Method and device for detecting and collecting biomarker

The microneedle array with probe-attached biomarkers allows for rapid and sensitive detection of biomarkers in situ, addressing the limitations of current methods by reducing invasiveness and processing time.

JP2025138775APending Publication Date: 2025-09-25MINDERA CORP +1
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
JP2025108143
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2012-12-14
Filing Date
2025-06-26
Publication Date
2025-09-25

AI Technical Summary

Technical Problem

Current methods for detecting molecular biomarkers require cumbersome procedures, large sample volumes, and prolonged diagnostic times, and are not suitable for localized, non-circulating biomarkers, often necessitating invasive biopsies with high risks of misdiagnosis.

Method used

A device comprising an array of microneedles with covalently or non-covalently attached probes specific to biomarkers, allowing in situ detection and extraction of biomarkers from tissue samples, including microneedles made of polymers, metals, or ceramics, with optional amplification and optical signal emission.

Benefits of technology

Enables rapid, sensitive, and minimally invasive detection of biomarkers, reducing processing time and sample volume requirements while minimizing misdiagnosis risks.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025138775000007
    Figure 2025138775000007
  • Figure 2025138775000008
    Figure 2025138775000008
  • Figure 2025138775000009
    Figure 2025138775000009
Patent Text Reader

Abstract

To provide a device and method for detecting and capturing a molecular biomarker from a subject in situ.SOLUTION: Specifically, a device comprises an array of microneedles to which a probe specific to one or more biomarkers of interest is attached. The device can be used directly on a subject (e.g., via skin puncture) in the detection of a biomarker within the body of the subject (e.g., the tissue or blood flow). In one embodiment, the device comprising a first microneedle is provided. The device attaches a first microneedle to a first probe specific to a first biomarker, either covalently or non-covalently.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Background technology]

[0001] Citation of Related Applications This application claims the benefit of U.S. Provisional Patent Application No. 61 / 737,237, filed December 14, 2012. U.S. Provisional Patent Application No. 61 / 737,237 is incorporated herein by reference in its entirety.

[0002] background Analysis of biomarkers is quickly becoming a preferred method for early detection of disease, stratification of patients, and monitoring the effectiveness of treatment. Rapid and sensitive detection of changes in biomarkers is often technically impossible or requires cumbersome procedures involving multiple processing steps, which necessitates large sample volumes and prolonged diagnostic / prognostic time periods. Samples derived from patients often have limited volume and are not suitable for processing or procedures that require multiple steps that extend processing time.

[0003] Current methods for detecting molecular biomarkers or biological analytes of interest in diagnostic applications primarily utilize the extraction of bodily fluids (e.g., blood, interstitial tissue fluid) from patients. The specific biomarkers assayed are derived from this bodily fluid sample. More recent inventions do not sample clinically relevant biomarkers directly from the application site, but require further processing of the bodily fluid. Other diagnostic methods not based on molecular assays, such as biopsies, are usually cumbersome and have a high risk of misdiagnosis due to their inherent visual and subjective nature. However, for localized, non-circulating biomarkers, biopsy is currently often the only diagnostic option. Summary of the Invention [Problem to be solved by the invention]

[0004] There is a need in the art for better means to detect and analyze biomarkers present in the bodies of subjects who have or are at risk of developing various diseases or disorders. The present invention addresses this and other needs. [Means for solving the problem]

[0005] Summary of the Invention In one aspect, the present invention provides a device for detecting or extracting one or more biomarkers in situ from a tissue or biological sample of a subject. The device can include an array of microneedles and multiple probes specific to the biomarkers, where the probes are covalently attached to the microneedles. In some devices, the probes are specific to different biomarkers, with each different probe attached to a different microneedle. In other devices, the same probe for a specific biomarker is attached to two or more microneedles. The microneedles in the device can be made of polymer, metal, ceramic, or any other suitable material.

[0006] In some cases, the present disclosure provides a device for detecting or extracting one or more biomarkers from a tissue or biological sample in situ from a subject, the device comprising one or more microneedles and one or more probes specific for the biomarkers, the probes being attached to the microneedles via covalent or non-covalent linkages.

[0007] The device may include a first microneedle. The first microneedle may be covalently attached to a first probe specific to a first biomarker. Alternatively, the first microneedle may be non-covalently attached to the first probe. Furthermore, the first probe may be attached to multiple microneedles. In some cases, the present invention provides a device including a first microneedle, wherein the first probe specific to the first biomarker is covalently or non-covalently attached to the first microneedle. In some cases, the first biomarker may be a polynucleotide. The first probe may be a polynucleotide complementary to the first biomarker. In other cases, the first biomarker may be a polypeptide, an antibody, a metabolite, or a small molecule. Furthermore, the first probe may be a polynucleotide, a polypeptide, a protein, an antibody, a small molecule, or a biological receptor. In some cases, the first needle is formed on a substrate.

[0008] The device may further include a second probe specific to a second biomarker. The second probe may be different from the first probe. The second probe may be covalently or non-covalently attached to the first microneedle. Alternatively, the second probe may be covalently or non-covalently attached to the second microneedle. The second biomarker may be a polynucleotide. The second probe may be a polynucleotide complementary to the second biomarker. The second biomarker may also be a polypeptide, antibody, metabolite, or small molecule. Furthermore, the second probe may be a polynucleotide, polypeptide, protein, antibody, small molecule, or biological receptor. In some cases, the first probe specifically binds to the first nucleotide polymorphism, and the second probe specifically binds to the second nucleotide polymorphism. In some cases, the first probe and the second probe are different antibodies each specific to a different epitope of the same biomarker.

[0009] In some cases, the device provides microneedles comprising a polymer, metal, or ceramic. The first probe can be covalently or non-covalently attached to the plurality of microneedles. The second probe and other probes can be covalently or non-covalently attached to the plurality of microneedles.

[0010] Some devices of the present invention are directed to the detection of nucleic acid biomarkers. In these devices, the probes that can be conjugated to the microneedles are oligonucleotides or polynucleotides complementary to the biomarkers. Some of the devices employ microneedles fabricated from thermoplastic polymers. The polynucleotide probes in the devices can be conjugated to the microneedles via a number of suitable linkages, including, but not limited to, thiol / amino bifunctional linkers or poly(ethylene glycol) linkers. In some cases, the devices of the present invention further include compartments for amplifying and identifying the first and second biomarkers.

[0011] Some other devices of the invention are specifically designed to detect peptide or protein biomarkers. In some of these devices, the probes immobilized on the microneedles are antibodies specific to the biomarkers. In various embodiments of the invention, a planar substrate is used to support the array of microneedles. The devices of the invention may additionally contain means for amplifying the biomarkers detected by the probes.

[0012] The device may include a plurality of microneedles. The plurality of microneedles may include at least one microneedle covalently or non-covalently attached to at least one probe specific to a biomarker. The biomarker may indicate a specific condition, including, but not limited to, a skin or eye condition. In some cases, the biomarker may indicate a skin condition. In some examples, the skin condition is skin cancer. In other cases, the biomarker may indicate an eye condition. In some examples, the eye condition is eye cancer or eye inflammation.

[0013] In some cases, the present disclosure provides a device comprising a plurality of microneedles, at least one of which is covalently or non-covalently attached to at least one probe specific to a biomarker, the biomarker indicating a skin or eye condition. In some cases, the biomarker is a polynucleotide and at least one probe is complementary to the biomarker. In some cases, at least one probe comprises different polynucleotide probes specific for different nucleotide polymorphisms of the same biomarker. In some cases, the biomarker is a peptide or polypeptide and at least one probe is an antibody specific to the biomarker. In some cases, at least one probe comprises different antibodies specific for different epitopes of the same biomarker.

[0014] The devices of the invention can include multiple probes specific for multiple different biomarkers, where the multiple probes are attached to the same or different microneedles. In some cases, at least two different probes are attached to the same microneedle. In some cases, the devices include at least two identical probes for specific biomarkers, where the at least two identical probes are attached to one or more microneedles.

[0015] Alternatively, the biomarkers can also be obtained during an intraoperative procedure. The device can further include a sensor that emits an optical signal when the probe detects the biomarker. In some examples, the optical signal of the probe can change when the probe detects the biomarker.

[0016] In another aspect, the present disclosure provides a method for detecting or amplifying one or more biomarkers from a tissue in situ (e.g., skin, bloodstream, tissue) or an ex vivo tissue sample in a subject. The method involves (a) preparing a plurality of microneedles having a plurality of probes specific for the biomarkers covalently attached thereto, (b) contacting the microneedles with the tissue or biological sample from the subject, and (c) detecting the biomarkers bound to the probes on the microneedles.

[0017] In some cases, the present disclosure provides a method for detecting one or more biomarkers from a tissue or biological sample in situ in a subject, the method comprising: (a) contacting a microneedle with the tissue or biological sample of the subject, the microneedle having attached thereto a set of probes, wherein the probes bind to one or more biomarkers in situ; and (b) detecting the one or more biomarkers bound to the probes.

[0018] In some cases, the present disclosure provides a device comprising a plurality of microneedles, the plurality of microneedles comprising at least one microneedle covalently or non-covalently attached to a probe specific for a biomarker, the probe comprising a sensor that emits an optical signal when the probe detects the biomarker. In some cases, the optical signal of the probe increases when the probe detects the biomarker. In some cases, the optical signal of the probe decreases when the probe detects the biomarker.

[0019] In some cases, the present disclosure provides methods for detecting one or more biomarkers in situ from tissue or biological samples in a subject, the methods comprising: (a) preparing a device comprising one or more microneedles having one or more probes specific for the biomarkers covalently attached thereto; (b) contacting the microneedle device with tissue or biological samples from the subject; and (c) detecting the biomarkers bound to the probes on the microneedle array.

[0020] In some cases, the present disclosure provides a method for detecting one or more biomarkers from tissue or a biological sample in situ in a subject, the method comprising: (a) contacting a microneedle device with the tissue or biological sample of the subject, wherein the microneedle device comprises one or more probes specific to the one or more biomarkers, at least one probe comprising a sensor that emits a visual signal when the probe detects the biomarker; and (b) detecting the biomarkers based on the visual signal.

[0021] Alternatively, the method may also include (a) contacting a microneedle device with tissue or a biological sample from a subject and at least two probes specific to one or more biomarkers, wherein the at least two probes specific to the biomarkers are different and the probes are attached to the microneedles via covalent or non-covalent linkages; and (b) detecting the biomarkers bound to the probes.

[0022] In some cases, the present disclosure provides a method for detecting one or more biomarkers in a tissue of a subject, the method comprising: (a) contacting a microneedle with the tissue of the subject in situ, the tissue comprising an extracellular matrix, the microneedle being covalently attached to a set of probes, the probes binding the biomarkers in situ; and (b) disrupting the extracellular matrix. In some cases, the extracellular matrix is ​​disrupted by enzymatic activity. In some cases, disrupting the extracellular matrix comprises applying ultrasonic energy to the extracellular matrix. In some cases, the extracellular matrix is ​​disrupted by an electrical potential.

[0023] In a further example, the method may include (a) contacting a microneedle device with a sample containing extracellular matrix, wherein the microneedles are covalently attached to a set of probes, and the probes bind to biomarkers in situ, and (b) disrupting the extracellular matrix. Alternatively, the method may also include disrupting cell membranes. In either example, the extracellular matrix or cell membranes can be disrupted by enzymatic activity, ultrasonic energy, or an electrical potential.

[0024] In yet another example, the method may include (a) contacting a microneedle device with tissue or a biological sample from a subject, wherein the microneedle device comprises one or more probes specific to one or more biomarkers; and (b) amplifying the biomarkers.

[0025] The biomarkers can be polynucleotides and the probes can be polynucleotides complementary to the biomarkers. In some cases, the probes can be different polynucleotide probes specific for different nucleotide polymorphisms of the same biomarker.

[0026] The biomarkers can be peptides or polypeptides, and the probes can be antibodies specific for the biomarkers. In some cases, the probes can be different antibodies specific for different epitopes of the same biomarker.

[0027] To simultaneously detect different biomarkers, the probes used in the method can be specific to different biomarkers. The probes can be attached to different microneedles or to the same microneedle. In other embodiments, at least two microneedles can carry the same probe, and multiple probes can be used to detect specific biomarkers.

[0028] The present disclosure also provides a method for preparing a microneedle device, the method comprising: (a) obtaining a solution containing an inorganic salt; (b) adding probes and microneedles to the solution; and (c) conjugating the probes to the microneedles in the solution. In some cases, the inorganic salt is sodium chloride. In some cases, the concentration of the inorganic salt is less than 2.5 M.

[0029] Any suitable material can be used to fabricate the microneedle arrays used in these methods. Examples include, but are not limited to, polymers, metals, or ceramics. Some methods of the present invention are intended for the detection of nucleic acid biomarkers. In these methods, the probes employed are oligonucleotide or polynucleotide molecules with sequences complementary to those of the biomarkers. In some methods, the nucleic acid biomarkers captured by the microneedle device are detected and analyzed by PCR or quantitative real-time PCR (qRT-PCR). In some methods, the microneedles are made of polymers, and the probes are attached to the microneedles via thiol / amino bifunctional linkers. Alternatively, the microneedles are made of stainless steel and coated with gold, and the probes are attached to the microneedles via thiol linkers. In some embodiments, the microneedles can be solid. Other methods of the present invention are intended for the detection of peptide or polypeptide biomarkers. In these methods, the probes employed are molecules capable of specifically binding to the biomarkers, such as monoclonal antibodies. Once captured with an antibody conjugated to a microneedle, the peptide or protein biomarker bound to the probe on the microneedle can be detected by adding a secondary antibody tagged with an oligonucleotide, followed by PCR amplification of the conjugated tag.

[0030] In some cases, a method for detecting one or more polynucleotide biomarkers from skin or eye tissue in a subject may include contacting a microneedle device with the skin or eye tissue of the subject. The method may further include contacting the microneedle device with skin capillaries of the subject. In other cases, the method may include contacting the microneedle device with tissue or a biological sample of the subject during an intraoperative procedure. The tissue or biological sample may be derived from an organ selected from the group consisting of the brain, heart, breast, liver, pancreas, spleen, bladder, stomach, lung, uterus, cervix, prostate, kidney, intestine, appendix, and colon. The method may further include contacting the microneedle with a tumor margin after tumor removal from the subject. In some cases, the methods of the present disclosure detect biomarkers present in the blood of the subject.

[0031] The present disclosure also provides a method for conjugating a probe to a microneedle, comprising adding an inorganic salt. Examples of inorganic salts include, but are not limited to, lithium, potassium, sodium, magnesium, and calcium salts, often with halide counterions. In some cases, the inorganic salt is sodium chloride. The inorganic salt may be added at a concentration of about 0.1 M to 2.0 M. Additionally, the inorganic salt may be added at a concentration of about 0.5 M to 1.5 M.

[0032] Various methods of the present invention may further include detecting one or more biomarkers from reference tissue obtained from the subject. Some devices or methods of the present invention are designed to detect and collect biomarkers from the subject's bloodstream. In these embodiments, the probe-conjugated microneedle array is contacted with the subject's bloodstream by puncturing the subject's skin.

[0033] In yet another aspect, the present invention provides a kit comprising any of the devices for detecting or extracting biomarkers described herein. The kit may further comprise a set of reagents for polymerase chain reaction. In some examples, the set of reagents may be for reverse transcriptase polymerase chain reaction. The kit may further comprise a holder or instructions for its use.

[0034] In some cases, the present disclosure provides a kit including: (a) a device including a plurality of microneedles, at least one of the microneedles being covalently or non-covalently attached to a first probe specific to a biomarker; and (b) a set of reagents for polymerase chain reaction. In some cases, the kit further includes a holder. In some cases, the set of reagents includes a polymerase enzyme, a buffer, and a control sample. In some cases, the kit further includes instructions for use.

[0035] In a further aspect, the present invention provides a composition comprising a plurality of microneedles coated with a substrate capable of disrupting the extracellular matrix. In some cases, the substrate can be an enzyme. The enzyme can be selected from the group consisting of serine proteases, thiol proteases, and MMPs. Specific enzymes include papain, hyaluronidase, streptokinase, streptodornase, trypsin, chymotrypsin, alpha-chymotrypsin, alpha-amylase, DNase, collagenase, and styrein. In one example, the enzyme is hyaluronidase.

