Immunogenic compositions comprising conjugated capsular saccharide antigens, kits containing the same, and uses thereof

Immunogenic compositions with specific glycoconjugates from various Streptococcus pneumoniae serotypes address the limitations of current vaccines, ensuring broad protection and effective immune responses without interference.

JP2025122002AActive Publication Date: 2025-08-20PFIZER INC
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
JP2025078497
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2015-07-21
Filing Date
2025-05-09
Publication Date
2025-08-20
Estimated Expiration
2036-07-18

AI Technical Summary

Technical Problem

Current pneumococcal vaccines, such as PREVNAR13®, do not provide adequate protection against all Streptococcus pneumoniae serotypes, and administering multiple antigens can lead to antigen competition, reducing immune response effectiveness.

Method used

Development of immunogenic compositions comprising glycoconjugates from serotypes 15B, 22F, 33F, 12F, 10A, and 8, along with additional glycoconjugates from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F, allowing for simultaneous, concurrent, or sequential administration to induce immune responses while minimizing immune interference.

Benefits of technology

The compositions provide broad protection against diverse pneumococcal serotypes, maintaining immune responses to existing vaccine serotypes and reducing the risk of antigen competition.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025122002000001_ABST
    Figure 2025122002000001_ABST
Patent Text Reader

Abstract

To provide novel immunogenic compositions, to provide kits containing the same, and to provide uses thereof.SOLUTION: Provided is a kit for simultaneous, concomitant, or sequential administration of first and second immunogenic compositions comprising: (a) a first immunogenic composition comprising at least one glycoconjugate selected from the group consisting of Streptococcus pneumoniae serotypes 15B, 22F, 33F, 12F, 10A, 11A, and 8; and (b) a second immunogenic composition comprising at least one glycoconjugate derived from a Streptococcus pneumoniae serotype selected from the group consisting of serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F.SELECTED DRAWING: Figure 1
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to novel immunogenic compositions comprising conjugated capsular saccharide antigens (glycoconjugates), kits comprising said immunogenic compositions, and uses thereof. The immunogenic compositions of the invention typically comprise glycoconjugates in which the saccharide is derived from a serotype of Streptococcus pneumoniae. The present invention also relates to vaccination of human subjects, particularly young children and the elderly, against pneumococcal infection using said novel immunogenic compositions and kits. [Background technology]

[0002] Infections caused by pneumococci are a major cause of morbidity and mortality worldwide. Pneumonia, febrile bacteremia, and meningitis are the most common manifestations of invasive pneumococcal disease, while bacterial dissemination within the respiratory tract can lead to middle ear infections, sinusitis, or recurrent bronchitis. Compared to invasive disease, non-invasive manifestations are usually less severe but are also more common.

[0003] In Europe and the United States, pneumococcal pneumonia is the most common community-acquired bacterial pneumonia, estimated to affect approximately 100 per 100,000 adults annually. The corresponding figures for febrile bacteremia and meningitis are 15–19 per 100,000 and 1–2 per 100,000, respectively. The risk of one or more of these manifestations is much higher in young children and the elderly, as well as immunocompromised individuals of any age. Even in economically developed regions, invasive pneumococcal disease has a high mortality rate; for adults with pneumococcal pneumonia, mortality averages 10%–20%, but can exceed 50% in high-risk groups. Pneumonia is by far the most common cause of pneumococcal death worldwide.

[0004] Streptococcus pneumoniae (the pneumococcus), the causative agent of pneumococcal disease, is a Gram-positive, encapsulated cocci surrounded by a polysaccharide capsule. Differences in the composition of this capsule allow serological differentiation among approximately 91 capsular types, some of which are frequently associated with pneumococcal disease, while others are rarely so. Invasive pneumococcal infections include pneumonia, meningitis, and febrile bacteremia; particularly common noninvasive manifestations are otitis media, sinusitis, and bronchitis.

[0005] Pneumococcal conjugate vaccine (PCV) is a pneumococcal vaccine used to protect against disease caused by Streptococcus pneumoniae (S. pneumoniae) (the pneumococcus). Currently, there are three PCV vaccines available on the global market: PREVNAR® (PREVENAR® in some countries) (7-valent vaccine), SYNFLORIX® (10-valent vaccine), and PREVNAR13® (PREVENAR13® in some countries) (13-valent vaccine).

[0006] The recent emergence of widespread microbial resistance to essential antibiotics and the increasing number of immunocompromised people highlight the need for a pneumococcal vaccine that offers even broader protection.

[0007] In particular, there is an unmet medical need for pneumococcal disease coverage that must be addressed, as there are serotypes not found in PREVNAR13® and non-PREVNAR13® serotypes may emerge. The specific disease-causing serotypes beyond the 13 in PREVNAR13® vary by region, population, and may change over time due to the acquisition of antibiotic resistance, the introduction of pneumococcal vaccines, and secular trends of unknown origin. There is a need for immunogenic compositions that can be used to induce immune responses against additional Streptococcus pneumoniae in humans, and particularly in children under the age of 2. Summary of the Invention [Problem to be solved by the invention]

[0008] The objective of the novel immunogenic compositions of the present invention is to provide adequate protection against S. pneumoniae serotypes not found in PREVNAR13®. In one embodiment, the objective of the immunogenic compositions of the present invention is to provide adequate protection against S. pneumoniae serotypes not found in PREVNAR® (7-valent vaccine), SYNFLORIX®, and / or PREVNAR13® while maintaining an immune response to the serotypes currently encompassed by said vaccines.

[0009] The development of multivalent vaccines is complicated by the phenomenon of antigen competition (or interference). Antigen interference refers to the observation that administering multiple antigens can reduce the immune response to a particular antigen compared to the immune response observed when such antigens are administered individually. Its occurrence when creating new combinations of antigens is unpredictable.

[0010] The objective of the immunogenic compositions, kits and administration schedules of the present invention is to provide adequate protection against Streptococcus pneumoniae (S. pneumoniae) serotypes not found in the vaccine, while maintaining an immune response against the serotypes currently encompassed by PREVNAR13® and minimizing the risk of immune interference. [Means for solving the problem]

[0011] To meet these and other needs, the present invention relates to novel immunogenic compositions, kits containing same, and uses thereof. The following sections describe several aspects and embodiments of the invention.

[0012] One aspect of the present invention is a glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 15B, a glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 22F, a glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 33F, a glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F, ...15B, a glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 15B, a glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 15B, a glycoconjugate derived from Streptococcus pneumoniae serotype 15B, a glycoconjugate derived from Streptococcus pneumoniae serotype 15B, a glycoconjugate derived from Streptococcus pneumoniae The present invention relates to an immunogenic composition comprising at least one glycoconjugate selected from the group consisting of a glycoconjugate derived from Streptococcus pneumoniae serotype 10A, a glycoconjugate derived from Streptococcus pneumoniae serotype 11A, and a glycoconjugate derived from Streptococcus pneumoniae serotype 8, wherein the immunogenic composition is a mono-, bi-, tri-, tetra-, pentapeutically, hexa-, or heptavalent pneumococcal conjugate composition.

[0013] In one aspect, the present invention provides a kit comprising: (a) a first immunogenic composition comprising the immunogenic composition; and (b) a second immunogenic composition comprising at least one glycoconjugate derived from a Streptococcus pneumoniae serovar selected from the group consisting of serovars 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, 22F, and 33F.

[0014] In another aspect, the present invention provides said immunogenic compositions for simultaneous, concurrent, concomitant or sequential administration.

[0015] One aspect of the invention provides the immunogenic composition for use in a vaccination schedule. In one embodiment, the vaccination schedule is a single dose schedule. In another embodiment, the vaccination schedule is a multiple dose schedule.

[0016] In certain embodiments, the kit is for simultaneous, concurrent, concomitant or sequential administration of the first and second immunogenic compositions.

[0017] Another aspect of the present invention provides the immunogenic composition or the kit for use as a medicament.

[0018] In one aspect of the invention, the immunogenic composition or the kit is for use as a vaccine.

[0019] In another aspect of the invention, there is provided said immunogenic composition or said kit for use in a method for preventing, treating, or ameliorating a bacterial infection, disease, or condition in a subject.

[0020] In another aspect of the invention, the immunogenic composition or the kit is for use in a method for preventing a bacterial infection, disease or condition in a subject.

[0021] One aspect of the invention provides the immunogenic composition or the kit for use in a method for protecting or treating a human susceptible to pneumococcal infection by administering the immunogenic composition by a systemic or mucosal route. [Brief explanation of the drawings]

[0022] [Figure 1] FIG. 1 shows the repeating polysaccharide structure of Streptococcus pneumoniae (S. pneumoniae) serotype 8 (Pn-8) capsular polysaccharide. [Figure 2] FIG. 1 shows the repeating polysaccharide structure of Streptococcus pneumoniae (S. pneumoniae) serotype 10A (Pn-10A) capsular polysaccharide. [Figure 3] FIG. 1 shows the repeating polysaccharide structure of Streptococcus pneumoniae (S. pneumoniae) serotype 11A (Pn-11A) capsular polysaccharide. [Figure 4] FIG. 1 shows the repeating polysaccharide structure of Streptococcus pneumoniae (S. pneumoniae) serotype 12F (Pn-12F) capsular polysaccharide. [Figure 5] FIG. 1 shows the repeating polysaccharide structure of Streptococcus pneumoniae (S. pneumoniae) serotype 15B (Pn-15B) capsular polysaccharide. [Figure 6] FIG. 1 shows the repeating polysaccharide structure of Streptococcus pneumoniae (S. pneumoniae) serotype 22F (Pn-22F) capsular polysaccharide. [Figure 7] FIG. 1 shows the repeating polysaccharide structure of Streptococcus pneumoniae (S. pneumoniae) serotype 33F (Pn-33F) capsular polysaccharide. [Figure 8] FIG. 1 shows representative process flow diagrams for activation (A) and conjugation (B) processes that can be used in the preparation of Pn-33F glycoconjugates. [Figure 9] FIG. 1 shows the effect of varying the amount of NCS on DO in the TEMPO / NCS oxidation reaction. [Figure 10]FIG. 1 shows the stability evaluation of Pn-12F glycoconjugates. [Figure 11] Figure 1 shows cross-functional OPA responses. A subset of 59 sera from adults vaccinated with a 13-valent pneumococcal conjugate vaccine (US Study 6115A1-004; ClinicalTrials.gov Identifier: NCT00427895) was evaluated in the OPA for the presence of functional antibodies to serotypes 9V, 9A, 9L, and 9N. The percent of samples with OPA-positive titers (i.e., 1:8 or greater) is shown above each group. Geometric mean titers (GMTs) are listed on the x-axis below each group. [Figure 12] Figure 1 shows the cross-functional OPA response of 66 matched pre / post sera. A subset of 66 matched pre- and post-vaccination serum panels from adults vaccinated with the 13-valent pneumococcal conjugate vaccine (Study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572) was evaluated in the OPA for the presence of functional antibodies to serotypes 9V, 9A, 9L, and 9N. The percent of samples with OPA-positive titers (i.e., ≥1:8) is shown above each group. Geometric mean titers (GMTs) are listed on the x-axis below each group. [Figure 13] Figure 1 shows the reverse cumulative distribution curves (RCDC) of OPA titers to serotype 9V (Pn9V) before and after immunization with pneumococcal serotype 9V. Figure 1 shows the reverse cumulative distribution curve of OPA titers to serotype 9V from a matched pre- and post-vaccination serum panel (N=66) vaccinated with the 13-valent pneumococcal conjugate vaccine (Study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). The plot represents the percent of sera with OPA-positive titers (i.e., ≥1:8). [Figure 14]Figure 1 shows the reverse cumulative distribution curves (RCDC) before and after immunization with pneumococcal serotype 9A (Pn9A). Figure 1 shows the reverse cumulative distribution curves (RCDC) of OPA titers against serotype 9A from a matched pre- and post-vaccination serum panel (N=66) vaccinated with a 13-valent pneumococcal conjugate vaccine (Study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). The plot represents the percent of sera with OPA-positive titers (i.e., ≥1:8). [Figure 15] Figure 1 shows the reverse cumulative distribution curves (RCDC) of OPA titers against serotype 9L (Pn9L) from a matched pre- and post-vaccination serum panel (N=66) vaccinated with a 13-valent pneumococcal conjugate vaccine (Study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). The plot represents the percent of sera with OPA-positive titers (i.e., ≥1:8). [Figure 16] Figure 1 shows the reverse cumulative distribution curves (RCDC) of OPA titers against serotype 9N (Pn9N) from a matched pre- and post-vaccination serum panel (N=66) vaccinated with a 13-valent pneumococcal conjugate vaccine (Study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). The plot represents the percent of sera with OPA-positive titers (i.e., ≥1:8). DETAILED DESCRIPTION OF THE INVENTION

[0023] 1. Glycoconjugates of the Present Invention Immunogenic compositions of the invention typically comprise conjugated capsular saccharide antigens (also called glycoconjugates) in which the saccharide is derived from a serovar of Streptococcus pneumoniae (S. pneumoniae).

[0024] If the protein carrier is the same for two or more saccharides in the composition, the saccharides can be conjugated to the same molecule of protein carrier (the carrier molecule having two or more different saccharides conjugated to it) [see, e.g., WO2004 / 083251].

[0025] However, in a preferred embodiment, the saccharides are each individually conjugated to different molecules of protein carrier (each molecule of protein carrier having only one type of saccharide conjugated to it), in which embodiment the capsular saccharides are said to be individually conjugated to the carrier protein.

[0026] For the purposes of the present invention, the term "glycoconjugate" refers to a capsular saccharide covalently linked to a carrier protein. In one embodiment, the capsular saccharide is directly linked to the carrier protein. In a second embodiment, the bacterial saccharide is linked to the protein via a spacer / linker.

[0027] 1.1 Carrier Proteins of the Invention A component of the glycoconjugates of the present invention is a carrier protein to which a saccharide is conjugated. The terms "protein carrier" or "carrier protein" or "carrier" can be used interchangeably herein. The carrier protein should be amenable to standard conjugation procedures.

[0028] In a preferred embodiment, the carrier protein of the glycoconjugate is DT (diphtheria toxin), TT (tetanus toxin) or fragment C of TT, CRM 197(a non-toxic but antigenically identical variant of diphtheria toxin), other DT mutants (CRM176, CRM228, CRM45 (Uchida et al. (1973) J. Biol. Chem. 218:3838-3844), CRM9, CRM102, CRM103, or CRM107; Nicholls and Youle, Genetically Engineered Toxins, Frankel (eds.), Maecel Dekker and other mutations described by Inc. (1992); deletions or mutations of Glu-148 to Asp, Gln, or Ser and / or Ala-158 to Gly and other mutations disclosed in U.S. Pat. Nos. 4,709,017 and 4,950,740; mutations of at least one or more residues of Lys516, Lys526, Phe530, and / or Lys534 and other mutations disclosed in U.S. Pat. Nos. 5,917,017 and 6,455,673; or fragments disclosed in U.S. Pat. No. 5,843,711, pneumococcal pneumolysin (ply) (Kuo et al. (1995) Infect Immun. 63:2706-2713), for example, ply detoxified in some manner, for example, dPLY-GMBS (WO2004 / 081515, WO2006 / 032499) or dPLY-formol, PhtX, for example, PhtA, PhtB, PhtD, PhtE (the sequences of PhtA, PhtB, PhtD or PhtE are disclosed in WO00 / 37105 and WO00 / 39299), and fusions of Pht proteins, for example, PhtDE fusions, PhtBE fusions, PhtAE (WO01 / 98334, WO03 / 054007, WO2009 / 000826), typically from Neisseria meningitidis (Neisseria OMPC (meningococcal outer membrane protein) extracted from Neisseria meningitidis serogroup B (EP0372501), PorB (Neisseria meningitidis (N.meningitidis), PD (Haemophilus influenzae protein D; see, e.g., EP 0594610B), or immunologically functional equivalents thereof, synthetic peptides (EP 0378881, EP 0427347), heat shock proteins (WO 93 / 17712, WO 94 / 03208), pertussis proteins (WO 98 / 58668, EP 0471177), cytokines, lymphokines, growth factors or hormones (WO 91 / 01146), artificial proteins containing multiple human CD4+ T cell epitopes derived from antigens from various pathogens (Falugi et al. (2001) Eur J Immunol 31:3816-3824), e.g., N19 protein (Baraldoi et al. (2004) Infect Immun 72:4884-4887), pneumococcal surface protein PspA (WO02 / 091998), iron uptake protein (WO01 / 72337), Clostridium difficile toxin A or B (WO00 / 61761), transferrin-binding protein, pneumococcal adhesion protein (PsaA), recombinant Pseudomonas aeruginosa exotoxin A (particularly non-toxic variants thereof, such as exotoxin A carrying a substitution at glutamic acid 553 (Douglas et al. (1987) J. Bacteriol. 169(11):4967-4971)). Other proteins, such as ovalbumin, keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA), or purified protein derivative of tuberculin (PPD), can also be used as carrier proteins. Other suitable carrier proteins include cholera toxoid (e.g., as described in WO 2004 / 083251), Escherichia coli LT, E. coli ST, and inactivated bacterial toxins such as exotoxin A from Pseudomonas aeruginosa.

[0029] In a preferred embodiment, the carrier protein of the glycoconjugate is TT, DT, DT variant (CRM197 and the like), Haemophilus influenzae (H. influenzae) protein D, PhtX, PhtD, PhtDE fusions (particularly those described in WO01 / 98334 and WO03 / 054007), detoxified pneumolysin, PorB, N19 protein, PspA, OMPC, Clostridium difficile (C. difficile) toxin A or B, and PsaA.

[0030] In one embodiment, the carrier protein of the glycoconjugate of the invention is DT (diphtheria toxoid). In another embodiment, the carrier protein of the glycoconjugate of the invention is TT (tetanus toxoid).

[0031] In another embodiment, the carrier protein of the glycoconjugate of the invention is PD (H. influenzae protein D; see, eg, EP0594610B).

[0032] In a preferred embodiment, the capsular saccharide of the invention is a CRM 197 Conjugated to a protein. CRM 197 The protein is a non-toxic form of diphtheria toxin, but is immunologically indistinguishable from diphtheria toxin. 197 was generated by nitrosoguanidine mutagenesis of the toxigenic corynephage beta (Uchida et al. (1971) Nature New Biology 233:8-11). tox- CRM is produced by Corynebacterium diphtheriae infected with 197 The protein has the same molecular weight as diphtheria toxin but differs from it by a single base change (guanine to adenine) in the structural gene, which causes an amino acid substitution (glutamic acid to glycine) in the mature protein, eliminating the toxicity of diphtheria toxin. 197Proteins are safe and effective T cell-dependent carriers for saccharides. 197 and further details regarding its production can be found, for example, in US Pat. No. 5,614,382.

[0033] In one embodiment, the capsular saccharide of the invention is CRM 197 Protein or CRM 197 (See CN103495161). In one embodiment, the capsular saccharide of the invention is conjugated to the A chain of CRM obtained via expression in recombinant E. coli. 197 (See CN103495161). In one embodiment, the capsular saccharides of the invention are all conjugated to the A chain of CRM 197 In one embodiment, the capsular saccharides of the invention are all conjugated to CRM 197 It is conjugated to the A chain of

[0034] Thus, in a common embodiment, the glycoconjugates of the invention comprise a CRMP as the carrier protein. 197 wherein the capsular polysaccharide is CRM 197 is covalently linked to

[0035] 1.2 Capsular saccharides of the invention Throughout this specification, the term "saccharide" may include polysaccharides or oligosaccharides, including both. In a common embodiment, the saccharide is a polysaccharide, in particular a S. pneumoniae capsular polysaccharide.

[0036] Capsular polysaccharides are prepared by standard techniques known to those skilled in the art.

[0037] In the present invention, capsular polysaccharides can be prepared from, for example, Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F. Typically, capsular polysaccharides are produced by growing the respective S. pneumoniae serotypes in a medium (e.g., a soy-based medium) and then prepared from bacterial culture. The S. pneumoniae bacterial strains used to produce the respective polysaccharides used in the glycoconjugates of the present invention can be obtained from established culture collections or clinical specimens.

[0038] Populations of organisms (respective S. pneumoniae serotypes) are often scaled up from seed vials to seed bottles and passaged through one or more seed fermentors of increasing capacity until a production-scale fermentation volume is reached. At the end of the growth cycle, the cells are lysed and the lysate broth is harvested for downstream (purification) processing (see, e.g., WO2006 / 110381, WO2008 / 118752, and U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and 2008 / 0286838).

[0039] Individual polysaccharides are typically purified by centrifugation, sedimentation, ultrafiltration, and / or column chromatography (see, for example, WO2006 / 110352 and WO2008 / 118752).

[0040] The purified polysaccharides can be activated (e.g., chemically activated) to allow them to react (e.g., with an eTEC spacer) and then incorporated into the glycoconjugates of the invention, as further described herein.

[0041] The Streptococcus pneumoniae (S. pneumoniae) capsular polysaccharide comprises repeating oligosaccharide units that may contain up to eight sugar residues.

[0042] In one embodiment, the capsular saccharide of the invention may be shorter than the natural length saccharide chain of one oligosaccharide unit or repeating oligosaccharide unit, hi one embodiment, the capsular saccharide of the invention is one repeating oligosaccharide unit of the relevant serotype.

[0043] In one embodiment, the capsular saccharide of the invention may be an oligosaccharide, which has a small number of repeating units (typically 5-15 repeating units) and is typically derived synthetically or by hydrolysis of a polysaccharide.

[0044] Preferably, however, all of the capsular saccharides of the invention and in the immunogenic compositions of the invention are polysaccharides. High molecular weight capsular polysaccharides are capable of inducing a specific antibody immune response due to epitopes present on the antigen surface. Isolation and purification of high molecular weight capsular polysaccharides is preferably contemplated for use in the conjugates, compositions and methods of the invention.

[0045] In some embodiments, the polysaccharide purified prior to conjugation has a molecular weight of between 10 kDa and 4,000 kDa. In other such embodiments, the polysaccharide has a molecular weight of between 50 kDa and 4,000 kDa. In further such embodiments, the polysaccharide has a molecular weight of between 50 kDa and 3,500 kDa; between 50 kDa and 3,000 kDa; between 50 kDa and 2,500 kDa; between 50 kDa and 2,000 kDa; between 50 kDa and 1,750 kDa; between 50 kDa and 1,500 kDa; between 50 kDa and 1,250 kDa; between 50 kDa and 1,000 kDa. kDa;50kDa~750kDa;50kDa~500kDa;100kDa~4,000kDa;100kDa~3,500kDa;100kDa~ 3,000kDa;100kDa~2,500kDa;100kDa~2,250kDa;100kDa~2,000kDa;100kDa~1,750k Da;100kDa~1,500kDa;100kDa~1,250kDa;100kDa~1,000kDa;100kDa~750kDa;100k Da~500kDa;200kDa~4,000kDa;200kDa~3,500kDa;200kDa~3,000kDa;200kDa~2,500 kDa; 200 kDa to 2,250 kDa; 200 kDa to 2,000 kDa; 200 kDa to 1,750 kDa; 200 kDa to 1,500 kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or 200 kDa to 500 kDa. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0046] Polysaccharides may become slightly reduced in size during normal purification procedures. Additionally, as described herein, polysaccharides may be subjected to sizing techniques prior to conjugation. Mechanical or chemical sizing can be used. Chemical hydrolysis can be performed using acetic acid. Mechanical sizing can be performed using high-pressure homogenizing shear. The molecular weight ranges listed above refer to purified polysaccharides prior to conjugation (e.g., prior to activation).

[0047] In a preferred embodiment, the purified polysaccharide is a capsular polysaccharide derived from Streptococcus pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F or 33F, wherein the capsular polysaccharide has a molecular weight within one of the molecular weight ranges set out herein above.

[0048] As used herein, the term "molecular weight" of a polysaccharide or carrier protein-polysaccharide conjugate refers to the molecular weight calculated by size exclusion chromatography (SEC) coupled with a multi-angle laser light scattering detector (MALLS).

[0049] In some embodiments, pneumococcal saccharides from serotypes 9V, 18C, 11A, 15B, 22F and / or 33F of the invention are O-acetylated. In some embodiments, pneumococcal saccharides from serotypes 9V, 11A, 15B, 22F and / or 33F of the invention are O-acetylated.

[0050] The purified polysaccharides described herein are chemically activated to generate saccharides that can react with carrier proteins. These pneumococcal conjugates are prepared by separate processes and formulated into single-dose formulations as described below.

[0051] 1.2.1 Pneumococcal polysaccharides from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F Capsular saccharides from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F can be prepared by standard techniques known to those skilled in the art (see, e.g., WO 2006 / 110381). Capsular polysaccharides can be produced by growing each S. pneumoniae serotype in culture medium; at the end of the growth cycle, the cells are lysed, and the lysate culture is harvested for downstream processing. Individual polysaccharides are typically purified by centrifugation, sedimentation, ultrafiltration, and / or column chromatography (see, e.g., WO 2006 / 110352 and WO 2008 / 118752). The purified polysaccharides can be further processed as further described herein to prepare the glycoconjugates of the invention.

[0052] In some embodiments, the purified polysaccharide from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and / or 23F prior to conjugation has a molecular weight between 10 kDa and 4,000 kDa. In other such embodiments, the polysaccharide has a molecular weight between 50 kDa and 4,000 kDa; 50 kDa and 3,000 kDa; or 50 kDa and 2,000 kDa. In further such embodiments, the polysaccharide is between 50 kDa and 3,500 kDa; 50 kDa and 3,000 kDa; 50 kDa and 2,500 kDa; 50 kDa and 2,000 kDa; 50 kDa and 1,750 kDa; 50 kDa and 1,500 kDa; 50 kDa and 1,250 kDa; 50 kDa and 1,750 kDa; 100kDa~3,500kDa;100kDa~3,000kDa;100kDa~2,500kDa;100kDa~2,000kDa;100kDa~1,750k 200k or 200 kDa to 500 kDa. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0053] Polysaccharides may become slightly reduced in size during normal purification procedures. Additionally, as described herein, polysaccharides may be subjected to sizing techniques prior to conjugation. The molecular weight ranges above refer to purified polysaccharides after the final sizing step and before conjugation (e.g., before activation).

[0054] In some embodiments, pneumococcal saccharides from serotype 9V and / or 18C of the invention are O-acetylated. In some embodiments, pneumococcal saccharides from serotype 9V of the invention are O-acetylated and pneumococcal saccharides from serotype 18C of the invention are de-O-acetylated.

[0055] 1.2.2 Pneumococcus polysaccharide serotype 8 The polysaccharide repeating unit of serotype 8 consists of a linear tetrasaccharide with one glucuronic acid (GlcpA), two glucopyranose (Glcp) and one galactopyranose (Galp) (Jones et al. (1957) The Journal of the American Chemical Society. 79(11):2787-2793). All four monosaccharides are linked by 1,4-linkages, as shown in Figure 1.

[0056] Serotype 8 saccharides can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752). Additionally, they can be produced using synthetic protocols.

[0057] Serotype 8 Streptococcus pneumoniae (S. pneumoniae) strains can be obtained from established culture collections (e.g., Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical specimens.

[0058] In some embodiments, the purified polysaccharide derived from Streptococcus pneumoniae (S. pneumoniae) serotype 8 prior to conjugation has a molecular weight of 10 kDa to 2,000 kDa. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa to 900 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 100 kDa to 800 kDa.

[0059] In further embodiments, the capsular polysaccharide has an affinity of between 100 kDa and 600 kDa; between 100 kDa and 500 kDa; between 100 kDa and 400 kDa; between 150 kDa and 600 kDa; between 150 kDa and 500 kDa; between 150 kDa and 400 kDa; between 200 kDa and 600 kDa; between 200 kDa and 500 kDa; between 200 kDa and 400 kDa; and similar desired molecular weight ranges. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0060] Polysaccharides may become slightly reduced in size during normal purification procedures. Additionally, as described herein, polysaccharides may be subjected to sizing techniques prior to conjugation. The molecular weight ranges above refer to purified polysaccharides after the final sizing step and before conjugation (e.g., before activation).

[0061] 1.2.3 Pneumococcus polysaccharide serotype 10A The polysaccharide repeating unit of serotype 10A contains two galactofuranose residues (Gal f ), three galactopyranose (Gal p ), one N-acetylgalactosamine (Gal pIt consists of a branched hexasaccharide repeating unit with a β-GalpNAc moiety (β-3-Galp and β-6-Galf) and a phosphoribitol backbone (Jones, C. (2005) Carbohydrate Research 269(1):175-181). As shown in Figure 2, there are two branched monosaccharides in the β-GalpNAc moiety (β-3-Galp and β-6-Galf).

[0062] Serotype 10A saccharides can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752). Additionally, they can be produced using synthetic protocols.

[0063] Serotype 10A Streptococcus pneumoniae (S. pneumoniae) strains can be obtained from established culture collections (e.g., the Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical specimens.

[0064] In some embodiments, the purified polysaccharide from Streptococcus pneumoniae (S. pneumoniae) serotype 10A prior to conjugation has a molecular weight of 10 kDa to 2,000 kDa. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa to 900 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 100 kDa to 800 kDa.

[0065] In further embodiments, the capsular polysaccharide is between 100 kDa and 600 kDa; 100 kDa and 500 kDa; 100 kDa and 400 kDa; 150 kDa and 600 kDa; 150 kDa and 500 kDa; 150 kDa and 400 kDa; 200 kDa and 600 kDa; 200 kDa and 500 kDa; 200 kDa and 400 kDa; 2 and similar desired molecular weight ranges. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0066] Polysaccharides may become slightly reduced in size during normal purification procedures. Additionally, as described herein, polysaccharides may be subjected to sizing techniques prior to conjugation. The molecular weight ranges above refer to purified polysaccharides after the final sizing step and before conjugation (e.g., before activation).

[0067] 1.2.4 Pneumococcus polysaccharide serotype 11A The polysaccharide repeating unit of serotype 11A is a linear tetrasaccharide backbone (two galactopyranose (Gal) p ) and two glucopyranose (Glc p )) and pendant phosphoglycerol (Richards et al. (1988) Adv. Exp. Med. Biol. 228:595-597). The polysaccharide is O-acetylated at multiple positions, and based on reported data in the literature (Calix et al. (2011) J. Bacteriol. 193(19):5271-5278), the total amount of O-acetylation in the 11A polysaccharide is approximately 2.6 O-acetyl groups per polysaccharide repeat unit.

[0068] Serotype 11A saccharides can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752). Additionally, they can be produced using synthetic protocols.

[0069] Serotype 11A Streptococcus pneumoniae (S. pneumoniae) strains can be obtained from established culture collections (e.g., the Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical specimens.

