stainless steel (e.g., 316L or any other suitable stainless steel) as well as metal alloys such as Inconel, plastic, and / or glass.
[0093] In embodiments, and unless otherwise specified herein, the devices, facilities, and methods described herein may also include any suitable unit operations and / or equipment not otherwise specifically mentioned, such as operations and / or equipment for the separation, purification, and isolation of such products. Conventional stick-built facilities, modular, mobile, and temporary facilities, or any other suitable construction, equipment, and / or layout, etc., any suitable facilities and environments can be used. For example, in some embodiments, a modular cleanroom can be used. Further, unless otherwise specified, the devices, systems, and methods described herein can be housed and / or implemented in a single location or facility, or can be housed and / or implemented in separate or multiple locations and / or facilities.
[0094] In further embodiments, a method of treating with adeno-associated virus (AAV) comprises transfecting a mammalian cell with an adenovirus helper gene comprising an E2A gene and an E4Orf6 gene under the control of a first inducible promoter, an AAV gene comprising a Rep gene and a Cap gene under the control of a second inducible promoter, a viral-associated non-coding RNA under the control of a third suppressible promoter, two inverted terminal repeat (ITR) sequences, and suppression elements for the first, second, and third inducible promoters; treating the mammalian cell with a binding partner of the suppression element; activating the first, second, and third inducible promoters; producing AAV; recovering the AAV; and administering the AAV to a mammalian patient. A method is provided herein.
[0095] Preferably, the method is used to treat a human patient with a gene of interest, which may include a gene for therapeutic purposes. Administration to a human patient can include, for example, inhalation, injection, or intravenous administration, and other administration methods known in the art.
[0096] Methods of producing AAV and the use of various inducible promoters are described herein.
[0097] In a further embodiment, a method of producing adeno-associated virus (AAV), comprising: stably expressing one or more nucleic acids encoding TetR and / or TetR-KRAB in mammalian cells, a mammalian cell under the control of a first inducible promoter E2A gene, E4Orf gene, and a first nucleic acid encoding an adenovirus helper gene comprising a viral-associated non-coding RNA, a second nucleic acid encoding an AAV gene comprising a Rep gene and a Cap gene under the control of a second inducible promoter, and optionally, a third nucleic acid encoding a gene of interest under the control of a third inducible promoter; transfecting; treating the mammalian cells with a binding partner of TetR; activating the first, second, and third inducible promoters; producing AAV; and recovering AAV. A method is provided herein.
[0098] As described herein, preferably, the mammalian cells are mammalian cell cultures including suspension cultures.
[0099] As described herein, preferably, the mammalian cells are human cells including Chinese hamster ovary (CHO) cells or human embryonic kidney (HEK) cells.
[0100] As described herein, there are advantages over combining nucleic acids in one plasmid, including the ability to optimize the ratios of separate AAV production and packaging components and exert temporal control over the expression of each transposon, by using two or three different nucleic acids or transposons to transfect mammalian cells.
[0101] As described herein, preferably, the nucleic acid encoding the E2A and E4Orf genes further comprises an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf gene.
[0102] As described herein, preferably, the inducible promoter comprises a functional promoter and two tetracycline operator sequences (TetO2).
[0103] As described herein, preferably, the functional promoter of the first inducible promoter is the cytomegalovirus (CMV) promoter.
[0104] In some embodiments, the mammalian cells used to produce adeno-associated virus (AAV) stably express one or more nucleic acids encoding TetR and / or TetR-KRAB under the control of a constitutive promoter.
[0105] As described herein, stable expression of TetR and / or TetR-KRAB in mammalian cells (prior to insertion of the nucleic acid carrying the viral components, preferably via a transposon) maximizes the repression of potentially cytotoxic AAV genes introduced by transfection and results in increased temporal control over the inducible promoter element.
[0106] In some embodiments, the KRAB repression domain is fused in-frame with TetR.
[0107] As described herein, fusing the KRAB repression domain in-frame with TetR ensures that "leaky" expression of the potentially cytotoxic AAV-packaged nucleic acid is unlikely to occur. The KRAB repression domain fused in-frame with the TetR repression domain provides an additional mechanism of action for achieving high levels of repression of the inducible promoter.
[0108] In some embodiments, the mammalian cell produces a sufficient amount of TetR. As used herein, "sufficient" TetR is defined as the amount and / or level of activity of a repressor (e.g., TetR) to stop the expression and / or activity of an inducible and / or derepressible element (i.e., prior to the addition of doxycycline).
[0109] As described herein, producing a sufficient amount of TetR is necessary for the repression of an inducible promoter under normal conditions (e.g., prior to the addition of doxycycline). If a sufficient amount of TetR is not produced by the mammalian cell, the cell may prematurely transcribe and translate AAV-packaging nucleic acids that are potentially cytotoxic.
[0110] In further embodiments, the mammalian cell further comprises stable expression of one or more nucleic acids encoding chicken hypersensitivity site-4 (cHS4) adjacent to the TetR and / or TetR-KRAB repressor sequences. As described herein, the expression of the cHS4 sequence adjacent to the TetR and / or TetR-KRAB repressor sequences prevents silencing of TetR expression and further improves the stability of the integrated repressor in the mammalian cell genome.
[0111] In further embodiments, the treatment comprises treating with doxycycline to remove repression of the inducible promoter.
[0112] In further embodiments, each of the first, second, and third nucleic acids is adjacent to a transposon-specific inverted terminal repeat (ITR).
[0113] In a further embodiment, a method for producing adeno-associated virus (AAV) comprises stably transfecting mammalian cells with a nucleic acid encoding TetR and / or a TetR-KRAB repressor, a chicken hypersensitivity site-4 (cHS4) sequence adjacent to the TetR and / or TetR-KRAB repressor, and a selectable gene; transfecting the stably transfected mammalian cells with a first nucleic acid encoding adenovirus helper genes comprising an E2A gene, an E4Orf gene, and a viral associated non-coding RNA, under the control of a first derepressible promoter; a second nucleic acid encoding AAV genes comprising a Rep gene and a Cap gene, under the control of a second derepressible promoter; and optionally, a third nucleic acid encoding a gene of interest, under the control of a third derepressible promoter; treating the mammalian cells with a binding partner of TetR; activating the first, second, and third derepressible promoters; producing AAV; and recovering the AAV.
[0114] In some embodiments, the mammalian cells further comprise a selectable gene, such as a zeocin resistance gene. Additional selectable genes include other antibiotic resistance genes, such as kanamycin and geneticin resistance genes. As described herein, the expression of the zeocin resistance gene allows for efficient selection of correctly integrated repression elements in the mammalian cell genome.
[0115] Additional exemplary embodiments Embodiment 1 is a mammalian cell for producing adeno-associated virus (AAV), comprising a nucleic acid molecule encoding a viral helper gene under the control of a first derepressible promoter, a nucleic acid molecule encoding an AAV gene under the control of a second derepressible promoter, and a nucleic acid molecule encoding repression elements of the first and second derepressible promoters.
[0116] Embodiment 2 includes the mammalian cells described in Embodiment 1, wherein the mammalian cells are mammalian cell cultures.
[0117] Embodiment 3 includes the mammalian cells described in Embodiment 2, wherein the mammalian cell culture is a suspension culture.
