RNA therapeutics and use methods thereof
ADAR-aRNA compositions enhance ADAR expression and editing efficiency, addressing issues in current RNA editing therapeutics by increasing ADAR activity and improving therapeutic outcomes for diseases like autoimmune and neurodegenerative disorders.
Patent Information
- Application Number
- JP2025096261
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-12-02
- Filing Date
- 2025-06-10
- Publication Date
- 2025-10-07
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
Current RNA editing therapeutics using ADAR-catalyzed adenosine-to-inosine base editing face challenges such as low ADAR activity, particularly in the brain, and issues like off-target editing, immunogenicity, and delivery complications, which hinder their efficacy in treating human diseases.
Development of adenosine deaminase (ADAR)-activating RNA (aRNA) compositions that enhance ADAR expression and activity, specifically designed to target ADAR1p110, ADAR1p150, ADAR2, or ADAR3, with complementary sequences and chemical modifications, delivered via vectors or vehicles to modulate ADAR activity in targeted tissues.
The ADAR-aRNA compositions significantly increase ADAR expression by up to 350% and enhance RNA editing efficiency, providing therapeutic benefits in treating diseases associated with excessive ADAR activity, including autoimmune and neurodegenerative disorders.
Smart Images

Figure 2025148338000001 
Figure 2025148338000002 
Figure 2025148338000003
Abstract
Description
[Technical Field]
[0001] The present invention is in the field of medicine. More specifically, the present invention relates to RNA editing therapeutic agents. .
[0002] Essentially, RNA editing is a biological process in which RNA is modified post-transcriptionally. Similar to transcription, RNA editing is an enzyme-catalyzed process that makes individual modifications to nucleotides. However, unlike DNA editing, RNA editing occurs at the RNA level (e.g., messenger mRNA, double-stranded RNA (dsRNA), microRNA (miRNA) ) etc.) to change the nucleotide but not the genome.
[0003] Adenosine deaminase acting on RNA (ADAR) is involved in RNA editing ADARs are a family of proteins that specifically target double-stranded RNA (dsRNA) during transcription. and then modifying the adenosine of the dsRNA to an inosine in the resulting mRNA. In humans, there are four isoforms of ADAR (ADAR1p110, A ADAR1p150, ADAR2 and ADAR3 are known. ADAR1p150 and ADAR2 are involved in RNA adenosine-to-inosine editing. It is known to play a role in innate immunity and RNA editing in nervous system tissues, among other functions. ADAR3 mediates the binding of other ADAR proteins (e.g., It is thought to negatively regulate RNA editing by competing with ADAR1 and 2. Overall, ADAR-catalyzed adenosine-to-inosine RNA editing is protective. It is understood that this contributes to the expansion of transcript function and diversity. Dysregulation of ADAR-catalyzed RNA editing is a key driver of several diseases, including autoimmune and neurodegenerative disorders. It is associated with several diseases.
[0004] The concept of using RNA as a therapeutic agent to increase or decrease mRNA translation are still in their early stages and continue to expand. Examples of such RNA therapeutics include RNA Guidance using systems such as interference, RNA activation, and CRISPR-Cas systems This includes targeted RNA editing by RNAi. RNA editing therapies for treating human diseases. Although promising, the use of the drug is still in its early stages and faces many obstacles, including: , RNA editing therapeutics utilizing ADAR-catalyzed adenosine-to-inosine base editing has proven to be problematic in efficacy due to low ADAR activity. ADAR expression in the brain is known to be lower than in other organisms, and varies depending on the tissue system. As a result, ADAR-catalyzed RNA editing systems are considered to be inefficient. To overcome these known problems, synthetically produced Aβ containing modified ADARs was developed. However, the use of synthetic ADARs in RNA-editing therapy remains challenging. have been found to be highly resistant to ribozymes, with significant off-target editing, immunogenicity, toxicity, and delivery-related complications. Therefore, for use in treating human diseases, it is necessary to overcome these challenges. There is a need for RNA editing therapies that utilize ADAR-catalyzed editing to overcome one or more of these problems. still exists.