[0036] A further understanding of the nature and advantages of the present invention may be realized by reference to the remaining portions of the specification and claims. In certain embodiments, for example, the following are provided: (Item 1) A device comprising a first microneedle, said first microneedle covalently or non-covalently attached to a first probe specific for a first biomarker. (Item 2) 2. The device of claim 1, wherein the first biomarker is a polynucleotide and the first probe is a polynucleotide complementary to the first biomarker. (Item 3) Item 1, wherein the first biomarker is a polypeptide. (Item 4) 2. The device of claim 1, wherein the first probe is an antibody specific to the first biomarker. (Item 5) 2. The device of claim 1, further comprising a second probe specific to a second biomarker, wherein the second probe is different from the first probe. (Item 6) 6. The device of claim 5, wherein the second probe is covalently or non-covalently attached to the first microneedle. (Item 7) 6. The device of item 5, wherein the second probe is covalently or non-covalently attached to the second microneedle. (Item 8) 6. The device of item 5, wherein the second biomarker is a polynucleotide and the second probe is a polynucleotide complementary to the second biomarker. (Item 9) Item 6. The device of item 5, wherein the first probe specifically binds to a first nucleotide polymorphism and the second probe specifically binds to a second nucleotide polymorphism. (Item 10) 6. The device of item 5, wherein the second biomarker is a polypeptide. (Item 11) 6. The device of item 5, wherein the first probe and the second probe are different antibodies each specific for a different epitope of the same biomarker. (Item 12) Item 1, wherein the first probe is attached to a plurality of microneedles. (Item 13) Item 10. The device of item 1, wherein the first microneedle comprises a polymer, a metal, or a ceramic. (Item 14) Item 10. The device of item 1, wherein the first microneedle comprises a polymer. (Item 15) Item 1, wherein the first probe is attached to the first microneedle via a linker. (Item 16) Item 16. The device of item 15, wherein the linker is a thiol / amino bifunctional linker. (Item 17) Item 16. The device of item 15, wherein the linker is a poly(ethylene glycol) linker. (Item 18) Item 19. The device according to item 1, wherein the first microneedle is formed on a substrate. 2. The device of claim 1, further comprising a compartment for amplifying and identifying the first biomarker and the second biomarker. (Item 20) A device comprising a plurality of microneedles, the plurality of microneedles including at least one microneedle covalently or non-covalently attached to at least one probe specific for a biomarker, the biomarker being indicative of a skin or eye condition. (Item 21) 21. The device of item 20, wherein the biomarker is indicative of a skin condition. (Item 22) 22. The device of claim 21, wherein the skin condition is skin cancer. (Item 23) 21. The device of item 20, wherein the biomarker is indicative of an ocular condition. (Item 24) 22. The device of item 21, wherein the eye condition is eye inflammation or eye cancer. (Item 25) 21. The device of claim 20, wherein the biomarker is a polynucleotide and the at least one probe is complementary to the biomarker. (Item 26) 26. The device of claim 25, wherein the at least one probe comprises different polynucleotide probes specific for different nucleotide polymorphisms of the same biomarker. (Item 27) 21. The device of claim 20, wherein the biomarker is a peptide or polypeptide and the at least one probe is an antibody specific for the biomarker. (Item 28) 28. The device of claim 27, wherein the at least one probe comprises different antibodies specific for different epitopes of the same biomarker. (Item 29) 21. The device of claim 20, comprising a plurality of probes specific for a plurality of different biomarkers, the plurality of probes being attached to the same or different microneedles. (Item 30) 30. The device of item 29, wherein at least two different probes are attached to the same microneedle. (Item 31) 21. The device of item 20, comprising at least two identical probes for specific biomarkers, the at least two identical probes being attached to one or more microneedles. (Item 32) 21. The device of claim 20, wherein the microneedles comprise a polymer, a metal, or a ceramic. (Item 33) 33. The device of claim 32, wherein the microneedles comprise a polymer. (Item 34) 21. The device of claim 20, wherein the probe is attached to the microneedle via a linker. (Item 35) 35. The device of claim 34, wherein the linker is a thiol / amino bifunctional linker. (Item 36) 35. The device of claim 34, wherein the linker is a poly(ethylene glycol) linker. (Item 37) 21. The device of claim 20, wherein the plurality of microneedles are formed on a substrate. (Item 38) 21. The device of item 20, further comprising a compartment for amplifying and identifying the biomarkers captured by the probes in situ. (Item 39) A device comprising a plurality of microneedles, the plurality of microneedles comprising at least one microneedle covalently or non-covalently attached to a probe specific for a biomarker, the probe comprising a sensor that emits an optical signal when the probe detects the biomarker. (Item 40) 40. The device of claim 39, wherein the optical signal of the probe increases when the probe detects the biomarker. (Item 41) 40. The device of claim 39, wherein the optical signal of the probe decreases when the probe detects the biomarker. (Item 42) 40. The device of claim 39, wherein the biomarker is a polynucleotide and the probe is a polynucleotide complementary to the biomarker. (Item 43) 43. The device of claim 42, wherein the probes are different polynucleotide probes specific for different nucleotide polymorphisms of the same biomarker. (Item 44) 40. The device of claim 39, wherein the biomarker is a peptide or polypeptide and the probe is an antibody specific for the biomarker. (Item 45) 45. The device of item 44, wherein the probes are different antibodies specific for different epitopes of the same biomarker. (Item 46) 40. The device of item 39, comprising a plurality of probes specific for a plurality of different biomarkers, the plurality of probes being attached to the same or different microneedles. (Item 47) 40. The device of item 39, wherein at least two different probes are attached to the same microneedle. (Item 48) 40. The device of item 39, comprising at least two identical probes for specific biomarkers, the identical probes being attached to one or more microneedles. (Item 49) 40. The device of claim 39, wherein the microneedles are made from a polymer, metal, or ceramic. (Item 50) 50. The device of claim 49, wherein the microneedles comprise a polymer. (Item 51) 40. The device of claim 39, wherein the probe is attached to the microneedle via a linker. (Item 52) 52. The device of item 51, wherein the linker is a thiol / amino bifunctional linker. (Item 53) 52. The device of item 51, wherein the linker is a poly(ethylene glycol) linker. (Item 54) 40. The device of item 39, further comprising a compartment for amplifying and identifying the biomarkers captured by the probes in situ. (Item 55) (a) a device comprising a plurality of microneedles, the plurality of microneedles comprising at least one microneedle covalently or non-covalently attached to a first probe specific for a biomarker; (b) a set of reagents for polymerase chain reaction; Kit including: (Item 56) 56. The kit of item 55, wherein at least one microneedle is covalently or non-covalently attached to a second probe specific for a different biomarker. (Item 57) 56. The kit of item 55, further comprising a holder. (Item 58) 56. The kit of item 55, wherein the biomarker is a polynucleotide and the probe is a polynucleotide complementary to the biomarker. (Item 59) 59. The kit of item 58, wherein the probes are different polynucleotide probes specific for different nucleotide polymorphisms of the same biomarker. (Item 60) 56. The kit of item 55, wherein the set of reagents comprises a polymerase enzyme, a buffer, and a control sample. (Item 61) 56. The kit of item 55, further comprising instructions for its use. (Item 62) 56. The kit of item 55, comprising a plurality of probes specific for a plurality of different biomarkers, the plurality of probes being attached to the same or different microneedles. (Item 63) Item 63. The kit of item 62, wherein at least two different probes are attached to the same microneedle. (Item 64) 56. The kit of item 55, further comprising at least two identical probes for specific biomarkers, the identical probes attached to one or more microneedles. (Item 65) 56. The kit of item 55, wherein the microneedles are made of a polymer, metal, or ceramic. (Item 66) Item 66. The kit of item 65, wherein the microneedles comprise a polymer. (Item 67) 56. The kit of item 55, wherein the probe is attached to the microneedle via a linker. (Item 68) 68. The kit of item 67, wherein the linker is a thiol / amino bifunctional linker. (Item 69) 68. The kit of item 67, wherein the linker is a poly(ethylene glycol) linker. (Item 70) 56. The kit of item 55, further comprising a compartment for amplifying and identifying the biomarker captured by the probe in situ. (Item 71) 56. The kit of item 55, wherein the probe comprises a sensor that emits a visual signal when the probe detects the biomarker. (Item 72) 56. The kit of item 55, wherein the kit detects or extracts one or more biomarkers derived from a skin condition by contact with a biological sample. (Item 73) 56. The kit of item 55, wherein the kit detects or extracts one or more biomarkers derived from an ocular condition by contact with a biological sample. (Item 74) 56. The kit according to item 55, wherein the set of reagents is for reverse transcriptase polymerase chain reaction. (Item 75) 1. A method for detecting one or more biomarkers from tissue or a biological sample in situ in a subject, the method comprising: (a) contacting a microneedle with the tissue or biological sample of the subject, the microneedle having attached thereto a set of probes, the probes binding to the one or more biomarkers in situ; and (b) detecting the one or more biomarkers bound to the probes. (Item 76) 76. The method of claim 75, wherein the one or more biomarkers are polynucleotides and the probes are polynucleotides complementary to the biomarkers. (Item 77) 77. The method of claim 76, wherein the probes are different polynucleotide probes specific for different nucleotide polymorphisms of the same biomarker. (Item 78) 76. The method of claim 75, wherein the one or more biomarkers are peptides or polypeptides and the probe is an antibody specific for the biomarker. (Item 79) 79. The method of claim 78, wherein the probes are different antibodies specific for different epitopes of the same biomarker. (Item 80) 76. The method of claim 75, comprising a plurality of probes specific for a plurality of different biomarkers, the plurality of probes being attached to the same or different microneedles. (Item 81) 81. The method of claim 80, wherein at least two different probes are attached to the same microneedle. (Item 82) 76. The method of claim 75, comprising at least two identical probes for specific biomarkers, the identical probes being attached to one or more microneedles. (Item 83) Item 76. The method of item 75, wherein the microneedles comprise a polymer, metal, or ceramic. (Item 84) Item 84. The method of item 83, wherein the microneedles comprise a polymer. (Item 85) Item 76. The method of item 75, wherein the probe is attached to the microneedle via a linker. (Item 86) Item 87. The method of item 85, wherein the linker is a thiol / amino bifunctional linker. 86. The method of claim 85, wherein the linker is a poly(ethylene glycol) linker. (Item 88) 76. The method of claim 75, wherein said detecting comprises contacting said one or more biomarkers with a detectable label. (Item 89) 89. The method of claim 88, wherein the detectable label is a fluorophore. (Item 90) 76. The method of claim 75, wherein said detecting comprises amplifying said biomarker. (Item 91) 76. The method of claim 75, wherein the biomarker bound to the probe on the microneedle is detected by polymerase chain reaction. (Item 92) 76. The method of claim 75, wherein the biomarker bound to the probe on the microneedle is detected by a polynucleotide-tagged secondary antibody and PCR amplification of the polynucleotide tag. (Item 93) 76. The method of claim 75, wherein the biomarker is a small molecule or a metabolite and the probe is a ligand specific for the biomarker. (Item 94) 1. A method for detecting one or more biomarkers from tissue or a biological sample in situ in a subject, the method comprising: (a) contacting a microneedle device with the tissue or biological sample of the subject, the microneedle device comprising one or more probes specific to the one or more biomarkers, at least one probe comprising a sensor that emits a visual signal when the probe detects the biomarker; and (b) detecting the biomarkers based on the visual signal. (Item 95) 95. The method of claim 94, wherein the one or more biomarkers are polynucleotides and the probes are polynucleotides complementary to the biomarkers. (Item 96) 96. The method of claim 95, wherein the probes are different polynucleotide probes specific for different nucleotide polymorphisms of the same biomarker. (Item 97) 95. The method of claim 94, wherein the one or more biomarkers are peptides or polypeptides and the probe is an antibody specific for the biomarker. (Item 98) 97. The method of claim 96, wherein the probes are different antibodies specific for different epitopes of the same biomarker. (Item 99) 95. The method of claim 94, comprising a plurality of probes specific for a plurality of different biomarkers, the plurality of probes being attached to the same or different microneedles. (Item 100) 99. The method of claim 99, wherein at least two different probes are attached to the same microneedle. (Item 101) 95. The method of claim 94, further comprising at least two identical probes for specific biomarkers, the identical probes being attached to one or more microneedles. (Item 102) Item 95. The method of item 94, wherein the microneedles are made of a polymer, metal, or ceramic. (Item 103) Item 103. The method of item 102, wherein the microneedles comprise a polymer. (Item 104) Item 95. The method of item 94, wherein the probe is attached to the microneedle via a linker. (Item 105) 105. The method of claim 104, wherein the linker is a thiol / amino bifunctional linker. (Item 106) Item 105. The method of item 104, wherein the linker is a poly(ethylene glycol) linker. (Item 107) 95. The method of claim 94, further comprising a system for amplifying and identifying the biomarkers captured by the probe in situ. (Item 108) 95. The method of claim 94, wherein said detecting comprises contacting said one or more biomarkers with a detectable label. (Item 109) 109. The method of claim 108, wherein the detectable label is a fluorophore. (Item 110) 95. The method of claim 94, wherein said detecting comprises amplifying said biomarker. (Item 111) Item 95. The method of item 94, wherein the biomarker bound to the probe on the microneedle is detected by polymerase chain reaction. (Item 112) 95. The method of claim 94, wherein the biomarker bound to the probe on the microneedle is detected by a polynucleotide-tagged secondary antibody and PCR amplification of the polynucleotide tag. (Item 113) 95. The method of claim 94, wherein the biomarker is a small molecule or a metabolite and the probe is a ligand specific for the biomarker. (Item 114) 95. The method of item 94, wherein the one or more biomarkers are associated with a skin condition. (Item 115) Item 116. The method of item 94, wherein the one or more biomarkers are associated with an ocular condition. Item 95. The method of item 94, wherein the microneedles are etched to increase the surface area of ​​the microneedles. (Item 117) A composition comprising a plurality of microneedles coated with an agent capable of disrupting the extracellular matrix. (Item 118) 118. The composition of claim 117, wherein the agent is an enzyme. (Item 119) Item 118. The composition of item 117, wherein the enzyme is selected from the group consisting of serine proteases, thiol proteases, MMPs, papain, hyaluronidase, streptokinase, streptodornase, trypsin, chymotrypsin, alpha-chymotrypsin, alpha-amylase, DNase, collagenase, and styrein. (Item 120) 118. The composition of claim 117, wherein the enzyme is hyaluronidase. (Item 121) A method for detecting one or more biomarkers in tissue of a subject, the method comprising: (a) contacting a microneedle with the tissue of the subject in situ, the tissue comprising an extracellular matrix, the microneedle being covalently attached to a set of probes, the probes binding to the biomarkers in situ; and (b) disrupting the extracellular matrix. (Item 122) Item 122. The method of item 121, wherein the extracellular matrix is ​​destroyed by enzymatic activity. (Item 123) Item 122. The method of item 121, wherein disrupting the extracellular matrix comprises applying ultrasonic energy to the extracellular matrix. (Item 124) Item 122. The method of item 121, wherein the extracellular matrix is ​​disrupted by an electric potential. (Item 125) A method for detecting one or more biomarkers from tissue in situ in a subject, the method comprising: (a) contacting a microneedle with the tissue, the tissue comprising a cell membrane, the microneedle having attached thereto a set of probes, the probes binding to the biomarkers in situ; and (b) disrupting the cell membrane. (Item 126) 126. The method of claim 125, wherein the cell membrane is disrupted by enzymatic activity. (Item 127) 126. The method of claim 125, wherein disrupting the cell membrane comprises applying ultrasonic energy to the cell membrane. (Item 128) 126. The method of claim 125, wherein the cell membrane is disrupted by an electric potential. (Item 129) 1. A method of preparing a microneedle device, comprising: (a) obtaining a solution containing an inorganic salt; (b) adding probes and microneedles to the solution; (c) conjugating the probe to the microneedle in the solution; A method comprising: (Item 130) Item 129. The method of item 129, wherein the inorganic salt is sodium chloride. (Item 131) Item 129. The method of item 129, wherein the concentration of the inorganic salt is less than 2.5M. (Item 132) A method for detecting one or more biomarkers in a subject, the method comprising contacting a microneedle device with the skin or eye tissue of the subject. (Item 133) 133. The method of claim 132, wherein the one or more biomarkers are related to a skin or eye condition. (Item 134) 133. The method of claim 132, wherein the biomarker is a polynucleotide. (Item 135) 133. The method of claim 132, wherein the biomarker is present in the blood of the subject. (Item 136) A method for detecting one or more biomarkers in a subject, the method comprising contacting a microneedle device with skin capillaries of the subject. (Item 137) Item 137. The method of item 136, further comprising contacting the microneedle device with a blood sample of the subject. (Item 138) A method for detecting one or more polynucleotide biomarkers from tissue in situ in a subject, the method comprising contacting a microneedle device with the tissue of the subject during an intraoperative procedure. (Item 139) 139. The method of claim 138, wherein the tissue is from an organ selected from the group consisting of brain, heart, breast, liver, pancreas, spleen, bladder, stomach, lung, uterus, cervix, prostate, kidney, intestine, appendix, thyroid, and colon. (Item 140) Item 139. The method of item 138, wherein the tissue of the subject comprises benign tissue. (Item 141) Item 139. The method of item 138, wherein the tissue of the subject comprises tissue suspected of being malignant. (Item 142) Item 139. The method of item 138, wherein the microneedle device contacts malignant tissue and benign tissue adjacent to the malignant tissue. (Item 143) Item 139. The method of item 138, wherein the microneedle device contacts benign tissue adjacent to malignant tissue. (Item 144) Item 139. The method of item 138, wherein the microneedle device contacts the tumor. (Item 145) 139. The method of claim 138, further comprising determining the surgical margins of the tumor. (Item 146) 139. The method of paragraph 75, 94, 121, 125, 129, 132, 136, or 138, further comprising detecting one or more biomarkers from a reference tissue obtained from the subject. (Item 147) 15. The device of claim 14, wherein the polymer is a thermoplastic polymer. (Item 148) Item 15. The device of item 14, wherein the thermoplastic polymer is selected from the group consisting of polycarbonate, poly(methyl methacrylate), polyethylene, and polypropylene.

[0037] Incorporation by Reference All publications and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0038] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present invention will be obtained by reference to the following detailed description and the accompanying drawings (also referred to as "Figures" or "FIGs") that set forth illustrative embodiments, in which the principles of the invention are utilized. [Brief explanation of the drawings]

[0039] [Figure 1] FIG. 1 illustrates a scheme for chemically modifying a polycarbonate surface and attaching thiol-modified DNA probes.

[0040] [Figure 2] Figure 2 illustrates a polymer surface modified with DNA bearing a 5'-Cy5 modification, imaged with a confocal microscope using a near-infrared filter. The area within the left part of the image was modified.

[0041] [Figure 3] Figure 3 illustrates a stainless steel surface modified with DNA containing fluorescent dUTP bases. Panel A: Fluorescence image of the DNA on the stainless steel surface. Panel B: Bright field image showing the surface of the stainless steel sample.

[0042] [Figure 4] FIG. 4 is a schematic diagram of the surface of a device of the present disclosure with multiple microneedles.

[0043] [Figure 5] FIG. 5 illustrates the process by which DNA probes coupled to a gold surface hybridize to biomarkers.

[0044] [Figure 6] FIG. 6 illustrates a method of administering treatment with a device of the present disclosure.

[0045] [Figure 7] FIG. 7 demonstrates the enhanced binding of oligonucleotides to the metal microneedle array surface when NaCl is added to the coupling procedure.

[0046] [Figure 8] FIG. 8 displays qRT-PCR data from assays of homogenized human skin samples using the methods of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0047] Detailed Description While various embodiments of the present invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are presented by way of example only. Numerous modifications, changes, and substitutions will occur to those skilled in the art without departing from the invention. It will be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention.

[0048] The present invention provides devices and methods for detecting and collecting biomarkers, particularly molecular biomarkers, from within a subject's body. In some embodiments, the present invention fabricates microneedle array-based devices with single or multiple microneedles. The length of individual microneedles on the array can vary, for example, from 50 μm to 5 mm. The devices can be fabricated from different materials, composites, and combinations of materials, including, but not limited to, metals and alloys, inorganic ceramics, and polymers. The microneedles are chemically modified to couple probes for biomarkers to the microneedle surface. The specific coupling chemistry depends on the microneedle material. Different biomarkers can be detected by cognate probes immobilized on the same array or microneedle. By way of example, the device can be applied to a patient's anatomical location, such as the skin, eye, tumor, or other tissue, to allow the desired biomarkers to bind to the displayed probes. Application can be by hand (e.g., thumb pressure) or by an applicator device with or without a strap or band to hold it in place for the duration of sampling. Physical insertion of a microneedle probe can disrupt the cell membrane, releasing genetic material containing biomarkers that can bind to the probe on the inserted microneedle. Extracellular biomarkers can directly bind to the probe and do not need to be sampled from material released from the disrupted cells.

[0049] The time required for biomarker binding to the microneedles will depend on several parameters, including, but not limited to, the total amount, biodistribution, and concentration of the biomarker, the tissue organization, and the physical and chemical dimensions of the microneedle probes (e.g., surface area, number of probes, number of binding sites). Application times can range, for example, from less than 10 seconds to 60 minutes. Once the microneedle array is removed from the tissue, the biomarkers can be assayed using several different techniques, including, but not limited to, PCR, quantitative PCR, protein PCR, sandwich ELISA, elution mass spectrometry, elution Western blot, and elution ELISA. Biomarkers can be assayed after separation from the microneedles or directly on the microneedles.

[0050] As will be illustrated in detail in the Examples, various chemical reactions can be used to conjugate probes to microneedles, depending on the microneedles and probes to be coupled. Chemical modification of microneedles made from polymers to covalently attach biomolecules can be carried out using a number of linkages developed in the art. For example, in microneedles with polycarbonate surfaces, carbonate monomers contain aromatic moieties that can be chemically derivatized after polymerization. Treating the needles with nitric acid and then reducing the resulting nitro groups results in amine handles that can couple molecules to the polymer backbone. Importantly, this two-step reaction can be carried out on the fabricated microneedle array without damaging the integrity of the array or individual microneedles. Using this procedure, standard amide bond coupling reagents can be used to link carboxylic acid-containing probes to the microneedle surface.

[0051] When microneedles are fabricated from metal, the same principles described for polymer surfaces can be applied to metal surfaces. For example, a stainless steel surface can be coated with gold through a sputter coating process, providing a chemical handle for attachment. Taking advantage of the well-characterized affinity of thiols for gold surfaces, a bivalent crosslinker can then be attached to the metal surface with a thiol at one end and an amine at the other, allowing for the same chemical coupling reaction of probe molecules to the microneedle surface. Methods suitable for chemically modifying other types of microneedle surfaces (e.g., inorganic ceramics) to covalently link biomolecules are also known in the art.

[0052] The inventions described herein have broad applicability in many different aspects of diagnostics, including genetic (e.g., mRNA, DNA) biomarkers, protein biomarkers, hormone biomarkers, small molecule biomarkers, and cellular biomarkers for diagnosis and disease prognosis. For example, the devices or methods described herein may be useful in detecting skin-based biomarkers, detecting systemic circulating biomarkers, detecting pathogens (e.g., bacteria, viruses, or parasites), or determining tumor margins during surgical tumor removal. As described herein, specific examples of skin-based diagnostic applications of the invention include the detection of biomarkers for cutaneous malignant melanoma, non-melanocytic skin cancers (e.g., basal cell carcinoma, squamous cell carcinoma), autoimmune disorders (e.g., psoriasis), infectious diseases, and topical diseases (e.g., Buruli ulcer, onchocerciasis). Specific examples of non-skin-based diagnostic applications of the invention include the detection of markers for neoplastic diseases, hematological diseases, cardiovascular diseases, Down's syndrome, and real-time, rapid biomarker detection during clinical trials.

[0053] The following sections provide more detailed guidance for practicing the present invention.

[0054] definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The following references provide those skilled in the art with general definitions for many of the terms used in this invention: Academic Press Dictionary of Science and Technology, Morris (Ed.), Academic Press (1st ed., 1992); Oxford Dictionary of Biochemistry and Molecular Biology, Smith et al. al. (Eds.), Oxford University Press (revised edition, 2000); Encyclopaedic Dictionary of Chemistry, Kumar (Ed.), Anmol Publications Pvt. Ltd. (2002); Dictionary of Microbiology and Molecular Biology, Singleton et al. (Eds.), John Wiley & Sons (3rd edition, 2002); Dictionary of Chemistry, Hunt (Ed.), Routledge (1st edition, 1999); Dictionary of Pharmaceutical Medicine, Nahler (Ed.), Springer-Verlag Telos (1994); Dictionary of Organic Chemistry, Kumar and Anandand (Eds.), Anmol Publications Pvt. Ltd. (2002); and A Dictionary of Biology (Oxford Paperback Reference), Martin and Hine (Eds.), Oxford University Press (4th ed., 2000). In addition, the following definitions are provided to assist the reader in the practice of the present invention.