[0118] Embodiment 4 includes the mammalian cells described in any one of Embodiments 1 to 3, wherein the viral helper gene is an adenovirus helper gene.
[0119] Embodiment 5 includes the mammalian cells described in Embodiment 4, wherein the adenovirus helper gene includes an E2A gene and an E4Orf6 gene.
[0120] Embodiment 6 includes the mammalian cells described in Embodiment 5, further including an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.
[0121] Embodiment 7 includes the mammalian cells described in any one of Embodiments 1 to 6, wherein the AAV gene includes a Rep gene and a Cap gene.
[0122] Embodiment 8 includes the mammalian cells described in Embodiment 7, wherein the Rep78 gene is under the control of a second inducible promoter, and the Rep52 gene is under the control of a third inducible promoter.
[0123] Embodiment 9 includes the mammalian cells described in Embodiment 7, wherein the Rep78 gene is under the control of a second inducible promoter, and the Rep52 gene is under the control of a third inducible promoter contained within an artificial intron.
[0124] Embodiment 10 includes the mammalian cells described in Embodiment 8 or 9, wherein the Cap gene is under the control of a native promoter.
[0125] Embodiment 11 includes the mammalian cells according to any one of Embodiments 1 to 10, wherein each of the suppressible promoters includes a functional promoter and two tetracycline operator arrays (TetO2).
[0126] Embodiment 12 includes the mammalian cells according to Embodiment 11, wherein the functional promoter of the first suppressible promoter is a cytomegalovirus (CMV) promoter.
[0127] Embodiment 13 includes the mammalian cells according to any one of Embodiments 1 to 12, wherein the suppression element is under the control of a constitutive promoter.
[0128] Embodiment 14 includes the mammalian cells according to any one of Embodiments 1 to 13, wherein the suppression element is a tetracycline repressor protein.
[0129] Embodiment 15 includes the mammalian cells according to Embodiment 14, further including a nucleic acid encoding a tetracycline repressor protein and a nucleic acid encoding a transcriptional repression domain in-frame.
[0130] Embodiment 16 includes the mammalian cells according to any one of Embodiments 1 to 15, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.
[0131] Embodiment 17 includes the mammalian cells according to any one of Embodiments 1 to 15, wherein the mammalian cell is a human cell.
[0132] Embodiment 18 includes the mammalian cells according to Embodiment 17, wherein the human cell is a human embryonic kidney (HEK) cell.
[0133] Embodiment 19 includes the mammalian cells according to any one of Embodiments 1 to 18, further including a nucleic acid molecule including two inverted terminal repeat (ITR) sequences.
[0134] Embodiment 20 includes the mammalian cell according to any one of Embodiments 1 to 19, further including a nucleic acid molecule encoding a target gene.
[0135] Embodiment 21 includes the mammalian cell according to any one of Embodiments 1 to 20, further including a nucleic acid encoding a virus-related non-coding RNA under the control of a fourth suppressible promoter.
[0136] Embodiment 22 is a mammalian cell for producing adeno-associated virus (AAV), including an adenovirus helper gene including an E2A gene and an E4Orf6 gene under the control of a first suppressible promoter, an AAV gene including a Rep gene and a Cap gene under the control of a second suppressible promoter, a virus-related non-coding RNA under the control of a third suppressible promoter, two inverted terminal repeat (ITR) sequences, and suppressor elements of the first, second, and third suppressible promoters, and is a mammalian cell including a nucleic acid molecule encoding the same.
[0137] Embodiment 23 includes the mammalian cell according to Embodiment 22, wherein the mammalian cell is a mammalian cell culture.
[0138] Embodiment 24 includes the mammalian cell according to Embodiment 23, wherein the mammalian cell culture is a suspension culture.
[0139] Embodiment 25 includes the mammalian cell according to any one of Embodiments 22 to 24, further including an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.
[0140] Embodiment 26 includes the mammalian cell according to any one of Embodiments 22 to 25, wherein the Rep78 gene is under the control of a second suppressible promoter, and the Rep52 gene is under the control of a fourth suppressible promoter.
[0141] Embodiment 27 includes the mammalian cells according to any one of Embodiments 22 to 25, wherein the Rep78 gene is under the control of a second derepressible promoter, and the Rep52 gene is under the control of a fourth derepressible promoter contained within an artificial intron.
[0142] Embodiment 28 includes the mammalian cells according to Embodiment 26 or 27, wherein the Cap gene is under the control of a natural promoter.
[0143] Embodiment 29 includes the mammalian cells according to any one of Embodiments 22 to 28, wherein each of the derepressible promoters includes a functional promoter and two tetracycline operator sequences (TetO2).
[0144] Embodiment 30 includes the mammalian cells according to Embodiment 29, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter.
[0145] Embodiment 31 includes the mammalian cells according to any one of Embodiments 22 to 30, wherein the repression element is under the control of a constitutive promoter.
[0146] Embodiment 32 includes the mammalian cells according to any one of Embodiments 22 to 31, wherein the repression element is a tetracycline repressor protein.
[0147] Embodiment 33 includes the mammalian cells according to Embodiment 25, further including a nucleic acid encoding a tetracycline repressor protein and a nucleic acid encoding a transcriptional repression domain in-frame therewith.
[0148] Embodiment 34 includes the mammalian cells according to any one of Embodiments 22 to 33, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.
[0149] Embodiment 35 includes the mammalian cell according to any one of Embodiments 22 to 33, wherein the mammalian cell is a human cell.
[0150] Embodiment 36 includes the mammalian cell according to Embodiment 35, wherein the human cell is a human embryonic kidney (HEK) cell.
[0151] Embodiment 37 includes the mammalian cell according to any one of Embodiments 22 to 36, further including a nucleic acid molecule encoding a gene of interest.
[0152] Embodiment 38 is an isolated nucleic acid molecule including an adenovirus helper gene including an E2A gene and an E4Orf6 gene under the control of a first derepressible promoter, an AAV gene including a Rep gene and a Cap gene under the control of a second derepressible promoter, a virus-related non-coding RNA under the control of a third suppressible promoter, two inverted terminal repeat (ITR) sequences, and suppression elements of the first, second, and third derepressible promoters.
[0153] Embodiment 39 includes the isolated nucleic acid according to Embodiment 38, further including an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.
[0154] Embodiment 40 includes the isolated nucleic acid according to Embodiment 38 or 39, wherein the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter.
[0155] Embodiment 41 includes the isolated nucleic acid according to Embodiment 38 or 39, wherein the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter included within an artificial intron.
[0156] Embodiment 42 includes the isolated nucleic acid according to Embodiment 40 or 41, wherein the Cap gene is under the control of a native promoter.
[0157] Embodiment 43 includes the isolated nucleic acid according to any one of Embodiments 38 to 42, wherein each of the derepressible promoters includes a functional promoter and two tetracycline operator sequences (TetO2).
[0158] Embodiment 44 includes the isolated nucleic acid according to Embodiment 43, wherein the functional promoter of the first derepressible promoter is a cytomegalovirus (CMV) promoter.
[0159] Embodiment 45 includes the isolated nucleic acid according to any one of Embodiments 38 to 44, wherein the repression element is under the control of a constitutive promoter.