[0070] The isolated serotype 11A capsular polysaccharide obtained by purification of serotype 11A polysaccharide from Streptococcus pneumoniae (S. pneumoniae) lysate, and optionally the sizing of the purified polysaccharide, can be characterized by various attributes, including, for example, molecular weight (MW) and mM acetate per mM of said serotype 11A capsular polysaccharide.

[0071] In some embodiments, the purified polysaccharide from Streptococcus pneumoniae (S. pneumoniae) serotype 11A prior to conjugation has a molecular weight of 10 kDa to 2,000 kDa. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa to 900 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 100 kDa to 800 kDa.

[0072] In further embodiments, the capsular polysaccharides are between 100 kDa and 600 kDa; 100 kDa and 500 kDa; 100 kDa and 400 kDa; 100 kDa and 300 kDa; 100 kDa and 200 kDa; 150 kDa and 600 kDa; 150 kDa and 500 kDa; 150 kDa and 400 kDa; 150 kDa and 300 kDa; 150 kDa and 200 kDa; 200 kDa and 600 kDa; and similar desired molecular weight ranges. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0073] Polysaccharides may become slightly reduced in size during normal purification procedures. Additionally, as described herein, polysaccharides may be subjected to sizing techniques prior to conjugation. The molecular weight ranges above refer to purified polysaccharides after the final sizing step and before conjugation (e.g., before activation).

[0074] In one embodiment, the purified serotype 11A polysaccharide is reduced in size by high-pressure homogenization, which achieves high shear rates by pumping the process stream through a channel with sufficiently small dimensions. The shear rate can be increased by using a higher applied homogenization pressure, and the exposure time can be increased by recirculating the feed stream through the homogenizer.

[0075] The high-pressure homogenization process is particularly suitable for reducing the size of purified serotype 11A polysaccharide while retaining structural features of the polysaccharide, such as the presence of O-acetyl groups.

[0076] The presence of O-acetyl in purified, isolated, or activated serotype 11A capsular polysaccharide or in serotype 11A polysaccharide-carrier protein conjugates is expressed as mM acetate per mM of said polysaccharide or as the number of O-acetyl groups per polysaccharide repeat unit.

[0077] In preferred embodiments, the purified polysaccharide derived from Streptococcus pneumoniae (S. pneumoniae) serotype 11A has at least 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4 or 1.6 μmol of acetate per μmol of said serotype 11A capsular polysaccharide.

[0078] 1.2.5 Pneumococcus polysaccharide serotype 12F The polysaccharide repeating unit of serotype 12F consists of two branches: Fuc p The pendant α-galactopyranose (Gal p ) and Man p α-Glc linked at C3 of NAcA p -(1→2)-α-Glc p A linear trisaccharide backbone (one N-acetylfucosamine (Fuc)) with a disaccharide branch p NAc), one N-acetylgalactosamine (Gal p NAc) and one N-acetylmannuronic acid (Man p NAcA) (Leontein et al. (1983) Carbohydrate Research 114(2):257-266)).

[0079] Serotype 12F Streptococcus pneumoniae strains can be obtained from established culture collections (e.g., the Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical specimens.

[0080] Capsular saccharides from S. pneumoniae serotype 12F are prepared by standard techniques known to those skilled in the art. Typically, capsular polysaccharides are produced by growing the respective S. pneumoniae serotype in a medium (e.g., a soy-based medium), and then the polysaccharide is prepared from the bacterial culture. The population of organisms (S. pneumoniae serotype 12F) is scaled up from seed vials to seed bottles and often passaged through one or more seed fermentors of increasing volume until a production-scale fermentation capacity is reached. At the end of the growth cycle, the cells are lysed and the lysate culture medium is harvested for downstream (purification) processing (see, e.g., WO2006 / 110381 and WO2008 / 118752, U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and 2008 / 0286838). The polysaccharide is typically purified by centrifugation, sedimentation, ultrafiltration, and / or column chromatography (see, e.g., WO2006 / 110352 and WO2008 / 118752).

[0081] As further described herein, purified polysaccharides derived from serotype 12F can be activated (e.g., chemically activated) to render them reactive and then incorporated into the glycoconjugates of the invention.

[0082] In some embodiments, the purified polysaccharide derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F prior to conjugation has a molecular weight of 10 kDa to 2,000 kDa. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 300 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa to 300 kDa. In further embodiments, the capsular polysaccharide is between 90 kDa and 250 kDa; 90 kDa and 150 kDa; 90 kDa and 120 kDa; 80 kDa and 120 kDa; 70 kDa and 100 kDa; 70 kDa and 110 kDa; 70 kDa and 120 kDa; 70 kDa and 130 kDa; 70 kDa and 140 kDa; 70 kDa and 150 kDa; 70 kDa and 160 kDa; 80 kDa and 110 kDa; 80 kDa and 120 kDa; 80 kDa and 130 kDa; 80 kDa and similar desired molecular weight ranges. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0083] Polysaccharides may become slightly reduced in size during normal purification procedures. Additionally, as described herein, polysaccharides may be subjected to sizing techniques prior to conjugation. The molecular weight ranges above refer to purified polysaccharides after the final sizing step and before conjugation (e.g., before activation).

[0084] 1.2.6 Pneumococcus polysaccharide serotype 15B As shown in Figure 5, the polysaccharide repeating unit of serotype 15B is Glc p αGal linked to the C4 hydroxyl group of NAc p -βGalp A branched trisaccharide backbone (one N-acetylglucosamine (Glc)) with a disaccharide p NAc), one galactopyranose (Gal p ) and one glucopyranose (Glc p )) Phosphoglycerol is converted to βGal in the disaccharide branch. p The capsular polysaccharide from serotype 15C has the same backbone structure as serotype 15B but lacks O-acetylation.

[0085] Serotype 15B polysaccharides can be obtained directly from bacteria using isolation procedures known to those of skill in the art (see, e.g., the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752), or they can be produced using synthetic protocols known to those of skill in the art.

[0086] Serotype 15B Streptococcus pneumoniae (S. pneumoniae) strains can be obtained from established culture collections (e.g., American Type Culture Collection (ATCC), Manassas, VA USA) (e.g., deposited strain ATCC10354) or Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA USA)) or clinical specimens.

[0087] The bacterial cells are grown in a medium, preferably a soy-based medium. After fermentation of the bacterial cells to produce Streptococcus pneumoniae serotype 15B capsular polysaccharide, the bacterial cells are lysed to obtain a cell lysate. The serotype 15B polysaccharide can then be isolated from the cell lysate using purification techniques known in the art, including centrifugation, depth filtration, sedimentation, ultrafiltration, treatment with activated carbon, diafiltration, and / or column chromatography (see, e.g., U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752). The purified serotype 15B capsular polysaccharide can then be used for the preparation of immunogenic conjugates.

[0088] The sizing of the isolated serotype 15B capsular polysaccharide, and optionally the purified polysaccharide, obtained by purification of serotype 15B polysaccharide from Streptococcus pneumoniae (S. pneumoniae) lysate can be characterized by various parameters, including, for example, molecular weight (MW), mM acetate per mM of said serotype 15B capsular polysaccharide, and mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0089] Preferably, to produce a 15B conjugate with advantageous filtration characteristics and / or yield, sizing of the polysaccharide to a target molecular weight range is performed prior to conjugation to the carrier protein. Advantageously, the size of the purified serotype 15B polysaccharide is reduced while retaining important structural features of the polysaccharide, such as the presence of O-acetyl groups. Preferably, the size of the purified serotype 15B polysaccharide is reduced by mechanical homogenization.

[0090] In a preferred embodiment, the purified serotype 15B polysaccharide is reduced in size by high-pressure homogenization, which achieves high shear rates by pumping the process stream through a channel with sufficiently small dimensions. The shear rate can be increased by using a larger applied homogenization pressure, and the exposure time can be increased by recirculating the feed stream through the homogenizer.

[0091] The high-pressure homogenization process is particularly suitable for reducing the size of purified serotype 15B polysaccharide while retaining structural features of the polysaccharide, such as the presence of O-acetyl groups.

[0092] In preferred embodiments, the isolated serotype 15B capsular polysaccharide has a molecular weight of 5 kDa to 500 kDa, 50 kDa to 500 kDa, 50 kDa to 450 kDa, 100 kDa to 400 kDa, and 100 kDa to 350 kDa. In preferred embodiments, the isolated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 350 kDa. In preferred embodiments, the isolated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 300 kDa. In preferred embodiments, the isolated serotype 15B capsular polysaccharide has a molecular weight of 150 kDa to 300 kDa. In preferred embodiments, the isolated serotype 15B capsular polysaccharide has a molecular weight of 150 kDa to 350 kDa. In further embodiments, the capsular polysaccharide has a molecular weight of 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa; 100 kDa to 200 kDa; 150 kDa to 500 kDa; 150 kDa to 400 kDa; 150 kDa to 300 kDa; 150 kDa to 200 kDa; 200 kDa to 500 kDa; 200 kDa to 400 kDa; 250 kDa to 500 kDa; 250 kDa to 400 kDa; 250 kDa to 350 kDa; 300 kDa to 500 kDa; 300 kDa to 400 kDa; and similar desired molecular weight ranges. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0093] Serotype 15B polysaccharides are O-acetylated, with a total amount of O-acetylation of approximately 0.8-0.9 O-acetyl groups per polysaccharide repeating unit. The degree of O-acetylation of a polysaccharide can be determined by any method known in the art, for example, by proton NMR (see, e.g., Lemercinier et al. (1996) Carbohydrate Research 296:83-96; Jones et al. (2002) J. Pharmaceutical and Biomedical Analysis 30:1233-1247; WO 2005 / 033148 and WO 00 / 56357). Another commonly used method is described in Hestrin, S. (1949) J. Biol. Chem. 180:249-261. Preferably, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0094] The presence of O-acetyl in purified, isolated, or activated serotype 15B capsular polysaccharide or in serotype 15B polysaccharide-carrier protein conjugates is expressed as mM acetate per mM of said polysaccharide or as the number of O-acetyl groups per polysaccharide repeat unit.

[0095] In preferred embodiments, the isolated serotype 15B capsular polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM acetate per mM of said serotype 15B capsular polysaccharide. In preferred embodiments, the isolated serotype 15B capsular polysaccharide comprises at least 0.5, 0.6, or 0.7 mM acetate per mM of said serotype 15B capsular polysaccharide. In preferred embodiments, the isolated serotype 15B capsular polysaccharide comprises at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide. In preferred embodiments, the isolated serotype 15B capsular polysaccharide comprises at least 0.7 mM acetate per mM of said serotype 15B capsular polysaccharide.

[0096] The presence of glycerol phosphate side chains is determined by measuring glycerol using high-performance anion exchange chromatography with pulsed amperometric detection (HPAEC-PAD) after liberation by treating the polysaccharide with hydrofluoric acid (HF). The presence of glycerol in purified, isolated, or activated serotype 15B polysaccharide or in serotype 15B polysaccharide-carrier protein conjugates is expressed as mM glycerol per mM serotype 15B polysaccharide.

[0097] In preferred embodiments, the isolated serotype 15B capsular polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM glycerol per mM of said serotype 15B capsular polysaccharide. In preferred embodiments, the isolated serotype 15B capsular polysaccharide comprises at least 0.5, 0.6, or 0.7 mM glycerol per mM of said serotype 15B capsular polysaccharide. In preferred embodiments, the isolated serotype 15B capsular polysaccharide comprises at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide. In preferred embodiments, the isolated serotype 15B capsular polysaccharide comprises at least 0.7 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0098] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of between 100 kDa and 350 kDa and comprises at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide.

[0099] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of between 100 kDa and 350 kDa and comprises at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0100] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of between 150 kDa and 300 kDa and comprises at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide.

[0101] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of between 150 kDa and 300 kDa and comprises at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0102] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of between 150 kDa and 350 kDa and comprises at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide.

[0103] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of between 150 kDa and 350 kDa and comprises at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0104] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide comprises at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide and at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0105] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of between 100 kDa and 350 kDa and comprises at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide and at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0106] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of between 150 kDa and 300 kDa and comprises at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide and at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0107] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of between 150 kDa and 350 kDa and comprises at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide and at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0108] 1.2.7 Pneumococcus polysaccharide serotype 22F As shown in Figure 6, the polysaccharide repeating unit of serotype 22F is βRha p αGlc linked to the C3 hydroxyl group of p A branched pentasaccharide backbone (one glucuronic acid (Glc) p A), one glucopyranose (Glc p ), one galactofuranose (Gal f ) and two rhamnopyranoses (Rha p )) (Richards et al. (1989), Canadian Journal of Chemistry 67(6):1038-1050). p The C2 hydroxyl group of approximately 80% of the residues is O-acetylated.

[0109] Serotype 22F polysaccharides can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752). Additionally, they can be produced using synthetic protocols.

[0110] Serotype 22F Streptococcus pneumoniae (S. pneumoniae) strains can be obtained from established culture collections (e.g., the Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical specimens.

[0111] The sizing of the isolated serotype 22F capsular polysaccharide and, optionally, the purified polysaccharide obtained by purification of serotype 22F polysaccharide from Streptococcus pneumoniae (S. pneumoniae) lysate can be characterized by various parameters, including, for example, molecular weight (MW) and mM acetate per mM of said serotype 22F capsular polysaccharide.

[0112] Preferably, to produce a serotype 22F conjugate with advantageous filtration characteristics and / or yield, sizing of the polysaccharide to a target molecular weight range is performed prior to conjugation to the carrier protein. Advantageously, the size of the purified serotype 22F polysaccharide is reduced while retaining important structural features of the polysaccharide, such as the presence of O-acetyl groups. Preferably, the size of the purified serotype 22F polysaccharide is reduced by mechanical homogenization.

[0113] In a preferred embodiment, the purified polysaccharides are reduced in size by high-pressure homogenization, which achieves high shear rates by pumping the process stream through channels with sufficiently small dimensions. The shear rate can be increased by using a larger applied homogenization pressure, and the exposure time can be increased by recirculating the feed stream through the homogenizer.

[0114] The high-pressure homogenization process is particularly suitable for reducing the size of purified serotype 22F polysaccharide while retaining structural features of the polysaccharide, such as the presence of O-acetyl groups.

[0115] In some embodiments, the purified polysaccharide from Streptococcus pneumoniae (S. pneumoniae) serotype 22F prior to conjugation has a molecular weight of 10 kDa to 2,000 kDa. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa to 900 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 100 kDa to 800 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 200 kDa to 600 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 400 kDa to 700 kDa.

[0116] In further embodiments, the capsular polysaccharides are from 100 kDa to 1,000 kDa; 100 kDa to 900 kDa; 100 kDa to 800 kDa; 100 kDa to 700 kDa; 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa; 150 kDa to 1,000 kDa; 150 kDa to 900 kDa; 150 kDa to 800kDa;150kDa~700kDa;150kDa~600kDa;150kDa~500kDa;150kDa~400kDa;150kDa~300kDa;200kDa~1 ,000kDa;200kDa~900kDa;200kDa~800kDa;200kDa~700kDa;200kDa~600kDa;200kDa~500kDa;200kDa~4 00kDa;200kDa~300kDa;250kDa~1,000kDa;250kDa~900kDa;250kDa~800kDa;250kDa~700kDa;250kDa~ 600kDa;250kDa~500kDa;250kDa~400kDa;250kDa~350kDa;300kDa~1,000kDa;300kDa~900kDa;300kDa~ and similar desired molecular weight ranges. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0117] The polysaccharide may undergo slight size reduction during normal purification procedures. Furthermore, as described herein above, the 22F polysaccharide may be subjected to sizing techniques prior to conjugation. The molecular weight ranges above refer to the purified polysaccharide after the final sizing step and before conjugation (e.g., before activation).

[0118] The degree of O-acetylation of polysaccharides can be determined by any method known in the art, for example, by proton NMR (see Lemercinier et al. (1996) Carbohydrate Research 296:83-96; Jones et al. (2002) J. Pharmaceutical and Biomedical Analysis 30:1233-1247; WO 2005 / 033148 and WO 00 / 56357). Another commonly used method is described in Hestrin, S. (1949) J. Biol. Chem. 180:249-261. Preferably, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0119] The presence of O-acetyl in purified, isolated, or activated serotype 22F capsular polysaccharide or in serotype 22F polysaccharide-carrier protein conjugates is expressed as mM acetate per mM of the polysaccharide or as the number of O-acetyl groups per polysaccharide repeat unit.

[0120] In preferred embodiments, the purified polysaccharide from S. pneumoniae serotype 22F has at least 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4 or 1.6 μmol of acetate per μmol of said serotype 22F capsular polysaccharide.

[0121] 1.2.8 Pneumococcus polysaccharide serotype 33F As shown in Figure 7, the polysaccharide repeating unit of serotype 33F contains αGal in the backbone. p Terminal αGal linked to the C2 hydroxyl group of the residue p A branched pentasaccharide backbone (two galactopyranoses (Gal p ), two galactofuranose (Gal f ) and one glucopyranose (Glc p )) (Lemercinier et al. (2006), Carbohydrate Research 341(1):68-74). fIt has been reported in the literature that the C2 hydroxyl group of the residue is O-acetylated.

[0122] Serotype 33F polysaccharides can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, the methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO2008 / 118752). Additionally, they can be produced using synthetic protocols.

[0123] Serotype 33F Streptococcus pneumoniae (S. pneumoniae) strains can be obtained from established culture collections (e.g., the Streptococcal Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA)) or clinical specimens.

[0124] Purified polysaccharides from serotype 33F can be activated (e.g., chemically activated) to render them reactive and then incorporated into the glycoconjugates of the invention, as further described herein.

[0125] The sizing of the isolated serotype 33F capsular polysaccharide and, optionally, the purified polysaccharide obtained by purification of serotype 33F polysaccharide from Streptococcus pneumoniae (S. pneumoniae) lysate can be characterized by various parameters, including, for example, molecular weight and mM acetate per mM of said serotype 33F capsular polysaccharide.

[0126] In some embodiments, the purified polysaccharide from Streptococcus pneumoniae (S. pneumoniae) serotype 33F prior to conjugation has a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the saccharide has a molecular weight of 50 kDa to 2,000 kDa. In further such embodiments, the saccharide has a molecular weight of 50 kDa to 1,750 kDa; 50 kDa to 15,000 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 7,500 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,2 and having a molecular weight of 50 kDa; 100 kDa to 1,000 kDa; 100 kDa to 750 kDa; 100 kDa to 500 kDa; 200 kDa to 2,000 kDa; 200 kDa to 1,750 kDa; 200 kDa to 1,500 kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or 200 kDa to 500 kDa. All integers within any of the above ranges are contemplated as embodiments of the present disclosure.

[0127] Polysaccharides may become slightly reduced in size during normal purification procedures. Additionally, as described herein, polysaccharides may be subjected to sizing techniques prior to conjugation. The molecular weight ranges above refer to purified polysaccharides after the final sizing step and before conjugation (e.g., before activation).

[0128] The presence of O-acetyl in purified, isolated, or activated serotype 33F capsular polysaccharide or in serotype 33F polysaccharide-carrier protein conjugates is expressed as mM acetate per mM of said polysaccharide or as the number of O-acetyl groups per polysaccharide repeat unit.

[0129] In preferred embodiments, the purified polysaccharide from S. pneumoniae serotype 33F has at least 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4 or 1.6 μmol of acetate per μmol of said serotype 33F capsular polysaccharide.

[0130] 1.3 Glycoconjugates of the Invention The purified saccharides are chemically activated to create saccharides that can react with a carrier protein (i.e., activated saccharides). Once activated, each capsular saccharide is separately conjugated to a carrier protein to form a glycoconjugate. In one embodiment, each capsular saccharide is conjugated to the same carrier protein. Chemical activation of the saccharides and subsequent conjugation to a carrier protein can be achieved by the activation and conjugation methods disclosed herein.

[0131] 1.3.1 Glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F Capsular polysaccharides from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F are prepared by standard techniques known to those skilled in the art (see, e.g., WO2006 / 110381, WO2008 / 118752, WO2006 / 110352, and U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and 2008 / 0286838).

[0132] In one embodiment, the polysaccharide is activated with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide is then coupled to a carrier protein (preferably a CRM). 197The polysaccharide is coupled to an amino group on the carrier directly or via a spacer (linker) group. For example, the spacer may be cystamine or cysteamine to obtain a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., using N-[γ-maleimidobutyryloxy]succinimide ester (GMBS)) or a haloacetylated carrier protein (e.g., iodoacetimide, N-succinimidyl bromoacetate (SBA; SIB), N-succinimidyl(4-iodoacetyl)aminobenzoate (SIAB), sulfosuccinimidyl(4-iodoacetyl)aminobenzoate (sulfo-SIAB), N-succinimidyl iodoacetate (SIA), or succinimidyl 3-[bromoacetamido]propionate (SBAP)). Preferably, cyanate esters (which may be generated by CDAP chemistry) are coupled with hexanediamine or adipic acid dihydrazide (ADH), and amino-derivatized saccharides are attached to carrier proteins (e.g., CRMs) using carbodiimide (e.g., EDAC or EDC) chemistry via carboxyl groups on the protein carrier. 197 Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO 96 / 129094.

[0133] Other suitable techniques for conjugation use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may also involve a carbonyl linker, which can be formed by reacting the free hydroxyl group of a sugar with 1,1'-carbonyldiimidazole (CDI) (see Bethell et al. (1979) J. Biol. Chern. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by reaction with a protein to form a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate with an amino group on the protein.

[0134] In a preferred embodiment, at least one capsular polysaccharide from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F of Streptococcus pneumoniae is conjugated to a carrier protein by reductive amination (as described in U.S. Patent Application Publication Nos. 2006 / 0228380, 2007 / 0231340, 2007 / 0184071, and 2007 / 0184072, WO2006 / 110381, WO2008 / 079653, and WO2008 / 143709). In a preferred embodiment, capsular polysaccharides from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F of Streptococcus pneumoniae are all conjugated to carrier proteins by reductive amination.

[0135] Reductive amination involves two steps: (1) oxidation of the polysaccharide, and (2) reduction of the activated polysaccharide and carrier protein to form a conjugate. Prior to oxidation, the polysaccharide may be hydrolyzed. Mechanical or chemical hydrolysis may be used. Chemical hydrolysis may be carried out using acetic acid. The oxidation step may involve reaction with periodate. For purposes of the present invention, the term "periodate" includes both periodate and periodic acid; the term also includes metaperiodate (IO4 - ) and orthoperiodate (IO6 5- ) and various salts of periodate (e.g., sodium periodate and potassium periodate).

[0136] In one embodiment, capsular polysaccharides from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, or 23F of S. pneumoniae are oxidized in the presence of metaperiodate, preferably sodium periodate (NaIO). In another embodiment, capsular polysaccharides from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F of S. pneumoniae are oxidized in the presence of orthoperiodate, preferably periodic acid.

[0137] After the polysaccharide oxidation step, the polysaccharide is said to be activated and is hereinafter referred to as "activated polysaccharide." The activated polysaccharide and carrier protein can be lyophilized (freeze-dried) independently (separate lyophilization) or together (co-lyophilization). In one embodiment, the activated polysaccharide and carrier protein are lyophilized simultaneously. In another embodiment, the activated polysaccharide and carrier protein are lyophilized independently.

[0138] In one embodiment, lyophilization is carried out in the presence of a non-reducing sugar, possible non-reducing sugars include sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol and palatinit.

[0139] The second step of the conjugation process is the reduction of the activated polysaccharide and carrier protein with a reducing agent (so-called reductive amination) to form a conjugate. Suitable reducing agents include cyanoborohydrides such as sodium cyanoborohydride, borane-pyridine, or borohydride exchange resins. In one embodiment, the reducing agent is sodium cyanoborohydride.

[0140] In one embodiment, the reduction reaction is carried out in an aqueous solvent, and in another embodiment, the reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.

[0141] At the end of the reduction reaction, there may be unreacted aldehyde groups remaining in the conjugate, which can be capped with a suitable capping agent. In one embodiment, the capping agent is sodium borohydride (NaBH4). After conjugation (reduction reaction and, optionally, capping), the glycoconjugate can be purified. The glycoconjugate can be purified by diafiltration and / or ion exchange chromatography and / or size exclusion chromatography. In one embodiment, the glycoconjugate is purified by diafiltration or ion exchange chromatography or size exclusion chromatography. In one embodiment, the glycoconjugate is sterile filtered.

[0142] In some embodiments, glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 9V and / or 18C comprise saccharides having a degree of O-acetylation of 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 75%-100%, 80%-100%, 90%-100%, 50%-90%, 60%-90%, 70%-90%, or 80%-90%. In other embodiments, the degree of O-acetylation is 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, or 90% or more, or about 100%.

[0143] In some embodiments, glycoconjugates derived from S. pneumoniae serotype 9V and / or 18C of the present invention are O-acetylated. In some embodiments, glycoconjugates derived from S. pneumoniae serotype 9V are O-acetylated and glycoconjugates derived from S. pneumoniae serotype 18C are de-O-acetylated.

[0144] 1.3.2 Glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 22F In one embodiment, serotype 22F glycoconjugates are obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled to an amino group on a carrier protein directly or via a spacer (linker) group. For example, cystamine or cysteamine may be used as the spacer to obtain a thiolated polysaccharide, which can be coupled to a carrier via a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., with GMBS) or a haloacetylated carrier protein (e.g., with iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, cyanate esters (which may be generated by CDAP chemistry) are coupled with hexanediamine or adipic acid dihydrazide (ADH), and the amino-derivatized saccharides are conjugated to carrier proteins via carboxyl groups on the protein carrier using carbodiimide (e.g., EDAC or EDC) chemistry. Such conjugates are described, for example, in WO93 / 15760, WO95 / 08348, and WO96 / 129094.

[0145] Other suitable techniques use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reaction of a free hydroxyl group of a sugar with CDI (see Bethell et al. (1979) J. Biol. Chern. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate with an amino group on the protein.

[0146] In a preferred embodiment, the serotype 22F glycoconjugates of the invention are prepared using reductive amination, which involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from vicinal diols in the individual hexasaccharide units, and (2) coupling of the activated polysaccharide and carrier protein (e.g., CRM) to form the conjugate. 197 ) reduction.

[0147] Preferably, prior to oxidation, serotype 22F polysaccharide is sizing to a target molecular weight (MW) range. Advantageously, the size of the purified serotype 22F polysaccharide is reduced while retaining important structural features of the polysaccharide, such as the presence of O-acetyl groups. Preferably, the size of the purified serotype 22F polysaccharide is reduced by mechanical homogenization (see section 1.2.7 above).

[0148] In one embodiment, the serotype polysaccharide is (a) reacting the isolated serotype 22F polysaccharide with an oxidizing agent; and (b) quenching the oxidation reaction by adding a quenching agent to obtain activated serotype 22F polysaccharide. It is activated (oxidized) by a process that includes

[0149] In a preferred embodiment, the oxidizing agent is periodate. For purposes of the present invention, the term "periodate" includes both periodate and periodic acid; the term also includes metaperiodate (IO4 - ) and orthoperiodate (IO6 5- ) and various salts of periodate (e.g., sodium periodate and potassium periodate). In a preferred embodiment, the oxidizing agent is sodium periodate. In a preferred embodiment, the periodate used to oxidize serotype 22F polysaccharide is metaperiodate. In a preferred embodiment, the periodate used to oxidize serotype 22F polysaccharide is sodium metaperiodate.

[0150] In one embodiment, the quenching agent is selected from a vicinal diol, a 1,2-amino alcohol, an amino acid, glutathione, a sulfite, a bisulfite, a dithionite, a metabisulfite, a thiosulfate, a phosphite, a hypophosphite, or a phosphorous acid.

[0151] In one embodiment, the quenching agent has the formula (I):

[0152] [ka] (In the formula, R 1 is selected from H, methyl, ethyl, propyl, or isopropyl) is a 1,2-amino alcohol.

[0153] In one embodiment, the quenching agent is selected from sodium and potassium salts of sulfites, bisulfites, dithionites, metabisulfites, thiosulfates, phosphites, hypophosphites or phosphorous acid.

[0154] In one embodiment, the quenching agent is an amino acid, which may be selected from serine, threonine, cysteine, cystine, methionine, proline, hydroxyproline, tryptophan, tyrosine, and histidine.

[0155] In one embodiment, the quenching agent is a sulfite, such as bisulfite, dithionite, metabisulfite, or thiosulfate.

[0156] In one embodiment, the quenching agent is a compound containing two vicinal hydroxyl groups (vicinal diol), ie, two hydroxyl groups covalently linked to two adjacent carbon atoms.

[0157] Preferably, the quenching agent has the formula (II):

[0158] [ka] (In the formula, R 1 and R 2 are each independently selected from H, methyl, ethyl, propyl, or isopropyl.

[0159] In a preferred embodiment, the quenching agent is glycerol, ethylene glycol, propane-1,2-diol, butane-1,2-diol or butane-2,3-diol, or ascorbic acid. In a preferred embodiment, the quenching agent is butane-2,3-diol.

[0160] In a preferred embodiment, the isolated serotype 22F polysaccharide is (a) reacting the isolated serotype 22F polysaccharide with periodate; and (b) quenching the oxidation reaction by the addition of butane-2,3-diol to obtain activated serotype 22F polysaccharide. It is activated by a process including

[0161] After the oxidation step of the polysaccharide, the polysaccharide is said to be activated and is hereinafter referred to as "activated polysaccharide".

[0162] In a preferred embodiment, the activated serotype 22F polysaccharide is purified. The activated serotype 22F polysaccharide is purified according to methods known to those skilled in the art, such as gel permeation chromatography (GPC), dialysis, or ultrafiltration / diafiltration. For example, the activated 22F polysaccharide is purified by concentration and diafiltration using an ultrafiltration device.

[0163] In preferred embodiments, the degree of oxidation of the activated serotype 22F polysaccharide is 2 to 30, 2 to 25, 2 to 20, 2 to 15, 2 to 10, 2 to 5, 5 to 30, 5 to 25, 5 to 20, 5 to 15, 5 to 10, 10 to 30, 10 to 25, 10 to 20, 10 to 15, 15 to 30, 15 to 25, 15 to 20, 20 to 30, or 20 to 25. In preferred embodiments, the degree of oxidation of the activated serotype 22F polysaccharide is 2 to 10, 4 to 8, 4 to 6, 6 to 8, 6 to 12, 8 to 14, 9 to 11, 10 to 16, 12 to 16, 14 to 18, 16 to 20, 16 to 18, 18 to 22, or 18 to 20.