[0055] A biomarker broadly refers to any characteristic that can be objectively measured and assessed as an indicator of normal biological processes, pathogenic processes, or pharmacological responses to therapeutic intervention. Unless otherwise specified, the term "biomarker" as used herein specifically refers to a biomarker that has biophysical properties that allow its measurement in a biological sample (e.g., plasma, serum, cerebrospinal fluid, bronchoalveolar lavage fluid, biopsy). Unless otherwise specified, the term "biomarker" is used interchangeably with "molecular biomarker" or "molecular marker." Examples of biomarkers include nucleic acid biomarkers (e.g., oligonucleotides or polynucleotides), peptide or protein biomarkers, lipid markers, and lipopolysaccharide markers.

[0056] As used herein, a "microneedle device or microneedle array (microarray)" refers to a device containing at least one small piercing element or microneedle having a diagnostic agent or compound immobilized thereon. Upon contact, the microneedle is capable of piercing a biological barrier in a human or other mammalian subject (e.g., the stratum corneum of the skin). Preferably, the device contains a plurality of such microneedles, for example, 2, 5, 10, 25, 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 2000, 5000, 10,000, 20,000, or more microneedles. By conjugating a diagnostic probe to the microneedle, the microneedle device of the present invention provides a means for in situ detection of a biomarker in a subject's tissue or biological sample (e.g., in the bloodstream or skin).

[0057] As used herein, the terms "polynucleotide" or "nucleic acid" refer to a polymeric form of nucleotides of any length, whether ribonucleotides or deoxyribonucleotides, containing purine and pyrimidine bases or other naturally occurring, chemically or biochemically modified, non-naturally occurring, or derivatized nucleotide bases. Polynucleotides of embodiments of the present invention include sequences of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or DNA copies of ribonucleic acid (cDNA), all of which can be isolated from natural sources, produced recombinantly, or artificially synthesized. A further example of a polynucleotide is a polyamide polynucleotide (PNA). Polynucleotides and nucleic acids can exist as single-stranded or double-stranded. The backbone of a polynucleotide can contain sugars and phosphate groups typically found in RNA or DNA, or can contain modified or substituted sugars or phosphate groups. A polynucleotide can contain modified nucleotides, such as methylated nucleotides and nucleotide analogs. The sequence of nucleotides can be interrupted by non-nucleotide components. Polymers made from nucleotides, such as nucleic acids and polynucleotides, may also be referred to herein as nucleotide polymers.

[0058] The term "oligonucleotide" is defined as a molecule containing two or more deoxyribonucleotides, preferably more than three. Its exact size will depend on many factors, many of which will depend on the ultimate function and use of the oligonucleotide. As used herein, the term "primer" refers to an oligonucleotide, whether naturally occurring in a purified restriction digest or produced synthetically, that is capable of initiating the synthesis of a primer extension product complementary to a nucleic acid strand when placed under appropriate temperature and pH conditions in the presence of nucleotides and an inducing agent, such as DNA polymerase. A primer may be single- or double-stranded and must be sufficiently long to prime the synthesis of the desired extension product in the presence of the inducing agent. The exact length of the primer will depend on many factors, including temperature, source of primer, and the method used. For example, in diagnostic applications, depending on the complexity of the target sequence, oligonucleotide primers typically contain 15 to 25 nucleotides or more, although fewer nucleotides may be used. Those of skill in the art will readily recognize the factors involved in determining appropriate primer length.

[0059] A polypeptide is a polymeric chain comprising amino acid residue monomers attached together by amide bonds (peptide bonds). Amino acids may be either the L- or D-optical isomers. Generally, a polypeptide refers to a long-chain polymer of amino acid residues, e.g., at least 10, 20, 50, 100, 200, 500, or more amino acid residue monomers. A polypeptide can be a chain of at least two amino acids, a peptidomimetic, a protein, a recombinant protein, an antibody (monoclonal or polyclonal), an antibody fragment, an antigen, an epitope, an enzyme, a receptor, a vitamin, or a structural analog, or a combination thereof. However, unless otherwise noted, the term "polypeptide" as used herein also encompasses short-chain peptides, which typically contain two or more amino acid monomers, but usually no more than 10, 15, or 20 amino acid monomers.

[0060] A protein is a long polymer of amino acids linked through peptide bonds and can consist of two or more polypeptide chains. More specifically, the term "protein" refers to a molecule consisting of one or more chains of amino acids in a specific order, e.g., determined by the base sequence of nucleotides in a gene encoding the protein. Proteins are essential for the structure, function, and regulation of cells, tissues, and organs in the body, and each protein has a unique function. Examples are hormones, enzymes, and antibodies. In some embodiments, the terms polypeptide and protein can be used interchangeably.

[0061] As used herein, a "biological sample" refers to a sample of biological tissue or chemical fluid suspected of containing a biomarker or analyte of interest. A sample can be an ex vivo or in vivo sample. Samples include, for example, bodily fluids such as whole blood, serum, plasma, cerebrospinal fluid, urine, lymph, and various exocrine secretions of the respiratory, intestinal, and genitourinary tracts, such as tears, saliva, semen, and breast milk; as well as other biological fluids, such as cell culture suspensions, cell extracts, and cell culture supernatants. Samples can also include tissue biopsies, for example, from the lung, liver, brain, eye, tongue, colon, kidney, muscle, heart, breast, skin, pancreas, uterus, cervix, prostate, salivary gland, and the like. A sample can also be a microbiopsy, a small sample, or even a single cell extracted from a patient and subsequently processed, for example, using laser capture microdissection. A sample can be suspended or dissolved, for example, in a buffer, extractant, solvent, or the like.

[0062] As used herein, "tissue" refers to a collection of similar cells and the intracellular material that surrounds them. There are four basic tissues in the body: 1) epithelium; 2) connective tissue, including blood, bone, and cartilage; 3) muscle tissue; and 4) nervous tissue.

[0063] Ranges may be expressed herein as from "about" one particular value and / or to "about" another particular value. When such a range is expressed, another embodiment includes the range from the one particular value and / or to the other particular value. Similarly, when values ​​are expressed as approximations, by use of the antecedent "about," it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint and independently of the other endpoint. In the context of a particular usage, the term "about" as used herein refers to a range of ±15% from the stated numerical value. For example, about 10 would include a range of 8.5 to 11.5.

[0064] Covalent bonds are chemical bonds that involve the sharing of electron pairs between atoms. Covalent bonds include many types of interactions, including σ bonds, π bonds, metal-metal bonds, agostic interactions, and three-center, two-electron bonds. Noncovalent interactions differ from covalent bonds in that they do not involve the sharing of electrons. Noncovalent bonds can generally be classified into four categories: electrostatic bonds, π effects, van der Waals forces, and hydrophobic effects.

[0065] Biomarkers The devices or methods described herein can be employed in a variety of diagnostic applications to detect and capture specific biomarkers. Biomarkers can be used in clinical practice to identify disease risk or diagnose disease, stratify patients, assess disease severity or progression, predict prognosis, and guide treatment. In drug development, biomarkers can be used to help determine how drugs work in the body, determine the bioeffective dose of drugs, evaluate whether drugs are safe or effective, and identify patients who are most likely to respond to treatment or least likely to suffer adverse events when treated with a drug. Biomarkers can also be used in some cases as part of the approval process for drugs or treatments to inform regulatory agency decision-making.

[0066] In some cases, employing the microneedle array device described herein and routinely practiced amplification techniques (e.g., genomics or proteomics techniques), the methods and devices of the present invention can detect a variety of biomarkers in a subject. In some cases, a microneedle array device can be used to capture a biomarker or set of biomarkers, and then one or more additional tagged probes can be used to detect the captured biomarkers, thereby detecting a variety of biomarkers from the subject.

[0067] Biomarkers that can be detected by the present disclosure include nucleic acid-based biomarkers (DNA, RNA, mRNA transcripts, genomic DNA, tRNA, siRNA, miRNA, mitochondrial DNA, mitochondrial RNA, exosomal nucleic acids, cell-free DNA or cell-free RNA, polynucleotides carrying mutated genes and polymorphisms), peptides, proteins, lipids, lipid metabolites, and small molecules. Biomarkers include diagnostic biomarkers (e.g., cardiac troponin for diagnosing myocardial infarction), disease biomarker staging (e.g., brain natriuretic peptide for congestive heart failure), disease prognostic biomarkers (cancer biomarkers), and biomarkers for monitoring clinical responses to interventions (e.g., HbAlc for antidiabetic treatment). Biomarkers also include biomarkers used in decision-making in early drug development. For example, pharmacodynamic (PD) biomarkers are markers for certain pharmacological responses that are of particular interest in dose optimization studies. Examples of disease-indicating biomarkers include serum LDL for high cholesterol and hypertension, the P53 gene for cancer, and MMPs. Below are described further examples of specific nucleic acid and protein biomarkers suitable for detection by the methods and devices of the present invention.

[0068] Some preferred embodiments of the present invention are directed to the detection and amplification of nucleic acid biomarkers. Many nucleic acid biomarkers are known in the art. Examples include telomerase reverse transcriptase mRNA as a diagnostic biomarker for hepatocellular carcinoma (Miura et al., Clin. Cancer Res., 11:3205-9, 2005), plasma hnRNP B1 mRNA as a biomarker for lung cancer (Sato et al., J. Cancer Res. Clin. Oncol., 134:1191-7, 2008), GD2 / GM2 synthase mRNA as a biomarker for small cell lung cancer (Chen et al., Lung Cancer., 67:216-20, 2010), serum transforming growth factor-alpha mRNA as a prognostic biomarker for fulminant hepatitis (Miura et al., Hepatol Int., 2:213-21, 2008), plakophilin 3 mRNA for gastrointestinal cancers (Valladares-Ayerbes et al., Cancer Epidemiol Biomarkers, 2008). Prev., 19:1432-1440, 2010), metallothionein as a biomarker for heavy metal exposure (Yamada et al., Industrial Health, 39:29-32, 2001), WT1 mRNA as a biomarker for monitoring minimal residual disease in acute myeloid leukemia (Sakamoto et al., Tohoku J Exp Med., 219:169-76, 2009), and granzyme A mRNA as a biomarker for renal transplant rejection (van Ham et al., Kidney Int'l., August 18, 2010). These biomarkers, as well as a variety of other nucleic acid biomarkers known in the art, are all suitable for detection by the methods and devices of the present invention. The polynucleotide sequences of these known biomarkers have been previously described and characterized in the art. Based on their known sequences, specific probes (eg, oligonucleotide primers) for detecting these biomarkers can be easily designed and synthesized by molecular biology methods.See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY, (3rd ed., 2000); and Brent et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (spiral-bound edition, 2003).

[0069] In some other embodiments, the devices and methods of the present invention detect peptide or protein biomarkers. The methods and devices described herein are useful for detecting a wide variety of peptide or protein biomarkers characterized in the art. Specific examples of peptide or protein biomarkers suitable for the present invention include PSA as a biomarker for prostate cancer (Polascik et al., J. Urol., 162:293-306, 1999), cancer antigen 125 (CA125) as a biomarker for ovarian cancer (Jacobs et al., Lancet, 353:1207-1210, 1999), BC1, BC2, and BC3 as serum biomarkers for detecting breast cancer (Mathelin et al., Breast Cancer Res. Treat., 96:83-90, 2006), beta-defensin-2 protein as a serum biomarker for psoriasis (Patrick et al., PLoS ONE, 4:e4725, 2009), and C-reactive protein as a biomarker for metastasis of renal cell carcinoma (Johnson et al., Mol. Diagn. Ther., 14:191-3, 2010), high molecular weight melanoma-associated antigen as a biomarker for desmoplastic melanoma (Goto et al., Pigment Cell Melanoma Res., 23:137-140, 2010), telomerase expression as a biomarker for malignant transformation in patients with inflammatory bowel disease (Gonzalo et al., Gastroenterol Hepatol., 33:288-96, 2010), and insulin-like growth factor II mRNA-binding protein 3 (IMP3) as a prognostic biomarker for oral squamous cell carcinoma (Li et al., Head Neck., July 22, 2010).Probes (e.g., monoclonal antibodies) for detecting these biomarkers can be readily produced by standard immunological techniques (e.g., hybridoma technology) or obtained from commercial suppliers (e.g., Abnova Corporation, Full Moon BioSystems, and Spring Bioscience).

[0070] Depending on the specific type of biomarker to be detected, the microneedle devices described herein can be combined with a variety of methods known in the art for amplifying and characterizing molecular entities. Many genomics and proteomic methods are suitable for use in the devices and methods of the present invention to detect and analyze protein and nucleic acid markers. For example, PCR can be used to amplify and characterize nucleic acid molecules bound to probes on the microneedles. ELISA can be used to analyze peptide or protein markers captured by the microneedle-based devices of the present invention. In addition to biomarker assay methods using genomics and proteomic platforms, metabolomics, lipidomics, and glycomics methods can also be used to identify and detect biomarkers from other chemical classes. For example, mass spectrometry, chromatography, and nuclear magnetic resonance are useful for detecting and characterizing various biomolecules bound to microneedles.

[0071] Microneedles for attaching diagnostic probes The present invention provides microneedle devices with covalently attached molecular probes for in situ detection and collection of biomarkers from a subject. The micro-based devices contain one or more microneedles that can be inserted into a mammalian biological barrier, such as the skin or mucosa. The microneedles are often non-invasive or minimally invasive. When multiple microneedles are present, the device may also have a planar substrate that supports the microneedles. The substrate can be made from the same material as the microneedles. The substrate can also be made from a different material. The microneedles employed in the present invention typically have lengths (heights) ranging from 20 μm to 1 mm, preferably from 50 μm to 500 μm. Figure 4 is a schematic diagram of the surface of a device of the present invention containing multiple microneedles. Each "square" in 401 illustrates an individual microneedle. 401 illustrates a plurality of microneedles on the surface of a device of the present invention, with the height of the needles ranging from about 400 μm to about 1000 μm. In some embodiments, the height of the needles ranges from about 20 μm to about 50 μm, from about 20 μm to about 100 μm, from about 20 μm to about 150 μm, from about 20 μm to about 200 μm, from about 20 μm to about 250 μm, from about 20 μm to about 300 μm, from about 20 μm to about 350 μm, from about 20 μm to about 400 μm, from about 20 μm to about 450 μm, or from about 20 μm to about 500 μm. to about 500 μm, about 20 μm to about 550 μm, about 20 μm to about 600 μm, about 20 μm to about 650 μm, about 20 μm to about 700 μm, about 20 μm to about 750 μm, about 20 μm to about 800 μm, about 20 μm to about 850 μm, about 20 μm to about 900 μm, about 20 μm to about 950 μm, or about 20 μm to about 1 mm.In some cases, the height of the microneedles is less than 1 μm, less than 5 μm, less than 10 μm, less than 15 μm, less than 20 μm, less than 25 μm, less than 30 μm, less than 35 μm, less than 40 μm, less than 45 μm, less than 50 μm, less than 75 μm, less than 100 μm, less than 150 μm, less than 200 μm, less than 250 μm, less than 300 μm, less than 500 μm, less than 750 μm, less than 1000 μm, less than 2000 μm, less than 3000 μm, less than 4000 μm, less than 5000 μm, less than 7500 μm, or less than 10000 μm. In some cases, the height of the microneedles is greater than 1 μm, greater than 5 μm, greater than 10 μm, greater than 15 μm, greater than 20 μm, greater than 25 μm, greater than 30 μm, greater than 35 μm, greater than 40 μm, greater than 45 μm, greater than 50 μm, greater than 75 μm, greater than 100 μm, greater than 150 μm, greater than 200 μm, greater than 250 μm, greater than 300 μm, greater than 500 μm, greater than 750 μm, greater than 1000 μm, greater than 2000 μm, greater than 3000 μm, greater than 4000 μm, greater than 5000 μm, greater than 7500 μm, or greater than 10000 μm.

[0072] Needle-shaped microneedles can be blunt-tipped objects, but are preferably sharp-tipped objects. In some embodiments, the microneedles have a conical structure with a base diameter generally in the range of 10 μm to 500 μm, preferably in the range of 20 μm to 200 μm. 401 illustrates the surface of a device of the present invention with multiple microneedles, each with a base diameter less than 10 mm wide. In devices containing multiple microneedles, the microneedles can be present in rows on the device. In some embodiments, the rows can be spaced substantially evenly with respect to the spacing between aligned needles. In some embodiments, the rows can also be spaced irregularly.

[0073] Microneedles can have multiple shapes; for example, they can be circular, conical, triangular, square, rectangular, pentagonal, hexagonal, heptagonal, octagonal, or any other suitable shape. Microneedles can be sharp, blunt, or any combination thereof. For example, a device of the present invention comprising multiple sharp microneedles can be used to penetrate the skin of a subject, thereby contacting probes on the microneedles with, for example, RNA biomarkers. Sharp microneedles can be used to disrupt tissue in a biological sample, such as a layer of cells or the outer membrane of a cell. Blunt microneedles can be used to contact the surface of the skin of a subject, thereby contacting the microneedles with, for example, cell surface biomarkers on the skin. In some cases, the present disclosure provides microneedle devices comprising microneedles of different shapes (e.g., sharp and blunt microneedles).

[0074] In some embodiments, the device of the present invention comprises at least 1 microneedle, at least 100 microneedles, at least 200 microneedles, at least 300 microneedles, at least 400 microneedles, at least 500 microneedles, at least 600 microneedles, at least 700 microneedles, at least 800 microneedles, at least 900 microneedles, at least 1000 microneedles, at least 1100 microneedles, at least 1200 microneedles, at least 1300 microneedles, at least 1400 microneedles, at least 1500 microneedles, at least 1600 microneedles, at least 1700 microneedles, at least 1800 microneedles, at least 1900 microneedles, at least 2000 microneedles, at least 2100 microneedles, at least 2200 microneedles, at least 2300 microneedles, at least 2400 microneedles, at least 2500 microneedles, at least 2600 microneedles, at least 2700 microneedles, at least 2800 microneedles, at least 2900 microneedles, at least 3000 microneedles, at least 3100 microneedles, at least 3200 microneedles, at least 3300 microneedles, at least 3400 microneedles, at least 3500 microneedles, at least 3600 microneedles microneedles, at least 3700 microneedles, at least 3800 microneedles, at least 3900 microneedles, at least 4000 microneedles, at least 4100 microneedles, at least 4200 microneedles, at least 4300 microneedles, at least 4400 microneedles, at least 4500 microneedles, at least 4600 microneedles, at least 4700 microneedles, at least 4800 microneedles,At least 4900 microneedles, or at least 5000 microneedles.

[0075] In some embodiments, the device of the invention comprises up to 10,000 microneedles, up to 5,000 microneedles, up to 2,500 microneedles, up to 2,000 microneedles, up to 1,000 microneedles, up to 500 microneedles, up to 400 microneedles, up to 300 microneedles, up to 100 microneedles, up to 90 microneedles, up to 50 microneedles, up to 40 microneedles, up to 30 microneedles, up to 20 microneedles, up to 15 microneedles, up to 10 microneedles, up to 9 microneedles, up to 8 microneedles, up to 7 microneedles, up to 6 microneedles, up to 5 microneedles, up to 4 microneedles, up to 3 microneedles, up to 2 microneedles, or 1 microneedle.