[0160] Embodiment 46 includes the isolated nucleic acid according to any one of Embodiments 38 to 45, wherein the repression element is a tetracycline repressor protein.
[0161] Embodiment 47 includes the isolated nucleic acid according to Embodiment 46, further including a nucleic acid encoding a tetracycline repressor protein and a nucleic acid encoding a transcriptional repression domain in-frame therewith.
[0162] Embodiment 48 includes the isolated nucleic acid according to any one of Embodiments 38 to 47, further including a gene of interest.
[0163] Embodiment 49 is a method for producing adeno-associated virus (AAV) in mammalian cells, the method comprising transfecting a mammalian cell with an isolated nucleic acid molecule encoding an adenovirus helper gene comprising an E2A gene and an E4Orf6 gene under the control of a first derepressible promoter, an AAV gene comprising a Rep gene and a Cap gene under the control of a second derepressible promoter, a virus-related non-coding RNA under the control of a third repressible promoter, two inverted terminal repeat (ITR) sequences, and repression elements for the first, second, and third derepressible promoters; treating the mammalian cell with a binding partner of the repression element; activating the first, second, and third derepressible promoters; producing AAV; and recovering the AAV.
[0164] Embodiment 50 includes the method according to Embodiment 49, wherein the mammalian cell is a mammalian cell culture.
[0165] Embodiment 51 includes the method according to Embodiment 50, wherein the mammalian cell culture is a suspension culture.
[0166] Embodiment 52 includes the method according to any one of Embodiments 49 to 51, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.
[0167] Embodiment 53 includes the method according to any one of Embodiments 49 to 52, wherein the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter.
[0168] Embodiment 54 includes the method according to any one of Embodiments 49 to 52, wherein the Rep78 gene is under the control of a second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter contained within an artificial intron.
[0169] Embodiment 55 includes the method according to Embodiment 54, wherein a fourth suppressible promoter is removed after activation of the suppressible promoter and before production of AAV.
[0170] Embodiment 56 includes the method according to Embodiment 53 or 54, wherein the Cap gene is under the control of a native promoter.
[0171] Embodiment 57 includes the method according to any one of Embodiments 49 to 56, wherein each of the suppressible promoters includes a functional promoter and two tetracycline operator sequences (TetO2).
[0172] Embodiment 58 includes the method according to Embodiment 57, wherein the functional promoter of the first suppressible promoter is a cytomegalovirus (CMV) promoter.
[0173] Embodiment 59 includes the method according to any one of Embodiments 49 to 58, wherein the suppressing element is under the control of a constitutive promoter.
[0174] Embodiment 60 is the method according to any one of Embodiments 49 to 59, wherein the suppressing element is a tetracycline repressor protein.
[0175] Embodiment 61 includes the method according to Embodiment 60, wherein the nucleic acid further includes a nucleic acid encoding a tetracycline repressor protein and a nucleic acid encoding a transcriptional repression domain in-frame therewith.
[0176] Embodiment 62 includes the method according to Embodiment 60 or 61, wherein the treatment includes treatment with doxycycline.
[0177] Embodiment 63 includes the method according to any one of Embodiments 49 to 62, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.
[0178] Embodiment 64 includes the method according to any one of Embodiments 49 to 63, wherein the mammalian cell is a human cell.
[0179] Embodiment 65 includes the method according to Embodiment 64, wherein the human cell is a human embryonic kidney (HEK) cell.
[0180] Embodiment 66 includes the method according to any one of Embodiments 49 to 65, wherein the AAV contains a nucleic acid molecule encoding a gene of interest.
[0181] Embodiment 67 includes the method according to Embodiment 66, wherein the AAV contains a gene for therapeutic purposes.
[0182] Embodiment 68 is a method of treating with adeno-associated virus (AAV), comprising transfecting a mammalian cell with an isolated nucleic acid molecule encoding an adenovirus helper gene containing an E2A gene and an E4Orf6 gene under the control of a first inducible promoter, an AAV gene containing a Rep gene and a Cap gene under the control of a second inducible promoter, a viral-associated non-coding RNA under the control of a third suppressible promoter, two inverted terminal repeat (ITR) sequences, and suppression elements of the first, second, and third inducible promoters; treating the mammalian cell with a binding partner of the suppression element; activating the first, second, and third inducible promoters; producing AAV; recovering the AAV; and administering the AAV to a mammalian patient.
[0183] Embodiment 69 includes the method according to Embodiment 68, wherein the mammalian cell is a mammalian cell culture.
[0184] Embodiment 70 includes the method according to Embodiment 69, wherein the mammalian cell culture is a suspension culture.
[0185] Embodiment 71 includes the method according to any one of Embodiments 68 to 70, further including an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.
[0186] Embodiment 72 includes the method according to any one of Embodiments 68 to 71, wherein the Rep78 gene is under the control of a second inducible promoter and the Rep52 gene is under the control of a fourth inducible promoter.
[0187] Embodiment 73 includes the method according to any one of Embodiments 68 to 72, wherein the Rep78 gene is under the control of a second inducible promoter and the Rep52 gene is under the control of a fourth inducible promoter contained within an artificial intron.
[0188] Embodiment 74 includes the method according to Embodiment 73, wherein the fourth inducible promoter is removed after activation of the inducible promoter and before production of AAV.
[0189] Embodiment 75 includes the method according to Embodiment 73 or 74, wherein the Cap gene is under the control of a native promoter.
[0190] Embodiment 76 includes the method according to any one of Embodiments 68 to 75, wherein each of the inducible promoters includes a functional promoter and two tetracycline operator sequences (TetO2).
[0191] Embodiment 77 includes the method according to Embodiment 76, wherein the functional promoter of the first inducible promoter is a cytomegalovirus (CMV) promoter.
[0192] Embodiment 78 includes the method according to any one of Embodiments 68 to 77, wherein the repression element is under the control of a constitutive promoter.
[0193] Embodiment 79 is the method according to any one of Embodiments 68 to 78, wherein the inhibitory element is a tetracycline repressor protein.
[0194] Embodiment 80 includes the method according to Embodiment 79, wherein the nucleic acid further includes a nucleic acid encoding a transcriptional repression domain in-frame with the nucleic acid encoding the tetracycline repressor protein.
[0195] Embodiment 81 includes the method according to Embodiment 79 or 80, wherein the treatment includes treatment with doxycycline.
[0196] Embodiment 82 includes the method according to any one of Embodiments 68 to 81, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.
[0197] Embodiment 83 includes the method according to any one of Embodiments 68 to 82, wherein the mammalian cell is a human cell.
[0198] Embodiment 84 includes the method according to Embodiment 83, wherein the human cell is a human embryonic kidney (HEK) cell.
[0199] Embodiment 85 includes the method according to any one of Embodiments 68 to 84, wherein the AAV includes a nucleic acid molecule encoding a gene of interest.
[0200] Embodiment 86 includes the method according to Embodiment 87, wherein the AAV includes a gene for therapeutic purposes.
[0201] Embodiment 87 includes the method according to any one of Embodiments 68 to 86, wherein the administration includes inhalation, injection, or intravenous administration.