[0164] In a preferred embodiment, the activated serotype 22F polysaccharide has a molecular weight of 25 kDa to 1,000 kDa, 100 kDa to 1,000 kDa, 300 kDa to 800 kDa, 300 kDa to 700 kDa, 300 kDa to 600 kDa, 400 kDa to 1,000 kDa, 400 kDa to 800 kDa, 400 kDa to 700 kDa, or 400 kDa to 600 kDa. In one embodiment, the activated serotype 22F polysaccharide has a molecular weight of 300 kDa to 800 kDa. In one embodiment, the activated serotype 22F polysaccharide has a molecular weight of 400 kDa to 600 kDa. In a preferred embodiment, the activated serotype 22F polysaccharide has a molecular weight of 400 kDa to 600 kDa and a degree of oxidation of 10 to 25, 10 to 20, 12 to 20, or 14 to 18. In a preferred embodiment, the activated serotype 22F polysaccharide has a molecular weight of 400 kDa to 600 kDa and a degree of oxidation of 10 to 20.

[0165] In preferred embodiments, the activated serotype 22F polysaccharide contains at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, or 0.7 or about 0.8 mM acetate per mM serotype 22F polysaccharide. In preferred embodiments, the activated serotype 22F polysaccharide contains at least 0.5, 0.6, or 0.7 mM acetate per mM serotype 22F polysaccharide. In preferred embodiments, the activated serotype 22F polysaccharide contains at least 0.6 mM acetate per mM serotype 22F polysaccharide. In preferred embodiments, the activated serotype 22F polysaccharide contains at least 0.7 mM acetate per mM serotype 22F polysaccharide.

[0166] In a preferred embodiment, the activated serotype 22F polysaccharide has a molecular weight of 400 kDa to 800 kDa and contains at least 0.6 mM acetate per mM serotype 22F polysaccharide.

[0167] In a preferred embodiment, the activated serotype 22F polysaccharide has a molecular weight of 400 kDa to 800 kDa, a degree of oxidation of 12 to 20, and contains at least 0.6 mM acetate per mM serotype 22F polysaccharide.

[0168] The activated polysaccharide and / or carrier protein can be lyophilized (freeze-dried) independently (separate lyophilization) or together (co-lyophilization).

[0169] In one embodiment, the activated serotype 22F polysaccharide is optionally freeze-dried in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol, and palatinit. In a preferred embodiment, the sugar is sucrose. In one embodiment, the freeze-dried activated polysaccharide is then mixed with a solution containing a carrier protein.

[0170] In another embodiment, the activated polysaccharide and carrier protein are freeze-dried simultaneously. In such an embodiment, the activated serotype 22F polysaccharide is mixed with the carrier protein and, optionally, freeze-dried in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol, and palatinit. In a preferred embodiment, the sugar is sucrose. The simultaneously freeze-dried polysaccharide and carrier protein can then be resuspended in a solution and reacted with a reducing agent.

[0171] The second step in the conjugation process is the reduction of the activated polysaccharide and carrier protein with a reducing agent (reductive amination) to form the conjugate.

[0172] Activated serotype 22F polysaccharide is (c) mixing the activated serotype 22F polysaccharide with a carrier protein; and (d) reacting the mixed activated serotype 22F polysaccharide and carrier protein with a reducing agent to form a serotype 22F polysaccharide-carrier protein conjugate. The compound can be conjugated to a carrier protein by a process comprising:

[0173] In one embodiment, the reduction reaction is carried out in an aqueous solvent. In another embodiment, the reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in a DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.

[0174] Conjugation of activated serotype 22F polysaccharide to a protein carrier by reductive amination in dimethyl sulfoxide (DMSO) is suitable for preserving the O-acetyl content of the polysaccharide, as compared to, for example, reductive amination in an aqueous phase, which can significantly reduce the level of O-acetylation of the polysaccharide. Thus, in a preferred embodiment, steps (c) and (d) are carried out in DMSO.

[0175] In one embodiment, the reducing agent is sodium cyanoborohydride, sodium triacetoxyborohydride, sodium borohydride or zinc borohydride in the presence of a Bronsted or Lewis acid, pyridine borane, 2-picoline borane, 2,6-diborane-methanol, dimethylamine-borane, t-BuMe i PrN-BH3, benzylamine-BH3 or an amine borane such as 5-ethyl-2-methylpyridine borane (PEMB). In a preferred embodiment, the reducing agent is sodium cyanoborohydride.

[0176] At the end of the reduction reaction, there may be unreacted aldehyde groups remaining in the conjugate, which can be capped with a suitable capping agent, which in one embodiment is sodium borohydride (NaBH4).

[0177] After conjugation of the serotype 22F polysaccharide to the carrier protein, the glycoconjugate can be purified (enriched with respect to the amount of polysaccharide-protein conjugate) by a variety of techniques known to those skilled in the art, including dialysis, concentration / diafiltration operations, tangential flow filtration sedimentation / elution, column chromatography (DEAE or hydrophobic interaction chromatography), and depth filtration.

[0178] In some embodiments, serotype 22F glycoconjugates of the invention comprise saccharides having a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the saccharides have a molecular weight of 50 kDa to 1,000 kDa. In other such embodiments, the saccharides have a molecular weight of 70 kDa to 900 kDa. In other such embodiments, the saccharides have a molecular weight of 100 kDa to 800 kDa. In other such embodiments, the saccharides have a molecular weight of 200 kDa to 600 kDa. In further such embodiments, the saccharides are selected from the group consisting of: 100 kDa to 1,000 kDa; 100 kDa to 900 kDa; 100 kDa to 800 kDa; 100 kDa to 700 kDa; 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa; 150 kDa to 1,000 kDa; 150 kDa to 900 kDa; 50kDa~800kDa;150kDa~700kDa;150kDa~600kDa;150kDa~500kDa;150kDa~400kDa;150kDa~300kDa;2 00kDa~1,000kDa;200kDa~900kDa;200kDa~800kDa;200kDa~700kDa;200kDa~600kDa;200kDa~500kDa ;200kDa~400kDa;200kDa~300kDa;250kDa~1,000kDa;250kDa~900kDa;250kDa~800kDa;250kDa~700k Da;250kDa~600kDa;250kDa~500kDa;250kDa~400kDa;250kDa~350kDa;300kDa~1000kDa;300kDa~900 kDa; 300 kDa to 800 kDa; 300 kDa to 700 kDa; 300 kDa to 600 kDa; 300 kDa to 500 kDa; 300 kDa to 400 kDa; 400 kDa to 1,000 kDa; 400 kDa to 900 kDa; 400 kDa to 800 kDa; 400 kDa to 700 kDa; 400 kDa to 600 kDa; 500 kDa to 600 kDa. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure. In some such embodiments, serotype 22F glycoconjugates are prepared using reductive amination.

[0179] In some embodiments, the serotype 22F glycoconjugates of the present invention have a molecular weight of 400 kDa to 15,000 kDa; 500 kDa to 10,000 kDa; 2,000 kDa to 10,000 kDa; 3,000 kDa to 8,000 kDa; or 3,000 kDa to 5,000 kDa. In other embodiments, the serotype 22F glycoconjugates have a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the serotype 22F glycoconjugates have a molecular weight of 1,000 kDa to 8,000 kDa. In still other embodiments, the serotype 22F glycoconjugates have a molecular weight of 2,000 kDa to 8,000 kDa or 3,000 kDa to 7,000 kDa.In further embodiments, the serotype 22F glycoconjugates of the invention have an affinity of 200 kDa to 20,000 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; 200 kDa to 7,500 kDa; 200 kDa to 5,000 kDa; 200 kDa to 3,000 kDa; 200 kDa to 1,000 kDa; 500 kDa to 20,000 kDa; 500 kDa to 15,000 kDa; 500 kDa to 12,500 kDa; 500 kDa ~10,000kDa;500kDa~7,500kDa;500kDa~6,000kDa;500kDa~5,000kDa;500kDa~4,000kDa;500kDa~3,000kDa;500kDa~2,000k Da;500kDa~1,500kDa;500kDa~1,000kDa;750kDa~20,000kDa;750kDa~15,000kDa;750kDa~12,500kDa;750kDa~10,000kDa;7 50kDa~7,500kDa;750kDa~6,000kDa;750kDa~5,000kDa;750kDa~4,000kDa;750kDa~3,000kDa;750kDa~2,000kDa;750kDa~1, 500kDa;1,000kDa~15,000kDa;1,000kDa~12,500kDa;1,000kDa~10,000kDa;1,000kDa~7,500kDa;1,000kDa~6,000kDa;1,00 having a molecular weight of 0 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 2,500 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa.

[0180] In further embodiments, the serotype 22F glycoconjugates of the invention have a molecular weight of 3,000 kDa to 20,000 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 4,000 kDa to 20,000 kDa; 4,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa.

[0181] In further embodiments, the serotype 22F glycoconjugates of the invention have a molecular weight of 5,000 kDa to 20,000 kDa; 5,000 to 15,000 kDa; 5,000 kDa to 10,000 kDa; 5,000 kDa to 7,500 kDa; 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 12,500 kDa; 6,000 kDa to 10,000 kDa; or 6,000 kDa to 7,500 kDa.

[0182] The molecular weight of the glycoconjugate is measured by SEC-MALLS. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0183] In preferred embodiments, serotype 22F glycoconjugates of the invention comprise at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, or 0.7 or about 0.8 mM acetate per mM serotype 22F polysaccharide. In preferred embodiments, glycoconjugates comprise at least 0.5, 0.6, or 0.7 mM acetate per mM serotype 22F polysaccharide. In preferred embodiments, glycoconjugates comprise at least 0.6 mM acetate per mM serotype 22F polysaccharide. In preferred embodiments, glycoconjugates comprise at least 0.7 mM acetate per mM serotype 22F polysaccharide.

[0184] In preferred embodiments, the ratio of mM acetate per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate per mM serotype 22F polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate per mM serotype 22F polysaccharide in the isolated polysaccharide is at least 0.7. In preferred embodiments, the ratio of mM acetate per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate per mM serotype 22F polysaccharide in the isolated polysaccharide is at least 0.9.

[0185] In preferred embodiments, the ratio of mM acetate per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate per mM serotype 22F polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate per mM serotype 22F polysaccharide in the activated polysaccharide is at least 0.7. In preferred embodiments, the ratio of mM acetate per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate per mM serotype 22F polysaccharide in the activated polysaccharide is at least 0.9.

[0186] Another method for characterizing the serotype 22F glycoconjugates of the invention is to characterize the extent of lysines conjugated to the carrier protein (e.g., CRMP) conjugated to the saccharide, which can be characterized as the extent of lysines conjugated (degree of conjugation). 197Evidence of lysine modification of the carrier protein due to covalent attachment to the polysaccharide can be obtained by amino acid analysis using routine methods known to those skilled in the art. Conjugation can be achieved by the number of lysine residues in the CRM used to generate the conjugated material. 197 This results in a reduced number of recovered lysine residues compared to the protein starting material. In preferred embodiments, the degree of conjugation of the serotype 22F glycoconjugates of the present invention is 2-15, 2-13, 2-10, 2-8, 2-6, 2-5, 2-4, 3-15, 3-13, 3-10, 3-8, 3-6, 3-5, 3-4, 5-15, 5-10, 8-15, 8-12, 10-15, or 10-12. In one embodiment, the degree of conjugation of the serotype 22F glycoconjugates of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In a preferred embodiment, the degree of conjugation of the serotype 22F glycoconjugates of the present invention is 4-7. In some such embodiments, the carrier protein is a CRM 197 is.

[0187] Serotype 22F glycoconjugates of the invention can also be characterized by the saccharide to carrier protein ratio (w / w). In some embodiments, the serotype 22F polysaccharide to carrier protein ratio (w / w) in the glycoconjugate is 0.5 to 3.0 (e.g., about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3.0). In other embodiments, the saccharide to carrier protein ratio (w / w) is 0.5 to 2.0, 0.5 to 1.5, 0.8 to 1.2, 0.5 to 1.0, 1.0 to 1.5, or 1.0 to 2.0. In further embodiments, the saccharide to carrier protein ratio (w / w) is 0.8 to 1.2. In preferred embodiments, the ratio of serotype 22F capsular polysaccharide to carrier protein in the conjugate is 0.9 to 1.1. In some such embodiments, the carrier protein is CRM 197 is.

[0188] Serotype 22F glycoconjugates and immunogenic compositions of the invention may contain free saccharides that are not covalently conjugated to a carrier protein but are nevertheless present in the glycoconjugate composition. The free saccharides can be non-covalently associated with (i.e., non-covalently bound, adsorbed, or entrapped within or with) the glycoconjugate.

[0189] In preferred embodiments, the serotype 22F glycoconjugates contain less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 15% free serotype 22F polysaccharide relative to the total amount of serotype 22F polysaccharide. In preferred embodiments, the serotype 22F glycoconjugates contain less than about 40% free serotype 22F polysaccharide relative to the total amount of serotype 22F polysaccharide. In preferred embodiments, the serotype 22F glycoconjugates contain less than about 25% free serotype 22F polysaccharide relative to the total amount of serotype 22F polysaccharide. In preferred embodiments, the serotype 22F glycoconjugates contain less than about 20% free serotype 22F polysaccharide relative to the total amount of serotype 22F polysaccharide. In preferred embodiments, the serotype 22F glycoconjugates contain less than about 15% free serotype 22F polysaccharide relative to the total amount of serotype 22F polysaccharide.

[0190] Serotype 22F glycoconjugates were analyzed based on their molecular size distribution (K d ) can also be characterized. Size exclusion chromatography media (CL-4B) can be used to determine the relative molecular size distribution of the conjugates. Size exclusion chromatography (SEC) is used in a gravity-fed column to profile the molecular size distribution of the conjugates. Large molecules that are excluded from the pores in the media elute more quickly than small molecules. A fraction collector is used to collect the column eluate. Fractions are tested colorimetrically by sugar assay. K d For the determination of K, the column is calibrated to determine the fraction at which the molecule is completely excluded (V), (K d = 0), the fraction representing maximum retention (V i ), (K d = 1). The fraction at which a particular sample attribute is reached (V e ) is K d =(V e -V0) / (V i -V0) equation, K d and related.

[0191] In a preferred embodiment, at least 30% of the serotype 22F glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 40% of the glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 22F glycoconjugates have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 22F glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 50% to 80% of the serotype 22F glycoconjugates have a K less than or equal to 0.3 in the CL-4B column. d In a preferred embodiment, 65% to 80% of serotype 22F glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. d It has.

[0192] 1.3.3 Glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 33F In one embodiment, serotype 33F glycoconjugates are obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled to an amino group on a carrier protein directly or via a spacer (linker) group. For example, cystamine or cysteamine may be used as the spacer to obtain a thiolated polysaccharide, which can be coupled to a carrier via a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., with GMBS) or a haloacetylated carrier protein (e.g., with iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, cyanate esters (which may be generated by CDAP chemistry) are coupled with hexanediamine or adipic acid dihydrazide (ADH), and the amino-derivatized saccharides are conjugated to carrier proteins via carboxyl groups on the protein carrier using carbodiimide (e.g., EDAC or EDC) chemistry. Such conjugates are described, for example, in WO93 / 15760, WO95 / 08348, and WO96 / 129094.

[0193] Other suitable techniques use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reaction of a free hydroxyl group of a sugar with CDI (see Bethell et al. (1979) J. Biol. Chern. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate with an amino group on the protein.

[0194] In certain embodiments, the serotype 33F glycoconjugates of the present invention are prepared using reductive amination. In such embodiments, the serotype 33F glycoconjugates of the present invention can be prepared using reductive amination in aqueous phase (RAC / aqueous). Reductive amination in aqueous phase has been successfully applied to produce pneumococcal conjugate vaccines (see, e.g., WO2006 / 110381). However, preferably, when reductive amination is used, the serotype 33F glycoconjugates are prepared by reductive amination in DMSO (RAC / DMSO). Given the challenges associated with retaining O-acetyl functionality using the RAC / aqueous process, reductive amination in DMSO is preferred. RAC / DMSO has been successfully applied to produce pneumococcal conjugate vaccines (see, e.g., WO2006 / 110381).

[0195] In a preferred embodiment, the serotype 33F glycoconjugates of the invention are prepared using eTEC conjugation (hereinafter "serotype 33F eTEC-linked glycoconjugates") as described in Examples 1, 2, and 3 and WO2014 / 027302. The 33F glycoconjugates comprise saccharides covalently conjugated to a carrier protein via one or more eTEC spacers, wherein the saccharides are covalently conjugated to the eTEC spacer via a carbamate bond and the carrier protein is covalently conjugated to the eTEC spacer via an amide bond. The eTEC-linked glycoconjugates of the invention can be represented by the general formula (III):

[0196] [ka] where the atoms that make up the eTEC spacer are contained in the central box.

[0197] The eTEC spacer contains seven linear atoms (i.e., -C(O)NH(CH2)2SCH2C(O)-) and provides stable thioether and amide bonds between the saccharide and the carrier protein. Synthesis of eTEC-linked glycoconjugates involves reaction of an activated hydroxyl group of a saccharide with the amino group of a thioalkylamine reagent, e.g., cystamine or cysteine amine, or a salt thereof, to form a carbamate bond with the saccharide, resulting in a thiolated saccharide. Generation of one or more free sulfhydryl groups is achieved by reaction with a reducing agent to yield an activated thiolated saccharide. Reaction of the free sulfhydryl group of the activated thiolated saccharide with an activated carrier protein bearing one or more α-haloacetamide groups on the amine-containing residue generates a thioether bond to form a conjugate, in which the carrier protein is linked to the eTEC spacer via an amide bond.

[0198] In the serotype 33F glycoconjugates of the present invention, the saccharide may be a polysaccharide or an oligosaccharide. The carrier protein may be selected from any suitable carrier described herein or known to those skilled in the art. In common embodiments, the saccharide is a polysaccharide. In some such embodiments, the carrier protein is a CRM. 197 In some such embodiments, the eTEC-bound glycoconjugate comprises Streptococcus pneumoniae (S. pneumoniae) serotype 33F capsular polysaccharide.

[0199] In a particularly preferred embodiment, the eTEC-linked glycoconjugate is linked to a CRM via an eTEC spacer. 197 (serotype 33F eTEC-bound glycoconjugate).

[0200] In some embodiments, serotype 33F glycoconjugates of the invention comprise saccharides having a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the saccharides have a molecular weight of 50 kDa to 2,000 kDa. In further such embodiments, the saccharides have a molecular weight of 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,25 or 200 kDa to 500 kDa. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0201] In some embodiments, the serotype 33F glycoconjugates of the present invention have a molecular weight of 50 kDa to 20,000 kDa. In other embodiments, the serotype 33F glycoconjugates have a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the serotype 33F glycoconjugates have a molecular weight of 200 kDa to 10,000 kDa. In still other embodiments, the serotype 33F glycoconjugates have a molecular weight of 1,000 kDa to 3,000 kDa.

[0202] In further embodiments, the serotype 33F glycoconjugates of the invention have a molecular weight of 200 kDa to 20,000 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; 200 kDa to 7,500 kDa; 200 kDa to 5,000 kDa; 200 kDa to 3,000 kDa; 200 kDa to 1,000 kDa; 500 kDa to 20,000 kDa; 500 kDa to 15,000 kDa; 500 kDa to 12,500 kDa; 500 kDa to 10,000 kDa; 500 kDa to 7,500 kDa; 500 kDa to 6,000 kDa. 0kDa;500kDa~5,000kDa;500kDa~4,000kDa;500kDa~3,000kDa;500kDa~2,000kDa;500kDa~1,500kDa;500kDa~1,000kDa;750kDa~20,000kDa;750kDa a~15,000kDa;750kDa~12,500kDa;750kDa~10,000kDa;750kDa~7,500kDa;750kDa~6,000kDa;750kDa~5,000kDa;750kDa~4,000kDa;750kDa~3,000kDa a;750kDa~2,000kDa;750kDa~1,500kDa;1,000kDa~15,000kDa;1,000kDa~12,500kDa;1,000kDa~10,000kDa;1,000kDa~7,500kDa;1,000kDa~6,000 kDa;1,000kDa~5,000kDa;1,000kDa~4,000kDa;1,000kDa~2,500kDa;2,000kDa~15,000kDa;2,000kDa~12,500kDa;2,000kDa~10,000kDa;2,000kDa~ 3,00 0kDa~12,500kDa;3,000kDa~10,000kDa;3,000kDa~9,000kDa;3,000kDa~8,000kDa;3,000kDa~7,000kDa;3,000kDa~6,000kDa;3,000kDa~5,000kDa;or a molecular weight of 3,000 kDa to 4,000 kDa. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0203] Another method for characterizing the serotype 33F glycoconjugates of the invention is to characterize the extent of lysines conjugated to the carrier protein (e.g., CRMP) conjugated to the saccharide, which can be characterized as the extent of lysines conjugated (degree of conjugation). 197 ) is due to the number of lysine residues in the

[0204] In preferred embodiments, the conjugation degree of the serotype 33F glycoconjugates of the present invention is 2 to 20, 4 to 16, 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 3 to 15, 3 to 13, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15, or 10 to 12. In one embodiment, the conjugation degree of the serotype 33F glycoconjugates of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20. In preferred embodiments, the degree of conjugation of the serotype 33F glycoconjugates of the invention is between 4 and 16. In some such embodiments, the carrier protein is a CRM 197 is.

[0205] In a preferred embodiment, the carrier protein is a CRM containing 39 lysine residues. 197 In some such embodiments, the CRM 197 may contain 4 to 16 of the 39 lysine residues covalently linked to saccharides. Another way to express this parameter is about 10% to about 41% CRM 197 In another such embodiment, the CRM 197may contain 2 to 20 of the 39 lysine residues covalently linked to saccharides. Another way to express this parameter is about 5% to about 50% CRM 197 In some embodiments, the CRM 197 may comprise about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, or about 16 of the 39 lysine residues covalently linked to saccharides.

[0206] In common embodiments, the carrier protein is covalently conjugated to the eTEC spacer via an amide bond to one or more ε-amino groups of lysine residues on the carrier protein. In some such embodiments, the carrier protein comprises 2 to 20 lysine residues covalently conjugated to saccharides. In other such embodiments, the carrier protein comprises 4 to 16 lysine residues covalently conjugated to saccharides.

[0207] Serotype 33F glycoconjugates of the invention may also be characterized by the saccharide to carrier protein ratio (weight / weight). In some embodiments, the ratio of saccharide to carrier protein (w / w) is 0.2 to 4.0 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, or about 4.0). In other embodiments, the ratio of saccharide to carrier protein (w / w) is between 1.0 and 2.5. In further embodiments, the ratio of saccharide to carrier protein (w / w) is between 0.4 and 1.7. In some such embodiments, the carrier protein is CRM. 197 is.

[0208] The frequency of attachment of saccharide chains to lysines on the carrier protein is another parameter for characterizing serotype 33F glycoconjugates of the invention. For example, in some embodiments, at least one covalent bond between the carrier protein and the polysaccharide occurs for every four saccharide repeat units of the polysaccharide. In other embodiments, a covalent bond between the carrier protein and the polysaccharide occurs at least once for every ten saccharide repeat units of the polysaccharide. In other embodiments, a covalent bond between the carrier protein and the polysaccharide occurs at least once for every fifteen saccharide repeat units of the polysaccharide. In further embodiments, a covalent bond between the carrier protein and the polysaccharide occurs at least once for every twenty-five saccharide repeat units of the polysaccharide.

[0209] In a common embodiment, the carrier protein is a CRM 197 and CRM 197 The covalent bond between the eTEC spacer and the polysaccharide occurs at least once for every 4, 10, 15, or 25 saccharide repeat units of the polysaccharide.

[0210] In other embodiments, the conjugate comprises at least one covalent bond between the carrier protein and the saccharide every 5-10 saccharide repeat units; every 2-7 saccharide repeat units; every 3-8 saccharide repeat units; every 4-9 saccharide repeat units; every 6-11 saccharide repeat units; every 7-12 saccharide repeat units; every 8-13 saccharide repeat units; every 9-14 saccharide repeat units; every 10-15 saccharide repeat units; every 2-6 saccharide repeat units; every 3-7 saccharide repeat units; every 4-8 saccharide repeat units; every 6-10 saccharide repeat units; every 7-11 saccharide repeat units; every 8-12 saccharide repeat units; every 9-13 saccharide repeat units; every 10-14 saccharide repeat units; every 10-20 saccharide repeat units; every 4-25 saccharide repeat units or every 2-25 saccharide repeat units. In a common embodiment, the carrier protein is a CRM 197 is.

[0211] In another embodiment, at least one bond between the carrier protein and the saccharide occurs every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 saccharide repeat units of the polysaccharide. 197 Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0212] An important consideration during conjugation is the development of conditions that allow for the preservation of potentially sensitive non-saccharide-substituted functional groups of the individual components, such as O-acyl, phosphate, or glycerol phosphate side chains, which may form part of the saccharide epitope.

[0213] In one embodiment, serotype 33F glycoconjugates of the invention comprise saccharides having a degree of O-acetylation of 10% to 100%. In some such embodiments, the saccharides have a degree of O-acetylation of 50% to 100%.

[0214] In other such embodiments, the saccharides have a degree of O-acetylation of 75% to 100%. In further embodiments, the saccharides have a degree of O-acetylation greater than or equal to 70% (70% or greater).

[0215] In preferred embodiments, the serotype 33F glycoconjugates of the invention contain at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM acetate per mM serotype 33F capsular polysaccharide. In preferred embodiments, the glycoconjugates contain at least 0.5, 0.6, or 0.7 mM acetate per mM serotype 33F capsular polysaccharide. In preferred embodiments, the glycoconjugates contain at least 0.6 mM acetate per mM serotype 33F capsular polysaccharide. In preferred embodiments, the glycoconjugates contain at least 0.7 mM acetate per mM serotype 33F capsular polysaccharide. In preferred embodiments, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0216] In preferred embodiments, the ratio of mM acetate per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate per mM serotype 33F polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate per mM serotype 33F polysaccharide in the isolated polysaccharide is at least 0.7. In preferred embodiments, the ratio of mM acetate per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate per mM serotype 33F polysaccharide in the isolated polysaccharide is at least 0.9.

[0217] In preferred embodiments, the ratio of mM acetate per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate per mM serotype 33F polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate per mM serotype 33F polysaccharide in the activated polysaccharide is at least 0.7. In preferred embodiments, the ratio of mM acetate per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate per mM serotype 33F polysaccharide in the activated polysaccharide is at least 0.9.

[0218] Serotype 33F glycoconjugates and immunogenic compositions of the invention may contain free saccharides that are not covalently conjugated to a carrier protein but are nevertheless present in the glycoconjugate composition. The free saccharides can be non-covalently associated with (i.e., non-covalently bound, adsorbed, or entrapped within or with) the glycoconjugate.

[0219] In some embodiments, the serotype 33F glycoconjugates of the present invention contain less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% free serotype 33F polysaccharide relative to the total amount of serotype 33F polysaccharide. Preferably, the serotype 33F glycoconjugates contain less than 15% free saccharides, more preferably less than 10% free saccharides, and even more preferably less than 5% free saccharides. In preferred embodiments, the serotype 33F glycoconjugates contain less than about 25% free serotype 33F polysaccharide relative to the total amount of serotype 33F polysaccharide. In preferred embodiments, the serotype 33F glycoconjugates contain less than about 20% free serotype 33F polysaccharide relative to the total amount of serotype 33F polysaccharide. In a preferred embodiment, the serotype 33F glycoconjugate comprises less than about 15% free serotype 33F polysaccharide compared to the total amount of serotype 33F polysaccharide.

[0220] In certain preferred embodiments, the present invention provides serotype 33F glycoconjugates having one or more of the following characteristics, alone or in combination: the polysaccharide has a molecular weight of 50 kDa to 2,000 kDa; the glycoconjugate has a molecular weight of 500 kDa to 10,000 kDa; the carrier protein comprises 2 to 20 lysine residues covalently linked to the saccharide; the saccharide to carrier protein ratio (w / w) is 0.2 to 4.0; the glycoconjugate comprises at least one covalent bond between the carrier protein and the polysaccharide for every 4, 10, 15, or 25 saccharide repeat units of the polysaccharide; the saccharide has a degree of O-acetylation of 75% to 100%; the conjugate comprises less than about 15% free polysaccharide relative to the total polysaccharide; 197 is.

[0221] Serotype 33F glycoconjugates were analyzed based on their molecular size distribution (K d ) can also be characterized. Size exclusion chromatography media (CL-4B) can be used to determine the relative molecular size distribution of the conjugates, as described above. In one embodiment, at least 15% of the serotype 33F glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In one embodiment, at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80% or 90% of the serotype 33F glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d It has.

[0222] In a preferred embodiment, at least 35% of the serotype 33F glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. dIn a preferred embodiment, at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% or 85% of the serotype 33F glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 33F glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 70% of the serotype 33F glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. d It has.

[0223] In a preferred embodiment, 40% to 90% of serotype 33F glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 50% to 90% of serotype 33F glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 65% to 80% of serotype 33F glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. d It has.

[0224] 1.3.4 Glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 15B In one embodiment, serotype 15B glycoconjugates are obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled to an amino group on a carrier protein directly or via a spacer (linker) group. For example, cystamine or cysteamine may be used as the spacer to obtain a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., with GMBS) or a haloacetylated carrier protein (e.g., with iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, cyanate esters (which may be generated by CDAP chemistry) are coupled with hexanediamine or adipic acid dihydrazide (ADH), and the amino-derivatized saccharides are conjugated to carrier proteins via carboxyl groups on the protein carrier using carbodiimide (e.g., EDAC or EDC) chemistry. Such conjugates are described, for example, in WO93 / 15760, WO95 / 08348, and WO96 / 129094.

[0225] Other suitable techniques use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reaction of a free hydroxyl group of a sugar with CDI (see Bethell et al. (1979) J. Biol. Chern. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate with an amino group on the protein.

[0226] In a preferred embodiment, the serotype 15B glycoconjugates of the invention are prepared using reductive amination, which involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from vicinal diols in the individual hexasaccharide units, and (2) reduction of the activated polysaccharide and carrier protein to form the conjugate.

[0227] Preferably, prior to oxidation, serotype 15B polysaccharide is sizing to a target molecular weight (MW) range. Advantageously, the purified serotype 15B polysaccharide is reduced in size while retaining important structural features of the polysaccharide, such as the presence of O-acetyl groups. Preferably, the purified serotype 15B polysaccharide is reduced in size by mechanical homogenization (see section 1.2.6 above).

[0228] The oxidation step may involve reaction with periodate. For purposes of the present invention, the term "periodate" includes both periodate and periodic acid; the term also includes metaperiodate (IO4 - ) and orthoperiodate (IO65- ) and various salts of periodate (e.g., sodium periodate and potassium periodate). In a preferred embodiment, the periodate used to oxidize serotype 15B capsular polysaccharide is metaperiodate. In a preferred embodiment, the periodate used to oxidize serotype 15B capsular polysaccharide is sodium metaperiodate.

