Genetically modified microorganisms that produce ethylene glycol, and method for producing ethylene glycol

Abstract

To provide a novel genetically modified microorganism that produces ethylene glycol, and to provide a method for producing ethylene glycol using the genetically modified microorganism.SOLUTION: Provided are a genetically modified microorganism capable of producing ethylene glycol from glycerol based on the following conversion pathway, and a method for producing ethylene glycol by culturing the genetically modified microorganism in a medium containing glycerol and producing ethylene glycol from glycerol.SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to a genetically modified microorganism that produces ethylene glycol and a method for producing ethylene glycol using the genetically modified microorganism. [Background technology]

[0002] Ethylene glycol is a dihydric alcohol with the structural formula "HOCH2CH2OH," and is widely used as a synthetic raw material for polyesters, etc., as well as a solvent, antifreeze, etc. Industrially, ethylene glycol is produced by obtaining ethylene from crude oil, oxidizing the ethylene to form ethylene oxide, and then hydrating this, but the production process requires large amounts of energy and water. In recent years, there has been a strong demand to reduce adverse environmental impacts such as global warming, and there is also a demand for reducing the environmental impact during the production of ethylene glycol. One means of achieving this has been proposed, and patent document 1, for example, proposes a genetically engineered microorganism capable of producing ethylene glycol from a gaseous substrate containing one or more of carbon monoxide, carbon dioxide, and hydrogen. The genetically engineered microorganism described in patent document 1 produced a maximum amount of ethylene glycol of about 2.4 mg / L after 20 days of culture (see Figure 3B), which is hardly considered to be excellent in productivity. [Prior art documents] [Patent documents]

[0003] [Patent Document 1] Special Publication No. 2021-506247 Summary of the Invention [Problem to be solved by the invention]

[0004] An objective of the present invention is to provide a novel genetically modified microorganism capable of producing ethylene glycol and a method for producing ethylene glycol using the genetically modified microorganism. [Means for solving the problem]

[0005] The means for solving the problems of the present invention are as follows. 1. A genetically modified microorganism capable of producing ethylene glycol from glycerol based on the following conversion pathway: [ka] 2. Enzyme A converts glycerol into glyceric acid via glyceraldehyde Enzyme C converts glycerate to hydroxypyruvate Enzyme D converts hydroxypyruvate to glycolaldehyde 1. The genetically modified microorganism according to 1, wherein a DNA encoding the 3. Enzyme A is one or more enzymes selected from the following enzyme group A: Enzyme C is one or more enzymes selected from the following enzyme group C: Enzyme D is one or more enzymes selected from the following enzyme group D: 2. The genetically modified microorganism according to 2., Enzyme group A: enzymes having the amino acid sequences shown in SEQ ID NOs: 1 to 29 or amino acid sequences having 90% or more sequence identity with the sequences shown in SEQ ID NOs: 1 to 29 Enzyme group C: enzymes having an amino acid sequence shown in any one of SEQ ID NOs: 67 to 80, or an amino acid sequence having 90% or more sequence identity with the sequence shown in SEQ ID NOs: 67 to 80 Enzyme group D: enzymes having an amino acid sequence shown in any one of SEQ ID NOs: 81 to 106, or an amino acid sequence having 90% or more sequence identity with the sequence shown in SEQ ID NOs: 81 to 106 4. Enzyme A is ArdAldO (SEQ ID NO: 1), Enzyme C is FtLox (SEQ ID NO: 67), Enzyme D is KsmdlC (SEQ ID NO: 81), 3. The genetically modified microorganism according to 3., 5. Enzyme B converts glyceraldehyde into glyceric acid. Enzyme E converts glycolaldehyde to ethylene glycol 5. The genetically modified microorganism according to any one of 2. to 4., wherein a DNA encoding the above has been introduced. 6. Enzyme B is one or more enzymes selected from the following enzyme group B: Enzyme E is one or more enzymes selected from the following enzyme group E: 5. The genetically modified microorganism according to 5., Enzyme group B: enzymes having an amino acid sequence shown in any one of SEQ ID NOs: 44 to 66, or an amino acid sequence having 90% or more sequence identity with the sequence shown in SEQ ID NOs: 44 to 66 Enzyme group E: enzymes having an amino acid sequence shown in any one of SEQ ID NOs: 107 to 117, or an amino acid sequence having 90% or more sequence identity with the sequence shown in SEQ ID NOs: 107 to 117 7. The enzyme selected from the enzyme group B is KppuuC (SEQ ID NO: 44), The enzyme selected from the enzyme group E is EcfucO (SEQ ID NO: 107), 6. The genetically modified microorganism according to 6., 8. Enzyme A2 converts glycerol into glyceraldehyde Enzyme B converts glyceraldehyde into glyceric acid Enzyme C converts glycerate to hydroxypyruvate Enzyme D converts hydroxypyruvate to glycolaldehyde 1. The genetically modified microorganism according to 1, wherein a DNA encoding the 9. The enzyme A2 is one or more enzymes selected from the following enzyme group A2: Enzyme B is one or more enzymes selected from the following enzyme group B: Enzyme C is one or more enzymes selected from the following enzyme group C: Enzyme D is one or more enzymes selected from the following enzyme group D: 8. The genetically modified microorganism according to 8., Enzyme group A2: enzymes having an amino acid sequence shown in any one of SEQ ID NOs: 30 to 43, or an amino acid sequence having 90% or more sequence identity with a sequence shown in SEQ ID NOs: 30 to 43 Enzyme group B: enzymes having an amino acid sequence shown in any one of SEQ ID NOs: 44 to 66, or an amino acid sequence having 90% or more sequence identity with the sequence shown in SEQ ID NOs: 44 to 66 Enzyme group C: enzymes having an amino acid sequence shown in any one of SEQ ID NOs: 67 to 80, or an amino acid sequence having 90% or more sequence identity with the sequence shown in SEQ ID NOs: 67 to 80 Enzyme group D: enzymes having an amino acid sequence shown in any one of SEQ ID NOs: 81 to 106, or an amino acid sequence having 90% or more sequence identity with the sequence shown in SEQ ID NOs: 81 to 106 10. Enzyme A2 is CbAldO (SEQ ID NO: 30), Enzyme B is KppuuC (SEQ ID NO: 44), Enzyme C is FtLox (SEQ ID NO: 67), Enzyme D is KsmdlC (SEQ ID NO: 81), 9. The genetically modified microorganism according to 9., 11. Enzyme E converts glycolaldehyde into ethylene glycol 11. The genetically modified microorganism according to any one of 8. to 10., wherein a DNA encoding the 12. Enzyme E is one or more enzymes selected from the following enzyme group E: 11. The genetically modified microorganism according to 11., Enzyme group E: enzymes having an amino acid sequence shown in any one of SEQ ID NOs: 107 to 117, or an amino acid sequence having 90% or more sequence identity with the sequence shown in SEQ ID NOs: 107 to 117 13. The enzyme selected from the enzyme group E is EcfucO (SEQ ID NO: 107), 13. The genetically modified microorganism according to 12., 14. A genetically modified microorganism according to any one of 1. to 13., wherein the microorganism is yeast or Escherichia coli. 15. The genetically modified microorganism according to 14, characterized in that the microorganism is one or more selected from the group consisting of CCI-p-1 strain (received number: NITE ABP-04087), CCI-p-2 strain (received number: NITE ABP-04088), CCI-p-3 strain (received number: NITE ABP-04089), CCI-p-4 strain (received number: NITE ABP-04090), CCI-e-1 strain (received number: NITE ABP-04091), and CCI-e-2 strain (received number: NITE ABP-04092). 16. A genetically modified microorganism having the following conversion pathway is cultured in a medium containing glycerol: A method for producing ethylene glycol, comprising producing ethylene glycol from glycerol. [ka] [Effects of the Invention]