[0202] Embodiment 88 is a method for producing adeno-associated (AAV) virus, comprising stably expressing a mammalian cell expressing TetR and / or one or more nucleic acids encoding TetR under the control of a first derepressible promoter, the E2A gene, the E4Orf gene, and a first nucleic acid encoding an adenovirus helper gene comprising a viral-associated non-coding RNA, a second nucleic acid encoding an AAV gene comprising a Rep gene and a Cap gene under the control of a second derepressible promoter, and optionally a third nucleic acid encoding a gene of interest under the control of a third derepressible promoter, transfecting the mammalian cell with the first, second, and third nucleic acids, treating the mammalian cell with a binding partner of TetR and / or TetR-KRAB, activating the first, second, and third derepressible promoters, producing AAV, and recovering the AAV.
[0203] Embodiment 89 includes the method according to Embodiment 88, wherein the mammalian cell is a mammalian cell culture.
[0204] Embodiment 90 includes the method according to any one of Embodiments 88 to 89, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.
[0205] Embodiment 91 includes the method according to any one of Embodiments 88 to 90, wherein the mammalian cell is a human cell.
[0206] Embodiment 92 includes the method according to Embodiment 91, wherein the human cell is a human embryonic kidney (HEK) cell.
[0207] Embodiment 93 includes the method according to Embodiment 89, wherein the mammalian cell culture is a suspension culture.
[0208] Embodiment 94 includes the method according to any one of Embodiments 88 to 90, wherein the mammalian cell further comprises an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.
[0209] Embodiment 95 includes the method according to any one of Embodiments 88 to 91, wherein each of the repressible promoters includes a functional promoter and two tetracycline operator arrays (TetO2).
[0210] Embodiment 96 includes the method according to Embodiment 92, wherein the functional promoter of the first repressible promoter is a cytomegalovirus (CMV) promoter.
[0211] Embodiment 97 includes the method according to any one of Embodiments 88 to 96, wherein stably expressed TetR and / or TetR-KRAB is under the control of a constitutive promoter.
[0212] Embodiment 98 includes the method according to Embodiment 97, wherein the nucleic acid encoding TetR-KRAB includes KRAB fused in-frame with TetR.
[0213] Embodiment 99 includes the method according to any one of Embodiments 88 to 98, wherein the treatment includes treatment with doxycycline.
[0214] Embodiment 100 includes the method according to any one of Embodiments 88 to 99, wherein each of the first, second, and third nucleic acids is adjacent to a transposon-specific inverted terminal repeat (ITR).
[0215] Embodiment 101 includes the method according to any one of Embodiments 88 to 100, wherein the mammalian cell expresses a sufficient amount of TetR and / or TetR-KRAB.
[0216] Embodiment 102 includes the method according to any one of Embodiments 88 to 101, wherein the AAV includes a gene for therapeutic purposes.
[0217] Embodiment 103 includes the method according to any one of Embodiments 88 to 102, further comprising stable expression of one or more nucleic acids encoding chicken hypersensitive site-4 (cHS4) adjacent to the TetR and / or TetR-KRAB repressor sequences in mammalian cells.
[0218] Embodiment 104 includes the method according to any one of Embodiments 88 to 103, further comprising a zeocin resistance gene in mammalian cells.
[0219] Embodiment 105 is a method for producing adeno-associated virus (AAV), comprising stably transfecting mammalian cells with a nucleic acid encoding TetR and / or a TetR-KRAB repressor, a chicken hypersensitive site-4 (cHS4) sequence adjacent to the TetR and / or TetR-KRAB repressor, and a selectable gene; stably transfecting the stably transfected mammalian cells with a first nucleic acid encoding an adenovirus helper gene comprising an E2A gene, an E4Orf gene, and a viral-associated non-coding RNA under the control of a first derepressible promoter; a second nucleic acid encoding an AAV gene comprising a Rep gene and a Cap gene under the control of a second derepressible promoter; and optionally, a third nucleic acid encoding a gene of interest under the control of a third derepressible promoter; treating the stably transfected mammalian cells with a binding partner of TetR; activating the first, second, and third derepressible promoters; producing AAV; and recovering AAV.
[0220] Embodiment 106 includes the method according to Embodiment 105, wherein the stably transfected mammalian cells produce a sufficient amount of TetR.
[0221] Embodiment 107 includes the method according to any one of Embodiments 106 and 107, wherein the KRAB repression domain is fused in-frame with TetR.
Examples
[0222] Example 1: Design and Verification of a Repressible Helper Gene To drive the expression of the E2A gene and the E4Orf6 gene, a repressible promoter derived from the pcDNA4 / TO vector (INVITROGEN) was utilized. This promoter contains a complete CMV promoter with two tetracycline operator sequences (TetO2) inserted between the TATA box and the transcription start site (TSS). In the presence of the tetracycline repressor protein (TetR), transcription initiation was blocked by binding TetR to the TetO2 site. Tetracycline or doxycycline, when added to the medium, binds to TetR and changes its conformation. This results in the release of TetR and the derepression / activation of the CMV promoter, leading to the induction of gene expression (Figure 1 shows the off and on conformations of the TETR / TetO2 repressible promoter system).
[0223] To simplify the design and improve stability, an internal ribosome entry site (IRES) element was used to initiate the translation of E4Orf6 after E2A in a single expression cassette driven by a single inducible CMV promoter (Figure 1).
[0224] To induce VA I non-coding RNA, an H1 promoter with TetO2 inserted was applied (see, for example, Wiederschain et al., “Single-vector inducible lentiviral RNAi system for oncology target validation, Cell Cycle 8:498-504 (2009)). Similarly, the addition of doxycycline releases TetR and turns on VA I expression (Figure 1).
[0225] As described above, a TetR gene expression cassette is included for the control of the repressible promoter (see Figure 1). A constitutive human PGK promoter is used to drive the expression of TetR, followed by the expression of an IRES used to select cells into which the transposon has integrated, the expression of puromycin N-acetyltransferase (see Figure 2A).
[0226] To reduce potential leaky expression from the repressible promoter, an enhanced TetR was also included (see, for example, Szulc et al., “A versatile tool for conditional gene expression and knockdown,” Nature Methods 3:109-116 (2006)). Briefly, the strong repression domain of KRAB was fused in-frame to the C-terminus of the native TetR, which improves its repression activity and minimizes basal gene expression prior to induction. To facilitate nuclear entry of the larger TetR-KRAB fusion protein, an SV40 nuclear localization signal (NLS) was also inserted (Figure 2A, Figures 12A-12B).
[0227] The sequence of the pcDNA3.1-E2A-E4-VA-TetR vector shown in Figure 2A is provided below.
[0228] iHelper1 / pcDNA3.1-E2A-E4-VA-TetR (11,986bp)
[0229]
[0230] The sequence of the pcDNA3.1-E2A-E4-VA-TetR-V2 vector shown in FIG. 2B is provided below.
[0231] iHelper2 / pcDNA3.1-E2A-E4-VA-TetR-V2 (11,641 bp)
[0232]
[0233] For use in AAV production by transient transfection, a total transfer plasmid containing a repressible helper (piHelper1) and a TetR expression cassette was tested. As shown in Figure 3, when the plasmid was co-transfected with the control pRep-Cap and pAAV-GOI plasmids, addition of Dox activated AAV production to about 30% of the level of the control helper vector that supports constitutive helper gene expression. Thus, the repressible helper construct functioned for AAV production upon induction.