[0229] In preferred embodiments, the polysaccharide is reacted with 0.01 to 10.0, 0.05 to 5.0, 0.1 to 1.0, 0.5 to 1.0, 0.7 to 0.8, 0.05 to 0.5, or 0.1 to 0.3 molar equivalents of oxidizing agent. In preferred embodiments, the polysaccharide is reacted with about 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95 molar equivalents of oxidizing agent. In preferred embodiments, the polysaccharide is reacted with about 0.15 molar equivalents of oxidizing agent. In preferred embodiments, the polysaccharide is reacted with about 0.25 molar equivalents of oxidizing agent. In preferred embodiments, the polysaccharide is reacted with about 0.5 molar equivalents of oxidizing agent. In a preferred embodiment, the polysaccharide is reacted with about 0.6 molar equivalents of the oxidizing agent. In a preferred embodiment, the polysaccharide is reacted with about 0.7 molar equivalents of the oxidizing agent.

[0230] In a preferred embodiment, the duration of the reaction is between 1 hour and 50 hours, between 10 hours and 30 hours, between 15 hours and 20 hours, between 15 hours and 17 hours, or about 16 hours.

[0231] In a preferred embodiment, the reaction temperature is maintained at 15°C to 45°C, 15°C to 30°C, or 20°C to 25°C. In a preferred embodiment, the reaction temperature is maintained at about 23°C.

[0232] In a preferred embodiment, the oxidation reaction is carried out in a buffer selected from sodium phosphate, potassium phosphate, 2-(N-morpholino)ethanesulfonic acid (MES), or Bis-Tris. In a preferred embodiment, the buffer is potassium phosphate.

[0233] In a preferred embodiment, the buffer has a concentration of 1 mM to 500 mM, 1 mM to 300 mM, or 50 mM to 200 mM. In a preferred embodiment, the buffer has a concentration of about 100 mM.

[0234] In a preferred embodiment, the oxidation reaction is carried out at a pH of 4.0 to 8.0, 5.0 to 7.0, or 5.5 to 6.5, and in a preferred embodiment, the pH is about 6.0.

[0235] In a preferred embodiment, the activated serotype 15B capsular polysaccharide is obtained by reacting 0.5 mg / mL to 5 mg / mL of isolated serotype 15B capsular polysaccharide with 0.2 to 0.3 molar equivalents of periodate at a temperature of 20°C to 25°C.

[0236] In a preferred embodiment, the activated serotype 15B capsular polysaccharide is purified according to methods known to those skilled in the art, such as gel permeation chromatography (GPC), dialysis, or ultrafiltration / diafiltration. For example, the activated capsular polysaccharide is purified by concentration and diafiltration using an ultrafiltration device.

[0237] In preferred embodiments, the degree of oxidation of the activated serotype 15B capsular polysaccharide is 2 to 20, 2 to 15, 2 to 10, 2 to 5, 5 to 20, 5 to 15, 5 to 10, 10 to 20, 10 to 15, or 15 to 20. In preferred embodiments, the degree of oxidation of the activated serotype 15B capsular polysaccharide is 2 to 10, 4 to 8, 4 to 6, 6 to 8, 6 to 12, 8 to 12, 9 to 11, 10 to 16, 12 to 16, 14 to 18, 16 to 20, 16 to 18, or 18 to 20.

[0238] In preferred embodiments, the activated serotype 15B capsular polysaccharide has a molecular weight of 5 kDa to 500 kDa, 50 kDa to 500 kDa, 50 kDa to 450 kDa, 100 kDa to 400 kDa, or 100 kDa to 350 kDa. In preferred embodiments, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 350 kDa. In preferred embodiments, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 300 kDa. In preferred embodiments, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 250 kDa.

[0239] In preferred embodiments, the activated serotype 15B capsular polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM acetate per mM of said serotype 15B capsular polysaccharide. In preferred embodiments, the activated serotype 15B capsular polysaccharide comprises at least 0.5, 0.6, or 0.7 mM acetate per mM of said serotype 15B capsular polysaccharide. In preferred embodiments, the activated serotype 15B capsular polysaccharide comprises at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide. In preferred embodiments, the activated serotype 15B capsular polysaccharide comprises at least 0.7 mM acetate per mM of said serotype 15B capsular polysaccharide.

[0240] In preferred embodiments, the activated serotype 15B capsular polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM glycerol per mM of said serotype 15B capsular polysaccharide. In preferred embodiments, the activated serotype 15B capsular polysaccharide comprises at least 0.5, 0.6, or 0.7 mM glycerol per mM of said serotype 15B capsular polysaccharide. In preferred embodiments, the activated serotype 15B capsular polysaccharide comprises at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide. In preferred embodiments, the activated serotype 15B capsular polysaccharide comprises at least 0.7 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0241] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of between 100 kDa and 250 kDa and comprises at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide.

[0242] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of between 100 kDa and 250 kDa and comprises at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0243] In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide and at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0244] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of between 100 kDa and 250 kDa and comprises at least 0.6 mM acetate per mM of said serotype 15B capsular polysaccharide and at least 0.6 mM glycerol per mM of said serotype 15B capsular polysaccharide.

[0245] In one embodiment, the activated serotype 15B capsular polysaccharide is optionally lyophilized in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol, and palatinit. In a preferred embodiment, the sugar is sucrose. The lyophilized activated capsular polysaccharide can then be mixed with a solution containing a carrier protein.

[0246] In another embodiment, the activated serotype 15B capsular polysaccharide is mixed with a carrier protein and, optionally, lyophilized in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol, and palatinit. In a preferred embodiment, the sugar is sucrose. The simultaneously lyophilized polysaccharide and carrier protein can then be resuspended in a solution and reacted with a reducing agent.

[0247] Activated serotype 15B capsular polysaccharide is (a) mixing activated serotype 15B capsular polysaccharide with a carrier protein; and (b) reacting the mixed activated serotype 15B capsular polysaccharide and carrier protein with a reducing agent to form a serotype 15B capsular polysaccharide-carrier protein conjugate. The compound can be conjugated to a carrier protein by a process comprising:

[0248] Conjugation of activated serotype 15B capsular polysaccharide to a protein carrier by reductive amination in dimethyl sulfoxide (DMSO) is suitable for preserving the O-acetyl content of the polysaccharide, as compared to, for example, reductive amination in aqueous solution, in which the level of O-acetylation of the polysaccharide is significantly lower. In a preferred embodiment, steps (a) and (b) are carried out in DMSO.

[0249] In a preferred embodiment, step (a) comprises dissolving lyophilized serotype 15B capsular polysaccharide in a solution comprising a carrier protein and DMSO. In a preferred embodiment, step (a) comprises dissolving co-lyophilized serotype 15B capsular polysaccharide and carrier protein in DMSO.

[0250] When steps (a) and (b) are carried out in an aqueous solution, steps (a) and (b) are preferably carried out in a buffer selected from PBS, MES, HEPES, Bis-tris, ADA, PIPES, MOPSO, BES, MOPS, DIPSO, MOBS, HEPPSO, POPSO, TEA, EPPS, bicine, or HEPB, at a pH of 6.0 to 8.5, 7.0 to 8.0, or 7.0 to 7.5. In a preferred embodiment, the buffer is PBS. In a preferred embodiment, the pH is about 7.3. In a preferred embodiment, the concentration of the activated serotype 15B capsular polysaccharide in step (b) is 0.1 mg / mL to 10 mg / mL, 0.5 mg / mL to 5 mg / mL, or 0.5 mg / mL to 2 mg / mL. In preferred embodiments, the concentration of activated serotype 15B capsular polysaccharide in step (b) is about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9 or 3.0 mg / mL.

[0251] In preferred embodiments, the initial input ratio (wt / wt) of activated serotype 15B capsular polysaccharide to carrier protein is 5:1 to 0.1:1, 2:1 to 0.1:1, 2:1 to 1:1, 1.5:1 to 1:1, 0.1:1 to 1:1, 0.3:1 to 1:1, or 0.6:1 to 1:1.

[0252] In a preferred embodiment, the initial input ratio of activated serotype 15B capsular polysaccharide to carrier protein is about 0.6:1 to 1:1. In another preferred embodiment, the initial input ratio of activated serotype 15B capsular polysaccharide to carrier protein is about 0.6:1 to 1.5:1. Such initial input ratios are particularly suitable for obtaining low levels of free polysaccharide in the glycoconjugate.

[0253] In preferred embodiments, the initial input ratio of activated serotype 15B capsular polysaccharide to carrier protein is about 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1 or 2:1.

[0254] In one embodiment, the reducing agent is sodium cyanoborohydride, sodium triacetoxyborohydride, sodium borohydride or zinc borohydride in the presence of a Bronsted or Lewis acid, pyridine borane, 2-picoline borane, 2,6-diborane-methanol, dimethylamine-borane, t-BuMeiPrN-BH3, benzylamine-BH3, or an amine borane such as 5-ethyl-2-methylpyridine borane (PEMB). In a preferred embodiment, the reducing agent is sodium cyanoborohydride. In a preferred embodiment, the reducing agent is sodium 2-picoline borane.

[0255] In a preferred embodiment, the amount of reducing agent used in step (b) is about 0.1 to 10.0 molar equivalents, 0.5 to 5.0 molar equivalents, or 1.0 to 2.0 molar equivalents, or about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2.0 molar equivalents.

[0256] In a preferred embodiment, the duration of step (b) is 1 hour to 60 hours, 10 hours to 50 hours, 40 hours to 50 hours, or 42 hours to 46 hours. In a preferred embodiment, the duration of step (b) is about 44 hours.

[0257] In a preferred embodiment, the reaction temperature in step (b) is maintained at 10° C. to 40° C., 15° C. to 30° C., or 20° C. to 26° C. In a preferred embodiment, the reaction temperature in step (b) is maintained at about 23° C.

[0258] In a preferred embodiment, the process for the preparation of a glycoconjugate comprising Streptococcus pneumoniae (S. pneumoniae) serotype 15B capsular polysaccharide covalently linked to a carrier protein further comprises a step (step (c)) of capping (quenching) unreacted aldehydes by the addition of NaBH4.

[0259] In a preferred embodiment, the amount of NaBH4 used in step (c) is 0.1 to 10 molar equivalents, 0.5 to 5.0 molar equivalents, or 1.0 to 3.0 molar equivalents. In a preferred embodiment, the amount of NaBH4 used in step (c) is about 2.0 molar equivalents.

[0260] In a preferred embodiment, the duration of step (c) is 0.1 hours to 10 hours, 0.5 hours to 5 hours, or 2 hours to 4 hours. In a preferred embodiment, the duration of step (c) is about 3 hours.

[0261] In a preferred embodiment, the reaction temperature in step (c) is maintained at 15° C. to 45° C., 15° C. to 30° C., or 20° C. to 26° C. In a preferred embodiment, the reaction temperature in step (c) is maintained at about 23° C.

[0262] In preferred embodiments, the yield of the conjugation step is greater than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%. In preferred embodiments, the yield of the conjugation step (step b) is greater than 60%. In preferred embodiments, the yield of the conjugation step (step b) is greater than 70%. The yield is the amount of serotype 15B polysaccharide in the conjugate x 100 / the amount of activated polysaccharide used in the conjugation step.

[0263] In a preferred embodiment, a process for the preparation of a glycoconjugate comprising Streptococcus pneumoniae (S. pneumoniae) serotype 15B capsular polysaccharide covalently linked to a carrier protein comprises: (a) sizing the purified serotype 15B polysaccharide by high-pressure homogenization; (b) reacting the sized serotype 15B polysaccharide with an oxidizing agent; (c) mixing the activated serotype 15B polysaccharide with a carrier protein; (d) reacting the mixed activated serotype 15B polysaccharide and carrier protein with a reducing agent to form a serotype 15B polysaccharide-carrier protein conjugate; and (e) Capping (quenching) any unreacted aldehyde by addition of NaBH4 Includes.

[0264] In preferred embodiments, the yield of the conjugation step (step d) of the above process is greater than 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%. In preferred embodiments, the yield of the conjugation step (step d) is greater than 60%. In preferred embodiments, the yield of the conjugation step (step d) is greater than 70%. The yield is the amount of serotype 15B polysaccharide in the conjugate x 100 / the amount of activated polysaccharide used in the conjugation step.

[0265] After conjugation of the serotype 15B capsular polysaccharide to the carrier protein, the polysaccharide-protein conjugate can be purified (enriched in terms of the amount of polysaccharide-protein conjugate) by a variety of techniques known to those skilled in the art, including dialysis, concentration / diafiltration operations, tangential flow filtration, sedimentation / elution, column chromatography (DEAE or hydrophobic interaction chromatography), and depth filtration.

[0266] In one embodiment, the carrier protein is as defined in Section 1.1. In one embodiment, the carrier protein is DT (diphtheria toxin), TT (tetanus toxin), CRM 197 , other DT variants, PD (Haemophilus influenzae protein D), or immunologically functional equivalents thereof. In one embodiment, the carrier protein is CRM 197 is.

[0267] In some embodiments, the serotype 15B glycoconjugates of the invention are coupled to a carrier protein (e.g., a CRM 197In other such embodiments, the saccharide has a molecular weight of 10 kDa to 1,500 kDa. In further such embodiments, the saccharide has a molecular weight of 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 50 kDa to 250 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa; 100 kDa to 1,000 kDa. The serotype 15B glycoconjugates of the present invention have a molecular weight of 0 kDa; 100 kDa to 750 kDa; 100 kDa to 500 kDa; 100 kDa to 250 kDa; 200 kDa to 1,500 kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or 200 kDa to 500 kDa; or 200 kDa to 400 kDa. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure. In some embodiments, the serotype 15B glycoconjugates of the present invention have a molecular weight of 50 kDa to 20,000 kDa. In some embodiments, the serotype 15B glycoconjugates of the present invention have a molecular weight of 1,000 kDa to 20,000 kDa. In preferred embodiments, the serotype 15B glycoconjugates of the invention have a molecular weight of 3,000 kDa to 20,000 kDa, 5,000 kDa to 10,000 kDa, 5,000 kDa to 20,000 kDa, 8,000 kDa to 20,000 kDa, 8,000 kDa to 16,000 kDa, or 10,000 kDa to 16,000 kDa.

[0268] In further embodiments, the serotype 15B glycoconjugates of the invention are of a molecular weight of about 1,000 kDa, about 1,500 kDa, about 2,000 kDa, about 2,500 kDa, about 3,000 kDa, about 3,500 kDa, about 4,000 kDa, about 4,500 kDa, about 5,000 kDa, about 5,500 kDa, about 6,000 kDa, about 6,500 kDa, about 7,000 kDa, about 7,500 kDa, about 8,000 kDa, about 8,500 kDa, about 9,000 kDa, about 9,500 kDa, about 10,000 kDa, about 11,000 kDa, about 12,000 kDa, about 13,000 kDa, about 14,000 kDa, about 15,000 kDa, about 16,000 kDa, about 17,000 kDa, about 18,000 kDa, about 19,000 kDa, about 20,000 kDa, about 21,000 kDa, about 22,000 kDa, about 23,000 kDa, about 24,000 kDa, about 25,000 kDa, about 26,000 kDa, about 27,000 kDa, about 28,000 kDa, about 29,000 kDa, about 30,000 kDa, about 31,000 kDa, about 32,000 kDa, about 33,000 kD The polypeptide has a molecular weight of about 0,500 kDa, about 11,000 kDa, about 11,500 kDa, about 12,000 kDa, about 12,500 kDa, about 13,000 kDa, about 13,500 kDa, about 14,000 kDa, about 14,500 kDa, about 15,000 kDa, about 15,500 kDa, about 16,000 kDa, about 16,500 kDa, about 17,000 kDa, about 17,500 kDa, about 18,000 kDa, about 18,500 kDa, about 19,000 kDa, about 19,500 kDa, or about 20,000 kDa.

[0269] In further embodiments, the serotype 15B glycoconjugates of the invention are selected from the group consisting of: 1,000 kDa to 20,000 kDa; 1,000 kDa to 15,000 kDa; 1,000 kDa to 10,000 kDa; 1,000 kDa to 7,500 kDa; 1,000 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 3,000 kDa; 2,000 kDa having a molecular weight of Da to 20,000 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa.

[0270] In further embodiments, the serotype 15B glycoconjugates of the invention are selected from the group consisting of: 3,000 kDa to 20,000 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 3,000 kDa to 4,000 kDa. Da; 4,000 kDa to 20,000 kDa; 4,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa. In further embodiments, the serotype 15B glycoconjugates of the invention have a molecular weight of 5,000 kDa to 20,000 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa; 5,000 kDa to 7,500 kDa; 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 12,500 kDa; 6,000 kDa to 10,000 kDa; or 6,000 kDa to 7,500 kDa.

[0271] The molecular weight of the glycoconjugate is measured by SEC-MALLS. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure. In one embodiment, the serotype 15B glycoconjugate is prepared using reductive amination.

[0272] The serotype 15B glycoconjugates of the present invention can also be characterized by the saccharide to carrier protein ratio (weight / weight). In preferred embodiments, the serotype 15B capsular polysaccharide to carrier protein ratio (weight / weight) in the conjugate is 0.5 to 3.0 (e.g., about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3.0). In preferred embodiments, the serotype 15B capsular polysaccharide to carrier protein ratio in the conjugate is 0.4 to 2. In preferred embodiments, the ratio of serotype 15B capsular polysaccharide to carrier protein in the conjugate is 0.5 to 2.0, 0.5 to 1.5, 0.5 to 1.0, 1.0 to 1.5, or 1.0 to 2.0. In preferred embodiments, the ratio of serotype 15B capsular polysaccharide to carrier protein in the conjugate is 0.7 to 0.9.

[0273] Serotype 15B glycoconjugates and immunogenic compositions of the invention may contain free saccharides that are not covalently conjugated to a carrier protein but are nonetheless present in the glycoconjugate composition. The free saccharides can be non-covalently associated with (i.e., non-covalently bound, adsorbed, or entrapped within or with) the glycoconjugate.

[0274] In preferred embodiments, the serotype 15B glycoconjugates of the present invention comprise less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 15% free serotype 15B capsular polysaccharide relative to the total amount of serotype 15B capsular polysaccharide. In preferred embodiments, the serotype 15B glycoconjugates of the present invention comprise less than about 25% free serotype 15B capsular polysaccharide relative to the total amount of serotype 15B capsular polysaccharide. In preferred embodiments, the serotype 15B glycoconjugates of the present invention comprise less than about 20% free serotype 15B capsular polysaccharide relative to the total amount of serotype 15B capsular polysaccharide. In preferred embodiments, the serotype 15B glycoconjugates of the present invention comprise less than about 15% free serotype 15B capsular polysaccharide relative to the total amount of serotype 15B capsular polysaccharide.

[0275] Serotype 15B glycoconjugates were analyzed based on their molecular size distribution (K d ) can also be characterized. Size exclusion chromatography media (CL-4B) can be used to determine the relative molecular size distribution of the conjugates, as described above. In a preferred embodiment, at least 20% of the serotype 15B glycoconjugates of the invention have a Kd of less than or equal to 0.3 in a CL-4B column. In a preferred embodiment, at least 30% of the immunogenic conjugates have a Kd of less than or equal to 0.3 in a CL-4B column. In a preferred embodiment, at least 40% of the serotype 15B glycoconjugates of the invention have a Kd of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 15 glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 15B glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. dIn a preferred embodiment, at least 70% of the serotype 15B glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. d It has.

[0276] In a preferred embodiment, 40% to 90% of serotype 15B glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 50% to 90% of serotype 15B glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 65% to 80% of serotype 15B glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. d It has.

[0277] In preferred embodiments, the serotype 15B glycoconjugates of the invention comprise at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM acetate per mM serotype 15B capsular polysaccharide. In preferred embodiments, the glycoconjugates comprise at least 0.5, 0.6, or 0.7 mM acetate per mM serotype 15B capsular polysaccharide. In preferred embodiments, the glycoconjugates comprise at least 0.6 mM acetate per mM serotype 15B capsular polysaccharide. In preferred embodiments, the glycoconjugates comprise at least 0.7 mM acetate per mM serotype 15B capsular polysaccharide. In preferred embodiments, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0278] In preferred embodiments, the ratio of mM acetate per mM serotype 15B capsular polysaccharide in the serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 15B capsular polysaccharide in the serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in the isolated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of mM acetate per mM serotype 15B capsular polysaccharide in the serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in the isolated polysaccharide is at least 0.9. In a preferred embodiment, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0279] In preferred embodiments, the ratio of mM acetate per mM serotype 15B capsular polysaccharide in the serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 15B capsular polysaccharide in the serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in the activated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of mM acetate per mM serotype 15B capsular polysaccharide in the serotype 15B glycoconjugate to mM acetate per mM serotype 15B capsular polysaccharide in the activated polysaccharide is at least 0.9. In a preferred embodiment, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0280] In preferred embodiments, serotype 15B glycoconjugates of the invention comprise at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM glycerol per mM serotype 15B capsular polysaccharide. In preferred embodiments, serotype 15B glycoconjugates of the invention comprise at least 0.5, 0.6, or 0.7 mM glycerol per mM serotype 15B capsular polysaccharide. In preferred embodiments, serotype 15B glycoconjugates of the invention comprise at least 0.6 mM glycerol per mM serotype 15B capsular polysaccharide. In preferred embodiments, serotype 15B glycoconjugates of the invention comprise at least 0.7 mM glycerol per mM serotype 15B capsular polysaccharide.

[0281] Another method for characterizing the serotype 15B glycoconjugates of the invention is to characterize the extent of lysines conjugated to the carrier protein (e.g., CRMP) conjugated to the saccharide, which can be characterized as the extent of lysines conjugated (degree of conjugation). 197 Evidence for lysine modification of the carrier protein due to covalent attachment to the polysaccharide can be obtained by amino acid analysis using routine methods known to those skilled in the art. Conjugation can be achieved by the number of lysine residues in the CRM used to generate the conjugated material. 197 This results in a reduction in the number of lysine residues recovered compared to the protein starting material.

[0282] In preferred embodiments, the conjugation degree of the serotype 15B glycoconjugates of the present invention is 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 3 to 15, 3 to 13, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15, or 10 to 12. In one embodiment, the conjugation degree of the serotype 15B glycoconjugates of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In a preferred embodiment, the conjugation degree of the serotype 15B glycoconjugates of the present invention is 2 to 5.

[0283] 1.3.5 Glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F In the glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F of the invention, the saccharide is selected from the group consisting of polysaccharides and oligosaccharides, and the carrier protein is selected from any suitable carrier described herein or known to those of skill in the art. In some preferred embodiments, the saccharide is a polysaccharide derived from S. pneumoniae serotype 12F.

[0284] In one embodiment, glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F are prepared using CDAP. The polysaccharide is activated with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide is then attached, either directly or via a spacer (linker) group, to a carrier protein (preferably a carrier protein (CRM)). 197For example, the spacer may be cystamine or cysteamine to provide a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., using GMBS) or a haloacetylated carrier protein (e.g., iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, a cyanate ester (optionally produced by CDAP chemistry) is coupled with hexanediamine or adipic acid dihydrazide (ADH), and the amino-derivatized saccharide is attached to the carrier protein (e.g., CRM) via carboxyl groups on the protein carrier using carbodiimide (e.g., EDAC or EDC) chemistry. 197 ) to be conjugated.

[0285] Other techniques for conjugation use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may also involve a carbonyl linker, which can be formed by reaction of the free hydroxyl group of a sugar with CDI (see Bethell et al. (1979) J. Biol. Chern. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate with an amino group on the protein.

[0286] In one embodiment, capsular polysaccharides from serotype 12F Streptococcus pneumoniae (S. pneumoniae) are conjugated to carrier proteins by reductive amination, which involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from vicinal diols in individual hexasaccharide units, and (2) reduction of the activated saccharide and carrier protein to form the conjugate.

[0287] Prior to oxidation, the serotype 12F polysaccharide is optionally hydrolyzed (sized). Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be carried out using acetic acid.

[0288] In one embodiment, the oxidizing agent is periodate. The term "periodate" includes both periodate and periodic acid (see below).

[0289] In a preferred embodiment, the oxidizing agent is 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) free radical and N-chlorosuccinimide (NCS) as a co-oxidant. In such an embodiment, glycoconjugates derived from Streptococcus pneumoniae serovar 12F are prepared using 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) free radical and N-chlorosuccinimide (NCS) as a co-oxidant, as described in Example 7 and WO 2014 / 097099, to oxidize the primary alcohol of a sugar to an aldehyde (hereinafter referred to as "TEMPO / NCS oxidation"). Thus, in one aspect, glycoconjugates derived from S. pneumoniae serotype 12F can be obtained by a method comprising: a) reacting 12F saccharides with 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) and N-chlorosuccinimide (NCS) in an aqueous solvent to produce activated saccharides; and b) reacting the activated saccharides with a carrier protein containing one or more amine groups (hereinafter "TEMPO / NCS-reductive amination"). In one aspect, glycoconjugates derived from S. pneumoniae serotype 12F can be obtained by the method. In one embodiment, the oxidation degree of the activated 12F saccharide is 1 to 50, 1 to 40, 1 to 30, 1 to 20, 1 to 10, 1 to 5, 3 to 40, 3 to 30, 3 to 20, 3 to 10, 4 to 40, 4 to 30, 4 to 20, 4 to 10, 5 to 30, 5 to 25, 5 to 20, 5 to 10, 6 to 50, 6 to 40, 6 to 30, 6 to 20, 6 to 15, 6 to 14, 6 to 13, 6 to The ranges are 12, 6-11, 6-10, 7-40, 7-30, 7-20, 7-15, 7-14, 7-13, 7-12, 7-11, 7-10, 8-40, 8-30, 8-20, 8-15, 8-14, 8-13, 8-12, 8-11, 8-10, 9-40, 9-30, 9-20, 9-15, 10-40, 10-30, 10-20, or 10-15.In further embodiments, the degree of oxidation of the activated saccharide is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40. Preferably, the carrier protein is a CRM. 197 is.

[0290] In one embodiment, prior to step a), the 12F saccharides are hydrolyzed to a molecular weight in the range of 100 kDa to 400 kDa. For example, in one aspect, the molecular weight is in the range of 100 kDa to 350 kDa, 100 kDa to 300 kDa, 100 kDa to 250 kDa, 100 kDa to 200 kDa, 100 kDa to 150 kDa, 200 kDa to 400 kDa, 200 kDa to 350 kDa, 200 kDa to 300 kDa, 200 kDa to 250 kDa, 300 kDa to 400 kDa, or 300 kDa to 350 kDa.

[0291] In a further embodiment, the method further comprises purifying the activated polysaccharide before step b). In a further embodiment, the method further comprises adding a reducing agent after step b). In one embodiment, the reducing agent is NaCNBH3. In a further embodiment, the method further comprises adding NaBH4 after adding NaCNBH3. In a further embodiment, the method comprises a purification step after adding NaBH4.

[0292] In another aspect, the present disclosure provides a glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F, produced or obtainable by any of the methods disclosed above. For example, in one aspect, the present disclosure provides a glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F comprising a saccharide conjugated to a carrier protein, produced or obtainable by a method comprising: a) reacting the saccharide with 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) and N-chlorosuccinimide (NCS) in an aqueous solvent to produce an activated saccharide; and b) reacting the activated saccharide with a carrier protein comprising one or more amine groups.

[0293] In one embodiment, the glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F of the present invention have a molecular weight of about 50 kDa to about 20,000 kDa. In another embodiment, the glycoconjugates have a molecular weight of about 200 kDa to about 10,000 kDa. In another embodiment, the glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F have a molecular weight of about 500 kDa to about 5,000 kDa. In one embodiment, the glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F have a molecular weight of about 1,000 kDa to about 3,000 kDa. In other embodiments, glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F have a molecular weight of about 600 kDa to about 2,800 kDa; about 700 kDa to about 2,700 kDa; about 1,000 kDa to about 2,000 kDa; about 1,800 kDa to about 2,500 kDa; about 1,100 kDa to about 2,200 kDa; about 1,900 kDa to about 2,700 kDa; about 1,200 kDa to about 2,400 kDa; about 1,700 kDa to about 2,600 kDa; about 1,300 kDa to about 2,600 kDa; or about 1,600 kDa to about 3,000 kDa.

[0294] In further embodiments, the serotype 12F glycoconjugates of the invention are selected from the group consisting of 1,000 kDa to 20,000 kDa; 1,000 kDa to 15,000 kDa; 1,000 kDa to 10,000 kDa; 1,000 kDa to 7,500 kDa; 1,000 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 3,000 kDa; 2,000 kDa and 2,000 kDa to 20,000 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure. In some such embodiments, the carrier protein is a CRM. 197 In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.

[0295] Another method for characterizing the serotype 12F glycoconjugates of the invention is to characterize the extent of lysines conjugated to the carrier protein (e.g., CRMP) conjugated to the saccharide, which can be characterized as the extent of lysines conjugated (degree of conjugation). 197 ) is due to the number of lysine residues in the

[0296] In preferred embodiments, the conjugation degree of the serotype 12F glycoconjugates of the present invention is 2 to 20, 4 to 16, 4 to 15, 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 3 to 15, 3 to 13, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15, or 10 to 12. In one embodiment, the conjugation degree of the serotype 12F glycoconjugates of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20.

[0297] The number of lysine residues in the carrier protein that are conjugated to a saccharide can also be expressed as a molar ratio. 197 In glycoconjugates in which 4 to 15 lysine residues are covalently linked to the saccharide, the CRM of the conjugated lysine residues in the glycoconjugate 197 The molar ratio of CRM to HCl is about 10:1 to about 40:1. 197 In an immunogenic composition in which 2 to 20 lysine residues are covalently linked to a saccharide, the CRM of the conjugated lysine in the glycoconjugate 197 The molar ratio of conjugated lysine to carrier protein in the glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F of the invention is about 5:1 to about 50:1. In one embodiment, the molar ratio of conjugated lysine to carrier protein in the glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F of the invention is about 10:1 to about 25:1. In some such embodiments, the carrier protein is CRM. 197 In some embodiments, the CRM 197 may contain about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 lysine residues out of 39 covalently linked to saccharides. In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.

[0298] In one embodiment, the saccharide to carrier protein ratio (w / w) is between 0.2 and 4.0 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, In another embodiment, the saccharide to carrier protein ratio (w / w) is 1.1 to 1.7 in a glycoconjugate derived from S. pneumoniae serotype 12F. In other embodiments, the ratio of saccharide to carrier protein (w / w) is between 0.8 and 1.8 (e.g., about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, or about 1.8). In some such embodiments, the carrier protein is CRM. 197 In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.