[0006] The genetically modified microorganism of the present invention can produce ethylene glycol using glycerol (glycerin) as a starting material. Glycerol has high solubility in water (24.4 g / 100 ml water, 20°C), and microorganisms can be cultured at concentrations as high as 20%, allowing the glycerol concentration in the culture solution to be increased, resulting in efficient production of ethylene glycol. Since glycerol can be obtained from biologically derived fats and oils (triacylglycerides), biologically derived ethylene glycol can be produced by using biologically derived glycerol as a starting material. Glycerol is produced in large quantities as a by-product of chemical reactions, but most of it is discarded. Therefore, by producing ethylene glycol using discarded glycerol as a raw material, the amount of glycerol discarded can be reduced, and the amount of carbon dioxide generated during the disposal of glycerol by incineration or other methods can also be reduced. DETAILED DESCRIPTION OF THE INVENTION

[0007] "Genetically modified microorganisms" The genetically modified microorganism of the present invention can produce ethylene glycol from glycerol based on the conversion pathway shown below. [ka]

[0008] The genetically modified microorganism of the present invention can be obtained by introducing into a microorganism DNA encoding the enzymes that perform the conversions in Steps 1 to 5 of the above conversion pathway. In the genetically modified microorganism of the present invention, the microorganism to be genetically modified is not particularly limited, and examples thereof include yeast, Escherichia coli, lactic acid bacteria, Bacillus subtilis, actinomycetes, coryneform bacteria, and pseudomonadform bacteria, with yeast and Escherichia coli being preferred because they are easy to transform and culture. Examples of yeast include those of the genus Pichia, Hansenula, Yarrowia, Saccharomyces, Schizosaccharomyces, Brettanomyces, Candida, Klocckera, Kluyveromyces, Issatchenkia, Schwanniomyces, Trichosporon, Yamadazyma, and Pachysolen, and more specifically, Pichia pastoris, Hansenula polymorpha, Yarrowia lipolytica, Saccharomyces cerevisiae, and Schizosaccharomyces Examples of Escherichia coli include Escherichia coli and Escherichia fergusonii.

[0009] The genetically modified microorganism of the first embodiment of the present invention has introduced therein DNA encoding enzyme A (Steps 1 and 2), which converts glycerol via glyceraldehyde to glyceric acid, enzyme C (Step 3), which converts glyceric acid to hydroxypyruvic acid, and enzyme D (Step 4), which converts hydroxypyruvic acid to glycolaldehyde. The enzyme that performs the conversion in Step 5 is naturally present in the microorganism.

[0010] Enzyme A is not particularly limited as long as it converts glycerol to glyceric acid via glyceraldehyde, and examples include the oxidases set forth in SEQ ID NOS: 1 to 20, the alcohol oxidases set forth in SEQ ID NOS: 21 to 25, and the alcohol dehydrogenases set forth in SEQ ID NOS: 26 to 29, all of which belong to Enzyme Group A in Table 1, or enzymes having amino acid sequences with 90% or greater sequence identity to the sequences set forth in SEQ ID NOS: 1 to 29. DNA encoding one or more of these enzymes can be introduced. Among these, ArdAldO (SEQ ID NOS: 1) is preferred because it exhibits high activity.