[0005] Accordingly, the present disclosure provides compositions and methods that address one or more of the problems outlined above. More specifically, embodiments of the present disclosure provide adenosine dehydrogenase (ADD) that acts on RNA enzymes. aminase ("ADAR")-activating RNA (aRNA) that enhances ADAR expression Pre-regulates adenosine deaminase ("ADAR") activity acting on RNA enzymes According to an embodiment of the present disclosure, ADARs are ADARs. 1p110, ADAR1p150, ADAR2, or ADAR3. In some embodiments, the ADAR aRNA is about 15 to about 50 nucleotides. In some embodiments, the ADAR aRNA is about 19 to about 30 nucleotides. In specific embodiments, the ADAR aRNA is 21 or 22 nucleotides.
[0006] According to embodiments, the ADAR aRNA comprises a sense sequence and an antisense sequence. The ADAR aRNA antisense sequence is complementary to the ADAR target genomic sequence and is The strand sequence is complementary to the complementary strand sequence of the ADAR target sequence. Therefore, ADAR aRNA sense and antisense have a small number of targets for each. According to an embodiment of the present disclosure, the ADAR aRNA target sequence is The ADAR target sequence is located within -3000 to +150 nucleotides of the transcription start site. According to some embodiments, the ADAR aRNA target sequence is selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 , 6, 7, 8, 9, 10, 11, 12, and / or 13. According to particular embodiments of the ADAR aRNA, the ADAR aRNA is selected from the group consisting of SEQ ID NOs: 14 to 16. ADAR1p110 aR conferred by one or more of 36 and 100-107 According to certain embodiments of the ADAR aRNAs provided herein, AR aRNA may be selected from one or more of SEQ ID NOs: 37-99, 108-113, and 134. The ADAR1p150 aRNA provided herein is an ADAR1p150 aRNA. According to particular embodiments of the aRNA, the ADAR aRNA is selected from the group consisting of SEQ ID NOs: 114-133 The ADAR2 aRNA provided herein is provided by one or more of the following: According to a particular embodiment of the ADAR aRNA, the ADAR aRNA is an ADAR3 According to some such embodiments, the target sequence is SEQ ID NO: 12 and / or within 13.
[0007] In some embodiments of the present disclosure, the ADAR aRNA comprises a sense strand and an antisense strand. In some embodiments, the ADAR aRNA comprises a 3' tail on one or both strands. In some such embodiments, at least one modified nucleotide is included. At least one modified nucleotide may be thio-modified, amino-modified, phosphate-modified, or cholesterol-modified. - Triethylene glycol (TEG)-modified, methyl-modified, and fluoro-modified nucleotides The nucleotides may include modifications from at least one of:
[0008] According to some embodiments of the present disclosure, the ADAR aRNA comprises a single strand. According to another embodiment, the ADAR aRNA is a double stranded molecule having an antisense strand and a sense strand. In some such embodiments, the antisense strand and the sense strand each comprise a single strand. In yet another embodiment, the antisense strand and In yet another embodiment, the sense strands each independently have about 19 to about 30 nucleotides. The antisense and sense strands are each independently about 21 nucleotides. In an embodiment, at least one of the antisense strand and the sense strand independently comprises a 3' overhang. Includes ng.
[0009] In some embodiments of the present disclosure, the ADAR aRNAs provided herein are nucleic acids Encoded on a vector.
[0010] Additionally, according to some embodiments of the ADAR aRNAs provided herein: The aRNA is linked to a ligand targeting moiety. The targeting moiety is GalNAc.
[0011] According to some further embodiments, the ADAR aRNAs provided herein are According to some such embodiments, the second RNA is linked to a therapeutic RNA. In some embodiments, the therapeutic RNA is an interfering RNA (iRNA) or and microRNA (miRNA); messenger RNA (mRNA); single guide guide RNA (gRNA) containing RNA (sgRNA); or activating RNA (aRNA) The antisense oligonucleotide (ASO) comprises one of the following:
[0012] According to the embodiments of the ADAR aRNA provided herein, the ADAR aRNA is It binds to the Argonaute 2 (AGO2) protein.