[0299] The frequency of attachment of saccharide chains to lysines on the carrier protein is another parameter for characterizing the serotype 12F glycoconjugates of the present disclosure. For example, in one embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 100 saccharide repeating units of the polysaccharide. In one embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 50 saccharide repeating units of the polysaccharide. In one embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 25 saccharide repeating units of the polysaccharide. In another embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 4 saccharide repeating units of the polysaccharide. In another embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 10 saccharide repeating units of the polysaccharide. In further embodiments, there is at least one covalent bond between the carrier protein and the polysaccharide for every 15 saccharide repeating units of the polysaccharide. In frequent embodiments, the carrier protein is a CRM. 197 and CRM 197 The covalent bond between the saccharide and the polysaccharide occurs at least once for every 4, 10, 15 or 25 saccharide repeating units of the polysaccharide.

[0300] In other embodiments, the conjugate comprises at least one covalent bond between the carrier protein and the saccharide every 5-10 saccharide repeat units; every 2-7 saccharide repeat units; every 3-8 saccharide repeat units; every 4-9 saccharide repeat units; every 6-11 saccharide repeat units; every 7-12 saccharide repeat units; every 8-13 saccharide repeat units; every 9-14 saccharide repeat units; every 10-15 saccharide repeat units; every 2-6 saccharide repeat units; every 3-7 saccharide repeat units; every 4-8 saccharide repeat units; every 6-10 saccharide repeat units; every 7-11 saccharide repeat units; every 8-12 saccharide repeat units; every 9-13 saccharide repeat units; every 10-14 saccharide repeat units; every 10-20 saccharide repeat units; every 4-25 saccharide repeat units, or every 2-25 saccharide repeat units. In a common embodiment, the carrier protein is a CRM 197 is.

[0301] In another embodiment, the CRM 197 and saccharide, there is at least one bond between every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 saccharide repeat units of the polysaccharide. In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.

[0302] In one embodiment, a glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F of the invention comprises at least one covalent bond between the carrier protein and the polysaccharide for every 25 saccharide repeat units of the polysaccharide. In another embodiment, a covalent bond between the carrier protein and the polysaccharide is present at least once for every 4 saccharide repeat units of the polysaccharide. In another embodiment, a covalent bond between the carrier protein and the polysaccharide is present at least once for every 10 saccharide repeat units of the polysaccharide. In a further embodiment, a covalent bond between the carrier protein and the polysaccharide is present at least once for every 15 saccharide repeat units of the polysaccharide. In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.

[0303] Serotype 12F glycoconjugates and immunogenic compositions of the invention may contain free saccharides that are not covalently conjugated to a carrier protein but are nevertheless present in the glycoconjugate composition. The free saccharides can be non-covalently associated with (i.e., non-covalently bound, adsorbed, or entrapped within or with) the glycoconjugate.

[0304] In some embodiments, the serotype 12F glycoconjugates of the present invention comprise less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% free serotype 12F polysaccharide relative to the total amount of serotype 12F polysaccharide. In one embodiment, the glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F comprise less than about 50% free serotype 12F polysaccharide relative to the total amount of serotype 12F polysaccharide. In one embodiment, the glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F comprise less than about 45% free serotype 12F polysaccharide relative to the total amount of serotype 12F polysaccharide. In another embodiment, the glycoconjugates comprise less than about 30% free serotype 12F polysaccharide relative to the total amount of serotype 12F polysaccharide. In another embodiment, the glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F comprises less than about 20% free serotype 12F polysaccharide relative to the total amount of serotype 12F polysaccharide. In a further embodiment, the glycoconjugate comprises less than about 10% free serotype 12F polysaccharide relative to the total amount of serotype 12F polysaccharide. In another embodiment, the glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F comprises less than about 5% free serotype 12F polysaccharide relative to the total amount of serotype 12F polysaccharide. In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.

[0305] In some embodiments, serotype 12F glycoconjugates of the invention comprise saccharides having a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the saccharides have a molecular weight of 50 kDa to 2,000 kDa. In further such embodiments, the saccharides have a molecular weight of 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa; 100 kDa to 1,000 kDa. In some such embodiments, the serotype 12F glycoconjugate has a molecular weight of between 1,000 kDa, 100 kDa and 750 kDa, 100 kDa and 500 kDa, 200 kDa and 2,000 kDa, 200 kDa and 1,750 kDa, 200 kDa and 1,500 kDa, 200 kDa and 1,250 kDa, 200 kDa and 1,000 kDa, 200 kDa and 750 kDa, or 200 kDa and 500 kDa, or 200 kDa and 400 kDa.

[0306] Serotype 12F glycoconjugates were analyzed based on their molecular size distribution (K d ) can also be characterized. Size exclusion chromatography media (CL-4B) can be used to determine the relative molecular size distribution of the conjugates, as described above. In a preferred embodiment, at least 35% of the serotype 12F glycoconjugates of the invention have a K less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% or 85% of the serotype 12F glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 12F glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column.d In a preferred embodiment, at least 70% of the serotype 12F glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. d It has.

[0307] In a preferred embodiment, 40% to 90% of serotype 12F glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 50% to 90% of serotype 12F glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 65% to 80% of serotype 12F glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. d It has.

[0308] 1.3.6 Glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 10A In one embodiment, serotype 10A glycoconjugates are obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled to an amino group on a carrier protein directly or via a spacer (linker) group. For example, cystamine or cysteamine may be used as the spacer to obtain a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., with GMBS) or a haloacetylated carrier protein (e.g., with iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, cyanate esters (which may be generated by CDAP chemistry) are coupled with hexanediamine or adipic acid dihydrazide (ADH), and the amino-derivatized saccharides are conjugated to carrier proteins via carboxyl groups on the protein carrier using carbodiimide (e.g., EDAC or EDC) chemistry. Such conjugates are described, for example, in WO93 / 15760, WO95 / 08348, and WO96 / 129094.

[0309] Other suitable techniques use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reaction of a free hydroxyl group of a sugar with CDI (see Bethell et al. (1979) J. Biol. Chern. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate with an amino group on the protein.

[0310] In a preferred embodiment, the serotype 10A glycoconjugates of the invention are prepared using reductive amination, which involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from vicinal diols in the individual hexasaccharide units, and (2) reduction of the activated polysaccharide and carrier protein to form the conjugate.

[0311] Prior to oxidation, the serotype 10A polysaccharide is optionally hydrolyzed (sized). Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be carried out using acetic acid.

[0312] In one embodiment, the serotype polysaccharide is (a) reacting the isolated serotype 10A polysaccharide with an oxidizing agent; and (b) quenching the oxidation reaction by adding a quenching agent to obtain activated serotype 10A polysaccharide. It is activated (oxidized) by a process that includes

[0313] In a preferred embodiment, the oxidizing agent is periodate. For purposes of the present invention, the term "periodate" includes both periodate and periodic acid; the term also includes metaperiodate (IO4 - ) and orthoperiodate (IO6 5- ) and various salts of periodate (e.g., sodium periodate and potassium periodate). In a preferred embodiment, the oxidizing agent is sodium periodate. In a preferred embodiment, the periodate used to oxidize serotype 10A polysaccharide is metaperiodate. In a preferred embodiment, the periodate used to oxidize serotype 10A polysaccharide is sodium metaperiodate.

[0314] In one embodiment, the quenching agent is selected from a vicinal diol, a 1,2-amino alcohol, an amino acid, glutathione, a sulfite, a bisulfite, a dithionite, a metabisulfite, a thiosulfate, a phosphite, a hypophosphite, or a phosphorous acid.

[0315] In one embodiment, the quenching agent has the formula (I):

[0316] [ka] (In the formula, R 1 is selected from H, methyl, ethyl, propyl or isopropyl It is a 1,2-amino alcohol.

[0317] In one embodiment, the quenching agent is selected from sodium and potassium salts of sulfites, bisulfites, dithionites, metabisulfites, thiosulfates, phosphites, hypophosphites or phosphorous acid.

[0318] In one embodiment, the quenching agent is an amino acid, which may be selected from serine, threonine, cysteine, cystine, methionine, proline, hydroxyproline, tryptophan, tyrosine, and histidine.

[0319] In one embodiment, the quenching agent is a sulfite, such as bisulfite, dithionite, metabisulfite, or thiosulfate.

[0320] In one embodiment, the quenching agent is a compound containing two vicinal hydroxyl groups (vicinal diol), ie, two hydroxyl groups covalently linked to two adjacent carbon atoms.

[0321] Preferably, the quenching agent has the formula (II):

[0322] [ka] (In the formula, R 1 and R 2 are each independently selected from H, methyl, ethyl, propyl, or isopropyl. is a compound of

[0323] In a preferred embodiment, the quenching agent is glycerol, ethylene glycol, propane-1,2-diol, butane-1,2-diol or butane-2,3-diol, ascorbic acid, or butane-2,3-diol.

[0324] In a preferred embodiment, the isolated serotype 10A polysaccharide is (a) reacting the isolated serotype 10A polysaccharide with periodate; and (b) quenching the oxidation reaction by the addition of butane-2,3-diol to obtain activated serotype 10A polysaccharide. It is activated by a process including

[0325] After the oxidation step of the polysaccharide, the polysaccharide is said to be activated and is hereinafter referred to as "activated polysaccharide".

[0326] In a preferred embodiment, the activated serotype 10A polysaccharide is purified. The activated serotype 10A polysaccharide is purified according to methods known to those skilled in the art, such as gel permeation chromatography (GPC), dialysis, or ultrafiltration / diafiltration. For example, the activated 10A polysaccharide is purified by concentration and diafiltration using an ultrafiltration device.

[0327] In preferred embodiments, the degree of oxidation of the activated serotype 10A polysaccharide is 2 to 30, 2 to 25, 2 to 20, 2 to 15, 2 to 10, 2 to 5, 5 to 30, 5 to 25, 5 to 20, 5 to 15, 5 to 10, 10 to 30, 10 to 25, 10 to 20, 10 to 15, 15 to 30, 15 to 25, 15 to 20, 20 to 30, or 20 to 25. In preferred embodiments, the degree of oxidation of the activated serotype 10A polysaccharide is 2 to 10, 4 to 8, 4 to 6, 6 to 8, 6 to 12, 8 to 14, 9 to 11, 10 to 16, 12 to 16, 14 to 18, 16 to 20, 16 to 18, 18 to 22, or 18 to 20.

[0328] In a preferred embodiment, the activated serotype 10A polysaccharide has a molecular weight of 50 kDa to 400 kDa, 50 kDa to 350 kDa, 50 kDa to 300 kDa, 50 kDa to 250 kDa, 50 kDa to 200 kDa, 100 kDa to 300 kDa, 100 kDa to 250 kDa, or 100 kDa to 200 kDa. In a preferred embodiment, the activated serotype 10A polysaccharide has a molecular weight of 50 kDa to 300 kDa. In a preferred embodiment, the activated serotype 10A polysaccharide has a molecular weight of 100 kDa to 200 kDa. In a preferred embodiment, the activated serotype 10A polysaccharide has a molecular weight of 100 kDa to 200 kDa and a degree of oxidation of 5 to 20, 5 to 15, 8 to 14, 8 to 12, or 9 to 11. In a preferred embodiment, the activated serotype 10A polysaccharide has a molecular weight of 100 kDa to 200 kDa and a degree of oxidation of 9 to 11.

[0329] The activated polysaccharide and / or carrier protein can be lyophilized (freeze-dried) independently (separate lyophilization) or together (co-lyophilization).

[0330] In one embodiment, the activated serotype 10A polysaccharide is optionally freeze-dried in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol, and palatinit. In a preferred embodiment, the sugar is sucrose. In one embodiment, the freeze-dried activated polysaccharide is then mixed with a solution containing a carrier protein.

[0331] In another embodiment, the activated polysaccharide and carrier protein are simultaneously lyophilized. In such an embodiment, the activated serotype 10A polysaccharide is mixed with the carrier protein and, optionally, lyophilized in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol, and palatinit. In a preferred embodiment, the sugar is sucrose. The simultaneously lyophilized polysaccharide and carrier protein can then be resuspended in a solution and reacted with a reducing agent.

[0332] The second step in the conjugation process is the reduction of the activated polysaccharide and carrier protein with a reducing agent (reductive amination) to form the conjugate.

[0333] The activated serotype 10A polysaccharide is (c) mixing the activated serotype 10A polysaccharide with a carrier protein; and (d) reacting the mixed activated serotype 10A polysaccharide and carrier protein with a reducing agent to form a serotype 10A polysaccharide-carrier protein conjugate. The compound can be conjugated to a carrier protein by a process comprising:

[0334] In one embodiment, the reduction reaction is carried out in an aqueous solvent, and in another embodiment, the reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.

[0335] In one embodiment, the reducing agent is sodium cyanoborohydride, sodium triacetoxyborohydride, sodium borohydride, or zinc borohydride in the presence of a Bronsted or Lewis acid, an amine borane such as pyridine borane, 2-picoline borane, 2,6-diborane-methanol, dimethylamine-borane, t-BuMeiPrN-BH3, benzylamine-BH3, or 5-ethyl-2-methylpyridine borane (PEMB). In a preferred embodiment, the reducing agent is sodium cyanoborohydride.

[0336] At the end of the reduction reaction, there may be unreacted aldehyde groups remaining in the conjugate, which can be capped with a suitable capping agent, which in one embodiment is sodium borohydride (NaBH4).

[0337] After conjugation of the serotype 10A polysaccharide to the carrier protein, the glycoconjugate can be purified (enriched with respect to the amount of polysaccharide-protein conjugate) by a variety of techniques known to those skilled in the art, including dialysis, concentration / diafiltration operations, tangential flow filtration sedimentation / elution, column chromatography (DEAE or hydrophobic interaction chromatography), and depth filtration.

[0338] In some embodiments, serotype 10A glycoconjugates of the invention comprise saccharides having a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the saccharides have a molecular weight of 50 kDa to 2,000 kDa. In further such embodiments, the saccharides have a molecular weight of 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa; 100 kDa to 1,000 kDa. In some such embodiments, the serotype 10A glycoconjugates have a molecular weight of between 1,000 kDa, 100 kDa and 750 kDa, 100 kDa and 500 kDa, 200 kDa and 2,000 kDa, 200 kDa and 1,750 kDa, 200 kDa and 1,500 kDa, 200 kDa and 1,250 kDa, 200 kDa and 1,000 kDa, 200 kDa and 750 kDa, or 200 kDa and 500 kDa, or 200 kDa and 400 kDa.

[0339] In some embodiments, the serotype 10A glycoconjugates of the present invention have a molecular weight of 50 kDa to 20,000 kDa. In other embodiments, the serotype 10A glycoconjugates have a molecular weight of 50 kDa to 15,000 kDa. In other embodiments, the serotype 10A glycoconjugates have a molecular weight of 500 kDa to 15,000 kDa, 500 kDa to 10,000 kDa, 2,000 kDa to 10,000 kDa, or 3,000 kDa to 8,000 kDa. In other embodiments, the serotype 10A glycoconjugates have a molecular weight of 1,000 kDa to 10,000 kDa. In other embodiments, the serotype 10A glycoconjugates have a molecular weight of 1,000 kDa to 8,000 kDa. In still other embodiments, the serotype 10A glycoconjugate has a molecular weight of 2,000 kDa to 8,000 kDa or 3,000 kDa to 7,000 kDa.In further embodiments, the serotype 10A glycoconjugates of the invention are selected from the group consisting of: 200 kDa to 20,000 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; 200 kDa to 7,500 kDa; 200 kDa to 5,000 kDa; 200 kDa to 3,000 kDa; 200 kDa to 1,000 kDa; 500 kDa to 20,000 kDa; 500 kDa to 15,000 kDa; 500 kDa to 12,500 kDa; 500 kDa ~10,000kDa;500kDa~7,500kDa;500kDa~6,000kDa;500kDa~5,000kDa;500kDa~4,000kDa;500kDa~3,000kDa;500kDa~2,000k Da;500kDa~1,500kDa;500kDa~1,000kDa;750kDa~20,000kDa;750kDa~15,000kDa;750kDa~12,500kDa;750kDa~10,000kDa;7 50kDa~7,500kDa;750kDa~6,000kDa;750kDa~5,000kDa;750kDa~4,000kDa;750kDa~3,000kDa;750kDa~2,000kDa;750kDa~1, 500kDa;1,000kDa~15,000kDa;1,000kDa~12,500kDa;1,000kDa~10,000kDa;1,000kDa~7,500kDa;1,000kDa~6,000kDa;1,00 having a molecular weight of 0 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 2,500 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa.

[0340] In further embodiments, the serotype 10A glycoconjugates of the invention have a molecular weight of 3,000 kDa to 20,000 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 4,000 kDa to 20,000 kDa; 4,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa. In further embodiments, the serotype 10A glycoconjugates of the invention have a molecular weight of 5,000 kDa to 20,000 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa, or 5,000 kDa to 7,500 kDa. In further embodiments, the serotype 10A glycoconjugates of the invention have a molecular weight of 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 10,000 kDa, or 6,000 kDa to 7,500 kDa. In further embodiments, the serotype 10A glycoconjugates of the invention have a molecular weight of 7,000 kDa to 20,000 kDa; 7,000 kDa to 15,000 kDa; 7,000 kDa to 10,000 kDa, or 7,000 kDa to 8,000 kDa. In further embodiments, the serotype 10A glycoconjugates of the invention have a molecular weight of 8,000 kDa to 20,000 kDa; 8,000 kDa to 15,000 kDa; or 8,000 kDa to 10,000 kDa.

[0341] Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure. Molecular weights of glycoconjugates are measured by SEC-MALLS.

[0342] Another method for characterizing the serotype 10A glycoconjugates of the invention is to characterize the extent of lysines conjugated to the carrier protein (e.g., CRMP) conjugated to the saccharide, which can be characterized as the extent of lysines conjugated (degree of conjugation).197 Evidence of lysine modification of the carrier protein due to covalent attachment to the polysaccharide can be obtained by amino acid analysis using routine methods known to those skilled in the art. Conjugation can be achieved by the number of lysine residues in the CRM used to generate the conjugated material. 197 This results in a reduction in the number of lysine residues recovered compared to the protein starting material.

[0343] In preferred embodiments, the degree of conjugation of the serotype 10A glycoconjugate is 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 3 to 15, 3 to 13, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15, or 10 to 12. In preferred embodiments, the degree of conjugation of the serotype 10A glycoconjugate is 6 to 8. In preferred embodiments, the carrier protein is a CRM. 197 is.

[0344] Serotype 10A glycoconjugates of the invention can also be characterized by the saccharide to carrier protein ratio (w / w). In some embodiments, the saccharide to carrier protein ratio (w / w) is between 0.5 and 3.0 (e.g., about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3.0). In preferred embodiments, the ratio of serotype 10A saccharide to carrier protein in the conjugate is 0.5 to 2.0, 0.5 to 1.5, 0.5 to 1.0, 1.0 to 1.5, or 1.0 to 2.0. In preferred embodiments, the ratio of serotype 10A polysaccharide to carrier protein in the conjugate is 0.8 to 1.4. In preferred embodiments, the ratio of serotype 10A polysaccharide to carrier protein in the conjugate is 0.8 to 1.2 (e.g., about 0.8, about 0.9, about 1.0, about 1.1, or about 1.2). In some such embodiments, the carrier protein is CRM. 197 is.

[0345] Serotype 10A glycoconjugates and immunogenic compositions of the invention may contain free saccharides that are not covalently conjugated to a carrier protein but are nevertheless present in the glycoconjugate composition. The free saccharides can be non-covalently associated with (i.e., non-covalently bound, adsorbed, or entrapped within or with) the glycoconjugate.

[0346] In some embodiments, serotype 10A glycoconjugates of the invention comprise less than about 50% free saccharides, less than about 45% free saccharides, less than about 40% free saccharides, less than about 35% free saccharides, less than about 30% free saccharides, less than about 25% free saccharides, less than about 20% free saccharides, less than about 15% free saccharides, less than about 10% free saccharides, or less than about 5% free saccharides relative to the total amount of 10A saccharides. Preferably, the serotype 10A glycoconjugates comprise less than 15% free saccharides, more preferably less than 10% free saccharides, and even more preferably less than 5% free saccharides.

[0347] Serotype 10A glycoconjugates were analyzed based on their molecular size distribution (K d ) can also be characterized. Size exclusion chromatography media (CL-4B) can be used to determine the relative molecular size distribution of the conjugates, as described above. In a preferred embodiment, at least 30% of the serotype 10A glycoconjugates of the invention have a K less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 40% of the serotype 10A glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 10A glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 10A glycoconjugates have a K less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 50% to 80% of the serotype 10A glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. d It has.

[0348] 1.3.7 Glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 11A In one embodiment, serotype 11A glycoconjugates are obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled to an amino group on a carrier protein directly or via a spacer (linker) group. For example, cystamine or cysteamine may be used as the spacer to obtain a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., with GMBS) or a haloacetylated carrier protein (e.g., with iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, cyanate esters (which may be generated by CDAP chemistry) are coupled with hexanediamine or adipic acid dihydrazide (ADH), and the amino-derivatized saccharides are conjugated to carrier proteins via carboxyl groups on the protein carrier using carbodiimide (e.g., EDAC or EDC) chemistry. Such conjugates are described, for example, in WO93 / 15760, WO95 / 08348, and WO96 / 129094.

[0349] Other suitable techniques use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reaction of a free hydroxyl group of a sugar with CDI (see Bethell et al. (1979) Biol. Chern. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate with an amino group on the protein.

[0350] In a preferred embodiment, the serotype 11A glycoconjugates of the invention are prepared using reductive amination, which involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from vicinal diols in the individual hexasaccharide units, and (2) reduction of the activated polysaccharide and carrier protein to form the conjugate.

[0351] Prior to oxidation, the serotype 11A polysaccharide is optionally hydrolyzed to reduce its viscosity. Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be performed using acetic acid. Mechanical sizing can be performed using high pressure homogenizing shear.

[0352] The oxidation step may involve reaction with periodate. For purposes of the present invention, the term "periodate" includes both periodate and periodic acid; the term also includes metaperiodate (IO4 - ) and orthoperiodate (IO6 5-) and various salts of periodate (e.g., sodium periodate and potassium periodate). In one embodiment, the capsular polysaccharide serotype 11A of Streptococcus pneumoniae (S. pneumoniae) is oxidized in the presence of metaperiodate, preferably in the presence of sodium periodate (NaIO). In another embodiment, the capsular polysaccharide from serotype 11A is oxidized in the presence of orthoperiodate, preferably periodic acid.

[0353] After the polysaccharide oxidation step, the polysaccharide is said to be activated and is hereinafter referred to as "activated polysaccharide." The activated polysaccharide can be purified and lyophilized (freeze-dried).

[0354] The activated polysaccharide and carrier protein can be lyophilized (freeze-dried) independently (separate lyophilization) or together (co-lyophilization). In one embodiment, the activated polysaccharide and carrier protein are lyophilized simultaneously. In another embodiment, the activated polysaccharide and carrier protein are lyophilized independently.

[0355] In one embodiment, lyophilization is carried out in the presence of a non-reducing sugar, possible non-reducing sugars include sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol and palatinit.

[0356] The second step of the conjugation process is reduction (reductive amination) of the activated polysaccharide and carrier protein with a reducing agent to form the conjugate. Suitable reducing agents include cyanoborohydrides such as sodium cyanoborohydride, borane-pyridine, or borohydride exchange resins. In one embodiment, the reducing agent is sodium cyanoborohydride.

[0357] In one embodiment, the reduction reaction is carried out in an aqueous solvent, and in another embodiment, the reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.

[0358] In one embodiment, 0.1 to 3.0, 0.15 to 2.0, 0.2 to 2.0, or 0.5 to 1.5 molar equivalents of sodium cyanoborohydride are used in the reduction reaction, hi one embodiment, about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 molar equivalents of sodium cyanoborohydride are used in the reduction reaction.

[0359] In one embodiment, the reducing agent is sodium triacetoxyborohydride. In further embodiments, 1.0 to 6.0 molar equivalents, 2.0 to 5.0 molar equivalents, or about 3.0 molar equivalents of sodium triacetoxyborohydride are used in the reduction reaction.

[0360] At the end of the reduction reaction, there may be unreacted aldehyde groups remaining in the conjugate. These can be capped with a suitable capping agent. In one embodiment, the capping agent is sodium borohydride (NaBH4). In one embodiment, capping is accomplished by combining the reduction reaction with 0.5 to 5.0 molar equivalents of NaBH4, e.g., about 1.0, 1.5, 2.0, 2.5, or 3.0 molar equivalents of NaBH4.

[0361] After conjugation (reduction reaction and, optionally, capping), the glycoconjugate can be purified. The glycoconjugate can be purified by diafiltration and / or ion exchange chromatography and / or size exclusion chromatography. In one embodiment, the glycoconjugate is purified by diafiltration or ion exchange chromatography or size exclusion chromatography.

[0362] In one embodiment, the glycoconjugate is sterile filtered.

[0363] In some embodiments, the serotype 11A glycoconjugates of the invention are coupled to a carrier protein (e.g., CRMP). 197 ) and having a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the saccharide has a molecular weight of 50 kDa to 2,000 kDa. In further such embodiments, the saccharides are selected from the group consisting of saccharides of 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 50 kDa to 400 kDa; 50 kDa to 300 kDa; 50 kDa to 200 kDa; 50 kDa to 100 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa; 100 kDa having a molecular weight of a~1,000kDa; 100kDa~750kDa; 100kDa~500kDa; 100kDa~400kDa; 100kDa~300kDa; 100kDa~200kDa; 200kDa~2,000kDa; 200kDa~1,750kDa; 200kDa~1,500kDa; 200kDa~1,250kDa; 200kDa~1,000kDa; 200kDa~750kDa; or 200kDa~500kDa; 200kDa~400kDa or 200kDa~300kDa.

[0364] In some embodiments, the serotype 11A glycoconjugates of the present invention have a molecular weight of 50 kDa to 20,000 kDa. In other embodiments, the serotype 11A glycoconjugates have a molecular weight of 50 kDa to 15,000 kDa. In other embodiments, the serotype 11A glycoconjugates have a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the serotype 11A glycoconjugates have a molecular weight of 200 kDa to 10,000 kDa. In still other embodiments, the serotype 11A glycoconjugates have a molecular weight of 1,000 kDa to 8,000 kDa or 2,000 kDa to 8,000 kDa.

[0365] In further embodiments, the serotype 11A glycoconjugates of the invention are selected from the group consisting of: 200 kDa to 20,000 kDa; 200 kDa to 17,500 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; 200 kDa to 7,500 kDa; 200 kDa to 5,000 kDa; 200 kDa to 3,000 kDa; 200 kDa to 2,000 kDa; 200 kDa to 1,000 kDa; 500 kDa to 20,000 kDa; 500 kDa to 17,500 kDa; 500 kDa to 15,000 kDa; 500 kDa to 12,000 kDa. ,500kDa;500kDa~10,000kDa;500kDa~7,500kDa;500kDa~6,000kDa;500kDa~5,000kDa;500kDa~4,000kDa;500kDa~3,000kDa;500kDa~2,000kDa;5 00kDa~1,500kDa;500kDa~1,000kDa;700kDa~20,000kDa;700kDa~17,500kDa;700kDa~15,000kDa;700kDa~12,500kDa;700kDa~10,000kDa;700kDa~ 7,500kDa;700kDa~6,000kDa;700kDa~5,000kDa;700kDa~4,500kDa;700kDa~4,000kDa;700kDa~3,500kDa;700kDa~3,000kDa;700kDa~2,000kDa;7 00kDa~1,500kDa;1,000kDa~20,000kDa;1,000kDa~17,500kDa;1,000kDa~15,000kDa;1,000kDa~12,500kDa;1,000kDa~10,000kDa;1,000kDa~7,5 00kDa;1,000kDa~6,000kDa;1,000kDa~5,000kDa;1,000kDa~4,000kDa;1,000kDa~2,500kDa;2,000kDa~20,000kDa;2,000kDa~17,500kDa;2,000kDa Da~15,000kDa;2,000kDa~12,500kDa;2,000kDa~10,000kDa;2,000kDa~7,500kDa;2,000kDa~6,000kDa;2,000kDa~5,000kDa;2,000kDa~4,000kDa;Or has a molecular weight of 2,000 kDa to 3,000 kDa;

[0366] In further embodiments, the serotype 11A glycoconjugates of the invention are selected from the group consisting of: 3,000 kDa to 20,000 kDa; 3,000 kDa to 17,500 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 4,000 kDa having a molecular weight of Da to 20,000 kDa; 4,000 kDa to 17,500 kDa; 4,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa. In further embodiments, the serotype 11A glycoconjugates of the invention have a molecular weight of 5,000 kDa to 20,000 kDa; 5,000 kDa to 17,500 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa or 5,000 kDa to 7,500 kDa.

[0367] In one embodiment, the serotype 11A glycoconjugate is prepared using reductive amination.

[0368] In preferred embodiments, the serotype 11A glycoconjugates of the invention comprise at least 0.3, 0.5, 0.6, 1.0, 1.4, 1.8, 2.2, 2.6, 3.0, 3.4, 3.8, 4.2, 4.6, or 5.0 mM acetate per mM serotype 11A polysaccharide. In preferred embodiments, the serotype 11A glycoconjugates comprise at least 1.8, 2.2, or 2.6 mM acetate per mM serotype 11A polysaccharide. In one embodiment, the glycoconjugates comprise at least 0.6 mM acetate per mM serotype 11A polysaccharide. In a preferred embodiment, the serotype 11A glycoconjugates of the invention comprise at least 0.6, 1.0, 1.4, 1.8, 2.2, 2.6, 3.0, 3.4, 3.8, 4.2, or 4.6 mM acetate per mM serotype 11A polysaccharide and less than about 5.0 mM acetate per mM serotype 11A polysaccharide. In one embodiment, the serotype 11A glycoconjugates of the invention comprise at least 0.6, 1.0, 1.4, 1.8, 2.2, 2.6, or 3.0 mM acetate per mM serotype 11A polysaccharide and less than about 3.4 mM acetate per mM serotype 11A polysaccharide. In one embodiment, the serotype 11A glycoconjugate of the invention comprises at least 0.6, 1.0, 1.4, 1.8, 2.2, 2.6, or about 3.0 mM acetate per mM serotype 11A polysaccharide and less than about 3.3 mM acetate per mM serotype 11A polysaccharide, any of which is contemplated as an embodiment of the present disclosure.