[0234] Example 2: Design and validation of a non-repressible Rep-Cap gene The challenges for production of the Rep protein are twofold. First, it is necessary to maintain the ratio of Rep78 to Rep52 during induction for high-titer AAV production. Second, the p19 promoter required for Rep52 expression is located within the coding region of Rep78, which presents a challenge for incorporating a repressible promoter. To overcome these challenges, two strategies were developed (Figures 4A - 4C).
[0235] First, to maintain the natural regulation of Rep gene expression (see Figure 4A), the original viral promoter was retained but modified by inserting two TetO sites around the TATA box and TSS. Two copies of the TetO site were inserted into the upstream truncated p5 promoter having a core element containing the TATA box, Rep binding element (RBE), and YY1 site. Further, a wild-type copy of the p5 promoter that functions as an enhancer was placed downstream of the Cap gene to support both Rep and Cap expression (Figure 5) (see, for example, U.S. Patent No. 5,622,856).
[0236] The sequence of the repressible p5 promoter described in Figure 5 is as follows.
[0237] min-p5-i1 TATTTAATCTCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGATCGCCCGAGTGAGCACGCAGGGTCTCCATTTTGAAGCGGGAGGTTTGAACGCGCAGCCGCC (SEQ ID NO: 3)
[0238] min-p5-i2 TATTTAAtcTCCCTATCAGTGATAGAGAtcGCCCGAGTGAGCACGCAGGGTCTCCATTTTGATCCCTATCAGTGATAGAGAAGCGGGAGGTTTGAACGCGCAGCCGCC (SEQ ID NO: 4)
[0239] min-p5-i3 TCCCTATCAGTGATAGAGAtcTATTTAAGCCCGAGTGAGCACGCAGTCCCTATCAGTGATAGAGAGGTCTCCATTTTGAAGCGGGAGGTTTGAACGCGCAGCCGCC (SEQ ID NO: 5)
[0240] Similarly, two copies of the TetO site were also inserted into the p19 promoter adjacent to the TSS site (Figure 6). To minimize interference with such insertions and maximize the original activity of these viral promoters, three insertion methods for the TetO site were designed for each promoter for optimal performance. Therefore, a total of nine variants were examined (iRepCap1 - iRepCap9).
[0241] The sequence of the inducible promoter containing p19 shown in Figure 6 is provided below.
[0242] p19-i1 ccagaaatggcgccggaggcgggaacaaggtggtggatgagtgctacatccccaattacttgctccccaaaacccagcctgagctccagtgggcgtggactaatatggaacagtatttaagcgcctgTCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGAtttgaatctcacggag (SEQ ID NO: 6)
[0243] p19-i2 ccagaaatggcgccggaggcgggaacaaggtggtggatgagtgctacatccccaattacttgctccccaaaacccagcctgagTCCCTATCAGTGATAGAGActccagtgggcgtggactaatatggaacagtatttaagcgcctgTCCCTATCAGTGATAGAGAtttgaatctcacggag (SEQ ID NO: 7)
[0244] p19-i3 ccagaaatggcgccggaggcgggaacaaggtggtggatgagtgctacatccccaattacttgctccccaaaacccagcctgagctccagtgggcgtggactaatatggaaTCCCTATCAGTGATAGAGAcagtatttaagcgcctgTCCCTATCAGTGATAGAGAtttgaatctcacggag (SEQ ID NO: 8)
[0245] Two methods for the placement of the derepressible p19 promoter were developed. In the first method, separate expression cassettes for Rep52 were generated, driven by the derepressible p19 promoter. In the first method shown in Figure 4B, the original p19 promoter in the Rep78 ORF was silenced by changing six nucleotides in three core regulatory elements (SP1, TATA-1, and TATA-2 sites) required for p19 activity. These changes did not alter the Rep78 protein sequence. Rep78 was controlled by the derepressible p5 promoter.
[0246] In the second method, an artificial intron was created for the insertion of the TetO site in Rep78ORF (Figure 4C). A chimeric intron between an intron derived from human β-globin and the immunoglobulin heavy chain gene was adapted by replacing a non-essential internal sequence with the TetO2 site (Figure 7A). The new artificial intron was inserted in situ 1 bp or 25 bp downstream of TATA-2 of promoter p19 (iRepCap-10 and iRepCap11) (Figure 4B and Figure 7B). The new p19 promoter with an intron containing adjacent TetO enabled the expression of Rep78 protein after removal of the intron during mRNA splicing while ensuring the suppression of Rep52 gene expression before induction. The efficiency of splicing was evaluated by PCR analysis of cDNA.
[0247] The nucleic acid sequences of the intron-based p19 promoter shown in Figures 7A to 7B are provided below.
[0248] In-p19-i1 ccagaaatggcgccggaggcgggaacaaggtggtggatgagtgctacatccccaattacttgctccccaaaacccagcctgagctccagtgggcgtggactaatatggaacagtatttaaggtaagtTCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGAtactgacatccactttgcctttctctccacagcgcctgtttgaatctcacggag (SEQ ID NO: 9)
[0249] In-p19-i2 ccagaaatggcgccggaggcgggaacaaggtggtggatgagtgctacatccccaattacttgctccccaaaacccagcctgagctccagtgggcgtggactaatatggaacagtatttaagcgcctgtttgaatctcacggaaaggtaagtTCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGAtactgacatccactttgcctttctctccacag(SEQ ID NO: 10)
[0250] To test the activity of 11 inducible Rep-Cap designs, HEK293 cells were transfected with one of the vectors along with standard pHelper and pAAV-GFP for AAV production. Three days after transfection, the cells were harvested for Rep-Cap protein expression and AAV titer analysis. Western blot analysis revealed various expression levels of Rep and Cap proteins, and many maintained a Rep78 to Rep52 ratio similar to that of the control RepCap vector (Figure 8A). qPCR analysis of AAV titers showed that the designs had titers performed similarly to or higher than the control triple transfection (Figure 8B).
[0251] To test the performance of both the inducible helper and inducible Rep-Cap designs together, HEK293 cells were transfected with the selected iRepCap vector, iHelper1 / 2, and pAAV-GFP and left untreated or treated with doxycycline for 3 days. As shown in Figure 9A, protein expression of Rep and Cap was induced only by the addition of Dox and the release of the repressible promoter. Thus, the AAV titer increased significantly by more than 10 to 25-fold when released from repression (Figure 9B).
[0252] To stably incorporate iHelper and iRepCap, iHelper1 / 2 and iRepCap10 were selected along with AAV-GFP and assembled into a functional cassette into a single PIGGYBAC™ transposon transfer vector PB007 (Transposagen, Inc., Lexington, KY). Figures 10A - 10D show plasmid constructs used for incorporation into mammalian cells, preferably HEK293 cells. To facilitate future addition of specific AAV genes of interest, AAV-GFP was not included in some of the transcription vectors (Figures 10A and 10B). HEK293 cells were transfected with both the transfer vector and transposase mRNA, and the pool of integrated cells was enriched by puromycin selection. Single cell clones were isolated and screened for AAV production with or without Dox treatment to activate derepression.