[0013] According to some embodiments, the ADAR aRNA is linked to a delivery vehicle. In some embodiments, the delivery vehicle is an antibody, or fragment thereof, an scFv, a peptide, The nanoparticles comprise at least one of GalNAc, an apatamer, or a nanoparticle.
[0014] According to some further embodiments, the ADAR aRNAs provided herein are According to some such embodiments, the delivery vehicle is fully or partially enclosed. The delivery vehicle may be a lipid, a liposome, a lipoplex, a polymer, or a nanoparticle. Contains at least one.
[0015] Additionally, provided herein are methods for modulating ADAR expression, thereby providing a patient with An ADAR aRNA of the present disclosure is administered. According to some such methods, an ADA In some such methods, ADAR expression is increased by at least 20%. , at least 30%, at least 40%, at least 50%, at least 100%, at least at least 150%, at least 200%, at least 250%, at least 300%, or Increase by at least 350%.
[0016] According to some embodiments of the present disclosure, a therapeutically effective amount of the ADAR aRNA of the present disclosure is administered. In certain embodiments, methods of treating AD include administering to a subject a therapeutically effective amount of a compound selected from the group consisting of acetaminophen, ... The AR aRNA is ADAR3 aRNA, and the ADAR3 target sequence is SEQ ID NO: 12 and In some such embodiments, the ADAR3 aRNA is within A The antibodies are delivered to tissues that exhibit overexpression of ADAR1 and / or ADAR2. According to the study, the disease is characterized by excessive transcriptional editing catalyzed by ADAR1 or ADAR2. In some embodiments, the disease is characterized by cancer, tumorigenesis, metastasis, brain cancer, In some embodiments, the disease is one of a chronic neurological disorder, an immune disorder, or an autoimmune disorder. According to the present invention, the ADAR3 aRNA is delivered to the CNS. A therapeutically effective amount of a therapeutic RNA against the
[0017] The present disclosure provides RNA compositions, including therapeutic RNAs and ADAR aRNAs, as provided herein. Also provided are therapeutic RNAs. According to some such embodiments, the therapeutic RNA is an mRNA A, miRNA, sgRNA, aRNA, iRNA, or ASO.
[0018] Further provided by the present disclosure are methods for treating human diseases. Such methods include administering to a human a therapeutically effective amount of an RNA editing therapeutic, Therapeutic agents include therapeutic RNAs and ADAR aRNAs of the present disclosure. In some embodiments, the therapeutic RNA and the ADAR aRNA are co-administered. In another embodiment, the therapeutic RNA and the ADAR aRNA are co-formulated. The therapeutic RNA and the ADAR aRNA are linked. At least one of the therapeutic RNA and the ADAR aRNA is contained in a delivery vehicle. According to some such embodiments, the delivery vehicle The lipidoid, liposome, lipoplex, polymer, or nanoparticle may be at least one of: In some embodiments, the therapeutic RNA and the ADAR aRNA At least one is coupled to a delivery vehicle. According to some such embodiments, The delivery vehicle may be an antibody or a fragment thereof, a scFv, a peptide, GalNAc, an aptamer, or the like. The nanoparticles may be either nanoparticles or nanoparticles.
[0019] Additionally, according to some embodiments, the therapeutic RNA, ADA provided herein A pharmaceutical composition comprising the R aRNA and at least one pharmaceutically acceptable excipient is disclosed. According to some embodiments, the therapeutic RNA is selected from the group consisting of mRNA, miRNA, and the like. The nucleic acid sequence may include one of RNA, sgRNA, aRNA, iRNA, or ASO.
[0020] Additionally, the present disclosure provides a method for treating a rheumatoid arthritis comprising administering to a human a therapeutically effective amount of a pharmaceutical composition of the present disclosure. Also provided are methods of treating human disease. According to such embodiments, the pharmaceutical composition comprises a therapeutic Therapeutic RNA, ADAR aRNA provided by the present disclosure, and pharmaceutically acceptable carriers According to some such embodiments, the therapeutic RNA and the ADAR aRNA A is co-administered with the therapeutic RNA. In some embodiments, the therapeutic RNA and the ADAR aRNA In some embodiments, the therapeutic RNA and the ADAR aRNA are co-formulated. Further, in some embodiments, the therapeutic RNA and the ADAR aR are linked. At least one of the NAs is fully or partially encapsulated within the delivery vehicle. According to some such embodiments, the delivery vehicle is a lipidoid, a liposome, a lipopeptide, or a soluble or soluble ... In some embodiments, the polymer comprises at least one of a polymer, a cellulose, a cellulose acylate ... At least one of the therapeutic RNA and the ADAR aRNA is associated with a delivery vehicle. According to some such embodiments, the delivery vehicle is an antibody or a fragment of, scFv, peptide, GalNAc, aptamer, or nanoparticle. include.