[0369] In preferred embodiments, the ratio of mM acetate per mM serotype 11A capsular polysaccharide in the serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 11A capsular polysaccharide in the serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in the isolated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of mM acetate per mM serotype 11A capsular polysaccharide in the serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in the isolated polysaccharide is at least 0.9. In a preferred embodiment, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0370] In preferred embodiments, the ratio of mM acetate per mM serotype 11A capsular polysaccharide in the serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate per mM serotype 11A capsular polysaccharide in the serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in the activated polysaccharide is at least 0.7. In a preferred embodiment, the ratio of mM acetate per mM serotype 11A capsular polysaccharide in the serotype 11A glycoconjugate to mM acetate per mM serotype 11A capsular polysaccharide in the activated polysaccharide is at least 0.9. In a preferred embodiment, the presence of O-acetyl groups is determined by ion-HPLC analysis.

[0371] In preferred embodiments, the serotype 11A glycoconjugates of the invention comprise at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 mM glycerol per mM serotype 11A polysaccharide. In preferred embodiments, the serotype 11A glycoconjugates of the invention comprise at least 0.2, 0.3, or 0.4 mM glycerol per mM serotype 11A polysaccharide. In preferred embodiments, the serotype 11A glycoconjugates of the invention comprise at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, or 0.9 mM glycerol per mM serotype 11A polysaccharide and less than about 1.0 mM glycerol per mM serotype 11A polysaccharide. In preferred embodiments, the serotype 11A glycoconjugates of the invention comprise at least 0.3, 0.4, 0.5, 0.6, or 0.7 mM glycerol per mM serotype 11A polysaccharide and less than about 0.8 mM glycerol per mM serotype 11A polysaccharide, any of which are contemplated as embodiments of the present disclosure.

[0372] Another method for characterizing the serotype 11A glycoconjugates of the invention is to characterize the extent of lysines conjugated to the carrier protein (e.g., CRMP) conjugated to the saccharide, which can be characterized as the extent of lysines conjugated (degree of conjugation). 197 ) is due to the number of lysine residues in the

[0373] Evidence for lysine modifications of the carrier protein due to covalent attachment to the polysaccharide can be obtained by amino acid analysis using routine methods known to those skilled in the art. Conjugation can be performed using the CRM used to generate the conjugated material. 197 This results in a reduction in the number of lysine residues recovered compared to the protein starting material.

[0374] In preferred embodiments, the degree of conjugation of the serotype 11A glycoconjugates of the invention is 1 to 15, 1 to 13, 1 to 10, 1 to 8, 1 to 6, 1 to 5, 1 to 4, 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15, or 10 to 12. In one embodiment, the degree of conjugation of the serotype 11A glycoconjugates of the invention is about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In preferred embodiments, the degree of conjugation of the serotype 11A glycoconjugates of the invention is 1 to 6 or 2 to 5. In some such embodiments, the carrier protein is a CRM. 197 is.

[0375] Serotype 11A glycoconjugates of the invention may also be characterized by the saccharide to carrier protein ratio (weight / weight). In some embodiments, the ratio of saccharide to carrier protein (w / w) is 0.2 to 4.0 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, or about 4.0). In other embodiments, the saccharide to carrier protein ratio (w / w) is 0.7 to 2.5, 0.8 to 2.0, 0.7 to 2.0, 0.8 to 1.5, 0.7 to 1.5, 0.7 to 1.4, 0.8 to 1.4, 0.7 to 1.45, or 0.8 to 1.45. In further embodiments, the saccharide to carrier protein ratio (w / w) is 0.8 to 1.6 (e.g., about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, or about 1.6). In some such embodiments, the carrier protein is CRM. 197In one embodiment, the serotype 11A glycoconjugate is prepared using reductive amination.

[0376] The serotype 11A glycoconjugates and immunogenic compositions of the invention may contain free saccharides that are not covalently conjugated to a carrier protein but are nevertheless present in the glycoconjugate composition. The free saccharides can be non-covalently associated with (i.e., non-covalently bound, adsorbed, or entrapped within or with) the glycoconjugate.

[0377] In some embodiments, serotype 11A glycoconjugates of the invention comprise less than about 50% free serotype 11A capsular polysaccharide relative to the total amount of serotype 11A capsular polysaccharide, less than about 45% free saccharides, less than about 40% free saccharides, less than about 35% free saccharides, less than about 30% free saccharides, less than about 25% free saccharides, less than about 20% free saccharides, less than about 15% free saccharides, less than about 10% free saccharides, or less than about 5% free serotype 11A capsular polysaccharide relative to the total amount of serotype 11A capsular polysaccharide. Preferably, the serotype 11A glycoconjugates comprise less than 15% free saccharides, more preferably less than 10% free saccharides, and even more preferably less than 5% free saccharides.

[0378] Serotype 11A glycoconjugates were analyzed based on their molecular size distribution (K d ) can also be characterized. Size exclusion chromatography media (CL-4B) can be used to determine the relative molecular size distribution of the conjugates, as described above. In a preferred embodiment, at least 30% of the serotype 11A glycoconjugates of the invention have a K less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80% or 85% of the serotype 11A glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. dIn a preferred embodiment, at least 60% of the serotype 11A glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 65% of the serotype 11A glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. d It has.

[0379] 1.3.8 Glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 8 In one embodiment, serotype 8 glycoconjugates are obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled to amino groups on a carrier protein directly or via a spacer (linker) group. For example, cystamine or cysteamine as the spacer can be used to obtain a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g., using GMBS) or a haloacetylated carrier protein (e.g., using iodoacetimide, SIB, SIAB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (which may be generated by CDAP chemistry) is coupled with hexanediamine or adipic acid dihydrazide (ADH), and the amino-derivatized saccharide is conjugated to the carrier protein via carboxyl groups on the protein carrier using carbodiimide (e.g., EDAC or EDC) chemistry. Such conjugates are described, for example, in WO93 / 15760, WO95 / 08348 and WO96 / 129094.

[0380] Other suitable techniques use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, and TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reaction of a free hydroxyl group of a sugar with CDI (see Bethell et al. (1979) J. Biol. Chern. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518), followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric terminus to a primary hydroxyl group, optionally protecting / deprotecting the primary hydroxyl group, reacting the primary hydroxyl group with CDI to form a CDI carbamate intermediate, and coupling the CDI carbamate intermediate with an amino group on the protein.

[0381] In a preferred embodiment, the serotype 8 glycoconjugates of the invention are prepared using reductive amination, which involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functional groups from vicinal diols in the individual hexasaccharide units, and (2) reduction of the activated polysaccharide and carrier protein to form the conjugate.

[0382] Prior to oxidation, the serotype 8 polysaccharide is optionally hydrolyzed to reduce its viscosity. Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be carried out using acetic acid.

[0383] The oxidation step may involve reaction with periodate. For purposes of the present invention, the term "periodate" includes both periodate and periodic acid; the term also includes metaperiodate (IO4 - ) and orthoperiodate (IO6 5-) and various salts of periodate (e.g., sodium periodate and potassium periodate). In one embodiment, the capsular polysaccharide serotype 8 of Streptococcus pneumoniae (S. pneumoniae) is oxidized in the presence of metaperiodate, preferably in the presence of sodium periodate (NaIO). In another embodiment, the capsular polysaccharide from serotype 8 is oxidized in the presence of orthoperiodate, preferably periodic acid.

[0384] After the polysaccharide oxidation step, the polysaccharide is said to be activated and is hereinafter referred to as "activated polysaccharide." The activated polysaccharide can be purified and lyophilized (freeze-dried).

[0385] The activated polysaccharide and carrier protein can be lyophilized (freeze-dried) independently (separate lyophilization) or together (co-lyophilization). In one embodiment, the activated polysaccharide and carrier protein are lyophilized simultaneously. In another embodiment, the activated polysaccharide and carrier protein are lyophilized independently.

[0386] In one embodiment, lyophilization is carried out in the presence of a non-reducing sugar, possible non-reducing sugars include sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol and palatinit.

[0387] The second step of the conjugation process is reduction (reductive amination) of the activated polysaccharide and carrier protein with a reducing agent to form the conjugate. Suitable reducing agents include cyanoborohydrides such as sodium cyanoborohydride, borane-pyridine, or borohydride exchange resins. In one embodiment, the reducing agent is sodium cyanoborohydride.

[0388] In one embodiment, the reduction reaction is carried out in an aqueous solvent, and in another embodiment, the reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.

[0389] In one embodiment, 0.1 to 3.0, 0.15 to 2.0, 0.2 to 1.0, or 0.25 to 0.5 molar equivalents of sodium cyanoborohydride are used in the reduction reaction, hi one embodiment, about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 molar equivalents of sodium cyanoborohydride are used in the reduction reaction.

[0390] In one embodiment, the reducing agent is sodium triacetoxyborohydride. In further embodiments, 1.0 to 6.0 molar equivalents, 2.0 to 5.0 molar equivalents, or about 3.0 molar equivalents of sodium triacetoxyborohydride are used in the reduction reaction.

[0391] At the end of the reduction reaction, there may be unreacted aldehyde groups remaining in the conjugate, which can be capped with a suitable capping agent. In one embodiment, the capping agent is sodium borohydride (NaBH). In one embodiment, capping is accomplished by combining the reduction reaction with 0.5 to 5.0 molar equivalents of NaBH, e.g., about 1.0, 1.5, 2.0, 2.5, or 3.0 molar equivalents of NaBH.

[0392] After conjugation (reduction reaction and, optionally, capping), the glycoconjugate can be purified. The glycoconjugate can be purified by diafiltration and / or ion exchange chromatography and / or size exclusion chromatography. In one embodiment, the glycoconjugate is purified by diafiltration or ion exchange chromatography or size exclusion chromatography.

[0393] In one embodiment, the glycoconjugate is sterile filtered.

[0394] In some embodiments, the serotype 8 glycoconjugates of the invention are coupled to a carrier protein (e.g., CRMP 197 In other such embodiments, the saccharide has a molecular weight of 50 kDa to 2,000 kDa. In further such embodiments, the saccharide has a molecular weight of 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa; 100 In one embodiment, the serotype 8 glycoconjugate has a molecular weight of from 1,000 kDa to 1,000 kDa; from 100 kDa to 750 kDa; from 100 kDa to 500 kDa; from 200 kDa to 2,000 kDa; from 200 kDa to 1,750 kDa; from 200 kDa to 1,500 kDa; from 200 kDa to 1,250 kDa; from 200 kDa to 1,000 kDa; from 200 kDa to 750 kDa; or from 200 kDa to 500 kDa; or from 200 kDa to 400 kDa.

[0395] In some embodiments, the serotype 8 glycoconjugates of the present invention have a molecular weight of 50 kDa to 20,000 kDa. In other embodiments, the serotype 8 glycoconjugates have a molecular weight of 50 kDa to 15,000 kDa. In other embodiments, the serotype 8 glycoconjugates have a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the serotype 8 glycoconjugates have a molecular weight of 200 kDa to 10,000 kDa. In still other embodiments, the serotype 8 glycoconjugates have a molecular weight of 1,000 kDa to 8,000 kDa or 2,000 kDa to 8,000 kDa.

[0396] In further embodiments, the serotype 8 glycoconjugates of the invention have an affinity for at least one of the following: 200 kDa to 20,000 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; 200 kDa to 7,500 kDa; 200 kDa to 5,000 kDa; 200 kDa to 3,000 kDa; 200 kDa to 1,000 kDa; 500 kDa to 20,000 kDa; 500 kDa to 15,000 kDa; 500 kDa to 12,500 kDa; 500 kDa to 10,000kDa;500kDa~7,500kDa;500kDa~6,000kDa;500kDa~5,000kDa;500kDa~4,000kDa;500kDa~3,000kDa;500kDa~2,000kDa a;500kDa~1,500kDa;500kDa~1,000kDa;750kDa~20,000kDa;750kDa~15,000kDa;750kDa~12,500kDa;750kDa~10,000kDa;75 0kDa~7,500kDa;750kDa~6,000kDa;750kDa~5,000kDa;750kDa~4,000kDa;750kDa~3,000kDa;750kDa~2,000kDa;750kDa~1, 500kDa;1,000kDa~15,000kDa;1,000kDa~12,500kDa;1,000kDa~10,000kDa;1,000kDa~7,500kDa;1,000kDa~6,000kDa;1,00 having a molecular weight of 0 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 2,500 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa.

[0397] In further embodiments, the serotype 8 glycoconjugates of the invention have a molecular weight of 3,000 kDa to 20,000 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 4,000 kDa to 20,000 kDa; 4,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa. In further embodiments, the serotype 8 glycoconjugates of the invention have a molecular weight of 5,000 kDa to 20,000 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa, or 5,000 kDa to 7,500 kDa. In further embodiments, the serotype 8 glycoconjugates of the invention have a molecular weight of 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 10,000 kDa, or 6,000 kDa to 7,500 kDa. In further embodiments, the serotype 8 glycoconjugates of the invention have a molecular weight of 7,000 kDa to 20,000 kDa; 7,000 kDa to 15,000 kDa; 7,000 kDa to 10,000 kDa, or 7,000 kDa to 8,000 kDa. In further embodiments, the serotype 8 glycoconjugates of the invention have a molecular weight of 8,000 kDa to 20,000 kDa; 8,000 kDa to 15,000 kDa; or 8,000 kDa to 10,000 kDa.

[0398] In one embodiment, the serotype 8 glycoconjugate is prepared using reductive amination.

[0399] Another method for characterizing the serotype 8 glycoconjugates of the invention is to characterize the extent of lysines conjugated to the carrier protein (e.g., CRMP) conjugated to the saccharide, which can be characterized as the extent of lysines conjugated (degree of conjugation). 197 ) is due to the number of lysine residues in the

[0400] Evidence for lysine modifications of a carrier protein due to covalent attachment to a polysaccharide can be obtained by amino acid analysis using routine methods known to those skilled in the art. In frequent embodiments, the carrier protein is covalently conjugated to an activated polysaccharide via an amine bond to one or more ε-amino groups of lysine residues on the carrier protein. In some such embodiments, the carrier protein contains 2 to 20 lysine residues covalently conjugated to saccharides. In other such embodiments, the carrier protein contains 4 to 16 or 6 to 14 lysine residues covalently conjugated to saccharides.

[0401] In preferred embodiments, the degree of conjugation of the serotype 8 glycoconjugates of the invention is 2-20, 2-15, 2-13, 2-10, 2-8, 2-6, 2-5, 2-4, 3-15, 3-13, 3-10, 3-8, 3-6, 3-5, 3-4, 5-15, 5-10, 8-15, 8-12, 10-15, or 10-12. In one embodiment, the degree of conjugation of the serotype 8 glycoconjugates of the invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In preferred embodiments, the degree of conjugation of the serotype 8 glycoconjugates of the invention is 4-16 or 6-14. In some such embodiments, the carrier protein is a CRM. 197 is.

[0402] In a preferred embodiment, the carrier protein is a CRM containing 39 lysine residues. 197 In some such embodiments, the CRM 197 may contain 4 to 16 or 6 to 14 lysine residues of the 39 covalently linked to saccharides. Another way to express this parameter is about 10% to about 41% or about 15% to about 36% CRM 197 In another such embodiment, the CRM 197may contain 2 to 20 of the 39 lysine residues covalently linked to saccharides. Another way to express this parameter is about 5% to about 50% of the CRM 197 In some such embodiments, the CRM 197 may comprise about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 lysine residues out of 39 covalently linked to saccharides.

[0403] Serotype 8 glycoconjugates of the invention may also be characterized by the saccharide to carrier protein ratio (weight / weight). In some embodiments, the ratio of saccharide to carrier protein (w / w) is 0.2 to 4.0 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, or about 4.0). In other embodiments, the ratio of saccharide to carrier protein (w / w) is 0.7 to 2.5. In further embodiments, the ratio of saccharide to carrier protein (w / w) is 0.8 to 1.5 (e.g., about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, or about 1.5). In some such embodiments, the carrier protein is CRM. 197 In one embodiment, the serotype 8 glycoconjugate is prepared using reductive amination.

[0404] The serotype 8 glycoconjugates and immunogenic compositions of the invention may contain free saccharides that are not covalently conjugated to a carrier protein but are nevertheless present in the glycoconjugate composition. The free saccharides can be non-covalently associated with (i.e., non-covalently bound, adsorbed, or entrapped within or with) the glycoconjugate.

[0405] In some embodiments, serotype 8 glycoconjugates of the invention comprise less than about 50% free saccharides, less than about 45% free saccharides, less than about 40% free saccharides, less than about 35% free saccharides, less than about 30% free saccharides, less than about 25% free saccharides, less than about 20% free saccharides, less than about 15% free saccharides, less than about 10% free saccharides, or less than about 5% free saccharides relative to the total amount of serotype 8 saccharide. Preferably, the serotype 8 glycoconjugates comprise less than 15% free saccharides, more preferably less than 10% free saccharides, and even more preferably less than 5% free saccharides.

[0406] Serotype 8 glycoconjugates were analyzed based on their molecular size distribution (K d ) can also be characterized. Size exclusion chromatography media (CL-4B) can be used to determine the relative molecular size distribution of the conjugates. Size exclusion chromatography (SEC) is used in a gravity-fed column to profile the molecular size distribution of the conjugates. Large molecules that are excluded from the pores in the media elute more quickly than small molecules. A fraction collector is used to collect the column eluate. Fractions are tested colorimetrically by sugar assay. K d For the determination of K, the column is calibrated to determine the fraction at which the molecule is completely excluded (V), (K d = 0), the fraction representing maximum retention (V i ), (K d = 1). The fraction at which a particular sample attribute is reached (V e ) is K d =(V e -V0) / (V i -V0) equation, K d and related.

[0407] In a preferred embodiment, at least 40% of the serotype 8 glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 8 glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 8 glycoconjugates of the present invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 70% of the serotype 8 glycoconjugates of the present invention have a K less than or equal to 0.3 in a CL-4B column. d It has.

[0408] In a preferred embodiment, 40% to 90% of the serotype 8 glycoconjugates have a K less than or equal to 0.3 in the CL-4B column. d In a preferred embodiment, 50% to 90% of the serotype 8 glycoconjugates have a K less than or equal to 0.3 in the CL-4B column. d In a preferred embodiment, 65% to 80% of the serotype 8 glycoconjugates have a K less than or equal to 0.3 in the CL-4B column. d It has.

[0409] 2. Immunogenic Compositions of the Present Invention In one embodiment, the number of S. pneumoniae capsular saccharides in the immunogenic composition may range from one serotype (or "v", valency) to seven different serotypes (7v). In one embodiment, one serotype is present. In one embodiment, two different serotypes are present. In one embodiment, three different serotypes are present. In one embodiment, four different serotypes are present. In one embodiment, five different serotypes are present. In one embodiment, six different serotypes are present. In one embodiment, seven different serotypes are present. The capsular saccharides are conjugated to a carrier protein to form a glycoconjugate as described herein above.

[0410] In one embodiment, the immunogenic compositions of the invention comprise a glycoconjugate derived from S. pneumoniae serotype 15B (such as the glycoconjugates described above in Section 1.3.4), a glycoconjugate derived from S. pneumoniae serotype 22F (such as the glycoconjugates described above in Section 1.3.2), a glycoconjugate derived from S. pneumoniae serotype 33F (such as the glycoconjugates described above in Section 1.3.3), a glycoconjugate derived from S. pneumoniae serotype 12F ...15B (such as the glycoconjugates described above in Section 1.3.4), a glycoconjugate derived from S. pneumoniae serotype 15B (such as the glycoconjugates described above in Section 1.3.4), a glycoconjugate derived from S. pneumoniae serotype 15B (such as the glycoconjugates described above in Section 1.3.4), a glycoconjugate derived from S. pneumoniae serotype 15B (such as the glycoconjugates described above in Section 1.3.4), a glycoconjugate derived from S. pneumoniae serotype 15B (such as the glycoconjugates described above in Section 1 The glycoconjugate comprises at least one glycoconjugate selected from the group consisting of a glycoconjugate (such as the glycoconjugate described in Section 1.3.5 above), a glycoconjugate derived from S. pneumoniae serotype 10A (such as the glycoconjugate described in Section 1.3.6 above), a glycoconjugate derived from S. pneumoniae serotype 11A (such as the glycoconjugate described in Section 1.3.7 above), and a glycoconjugate derived from S. pneumoniae serotype 8 (such as the glycoconjugate described in Section 1.3.8 above).

[0411] In one embodiment, an immunogenic composition of the invention comprises at least one glycoconjugate derived from S. pneumoniae serotype 15B, such as the glycoconjugates described in Section 1.3.4 above. In one embodiment, an immunogenic composition of the invention comprises at least one glycoconjugate derived from S. pneumoniae serotype 22F, such as those disclosed in Section 1.3.2 above. In one embodiment, an immunogenic composition of the invention comprises at least one glycoconjugate derived from S. pneumoniae serotype 33F, such as those disclosed in Section 1.3.3 above. In one embodiment, an immunogenic composition of the invention comprises at least one glycoconjugate derived from S. pneumoniae serotype 12F, such as those disclosed in Section 1.3.5 above. In one embodiment, the immunogenic compositions of the invention comprise at least one glycoconjugate derived from S. pneumoniae serotype 10A, such as those disclosed in Section 1.3.6 above. In one embodiment, the immunogenic compositions of the invention comprise at least one glycoconjugate derived from S. pneumoniae serotype 11A, such as those disclosed in Section 1.3.7 above. In one embodiment, the immunogenic compositions of the invention comprise at least one glycoconjugate derived from S. pneumoniae serotype 8, such as those disclosed in Section 1.3.8 above.

[0412] In one embodiment, the immunogenic composition of the invention comprises at least one glycoconjugate of two each of Streptococcus pneumoniae (S. pneumoniae) serotypes selected from the group consisting of 15B and 22F, 15B and 33F, 15B and 12F, 15B and 10A, 15B and 11A, 15B and 8, 22F and 33F, 22F and 12F, 22F and 10A, 22F and 11A, 22F and 8, 33F and 12F, 33F and 10A, 33F and 11A, 33F and 8, 12F and 10A, 12F and 11A, 12F and 8, 10A and 11A, 10A and 8, and 11A and 8.

[0413] In one embodiment, the immunogenic composition of the invention comprises an immunogen containing each of the three following Streptococcus pneumoniae (S. pneumoniae) serotypes: 15B and 22F and 33F, 15B and 22F and 12F, 15B and 22F and 10A, 15B and 22F and 11A, 15B and 22F and 8, 15B and 33F and 12F, 15B and 33F and 10A, 15B and 33F and 11A, 15B and 33F and 8, 15B and 12F and 10A, 15B and 12F and 11A, 15B and 12F and 8, 15B and 10A and 11A, 15B and 10A and 8, 15B and 11A and 8, 22F and 33F and 12F, 22F and 33F and 10A, 22F and 33F and 11A, 22F and 33F and 8, 22F and 12F and 10A, 22F and 12F and 11A, 22F and 12F and 8, 22F and 10A and 11A, 22F and 10A and 8, 22F and 11A and 8, 33F and 12F and 10A, 33F and 12F and 11A, 33F and 12F and 8, 33F and 10A and 11A, 33F and 10A and 8, 33F and 11A and 8, 12F and 10A and 11A, 12F and 10A and 8, 12F and 11A and 8 or 10A and 11A and 8 The glycoconjugate comprises at least one of the following:

[0414] In one embodiment, the immunogenic composition of the invention comprises antibodies against each of the four following S. pneumoniae serotypes: 15B and 22F and 33F and 12F, 15B and 22F and 33F and 10A, 15B and 22F and 33F and 11A, 15B and 22F and 33F and 8, 15B and 22F and 12F and 10A, 15B and 22F and 12F and 11A, 15B and 22F and 12F and 8, 15B and 22F and 10A and 11A, 15B and 22F and 10A and 8, 15B and 22F and 11A and 8, 15B and 33F and 12F and 10A, 15B and 33F and 12F and 11A, 15B and 33F and 12F and 8, 15B and 33F and 10A and 11A, 15B and 33F and 10A and 8, 15B and 33F and 11A and 8, 15B and 12F and 10A and 11A, 15B and 12F and 10A and 8, 15B and 12F and 11A and 8, 15B and 10A and 11A and 8, 22F and 33F and 12F and 10A, 22F and 33F and 12F and 11A, 22F and 33F and 12F and 8, 22F and 33F and 10A and 11A, 22F and 33F and 10A and 8, 22F and 33F and 11A and 8, 22F and 12F and 10A and 11A, 22F and 12F and 10A and 8, 22F and 12F and 11A and 8, 22F and 10A and 11A and 8, 33F and 12F and 10A and 11A, 33F and 12F and 10A and 8, 33F and 12F and 11A and 8, 33F and 10A and 11A and 8 or 12F and 10A and 11A and 8 The glycoconjugate comprises at least one of the following:

[0415] In one embodiment, the immunogenic composition of the invention comprises five each of the following Streptococcus pneumoniae (S. pneumoniae) serotypes: 15B and 22F and 33F and 12F and 10A, 15B and 22F and 33F and 12F and 11A, 15B and 22F and 33F and 12F and 8, 15B and 22F and 33F and 10A and 11A, 15B and 22F and 33F and 10A and 8, 15B and 22F and 33F and 11A and 8, 15B and 22F and 12F and 10A and 11A, 15B and 22F and 12F and 10A and 8, 15B and 22F and 12F and 11A and 8, 15B and 22F and 10A and 11A and 8, 15B and 33F and 12F and 10A and 11A, 15B and 33F and 12F and 10A and 8, 15B and 33F and 12F and 11A and 8, 15B and 33F and 10A and 11A and 8, 15B and 12F and 10A and 11A and 8, 22F and 33F and 12F and 10A and 11A, 22F and 33F and 12F and 10A and 8, 22F and 33F and 12F and 11A and 8, 22F and 33F and 10A and 11A and 8, 22F and 12F and 10A and 11A and 8 or 33F and 12F and 10A and 11A and 8 The glycoconjugate comprises at least one of the following:

[0416] In one embodiment, the immunogenic composition of the invention comprises six individual serotypes of Streptococcus pneumoniae (S. pneumoniae): 15B and 22F and 33F and 12F and 10A and 11A, 15B and 22F and 33F and 12F and 10A and 8, 15B and 22F and 33F and 12F and 11A and 8, 15B and 22F and 33F and 10A and 11A and 8, 15B and 22F and 12F and 10A and 11A and 8, 15B and 33F and 12F and 10A and 11A and 8 or 22F and 33F and 12F and 10A and 11A and 8 The glycoconjugate comprises at least one of the following:

[0417] In one embodiment, the immunogenic composition of the invention comprises a glycoconjugate of at least one of the following seven Streptococcus pneumoniae (S. pneumoniae) serotypes: 15B, 22F, 33F, 12F, 10A, 11A, and 8, respectively.

[0418] In one embodiment, the glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 15B, 22F, 33F, 12F, 10A, 11A and / or 8 of any of the immunogenic compositions defined in this section are those disclosed above in Sections 1.3.2 to 1.3.8.

[0419] Preferably, all glycoconjugates of the above immunogenic composition are individually conjugated to a carrier protein.

[0420] In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 22F is a CRM 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 33F is conjugated to a CRM 197In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 15B is conjugated to a CRM 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 12F is conjugated to a CRM 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 10A is conjugated to a CRM 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 11A is conjugated to a CRM 197 In one embodiment of any of the above immunogenic compositions, the glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 8 is conjugated to a CRM 197 It is conjugated to

[0421] In one embodiment of any of the above immunogenic compositions, the glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) are all CRM 197 are individually conjugated to

[0422] In another embodiment of any of the above immunogenic compositions, all of the glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) are individually conjugated to PD. In another embodiment, all of the glycoconjugates derived from S. pneumoniae are individually conjugated to TT. In yet another embodiment, all of the glycoconjugates derived from S. pneumoniae are individually conjugated to DT.

[0423] In another embodiment of the above immunogenic composition, glycoconjugates derived from S. pneumoniae serotypes 22F, 33F, 15B, 12F, 10A, 11A and / or 8 are individually conjugated to DT. In another embodiment, glycoconjugates derived from S. pneumoniae serotypes 22F, 33F, 15B, 12F, 10A, 11A and / or 8 are individually conjugated to TT. In another embodiment, glycoconjugates derived from S. pneumoniae serotypes 22F, 33F, 15B, 12F, 10A, 11A and / or 8 are individually conjugated to PD.

[0424] In another embodiment of any of the above immunogenic compositions, at least one of the glycoconjugates is individually conjugated to DT and the other glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) are individually conjugated to TT. In another embodiment, at least one of the glycoconjugates is individually conjugated to TT and the other glycoconjugates are individually conjugated to DT. In another embodiment, at least one of the glycoconjugates is individually conjugated to PD and the other glycoconjugates are individually conjugated to DT. In another embodiment, at least one of the glycoconjugates is individually conjugated to PD and the other glycoconjugates are individually conjugated to TT. In another embodiment, at least one of the glycoconjugates is individually conjugated to TT and the other glycoconjugates are individually conjugated to PD. In another embodiment, at least one of the glycoconjugates is individually conjugated to a DT and the other glycoconjugate is individually conjugated to a PD.

[0425] In another embodiment of any of the above immunogenic compositions, at least one of the glycoconjugates is a CRM 197 and another glycoconjugate derived from S. pneumoniae is individually conjugated to a DT. In another embodiment, at least one of the glycoconjugates is individually conjugated to a CRM. 197 and the other glycoconjugates are individually conjugated to TT. In another embodiment, at least one of the glycoconjugates is individually conjugated to a CRM 197In another embodiment, at least one of the glycoconjugates is individually conjugated to a DT and the other glycoconjugate is individually conjugated to a CRM. 197 In another embodiment, at least one of the glycoconjugates is individually conjugated to TT, and the other glycoconjugate is individually conjugated to CRM. 197 In another embodiment, at least one of the glycoconjugates is individually conjugated to a PD, and the other glycoconjugate is individually conjugated to a CRM. 197 are individually conjugated to

[0426] In one embodiment, the immunogenic composition comprises one to seven different serotypes of Streptococcus pneumoniae (S. pneumoniae). In one embodiment, the immunogenic composition is a 1-, 2-, 3-, 4-, 5-, 6-, or 7-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 6-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 7-valent pneumococcal conjugate composition.

[0427] 1. In one embodiment, the immunogenic compositions of the invention comprise at least one glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 15B, such as the glycoconjugates described in Section 1.3.4 above.

[0428] 2. In another embodiment, the immunogenic composition of the invention comprises, in addition to point 1 above, at least one glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 22F, such as those disclosed in section 1.3.2 above.

[0429] 3. In another embodiment, the immunogenic composition of the invention comprises, in addition to points 1 or 2 above, at least one glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 33F, such as those disclosed in section 1.3.3 above.

[0430] 4. In another embodiment, the immunogenic composition of the invention comprises, in addition to points 1, 2 or 3 above, at least one glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 12F, such as those disclosed in section 1.3.5 above.