[0253] The nucleic acid sequence of the vector shown in Figure 10A is provided below.
[0254] PB007-iHelper1-iRepCap10 / PBBG7(18,281bp)
[0255] The array of the vector illustrated in FIG. 10B is provided below.
[0256] PB007-iHelper2-iRepCap10 / PBBG8(17,936bp)
[0257] The array of vectors shown in FIG. 10C is provided below.
[0258] PB007-iHelper1-iRepCap10-AAV-GFP / PBBG9(21,391bp) AGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCAT(SEQ ID NO: 13)
[0259] The sequence of the vector shown in FIG. 10D is provided below.
[0260] PB007-iHelper2-iRepCap10-AAV-GFP / PBBG10(21,046bp) AACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCAT (SEQ ID NO: 14)
[0261] Sequence of an additional vector for use in practicing the present invention:
[0262] iRepCap1 / pKan - Anc80 - RepCap - p5i1 - p19i1 (10,497bp)
[0263] agtgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc(SEQ ID NO: 15)
[0264] iRepCap2 / pKan - Anc80 - RepCap - p5i2 - p19i1(10,495bp)
[0265] tgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc(SEQ ID NO: 16)
[0266] iRepCap3 / pKan - Anc80 - RepCap - p5i3 - p19i1(10,493bp)
[0267] tagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc(SEQ ID NO: 17)
[0268] iRepCap4 / pKan - Anc80 - RepCap - p5i1 - p19i2 (10,495bp)
[0269] tgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc(SEQ ID NO:18)
[0270] iRepCap5 / pKan - Anc80 - RepCap - p5i2 - p19i2(10,493bp)
[0271] tagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc(SEQ ID NO: 19)
[0272] iRepCap6 / pKan - Anc80 - RepCap - p5i3 - p19i2(10,491bp)
[0273] gcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc(SEQ ID NO:20)
[0274] iRepCap7 / pKan - Anc80 - RepCap - p5i1 - p19i3(10,495bp)
[0275] tgtagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc(SEQ ID NO: 21)
[0276] iRepCap8 / pKan - Anc80 - RepCap - p5i2 - p19i3(10,493bp)
[0277] tagcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc(SEQ ID NO: 22)
[0278] iRepCap9 / pKan - Anc80 - RepCap - p5i3 - p19i3 (10,491bp)
[0279] gcggtcacgctgcgcgtaaccaccacacccgccgcgcttaatgcgccgctacagggcgcgtcccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgagcgcgcggcgaattgggtaccgggccccc(SEQ ID NO: 23)
[0280] iRepCap10 / pKan - Anc80 - Intron - induced RepCap (7,567 bp)
[0281]
[0282] iRepCap11 / pKan - Anc80 - Intron - induced RepCap - d2(7,567bp)
[0283]
[0284] The sequence of the PBBG-iHelper-Puro construct shown in Fig. 11A is shown below:
[0285] PBBG-iHelper-Puro (11,801 bp)
[0286]
[0287] The sequence of the PBBG-ITRGFP construct shown in Fig. 11B is shown below:
[0288] PBBG-ITRGFP (7,798bp)
[0289]
[0290] The sequence of the PBBG-iRC8 construct shown in Fig. 11C is shown below:
[0291] PBBG-iRC8 (9,399 bp)
[0292]
[0293] The sequence of the PBBG-iRC9 construct shown in FIG. 11D is shown below:
[0294] PBBG-iRC9 (9,393 bp)
[0295]
[0296] The sequence of the PBBG-Anc80iRC construct shown in Fig. 11E is shown below:
[0297] PBBG-Anc80iRC (9,393 bp)
[0298]
[0299] The sequence of the pcDNA-TetR-In construct shown in Fig. 12A is shown below:
[0300] pcDNA-TetR-In (7147bp)
[0301]
[0302] The sequence of the pcDNA-TetR-KRAB-Ins construct shown in FIG. 12B is shown below:
[0303] pcDNA-TetR-KRAB-Ins (7493bp)
[0304]
[0305] It will be readily apparent to those skilled in the relevant art that other suitable modifications and adaptations to the methods and uses described herein can be made without departing from the scope of any of the embodiments.
[0306] Although specific embodiments are illustrated and described herein, it should be understood that the claims should not be limited to the specific forms or arrangements of the parts shown and described. Although exemplary embodiments are disclosed herein and specific terms are used, they are used for illustrative and general descriptive purposes only, not for purposes of limitation. Modifications and variations of the embodiments are possible in light of the above teachings. Accordingly, the embodiments should be understood to be capable of being practiced in ways other than as specifically described.
[0307] All publications, patents, and patent applications mentioned herein are hereby incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.
Claims
1. A mammalian cell for producing adeno-associated virus (AAV), comprising: a. A nucleic acid molecule encoding a viral helper gene under the control of a first inducible promoter; b. A nucleic acid molecule encoding an AAV gene under the control of a second inducible promoter; c. A nucleic acid molecule encoding a repressor element of the first and second inducible promoters.
2. The mammalian cell according to claim 1, wherein the mammalian cell is a mammalian cell culture.
3. The mammalian cell according to claim 2, wherein the mammalian cell culture is a suspension culture.
4. The mammalian cell according to any one of claims 1 to 3, wherein the viral helper gene is an adenovirus helper gene.
5. The mammalian cell according to claim 4, wherein the adenovirus helper gene comprises an E2A gene and an E4Orf6 gene.
6. The mammalian cell according to claim 5, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.
7. The mammalian cell according to any one of claims 1 to 6, wherein the AAV gene comprises a Rep gene and a Cap gene.
8. The mammalian cell according to claim 7, wherein the Rep78 gene is under the control of the second inducible promoter, and the Rep52 gene is under the control of a third inducible promoter.
9. The mammalian cell according to claim 7, wherein the Rep78 gene is under the control of the second inducible promoter, and the Rep52 gene is under the control of a third inducible promoter contained within an artificial intron.
10. The mammalian cell according to claim 8 or 9, wherein the Cap gene is under the control of a native promoter.
11. Each of the suppressible promoters is a functional promoter and two tetracycline operator arrays (TetO 2 ), the mammalian cell according to any one of claims 1 to 10.
12. The mammalian cell according to claim 11, wherein the functional promoter of the first inducible promoter is a cytomegalovirus (CMV) promoter.
13. The mammalian cell according to any one of claims 1 to 12, wherein the repressor element is under the control of a constitutive promoter.
14. The mammalian cell according to any one of claims 1 to 13, wherein the repressor element is a tetracycline repressor protein.
15. The mammalian cell according to claim 14, further comprising a nucleic acid encoding the tetracycline repressor protein and a nucleic acid encoding a transcription repression domain in-frame.
16. The mammalian cell according to any one of claims 1 to 15, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.
17. The mammalian cell according to any one of claims 1 to 15, wherein the mammalian cell is a human cell.
18. The mammalian cell according to claim 17, wherein the human cell is a human embryonic kidney (HEK) cell.
19. The mammalian cell according to any one of claims 1 to 18, further comprising a nucleic acid molecule comprising two inverted terminal repeat (ITR) sequences.