[0076] In some embodiments, the device of the present invention comprises from about 1 microneedle to about 100 microneedles, from about 1 microneedle to about 200 microneedles, from about 1 microneedle to about 300 microneedles, from about 1 microneedle to about 400 microneedles, from about 1 microneedle to about 500 microneedles, from about 1 microneedle to about 600 microneedles, from about 1 microneedle to about 700 microneedles, from about 1 microneedle to about 800 microneedles, from about 1 microneedle to about 900 microneedles, from about 1 microneedle to about 1000 microneedles, from about 1 microneedle to about 1100 microneedles, from about 1 microneedle to about 1200 microneedles, from about 1 microneedle to about 1300 microneedles, from about 1 microneedle to about 1400 microneedles, from about 1 microneedle to about 1500 microneedles, from about 1 microneedle to about 1600 microneedles, from about 1 microneedle to about 1700 microneedles, from about 1 microneedle to about 1800 microneedles, from about 1 microneedle to about 1900 microneedles, from about 1 microneedle to about 2000 microneedles, from about 1 microneedle to about 2100 microneedles, from about 1 microneedle to about 2200 microneedles, from about 1 microneedle to about 2300 microneedles, from about 1 microneedle to about 2400 microneedles, from about 1 microneedle to about 2500 microneedles, from about 1 microneedle to ~ about 900 microneedles, about 1 microneedle to about 1000 microneedles, about 1 microneedle to about 1100 microneedles, about 1 microneedle to about 1200 microneedles, about 1 microneedle to about 1300 microneedles, about 1 microneedle to about 1400 microneedles, about 1 microneedle to about 1500 microneedles, about 1 microneedle to about 1600 microneedles, about 1 microneedle to about 1700 microneedles , about 1 microneedle to about 1800 microneedles, about 1 microneedle to about 1900 microneedles, about 1 microneedle to about 2000 microneedles, about 1 microneedle to about 2100 microneedles, about 1 microneedle to about 2200 microneedles, about 1 microneedle to about 2300 microneedles, about 1 microneedle to about 2400 microneedles, about 1 microneedle to about 2500 microneedles, about 1 microneedle to about 2600 microneedles, approximately 1 microneedle to approximately 2700 microneedles, approximately 1 microneedle to approximately 2800 microneedles, approximately 1 microneedle to approximately 2900 microneedles, approximately 1 microneedle to approximately 3000 microneedles, approximately 1 microneedle to approximately 3100 microneedles, approximately 1 microneedle to approximately 3200 microneedles, approximately 1 microneedle to approximately 3300 microneedles, approximately 1 microneedle to approximately 3400 microneedles,Approximately 1 microneedle to approximately 3500 microneedles, approximately 1 microneedle to approximately 3600 microneedles, approximately 1 microneedle to approximately 3700 microneedles, approximately 1 microneedle to approximately 3800 microneedles, approximately 1 microneedle to approximately 3900 microneedles, approximately 1 microneedle to approximately 4000 microneedles, approximately 1 microneedle to approximately 4100 microneedles, approximately 1 microneedle to approximately 4200 microneedles, approximately 1 to about 4300 microneedles, about 1 microneedle to about 4400 microneedles, about 1 microneedle to about 4500 microneedles, about 1 microneedle to about 4600 microneedles, about 1 microneedle to about 4700 microneedles, about 1 microneedle to about 4800 microneedles, about 1 microneedle to about 4900 microneedles, or about 1 microneedle to about 5000 microneedles.

[0077] The substrate and microneedles of the array can be made from a variety of biodegradable or non-biodegradable materials. Examples of materials for the microneedles or substrate include poly(methyl methacrylate), silicon, silicon dioxide, ceramics, metals (such as stainless steel, titanium, nickel, molybdenum, chromium, and cobalt), and synthetic or natural resin materials. In some embodiments, biodegradable polymers such as polylactic acid, polyglycolide, polylactic acid-co-polyglycolide, pullulan, capronolactone, polyurethane, or polyanhydride are used. In other embodiments, non-degradable materials, such as polymers polycarbonate, polymethacrylic acid, ethylene vinyl acetate, polytetrafluoroethylene, polysulfone, or polyoxymethylene, are used to fabricate the microneedle array. In some embodiments, the materials used contain or are coated with polysaccharides such as hyaluronic acid, pullulan, dextran, dextrin, or chondroitin sulfate. In some cases, the microneedles are fabricated from a thermoplastic polymer.

[0078] The substrate and microneedles of the array can be made from a variety of thermoplastic polymers. Non-limiting examples of thermoplastic polymers include poly(methyl methacrylate) (PMMA), nylon, polyethylene, polypropylene, polystyrene, polyvinyl chloride, or acrylic polymers such as Teflon. In some cases, the devices of the present invention are fabricated from a thermoplastic polymer selected from the group consisting of polycarbonate, poly(methyl methacrylate), polyethylene, and polypropylene.

[0079] Non-limiting examples of non-degradable polymers include hydrogels such as silicones, cross-linked poly(vinyl alcohol) and cross-linked poly(hydroxyethyl methacrylate), ethylene-vinyl acetate, acyl-substituted cellulose acetate and its alkyl derivatives, partially or fully hydrolyzed alkylene-vinyl acetate copolymers, unplasticized polyvinyl chloride, cross-linked homopolymers and copolymers of polyvinyl acetate, cross-linked polyesters of acrylic acid and / or methacrylic acid, polyvinyl alkyl ethers, polyvinyl fluoride, polycarbonate, polyurethane, polyamide, polysulfone, styrene-acrylonitrile copolymers, cross-linked poly(ethylene oxide), cross-linked poly(alkylene), cross-linked poly(vinylimidazole), cross-linked poly(ester), cross-linked poly(ethylene terephthalate), cross-linked polyphosphazene, and cross-linked chlorosulfonated polyolefins, and combinations thereof. In some embodiments, the polymer comprises ethylene vinyl acetate.

[0080] Non-limiting examples of biodegradable polymers include polyesters such as 3-hydroxypropionate, 3-hydroxybutyrate, 3-hydroxyvalerate, 3-hydroxycaproate, 3-hydroxyheptanoate, 3-hydroxyoctanoate, 3-hydroxynonanoate, 3-hydroxydecanoate, 3-hydroxyundecanoate, 3-hydroxydodecanoate, 4-hydroxybutyrate, and 5-hydroxyvalerate; polylactides or polylactic acids, including poly(d-lactic acid), poly(l-lactic acid), and poly(d,l-lactic acid); polyglycolic acid and polyglycolide; poly(lactic acid-co-glycolic acid); poly(lactide-co-glycolide); poly(ε-caprolactone); and polydioxanone. Polysaccharides, including starch, glycogen, cellulose, and chitin, can also be used as biodegradable materials.

[0081] 402 illustrates a surface of a device 401 of the present disclosure that includes a plurality of microneedles coupled to at least one type of probe. 402 can be coupled to, for example, polynucleotide probes, peptide probes, protein probes, or any combination thereof. The probes attached to the microneedles on device 402 can be covalently or non-covalently coupled to the microneedles. Examples 1 and 2 describe in more detail various methods for covalently coupling probes to surfaces.

[0082] The center-to-center distance between two microneedles on a device of the present disclosure can be calculated to determine the density of microneedles within the device. In some embodiments, the center-to-center distance between two microneedles can be less than 1000 μm, less than 900 μm, less than 800 μm, less than 700 μm, less than 600 μm, less than 500 μm, less than 400 μm, less than 300 μm, less than 200 μm, or less than 100 μm. In some embodiments, the center-to-center distance between two microneedles can be 100 μm or less, 200 μm or less, 300 μm or less, 400 μm or less, 500 μm or less, 600 μm or less, 700 μm or less, 800 μm or less, 900 μm or less, or 1000 μm or less.

[0083] The microneedles of the present disclosure may include a variety of different diameters or base widths. The base shape of the microneedle may be, for example, circular, rectangular, triangular, square, pentagonal, hexagonal, heptagonal, or other geometric shapes. The microneedles of the present disclosure may have a diameter or base width of 500 μm or less, 400 μm or less, 300 μm or less, 200 μm or less, 100 μm or less, 50 μm or less, 40 μm or less, 30 μm or less, 20 μm or less, 10 μm or less, 1000 nm or less, 900 nm or less, 800 nm or less, 700 nm or less, 600 nm or less, 500 nm or less, 400 nm or less, 300 nm or less, 200 nm or less, or 100 nm or less.

[0084] The probe can be covalently or non-covalently attached to the microneedle at multiple different depths within the microneedle. 403 illustrates a microneedle that is 600 μm high and 200 μm wide. 404 illustrates a microneedle that is 600 μm high and 200 μm wide and has a covalently attached probe at a depth of 10 μm. 405 illustrates a microneedle that is 600 μm high and 200 μm wide and has a covalently attached probe at a depth of 500 μm. In some cases, the depth of the probe within the microneedle can be used to determine the depth within tissue where a biomarker can be found. In some cases, a device including multiple microneedles with multiple probes attached at different depths on different microneedles can be used to determine where a biomarker can be found within tissue. For example, the device can be used to determine the size or depth of a lesion, such as a cancerous lesion.

[0085] The probe depth is about 10 μm, about 20 μm, about 30 μm, about 40 μm, about 50 μm, about 60 μm, about 70 μm, about 80 μm, about 90 μm, about 100 μm, about 110 μm, about 120 μm, about 130 μm, about 140 μm, about 150 μm, about 160 μm, about 170 μm, about 180 μm, about 190 μm, about 200 μm, about 210 μm, about 220 μm, about 230 μm, about 240 μm, about 250 μm, about 260 μm, about 270 μm, about 280 μm, about 290 μm, about 300 μm, about 310 μm, about 320 μm, about 330 μm, about 340 μm, about 350 μm, about 360 μm, about 370 μm, about 380 μm, about 390 μm, about 400 μm, about 410 μm, about 420 μm, about 430 μm, about 440 μm, about 450 μm, about 460 μm, about 470 μm, about 480 μm, about 490 μm, about 500 μm, about 510 μm, about 520 μm, about 530 μm, about 540 μm, about 550 μm, about 560 μm, about 570 μm, about 580 μm, about 590 μm, about 600 μm, about 610 μm, about 620 μm, about 630 μm, about 640 μm, about 65 60μm, about 270μm, about 280μm, about 290μm, about 300μm, about 310μm, about 320μm, about 330μm, about 340μm, about 350μm, about 360μm, about 370μm, about 380μm , about 390μm, about 400μm, about 410μm, about 420μm, about 430μm, about 440μm, about 450μm, about 460μm, about 470μm, about 480μm, about 490μm, about 500μm, about 510 μm, approximately 520 μm, approximately 530 μm, approximately 540 μm, approximately 550 μm, approximately 560 μm, approximately 570 μm, approximately 580 μm, approximately 590 μm, approximately 600 μm, approximately 610 μm, approximately 620 μm, approximately 630 μm, approximately 640μm, about 650μm, about 660μm, about 670μm, about 680μm, about 690μm, about 700μm, about 710μm, about 720μm, about 730μm, about 740μm, about 750μm, about 760μm , about 770 μm, about 780 μm, about 790 μm, about 800 μm, about 810 μm, about 820 μm, about 830 μm, about 840 μm, about 850 μm, about 860 μm, about 870 μm, about 880 μm, about 890 μm, about 900 μm, about 910 μm, about 920 μm, about 930 μm, about 940 μm, about 950 μm, about 960 μm, about 970 μm, about 980 μm, about 990 μm, or about 1000 μm.

[0086] Optionally, the microneedle devices of the present invention may additionally contain an applicator unit that can be used to apply the device to a subject. The applicator unit may control various application parameters, such as the speed at which the array is applied, the force at which the array is applied, and / or the angle at which the array impacts the subject's tissue (e.g., skin). Additionally, the applicator may also aid in manipulating or otherwise transferring the array from a storage unit to a subject. In some embodiments, the applicator may be a single-use, disposable tool that serves as both a storage unit and an application tool. Examples of suitable applicators and application methods for microneedle arrays are disclosed in U.S. Patent Nos. 6,293,925 (Safabash et al.), 6,743,211 (Prausnitz et al.), 6,881,203 (Delmore et al.), and 6,855,131 (Trautman et al.), and U.S. Patent Application Publication Nos. 2004 / 0181203 (Cormier et al.), 2002 / 0032415 (Trautman et al.), and 2002 / 0087182 (Trautman et al.). The applicator unit can have a number of different shapes. In some embodiments, the applicator unit can be, for example, linear, triangular, rectangular, or disc-shaped. In some embodiments, the applicator unit is a pen applicator.

[0087] Microneedle arrays for conjugating diagnostic probes can be easily produced by using materials and methods known in the art for fabricating arrays with microprotrusion structures.See, for example, US Patent No. 7416541, US Patent No. 7332197, US Patent No. 6663820, US Patent No. 6503231, US Patent Application No. 20100106105, and European Patent Application No. 2119469A.For example, microneedle arrays can be fabricated by wet or dry etching using silicon substrates, precision machining using metal or resin (such as electrical discharge machining, laser machining, dicing, hot embossing, and injection molding), and mechanical cutting.By such processing methods, needle portion and support portion are formed into one piece.Examples of the method for hollowing out needle portion include the method of preparing needle portion and then carrying out secondary processing by using laser mechanical processing, etc. In some cases, the microneedles of the present disclosure can be solid (non-hollow) microneedles. In some cases, the microneedles of the present disclosure can be etched to increase the surface area of ​​the microneedles.

[0088] Multiple methods of cell disruption may be required to make biomarkers accessible to the probe. Cells can be disrupted by disrupting the extracellular matrix or by disrupting the cell membrane. The device of the present disclosure can cause cell disruption, for example, when at least one microneedle contacts and pierces a biological sample, such as human skin.

[0089] A substance can be used to disrupt multiple cells in situ or ex vivo. Accordingly, the present invention further provides a composition comprising multiple microneedles coated with a substance capable of disrupting the extracellular matrix. In some cases, the substance is an enzyme. Several enzymes, including but not limited to serine proteases, thiol proteases, and MMPs, may be useful in this process. Non-limiting examples of enzymes that can be used to disrupt cells and tissues include, but are not limited to, papain, hyaluronidase, streptokinase, streptodornase, trypsin, chymotrypsin, alpha-chymotrypsin, alpha-amylase, DNase, collagenase, the protease styrein, lysozyme, lipase, zymolase, cellulase, mutanolysin, or glycanase. In some examples, the enzyme is hyalurodinase.

[0090] Additional methods of disrupting cells and tissues can include, for example, sonication, electroporation, cryogenic pulverization, physical disruption by pressure, crushing, detergent-based cell lysis, or mechanical shearing of tissues, for example, with a homogenizer. For example, the extracellular matrix or cell membrane can be disrupted by ultrasonic energy or by an electric potential. Application of a solvent to a biological sample can also be used to make biomarkers available for hybridization with a probe.

[0091] The disclosed device can disrupt biological tissue in situ or ex vivo in a minimally invasive manner. For example, a microneedle of the present disclosure can be contacted with the outer skin of a subject's eye. The microneedle can gently disrupt the membrane of a layer of cells in the outer skin of the eye, thereby providing access to the intraocular biomarker to the probe within the microneedle. In some embodiments, the disclosed method and device can be applied to the identification and characterization of biomarkers from sensitive or inoperable tissues. For example, biomarkers are present in the eye or brain. In some embodiments, the disclosed method and device is applied to the in situ characterization of biomarkers from biological samples that may not be available for surgical removal in a biopsy, such as certain brain tumors.

[0092] Probe conjugation and assays for amplifying and detecting biomarkers Microneedles conjugated with probes

[0093] Multiple probes can be attached to the microneedles of the present disclosure. In some cases, the probes comprise polynucleotides (e.g., DNA, RNA, cDNA, cRNA, etc.). Polynucleotide probes are often designed to bind or hybridize to specific polynucleotide biomarkers. The present disclosure also provides methods and devices for detecting peptide or protein biomarkers. In these embodiments, the probes attached to the microneedles can specifically recognize and bind to target peptides or proteins of interest. The probes can be any substance capable of binding to specific peptide or protein biomarkers. The probes can be, for example, proteins (e.g., antibodies, antigens, or fragments thereof), carbohydrates, or polynucleotides. The polynucleotides can possess sequence specificity for the biomarkers.

[0094] The probes used will depend on the biomarker or biomarkers to be detected. Thus, depending on the nature and number of biomarkers to be detected, the number of probes immobilized on the microneedle can be 2, 3, 4, 5, 6, 7, 8, 9, 10 or more. In some cases, the total number of probes in the microneedle is from about 1 probe to about 1,000 probes, from about 1 probe to about 10,000 probes, from about 1 probe to about 100,000 probes, from about 1 probe to about 1,000,000 probes, from about 1 probe to about 10,000,000 probes, from about 1 probe to about 100,000,000 probes, from about 1,000 probes to about 10,000 probes, from about 1,000 probes to about 100,000 probes, from about 1,000 probes to about 10,000,000 probes, from about 1,000 probes to about 100,000,000 probes, from about 1,000 probes to about 100,000,000 probes, The number of probes may be 0 to about 100,000, about 10,000 to about 1,000,000, about 10,000 to about 10,000,000, about 10,000 to about 100,000,000, about 100,000 to about 1,000,000, about 100,000 to about 10,000,000, about 100,000 to about 100,000,000, about 1,000,000 to about 10,000,000, about 1,000,000 to about 100,000,000, or about 10,000,000 to about 100,000,000 probes.

[0095] In some cases, the total number of probes in the microneedle is at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 12, about 14, about 16, about 18, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450, about 500, About 600, about 700, about 800, about 900, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8000, about 9000, about 10000, about 12000, about 14000, about 16000, about 18000, about 20000, about 30000, about 40,000, approximately 50,000, approximately 60,000, approximately 70,000, approximately 80,000, approximately 90,000, approximately 100,000, approximately 200,000, approximately 300,000, approximately 400,000, approximately 500,000, approximately 600,000, approximately 700,000, approximately 800,000, approximately 900,000, approximately 1,000,000, approximately 2,000,000, approximately 3,000,000, approximately 4,000,000, approximately 5,000,000, approximately 6, 000,000, about 7,000,000, about 8,000,000, about 9,000,000, about 10,000,000, about 20,000,000, about 30,000,000, about 40,000,000, about 50,000,000, about 60,000,000, about 70,000,000, about 80,000,000, about 90,000,000, or about 100,000,000 probes.

[0096] In some cases, the total number of probes in the microneedle is less than about 1 probe, less than about 2 probes, less than about 3 probes, less than about 4 probes, less than about 5 probes, less than about 6 probes, less than about 7 probes, less than about 8 probes, less than about 9 probes, less than about 10 probes, less than about 12 probes, less than about 14 probes, less than about 16 probes, less than about 18 probes, less than about 20 probes, less than about 25 probes, less than about 30 probes, less than about 35 probes, less than about 40 probes, less than about 45 probes, less than about 50 probes, less than about 60 probes, less than about 70 probes, Less than about 80 probes, less than about 90 probes, less than about 100 probes, less than about 150 probes, less than about 200 probes, less than about 250 probes, less than about 300 probes, less than about 350 probes, less than about 400 probes, less than about 450 probes, less than about 500 probes, less than about 600 probes, less than about 700 probes, less than about 800 probes, less than about 900 probes, less than about 1000 probes, less than about 1100 probes, less than about 1200 probes, less than about 1300 probes, less than about 1400 probes, less than about 1500 probes, less than about 2000 probes, less than about 25 less than about 00 probes, less than about 3000 probes, less than about 3500 probes, less than about 4000 probes, less than about 4500 probes, less than about 5000 probes, less than about 6000 probes, less than about 7000 probes, less than about 8000 probes, less than about 9000 probes, less than about 10000 probes, less than about 12000 probes, less than about 14000 probes, less than about 16000 probes, less than about 18000 probes, less than about 20000 probes, less than about 30000 probes, less than about 40000 probes, less than about 50000 probes, less than about 60000 probes, less than about 70 less than about 80,000 probes, less than about 90,000 probes, less than about 100,000 probes, less than about 200,000 probes, less than about 300,000 probes, less than about 400,000 probes, less than about 500,000 probes, less than about 600,000 probes, less than about 700,000 probes, less than about 800,000 probes, less than about 900,000 probes, less than about 1,000,000 probes, less than about 2,000,000 probes, less than about 3,000,000 probes, less than about 4,000,000 probes, less than about 5,000,000 probes, less than about 6,The number of probes is less than about 7,000,000, less than about 8,000,000, less than about 9,000,000, less than about 10,000,000, less than about 20,000,000, less than about 30,000,000, less than about 40,000,000, less than about 50,000,000, less than about 60,000,000, less than about 70,000,000, less than about 80,000,000, less than about 90,000,000, or less than about 100,000,000 probes.

[0097] In addition, probes for biomarkers can be immobilized on multiple microneedles within the devices of the present disclosure, as further described herein, particularly for detecting low concentrations of biomarkers. In some cases, a single microneedle contains multiple different probes capable of binding to or detecting the same biomarker. In some cases, a single microneedle can contain at least two different probes for the same biomarker, at least three different probes, at least four different probes, at least five different probes, at least six different probes, at least seven different probes, at least eight different probes, at least nine different probes, at least ten different probes, at least eleven different probes, at least twelve different probes, at least thirteen different probes, at least fourteen different probes, at least fifteen different probes, at least sixteen different probes, at least seventeen different probes, at least eighteen different probes, at least nineteen different probes, at least twenty different probes. , at least 21 different probes, at least 22 different probes, at least 23 different probes, at least 24 different probes, at least 25 different probes, at least 26 different probes, at least 27 different probes, at least 28 different probes, at least 29 different probes, at least 30 different probes, at least 40 different probes, at least 41 different probes, at least 42 different probes, at least 43 different probes, at least 44 different probes, at least 45 different probes, at least 46 different probes, at least 47 different probes, at least 48 different probes, at least 49 different probes, or at least 50 different probes. In some cases, the same microneedle contains more than 50 different probes for the same biomarker.