[0021] As used herein, RNA editing therapy refers to a therapeutic that modulates the translation of a protein from RNA. systems or methods that use therapeutic RNA to upregulate or downregulate Examples of RNA editing therapeutics include RNA interference, RNA activation, and CRISPR- Examples include targeted RNA editing using guide RNAs, such as the Cas system. Such RNA editing therapeutics include, but are not limited to, interfering RNA (iRNA, Also known as siRNA, microRNA (miRNA), mRNA, RNA aptamers, and aRNA (also known as saRNA) and single guide RNA (sgRNA) Therapeutic R such as antisense oligonucleotides, including guide RNA (gRNA) The term therapeutic RNA refers to RNA oligonucleotides used in RNA editing therapeutics. oligonucleotides (e.g., ASOs, iRNA, miRNA, mRNA, RNA aptamers) , aRNA, gRNA, sgRNA, etc.
[0022] As used herein, ADAR-activating RNA (ADAR aRNA) refers to an endogenous ADAR aRNA refers to the RNA that regulates the expression of ADAR. It comprises an antisense sequence that is complementary, at least 80% complementary, to the target sequence. According to the study, the ADAR aRNA target sequence is located at -3000 of the ADAR target sequence transcription start site. (e.g., 3000 nucleotides upstream) to +150 (150 nucleotides downstream) nucleobases According to a more specific embodiment, the ADAR aRNA target sequence is located between Within SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, and / or 13 In certain embodiments, for example, the ADAR1 p110 aRNA target sequence is located at: may be located within SEQ ID NO: 1, 2, and / or 3, while the ADAR1 p150 aRNA target The sequence may be located within SEQ ID NO: 4, 5, 6, and / or 7, while the ADAR2 aRNA The target sequence may be located within SEQ ID NO: 8, 9, 10 and / or 11, while ADAR3 a The RNA target sequence may be located within SEQ ID NO:12 and / or SEQ ID NO:13.
[0023] Additionally, in accordance with the present disclosure, therapeutic RNA and ADAR aRNA embodiments are directed to methods of the present invention that are well known in the art. It can be chemically synthesized or recombinantly produced using methods known in the art. Embodiments of the therapeutic RNA and / or ADAR aRNA include thio-modified, amino-modified, phosphorus-modified, Acid-modified, cholesterol-TEG-modified, methyl-modified, fluoro-modified nucleotides, etc. It may contain one or more modified nucleotides known in the art.
[0024] As used herein, "RNA" refers interchangeably to ribonucleic acid and ribonucleotides. RNA refers to both natural and non-natural (artificial, synthetic) modified or unmodified nucleotides. It refers to a gene or polynucleotide.
[0025] As used herein, "linked" means directly, to form a structure. or physically joined or connected to each other via one or more additional moieties that function as linking agents Refers to two or more parts that are connected together.
[0026] The Argonaute 2 protein (AGO2) referred to herein is a naturally occurring protein in humans. AGO2 is a protein that is known to bind to RNA. It is known to have endonuclease activity.
[0027] As referred to herein, a delivery vehicle is a molecule that is capable of delivering an ADAR RNA to a patient. aRNA or a molecule used in conjunction with a therapeutic RNA. Examples include antibodies or The present invention relates to a fragment thereof, an scFv, a peptide, a GalNAc, an aptamer, or a nucleic acid linked to RNA. Other examples include lipidoids, liposomes, and vesicles in which RNA is fully or partially encapsulated. These include somes, lipoplexes, polymers, or nanoparticles.