20. The mammalian cell according to any one of claims 1 to 19, further comprising a nucleic acid molecule encoding a gene of interest.
21. The mammalian cell according to any one of claims 1 to 20, further comprising a nucleic acid encoding a virus-related non-coding RNA under the control of a fourth inducible promoter.
22. A mammalian cell for producing adeno-associated virus (AAV), comprising: a. i. An adenovirus helper gene comprising an E2A gene and an E4Orf6 gene under the control of a first inducible promoter; ii. An AAV gene comprising a Rep gene and a Cap gene under the control of a second inducible promoter; iii. A virus-related non-coding RNA under the control of a third suppressible promoter; iv. Two inverted terminal repeat (ITR) sequences; and v. Nucleic acid molecules encoding the suppression elements of the first, second, and third inducible promoters.
23. The mammalian cell according to claim 22, wherein the mammalian cell is a mammalian cell culture.
24. The mammalian cell culture according to claim 23, wherein the mammalian cell culture is a suspension culture.
25. The mammalian cell according to any one of claims 22 to 24, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.
26. The mammalian cell according to any one of claims 22 to 25, wherein the Rep78 gene is under the control of the second inducible promoter and the Rep52 gene is under the control of a fourth inducible promoter.
27. The Rep78 gene is under the control of the second inducible promoter, and the Rep52 gene is under the control of a fourth inducible promoter contained within an artificial intron, the mammalian cell according to any one of claims 22 to 25.
28. The mammalian cell according to claim 26 or 27, wherein the Cap gene is under the control of a native promoter.
29. Each of the suppressible promoters is a functional promoter and two tetracycline operator sequences (TetO 2 ), the mammalian cell according to any one of claims 22 to 28.
30. The mammalian cell according to claim 29, wherein the functional promoter of the first inducible promoter is a cytomegalovirus (CMV) promoter.
31. The mammalian cell according to any one of claims 22 to 30, wherein the repression element is under the control of a constitutive promoter.
32. The mammalian cell according to any one of claims 22 to 31, wherein the repression element is a tetracycline repressor protein.
33. The mammalian cell according to claim 25, further comprising a nucleic acid encoding a transcriptional repression domain in-frame with the nucleic acid encoding the tetracycline repressor protein.
34. The mammalian cell according to any one of claims 22 to 33, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.
35. The mammalian cell according to any one of claims 22 to 33, wherein the mammalian cell is a human cell.
36. The mammalian cell according to claim 35, wherein the human cell is a human embryonic kidney (HEK) cell.
37. The mammalian cell according to any one of claims 22 to 36, further comprising a nucleic acid molecule encoding a gene of interest.
38. a. An adenovirus helper gene comprising an E2A gene and an E4Orf6 gene under the control of a first inducible promoter; b. An AAV gene comprising a Rep gene and a Cap gene under the control of a second inducible promoter; c. A viral-associated non-coding RNA under the control of a third suppressible promoter; d. Two inverted terminal repeat (ITR) sequences; e. An isolated nucleic acid molecule encoding the repression elements of the first, second, and third inducible promoters.
39. The isolated nucleic acid according to claim 38, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.
40. The isolated nucleic acid according to claim 38 or 39, wherein the Rep78 gene is under the control of the second inducible promoter, and the Rep52 gene is under the control of the fourth inducible promoter.
41. The isolated nucleic acid according to claim 38 or 39, wherein the Rep78 gene is under the control of the second inducible promoter, and the Rep52 gene is under the control of the fourth inducible promoter contained within an artificial intron.
42. The isolated nucleic acid according to claim 40 or 41, wherein the Cap gene is under the control of a native promoter.
43. The isolated nucleic acid according to any one of claims 38 to 42, wherein each of the inducible promoters comprises a functional promoter and two tetracycline operator sequences (TetO2).
44. The isolated nucleic acid according to claim 43, wherein the functional promoter of the first inducible promoter is a cytomegalovirus (CMV) promoter.
45. The isolated nucleic acid according to any one of claims 38 to 44, wherein the inhibitory element is under the control of a constitutive promoter.
46. The isolated nucleic acid according to any one of claims 38 to 45, wherein the inhibitory element is a tetracycline repressor protein.
47. The isolated nucleic acid according to claim 46, further comprising a nucleic acid encoding a transcriptional repression domain in-frame with the nucleic acid encoding the tetracycline repressor protein.
48. The isolated nucleic acid according to any one of claims 38 to 47, further comprising a gene of interest.
49. A method for producing adeno-associated virus (AAV) in mammalian cells, comprising: a. Transfecting the mammalian cells with i. An adenovirus helper gene comprising an E2A gene and an E4Orf6 gene under the control of a first inducible promoter; ii. An AAV gene comprising a Rep gene and a Cap gene under the control of a second inducible promoter; iii. A virus-associated non-coding RNA under the control of a third repressible promoter; iv. Two inverted terminal repeat (ITR) sequences; and v. An isolated nucleic acid molecule encoding the inhibitory elements of the first, second, and third inducible promoters. b. treating the mammalian cell with a binding partner of the inhibitory element; c. activating the first, second, and third inducible promoters; d. producing the AAV; e. recovering the AAV. A method comprising the steps of: **Claim 50** The method according to claim 49, wherein the mammalian cell is a mammalian cell culture. **Claim 51** The method according to claim 50, wherein the mammalian cell culture is a suspension culture. **Claim 52** The method according to any one of claims 49 to 51, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene. **Claim 53** The method according to any one of claims 49 to 52, wherein the Rep78 gene is under the control of the second inducible promoter and the Rep52 gene is under the control of a fourth inducible promoter. **Claim 54** The method according to any one of claims 49 to 52, wherein the Rep78 gene is under the control of the second inducible promoter and the Rep52 gene is under the control of a fourth inducible promoter contained within an artificial intron. **Claim 55** The method according to claim 54, wherein the fourth inducible promoter is removed after activation of the inducible promoter and before production of the AAV. **Claim 56** The method according to claim 53 or 54, wherein the Cap gene is under the control of a native promoter. **Claim 57** Each of the suppressible promoters is a functional promoter and two tetracycline operator arrays (TetO 2 ) The method according to any one of claims 49 to 56, comprising. **Claim 58** The method according to claim 57, wherein the functional promoter of the first inducible promoter is a cytomegalovirus (CMV) promoter. **Claim 59** The method according to any one of claims 49 to 58, wherein the inhibitory element is under the control of a constitutive promoter. **Claim 60** The method according to any one of claims 49 to 59, wherein the inhibitory element is a tetracycline repressor protein. **Claim 61** The method according to claim 60, wherein the nucleic acid further comprises a nucleic acid encoding a transcriptional repression domain in-frame with the nucleic acid encoding the tetracycline repressor protein. **Claim 62** The method according to claim 60 or 61, wherein the treatment comprises treatment with doxycycline. **Claim 63** The method according to any one of claims 49 to 62, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.
64. The method according to any one of claims 49 to 63, wherein the mammalian cell is a human cell.
65. The method according to claim 64, wherein the human cell is a human embryonic kidney (HEK) cell.
66. The method according to any one of claims 49 to 65, wherein the AAV comprises a nucleic acid molecule encoding a gene of interest.