[0098] In some cases, the same microneedle contains multiple different probes, which may be specific for the same biomarker or for different biomarkers. The microneedles may be configured with at least 2 different probes, at least 10 different probes, at least 100 different probes, at least 200 different probes, at least 300 different probes, at least 400 different probes, at least 500 different probes, at least 600 different probes, at least 700 different probes, at least 800 different probes, at least 900 different probes, at least 1,000 different probes, at least 1,100 different probes, at least 1,200 different probes, at least 1,300 different probes, at least 1,400 different probes, at least 1,500 different probes, at least 1,600 different probes, at least 1,700 different probes, at least 1,800 different probes, at least 1,900 different probes, at least 2,000 different probes, at least 2,100 different probes, at least 2,200 different probes different probes, at least 2,300 different probes, at least 2,400 different probes, at least 2,500 different probes, at least 2,600 different probes, at least 2,700 different probes, at least 2,800 different probes, at least 2,900 different probes, at least 3,000 different probes, at least 3,100 different probes, at least 3,200 different probes, at least 3,300 different probes, at least 3,400 different probes, at least 3,500 different probes, at least 3,600 different probes, at least 3,700 different probes, at least 3,800 different probes, at least 3,900 different probes, at least 4,000 different probes, at least 4,100 different probes, at least 4,200 different probes, at least 4,300 different probes, at least 4,400 different probes, at least 4,500 different probes, at least 4,600 different probes, at least 4,700 different probes, at least 4,800 different probes, at least 4,900 different probes, at least 5,000 different probes, at least 5,100 different probes, at least 5,200 different probes, at least 5,300 different probes, at least 5,400 different probes, at least 5,500 different probes, at least 5,600 different probes, at least 5,700 different probes probes, at least 5,800 different probes, at least 5,900 different probes, at least 6,000 different probes, at least 6,100 different probes, at least 6,200 different probes, at least 6,300 different probes, at least 6,400 different probes, at least 6,500 different probes, at least 6,600 different probes, at least 6,700 different probes, at least 6,800 different probes, at least 6,900 different probes, at least 7, 000 different probes, at least 7,100 different probes, at least 7,200 different probes, at least 7,300 different probes, at least 7,400 different probes, at least 7,500 different probes, at least 7,600 different probes, at least 7,700 different probes, at least 7,800 different probes, at least 7,900 different probes, at least 8,000 different probes, at least 8,100 different probes, at least 8,200 different probes probes, at least 8,300 different probes, at least 8,400 different probes, at least 8,500 different probes, at least 8,600 different probes, at least 8,700 different probes, at least 8,800 different probes, at least 8,900 different probes, at least 9,000 different probes, at least 9,100 different probes, at least 9,200 different probes, at least 9,300 different probes, at least 9,400 different probes, at least 9,The microneedles may comprise 500 different probes, at least 9,600 different probes, at least 9,700 different probes, at least 9,800 different probes, at least 9,900 different probes, or at least 10,000 different probes. The microneedles may comprise fewer than 2 different probes, fewer than 10 different probes, fewer than 100 different probes, fewer than 200 different probes, fewer than 300 different probes, fewer than 400 different probes, fewer than 500 different probes, fewer than 600 different probes, fewer than 700 different probes, fewer than 800 different probes, fewer than 900 different probes, fewer than 1,000 different probes, fewer than 1,100 different probes, or fewer than 1,200 different probes. less than 1,300 different probes, less than 1,400 different probes, less than 1,500 different probes, less than 1,600 different probes, less than 1,700 different probes, less than 1,800 different probes, less than 1,900 different probes, less than 2,000 different probes, less than 2,100 different probes, less than 2,200 different probes, less than 2,300 different probes, less than 2,400 different probes, less than 2,500 different probes, less than 2,600 different probes, less than 2,700 different probes, less than 2,800 different probes, less than 2,900 different probes, less than 3,000 different probes, less than 3,100 different probes, less than 3,200 different probes, less than 3,300 different probes, less than 3,400 different probes, less than 3,500 different probes, less than 3,600 different probes, less than 3,700 different probes, less than 3,800 less than 3,900 different probes, less than 4,000 different probes, less than 4,100 different probes, less than 4,200 different probes, less than 4,300 different probes, less than 4,400 different probes, less than 4,500 different probes, less than 4,600 different probes, less than 4,700 different probes, less than 4,800 different probes, less than 4,900 different probes, less than 5,000 different probes,Fewer than 100 different probes, Fewer than 5,200 different probes, Fewer than 5,300 different probes, Fewer than 5,400 different probes, Fewer than 5,500 different probes, Fewer than 5,600 different probes, Fewer than 5,700 different probes, Fewer than 5,800 different probes, Fewer than 5,900 different probes, Fewer than 6,000 different probes, Fewer than 6,100 different probes, Fewer than 6,200 different probes, Fewer than 6,300 different probes probes, less than 6,400 different probes, less than 6,500 different probes, less than 6,600 different probes, less than 6,700 different probes, less than 6,800 different probes, less than 6,900 different probes, less than 7,000 different probes, less than 7,100 different probes, less than 7,200 different probes, less than 7,300 different probes, less than 7,400 different probes, less than 7,500 different probes, less than 7,600 less than 7,700 different probes, less than 7,800 different probes, less than 7,900 different probes, less than 8,000 different probes, less than 8,100 different probes, less than 8,200 different probes, less than 8,300 different probes, less than 8,400 different probes, less than 8,500 different probes, less than 8,600 different probes, less than 8,700 different probes, less than 8,800 different probes The probes may include fewer than 8,900 different probes, fewer than 9,000 different probes, fewer than 9,100 different probes, fewer than 9,200 different probes, fewer than 9,300 different probes, fewer than 9,400 different probes, fewer than 9,500 different probes, fewer than 9,600 different probes, fewer than 9,700 different probes, fewer than 9,800 different probes, fewer than 9,900 different probes, or fewer than 10,000 different probes.

[0099] In some cases, the multiple probes are identical (e.g., identical copies of the same polynucleotide or antibody). In some embodiments, the microneedle may be associated with multiple copies of the same probe (e.g., greater than 2, 5, 10, 50, 100, 1000, 5000, 7500, 10,000, or 50,000 copies of the same probe). For example, the microneedle may contain multiple copies of a polynucleotide probe designed to hybridize to the same polymorphism or biomarker. In some cases, the microneedle may contain multiple copies of an antibody probe designed to bind to the same epitope.

[0100] In some cases, the microneedle contains a polynucleotide probe. The probes can be designed to detect different biomarkers associated with the same disease, disorder, or condition. In some cases, a first probe recognizes a polymorphism (e.g., a DNA polymorphism, an RNA polymorphism) associated with a disease, and a second probe recognizes a different polymorphism associated with the same disease. For example, a first DNA probe on the microneedle can be designed to detect a first polymorphism in an RNA biomarker associated with onchocerciasis, a skin condition. A second DNA probe on the microneedle can be designed to detect a second polymorphism in an RNA biomarker associated with onchocerciasis. The polymorphism can be, for example, a single nucleotide polymorphism (SNP). Genetic and genomic mutations can involve a single SNP or multiple SNPs. SNPs can occur at a single locus or at multiple loci. It is predictable that an individual who possesses a particular SNP allele at one locus will also possess specific SNP alleles at other loci. The correlation of SNPs can result in the association between alleles that predispose individuals to disease or condition.In some cases, different polynucleotide probes are designed to detect different biomarkers associated with different conditions.For example, one probe can detect a disease biomarker, while another probe can detect housekeeping gene or housekeeping gene product.In some cases, microneedles are attached to polynucleotide, polypeptide, or a mixture of polynucleotide and polypeptide.

[0101] The microneedle can also be associated with multiple different protein or antibody probes. For example, a first antibody probe on the microneedle can be designed to detect a first epitope of an antigen associated with, for example, skin cancer. A second antibody probe can be designed to detect a second epitope associated with the antigen. Or, in some cases, the second antibody probe can detect an epitope associated with a different skin condition.

[0102] In some cases, the present disclosure provides microneedle devices that include a set of microneedles, each microneedle in the set including an identical probe or set of probes. In some embodiments, the same probe is attached to multiple microneedles of the device. Identical probes can be attached to, for example, about 1% of the microneedles, about 5% of the microneedles, about 10% of the microneedles, about 15% of the microneedles, about 20% of the microneedles, about 25% of the microneedles, about 30% of the microneedles, about 35% of the microneedles, about 40% of the microneedles, about 45% of the microneedles, about 50% of the microneedles, about 55% of the microneedles, about 60% of the microneedles, about 65% of the microneedles, about 70% of the microneedles, about 75% of the microneedles, about 80% of the microneedles, about 85% of the microneedles, about 90% of the microneedles, about 95% of the microneedles, or about 100% of the microneedles. In some embodiments, identical probes are attached to no more than 5% of the microneedles, no more than 10% of the microneedles, no more than 15% of the microneedles, no more than 20% of the microneedles, no more than 25% of the microneedles, no more than 30% of the microneedles, no more than 35% of the microneedles, no more than 40% of the microneedles, no more than 45% of the microneedles, no more than 50% of the microneedles, no more than 55% of the microneedles, no more than 60% of the microneedles, no more than 70% of the microneedles, no more than 75% of the microneedles, no more than 80% of the microneedles, no more than 85% of the microneedles, no more than 90% of the microneedles, no more than 95% of the microneedles, or no more than 99% of the microneedles.

[0103] In some cases, the set of microneedles may include at least one microneedle attached to a first probe and at least one microneedle attached to a second probe different from the first probe. For example, as described herein, the first probe may be a polynucleotide or polypeptide (e.g., an antibody, a protein) that specifically binds to a biomarker for a disease or disorder, and the second probe may be a polynucleotide or polypeptide that specifically binds to a different biomarker associated with the same disease or disorder. In some cases, the first probe may be a polynucleotide or polypeptide (e.g., an antibody, a protein) that specifically binds to a biomarker for a disease or disorder, and the second probe may be a polynucleotide or polypeptide that specifically binds to a different biomarker associated with a different disease, disorder, or condition. In some cases, the different diseases, conditions, or disorders are associated with the same organ. For example, the first probe may be associated with a first disease, disorder, or condition associated with the skin, and the second probe may be associated with a second disease, disorder, or condition associated with the skin or the eye. In some cases, the device can include an array of microneedles, each microneedle containing a probe that detects a biomarker associated with a different disease, disorder, or condition associated with the same organ. The array of microneedles can include more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 75, 100, 150, 200, 50, or 1000 microneedles associated with different diseases, disorders, or conditions. In some cases, the different diseases, disorders, or conditions are associated with different organs (e.g., more than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 organs).

[0104] In some cases, the microneedle device includes a plurality of arrays of microneedles, which are often suitable for multiplex reactions. In some cases, the plurality of arrays includes two or more arrays of microneedles designed to detect different biomarkers. In some cases, a first array of microneedles can be designed to detect a biomarker associated with a disease, disorder, or condition, and a second array of microneedles can be designed to detect a different biomarker associated with the same disease, disorder, or condition. In some cases, a first array of microneedles can be designed to detect a biomarker associated with a disease, disorder, or condition, and a second array of microneedles can be designed to detect a different biomarker associated with a different disease, disorder, or condition. In some cases, a first array of microneedles can be designed to detect multiple biomarkers associated with a disease, disorder, or condition, and a second array of microneedles can be designed to detect multiple biomarkers associated with a different disease, disorder, or condition. In some cases, the second array of microneedles can be designed to detect a control biomarker (e.g., a housekeeping gene), whether a positive or negative control.

[0105] In some cases, the method and device presented herein can be used to carry out multiplex reaction, with or without the use of fluorescence.For example, each microneedle containing a unique PCR reagent (for example, unique probe or primer) can be inserted into its own cavity (for example, needle-pierced cavity).PCR reaction can be carried out, and sample can be analyzed for various biomarkers.In some cases, multiplex reaction is carried out by fluorescently labeled probe or probe that emits different optical signals.In some cases, fluorescence is not used.

[0106] The microneedle devices described herein can include any number of probes, which are often attached to multiple needles within the device. The probes can be the same or different. In addition, probes for biomarkers can be immobilized on multiple microneedles within the devices of the present disclosure, particularly for detecting low concentrations of biomarkers. In some cases, the total number of probes in the microneedle device is from about 1 probe to about 1,000 probes, from about 1 probe to about 10,000 probes, from about 1 probe to about 100,000 probes, from about 1 probe to about 1,000,000 probes, from about 1 probe to about 10,000,000 probes, from about 1 probe to about 100,000,000 probes, from about 1,000 probes to about 10,000 probes, from about 1,000 probes to about 100,000,000 probes, from about 1,000 probes to about 10,000,000 probes, from about 1,000 probes to about 100,000,000 probes, The number of probes may be 0 to about 100,000, about 10,000 to about 1,000,000, about 10,000 to about 10,000,000, about 10,000 to about 100,000,000, about 100,000 to about 1,000,000, about 100,000 to about 10,000,000, about 100,000 to about 100,000,000, about 1,000,000 to about 10,000,000, about 1,000,000 to about 100,000,000, or about 10,000,000 to about 100,000,000 probes.

[0107] In some cases, the total number of probes in the microneedle device is at least about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 12, about 14, about 16, about 18, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 60, about 70, about 80, about 90, about 100, about 150, about 200, about 250, about 300, about 350, about 400, about 450, about 500, about 600, about 700, about 800, about 900, about 1000, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8000, about 9000, about 10000, about 15 ... 00, about 600, about 700, about 800, about 900, about 1000, about 1100, about 1200, about 1300, about 1400, about 1500, about 2000, about 2500, about 3000, about 3500, about 4000, about 4500, about 5000, about 6000, about 7000, about 8000, about 9000, about 10000, about 12000, about 14000, about 16000, about 18000, about 20000, about 30000 ,approx. 40,000,approx. 50,000,approx. 60,000,approx. 70,000,approx. 80,000,approx. 90,000,approx. 100,000,approx. 200,000,approx. 300,000,approx. 400,000,approx. 500,000,approx. 600,000,approx. 700,000,approx. 800,000,approx. 900,000,approx. 1,000,000,approx. 2,000,000,approx. 3,000,000,approx. 4,000,000,approx. 5,000,000,approx. 6 ,000,000, about 7,000,000, about 8,000,000, about 9,000,000, about 10,000,000, about 20,000,000, about 30,000,000, about 40,000,000, about 50,000,000, about 60,000,000, about 70,000,000, about 80,000,000, about 90,000,000, or about 100,000,000 probes.

[0108] In some cases, the total number of probes in the microneedle device is less than about 1 probe, less than about 2 probes, less than about 3 probes, less than about 4 probes, less than about 5 probes, less than about 6 probes, less than about 7 probes, less than about 8 probes, less than about 9 probes, less than about 10 probes, less than about 12 probes, less than about 14 probes, less than about 16 probes, less than about 18 probes, less than about 20 probes, less than about 25 probes, less than about 30 probes, less than about 35 probes, less than about 40 probes, less than about 45 probes, less than about 50 probes, less than about 60 probes, less than about 70 probes, less than about 80 probes, less than about 90 probes, less than about 10 probes, less than about 12 probes, less than about 14 probes, less than about 16 probes, less than about 18 probes, less than about 20 probes, less than about 25 probes, less than about 30 probes, less than about 35 probes, less than about 40 probes, less than about 45 probes, less than about 50 probes, less than about 60 probes, less than about 70 probes, less than about 80 probes, less than about 80 probes, less than about 90 probes, less than about 10 probes, less than about 12 probes, less than about 14 probes, less than about 16 probes, less than about 18 probes, less than about 20 probes, less than about 25 probes, less than about 30 probes, less than about 35 probes, less than about 40 probes, less than about 45 probes, less than about 50 probes, less than about 60 probes, less than about 70 probes less than about 80 probes, less than about 90 probes, less than about 100 probes, less than about 150 probes, less than about 200 probes, less than about 250 probes, less than about 300 probes, less than about 350 probes, less than about 400 probes, less than about 450 probes, less than about 500 probes, less than about 600 probes, less than about 700 probes, less than about 800 probes, less than about 900 probes, less than about 1000 probes, less than about 1100 probes, less than about 1200 probes, less than about 1300 probes, less than about 1400 probes, less than about 1500 probes, less than about 2000 probes less than about 2500 probes, less than about 3000 probes, less than about 3500 probes, less than about 4000 probes, less than about 4500 probes, less than about 5000 probes, less than about 6000 probes, less than about 7000 probes, less than about 8000 probes, less than about 9000 probes, less than about 10000 probes, less than about 12000 probes, less than about 14000 probes, less than about 16000 probes, less than about 18000 probes, less than about 20000 probes, less than about 30000 probes, less than about 40000 probes, less than about 50000 probes, less than about 6000 Less than 0 probes, less than about 70,000 probes, less than about 80,000 probes, less than about 90,000 probes, less than about 100,000 probes, less than about 200,000 probes, less than about 300,000 probes, less than about 400,000 probes, less than about 500,000 probes, less than about 600,000 probes, less than about 700,000 probes, less than about 800,000 probes, less than about 900,000 probes, less than about 1,000,000 probes, less than about 2,000,000 probes, less than about 3,000,000 probes, less than about 4,000,000 probes, less than about 5,000,, 000 probes, less than about 6,000,000 probes, less than about 7,000,000 probes, less than about 8,000,000 probes, less than about 9,000,000 probes, less than about 10,000,000 probes, less than about 20,000,000 probes, less than about 30,000,000 probes, less than about 40,000,000 probes, less than about 50,000,000 probes, less than about 60,000,000 probes, less than about 70,000,000 probes, less than about 80,000,000 probes, less than about 90,000,000 probes, or less than about 100,000,000 probes.

[0109] In some cases, the microneedle device may include at least two different probes for the same biomarker, at least three different probes, at least four different probes, at least five different probes, at least six different probes, at least seven different probes, at least eight different probes, at least nine different probes, at least ten different probes, at least eleven different probes, at least twelve different probes, at least thirteen different probes, at least fourteen different probes, at least fifteen different probes, at least sixteen different probes, at least seventeen different probes, at least eighteen different probes, at least nineteen different probes, at least twenty different probes, At least 21 different probes, at least 22 different probes, at least 23 different probes, at least 24 different probes, at least 25 different probes, at least 26 different probes, at least 27 different probes, at least 28 different probes, at least 29 different probes, at least 30 different probes, at least 40 different probes, at least 41 different probes, at least 42 different probes, at least 43 different probes, at least 44 different probes, at least 45 different probes, at least 46 different probes, at least 47 different probes, at least 48 different probes, at least 49 different probes, or at least 50 different probes. In some cases, the same microneedle contains more than 50 different probes for the same biomarker.