[0028] As used herein, pharmaceutical compositions include liquid dosage forms, injectable formulations, pulmonary dosage forms, and solid dosage forms. topical, intranasal, intratracheal, or injection (e.g., intravenous, intraocular, intravitreal, intramuscular, and the ADAR aRNA of the present disclosure formulated in a dosage form such as intracardiac, intraperitoneal, or subcutaneous. A pharmaceutical composition also refers to a composition containing at least one pharmaceutically acceptable excipient. and may include an ADAR aRNA formulated in a dosage form in combination with a therapeutic RNA. good.
[0029] As used interchangeably herein, "treatment" and / or "treatment" may refer to "Treating" and / or "treat" means complete digestion. loss, slowing or delay, reduction in severity or frequency (e.g., of episodes), disease and / or It is intended to refer to any process in which there may be an interruption or cessation of the progression of symptoms of a disease, Complete disappearance of all disease symptoms is not required. Treatment involves the reduction of at least one of the above processes. RNA editing therapy according to the present disclosure, comprising administration of an ADAR aRNA to a human who would benefit from it. This includes the administration of medicines to (a) prevent or slow the further progression of the symptoms and effects of the disease; (b) alleviating the disease, i.e., preventing the onset or progression of the disease, causing the disappearance or regression of disease symptoms or disease complications; and (c) the disappearance or regression of disease episodes. and preventing or reducing the frequency of
[0030] As used herein, the terms "about" or "approximately" mean the amount of the substance or substance to which the specific recitation applies. When used in reference to a listed value or range of values, the value shall be 10% of the listed value. This means that the value may vary by up to (e.g., + / - 10%). When used, the expression "about 100" includes 90 and 110 and all values therebetween (e.g. For example, 91, 92, 93, 94, etc. [Example]
[0031] Example 1: Exemplary ADAR aRNAs Exemplary ADAR aRNAs can be prepared substantially as described below. For the ADAR isoforms, we generated an ADAR aRNA library and screened The ADAR transcription initiation sequence (e.g., position 0) can be sequenced at approximately -3000 ( nucleotides from approximately +3000 nucleotides upstream to approximately +150 (150 nucleotides downstream) More specifically, for ADAR1p110, the sequences of SEQ ID NOs: 1 and 2 can be selected. and / or target sequence regions within 3 (e.g., ADAR1 p110 targeting regions A, B, and C). For ADAR1p150, the sequences within SEQ ID NOs: 4, 5, 6 and / or 7 can be selected. Target sequence regions (e.g., ADAR1 p150 targeting regions A, B, C, and D) can be selected. Similarly, for ADAR2, target sequences within SEQ ID NOs: 8, 9, 10 and / or 11 A region (e.g., ADAR2 targeting regions A, B, C, and D) can be selected, and for ADAR3 In this case, the target sequence region within SEQ ID NO: 12 and / or 13 (e.g., the ADAR3 target region) A and B) can then be selected. Areas can be screened out.
[0032] An initial library of nucleotide sequences of 15 to 50 nucleotides can then be selected. In exemplary embodiments, sequences of 21 and 22 nucleotides may be selected. ADAR1_p110 aRNA antisense sequence (Table 4), ADAR1_p150 aRNA antisense sequences (Tables 1, 2, 6, and 9), and ADAR2 aRNA antisense sequences. An exemplary library of transsense sequences (Table 8) is provided herein.
[0033] Further screening may be performed. The library candidate may be a library containing the ADAR transcription region and miRNA libraries that can be compared with each other, thereby R aRNA candidates can be screened. Any candidate AD that shows a complementary match can also be screened. The AR aRNA may be screened for its complement (e.g., one of a complementary pair). (Only one candidate will be selected). Additionally, A genes identified as cross-reactive with other genes DAR aRNA candidates (e.g., identical to another gene transcriptome or Furthermore, by performing further screening, it is possible to screen for sequences with a mismatch of up to one base. By using this method, we were able to screen ADAR aRNA candidates that target low-expression exon regions. Using AGO2 binding prediction scores from the ADAR aRNA candidate library, can also be used to rank candidates for further in vitro and in vivo evaluation.