[0431] 5. In another embodiment, the immunogenic composition of the invention comprises, in addition to points 1, 2, 3 or 4 above, at least one glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 10A, such as those disclosed in section 1.3.6 above.

[0432] 6. In another embodiment, the immunogenic composition of the invention comprises, in addition to points 1, 2, 3, 4 or 5 above, at least one glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 11A, such as those disclosed in section 1.3.7 above.

[0433] 7. In another embodiment, the immunogenic composition of the invention comprises, in addition to points 1, 2, 3, 4, 5 or 6 above, at least one glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 8, such as those disclosed in section 1.3.8 above.

[0434] In one embodiment, the immunogenic compositions of the invention comprise conjugated S. pneumoniae saccharides derived from serotypes 8, 10A, 11A, 12F, 15B, 22F and 33F.

[0435] In one embodiment, the glycoconjugates of the immunogenic compositions of the invention consist of glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 8, 10A, 11A, 12F, 15B, 22F and 33F.

[0436] Preferably, all glycoconjugates of the immunogenic composition of the invention (eg, any of points 1-7 above) are individually conjugated to a carrier protein.

[0437] In one embodiment of any of points 1 to 7 above, the glycoconjugate derived from S. pneumoniae serotype 22F is a CRM 197 In one embodiment of any of points 2 to 7 above, the glycoconjugate derived from S. pneumoniae serotype 33F is conjugated to CRM 197 In one embodiment of any of points 3 to 7 above, the glycoconjugate derived from S. pneumoniae serotype 15B is conjugated to CRM 197 In one embodiment of any of points 4 to 7 above, the glycoconjugate derived from S. pneumoniae serotype 12F is conjugated to CRM 197 In one embodiment of any of points 5 to 7 above, the glycoconjugate derived from S. pneumoniae serotype 10A is conjugated to CRM 197 In one embodiment of any of points 6 to 7 above, the glycoconjugate derived from S. pneumoniae serotype 11A is conjugated to CRM 197In the embodiment of point 7 above, the glycoconjugate derived from S. pneumoniae serotype 8 is conjugated to CRM 197 It is conjugated to

[0438] In one embodiment, the glycoconjugate of the immunogenic composition of points 1 to 7 above is CRM 197 are individually conjugated to

[0439] In one embodiment, the glycoconjugates of the immunogenic compositions of points 1 to 7 above are individually conjugated to PD. In one embodiment, the glycoconjugates of the immunogenic compositions of points 1 to 7 above are individually conjugated to TT. In one embodiment, the glycoconjugates of the immunogenic compositions of points 1 to 7 above are individually conjugated to DT.

[0440] In one embodiment, at least one of the glycoconjugates of the immunogenic compositions of points 1 to 7 above is individually conjugated to DT, and the other glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) are individually conjugated to TT. In another embodiment, at least one of the glycoconjugates of the immunogenic compositions of points 1 to 7 above is individually conjugated to TT, and the other glycoconjugates are individually conjugated to DT. In another embodiment, at least one of the glycoconjugates of the immunogenic compositions of points 1 to 7 above is individually conjugated to PD, and the other glycoconjugates are individually conjugated to DT. In another embodiment, at least one of the glycoconjugates of the immunogenic compositions of points 1 to 7 above is individually conjugated to PD, and the other glycoconjugates are individually conjugated to TT. In another embodiment, at least one of the glycoconjugates of the immunogenic compositions of points 1 to 7 above is individually conjugated to TT and the other glycoconjugates are individually conjugated to PD. In another embodiment, at least one of the glycoconjugates of the immunogenic compositions of points 1 to 7 above is individually conjugated to DT and the other glycoconjugates are individually conjugated to PD.

[0441] In another embodiment, at least one of the glycoconjugates of the immunogenic composition of points 1 to 7 above is a CRM 197 and the other glycoconjugate derived from S. pneumoniae is individually conjugated to DT. In another embodiment, at least one of the glycoconjugates of the immunogenic composition of points 1 to 7 above is individually conjugated to CRM. 197and the other glycoconjugates are individually conjugated to TT. In another embodiment, at least one of the glycoconjugates of the immunogenic composition of points 1 to 7 above is individually conjugated to CRM 197 In another embodiment, at least one of the glycoconjugates of the immunogenic composition of points 1 to 7 above is individually conjugated to a DT, and the other glycoconjugates are individually conjugated to a CRM. 197 In another embodiment, at least one of the glycoconjugates of the immunogenic composition of points 1 to 7 above is individually conjugated to TT, and the other glycoconjugates are individually conjugated to CRM. 197 In another embodiment, at least one of the glycoconjugates of the immunogenic composition of points 1 to 7 above is individually conjugated to a PD, and the other glycoconjugates are individually conjugated to a CRM. 197 are individually conjugated to

[0442] In one embodiment, the immunogenic composition is a 1-, 2-, 3-, 4-, 5-, 6-, or 7-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 6-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 7-valent pneumococcal conjugate composition.

[0443] After conjugation of the capsular polysaccharide to the carrier protein, the glycoconjugate is purified (enriched in terms of the amount of polysaccharide-protein conjugate) by various techniques. These techniques include concentration / diafiltration operations, precipitation / elution, column chromatography, and depth filtration (see, for example, U.S. Patent Application Publication No. 2007 / 0184072 or WO2008 / 079653). After the individual glycoconjugates are purified, they are mixed to formulate the immunogenic compositions of the invention.

[0444] In one embodiment, the dosage of the immunogenic composition is as disclosed in Section 5 below.

[0445] In one embodiment, the immunogenic composition further comprises antigens derived from other pathogens, particularly bacteria and / or viruses, as disclosed in Section 6 below.

[0446] In one embodiment, the immunogenic composition further comprises one or more adjuvants as disclosed in Section 6 below.

[0447] In one embodiment, the immunogenic composition is formulated as disclosed in Section 8 below.

[0448] 3. Immunogenic compositions that may be used in combination with the immunogenic composition of the present invention In one embodiment, an immunogenic composition of the invention (such as any of those in section 2 above) is used in combination with a second immunogenic composition.

[0449] In one embodiment, the second immunogenic composition comprises at least one glycoconjugate derived from a Streptococcus pneumoniae serovar selected from the group consisting of serovars 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, 22F and 33F.

[0450] In one embodiment, the second immunogenic composition comprises at least one glycoconjugate derived from a Streptococcus pneumoniae serovar selected from the group consisting of serovars 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F.

[0451] 1. In one embodiment, the second immunogenic composition comprises at least one glycoconjugate derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F (such as the glycoconjugates in Section 1.3.1 above).

[0452] 2. In another embodiment, the second immunogenic composition, in addition to point 1 above, comprises at least one glycoconjugate derived from S. pneumoniae serotypes 1, 5, and 7F (such as the glycoconjugates in section 1.3.1 above).

[0453] 3. In another embodiment, the second immunogenic composition, in addition to points 1 or 2 above, comprises at least one glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 6A and 19A (such as the glycoconjugates in section 1.3.1 above).

[0454] 4. In another embodiment, said second immunogenic composition, in addition to points 1, 2 or 3 above, comprises at least one glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 3 (such as the glycoconjugate in section 1.3.1 above).

[0455] 5. In another embodiment, said second immunogenic composition comprises, in addition to points 1, 2, 3 or 4 above, at least one glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 22F, such as those disclosed in section 1.3.2 above.

[0456] 6. In another embodiment, said second immunogenic composition comprises, in addition to points 1, 2, 3, 4 or 5 above, at least one glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 33F, such as those disclosed in section 1.3.3 above.

[0457] Preferably, all of the glycoconjugates of the second immunogenic composition are individually conjugated to a carrier protein.

[0458] In one embodiment of any of the above second immunogenic compositions, the glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F are CRM 197 In one embodiment of any of the above second immunogenic compositions, the glycoconjugates derived from S. pneumoniae serotypes 1, 5, and 7F are conjugated to CRM 197 In one embodiment of any of the above second immunogenic compositions, the glycoconjugates derived from S. pneumoniae serotypes 6A and 19A are conjugated to CRM 197 In one embodiment of any of the above second immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 3 is conjugated to CRM 197 In one embodiment of any of the above second immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 22F is conjugated to a CRM 197 In one embodiment of any of the above second immunogenic compositions, the glycoconjugate derived from S. pneumoniae serotype 33F is conjugated to a CRM 197 It is conjugated to

[0459] In one embodiment, the glycoconjugates of any of the second immunogenic compositions are all CRM 197 are individually conjugated to

[0460] In one embodiment, the glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of the second immunogenic compositions are individually conjugated to PD.

[0461] In one embodiment, the glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 18C of any of the above second immunogenic compositions is conjugated to TT.

[0462] In one embodiment, the glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 19F of any of the second immunogenic compositions is conjugated to DT.

[0463] In one embodiment, the glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of the above second immunogenic compositions are individually conjugated to PD, the glycoconjugate derived from S. pneumoniae serotype 18C is conjugated to TT, and the glycoconjugate derived from S. pneumoniae serotype 19F is conjugated to DT.

[0464] In one embodiment, the glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of the above second immunogenic compositions are individually conjugated to PD, the glycoconjugate derived from S. pneumoniae serotype 18C is conjugated to TT, the glycoconjugate derived from S. pneumoniae serotype 19F is conjugated to DT, and the glycoconjugate derived from S. pneumoniae serotype 22F is conjugated to CRM. 197 The glycoconjugate, derived from Streptococcus pneumoniae serotype 33F, is conjugated to CRM 197 It is conjugated to

[0465] In one embodiment, the second immunogenic composition comprises 7 to 15 different serotypes of Streptococcus pneumoniae (S. pneumoniae). In one embodiment, the second immunogenic composition comprises glycoconjugates derived from 7, 8, 9, 10, 11, 12, 13, 14, or 15 different serotypes. In one embodiment, the second immunogenic composition comprises glycoconjugates derived from 10 to 15 different serotypes. In one embodiment, the second immunogenic composition is a 7, 8, 9, 10, 11, 12, 13, 14, or 15-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 10-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is an 11-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 12-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 13-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 14-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 15-valent pneumococcal conjugate composition.

[0466] In one embodiment, the second immunogenic composition is a 7-valent pneumococcal conjugate composition, wherein the 7-valent conjugate comprises a CRM 197 It consists of seven glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F individually conjugated to

[0467] In one embodiment, the second immunogenic composition is a 10-valent pneumococcal conjugate composition, wherein the 10-valent conjugate consists of glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F individually conjugated to PD, a glycoconjugate derived from S. pneumoniae serotype 18C conjugated to TT, and a glycoconjugate derived from S. pneumoniae serotype 19F conjugated to DT.

[0468] In one embodiment, the second immunogenic composition is an 11-valent pneumococcal conjugate composition, the 11-valent conjugate comprising glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F individually conjugated to PD, a glycoconjugate derived from S. pneumoniae serotype 18C conjugated to TT, a glycoconjugate derived from S. pneumoniae serotype 19F conjugated to DT, and a CRM 197 It consists of a glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 22F conjugated to

[0469] In one embodiment, the second immunogenic composition is an 11-valent pneumococcal conjugate composition, the 11-valent conjugate comprising glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F individually conjugated to PD, a glycoconjugate derived from S. pneumoniae serotype 18C conjugated to TT, a glycoconjugate derived from S. pneumoniae serotype 19F conjugated to DT, and a CRM 197 It consists of a glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 33F conjugated to

[0470] In one embodiment, the second immunogenic composition is a 12-valent pneumococcal conjugate composition, the 12-valent conjugates comprising glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F individually conjugated to PD; a glycoconjugate derived from S. pneumoniae serotype 18C conjugated to TT; a glycoconjugate derived from S. pneumoniae serotype 19F conjugated to DT; a glycoconjugate derived from S. pneumoniae serotype 20F conjugated to CRM; 197 Glycoconjugates and CRMs derived from Streptococcus pneumoniae (S. pneumoniae) serotype 22F conjugated to 197 It consists of a glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 33F conjugated to

[0471] In one embodiment, the second immunogenic composition is a 13-valent pneumococcal conjugate composition, wherein the 13-valent conjugate is a CRM 197It consists of glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to

[0472] In one embodiment, the second immunogenic composition is a 14-valent pneumococcal conjugate composition, wherein the 14-valent conjugate is a CRM 197 It consists of glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, and 22F individually conjugated to

[0473] In one embodiment, the second immunogenic composition is a 14-valent pneumococcal conjugate composition, wherein the 14-valent conjugate is a CRM 197 It consists of glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, and 33F individually conjugated to

[0474] In one embodiment, the second immunogenic composition is a 15-valent pneumococcal conjugate composition, wherein the 15-valent conjugate comprises a CRM 197 It consists of glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, 22F, and 33F individually conjugated to

[0475] In one embodiment, the dosage of the second immunogen is as disclosed in Section 5 below.

[0476] In one embodiment, the second immunogenic composition further comprises antigens derived from other pathogens, particularly bacteria and / or viruses such as those disclosed in Section 6 below.

[0477] In one embodiment, the second immunogenic composition further comprises one or more adjuvants disclosed in Section 7 below.

[0478] In one embodiment, the second immunogenic composition is formulated as disclosed in Section 8 below.

[0479] In one embodiment, an immunogenic composition of the invention (such as any of those in Section 2 above) is used in combination with PREVNAR® (PREVENAR® in some countries) (7-valent vaccine), SYNFLORIX® (10-valent vaccine), and / or PREVNAR13® (PREVENAR13® in some countries) (13-valent vaccine).

[0480] 4. Kits of the Present Invention In certain aspects, the present invention provides a kit comprising: (a) a first immunogenic composition as defined in Section 2 above; and (b) a second immunogenic composition comprising at least one glycoconjugate derived from a Streptococcus pneumoniae serovar selected from serovars 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, 22F, and 33F.

[0481] In certain aspects, the present invention provides a kit comprising: (a) a first immunogenic composition as defined in Section 2 above; and (b) a second immunogenic composition comprising at least one glycoconjugate derived from a Streptococcus pneumoniae serovar selected from serovars 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F.

[0482] In certain embodiments, the present invention provides a kit comprising: (a) a first immunogenic composition as defined in Section 2 above; and (b) a second immunogenic composition as defined in Section 3 above.

[0483] 1. In one embodiment, the second immunogenic composition of the kit (part (b) of the kit) comprises glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 4, 6B, 9V, 14, 18C, 19F and 23F (such as the glycoconjugates in section 1.3.1 above).

[0484] 2. In another embodiment, the second immunogenic composition, in addition to point 1 above, comprises at least one glycoconjugate derived from S. pneumoniae serotypes 1, 5, and 7F (such as the glycoconjugates in section 1.3.1 above).

[0485] 3. In another embodiment, the second immunogenic composition, in addition to points 1 or 2 above, comprises at least one glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 6A and 19A (such as the glycoconjugates in section 1.3.1 above).

[0486] 4. In another embodiment, said second immunogenic composition, in addition to points 1, 2 or 3 above, comprises at least one glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 3 (such as the glycoconjugate in section 1.3.1 above).

[0487] 5. In another embodiment, said second immunogenic composition comprises, in addition to points 1, 2, 3 or 4 above, at least one glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 22F, such as those disclosed in section 1.3.2 above.

[0488] 6. In another embodiment, said second immunogenic composition comprises, in addition to points 1, 2, 3, 4 or 5 above, at least one glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 33F, such as those disclosed in section 1.3.3 above.

[0489] In one embodiment, the second immunogenic composition of the kit (part (b) of the kit) comprises glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F (such as the glycoconjugates in section 1.3.1 above).

[0490] In one embodiment, the second immunogenic composition of the kit comprises glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, and 23F (such as the glycoconjugates in Section 1.3.1 above).

[0491] In one embodiment, the second immunogenic composition of the kit comprises glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F (such as the glycoconjugates in Section 1.3.1 above).

[0492] In one embodiment, the second immunogenic composition of the kit comprises glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F (such as the glycoconjugates in Section 1.3.1 above).

[0493] In one embodiment, the second immunogenic composition of the kit comprises glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, 23F, and 22F (such as the glycoconjugates in sections 1.3.1 and 1.3.2 above).

[0494] In one embodiment, the second immunogenic composition of the kit comprises glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, 23F, and 33F (such as the glycoconjugates in sections 1.3.1 and 1.3.3 above).

[0495] In one embodiment, the second immunogenic composition of the kit comprises glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 4, 5, 6B, 7F, 9V, 14, 18C, 19F, 23F, 22F, and 33F (such as the glycoconjugates in sections 1.3.1, 1.3.2, and 1.3.3 above).

[0496] In one embodiment, the second immunogenic composition of the kit comprises glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, and 22F (such as the glycoconjugates in sections 1.3.1 and 1.3.2 above).

[0497] In one embodiment, the second immunogenic composition of the kit comprises glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, and 33F (such as the glycoconjugates in sections 1.3.1 and 1.3.3 above).

[0498] In one embodiment, the second immunogenic composition of the kit comprises glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, 22F, and 33F (such as the glycoconjugates in sections 1.3.1, 1.3.2, and 1.3.3 above).

[0499] Preferably, all of the glycoconjugates of the second immunogenic composition of the kit are individually conjugated to a carrier protein.

[0500] In one embodiment of any of the above kits, the glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F are CRM 197 In one embodiment of any of the above kits, the glycoconjugates derived from S. pneumoniae serotypes 1, 5, and 7F are conjugated to a CRM. 197 In one embodiment of any of the above kits, the glycoconjugates derived from S. pneumoniae serotypes 6A and 19A are conjugated to a CRM. 197 In one embodiment of any of the above kits, the glycoconjugate derived from S. pneumoniae serotype 3 is conjugated to a CRM 197 It is conjugated to

[0501] In one embodiment, the glycoconjugates of any of the above kits are all CRM 197 are individually conjugated to

[0502] In another embodiment, the glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of the above kits are individually conjugated to PDs.

[0503] In one embodiment, the glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 18C of any of the above kits is conjugated to TT.

[0504] In one embodiment, the glycoconjugate derived from S. pneumoniae serotype 19F of any of the above kits is conjugated to DT.

[0505] In one embodiment, the glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of the above kits are individually conjugated to PD, the glycoconjugate derived from S. pneumoniae serotype 18C is conjugated to TT, and the glycoconjugate derived from S. pneumoniae serotype 19F is conjugated to DT.

[0506] In one embodiment, the glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of the above kits are individually conjugated to PD, the glycoconjugate derived from S. pneumoniae serotype 18C is conjugated to TT, the glycoconjugate derived from S. pneumoniae serotype 19F is conjugated to DT, and the glycoconjugate derived from S. pneumoniae serotype 22F is conjugated to CRM. 197 The glycoconjugate, derived from Streptococcus pneumoniae serotype 33F, is conjugated to CRM 197 It is conjugated to

[0507] In one embodiment, the second immunogenic composition comprises 7 to 15 different serotypes of Streptococcus pneumoniae (S. pneumoniae). In one embodiment, the second immunogenic composition comprises glycoconjugates derived from 7, 8, 9, 10, 11, 12, 13, 14, or 15 different serotypes. In one embodiment, the second immunogenic composition comprises glycoconjugates derived from 10 to 15 different serotypes. In one embodiment, the second immunogenic composition is a 7, 8, 9, 10, 11, 12, 13, 14, or 15-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 10-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is an 11-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 12-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 13-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 14-valent pneumococcal conjugate composition. In one embodiment, the second immunogenic composition is a 15-valent pneumococcal conjugate composition.

[0508] In one embodiment, the second immunogenic composition is a 7-valent pneumococcal conjugate composition, wherein the 7-valent conjugate comprises a CRM 197 It consists of seven glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F individually conjugated to

[0509] In one embodiment, the second immunogenic composition is a 10-valent pneumococcal conjugate composition, wherein the 10-valent conjugate consists of glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F individually conjugated to PD, a glycoconjugate derived from S. pneumoniae serotype 18C conjugated to TT, and a glycoconjugate derived from S. pneumoniae serotype 19F conjugated to DT.

[0510] In one embodiment, the second immunogenic composition is an 11-valent pneumococcal conjugate composition, the 11-valent conjugate comprising glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F individually conjugated to PD, a glycoconjugate derived from S. pneumoniae serotype 18C conjugated to TT, a glycoconjugate derived from S. pneumoniae serotype 19F conjugated to DT, and a CRM 197 It consists of a glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 22F conjugated to

[0511] In one embodiment, the second immunogenic composition is an 11-valent pneumococcal conjugate composition, the 11-valent conjugate comprising glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F individually conjugated to PD, a glycoconjugate derived from S. pneumoniae serotype 18C conjugated to TT, a glycoconjugate derived from S. pneumoniae serotype 19F conjugated to DT, and a CRM 197 It consists of a glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 33F conjugated to

[0512] In one embodiment, the second immunogenic composition is a 12-valent pneumococcal conjugate composition, the 12-valent conjugates comprising glycoconjugates derived from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14, and 23F individually conjugated to PD; a glycoconjugate derived from S. pneumoniae serotype 18C conjugated to TT; a glycoconjugate derived from S. pneumoniae serotype 19F conjugated to DT; a glycoconjugate derived from S. pneumoniae serotype 20F conjugated to CRM; 197 Glycoconjugates and CRMs derived from Streptococcus pneumoniae (S. pneumoniae) serotype 22F conjugated to 197 It consists of a glycoconjugate derived from Streptococcus pneumoniae (S. pneumoniae) serotype 33F conjugated to

[0513] In one embodiment, the second immunogenic composition is a 13-valent pneumococcal conjugate composition, wherein the 13-valent conjugate is a CRM 197It consists of glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F individually conjugated to

[0514] In one embodiment, the second immunogenic composition is a 14-valent pneumococcal conjugate composition, wherein the 14-valent conjugate is a CRM 197 It consists of glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, and 22F individually conjugated to

[0515] In one embodiment, the second immunogenic composition is a 14-valent pneumococcal conjugate composition, wherein the 14-valent conjugate is a CRM 197 It consists of glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, and 33F individually conjugated to

[0516] In one embodiment, the second immunogenic composition is a 15-valent pneumococcal conjugate composition, wherein the 15-valent conjugate comprises a CRM 197 It consists of glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 23F, 22F, and 33F individually conjugated to

[0517] In one embodiment, the dosage of the second immunogen is as disclosed in Section 5 below.

[0518] In one embodiment, the second immunogenic composition further comprises antigens derived from other pathogens, particularly bacteria and / or viruses such as those disclosed in Section 6 below.

[0519] In one embodiment, the second immunogenic composition further comprises one or more adjuvants disclosed in Section 7 below.

[0520] In one embodiment, the second immunogenic composition is formulated as disclosed in Section 8 below.

[0521] In one embodiment, an immunogenic composition of the invention (such as any of those in Section 2 above) is used in combination with PREVNAR® (PREVENAR® in some countries) (7-valent vaccine), SYNFLORIX® (10-valent vaccine), and / or PREVNAR13® (PREVENAR13® in some countries) (13-valent vaccine).

[0522] In one embodiment of the invention, the kit takes the form of two containers. Thus, in one embodiment of the invention, each of the immunogenic compositions of the kit (i.e., the first immunogenic composition and the second immunogenic composition) is contained in a separate container.

[0523] In one embodiment, the first immunogenic composition of the kit (part (a) of the kit) is contained in a container selected from the group consisting of a vial, a syringe, a flask, a fermentor, a bioreactor, a bag, a jar, an ampoule, a cartridge, and a disposable pen. In certain embodiments, the container is siliconized.

[0524] In one embodiment, the second immunogenic composition of the kit (part (b) of the kit) is contained in a container selected from the group consisting of a vial, a syringe, a flask, a fermentor, a bioreactor, a bag, a jar, an ampoule, a cartridge, and a disposable pen. In certain embodiments, the container is siliconized.

[0525] In one embodiment, the container is made of glass, metal (e.g., steel, stainless steel, aluminum, etc.) and / or polymer (e.g., thermoplastic, elastomer, thermoplastic elastomer). In one embodiment, the container is made of glass.

[0526] In one embodiment, the first and second immunogenic compositions of the kit are contained in a syringe or a disposable pen. In one embodiment, the first and second immunogenic compositions of the kit are contained in a syringe. In certain embodiments, the syringe is siliconized. In certain embodiments, the siliconized syringe is made of glass.

[0527] In one embodiment, the first and second immunogenic compositions of the kit are mixed extemporaneously for simultaneous administration.

[0528] In one embodiment, the first and second immunogenic compositions are in liquid form, preferably contained in two containers. In one embodiment, the first and second containers are separate chambers in a dual-chamber syringe that, when actuated, introduces the liquid in the first container into the second container. The resulting mixture can then exit the syringe. The two immunogenic compositions are kept separate until ready to be mixed.

[0529] In one embodiment, the first and / or second immunogenic compositions of the kit are in lyophilized form.

[0530] In one embodiment, the first immunogenic composition of the kit is in lyophilized form and the second immunogenic composition is in liquid form. In another embodiment, the second immunogenic composition of the kit is in lyophilized form and the first immunogenic composition is in liquid form. In said embodiment, the lyophilized immunogenic composition can be extemporaneously reconstituted with the liquid immunogenic composition for simultaneous administration of both immunogenic compositions.

[0531] In the embodiment, the kit includes two containers, one container containing a liquid material for reconstitution and a second container containing a lyophilized material. In one embodiment, the second container is sealed. In one embodiment, the liquid material is introduced into the second container through a first needle, thereby reconstituting the lyophilized material into a liquid form. The resulting mixture is then withdrawn into a container (such as a syringe) for administration to a patient. In one embodiment, the withdrawal step is through the first needle. In another embodiment, the withdrawal step is through a second needle. In one embodiment, the needle used in the withdrawal step is the same needle used to inject the patient. In another embodiment, the needle used in the withdrawal step is different from the needle used to inject the patient.

[0532] In one embodiment, the second container is a vial. In a further embodiment, the first and second containers are separate chambers in a dual-chamber syringe that, when actuated, introduces liquid material from the first container into the second container. The resulting mixture exits the syringe in liquid form. In a preferred embodiment, the lyophilized and liquid materials are kept separate until ready to be mixed.

[0533] In one embodiment, the kit includes a pre-filled syringe and a vial. In one embodiment, the syringe contains a single dose of a first immunogenic composition and the vial contains a single dose of a second immunogenic composition. In one embodiment, the syringe contains a single dose of a second immunogenic composition and the vial contains a single dose of a first immunogenic composition. In another embodiment, the syringe and the vial contain multiple doses.

[0534] 5. Dosage of Immunogenic Composition The amount of glycoconjugate in each dose is selected to induce an immunoprotective response in a typical vaccine recipient without significant adverse side effects, and such amount will vary depending on the particular immunogen used and the manner in which it is presented.

[0535] 5.1 Amount of glycoconjugate The amount of a particular glycoconjugate in an immunogenic composition can be calculated based on the total polysaccharide (conjugated and unconjugated) of that conjugate. For example, a glycoconjugate containing 20% free polysaccharide will have approximately 80 μg of conjugated polysaccharide and approximately 20 μg of unconjugated polysaccharide in a 100 μg polysaccharide dose. The amount of glycoconjugate may vary depending on the pneumococcal serotype. The concentration of saccharides can be determined by uronic acid assay.

[0536] The "immunogenic amounts" of the various polysaccharide components in the immunogenic composition may vary and may each comprise about 1 μg, about 2 μg, about 3 μg, about 4 μg, about 5 μg, about 6 μg, about 7 μg, about 8 μg, about 9 μg, about 10 μg, about 15 μg, about 20 μg, about 30 μg, about 40 μg, about 50 μg, about 60 μg, about 70 μg, about 80 μg, about 90 μg, or about 100 μg of any particular polysaccharide antigen.

[0537] Generally, each dose contains between 0.1 μg and 100 μg of polysaccharide for a given serotype, particularly between 0.5 μg and 20 μg, more particularly between 1.0 μg and 10 μg, and even more particularly between 2.0 μg and 5.0 μg. Any whole integer within any of the above ranges is contemplated as an embodiment of the present disclosure.

[0538] In one embodiment, each dose comprises about 1.0 μg, about 1.2 μg, about 1.4 μg, about 1.6 μg, about 1.8 μg, about 2.0 μg, about 2.2 μg, about 2.4 μg, about 2.6 μg, about 2.8 μg, about 3.0 μg, about 3.2 μg, about 3.4 μg, about 3.6 μg, about 3.8 μg, about 4.0 μg, about 4.2 μg, about 4.4 μg, about 4.6 μg, about 4.8 μg, about 5.0 μg, about 5.2 μg, about 5.4 μg, about 5.6 μg, about 5.8 μg, or about 6.0 μg of polysaccharide for each particular glycoconjugate.

[0539] In one embodiment, each dose contains about 1.1 μg of glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and / or 33F. , about 1.2 μg, about 1.3 μg, about 1.4 μg, about 1.5 μg, about 1.6 μg, about 1.7 μg, about 1.8 μg, about 1.9 μg, about 2.0 μg, about 2.1 μg, about 2.2 μg, about 2.3 μg, about 2.4 μg, about 2.5 μg, about 2.6 μg, about 2.7 μg, about 2.8 μg, about 2.9 μg, or about 3.0 μg of polysaccharide.

[0540] In one embodiment, each dose contains about 1.1 μg, about 1.2 μg, about 1.3 μg, about 1.4 μg, about 1.5 μg, about 1.6 μg, about 1.7 μg, about 1.8 μg, about 1.9 μg, about 2.0 μg, about 2.1 μg, about 2.2 μg, about 2.3 μg, about 2.4 μg, about 2.5 μg, about 2.6 μg, about 2.7 μg, about 2.8 μg, about 2.9 μg, or about 3.0 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotypes 8, 10A, 11A, 12F, 15B, 22F, and 33F.

[0541] In one embodiment, each dose contains about 2.0 μg, about 2.2 μg, about 2.4 μg, about 2.6 μg, about 2.8 μg, about 3.0 μg, about 3.2 μg, about 3.4 μg, about 3.6 μg, about 3.8 μg, about 4.0 μg, about 4.2 μg, about 4.4 μg, about 4.6 μg, about 4.8 μg, about 5.0, about 5.2 μg, about 5.4 μg, about 5.6 μg, about 5.8 μg, or about 6.0 μg of polysaccharide for glycoconjugates derived from Streptococcus pneumoniae (S. pneumoniae) serotype 6B.

[0542] In one embodiment, each dose contains from about 1.5 μg to about 3.0 μg of polysaccharide for each glycoconjugate derived from S. pneumoniae serotype 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and / or 33F, and from about 3.0 μg to about 6.0 μg of polysaccharide for glycoconjugates derived from S. pneumoniae serotype 6B.