[0110] In some cases, the microneedle device includes multiple different probes. The different probes may be specific for the same biomarker or for different biomarkers. The microneedle device may include at least 2 different probes, at least 10 different probes, at least 100 different probes, at least 200 different probes, at least 300 different probes, at least 400 different probes, at least 500 different probes, at least 600 different probes, at least 700 different probes, at least 800 different probes, at least 900 different probes, at least 1,000 different probes, at least 1,100 different probes, at least 1,200 different probes, at least 1,300 different probes, at least 1,400 different probes, at least 1,500 different probes, at least 1,600 different probes, at least 1,700 different probes, at least 1,800 different probes, at least 1,900 different probes, at least 2,000 different probes, or at least 2,100 different probes. , at least 2,200 different probes, at least 2,300 different probes, at least 2,400 different probes, at least 2,500 different probes, at least 2,600 different probes, at least 2,700 different probes, at least 2,800 different probes, at least 2,900 different probes, at least 3,000 different probes, at least 3,100 different probes, at least 3,200 different probes, at least 3,300 different probes, at least 3,400 different probes, at least 3,500 different probes, at least 3,600 different probes, at least 3,700 different probes, at least 3,800 different probes, at least 3,900 different probes, at least 4,000 different probes, at least 4,100 different probes, at least 4,200 different probes, at least 4,300 different probes, at least 4,400 different probes, at least 4,500 different probes, at least 4,600 different probes, at least 4,700 different probes, at least 4,800 different probes, at least 4,900 different probes, at least 5,000 different probes, at least 5,100 different probes, at least 5,200 different probes, at least 5,300 different probes, at least 5,400 different probes, at least 5,500 different probes, at least 5,600 different probes probes, at least 5,700 different probes, at least 5,800 different probes, at least 5,900 different probes, at least 6,000 different probes, at least 6,100 different probes, at least 6,200 different probes, at least 6,300 different probes, at least 6,400 different probes, at least 6,500 different probes, at least 6,600 different probes, at least 6,700 different probes, at least 6,800 different probes, at least 6, 900 different probes, at least 7,000 different probes, at least 7,100 different probes, at least 7,200 different probes, at least 7,300 different probes, at least 7,400 different probes, at least 7,500 different probes, at least 7,600 different probes, at least 7,700 different probes, at least 7,800 different probes, at least 7,900 different probes, at least 8,000 different probes, at least 8,100 different probes probes, at least 8,200 different probes, at least 8,300 different probes, at least 8,400 different probes, at least 8,500 different probes, at least 8,600 different probes, at least 8,700 different probes, at least 8,800 different probes, at least 8,900 different probes, at least 9,000 different probes, at least 9,100 different probes, at least 9,200 different probes, at least 9,300 different probes, at least 9,It may include 400 different probes, at least 9,500 different probes, at least 9,600 different probes, at least 9,700 different probes, at least 9,800 different probes, at least 9,900 different probes, or at least 10,000 different probes. In some cases, the microneedle device may comprise less than 2 different probes, less than 10 different probes, less than 100 different probes, less than 200 different probes, less than 300 different probes, less than 400 different probes, less than 500 different probes, less than 600 different probes, less than 700 different probes, less than 800 different probes, less than 900 different probes, less than 1,000 different probes, less than 1,100 different probes, less than 1,200 different probes, less than 1,300 different probes, less than 1,400 different probes, less than 1,500 different probes, less than 1,600 different probes, less than 1,700 different probes, less than 1,800 different probes, less than 1,900 different probes, less than 2,000 different probes, less than 2,100 different probes, less than 2,200 different probes, less than 2,300 different probes, less than 2,400 different probes, less than 2,500 different probes, less than 2,600 different probes, less than 2,700 different probes, less than 2,800 different probes, less than 2,900 different probes, less than 3,000 different probes, less than 3,100 different probes, less than 3,200 different probes, less than 3,300 different probes, less than 3,400 different probes, less than 3,500 different probes, less than 3,600 different probes less than 3,700 different probes, less than 3,800 different probes, less than 3,900 different probes, less than 4,000 different probes, less than 4,100 different probes, less than 4,200 different probes, less than 4,300 different probes, less than 4,400 different probes, less than 4,500 different probes, less than 4,600 different probes, less than 4,700 different probes, less than 4,800 different probes,Less than 900 different probes, Less than 5,000 different probes, Less than 5,100 different probes, Less than 5,200 different probes, Less than 5,300 different probes, Less than 5,400 different probes, Less than 5,500 different probes, Less than 5,600 different probes, Less than 5,700 different probes, Less than 5,800 different probes, Less than 5,900 different probes, Less than 6,000 different probes, Less than 6,100 different probes, Less than 6,2 less than 6,000 different probes, less than 6,300 different probes, less than 6,400 different probes, less than 6,500 different probes, less than 6,600 different probes, less than 6,700 different probes, less than 6,800 different probes, less than 6,900 different probes, less than 7,000 different probes, less than 7,100 different probes, less than 7,200 different probes, less than 7,300 different probes, less than 7,400 different probes, less than 7,500 less than 7,600 different probes, less than 7,700 different probes, less than 7,800 different probes, less than 7,900 different probes, less than 8,000 different probes, less than 8,100 different probes, less than 8,200 different probes, less than 8,300 different probes, less than 8,400 different probes, less than 8,500 different probes, less than 8,600 different probes, less than 8,700 different probes, less than 8,800 different probes The number of different probes may be less than 8,900, less than 9,000, less than 9,100, less than 9,200, less than 9,300, less than 9,400, less than 9,500, less than 9,600, less than 9,700, less than 9,800, less than 9,900, or less than 10,000 different probes.

[0111] Probes for detecting various biological markers can be purchased commercially or synthesized according to methods well known in the art. Probes can be designed according to any suitable method. For example, computerized search programs can be used to design nucleic acid probes specific to target biomarker sequences (e.g., mRNA) with minimal cross-hybridization and similar hybridization efficiency. Exemplary programs include Oligo 5.0 (National Biosciences Inc.), Primer 3 (MIT), and Array Designer (Telechem International Inc.). Nucleotide probes used in the present methods can have any suitable length, for example, from about 15 to about 100 nucleotides. For protein biomarkers, specific probes (antibodies) for detecting the biomarkers can also be readily produced or purchased. The nucleotide or polypeptide probes used in the present methods can contain a detectable label. Any suitable label can be used. For example, detectable labels can be detected by optical, magnetic, mechanical, spectroscopic, photochemical, biochemical, immunochemical, radioactive, or enzymatic means. In some embodiments, the detectable label is a fluorescent or chemiluminescent label, such as GFP; a magnetic moiety; a protein, such as avidin, streptavidin; or a peptide tag, such as a histidine tag or a FLAG tag.

[0112] The immobilized probes are present on the surface of the microneedle devices described herein. The immobilized probes can be covalently or non-covalently bound to the surface of the microneedles by methods known in the art or specific linking methods described in the Examples herein. For example, the probes can be conjugated to the microneedles via, for example, biotin-avidin or biotin-streptavidin interactions, protein A interactions, protein G interactions, goat anti-mouse Fc interactions, amide bonds, or any other covalent or non-covalent interaction. The probes can be covalently attached to the microneedles with or without an appropriate spacer element between the probe and the microneedle surface, such as poly(ethylene glycol) (PEG). Methods routinely used in the art for immobilizing antibody or nucleotide probes can be readily adapted and modified as appropriate in the practice of the present invention. Such methods are known in the art, e.g., Mendoza et al., Biotechniques 27:778-786, 1999; Arenkov et al., Anal. Bioc hem. 278:123-131,2000;Zhu et al., Nat. Ge net. 26:283-289,2000;MacBeath et al.,Sci ence 289:1760-1763,2000;Jyoung et al.,Bi osens. Bioelectron. 21:2315- 2319,2006;L u et al.,Anal. Chem. 67:83 87,1995;Vijayendran et al.,Anal. Chem. 73:471-480,200 1;Nakanishi et al.,Anal. Chem. 68:1695-1 700,1996;Rowe et al.,Anal. Chem. 71:433- 439, 1999; Day et al., Biochem. J. 278:735-740, 1991; Fodor et al., Science 251:767-773, 1991; Schene et al., Science 270:467-470, 1995; Lamture et al., Nucl. Acids Res. 22:2121-2125, 1994; Guo et al., Nucl. Acids Res. 22:5456-5465, 1994; and PCT International Publication Nos. WO00 / 22108, WO01 / 75447 and WO02 / 12891.

[0113] The probes can also be modified with a reactive moiety and attached to the gold-coated surface of one or more microneedles. The reactive moiety can be a thiol group. In some cases, an inorganic salt can be added. Examples of inorganic salts include, but are not limited to, lithium, potassium, sodium, magnesium, and calcium salts, often with halide counterions. In some cases, the inorganic salt is sodium chloride. The inorganic salt can be present at a concentration preferably between about 0.1 M and 2.0 M, about 0.2 M and 2.0 M, about 0.2 M and 1.5 M, or about 0.5 M and 1.5 M. In some cases, the concentration of the inorganic salt is less than about 0.1 M, less than about 0.2 M, less than about 0.2 M, less than about 0.3 M, less than about 0.4 M, less than about 0.5 M, less than about 1.0 M, less than about 1.1 M, less than about 1.2 M, less than about 1.3 M, less than about 1.4 M, less than about 1.5 M, less than about 1.6 M, less than about 1.7 M, less than about 1.8 M, less than about 1.9 M, less than about 2.0 M, less than about 2.5 M, less than about 3.0 M, less than about 3.5 M, less than about 4.0 M, or less than about 4.5 M. In some cases, the concentration of the inorganic salt is greater than about 0.1 M, greater than about 0.2 M, greater than about 0.2 M, greater than about 0.3 M, greater than about 0.4 M, greater than about 0.5 M, greater than about 1.0 M, greater than about 1.1 M, greater than about 1.2 M, greater than about 1.3 M, greater than about 1.4 M, greater than about 1.5 M, greater than about 1.6 M, greater than about 1.7 M, greater than about 1.8 M, greater than about 1.9 M, greater than about 2.0 M, greater than about 2.5 M, greater than about 3.0 M, greater than about 3.5 M, greater than about 4.0 M, or greater than about 4.5 M.

[0114] Biomarker capture

[0115] Microneedles covalently or non-covalently attached to probes can be inserted into biological samples in situ, such as human skin, eyes, surgical tissue, and skin capillaries. Microneedles covalently attached to probes can also be inserted into biological samples ex vivo, such as extracted tissue during biopsy. The probes can be hybridized or bound to biomarkers for a specified time under physiological conditions for the biological sample. A temperature range of about 20 to about 40 degrees Celsius, atmospheric pressure of 1, pH 6-8, glucose concentration of 1-20 mM, atmospheric oxygen concentration, and gravity on Earth are examples of physiological conditions for most subjects. The probe can be hybridized or bound to the biological sample for at least 1 minute, at least 2 minutes, at least 3 minutes, at least 5 minutes, at least 10 minutes, at least 15 minutes, at least 20 minutes, at least 25 minutes, at least 30 minutes, at least 45 minutes, at least 1 hour, at least 2 hours, at least 3 hours, at least 5 hours, at least 10 hours, or at least 24 hours.In some embodiments, the probe can be hybridized to the biological sample for 1 minute or less, 2 minutes or less, 3 minutes or less, 5 minutes or less, 10 minutes or less, 15 minutes or less, 20 minutes or less, 25 minutes or less, 30 minutes or less, 1 hour or less, 2 hours or less, 3 hours or less, 5 hours or less, or 10 hours or less.The microneedle with the probe linked by covalent or non-covalent bond can be removed from the biological sample, for example, human skin.The biomarker hybridized or bound to the probe can be isolated from the biological sample by removing the microneedle from human skin.

[0116] Biomarker detection

[0117] Some embodiments of the present invention are directed to the detection of polynucleotide biomarkers (e.g., mRNA, DNA). In these embodiments, probes (e.g., oligonucleotide probes, polynucleotide probes) for one or more specific biomarkers can be readily synthesized based on the sequence of the target biomarker. Once bound to the probes on the microneedle devices of the present invention, the nucleic acid biomarkers are typically subjected to an amplification reaction (e.g., PCR, reverse transcription PCR) or detected by a labeled tag. The labeled tag can be directly linked to the probe attached to the microneedle, or in some cases, the labeled tag binds to the biomarker after it has already been captured by the probe attached to the microneedle.

[0118] Numerous methods routinely practiced in the art can be easily employed to amplify nucleic acid biomarkers obtained from a subject. These include, for example, polymerase chain reaction (PCR) or reverse transcription PCR. See generally PCR Technology: Principles and Applications for DNA Amplification (edited by H.A. Erlich, Freeman Press, NY, NY, 1992); PCR Protocols: A Guide to Methods and Applications (edited by Innis et al., Academic Press, San Diego, CA, 1990); Mattila et al., Nucleic Acids Res., Vol. 19, p. 4967 (1991); Eckert et al., PCR Methods and Applications, Vol. 1, p. 17 (1991); PCR (edited by McPherson et al., IRL Press, Oxford); and U.S. Patent No. 4,683,202 (each of which is incorporated by reference for all purposes). Other suitable amplification methods include ligase chain reaction (LCR) (see Wu and Wallace, Genomics, 4, 560 (1989); Landegren et al., Science, 241, 1077 (1988)), transcription amplification (Kwoh et al., Proc. Natl. Acad. Sci. USA, 86, 1173 (1989)), and self-sustained sequence replication (Guatelli et al., Proc. Nat. Acad. Sci. USA, 87, 1874 (1990)) and nucleic acid-based sequence amplification (NASBA). The latter two amplification methods involve isothermal transcription-based reactions that generate both single-stranded RNA (ssRNA) and double-stranded DNA (dsDNA) as amplification products at ratios of approximately 30 to 1 or 100 to 1, respectively. Once amplified, the identity of the captured biomarkers can then be readily confirmed by standard techniques, such as, for example, sequencing analysis, electrophoresis, and the like.

[0119] In some embodiments of the present invention, PCR is used to detect biomarkers hybridized to or otherwise attached to probes. Amplification of biomarkers by PCR can span several orders of magnitude, potentially producing thousands to millions of copies of a specific DNA sequence, starting with a single or few copies of the target. PCR may use thermal cycling, which involves repeated heating and cooling cycles to melt the DNA and enzymatically replicate it. These thermal cycling procedures may physically separate the two strands in the DNA double helix at high temperatures in a process called DNA melting. Then, at low temperatures, each strand can be used as a template for DNA synthesis by DNA polymerase, selectively amplifying the target DNA. The selectivity of PCR may result from the use of primers (short DNA fragments) complementary to the DNA region targeted for amplification under specific thermal cycling conditions.

[0120] Primers containing sequences complementary to the biomarker of interest can be used with DNA polymerase to achieve selective and repeated amplification. As PCR proceeds, the DNA produced can be used as a template for replication to initiate a chain reaction in which the DNA template is exponentially amplified. PCR applications can employ thermostable DNA polymerases, such as Taq polymerase, an enzyme originally isolated from the bacterium Thermus aquaticus. This DNA polymerase can enzymatically assemble new DNA strands from nucleotides, for example, by using single-stranded DNA as a template and a DNA oligonucleotide (also called a DNA primer) to initiate DNA synthesis.

[0121] The PCR reaction can be performed directly on the microneedle inserted into the biological sample. For example, the microneedle can be placed in a test tube containing the reagents necessary for the PCR reaction, or it can be placed between two plates (e.g., a glass slide). The biomarkers can be detached from the needle and released into the PCR test tube by several different methods. For example, the biomarkers can be released from the microneedle by heating the microneedle, or the biomarkers can be spontaneously released from the needle into the PCR solution. The PCR reaction can be performed as described above, and the PCR products can be analyzed by standard procedures, such as electrophoresis, real-time PCR, and PCR Technology: Principles and Applications for PCR. Other procedures such as those described in DNA Amplification (edited by H.A. Erlich, Freeman Press, NY, NY, 1992); PCR Protocols: A Guide to Methods and Applications (edited by Innis et al., Academic Press, San Diego, CA, 1990) can be used for analysis. Samples can be analyzed using different PCR methods, such as standard PCR and real-time PCR. Real-time PCR (RT-PCR) is a PCR-based laboratory technique that can be used to amplify and simultaneously quantify targeted DNA molecules. Real-time PCR can be combined with reverse transcription to quantify messenger RNA and non-coding RNA in cells or tissues.

[0122] In some embodiments, the device of the present disclosure can be further configured to include at least one compartment in which a PCR reaction can be performed. For example, the device of the present disclosure can be configured to include a plurality of microneedles or an array of microneedles and a compartment in which a PCR reaction can be performed.

[0123] A PCR reaction can selectively amplify a biomarker hybridized to a particular microneedle, or a PCR reaction can amplify a set of biomarkers hybridized to multiple microneedles. For example, 402 illustrates a surface of a device of the present invention comprising multiple microneedles in contact with a biological sample. Each "square" in 402 illustrates an individual microneedle, where each individual microneedle comprises at least one probe. Each probe in 402 may or may not hybridize to a biomarker. Each microneedle illustrated in 402 can be placed in a separate PCR tube, and each PCR product can be analyzed individually. Alternatively, multiple microneedles illustrated in 402 can be placed in the same PCR tube for simultaneous analysis.

[0124] In some cases, the captured biomarker can be detected by using a labeled probe capable of binding to the captured biomarker. In some cases, the labeled probe binds to the biomarker after the biomarker has already been captured by a probe attached to a microneedle, as described herein. In some cases, the microneedle is directly attached to a probe tagged with a label designed to alter its optical signal (decrease or increase intensity) upon binding to the biomarker.

[0125] A labeled probe can include a label (e.g., a fluorophore, a radioisotope, etc.) that can emit an optical signal. The fluorescent moiety can be a fluorescent protein, such as green fluorescent protein (GFP), red fluorescent protein (RFP), yellow fluorescent protein (YFP), or variations thereof. In some cases, a labeled probe includes a label with an optical signal that increases or decreases when the probe binds to its target. The fluorescent moiety can be an RNA aptamer that binds to a fluorophore. The RNA-fluorophore complex can emit an optical signal across the visible light spectrum (see Paige et al., Science, 333:6042 (2011)). For example, a "Spinach aptamer sequence" is an RNA mimic of GFP that can be configured to emit a fluorescent optical signal when hybridized to a biomarker.

[0126] In some embodiments, a microneedle containing a set of probes non-covalently or covalently bound thereto can be used to detect biomarkers in a subject. For example, the device of the present disclosure can be contacted with the skin of a subject. The device can include a polynucleotide probe containing an RNA-fluorophore moiety. The RNA-fluorophore moiety can be configured to emit an optical signal, such as a fluorescent signal, when hybridized with a biomarker of interest.

[0127] Protein or peptide biomarkers can be detected and quantified by any of several methods well known to those skilled in the art for polypeptide detection. These include assay formats such as protein PCR and ELISA. Both local and systemic protein biomarkers and local and systemic peptide biomarkers can be assayed using the microneedle array device of the present invention. Other methods suitable for this purpose include analytical biochemical methods such as electrophoresis, capillary electrophoresis, high-performance liquid chromatography (HPLC), thin-layer chromatography (TLC), high-diffusion chromatography, mass spectrometry, or various other immunological methods such as fluid or gel precipitin reactions, immunodiffusion (single or two-way), immunohistochemistry, affinity chromatography, immunoelectrophoresis, radioimmunoassay (RIA), immunofluorescence assay, Western blotting, dipstick, etc. For general reviews of immunoassays, see Methods in Cell Biology, Vol. 37: Antibodies in Cell Biology, edited by Asai, Academic Press, Inc., New York (1993); Basic and Clinical Immunology, 7th ed., edited by Stites & Terr (1991); Immunoassays for the 80s, Voller, A. et al. (eds.), Baltimore: University Park Press (1981); Maggio et al., Enzyme-Immunoassay, Boca Raton: CRC Press, pp. 172-176 (1980); and Tijssen, Laboratory Techniques in Biochemistry and Molecular See also Biology: Practice and Theory of Immunoassays, Vol. 15, Elsevier, 1985. Reagents for performing these assays for any specific protein or peptide biomarker (e.g., antibodies) can be readily obtained from commercial sources or can be produced by standard, routinely practiced techniques (e.g., hybridoma technology for producing monoclonal antibodies).

[0128] The binding interaction between the probe and the biomarker can be detected using a secondary detection reagent such as a secondary antibody. For example, a "sandwich ELISA" can be used to detect the binding of a biomarker to an antibody probe. The binding of a biomarker to a probe can be detected using a detection antibody specific to a different epitope of the biomarker. The antibody used in detection can be of a different isotype from the antibody used as the probe; for example, the antibody probe can be an IgG antibody (including any of the subtypes such as IgG1, IgG2, IgG3, and IgG4), and the secondary antibody can be IgA or IgM. The detection antibody can be conjugated to a detectable label, such as a fluorescent moiety or a radioactive label. The binding of the probe to the biomarker can be detected using an antibody-based detection method, such as an enzyme-linked immunosorbent assay (ELISA).

[0129] Protein biomarkers and peptide biomarkers can also be assayed using protein PCR.For example, in these applications, one assay suitable for detecting biomarkers is PCR-ELISA protocol.The assay employs standard immunoassay procedures.Capture antibody is attached to the surface of the microneedle of the device.Instead of using a reporter enzyme to generate analytical signals, secondary antibody can be fused to single-stranded oligonucleotide, which can then be amplified using PCR.After insertion and capture of biomarker, the secondary antibody labeled with oligonucleotide is added, and then PCR analysis is performed on the conjugated tag to detect the presence of biomarker.