[0034] ADAR aRNA (both sense and antisense strands) may contain chemical modifications. Exemplary chemical modifications according to embodiments of the present disclosure include: 2'-O-methyl (mG, mA, mC, or mU) and / or 2'-fluoro (fG, f Additionally, the phosphodiester backbone may be one or more nucleotides. In the case of thiol, a phosphonothioate may be substituted, and a 5'-phosphorylated modification may be added, e.g., Furthermore, as described herein, the A of the present disclosure may be introduced at the 5' end of the sense strand. The DAR aRNA can be coupled to a delivery vehicle or ligase such as cholesterol or GalNAc. The targeting moiety may be linked to the ADAR aR via, for example, triethylene glycol. An exemplary embodiment is shown in Table 1. [Table 1]
[0035] Additionally, the sense and antisense strands of the ADAR aRNA of the present disclosure may be 1 nucleotide apart. nucleotide, 2 nucleotides, or up to 5 nucleotides of nucleotide overhang According to some embodiments, one or both of the sense and antisense strands may comprise: It may contain one, two, or up to five nucleotides at the 5' end. In this embodiment, one or both of the sense and antisense strands may have one, two, or even more amino acids at the 3' end. In some embodiments, the sense and antisense strands contain at least five nucleotides. Both contain two uracil 3' overhangs.
[0036] Additionally, as described herein, the ADAR aRNAs provided herein One or both of the sense and antisense strands may be In this case, the target sequence may contain one or more nucleotide mismatches between the nucleotide sequences of the target sequence. Exemplary embodiments involving mismatched nucleotide sequences in both the sense and antisense strands The sequences are provided in Table 2 (the sense and antisense sequences of Reference A and Reference B in Table 2 are (These sequences do not contain mismatches to the respective ADAR target sequences.) The regulation of ADAR1 p150 expression by various ADAR aRNAs is described in Example 2B herein. The ADAR1 expression level compared to Reference A or Reference B is determined according to the process provided. The percentages of each are shown in Table 2. [Table 2]
[0037] Example 2: In vitro ADAR expression regulation ADAR aRNA candidates prepared according to the processes provided herein Modulation of AR expression can be assessed substantially as described herein. NAs can be transfected into target cell lines at serial concentrations for 24 hours. A and / or assay individual ADAR isoform expression at the protein level separately ADAR mRNA levels can be measured by quantitative reverse transcription polymerase chain reaction ( ADAR protein expression levels were assayed using qRT-PCR. Assay by stain blot or enzyme-linked immunosorbent assay (ELISA) The expression levels of ADAR mRNA and protein were then compared to untreated controls. By comparison, ADAR aRNA candidates that provide the greatest upregulation can be identified.
[0038] Example 2A. ADAR1 p110 transfected with ADAR1 p110 aRNA substantially as described herein. The expression level of ADAR1 mRNA in transfected HEK293T cells was evaluated. , HEK293T cells not transfected with ADAR1 p110 aRNA The ADAR1 mRNA levels were compared with those of control. , 96-well plates in serum-free medium (Opti-MEM, Cat. No. 11058021) Cells are then seeded onto the plate at 10,000 cells / well. 100 nM ADAR containing ATP (RNAiMax, Cat. No. 13778100) The mice were treated with p110 aRNA (antisense sequence listed in Table 4) or with β-actin as a control. Vehicle alone (not transfected with ADAR p110 aRNA) at 12 h The medium from treated and untreated cells was then transferred to the cytosol for 8-12 hours after transfection. The medium is then replaced with complete medium (DMEM + 10% FBS) to maintain the cell culture until the end point. DAR1 mRNA levels were measured using SYBR Green Fast Transfection Kit (SYBR Fast Transfection Kit) according to the manufacturer's instructions. Advanced Cells-to-cT Kit, Catalog No. A35379), Quantitative RT-PCR (PowerTrack SYBR Green Master M ix Catalog No. A46012). As shown in Table 4a, three specific The ADAR1 p110 targeting regions (denoted as regions A, B, and C in Table 3) were identified, The ADAR1p110 aRNA antisense sequence targeting one of these three regions is Shows up to a 150% increase in ADAR1 transcription. [Table 3] [Table 4]