[0011] [Table 1]

[0012] The sequence identity of amino acid sequences can be determined using methods well known to those skilled in the art, such as sequence analysis software, for example, the blastn or blastp program of the BLAST algorithm, or the fasta program of the FASTA algorithm. As used herein, "sequence identity" refers to the frequency, expressed as a percentage, of identical amino acids appearing at identical positions in amino acid sequences, including gaps, when amino acid sequence X and the amino acid sequence to be evaluated are aligned, and gaps are introduced as necessary to maximize the degree of amino acid identity between the two. In the present specification, the sequence identity of the amino acid sequences is preferably 92% or more, more preferably 94% or more, even more preferably 96% or more, and even more preferably 98% or more.

[0013] Enzyme C is not particularly limited as long as it converts glyceric acid to hydroxypyruvic acid, and examples include the hydroxyacid oxidases set forth in SEQ ID NOS: 67 to 77, hydroxyacid dehydrogenases set forth in SEQ ID NOS: 78 to 80, and enzymes having amino acid sequences with 90% or greater sequence identity to the sequences set forth in SEQ ID NOS: 67 to 80, all of which belong to enzyme group C in Table 2. DNA encoding one or more of these enzymes can be introduced. Among these, FtLox (SEQ ID NO: 67) is preferred because it exhibits high activity.

[0014] [Table 2]

[0015] Enzyme D is not particularly limited as long as it converts hydroxypyruvic acid to glycolaldehyde, and examples include the decarboxylases set forth in SEQ ID NOS: 81 to 106 belonging to Enzyme Group D in Table 3, or enzymes having amino acid sequences with 90% or more sequence identity to the sequences set forth in SEQ ID NOS: 81 to 106. DNA encoding one or more of these enzymes can be introduced. Among these, KsmdlC (SEQ ID NOS: 81) is preferred because it exhibits high activity.

[0016] [Table 3]

[0017] The genetically modified microorganism of the first embodiment is preferably introduced with DNA encoding an enzyme B that converts glyceraldehyde to glyceric acid and an enzyme E that converts glycolaldehyde to ethylene glycol. By introducing the DNA encoding the enzymes B and E, ethylene glycol can be produced more efficiently.

[0018] Enzyme B is not particularly limited as long as it converts glyceraldehyde to glyceric acid, but examples include the aldehyde dehydrogenases set forth in SEQ ID NOS: 44 to 66, which belong to Enzyme Group B in Table 4, or enzymes having amino acid sequences with 90% or more sequence identity to the sequences set forth in SEQ ID NOS: 44 to 66. DNA encoding one or more of these enzymes can be introduced. Among these, KppuuC (SEQ ID NOS: 44) is preferred because it exhibits high activity.

[0019] [Table 4]

[0020] Enzyme E is not particularly limited as long as it converts glycerol to hydroxypyruvic acid, but examples include the reductases set forth in SEQ ID NOS: 107 to 110, the dehydrogenases set forth in SEQ ID NOS: 111 to 117, and enzymes having amino acid sequences with 90% or more sequence identity to the sequences set forth in SEQ ID NOS: 107 to 110, all of which belong to Enzyme Group E in Table 5. DNA encoding one or more of these enzymes can be introduced. Among these, EcfucO (SEQ ID NOS: 107) is preferred because it exhibits high activity.

[0021] [Table 5]

[0022] The first embodiment of the genetically modified microorganism includes, for example, Examples include P. pastoris CCI-p-1 (P. pastoris::ArdAldO::FtLox::KsmdlC, hereinafter also referred to as "CCI-p-1 strain"), a yeast into which genes encoding ArdAldO (SEQ ID NO: 1) as enzyme A, FtLox (SEQ ID NO: 67) as enzyme C, and KsmdlC (SEQ ID NO: 81) as enzyme D have been introduced, and E. coli CCI-e-1 (E. coli pPGP-ArdAldO, pPGPH-FtLox-KsmdlC, hereinafter also referred to as "CCI-e-1 strain"), an Escherichia coli strain. Another example is P. pastoris CCI-p-3 (P. pastoris::ArdAldO::KpPuuC::FtLox::KsmdlC::EcfucO; hereinafter also referred to as "CCI-p-3 strain"), a yeast into which genes encoding ArdAldO (SEQ ID NO: 1) as enzyme A, KppuuC (SEQ ID NO: 44) as enzyme B, FtLox (SEQ ID NO: 67) as enzyme C, KsmdlC (SEQ ID NO: 81) as enzyme D, and EcfucO (SEQ ID NO: 107) as enzyme E have been introduced. The CCI-p-1, CCI-e-1, and CCI-p-3 strains were received on February 28, 2024, at the National Institute of Technology and Evaluation, Patent Microorganisms Depositary (NPMD) (2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan (Postal Code: 292-0818)) under the receipt numbers NITE ABP-04087, 04091, and 04089, respectively.

[0023] The genetically modified microorganism of the second embodiment of the present invention has introduced therein DNA encoding enzyme A2 (Step 1), which converts glycerol to glyceraldehyde; enzyme B (Step 2), which converts glyceraldehyde to glyceric acid; enzyme C (Step 3), which converts glyceric acid to hydroxypyruvic acid; and enzyme D (Step 4), which converts hydroxypyruvic acid to glycolaldehyde.

[0024] Enzyme A2 is not particularly limited as long as it converts glycerol to glyceraldehyde, and examples include the oxidases set forth in SEQ ID NOS: 30 to 35, the alcohol oxidases set forth in SEQ ID NOS: 36 to 39, and the alcohol dehydrogenases set forth in SEQ ID NOS: 40 to 43, all of which belong to enzyme group A2 in Table 6, or enzymes having amino acid sequences with 90% or greater sequence identity to the sequences set forth in SEQ ID NOS: 30 to 43. DNA encoding one or more of these enzymes can be introduced. Among these, CbAldO (SEQ ID NOS: 30) is preferred because it exhibits high activity.