[0130] Diagnostic Applications and Associated Kits The devices and methods described herein are useful for detecting and capturing biomarkers in a variety of diagnostic applications. These include, for example, diagnosing skin diseases, detecting circulating gene markers, and detecting protein or peptide biomarkers. By way of example, the devices can be readily employed for diagnosing cutaneous malignant melanoma (CMM) in subjects suspected of having or being at risk for developing CMM. In these applications, probes for CMM-specific biomarkers can be coupled to the microneedles. The device containing one or more of the probe-conjugated microneedles can then be applied directly to all moles (nevi) on the subject's skin. The device is removed from each nevi, and any biomarkers captured by the microneedles are then assayed in situ on the device or after separation from the device. The devices of the present disclosure can be used clinically for diagnostic and prognostic applications.

[0131] In another specific application, the devices and methods described herein are also employed for margin detection in skin cancer excision. In these embodiments, the devices contain microneedles of different lengths conjugated with probes. Detection and assay of tumor-specific biomarkers by these devices can provide surgeons with information about the extent of tumor invasion in the intradermal, subcutaneous, and basal spaces. These applications avoid the repeated histopathological examinations currently required to determine margins during skin tumor excision. In some cases, the methods do not involve skin biopsies.

[0132] The methods and devices of the present invention can be used in the diagnosis and / or treatment of skin conditions. These methods can include contacting a microneedle with a skin tissue of a subject. The skin condition can be a benign condition, a pre-malignant condition, or a malignant condition. The skin condition can be a healthy condition. Non-limiting examples of skin conditions include skin cancer, such as melanoma and Mohs skin cancer; onchocerciasis; lupus; measles; hemangioma; psoriasis; rosacea; seborrheic dermatitis; hives, vitiligo; warts; gangrenofascial fasciitis; cutaneous candidiasis; carbuncles; cellulitis; hypohidrosis; impetigo; cutis laxa; decubitus ulcers; erysipelas; dyshidrotic eczema; stomatitis; moles; herpetic stomatitis; ichthyosis vulgaris; acne; herpes; dermatomyositis; molluscum contagiosum; acrodermatitis; sebaceous cysts; seborrheic keratosis; pilonidal sinus; keloids; lichen planus; actinic keratosis; stasis dermatitis; corns and calluses; eczema; tinea versicolor; pemphigoid; ulcers; or shingles. The methods and devices of the present invention can be used in the diagnosis and treatment of multiple ocular conditions, such as uveitis, dry eye disease, retinal disease, glaucoma, and inflammatory diseases. The devices of the present invention can be used to stage cancer. Cancer can be staged as stage 0, stage I, stage II, stage III, or stage IV.

[0133] The methods and devices of the present invention can also be used in the diagnosis and / or treatment of ocular conditions, such as corneal surface inflammation, uveitis, or dry eye disease. These methods can include contacting the microneedle with the ocular tissue of a subject, for example, by contacting the subconjunctival space. The ocular condition can be a benign condition, a pre-malignant condition, or a malignant condition. The ocular condition can be a healthy condition. Non-limiting examples of ocular conditions include retinoblastoma; cutaneous or intraocular (ocular) melanoma; retinitis pigmentosa (RP); diabetic retinopathy; glaucoma (including open-angle glaucoma (e.g., primary open-angle glaucoma), angle-closure glaucoma, and secondary glaucoma (e.g., pigmentary glaucoma, pseudoexfoliation glaucoma, and glaucoma resulting from trauma and inflammatory diseases)), retinal detachment, age-related maculopathy or other maculopathies, age-related macular degeneration, photoretinopathy, surgery-induced retinopathy, toxic retinopathy, retinopathy of prematurity, retinopathy due to ocular trauma or infiltrative lesions, hereditary retinal degeneration, surgery-induced retinopathy, toxic retinopathy, retinopathy due to ocular trauma or infiltrative lesions. Specific exemplary genetic conditions of interest include, but are not necessarily limited to, Bardet-Biedl syndrome; congenital amaurosis; cone or cone-rod dystrophy; congenital stationary night blindness; macular degeneration; optic atrophy; symptomatic or systemic retinopathy; and Usher syndrome.

[0134] The method and device of the present invention can be used to monitor the expression of biomarkers during surgical or cosmetic procedures.The device and method of the present disclosure can be used to perform biopsies of sensitive tissues, such as eye tissue or brain tissue.In some cases, the microneedle device can be contacted with the tissue or biological sample of a subject during an intraoperative procedure.The tissue or biological sample can be obtained from an organ selected from the group consisting of the brain, heart, breast, liver, pancreas, spleen, bladder, stomach, lung, uterus, cervix, prostate, kidney, intestine, appendix, and colon.In further cases, the microneedle can be contacted with the margin of a tumor before or after tumor removal from a subject.

[0135] As a further example of the diagnostic application of the present invention, the methods and devices described herein can also be used to detect systemic and circulating genetic biomarkers in a subject's bodily fluids (e.g., bloodstream). Many diseases (e.g., Down's syndrome) are known to have genetic (e.g., mRNA) biomarkers circulating in the blood. By extending the length of the microneedles in the device of the present invention and penetrating and accessing dermal or subcutaneous capillaries, probes for biomarkers can specifically bind to such biomarkers. Any other nucleic acid biomarkers known to be present in blood can also be detected in a similar manner. For example, the microneedles on the device of the present disclosure can penetrate the skin of a subject in situ and contact the subject's dermal capillaries. Skin capillaries may be the smallest blood vessels in a subject's body, and the inner membrane of a skin capillary may be approximately one cell layer thick. The device of the present disclosure can penetrate the membrane of one or more skin capillaries when the device is contacted with the subject's skin. In some embodiments, the devices of the present disclosure can be utilized to examine biomarkers circulating in the bloodstream without drawing a blood sample from the subject. In some cases, the devices of the present disclosure can detect fetal or maternal biomarkers of a condition, including biomarkers associated with pregnancy. In some cases, the devices of the present disclosure can detect biomarkers circulating in the bloodstream, such as proteins, hormones, vitamins, cofactors, or polynucleotides.

[0136] Non-limiting examples of genetic conditions that can be diagnosed with the polynucleotide biomarker-based methods and devices of the present invention include cystic fibrosis; Duchenne muscular dystrophy; hemochromatosis; Tay-Sachs disease; Prader-Willi syndrome; Angelman syndrome; neurofibromatosis; phenylketonuria; Canavan disease; celiac disease; acid beta-glucosidase deficiency; Gaucher disease; Charcot-Marie-Tooth disease; color blindness; cat crying syndrome; polycystic kidney disease; acrocephaly; familial adenomatous polyposis; adrenal gland disorders; amyotrophic lateral sclerosis (ALS); Alzheimer's disease; Parkinson's disease; anemia; ataxia; ataxia-telangiectasia; autism; bone marrow diseases; Bonnevie-Ullrich syndrome; brain diseases; von Hirsch-Holz syndrome; These conditions include: Eckel-Lindau disease; congenital heart disease; Crohn's disease; dementia; myotonic dystrophy; Fabry disease; Fragile X syndrome; galactosemia; hereditary emphysema; retinoblastoma; Pendred syndrome; Usher syndrome; Wilson's disease; neurological disorders; Huntington's disease; immune system disorders; gout; X-linked spinal and bulbar muscular atrophy; learning disabilities; Li-Fraumeni syndrome; lipase D deficiency; Lou Gehrig's disease; Marfan syndrome; metabolic disorders; Niemann-Pick disease; Noonan syndrome; fragile bone disease; Peutz-Jeghers syndrome; Pfeiffer syndrome; porphyria; progeria; Rett syndrome; tuberous sclerosis; speech and communication disorders; spinal muscular atrophy; Treacher Collins syndrome; trisomy; and monosomy.

[0137] In some cases, the probes of the present invention can be used to detect the state of the immune system. The devices of the present invention can be used in allergy testing to confirm or prevent allergies. In some cases, the devices of the present invention can be used to analyze an allergy panel. Non-limiting examples of immune disorders include HIV, diabetes, Parkinson's disease, Alzheimer's disease, rheumatoid arthritis, lupus, cancer, multiple sclerosis, inflammatory bowel disease, psoriasis, scleroderma, autoimmune thyroid disease, vasculitis, pernicious anemia, severe combined immunodeficiency (SCID), DiGeorge syndrome, hyperimmunoglobulin E syndrome, common variable immunodeficiency, chronic granulomatous disease, Wiskott-Aldrich syndrome, autoimmune lymphoproliferative syndrome (ALPS), hyper-IgM syndrome, leukocyte adhesion deficiency (LAD), NEMO (NF-κB essential modifier) ​​disorder, selective immunoglobulin A deficiency, X-linked agammaglobulinemia, X-linked lymphoproliferative disorder, ataxia-telangiectasia, seasonal allergies, mastocytosis, perennial allergies, anaphylaxis, food allergies, allergic rhinitis, and atopic dermatitis.

[0138] In some embodiments, the devices and methods of the present invention can be used to diagnose a variety of biomarkers associated with multiple cancers.Non-limiting examples of cancer include acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, AIDS-related cancer, AIDS-related lymphoma, anal cancer, appendix cancer, astrocytoma, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brain tumors such as cerebellar astrocytoma, cerebral astrocytoma / malignant glioma, ependymoma, medulloblastoma, supratentorial primitive neuroectodermal tumor, visual pathway and hypothalamic glioma, breast cancer, bronchial adenoma, Burkitt's lymphoma, cancer of unknown primary, central nervous system lymphoma, cerebellar astrocytoma, cervical cancer, childhood cancer, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic Myeloproliferative disorders, colon cancer, cutaneous T-cell lymphoma, desmoplastic small round cell tumor, endometrial cancer, ependymoma, esophageal cancer, Ewing's sarcoma, germ cell tumors, gallbladder cancer, gastric cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumors, glioma, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular (liver) cancer, Hodgkin's lymphoma, hypopharyngeal cancer, intraocular melanoma, islet cell carcinoma, Kaposi's sarcoma, kidney cancer, laryngeal cancer, lip and oral cavity cancer, liposarcoma, liver cancer, lung cancer including non-small cell lung cancer and small cell lung cancer, lymphoma, leukemia, macroglobulinemia disease, malignant fibrous histiocytoma / osteosarcoma of bone, medulloblastoma, melanoma, mesothelioma, metastatic squamous cell carcinoma of the neck of unknown primary site, oral cancer, multiple endocrine neoplasia syndrome, myelodysplastic syndrome, myeloid leukemia, nasal cavity and paranasal sinus cancer, nasopharyngeal carcinoma, neuroblastoma, non-Hodgkin's lymphoma, non-small cell lung cancer, oral cavity cancer, oropharyngeal cancer, osteosarcoma / malignant fibrous histiocytoma of bone, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, pancreatic cancer, pancreatic islet cell cancer, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal astrocytoma, pineal germ cell tumors, pituitary adenoma, pleuropulmonary blastoma, plasma cell neoplasms, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell carcinoma, renal pelvis and ureteral transitional cell carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, skin cancer, cutaneous Merkel cell carcinoma, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, stomach cancer, T-cell lymphoma, throat cancer, thymoma, thymic carcinoma, thyroid cancer, trophoblastic neoplasia (gestational), carcinoma of unknown primary site, urethral cancer, uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom's macroglobulinemia, and Wilms' tumor.

[0139] The disclosed devices can be used for independent diagnostics or as secondary diagnostics to inform therapeutic treatment. The disclosed microneedles and methods provide minimally invasive, rapid, and accurate diagnostics and treatments. In addition, the disclosed devices and methods can provide portable, painless, and inexpensive diagnostics for multiple subjects. Subjects of the present invention can be of any age, including, for example, geriatric adults, adults, adolescents, juveniles, children, infants, and babies. Subjects of the present invention can be mammals, birds, fish, reptiles, or amphibians. Non-limiting examples of subjects include humans, primates, dogs, cats, horses, pigs, and mice.

[0140] A subject may provide multiple biological samples for analysis using the microneedles of the present invention. Analysis of a subject's biological sample can be performed in situ or ex vivo. For example, in situ analysis can involve directly contacting a microneedle of the present invention with the skin of a subject. Ex vivo analysis can involve contacting a microneedle of the present invention with biopsy tissue. In some embodiments, about 1 mg, about 5 mg, about 10 mg, about 15 mg, about 20 mg, about 25 mg, about 30 mg, about 35 mg, about 40 mg, about 45 mg, about 50 mg, about 55 mg, about 60 mg, about 65 mg, about 7 mg, about 75 mg, about 80 mg, about 85 mg, about 90 mg, about 95 mg, or about 100 mg of biological sample is required for biomarker analysis using the microneedles and methods of the present invention.

[0141] In some embodiments, the method and microneedle of the present invention can deliver a dose of about 1 mg to about 5 mg or less, about 1 mg to about 10 mg or less, about 1 mg to about 20 mg or less, about 1 mg to about 30 mg or less, about 1 mg to about 40 mg or less, about 1 mg to about 50 mg or less, about 50 mg to about 60 mg or less, about 50 mg to about 70 mg or less, about 50 mg to about 80 mg or less, about 50 mg to about 90 mg or less, about 50 mg to about 100 mg or less, about 100 mg to about 1 gram or less, about 100 mg to about 2 grams or less, about 100 mg to about 3 grams or less, or about 100 mg to about 4 grams. A biological sample of about 1 gram or less, about 100 mg to about 5 grams or less, about 100 mg to about 6 grams or less, about 100 mg to about 7 grams or less, about 100 mg to about 8 grams or less, about 100 mg to about 9 grams or less, about 100 mg to about 10 grams or less, about 1 gram to about 2 grams or less, about 1 gram to about 3 grams or less, about 1 gram to about 4 grams or less, about 1 gram to about 5 grams or less, about 1 gram to about 6 grams or less, about 1 gram to about 7 grams or less, about 1 gram to about 8 grams or less, about 1 gram to about 9 grams or less, or about 1 gram to about 10 grams or less is required.

[0142] In some embodiments, further assays are used to verify the diagnosis that is made based on the identification of the biomarkers that are identified by the microneedle and method of the present disclosure.Non-limiting examples of the assays that can verify biomarkers include: a) the assay that assesses the interaction of protein with DNA, such as DNase footprinting assay and gel shift assay; b) the assay that assesses the integrity of RNA molecules, such as nuclear run-on assay; c) the end-point assay that can measure the final result of the assay quantitatively or qualitatively; d) the reaction rate assay that assesses the reading of data points at multiple time intervals and can compare the reaction rate of biological processes; e) the semi-quantitative assay that can provide quantifiable readings in some context, such as Western blot assay, coagulation assay and agglutination assay; f) the immunoassay that assesses the response of antigen-antibody binding reaction; g) enzyme activity assay that examines function and activity; h) colony formation assay that can examine the ability of cells to proliferate and differentiate; i) counting assay, such as flow cytometry assay; and j) multiple PCR assay, such as real-time PCR.

[0143] Furthermore, the methods of the present disclosure may further include detecting one or more biomarkers from a reference tissue obtained from the subject. For example, the method may include detecting biomarkers from the sample tissue and the reference tissue. The reference tissue may be benign tissue. In some cases, the reference tissue is tissue from the same organ or region as the sample tissue. In some cases, the sample tissue includes tissue suspected of having a disease or disorder (e.g., a malignant tumor), and the reference tissue includes tissue from the same organ that is known to be disease-free or disorder-free. In some cases, the biomarker levels detected in the sample tissue can be further compared with the biomarker levels detected in the reference tissue.

[0144] In some cases, the device of the present disclosure can be used to remove tumors and / or identify tumor margins during surgery.The device of the present invention can be used to characterize different tissue shapes and tissue margins in situ or ex vivo.For example, in Mohs skin cancer surgery, where tissues are usually removed, sectioned, and evaluated by histological methods, the device of the present invention can be used to analyze tumor margins.In some cases, the device of the present invention can be used to identify cancer metastasis by analyzing tissue margins.

[0145] The devices and methods of the present disclosure can be utilized in personalized medicine applications. A subject can provide a certain amount, for example, a skin sample, to a clinician. The clinician can use the device of the present disclosure to examine multiple biomarkers associated with the subject's skin. The clinician can use the identified biomarkers to determine the predicted effectiveness of a treatment in a particular subject. The devices and methods of the present disclosure can also be used to monitor a subject's response to a particular treatment, for example, by monitoring an increase or decrease in biomarker expression. Clinicians can use the increase or decrease in biomarker expression levels to determine the effectiveness of a treatment. The device of the present disclosure can be used to quantitatively measure the expression of a biomarker. For example, quantitative PCR can be used to amplify the copy number of a biomarker hybridized to a polynucleotide probe on a microneedle. A microneedle that has not been contacted with or hybridized to a biological sample can be used as a negative control. A microneedle with a known amount of a standard control, such as a housekeeping gene, can be used as a positive control for the reaction. Quantitative PCR can be performed as described in The PCR Technique: Quantitative PCR, James W. Larrick, June 1997, Eaton Publishing.

[0146] The disclosed devices and methods can be used in biodefense. Biodefense can involve detecting the release or dissemination of biological or chemical agents. These agents can be bacteria, viruses, or toxins, either in naturally occurring or human-modified forms. The disclosed devices can be used to detect multiple biomarkers associated with pathological agents that can be used in biological warfare.

[0147] Biological and / or chemical warfare agents can include, for example, any biological and / or chemical entity that can be used as a weapon to cause terror, mayhem, disease, insecurity, and / or death. Non-limiting examples of chemical and biological agents include anthrax; smallpox; tularemia; avian influenza; plague; HIV; Ebola; foot-and-mouth disease; ricin; neurotoxic organophosphates; cyanides; vesicants (or blister agents) such as mustard gas and lewisite; asphyxiants such as chlorine and phosgene; nerve agents such as sarin, tabun, soman, and VX; hallucinogens such as BZ; insecticides such as parathion, malathion, and azinphosmethyl; and derivatives or combinations thereof.

[0148] The present invention also provides kits for carrying out the diagnostic applications described herein. The kits typically contain a microneedle device comprising one or more microneedles. In some kits, the microneedles are already conjugated with specific probes for detecting one or more biomarkers. In other kits, the probes for detecting one or more biomarkers and the reagents for conjugating them to the microneedles are provided as separate components. Some kits of the present invention are intended to detect and capture a single biomarker specific to a known disease or disorder (e.g., plakophilin-3 mRNA for gastrointestinal cancer). In these kits, the microneedles of the device are typically conjugated or will be conjugated with the same probe molecule (e.g., an oligonucleotide complementary to the target biomarker). Other kits of the present invention are designed to detect multiple biomarkers involved in one or more diseases or disorders. In these kits, different probes for different biomarkers are conjugated to the microneedles of the device or provided for conjugation thereto. In addition to the microneedle device and probe, the kits of the invention may also include other reagents for applying the device to a subject and analyzing the captured biomarkers (e.g., reagents for PCR amplification of the biomarkers). The kits may further contain instructions (e.g., on an instruction sheet within the kit or on the kit's packaging material) for using the kit to perform the intended diagnostic application.

[0149] The device of the present invention can be packaged as a kit. In some embodiments, the kit includes instructions for using the device to treat conditions such as basal cell carcinoma. The written material can be, for example, a label. The written material can suggest conditions and methods for using the microneedles and additional reagents included in the kit. The instructions provide the subject and their physician with the best guidance for achieving optimal detection of the biomarker.

[0150] The kits of the present disclosure may include the device described herein and a set of reagents for polymerase chain reaction. The kits of the present disclosure may include the device described herein and a set of reagents for ELISA assay. The kits may be designed to identify a specific condition, such as basal cell carcinoma, or may be designed to simultaneously diagnose multiple conditions, such as squamous cell carcinoma, Kaposi's sarcoma, melanoma, basal cell carcinoma, and actinic keratosis (a precursor to squamous cell carcinoma). In some cases, the kits of the present disclosure may include the device of the present disclosure and written materials. In some cases, the kits of the present disclosure may include the device of the present disclosure, a set of probes, and a set of reagents that can be used to connect the probes to microneedles.

[0151] The kit of the present disclosure may include a positive control and a negative control. The positive control may be, for example, a sample containing a known biomarker. The positive control may be a polynucleotide of a known sequence, such as a polynucleotide of a known SNP associated with basal cell carcinoma. The negative control may be, for example, a scrambled polynucleotide sequence. In some cases, the kit may include a reagent (e.g., a polypeptide, a polynucleotide) of known concentration or amount that can be used to create a calibration curve for quantifying the amount of biomarker present in a tissue or biological sample. Such a reagent may also be used with any of the methods presented herein.

[0152] Animal models Many drugs, treatments, and cures for diseases can be developed through the use of animal models. Animal models can be live animals used in the study and exploration of diseases. The development of drugs as pharmaceuticals can include the exploration of toxicity and adverse side effects not detected in cellular assays. Animal models can be used to assess the efficacy, absorption, metabolism, distribution, excretion, toxicity, pharmacology, and side effects of pharmacological treatments. The devices and methods of the present invention can be used to identify biomarker responses to pharmacological treatments in animal models.