[0543] In one embodiment, each dose contains about 2.0 μg to about 2.5 μg of polysaccharide for each glycoconjugate derived from S. pneumoniae serotype 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and / or 33F, and about 4.0 μg to about 4.8 μg of polysaccharide for a glycoconjugate derived from S. pneumoniae serotype 6B.

[0544] In one embodiment, each dose contains about 2.2 μg of polysaccharide derived from each glycoconjugate derived from S. pneumoniae serotype 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and / or 33F, and about 4.4 μg of polysaccharide derived from S. pneumoniae serotype 6B.

[0545] In one embodiment, each dose contains about 1.5 μg to about 3.0 μg of polysaccharide for each glycoconjugate from S. pneumoniae serotypes 8, 10A, 11A, 12F, 15B, 22F, and 33F.

[0546] In one embodiment, each dose contains about 2.0 μg to about 2.5 μg of polysaccharide for each glycoconjugate from S. pneumoniae serotypes 8, 10A, 11A, 12F, 15B, 22F, and 33F.

[0547] In one embodiment, each dose contains about 2.2 μg of polysaccharide derived from each glycoconjugate derived from S. pneumoniae serotypes 8, 10A, 11A, 12F, 15B, 22F and 33F.

[0548] 5.2 Amount of support Generally, each dose of the immunogenic composition of the invention comprises 1 μg to 150 μg of carrier protein, particularly 10 μg to 100 μg of carrier protein, more particularly 15 μg to 50 μg of carrier protein, and even more particularly 16 μg to 40 μg of carrier protein. In one embodiment, the carrier protein is CRM. 197 is.

[0549] In one embodiment, each dose is about 1 μg, about 2 μg, about 3 μg, about 4 μg, about 5 μg, about 6 μg, about 7 μg, about 8 μg, about 9 μg, about 10 μg, about 11 μg, about 12 μg, about 13 μg, about 14 μg, about 15 μg, about 16 μg, about 17 μg, about 18 μg, about 19 μg, about 20 μg, about 21 μg, about 22 μg, about 23 μg, about 24 μg, about 25 μg, about 26 μg, about 27 μg, about 28 μg, about 29 μg, about 30 μg, about 31 μg, about 32 μg, about 33 μg, about 34 μg, about 35 μg, about 36 μg, about 37 μg, about 38 μg , about 39 μg, about 40 μg, about 41 μg, about 42 μg, about 43 μg, about 44 μg, about 45 μg, about 46 μg, about 47 μg, about 48 μg, about 49 μg, about 50 μg, about 51 μg, about 52 μg, about 53 μg, about 54 μg, about 55 μg, about 56 μg, about 57 μg, about 58 μg, about 59 μg, about 60 μg, about 61 μg, about 62 μg, about 63 μg, about 64 μg, about 65 μg, about 66 μg, about 67 μg, about 68 μg, about 69 μg, about 70 μg, about 71 μg, about 72 μg, about 73 μg, about 74 μg, or about 75 μg of carrier protein. 197 is.

[0550] In one embodiment, each dose comprises about 10 μg, about 11 μg, about 12 μg, about 13 μg, about 14 μg, about 15 μg, about 16 μg, about 17 μg, about 18 μg, about 19 μg, about 20 μg, about 21 μg, about 22 μg, about 23 μg, about 24 μg, about 25 μg, about 26 μg, about 27 μg, about 28 μg, about 29 μg, or about 30 μg of carrier protein. In one embodiment, the carrier protein is CRM 197 is.

[0551] 6. Further antigens The immunogenic compositions disclosed herein contain conjugated Streptococcus pneumoniae (S. pneumoniae) saccharide antigens (glycoconjugates). They may also further contain at least one antigen derived from other pathogens, particularly bacteria and / or viruses.

[0552] In one embodiment, the immunogenic composition disclosed herein further comprises at least one antigen selected from the group consisting of diphtheria toxoid (D), tetanus toxoid (T), pertussis antigen (P), acellular pertussis antigen (Pa), hepatitis B virus (HBV) surface antigen (HBsAg), hepatitis A virus (HAV) antigen, conjugated Haemophilus influenzae type b capsular saccharide (Hib), and inactivated poliovirus vaccine (IPV).

[0553] In one embodiment, the immunogenic composition disclosed herein comprises DT-Pa. In one embodiment, the immunogenic composition disclosed herein comprises DT-Pa-Hib, DT-Pa-IPV, or DT-Pa-HBsAg. In one embodiment, the immunogenic composition disclosed herein comprises DT-Pa-HBsAg-IPV or DT-Pa-HBsAg-Hib. In one embodiment, the immunogenic composition disclosed herein comprises DT-Pa-HBsAg-IPV-Hib.

[0554] Pertussis antigens: Bordetella pertussis causes whooping cough. Pertussis antigens in vaccines can be cellular (whole cell, in the form of inactivated B. pertussis cells) or acellular. Preparation of cellular pertussis antigens is well documented (e.g., they can be obtained by heat inactivation of Phase I cultures of B. pertussis). However, the present invention preferably uses acellular antigens. When acellular antigens are used, it is preferred to use one, two, or (preferably) three of the following antigens: (1) detoxified pertussis toxin (pertussis toxoid, or PT); (2) fibrillar hemagglutinin (FHA); and (3) pertactin (also known as the 69-kilodalton outer membrane protein). FHA and pertactin can be treated with formaldehyde prior to use in accordance with the present invention. PT is preferably detoxified by treatment with formaldehyde and / or glutaraldehyde. Acellular pertussis antigens are preferably adsorbed onto one or more aluminum salt adjuvants. Alternatively, they may be added in a non-adsorbed state. If pertactin is added, it is preferably already adsorbed onto aluminum hydroxide adjuvant. PT and FHA can be adsorbed onto aluminum hydroxide adjuvant or aluminum phosphate adjuvant. Adsorption of all of PT, FHA, and pertactin onto aluminum hydroxide is most preferred.

[0555] Inactivated Poliovirus Vaccine: Poliovirus causes acute poliomyelitis. Rather than using an oral poliovirus vaccine, a preferred embodiment of the present invention uses IPV. Before administration to a patient, the poliovirus must be inactivated, which can be achieved by treatment with formaldehyde. Acute poliomyelitis can be caused by one of three types of poliovirus. Although the three types are similar and cause the same symptoms, they are antigenically distinct, and infection with one type does not protect against infection with the others. Therefore, three poliovirus antigens are preferably used in the present invention: poliovirus type 1 (e.g., Mahoney strain), poliovirus type 2 (e.g., MEF-1 strain), and poliovirus type 3 (e.g., Saukett strain). The viruses are preferably grown, purified, and inactivated individually and then combined to provide a bulk trivalent mixture for use with the present invention.

[0556] Diphtheria toxoid: Corynebacterium diphtheriae causes diphtheria. Diphtheria toxin can be treated (e.g., with formalin or formaldehyde) to remove toxicity while retaining the ability to induce specific antitoxin antibodies after injection. These diphtheria toxoids are used in diphtheria vaccines. Preferred diphtheria toxoids are those prepared by formaldehyde treatment. Diphtheria toxoid can be obtained by growing C. diphtheriae in a growth medium, followed by formaldehyde treatment, ultrafiltration, and precipitation. The toxoided material can then be processed by processes including sterile filtration and / or dialysis. Diphtheria toxoid is preferably adsorbed onto an aluminum hydroxide adjuvant.

[0557] Tetanus toxoid: Clostridium tetani causes tetanus. Tetanus toxoid can be processed to produce a protective toxoid. The toxoid is used in tetanus vaccines. A preferred tetanus toxoid is one prepared by formaldehyde treatment. Tetanus toxoid can be obtained by growing C. tetani in a growth medium, followed by formaldehyde treatment, ultrafiltration, and precipitation. The material can then be processed by processes including sterile filtration and / or dialysis.

[0558] Hepatitis A virus antigen: Hepatitis A virus (HAV) is one of the known agents that causes viral hepatitis. Preferred HAV components are based on inactivated virus, and inactivation can be achieved by formalin treatment.

[0559] Hepatitis B virus (HBV) is one of the known agents that cause viral hepatitis. The main component of the capsid is a protein known as HBV surface antigen, or more commonly, HBsAg, a 226 amino acid polypeptide typically with a molecular weight of about 24 kDa. All existing hepatitis B vaccines contain HBsAg, and when this antigen is administered to normal vaccinees, it stimulates the production of anti-HBsAg antibodies that protect against HBV infection.

[0560] For vaccine production, HBsAg has been produced in two ways: by purification of the antigen in particulate form from the plasma of chronic hepatitis B carriers or by expression of the protein by recombinant DNA techniques (e.g., recombinant expression in yeast cells). Unlike native HBsAg (i.e., as in plasma purified products), yeast-expressed HBsAg is generally not glycosylated, and this is the most preferred form of HBsAg for use with the present invention.

[0561] Conjugated Haemophilus influenzae type b antigen: Haemophilus influenzae type b (Hib) causes bacterial meningitis. Hib vaccines are typically based on capsular saccharide antigens, the preparation of which is well documented. The Hib saccharide can be conjugated to a carrier protein to enhance its immunogenicity, particularly in children. Typical carrier proteins are tetanus toxoid, diphtheria toxoid, CRM 197 , Haemophilus influenzae (H. influenzae) protein D, and an outer membrane protein complex derived from serogroup B Neisseria meningitidis. The saccharide portion of the conjugate may comprise full-length polyribosyl ribitol phosphate (PRP) and / or fragments of full-length PRP prepared from Hib bacteria. The Hib conjugate may or may not be adsorbed to an aluminum salt adjuvant.

[0562] In one embodiment, the immunogenic composition disclosed herein further comprises a conjugated Neisseria meningitidis (N. meningitidis) serogroup Y capsular saccharide (MenY), and / or a conjugated Neisseria meningitidis (N. meningitidis) serogroup C capsular saccharide (MenC).

[0563] In one embodiment, the immunogenic composition disclosed herein further comprises a conjugated N. meningitidis serogroup A capsular saccharide (MenA), a conjugated N. meningitidis serogroup W135 capsular saccharide (MenW135), a conjugated N. meningitidis serogroup Y capsular saccharide (MenY), and / or a conjugated N. meningitidis serogroup C capsular saccharide (MenC).

[0564] In one embodiment, the immunogenic composition disclosed herein further comprises a conjugated N. meningitidis serogroup W135 capsular saccharide (MenW135), a conjugated N. meningitidis serogroup Y capsular saccharide (MenY), and / or a conjugated N. meningitidis serogroup C capsular saccharide (MenC).

[0565] An aspect of the invention provides a kit as defined in section 4 above, wherein any of the additional antigens is part of the first immunogenic composition (part (a) of the kit).

[0566] An aspect of the invention provides a kit as defined in section 4 above, wherein any of the further antigens is part of a second immunogenic composition (part (b) of the kit).

[0567] An aspect of the invention provides a kit as defined in section 4 above, wherein any of the additional antigens is part of a first immunogenic composition (part (a) of the kit) and any of the additional antigens is part of a second immunogenic composition (part (b) of the kit).

[0568] 7. Adjuvants In some embodiments, the immunogenic compositions disclosed herein may further comprise at least one, two, or three adjuvants. The term "adjuvant" refers to a compound or mixture that enhances the immune response to an antigen. The antigen may act primarily as a delivery system, primarily as an immunomodulator, or have both potent features. Suitable adjuvants include those suitable for use in mammals, including humans.

[0569] Examples of known suitable delivery system-type adjuvants that can be used in humans include, but are not limited to, alum (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide), calcium phosphate, liposomes, oil-in-water emulsions such as MF59 (4.3% w / v squalene, 0.5% w / v polysorbate 80 (TWEEN® 80), 0.5% w / v sorbitan trioleate (Span 85)), water-in-oil emulsions such as MONTANIDE™, and poly(D,L-lactide-co-glycolide) (PLG) microparticles or nanoparticles.

[0570] In one embodiment, the immunogenic compositions disclosed herein comprise an aluminum salt (alum) (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide) as an adjuvant. In a preferred embodiment, the immunogenic compositions disclosed herein comprise aluminum phosphate or aluminum hydroxide as an adjuvant. In one embodiment, the immunogenic compositions disclosed herein comprise 0.1 mg / mL to 1 mg / mL or 0.2 mg / mL to 0.3 mg / mL of elemental aluminum in the form of aluminum phosphate. In one embodiment, the immunogenic compositions disclosed herein comprise about 0.25 mg / mL of elemental aluminum in the form of aluminum phosphate.

[0571] Examples of known suitable immunomodulatory adjuvants that can be used in humans include, but are not limited to, saponin extract derived from the bark of the Aquilla tree (QS21, QUILA®), TLR4 agonists such as MPL (monophosphoryl lipid A), 3DMPL (3-O-deacylated MPL) or GLA-AQ, LT / CT mutants, cytokines such as various interleukins (e.g., IL-2, IL-12) or GM-CSF, and others.

[0572] Examples of known suitable immunomodulatory adjuvants that are characterized by both delivery and immunomodulation and can be used in humans include, but are not limited to, ISCOMS (see, e.g., Sjolander et al. (1998) J. Leukocyte Biol. 64:713; WO90 / 03184, WO96 / 11711, WO00 / 48630, WO98 / 36772, WO00 / 41720, WO2006 / 134423 and WO2007 / 026190) or GLA-EM, which is a combination of a TLR4 agonist and an oil-in-water emulsion.

[0573] For veterinary applications, such as, but not limited to, animal testing, those skilled in the art will recognize various adjuvants, including complete Freund's adjuvant (CFA), incomplete Freund's adjuvant (IFA), EMULSIGEN®, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-normuramyl-L-alanyl-D-isoglutamine (CGP11637, referred to as nor-MDP), N-acetyl ...), and N-acetylmuramyl-L-alanyl-D-isoglutamine (CGP11637). One example is RIBI™, which contains 1'-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP19835A, referred to as MTP-PE), and three components extracted from bacteria, monophosphoryl lipid A, trehalose dimycolate, and cell wall skeleton (MPL+TDM+CWS), in a 2% squalene / TWEEN® 80 emulsion.

[0574] Additional exemplary adjuvants for enhancing the efficacy of the pneumococcal vaccines disclosed herein include, but are not limited to, (1) SAF containing, for example, (a) 10% squalane, 0.4% TWEEN® 80, 5% Pluronic block polymer L121, and thr-MDP microfluidized or vortexed into a submicron emulsion to generate a larger particle size emulsion, and (b) the RIBI™ Adjuvant System (RAS) (Ribi™) containing 2% squalene, 0.2% TWEEN® 80, and one or more bacterial cell wall components such as monophosphoryl lipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL+CWS (DETOX™). (2) saponin adjuvants such as QS21, STIMULON™ (Cambridge Bioscience, Worcester, MA), ABISCO® (Isconova, Sweden), or particles generated therefrom such as ISCOMATRIX® (Commonwealth Serum Laboratories, Australia) or ISCOMs (immunostimulating complexes) that may not contain additional surfactants (e.g., WO 00 / 07621); (3) complete Freund's adjuvant (CFA) and incomplete Freund's adjuvant (IFA); (4) interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12 (e.g., WO 99 / 446 36)), cytokines such as interferons (e.g., gamma interferon), macrophage colony-stimulating factor (M-CSF), and tumor necrosis factor (TNF); (5) monophosphoryl lipid A (MPL) or 3-O-deacylated MPL (3dMPL), optionally in the substantial absence of alum, when used with pneumococcal saccharides (see, e.g., WO 00 / 56358) (see, e.g., GB-2220221, EP 0689454);(6) 3dMPL in combination with, for example, QS21 and / or oil-in-water emulsions (see, for example, EP 0835318, EP 0735898, EP 0761231); (7) polyoxyethylene ethers or polyoxyethylene esters (see, for example, WO 99 / 52549); (8) polyoxyethylene sorbitan ester surfactants in combination with octoxynol (see, for example, WO 01 / 21207) or polyoxyethylene alkyl ethers or esters in combination with at least one further non-ionic surfactant such as octoxynol. (9) saponin and immunostimulatory oligonucleotides (e.g., CpG oligonucleotides) (e.g., WO00 / 62800); (10) particles of immunostimulants and metal salts (see, e.g., WO00 / 23105); (11) saponin and oil-in-water emulsions (e.g., WO99 / 11241); (12) saponin (e.g., QS21) + 3dMPL + IM2 (optionally + sterol) (e.g., WO98 / 57659); (13) other substances that act as immunostimulants to enhance the efficacy of the composition. Examples of muramyl peptides include N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-25-acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP), and N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (MTP-PE).

[0575] In one embodiment of the present invention, the immunogenic composition disclosed herein comprises a CpG oligonucleotide as an adjuvant. As used herein, CpG oligonucleotide refers to an immunostimulatory CpG oligodeoxynucleotide (CpG ODN), and therefore, these terms are used interchangeably unless otherwise indicated. An immunostimulatory CpG oligodeoxynucleotide contains one or more immunostimulatory CpG motifs, which are unmethylated cytosine-guanine dinucleotides, optionally within the context of certain preferred bases. The methylation state of a CpG immunostimulatory motif generally refers to the cytosine residue in the dinucleotide. An immunostimulatory oligonucleotide containing at least one unmethylated CpG dinucleotide is an oligonucleotide that contains a 5' unmethylated cytosine linked to a 3' guanine by a phosphate bond and activates the immune system by binding to Toll-like receptor 9 (TLR-9). In another embodiment, immunostimulatory oligonucleotides can contain one or more methylated CpG dinucleotides, and they can activate the immune system through TLR9, although not as strongly as when the CpG motif is unmethylated.CpG immunostimulatory oligonucleotides can in turn contain one or more palindromes that can contain CpG dinucleotides.CpG oligonucleotides are described in several issued patents, published patent applications and other publications, such as U.S. Patent Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; and 6,339,068.

[0576] In one embodiment of the present invention, the immunogenic composition disclosed herein comprises any of the CpG oligonucleotides described on page 3, line 22 to page 12, line 36 of WO2010 / 125480.

[0577] Different classes of CpG immunostimulatory oligonucleotides have been identified, referred to as the A, B, C, and P classes, and are described in more detail in WO2010 / 125480, page 3, line 22 to page 12, line 36. The methods of the present invention encompass the use of these different classes of CpG immunostimulatory oligonucleotides.

[0578] In one embodiment of the present invention, the immunogenic composition disclosed herein comprises an A-class CpG oligonucleotide. Preferably, the "A-class" CpG oligonucleotide of the present invention has the following nucleic acid sequence: 5'GGGGACGACGTCGTGGGGGGG 3' (SEQ ID NO: 1). Some non-limiting examples of A-class oligonucleotides include 5'G*G*G_G_A_C_G_A_C_G_T_C_G_T_G_G*G*G*G*G 3' (SEQ ID NO: 2), where "*" indicates a phosphorothioate linkage and "_" indicates a phosphodiester linkage.

[0579] In one embodiment of the present invention, the immunogenic composition disclosed herein comprises a B-class CpG oligonucleotide. In one embodiment, the CpG oligonucleotide for use in the present invention is a B-class CpG oligonucleotide represented by at least the formula: 5'X1X2CGX3X43', where X1, X2, X3, and X4 are nucleotides. In one embodiment, X2 is adenine, guanine, or thymine. In another embodiment, X3 is cytosine, adenine, or thymine.

[0580] The B-class CpG oligonucleotide sequences of the present invention are those broadly described above and those disclosed in WO96 / 02555, WO98 / 18810 and U.S. Patent Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; and 6,339,068.Exemplary sequences include, but are not limited to, those disclosed in these latter applications and patents.

[0581] In one embodiment, the "B class" CpG oligonucleotide of the invention has the following nucleic acid sequence: 5'TCGTCGTTTTTCGGTGCTTTT3' (SEQ ID NO: 3), or 5'TCGTCGTTTTTCGGTCGTTTT3' (SEQ ID NO: 4), or 5'TCGTCGTTTTGTCGTTTTGTCGTT3' (SEQ ID NO: 5), or 5'TCGTCGTTTCGTCGTTTTGTCGTT3' (SEQ ID NO: 6), or 5'TCGTCGTTTTGTCGTTTTTTTCGA3' (SEQ ID NO: 7) It has.

[0582] In any of these sequences, all linkages may be phosphorothioate linkages. In another embodiment, in any of these sequences, one or more linkages may be phosphodiester, preferably between the "C" and "G" of the CpG motif, creating a semi-soft CpG oligonucleotide. In any of these sequences, an ethyl-uridine or halogen may replace the 5' T; examples of halogen substitutions include, but are not limited to, bromo-uridine or iodo-uridine substitutions.

[0583] Some non-limiting examples of B class oligonucleotides include: 5'T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T3' (SEQ ID NO: 8), or 5'T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T*T3' (SEQ ID NO: 9), or 5'T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T3' (SEQ ID NO: 10), or 5'T*C*G*T*C*G*T*T*T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T3' (SEQ ID NO: 11), or 5'T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*T*T*T*C*G*A3' (Sequence number 12) (wherein "*" indicates a phosphorothioate bond).

[0584] In one embodiment of the invention, the immunogenic compositions disclosed herein comprise a C-class CpG oligonucleotide. In one embodiment, the "C-class" CpG oligonucleotide of the invention has the following nucleic acid sequence: 5'TCGCGTCGTTCGGCGCGCGCCG3' (SEQ ID NO: 13), or 5'TCGTCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO: 14), or 5'TCGGACGTTCGGCGCGCGCCG3' (SEQ ID NO: 15), or 5'TCGGACGTTCGGCGCGCCG3' (SEQ ID NO: 16), or 5'TCGCGTCGTTCGGCGCGCCG3' (SEQ ID NO: 17), or 5'TCGACGTTCGGCGCGCGCCG3' (SEQ ID NO: 18), or 5'TCGACGTTCGGCGCGCCG3' (SEQ ID NO: 19), or 5'TCGCGTCGTTCGGCGCCG3' (SEQ ID NO: 20), or 5'TCGCGACGTTCGGCGCGCGCCG3' (SEQ ID NO: 21), or 5'TCGTCGTTTTCGGCGCGCGCCG3' (SEQ ID NO: 22), or 5'TCGTCGTTTTCGGCGGCCGCCG3' (SEQ ID NO: 23), or 5'TCGTCGTTTTACGGCGCCGTGCCG3' (SEQ ID NO: 24), or 5'TCGTCGTTTTCGGCGCGCGCCGT3' (SEQ ID NO: 25) It has.

[0585] In any of these sequences, all of the linkages may be phosphorothioate linkages. In another embodiment, in any of these sequences, one or more of the linkages may be phosphodiester, preferably between the "C" and "G" of the CpG motif, creating a semi-soft CpG oligonucleotide.

[0586] Some non-limiting examples of C class oligonucleotides include: 5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C_G*C*G*C*G*C*G3' (SEQ ID NO: 26), or 5'T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*G3' (SEQ ID NO: 27), or 5'T*C_G*G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G3' (SEQ ID NO: 28), or 5'T*C_G*G*A*C_G*T*T*C_G*G*C*G*C*G*C*G*C*G3' (SEQ ID NO: 29), or 5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*G*C*G*C*G3' (SEQ ID NO: 30), or 5'T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*G*C*G3' (SEQ ID NO: 31), or 5'T*C_G*A*C_G*T*T*C_G*G*C*G*C*G*C*G*C*G3' (SEQ ID NO: 32), or 5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*C*G3' (SEQ ID NO: 33), or 5'T*C_G*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*G*C*G3' (SEQ ID NO: 34), or 5'T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*G*C*G3' (SEQ ID NO: 35), or 5'T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*G*C*G*C*G*C*C*G*C*G3' (SEQ ID NO: 36), or 5'T*C*G*T*C_G*T*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G3' (SEQ ID NO: 37), or 5'T*C_G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T3' (Sequence number 38) (where "*" refers to a phosphorothioate bond and "_" refers to a phosphodiester bond). In any of these sequences, ethyl-uridine or a halogen may replace the 5' T; examples of halogen substitutions include, but are not limited to, bromo-uridine or iodo-uridine substitutions.

[0587] In one embodiment of the present invention, the immunogenic composition disclosed herein comprises a P-class CpG oligonucleotide. In one embodiment, the CpG oligonucleotide for use in the present invention is a P-class CpG oligonucleotide containing a 5' TLR activation domain and at least two palindromic regions, one of which is a 5' palindromic region at least 6 nucleotides in length and is connected, directly or via a spacer, to a 3' palindromic region at least 8 nucleotides in length, and which contains at least one YpR dinucleotide. In one embodiment, the oligonucleotide is not T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*G (SEQ ID NO: 27). In one embodiment, the P-class CpG oligonucleotide comprises at least one unmethylated CpG dinucleotide. In another embodiment, the TLR activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT, or TTTT. In yet another embodiment, the TLR activation domain is within the 5' palindromic region. In another embodiment, the TLR activation domain is immediately 5' to the 5' palindromic region.

[0588] In one embodiment, a "P class" CpG oligonucleotide of the invention has the following nucleic acid sequence: 5'TCGTCGACGATCGGCGCGCGCCG 3' (SEQ ID NO: 39).

[0589] In the above sequences, all of the linkages may be phosphorothioate linkages. In another embodiment, one or more of the linkages may be phosphodiester, preferably between the "C" and "G" of the CpG motif, creating a semi-soft CpG oligonucleotide. In any of these sequences, ethyl-uridine or halogen may replace the 5' T; examples of halogen substitutions include, but are not limited to, bromo-uridine or iodo-uridine substitutions.

[0590] Non-limiting examples of P class oligonucleotides include: 5'T*C_G*T*C_G*A*C_G*A*T*C_G*G*C*G*C_G*C*G*C*C*G3' (Sequence number 40) where "*" refers to a phosphorothioate bond and "_" refers to a phosphodiester bond.

[0591] In one embodiment, the oligonucleotide comprises at least one phosphorothioate bond. In another embodiment, all internucleotide bonds of the oligonucleotide are phosphorothioate bonds. In another embodiment, the oligonucleotide comprises at least one phosphodiester-like bond. In another embodiment, the phosphodiester-like bond is a phosphodiester bond. In another embodiment, a lipophilic group is conjugated to the oligonucleotide. In one embodiment, the lipophilic group is cholesterol.

[0592] In one embodiment, all internucleotide bonds of the CpG oligonucleotides disclosed herein are phosphodiester bonds ("soft" oligonucleotides described in WO2007 / 026190). In another embodiment, the CpG oligonucleotides of the present invention are made resistant to degradation (e.g., stabilized). "Stabilized oligonucleotide" refers to an oligonucleotide that is relatively resistant to in vivo degradation (e.g., by exo- or endonuclease). Nucleic acid stabilization can be achieved by backbone modification. Oligonucleotides with phosphorothioate bonds produce maximum activity and protect the oligonucleotide from degradation by intracellular exo- and endonucleases.

[0593] Immunostimulatory oligonucleotides may have a chimeric backbone that has a combination of phosphodiester and phosphorothioate bonds.For the purpose of the present invention, chimeric backbone refe...

Claims

1. (a) glycoconjugates derived from S. pneumoniae serotype 15B, glycoconjugates derived from S. pneumoniae serotype 22F, glycoconjugates derived from S. pneumoniae serotype 33F, glycoconjugates derived from S. pneumoniae serotype 12F, glycoconjugates derived from S. pneumoniae serotype 10A, and a second immunogenic composition comprising at least one glycoconjugate selected from the group consisting of a glycoconjugate derived from S. pneumoniae serotype 11A and a glycoconjugate derived from S. pneumoniae serotype 8; and a second immunogenic composition comprising at least one glycoconjugate derived from a Streptococcus pneumoniae serotype selected from the group consisting of serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F.

2. The first immunogenic composition is selected from the group consisting of a glycoconjugate derived from S. pneumoniae serotype 15B, a glycoconjugate derived from S. pneumoniae serotype 22F, a glycoconjugate derived from S. pneumoniae serotype 33F, a glycoconjugate derived from S. pneumoniae serotype 12F, a glycoconjugate derived from S. pneumoniae serotype 15C, a glycoconjugate derived from S. pneumoniae serotype 15D, a glycoconjugate derived from S. pneumoniae serotype 15 ...C, a glycoconjugate derived from S. pneumoniae serotype 15C, a glycoconjugate derived from S. pneumoniae serotype 15C, a glycoconjugate derived from S. pneumoniae serotype 15C, a glycoconjugate derived from S. pneumoniae serotype 15C, a glycoconjugate derived from S. pneumoniae s 10. The kit of claim 1, comprising a glycoconjugate, a glycoconjugate derived from S. pneumoniae serotype 10A, a glycoconjugate derived from S. pneumoniae serotype 11A, and a glycoconjugate derived from S. pneumoniae serotype 8, wherein the composition is a 7-valent pneumococcal conjugate composition.

3. The glycoconjugate of the first immunogenic composition is a CRM. 197 The kit of claim 1 or 2, wherein the

4. The kit of any one of claims 1 to 3, wherein the first immunogenic composition further comprises at least one adjuvant.

5. 5. The kit of any one of claims 1 to 4, wherein the second immunogenic composition comprises glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F.

6. Glycoconjugates derived from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F are CRMs. 197 The kit of claim 5, wherein the antibody is conjugated to

7. Glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F are CRMs. 197 The kit of claim 5, wherein the antibody is conjugated to

8. The kit of any one of claims 1 to 7, wherein the second immunogenic composition is a 13-, 14- or 15-valent pneumococcal conjugate composition.

9. The second immunogenic composition is a 13-valent pneumococcal conjugate composition, and the 13 conjugate is a CRM. 197 9. The kit of any one of claims 1 to 8, comprising glycoconjugates derived from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F individually conjugated to:

10. The kit of any one of claims 1 to 9, wherein the second immunogenic composition further comprises at least one adjuvant.

11. The kit according to any one of claims 1 to 10, wherein the schedule of concomitant or simultaneous administration vaccinations is a multiple dose schedule.

12. 12. The kit of claim 11, wherein the multiple dose schedule consists of at least one dose in the first year of life, followed by at least one infant dose.

13. A kit according to any one of claims 1 to 10 for use in a method of sequential administration of a first and a second immunogenic composition.

14. 14. The kit of claim 13, wherein the sequential vaccination schedule consists of a 2, 3, 4, 5, 6, 7 or 8 dose series.

15. The vaccination schedule is (a) a first immunogenic composition; and (b) Concomitant or simultaneous administration of a first immunogenic composition with a second immunogenic composition.

15. The kit of claim 13 or 14, comprising the sequential administration of

16. The vaccination schedule is (a) a second immunogenic composition; and (b) Concomitant or simultaneous administration of a first immunogenic composition with a second immunogenic composition.

15. The kit of claim 13 or 14, comprising the sequential administration of

Citation Information

Patent Citations

  • Pneumococcal vaccine and use thereof

    JP2010260849A