[0025] [Table 6]

[0026] Enzyme B, enzyme C, and enzyme D include the same enzymes as those in the genetically modified microorganism of the first embodiment, and one or more types of DNA encoding each enzyme can be introduced.

[0027] The genetically modified microorganism of the second embodiment is preferably introduced with a DNA encoding an enzyme E that converts glycolaldehyde to ethylene glycol. By introducing a DNA encoding the enzyme E, ethylene glycol can be produced more efficiently. Examples of enzyme E include the same enzymes as those in the genetically modified microorganism of the first embodiment, and one or more types of DNA encoding each enzyme can be introduced.

[0028] Examples of genetically modified microorganisms according to the second embodiment include P. pastoris CCI-p-2 (P. pastoris::CbAld::KpPuuC::FtLox::KsmdlC; hereinafter also referred to as "CCI-p-2 strain"), a yeast strain into which genes encoding CbAldO (SEQ ID NO: 30) as enzyme A2, KppuuC (SEQ ID NO: 44) as enzyme B, FtLox (SEQ ID NO: 67) as enzyme C, and KsmdlC (SEQ ID NO: 81) as enzyme D have been introduced, and E. coli CCI-e-2 (E. coli pPGP-CbAldO-KpPuuC, pPGPH-FtLox-KsmdlC; hereinafter also referred to as "CCI-e-2 strain"), an Escherichia coli strain. Another example is P. pastoris CCI-p-4 (P. pastoris::CbAldO::KpPuuC::FtLox::KsmdlC::EcpuuC; hereinafter also referred to as "CCI-p-4 strain"), a yeast into which genes encoding CbAldO (SEQ ID NO: 30) as enzyme A2, KppuuC (SEQ ID NO: 44) as enzyme B, FtLox (SEQ ID NO: 67) as enzyme C, KsmdlC (SEQ ID NO: 81) as enzyme D, and EcfucO (SEQ ID NO: 107) as enzyme E have been introduced. The CCI-p-2, CCI-e-2, and CCI-p-4 strains were received on February 28, 2024, at the National Institute of Technology and Evaluation, Patent Microorganisms Depositary (NPMD) (2-5-8 Kazusa Kamatari, Kisarazu City, Chiba Prefecture, Japan (Postal Code: 292-0818)) under the receipt numbers NITE ABP-04088, 04092, and 04090, respectively.

[0029] "Method of producing ethylene glycol" Ethylene glycol can be produced from glycerol by culturing the microorganism of the present invention having the above conversion pathway in a medium containing glycerol. The culture conditions for the microorganisms can be set depending on the microorganism. For example, YPG medium, LB+Amp+glycerol medium, etc. can be used, and the microorganisms can be cultured under aerobic conditions, pH 4.0 to 10.0, and 25 to 37°C.

[0030] The glycerol concentration in the medium is not particularly limited as long as it is within a range that does not interfere with the growth of the genetically modified microorganism of the present invention, and can be, for example, 0.5% by weight or more and 20% by weight or less. The ethylene glycol concentration is preferably 1% by weight or more, more preferably 3% by weight or more, and even more preferably 5% by weight or more. Cultivation in a liquid medium is preferred because it allows the recombinant microorganism to be cultured in large quantities and also allows for continuous production of ethylene glycol by withdrawing the ethylene glycol-containing medium and supplying the same amount of medium, in which case the new medium to be supplied preferably contains glycerol. [Example]

[0031] ·screening Enzymes were selected from published literature and databases (UniProt), and the activity of the enzymes against the substrates was evaluated to perform primary screening (referred to as primary in Tables 1 to 6). A phylogenetic tree was created for the enzymes with high activity in one screening according to the following procedure. (1) A homology search was performed using NCBI's BLAST based on the amino acid sequences of the enzymes with high activity obtained in the primary screening (listed as the original enzymes for the secondary screening in Tables 1 to 6). (2) The results of the homology search were clustered using CD-HIT. (3) Amino acid sequences were aligned to the clustered sequences using mafft. (4) Maximum likelihood estimation of the phylogenetic tree was performed using iq-tree to create a phylogenetic tree. Several enzymes were selected from each clade of the constructed phylogenetic tree (listed as secondary in Tables 1 to 6).

[0032] Activity evaluation (1) Culture medium YPD medium (polypeptone 20g / L, yeast extract 10g / L, glucose 20g / L) LB+Amp medium (polypeptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, ampicillin sodium 0.1g / L) (2) Buffer used Washing buffer (10 mM sodium phosphate buffer; pH 6.8, 2 mM EDTA) Extraction buffer (100 mM sodium phosphate buffer; pH 6.8, 2 mM magnesium sulfate, 1 mM dithiothreitol)

[0033] (3)Culture The strains were cultured in 5 mL of YPD medium (yeast) and LB medium (Escherichia coli) with shaking at 30°C, 140 rpm for 24 hours. (4) Crushing bacterial cells The cells were collected from the culture medium, washed with a washing buffer, suspended in an extraction buffer, and disrupted with 0.5 mm glass beads. After disruption, the cells were centrifuged and the supernatant was collected and used as a cell lysate for activity measurement.