[0153] Animal models can provide guidance for selecting pharmacological compounds for further evaluation. Animal models can provide guidance, for example, for pharmacokinetic / metabolism studies in humans. Animal models can be used, for example, to assess absorption, distribution, metabolism, excretion, and toxicity (ADMET) parameters that support Investigational New Drug (IND) applications. Studies in animal models can, for example, result in the selection of compounds to be further evaluated in preclinical and clinical trials.

[0154] Clinical Interventions and Clinical Trials The device of the present disclosure can be used in clinical trials. For example, the device of the present disclosure can be used during surgical procedures to identify biomarkers in tissues that are difficult to reach or cannot be excised and removed for biopsy. For example, the device of the present disclosure can be applied to the detection of biomarkers in cardiovascular tissue, brain tissue, or internal organs exposed to clinicians during surgical procedures. In some cases, the device of the present disclosure can prevent medical complications that would otherwise occur when a clinician removes tissue from a subject for biopsy. The device of the present disclosure can be used, for example, in routine examinations, during surgical procedures, or by a subject at their own home. The device of the present disclosure can be used, for example, in cardiovascular surgery or eye surgery.

[0155] The device of the present disclosure can be used in the design of clinical trial protocols. For example, the device of the present disclosure can be used in conjunction with clinical trials to detect biomarker levels and monitor a subject's response to pharmacological treatment. The device of the present disclosure can provide guidelines for the design, execution, and analysis of preclinical development and clinical trials. The present disclosure presents methods for identifying and quantifying biomarkers that can be selected for optimal administration of therapeutically effective compounds.

[0156] The disclosed device can be used in predicting a subject's response to different drug dosages in clinical trials. For example, by monitoring the increase or decrease of biomarker levels, such as retinal disease biomarkers in eye tissue, the methods and devices of the present invention can establish the effectiveness of pharmacological treatments for retinal diseases. In some cases, clinical trials for therapeutic agents are performed or modified based on the detection of biomarkers by the disclosed device. In some cases, the disclosed method and device can be used to compare treatments evaluated in clinical trials with treatments that are known standard treatments.

[0157] Clinical trials typically proceed through multiple steps, including preclinical studies, pilot studies, safety screening studies, and efficacy assessment studies. For a drug to be approved and marketed, it must often meet all endpoints specified in the clinical trial protocol, including support for efficacy within the proposed confidence interval and the inclusion of a significant number of individuals to support the statistical power of the present invention. A non-limiting example of the application of the present invention includes monitoring multiple biomarkers throughout a clinical trial. The device and method of the present disclosure can also be used to monitor how different pharmacological treatments can affect biomarker expression in the early stages of clinical trials (preclinical and Phase I).

[0158] The disclosed devices and methods can also be used to predict changes in basal cellular pathways affected by a pharmacological treatment based on the expression levels of the identified biomarkers. Non-limiting examples of pharmacodynamic and pharmacokinetic parameters of a pharmacological treatment that can affect basal cellular pathways include: a) the amount of drug administered, which can be expressed as dose D; b) the dosing interval, which can be expressed as τ; c) the volume of distribution V d [where V d = D / C0]; d) the apparent volume of distribution of the drug, which can be expressed as the concentration C0 or C ss [where C0 or C ss = D / Vd]; e) the half-life of the drug, t 1 / 2 [where t 1 / 2 =ln(2) / k e ]; f) k, the rate at which the drug is eliminated from the body e [where k e =ln(2) / t 1 / 2 =CL / V d ];g) The injection rate K required to equalize both sides of the equation in [where K in =C ss ×CL];h)AUC 0-∞ (Here,

number

number

number

number

number

[0047] includes peak-trough fluctuations within one dosing interval at steady state, which can be expressed as: [Example]

[0159] The following examples are presented for the purpose of further illustrating the present invention, but not for the purpose of limiting its scope.

[0160] Example 1 Detection of ssDNA in solution using probes immobilized on polycarbonate This example describes polycarbonate functionalized with a DNA probe and its utilization for the specific capture of ssDNA from solution.

[0161] Attachment of DNA probes to polycarbonate: The polycarbonate surface was first treated with nitric acid and reduced to introduce amino groups, which were used to further attach commercially available thiol / amino bifunctional linkers (Figure 1). DNA with a 3' thiol modification was then coupled to the linker that was grafted onto the polycarbonate.

[0162] Visualization of 5'-Cy5-modified DNA attached to polycarbonate: To visualize DNA on polycarbonate surfaces, DNA was modified with one Cy5 at the 5' end and a thiol at the 3' end and attached using the chemistry described above. A monolayer of 5'Cy5-DNA was imaged by confocal microscopy (Figure 2), demonstrating successful surface functionalization. In vitro capture of ssDNA on polycarbonate modified with specific DNA probes: To investigate the ability of DNA probes attached to polycarbonate to specifically capture (hybridize to) ssDNA from solution, polycarbonate disks were modified with DNA probes complementary to a region of circular single-stranded DNA (ssDNA, approximately 3.4 kb in size). After incubation with the ssDNA solution, the modified discs were thoroughly washed, and the hybridized ssDNA was released from the discs by denaturing at high temperature and quantified via quantitative PCR (qPCR). The amount of DNA captured on polycarbonate modified with specific DNA probes was expressed as a ratio to the capture on polycarbonate modified with linker alone (background control) (Figure 1).

[0163] The results from the study are summarized in Table 1. The data show that the ssDNA target was successfully enriched onto the specific probe at all ssDNA concentrations tested (concentrations varied over 6 logs).

[0164] [Table 1]

[0165] The materials and methods used in the study are described in detail below.

[0166] Derivatization of polycarbonate: Polycarbonate was shaken in 30% aqueous HNO3 at 65°C for 30 minutes and then washed thoroughly with water. Nitric acid-treated polycarbonate (step 1) was immersed in 10% NaBH4 solution in water, shaken overnight at room temperature, and finally washed thoroughly with water. Amino-modified polycarbonate (step 2) was immersed in 6.4 mM Sulfo-GMBS solution (Pierce) in PBS, pH 7.2, shaken for 1.5 hours at room temperature, and finally washed thoroughly with water.

[0167] Deprotection of DNA thiol groups: DNA with the thiol modifier C3 SS at the 3' end was purchased from IDT. To deprotect the thiol modification, 5 μL of a 100 μM DNA solution in water was treated with 25 μL of 100 mM 2-mercaptoethanol in PBS, pH 8.1, for 30 minutes at room temperature. To purify the deprotected DNA, 600 μL of PN buffer from the Qiagen Nucleotide Removal Kit was added to the reaction mixture, followed by 250 μL of isopropyl alcohol. The solution was applied to a silica column from the Qiagen Nucleotide Removal Kit, washed according to the kit's instructions, and eluted with 35 μL of PBS, pH 7.2. Attachment of DNA to polycarbonate: The solution of deprotected thiol-modified DNA (Step 4) was quickly applied to the maleimide linker-modified polycarbonate (Step 3) and incubated for 45 minutes at 37°C in a humidified atmosphere. The column was then thoroughly washed with water and air-dried.

[0168] Visualization of Cy5-modified DNA: A 25-mer DNA modified with one Cy5 at the 5' end and a thiol at the 3' end was attached to a polycarbonate surface using the chemistry described above. After extensive washing with water and drying, the polycarbonate was mounted on a microscope slide and imaged with a confocal microscope using a near-infrared filter. The edges of the DNA-modified areas on the surface were localized and imaged, clearly demonstrating the effectiveness of the Cy5-labeled DNA monolayer modification.

[0169] Capture of ssDNA on polycarbonate functionalized with specific DNA probes: Using the procedure described above (steps 1–4), a DNA probe with a 3′-thiol modification (5′-CAAGTTTGCCTTTAGCGTCAGACTGTATTTTTTTT / ThioMC3 / -3′) (SEQ ID NO: 1) was attached to a polycarbonate disk. For negative control experiments, the disk was modified with the linker alone (steps 1–3). The disk was immersed in a solution of circular ssDNA isolated from filamentous phage in 3× SSC buffer (150 mM NaCl, 15 mM sodium citrate) (see Table 1 for DNA concentration) and incubated at 37°C for 10 min. The disk was then washed with three wash buffers (Wash Buffer 1: 1× SSC + 0.03% SDS; Wash Buffer 2: 0.2× SSC; Wash Buffer 3: 0.05× SSC). After washing, the discs were immersed in a minimal volume of sterile distilled water and heated at 90°C for 2 minutes, after which the still-warm water was removed from the discs. ssDNA in the aqueous aliquots was quantified using qPCR with primers specific for the p3 gene of filamentous phage.

[0170] Example 2 Conjugation of DNA probes to stainless steel surfaces This example describes the attachment of DNA oligomer probes containing 3' thiol modifications to gold-coated stainless steel surfaces. Attachment of DNA probes to gold-coated stainless steel: Gold surfaces were easily modified by attaching thiol-derivatized single-stranded DNA. The sulfur atom of the thiolated DNA forms a covalent bond with the gold. Visualization of DNA on gold-coated stainless steel: To visualize DNA on the surface of gold-coated stainless steel samples, a fill-in PCR reaction was performed using fluorescently labeled dUTP to synthesize the complementary strand of the single-stranded DNA. The resulting double-stranded oligomers contained multiple copies of Chromatide® Alexa Fluor® 488-5-dUTP, which fluoresces in the green channel, similar to fluorescein. Fluorescence microscopy confirms the successful functionalization of the gold-coated stainless steel surface (Figure 3).

[0171] The materials and methods used in the study are described in detail below.

[0172] Deprotection of DNA thiol groups and conjugation to stainless steel: DNA with the thiol modifier C3 SS at the 3' end was purchased from IDT. To deprotect the thiol modification, 5 pL of a 100 pM DNA solution in water was treated with 25 pL of 100 mM 2-mercaptoethanol in PBS, pH 8.1, for 30 minutes at room temperature. To purify the deprotected DNA, 600 pL of PN buffer from the Qiagen Nucleotide Removal Kit was added to the reaction mixture, followed by isopropyl alcohol (300 pL). The solution was applied to a silica column from the Qiagen Nucleotide Removal Kit, washed according to the kit's instructions, and then eluted with 24 pL of TE buffer (10 mM Tris; 1 mM EDTA), pH 7.2.

[0173] The deprotected thiol-modified DNA solution was quickly applied to the gold surface of a stainless steel strip (approximately 5 mm x 2.5 mm). The solution was incubated at 37°C in a humidified atmosphere for 16–20 hours, then thoroughly washed with water and air-dried.

[0174] Fill-in reaction to amplify the fluorescent signal: A 75-bp single-stranded DNA oligo (5'-GCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCGCCTGTGGGCGACTAAATTCCGTTAAAGCCGGC / ThiolMC3 / -3') (SEQ ID NO: 2) with thiol derivatization at the 3' end was attached to the surface of a gold-coated stainless steel sample. After washing and drying, the stainless steel sample was placed in a 0.5 mL test tube. 48.5 pL of dH2O and 1.5 pL of a 10 pM primer complementary to the 3' end of the thiol-derivatized DNA were then added. The mixture was incubated at 55°C for 2 minutes to allow the primer to anneal to the single-stranded DNA. The mixture was then allowed to return to room temperature.

[0175] A fill-in reaction was then performed using Chromatide® Alexa Fluor® 488-5-dUTP purchased from Invitrogen. The following components were added to the mixture from step 3: 2 pL of 10 mM dNTP mix (dATP, dGTP, dCTP), 7.5 pL of 10x Klenow Fragment Buffer (New England Biolabs), 9.5 pL of dH2O, 4 pL of 1 mM 488-5-dUTP, and 2 pL of Klenow Fragment (New England Biolabs). The reaction was incubated at 37°C for 30 minutes. The stainless steel sample was removed from the tub, washed thoroughly with water, and air-dried.

[0176] Visualization of Chromatide® Alexa Fluor®-modified DNA: Once the stainless steel samples were dry, they were mounted on microscope slides and imaged by fluorescence microscopy using a green filter. The edges of the DNA-modified areas on the stainless steel were localized and imaged, clearly showing conjugation of the DNA to the gold-coated surface.

[0177] Example 3 Enhanced binding of oligonucleotides to the surface of an array of metal microneedles To further facilitate the attachment of DNA oligomer probes containing 3'-thiol modifications to gold-coated stainless steel surfaces, NaCl titration was introduced. The protocol described in Example 2 above was carried out by adding increasing concentrations of NaCl. The amount of ssDNA coupled to the surface increased proportionally with the amount of NaCl added, with an approximately 10-fold increase observed at a NaCl concentration of 1 M (Figure 7). Quantification of DNA bound to the gold surface was determined using the Quanti-iT Green ssDNA Reagent Kit (Invitrogen).

[0178] Example 4 Diagnostic methods Misdiagnosis of melanoma is a significant concern for dermatologists. The consequences of a misdiagnosis can be devastating for the patient, costly for insurance companies, and damaging for physicians; therefore, early detection of melanoma is crucial. However, the invasive nature of standard biopsy procedures can deter physicians from performing biopsies on benign-appearing tissue. Figures 5 and 6 illustrate the noninvasive diagnosis of melanoma with the device and method of the present disclosure. 501-505 describe the surface of 603 in more detail.

[0179] Figure 5 illustrates the process by which a DNA probe designed to detect a melanoma biomarker hybridizes to a desired biomarker. 501 illustrates a single DNA probe attached to the gold surface of a microneedle. The DNA probe in 501 contains a single nucleotide polymorphism that selectively hybridizes to RNA associated with melanoma. As described in Example 2, the DNA probe in 501 was covalently linked to the gold surface within the microneedle. 505 illustrates brightfield and fluorescent field images of the surface of a device of the present invention containing multiple microneedles with covalently linked DNA probes. When the device is contacted with a subject's skin, the microneedles gently disrupt the membranes of cells within the skin that they contact. This process exposes the probes on the microneedles to intracellular polynucleotide, peptide, and protein biomarkers. The probes on the microneedles can be hybridized 502 to the biomarkers in situ under physiological conditions for a specified time, for example, the probes can be hybridized for about 30 minutes at physiological body temperature (about 37°C). A reverse transcriptase-PCR (RT-PCR) assay 503 can be utilized to convert the hybridized RNA to DNA. A standard PCR protocol 504 can be utilized to amplify the product of 503.

[0180] Figure 6 illustrates an overview of how treatment with a device of the invention may be administered. 601 illustrates a clinician performing a visual inspection of a subject's skin. The clinician 601 can determine whether the skin 602, or a portion of skin, appears healthy or unhealthy. The clinician contacts the subject's skin with a device of the invention, thereby contacting probes for biomarkers to the subject's skin in a non-invasive manner. 603 is a schematic diagram of the device surface, described in more detail in Figure 5. 604 illustrates a PCR assay being performed to amplify the hybridized biomarkers. 605 depicts the clinician returning the results of the analysis to the subject.

[0181] Example 5 In vivo studies on modified polymer microneedle arrays This example describes the in vivo detection of mouse actin using the modified polymer microneedle array described in this application. Polycarbonate microneedles were modified with a mouse actin ssDNA probe, and samples of the microneedles coupled with the ssDNA probe were also coated with hyaluronidase. Mice (n=4; A / J, Swiss Webster) were treated with the ssDNA-modified polycarbonate microneedles. The microneedle array was applied to the shaved hind leg of the mouse using thumb pressure and held in place for approximately 10 seconds. The array was then inverted onto a glass slide, the gap between the needle base and the slide was sealed with oil, and the slide was placed on a heat block at 50°C for 30 minutes to reverse-transcribe the mRNA bound to the array into cDNA directly on the microneedle surface. The reaction mixture was then transferred from the slide to a PCR tube and amplified using conventional PCR methods. The cycling program was as follows: 94°C for 1 minute; 40 cycles of 94°C for 15 seconds, 55°C for 30 seconds, 68°C for 60 seconds; 68°C for 5 minutes. Samples were visualized by gel imaging and quantified using densitometry.

[0182] A significant increase in the amount of mRNA isolated from the probe-containing microneedles was observed. While the difference between the sample containing the ssDNA probe and the unmodified microneedle array was approximately 2-3-fold, the difference between the sample containing both the ssDNA probe and the unmodified microneedle array was approximately 8-fold. This indicates that the microneedles not only extract targets from the skin, but also that disruption of the extracellular matrix can facilitate the extraction process, resulting in increased yield. Several enzymes, including but not limited to serine proteases, thiol proteases, and MMPs, could be useful in this process. Further examples of enzymes include, but are not limited to, papain, hyaluronidase, streptokinase, streptodornase, trypsin, chymotrypsin, alpha-chymotrypsin, alpha-amylase, DNase, collagenase, and styrein.

[0183] Example 6 Isolation of target mRNA from homogenized human skin This example describes the isolation of target mRNA from homogenized human skin. Excess human skin, including both cancerous and benign tissue excised during Mohs micrographic surgery, was obtained from Scripps Clinic. The skin was homogenized, and total RNA was extracted using the following procedure. The skin was homogenized in RNAlater™ using an MP Biomedical FastPrep-24 and Lysing Matrix D beads (approximately 30-40 mg of tissue per tube) at a setting of 6.0 for 25 seconds. Total RNA was then isolated from the homogenate using an RNA extraction kit (Qiagen™) according to the manufacturer's instructions. A DNA probe with a sequence complementary to human beta-actin was conjugated to a gold-coated stainless steel microneedle and placed in the RNA solution isolated from the homogenized skin and incubated at room temperature or 37°C for a period of time. The stainless steel strips were isolated from the solution, and the bound mRNA was reverse transcribed into cDNA, which was then amplified and analyzed using qRT-PCR. As a result, only the microneedles coupled to the beta-actin probe and subsequently amplified using the appropriate beta-actin probe yielded measurable amounts of target (Figure 8). In this example, a non-specific DNA sequence was conjugated to the surface of the microneedles; for targets other than actin, a BMP-4:TaqMan probe was used; and an Actb-human-1:beta-actin sequence was conjugated to the surface of the microneedles.

[0184] Example 7 Detection of mRNA from a mouse skin mRNA library using a microneedle array In these experiments, target mRNA was isolated from a mouse skin mRNA library (Zyagen™). The total concentration of mRNA in the pool was 250 μg / mL. A gold-coated stainless steel microneedle array coupled with probe ssDNA was then added to the mRNA library (5 μL in 20 μL of water) and incubated at 37°C for approximately 10 minutes. The array was then gently washed and briefly air-dried. A reverse transcriptase reaction mix (3 μL of 10x reverse transcriptase buffer, 6 μL of 25 mM MgCl2, 3 μL of 0.1 M DTT, 1.5 μL of RNase OUT™, 13 μL of DEPC water, 2 μL of 10 mM dNTP mix) was then added to the tube containing the microneedle array and incubated at 42°C for 2 minutes, after which cDNA synthesis was performed by adding 1.5 μL of SuperScript II™ reverse transcriptase. The reactions were cycled according to the following program: 42°C for 50 minutes, 70°C for 15 minutes, and then on ice for approximately 15 minutes. RNase H was then added to each reaction (1.5 μL), and the reactions were incubated at 37°C for 20 minutes. This was then followed by TaqMan™ PCR amplification using 20x concentrated TaqMan™ assay primers (1.5 μL) and 2x concentrated TaqMan™ Gene Expression Mix (15 μL). The total reaction volume was 30 μL. After four cycles, 5 μL of solution was removed and used as template for TaqMan™ qRT-PCR (40 cycles), performed according to the manufacturer's instructions.

[0185] Although the foregoing invention has been described in some detail, for purposes of illustration and example for clarity of understanding, it will be readily apparent to those skilled in the art in light of the teachings of the present invention that certain changes and modifications to the foregoing invention may be made without departing from the spirit or scope of the appended claims.

[0186] All publications, databases, GenBank sequences, patents, and patent applications cited herein are hereby incorporated by reference to the same extent as if each was specifically and individually indicated to be incorporated by reference.

Claims

[Claim 1] The method described in the specification, etc.

Citation Information

Patent Citations

  • Applicator for microneedle arrays

    JP2010516337A

  • Biomarkers for the treatment of psoriasis

    JP2013531499A

  • Silk fibroin-based microneedles and their manufacturing method

    JP2014501547A

  • Analysis of gene expression profiles using sequential hybridization

    US20030087279A1

  • Biomarkers for the treatment of psoriasis

    WO2011159750A1