67. The method according to claim 66, wherein the AAV comprises a gene for therapeutic purposes.
68. A therapeutic method using adeno-associated virus (AAV), comprising: a. transfecting the mammalian cell with an isolated nucleic acid molecule encoding: i. an adenovirus helper gene comprising an E2A gene and an E4Orf6 gene under the control of a first derepressible promoter; ii. an AAV gene comprising a Rep gene and a Cap gene under the control of a second derepressible promoter; iii. a virus-associated non-coding RNA under the control of a third repressible promoter; iv. two inverted terminal repeat (ITR) sequences; and v. repression elements of the first, second, and third derepressible promoters; b. treating the mammalian cell with a binding partner of the repression element; c. activating the first, second, and third derepressible promoters; d. producing the AAV; e. recovering the AAV; and f. administering the AAV to a mammalian patient.
69. The method according to claim 68, wherein the mammalian cell is a mammalian cell culture.
70. The method according to claim 69, wherein the mammalian cell culture is a suspension culture.
71. The method according to any one of claims 68 to 70, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.
72. The method according to any one of claims 68 to 71, wherein the Rep78 gene is under the control of the second derepressible promoter and the Rep52 gene is under the control of a fourth derepressible promoter.
73. The method according to any one of claims 68 to 72, wherein the Rep78 gene is under the control of the second inducible promoter, and the Rep52 gene is under the control of a fourth inducible promoter contained within an artificial intron.
74. The method according to claim 73, wherein the fourth inducible promoter is removed after activation of the inducible promoter and before production of the AAV.
75. The method according to claim 73 or 74, wherein the Cap gene is under the control of a native promoter.
76. Each of the suppressible promoters is a functional promoter and two tetracycline operator arrays (TetO 2 ), the method according to any one of claims 68 to 75.
77. The method according to claim 76, wherein the functional promoter of the first inducible promoter is a cytomegalovirus (CMV) promoter.
78. The method according to any one of claims 68 to 77, wherein the inhibitory element is under the control of a constitutive promoter.
79. The method according to any one of claims 68 to 78, wherein the inhibitory element is a tetracycline repressor protein.
80. The method according to claim 79, wherein the nucleic acid further comprises a nucleic acid encoding a transcriptional repression domain in-frame with the nucleic acid encoding the tetracycline repressor protein.
81. The method according to claim 79 or 80, wherein the treatment comprises treatment with doxycycline.
82. The method according to any one of claims 68 to 81, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.
83. The method according to any one of claims 68 to 82, wherein the mammalian cell is a human cell.
84. The method according to claim 83, wherein the human cell is a human embryonic kidney (HEK) cell.
85. The method according to any one of claims 68 to 84, wherein the AAV comprises a nucleic acid molecule encoding a gene of interest.
86. The method according to claim 85, wherein the AAV comprises a gene for therapeutic purposes.
87. The method according to any one of claims 68 to 86, wherein the administration comprises inhalation, injection, or intravenous administration.
88. A method for producing adeno-associated virus (AAV), comprising: a. A mammalian cell stably expressing one or more nucleic acids encoding TetR and / or TetR-KRAB i. A first nucleic acid encoding an adenovirus helper gene comprising an E2A gene, an E4Orf gene, and a virus-related non-coding RNA, which is under the control of a first repressible promoter; ii. A second nucleic acid encoding an AAV gene comprising a Rep gene and a Cap gene, which is under the control of a second repressible promoter; iii. Optionally, a third nucleic acid encoding a gene of interest, which is under the control of a third repressible promoter, and transfecting; b. Treating the mammalian cell with the binding partner of TetR; c. Activating the first, second, and third repressible promoters; d. Producing the AAV; e. Recovering the AAV, a method comprising.
89. The method according to claim 88, wherein the mammalian cell is a mammalian cell culture.
90. The method according to claim 88 or 89, wherein the mammalian cell is a Chinese hamster ovary (CHO) cell.
91. The method according to any one of claims 88 to 90, wherein the mammalian cell is a human cell.
92. The method according to claim 91, wherein the human cell is a human embryonic kidney (HEK) cell.
93. The method according to claim 89, wherein the mammalian cell culture is a suspension culture.
94. The method according to any one of claims 88 to 90, further comprising an internal ribosome entry site (IRES) element between the E2A gene and the E4Orf6 gene.
95. Each of the suppressible promoters is a functional promoter and two tetracycline operator arrays (TetO 2 ), the method according to any one of claims 88 to 91.
96. The method according to claim 95, wherein the functional promoter of the first repressible promoter is a cytomegalovirus (CMV) promoter.
97. The method according to any one of claims 88 to 96, wherein the TetR and / or TetR-KRAB is under the control of a constitutive promoter.
98. The method according to claim 97, wherein the nucleic acid encoding TetR-KRAB comprises KRAB fused in-frame with TetR.
99. The method according to any one of claims 88 to 98, wherein the treatment comprises treating with doxycycline.
100. The method according to any one of claims 88 to 99, wherein each of the first, second, and third nucleic acids is adjacent to a transposon-specific inverted terminal repeat (ITR).
101. The method according to any one of claims 88 to 100, wherein the mammalian cell expresses a sufficient amount of TetR and / or TetR-KRAB.
102. The method according to any one of claims 88 to 101, wherein the AAV contains a gene for therapeutic purposes.
103. The method according to any one of claims 88 to 102, wherein the mammalian cell further comprises stable expression of one or more nucleic acids encoding chicken hypersensitive site-4 (cHS4) adjacent to the TetR and / or TetR-KRAB repressor sequence.
104. The method according to any one of claims 88 to 103, wherein the mammalian cell further comprises a selection gene.
105. A method for producing adeno-associated virus (AAV), comprising: a. Transfecting a mammalian cell stably with a nucleic acid encoding TetR and / or a TetR-KRAB repressor, a chicken hypersensitive site-4 (cHS4) sequence adjacent to the TetR and / or TetR-KRAB repressor, and a selection gene; b. Transfecting the stably transfected mammalian cell with i. a first nucleic acid encoding an adenovirus helper gene comprising an E2A gene, an E4Orf gene, and a viral-associated non-coding RNA under the control of a first derepressible promoter, ii. a second nucleic acid encoding an AAV gene comprising a Rep gene and a Cap gene under the control of a second derepressible promoter, and iii. optionally, a third nucleic acid encoding a gene of interest under the control of a third derepressible promoter; c. Treating the stably transfected mammalian cell with a binding partner of TetR; d. Activating the first, second, and third derepressible promoters; e. Producing the AAV; and f. Recovering the AAV.
106. The method according to claim 105, wherein the stably transfected mammalian cell produces a sufficient amount of TetR.
107. The method according to claim 105 or 106, wherein the KRAB repression domain is fused in-frame with the TetR.
Citation Information
Patent Citations
Method for enhancing production efficiency of recombinant aav
JP2001512674A
Cell for producing virus vector, method for producing the virus vector and method for producing virus vector using the cell
JP2002153278A
Pharmacologically induced transgene ablation system
JP2013529063A
Systems for stable gene expression
JP2018508223A
Method for generating replication defective viral vectors that are helper free
US20030152914A1