[0034] (5) Activity evaluation ·Enzyme group A, A2, B (step1,2) 25 μL of the recovered cell lysate was mixed with a reaction solution containing 20 mM of the substrate shown in Table 7 below, and the change in absorbance at 555 nm was measured at 30°C for 5 minutes to calculate the activity value. The activity values ​​are shown in Tables 1, 6, and 4 above, respectively. [Table 7]

[0035] ·Enzyme group C (step 3) 25 μL of the recovered cell lysate was mixed with a reaction solution containing 10 mM of the substrate shown in Table 8 below, and the change in absorbance at 550 nm was measured at 30° C. for 5 minutes to calculate the activity value. The activity values ​​are shown in Table 2 above. [Table 8]

[0036] ·Enzyme group D, E (step 4, 5) 25 μL of the recovered cell lysate was mixed with a reaction solution containing 20 mM of the substrate shown in Table 9 below, and the change in absorbance at 340 nm was measured for 5 minutes at 30°C to calculate the activity. The activity values ​​are shown in Tables 3 and 5 above, respectively. [Table 9]

[0037] Creation of genetically modified microorganisms 1. Materials and general procedures 1.1 Reagents used (1) Plasmid construction ·In-Fusion HD Cloning Kit (Takara) ·KOD one (Toyobo) SpeI (Takara) ·XhoI(Takara) KasI (New England BioLabs Japan) EcoRV (Takara) Bsp1407I(Takara) Aat II (Takara) NotI(Takara) AscI (Nihon Genetics)

[0038] (2) Yeast transformation Lithium acetate dihydrate (Wako) 50% w / v polyethylene glycol 3,350 (Nacalai) Dithiothreitol (DTT) (Nacalai) Carrier DNA (Takara) (3) Antibiotics Ampicillin sodium (Wako) G418 Disulfate (Tokyo Chemical Industry Co., Ltd.) Hygromycin B (Nacalai) ·ClonNAT (Wako)

[0039] 1.2 Plasmids used (1) pPGP-EGFP (Ito, Y. et al, “Deletion of DNA Ligase IV Homolog Confers Higher Gene Targeting Efficiency on Homologous Recombination in “Komagataella Phaffii” FEMS Yeast Res.2018,18,No.foy074.) (2) pPGPH-EGFP (Kumokita R. et al,“Construction of an l-Tyrosine Chassis in Pichia pastoris Enhances Aromatic Secondary Metabolite Production from Glycerol”ACS Synth. Biol.2022,11,6,2098-2107) (3) pPNS (Kumokita R. et al,“Construction of an l-Tyrosine Chassis in Pichia pastoris Enhances Aromatic Secondary Metabolite Production from Glycerol” ACS Synth. Biol.2022,11,6,2098-2107)

[0040] 1.3 Genes used The DNA was artificially synthesized by GeneArt (Thermo Fisher Scientific Inc.) after being optimized for S. cerevisiae codons and equipped with a homologous sequence for in-fusion.

[0041] 1.4 Transformation of E. coli (1) E. coli used E. coli DH5α (2) Culture medium used LB+Amp medium (polypeptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, ampicillin sodium 0.1g / L) (3) Transformation method The plasmid was suspended in competent cells, incubated at 42°C for 1 minute, transformed, and plated on LB+Amp medium. The resulting colonies were checked by PCR to see if the gene had been introduced, and the sequence was confirmed.

[0042] 1.5 Yeast transformation (1) Yeast used P. pastoris CBS7435 (2) Culture medium used YPD medium (polypeptone 20g / L, yeast extract 10g / L, glucose 20g / L) YPD+G418 medium (YPD medium + G418 500μg / mL) YPD + hygromycin medium (YPD medium + hygromycin 300 μg / mL) YPD + clonNAT medium (YPD medium + clonNAT 50 μg / mL)

[0043] (3) Transformation method This was performed according to the one-step transformation method using lithium acetate (Chen et al. Current Genetics, 21(1), 83-84, 1992). procedure 1. Culture overnight in 5 mL of YPD. 2.OD 600 = 10 x 1 ml of bacteria collected. 3. Wash with 500 μL of sterile water. 4. Remove the supernatant with a pipette and add the solution in Table 10 below to the bacterial cells and mix. [Table 10] 5. Incubate at 42°C for 30 minutes. 6. After centrifugation, the supernatant was removed and the cells were resuspended in 500 μL of YPD (without drug) and cultured for recovery at 30°C and 140 rpm for 2 hours. After 2 hours, 100 μL of the culture was plated on a plate. (4) How to check Colonies were picked up and PCR was used to confirm whether the gene had been introduced.

[0044] 2. Preparation of yeast carrying ACD enzymes CCI-p-1 strain: P.pastoris CCI-p-1(P.pastoris::ArdAldO::FtLox::KsmdlC) 2.1 Plasmid construction (1) Plasmid for introducing ArdAldO (pPGP-ArdAldO plasmid) 1. Construction of pPGP-ArdAldO Plasmid pPGP-EGFP was digested with SpeI and XhoI and an ArdAldO synthetic gene fragment (SEQ ID NO: 118) was inserted by in-fusion to prepare the vector.

[0045] (2) Plasmid for introducing FtLox and KsmdlC (pPGPH-FtLox-KsmdlC plasmid) 1. Construction of pPGPH-FtLox plasmid The vector was prepared by digesting pPGPH-EGFP with SpeI and XhoI and incorporating a synthetic FtLox gene fragment (SEQ ID NO: 121) by in-fusion. 2. Construction of pPGP-KsmdlC Plasmid The vector was prepared by digesting pPGP-EGFP with SpeI and XhoI and incorporating a synthetic KsmdlC gene fragment (SEQ ID NO: 122) by in-fusion. 3. Construction of pPGPH-FtLox-KsmdlC plasmid A DNA fragment was generated by PCR amplification using pPGP-KsmdlC as a template and a primer set (pPGPH-GAPDH, pPGPH-AOX1t). The generated DNA fragment was then in-fused into pPGPH-FtLOx digested with KasI. (primer set) pPGPH-GAPDH:taccgcatcaggcgcTTTTTTGTAGAAATGTCTTGGTGTCC pPGPH-AOX1t:aatggcgaatggcgcGGATCTAAGCTTGCACAAACGAAC

[0046] 2.2 Yeast transformation (1) Introduction of ArdAldO The pPGP-ArdAldO plasmid was digested with EcoRV and transformed into P. pastoris CBS7435, which was then plated on YPD+G418 agar medium, and the resulting colonies were examined by PCR to confirm whether the gene had been introduced. (2) Introduction of FtLox and KsmdlC The pPGPH-FtLox-KsmdlC plasmid was digested with Bsp1407I, and the strain into which ArdAldO had been introduced was transformed. The resulting colonies were then plated on YPD + hygromycin agar medium, and PCR was used to confirm whether the gene had been introduced. P. pastoris CCI-p-1 (P. pastoris::ArdAldO::FtLox::KsmdlC) was constructed. The genes introduced are shown in Table 11. [Table 11]

[0047] 3. Preparation of yeast carrying the enzyme group ABCDE CCI-p-3 strain: P.pastoris CCI-p-3(P.pastoris::ArdAldO::KpPuuC::FtLox::KsmdlC::EcfucO) 3.1 Plasmid construction (1) Plasmid for introducing ArdAldO and KpPuuC (pPGP-ArdAldO-KppuuC plasmid) 1. Construction of pPGP-ArdAldO plasmid pPGP-EGFP was digested with SpeI and XhoI and an ArdAldO synthetic gene fragment (SEQ ID NO: 118) was inserted by in-fusion (similar to 2.1(1)).

[0048] 2. Construction of pPGPH-KppuuC plasmid pPGPH-EGFP was digested with SpeI and XhoI and cloning was performed using KpPuuC The synthetic gene fragment (SEQ ID NO: 120) was integrated by in-fusion to produce the vector. 3. Construction of pPGP-ArdAldO-KpPuuC plasmid A DNA fragment was generated by PCR amplification using pPGPH-KppuuC as a template and a primer set (pPGP-GAPDH, pPGP-AOX1t). The generated DNA fragment was then in-fused into pPGP-ArdAldO digested with AatII. (primer set) pPGP-GAPDH:AAAAGTGCCACCTGACGTCTTTTTTGTAGAAATGTCTTGG pPGP-AOX1t:ATAATGGTTTCTTAGACGTCAAGCTTGCACAAACGAAC

[0049] (2) Plasmid for introducing FtLox and KsmdlC (pPGPH-FtLox-KsmdlC plasmid) It was created in the same manner as 2.1(2). (3) Plasmid for introducing EcFucO 1. Construction of pPNS-EcfucO Plasmid The pPNS was digested with NotI and a fragment of the synthetic EcfucO gene (SEQ ID NO: 123) was integrated by in-fusion.

[0050] 3.2 Yeast transformation (1) Introduction of ArdAldO and KppuuC It was installed in the same way as 2.2(1). (2) Introduction of FtLox and KsmdlC It was introduced in the same way as 2.2(2). (3) Introduction of EcfucO The pPNS-EcfuoO plasmid was digested with AscI, and the strain containing ArdAldO, KppuuC, FtLox, and KsmdlC was transformed. The resulting colonies were plated on YPD+ClonNAT agar medium, and PCR was used to confirm the presence of the genes. P. pastoris CCI-p-3 (P. pastori::ArdAldO::KppuuC::FtLox::KsmdlC::EcpuuC) was generated. The genes introduced are shown in Table 12. [Table 12]

[0051] 4. Preparation of yeast carrying the A2BCD enzyme group CCI-p-2 strain: P.pastoris CCI-p-2(P.pastoris ::CbAld::KpPuuC::FtLox::KsmdlC) 4.1 Plasmid construction (1) Plasmid for introducing CbAldO and KpPuuC (pPGP-CbAldO-KpPuuC plasmid) This was prepared in the same manner as in 3.1(1), except that ArdAldO was replaced with CbAldO (SEQ ID NO: 119). (2) Plasmid for introducing FtLox and KsmdlC (pPGPH-FtLox-KsmdlC plasmid) It was created in the same manner as 2.1(2).

[0052] 4.2 Yeast transformation (1) Introduction of CbAldO and KpPuuC It was installed in the same way as 2.2(1). (2) Introduction of FtLox and KsmdlC P. pastoris CCI-p-2 (P. pastoris::CbAldO::KpPuuC::FtLox::KsmdlC) was constructed using the same procedure as in 2.2(2). The genes introduced are shown in Table 13. [Table 13]

[0053] 5. Preparation of yeast carrying the enzyme group A2BCDE CCI-p-4 strain: P.pastoris CCI-p-4(P.pastoris ::CbAldO::KpPuuC::FtLox::KsmdlC::EcpuuC) 5.1 Plasmid construction (1) Plasmid for introducing CbAldO and KpPuuC (pPGP-CbAldO-KpPuuC plasmid) It was prepared in the same manner as in 3.1(1), except that ArdAldO was replaced with CbAldO. (2) Plasmid for introducing FtLox and KsmdlC (pPGPH-FtLox-KsmdlC plasmid) It was created in the same manner as 2.1(2). (3) Plasmid for introducing EcFucO It was created in the same manner as in 3.1(3).

[0054] 5.2 Yeast transformation (1) Introduction of CbAldO and KpPuuC It was installed in the same way as 2.2(1). (2) Introduction of FtLox and KsmdlC It was introduced in the same way as 2.2(2). (3) Introduction of EcfucO P. pastoris CCI-p-4 (P. pastoris::CbAldO::KpPuuC::FtLox::KsmdlC::EcfucO) was constructed using the same procedure as in 3.2(3). The introduced genes are shown in Table 14. [Table 14]

[0055] 6. Preparation of E. coli transfected with enzyme group ACD CCI-e-1 strain: E.coli CCI-e-1(E.coli pPGP-ArdAldO, pPGPH-FtLox-KsmdlC) The plasmids (pPGP-ArdAldO, pPGPH-FtLox-KsmdlC) prepared in 2.1 were transformed into E. coli DH5α to prepare E. coli CCI-e-1 (E. coli pPGP-ArdAldO, pPGPH-FtLox-KsmdlC). The introduced genes are shown in Table 15. [Table 15]

[0056] 7. Preparation of E. coli carrying the enzyme group A2BCD CCI-e-2 strain: E.coli CCI-e-2 (E.coli pPGP-CbAldO-KpPuuc, pPGPH-FtLox-KsmdlC) The pPGP-CbAldO-KpPuuC and pPGPH-FtLox-KsmdlC constructs prepared in 4.1 were transformed into E. coli DH5α to construct E. coli CCI-e-2 (E. coli pPGP-CbAldO-KpPuuC, pPGPH-FtLox-KsmdlC). The introduced genes are shown in Table 16. [Table 16]

[0057] "Example 1" The CCI-p-1 strain (NITE ABP-04087, introduced gene: enzyme group ACD) was pre-cultured in YPG medium (yeast extract 1%, hypopeptone 2%, glycerol 6%) at 30°C, 140 rpm, and shaking for 24 hours. The pre-cultured cells were collected and washed twice with sterilized water. 100 mL of the same YPG medium was prepared in a Sakaguchi flask, and the cells suspended in sterilized water were analyzed by OD analysis. 600 The medium was added so that the pH became 5.0, and the mixture was cultured at 30°C with shaking at 140 rpm. The culture supernatant was analyzed by HPLC after 24, 48, and 72 hours of culture. The results are shown in Table 17. [Table 17]

[0058] The glycerol concentration decreased over time, while the ethylene glycol concentration increased, confirming that ethylene glycol could be produced from glycerol. After 72 hours of cultivation, the ethylene glycol concentration in the medium was 220 mg / L.

[0059] "Example 2" Cultivation was carried out in the same manner as in Example 1, except that the CCI-p-3 strain (NITE ABP-04089, introduced genes: enzyme group ABCDE) was used. The culture supernatant was analyzed by HPLC after 24, 48, and 72 hours of culture. The results are shown in Table 18. [Table 18]

[0060] The glycerol concentration decreased over time, while the ethylene glycol concentration increased, confirming that ethylene glycol could be produced from glycerol. After 72 hours of cultivation, the ethylene glycol concentration in the medium was 236 mg / L. Compared to the CCI-p-1 strain, which had DNA encoding enzymes A, C, and D introduced, the CCI-p-3 strain, which had DNA encoding enzymes B and E introduced, was confirmed to have improved ethylene glycol productivity.

[0061] "Example 3" Cultivation was carried out in the same manner as in Example 1, except that the CCI-p-2 strain (NITE ABP-04088, introduced gene: enzyme group A2BCD) was used. The culture supernatant was analyzed by HPLC after 24, 48, and 72 hours of culture. The results are shown in Table 19. [Table 19]

[0062] The glycerol concentration decreased over time, while the ethylene glycol concentration increased, confirming that ethylene glycol could be produced from glycerol. After 72 hours of cultivation, the ethylene glycol concentration in the medium was 204 mg / L.

[0063] Example 4 Cultivation was carried out in the same manner as in Example 1, except that the CCI-p-4 strain (NITE ABP-04090, introduced gene: enzyme group A2BCDE) was used. The culture supernatant was analyzed by HPLC after 24, 48, and 72 hours of culture. The results are shown in Table 20. [Table 20]

[0064] The glycerol concentration decreased over time, while the ethylene glycol concentration increased, confirming that ethylene glycol could be produced from glycerol. After 72 hours of cultivation, the ethylene glycol concentration in the medium was 214 mg / L. Compared to the CCI-p-2 strain, which had DNA encoding enzymes A2, B, C, and D introduced, the CCI-p-4 strain, which had DNA encoding enzyme E introduced, was confirmed to have improved ethylene glycol productivity.

[0065] "Example 5" The CCI-e-1 strain (NITE ABP-04091, introduced gene: enzyme group ACD) was pre-cultured in LB+Amp+glycerol medium (polypeptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L, ampicillin sodium 0.1 g / L, glycerol 60 g / L) at 37°C, 140 rpm, and with shaking for 24 hours. The pre-cultured cells were collected and washed twice with sterilized water. 100 mL of the same LB+Amp+glycerol medium was prepared in a Sakaguchi flask, and the cells suspended in sterilized water were analyzed at OD . 600 The medium was added so that the pH became 5.0, and the mixture was cultured at 37°C with shaking at 140 rpm. The culture supernatant was analyzed by HPLC after 24, 48, and 72 hours of culture. The results are shown in Table 21. [Table 21]

[0066] The glycerol concentration decreased over time, while the ethylene glycol concentration increased, confirming that ethylene glycol could be produced from glycerol. After 72 hours of cultivation, the ethylene glycol concentration in the medium was 51 mg / L.

[0067] "Example 6" Cultivation was carried out in the same manner as in Example 5, except that the CCI-e-2 strain (NITE ABP-04092, introduced gene: enzyme group A2BCD) was used. The culture supernatant was analyzed by HPLC after 24, 48, and 72 hours of culture. The results are shown in Table 22. [Table 22]

[0068] The glycerol concentration decreased over time, while the ethylene glycol concentration increased, confirming that ethylene glycol could be produced from glycerol. After 72 hours of cultivation, the ethylene glycol concentration in the medium was 48 g / L.

Claims

1. A genetically modified microorganism capable of producing ethylene glycol from glycerol based on the following conversion pathway: 【Chemical 1】

2. Enzyme A converts glycerol into glyceric acid via glyceraldehyde Enzyme C converts glycerate to hydroxypyruvic acid Enzyme D converts hydroxypyruvic acid to glycolaldehyde 2. The genetically modified microorganism according to claim 1, wherein a DNA encoding the

3. Enzyme A is one or more enzymes selected from the following enzyme group A: Enzyme C is one or more enzymes selected from the following enzyme group C: Enzyme D is one or more enzymes selected from the following enzyme group D:

3. The genetically modified microorganism according to claim 2, wherein Enzyme group A: enzymes having the amino acid sequences shown in SEQ ID NOs: 1 to 29 or amino acid sequences having 90% or more sequence identity with the sequences shown in SEQ ID NOs: 1 to 29 Enzyme group C: enzymes having an amino acid sequence shown in any one of SEQ ID NOs: 67 to 80, or an amino acid sequence having 90% or more sequence identity with a sequence shown in SEQ ID NOs: 67 to 80 Enzyme group D: enzymes having an amino acid sequence shown in any one of SEQ ID NOs: 81 to 106, or an amino acid sequence having 90% or more sequence identity with a sequence shown in SEQ ID NOs: 81 to 106

4. Enzyme A is ArdAldO (SEQ ID NO: 1), Enzyme C is FtLox (SEQ ID NO: 67); Enzyme D is KsmdlC (SEQ ID NO: 81); 4. The genetically modified microorganism according to claim 3,

5. Enzyme B converts glyceraldehyde into glyceric acid. Enzyme E converts glycolaldehyde to ethylene glycol The genetically modified microorganism according to claim 2, characterized in that a DNA encoding the

6. Enzyme B is one or more enzymes selected from the following enzyme group B: Enzyme E is one or more enzymes selected from the following enzyme group E:

6. The genetically modified microorganism according to claim 5, Enzyme group B: enzymes having an amino acid sequence shown in any one of SEQ ID NOs: 44 to 66, or an amino acid sequence having 90% or more sequence identity with a sequence shown in SEQ ID NOs: 44 to 66 Enzyme group E: enzymes having an amino acid sequence shown in any one of SEQ ID NOs: 107 to 117, or an amino acid sequence having 90% or more sequence identity with a sequence shown in SEQ ID NOs: 107 to 117

7. The enzyme selected from the enzyme group B is KppuuC (SEQ ID NO: 44), The enzyme selected from the enzyme group E is EcfucO (SEQ ID NO: 107), 7. The genetically modified microorganism according to claim 6,

8. Enzyme A2 converts glycerol to glyceraldehyde Enzyme B converts glyceraldehyde into glyceric acid Enzyme C converts glycerate to hydroxypyruvic acid Enzyme D converts hydroxypyruvic acid to glycolaldehyde 2. The genetically modified microorganism according to claim 1, wherein a DNA encoding the

9. The enzyme A2 is one or more enzymes selected from the following enzyme group A2: Enzyme B is one or more enzymes selected from the following enzyme group B: Enzyme C is one or more enzymes selected from the following enzyme group C: Enzyme D is one or more enzymes selected from the following enzyme group D:

9. The genetically modified microorganism according to claim 8, Enzyme group A2: enzymes having an amino acid sequence shown in any one of SEQ ID NOs: 30 to 43, or an amino acid sequence having 90% or more sequence identity with a sequence shown in SEQ ID NOs: 30 to 43 Enzyme group B: enzymes having an amino acid sequence shown in any one of SEQ ID NOs: 44 to 66, or an amino acid sequence having 90% or more sequence identity with a sequence shown in SEQ ID NOs: 44 to 66 Enzyme group C: enzymes having an amino acid sequence shown in any one of SEQ ID NOs: 67 to 80, or an amino acid sequence having 90% or more sequence identity with a sequence shown in SEQ ID NOs: 67 to 80 Enzyme group D: enzymes having an amino acid sequence shown in any one of SEQ ID NOs: 81 to 106, or an amino acid sequence having 90% or more sequence identity with a sequence shown in SEQ ID NOs: 81 to 106

10. Enzyme A2 is CbAldO (SEQ ID NO: 30); Enzyme B is KppuuC (SEQ ID NO: 44); Enzyme C is FtLox (SEQ ID NO: 67); Enzyme D is KsmdlC (SEQ ID NO: 81); 10. The genetically modified microorganism according to claim 9,

11. Enzyme E converts glycolaldehyde to ethylene glycol The genetically modified microorganism according to claim 8, wherein a DNA encoding the

12. Enzyme E is one or more enzymes selected from the following enzyme group E:

12. The genetically modified microorganism according to claim 11, Enzyme group E: enzymes having an amino acid sequence shown in any one of SEQ ID NOs: 107 to 117, or an amino acid sequence having 90% or more sequence identity with a sequence shown in SEQ ID NOs: 107 to 117

13. The enzyme selected from the enzyme group E is EcfucO (SEQ ID NO: 107), 13. The genetically modified microorganism according to claim 12,

14. The genetically modified microorganism according to any one of claims 1 to 13, wherein the microorganism is yeast or Escherichia coli.

15. The genetically modified microorganism according to claim 14, characterized in that the microorganism is one or more selected from the group consisting of CCI-p-1 strain (received number: NITE ABP-04087), CCI-p-2 strain (received number: NITE ABP-04088), CCI-p-3 strain (received number: NITE ABP-04089), CCI-p-4 strain (received number: NITE ABP-04090), CCI-e-1 strain (received number: NITE ABP-04091), and CCI-e-2 strain (received number: NITE ABP-04092).

16. A genetically modified microorganism having the following conversion pathway is cultured in a medium containing glycerol, A method for producing ethylene glycol, comprising producing ethylene glycol from glycerol. 【Chemistry 2】

Images