[0039] transfected with ADAR1 p110 aRNA substantially as described herein. The expression level of ADAR1 p110 mRNA in transfected HELA cells was evaluated. of HELA cells transfected with ADAR1 p110 aRNA but not transfected with The ADAR1 P100 levels are compared to the control ADAR1 P100 levels. Briefly, HELA cells were cultured in serum-free medium. 96-well plate set in medium (Opti-MEM, Cat. No. 11058021) Cells are then seeded onto the plate at 10,000 cells / well. 100 nM ADAR containing ATP (RNAiMax, Cat. No. 13778100) Treatment with p110 aRNA (antisense sequence listed in Table 4b) or as a control 12 with vehicle alone (not transfected with ADAR p110 aRNA) The medium from treated and untreated cells was then transferred to the cytosol for 8 to 12 hours after transfection. After a period of time, the medium is replaced with complete medium (DMEM + 10% FBS) to maintain the cell culture until the end point. ADAR1P110 mRNA levels were measured using SYBR Green ELISA according to the manufacturer's instructions. Fast Advanced Cells-to-cT Kit, Catalog No. A35 379), quantitative RT-PCR (TaqMan™ Fast Advanced M The assay is performed using a Master Mix (Cat. No. 4444965). As such, three specific ADAR1P110 targeting regions (denoted as regions A, B, and C in Table 3) were identified. The ADAR1P110 aRNA targeting one of these three regions was identified. The antisense sequence shows an increase in ADAR1P110 transcription of up to 350%. [Table 5]
[0040] Example 2B. ADAR1 p150 Transfected with ADAR1 p150 aRNA substantially as described herein. The expression level of ADAR1p150 mRNA in the transfected HEK293T cells was evaluated. HEK293T cells not transfected with ADAR1p150 aRNA The ADAR1 mRNA levels were compared with control ADAR1 mRNA levels in HEK293T cells. , 96-well plates in serum-free medium (Opti-MEM, Cat. No. 11058021) Cells are then seeded onto the plate at 10,000 cells / well. 100 nM ADAR containing ATP (RNAiMax, Cat. No. 13778100) Treatment with p150 aRNA (antisense sequence listed in Table 6a) or as a control 12 with vehicle alone (not transfected with ADAR p150 aRNA) The medium from treated and untreated cells was then transferred to the cytosol for 8 to 12 hours after transfection. After a period of time, the medium is replaced with complete medium (DMEM + 10% FBS) to maintain the cell culture until the end point. ADAR1p150 mRNA transcription was performed according to the manufacturer's instructions (SYBR Green Fast Advanced Cells-to-cT Kit, Catalog No. A353 79), quantitative RT-PCR (PowerTrack SYBR Green Mast Measure using a 4-amino acid esterase inhibitor (Cat. No. A46012). Three specific ADAR1 p150 targeting regions (denoted as regions A, B, C, and D in Table 5) ADAR1p150 aRNA antisense oligonucleotides targeting one of these four regions were identified. The sequence shows an increase in ADAR1 transcription of up to 370%. [Table 6] [Table 7]
[0041] transfected with ADAR1 p150 aRNA substantially as described herein. Expression of ADAR1 p150 mRNA and protein in transfected HELA cells Current levels were assessed in mice not transfected with ADAR1 p150 aRNA. This is compared to control ADAR1 p150 levels in HELA cells. Cells are set up in serum-free medium (Opti-MEM, Cat. No. 11058021). 10,000 cells / well are seeded onto a 96-well plate. 100n containing 100ml of RNAiMax (Lipofectamine RNAiMax, Cat. No. 13778100) Treatment with ADAR p150 aRNA (antisense sequence listed in Table 6b) of M or vehicle alone (transfected with ADAR p150 aRNA) as a control. The treated and untreated cells were treated with 100 μg of ... After 8-12 hours of incubation, the medium was replaced with complete medium (DMEM + 10% FBS) and the cells were cultured until the end point. ADAR1 p150 mRNA levels were measured according to the manufacturer's instructions (SY BR Green Fast Advanced Cells-to-cT Kit, Catalog number A35379), quantitative RT-PCR (TaqMan™ Fast Adapter (Advanced Master Mix, Cat. No. 4444965) As shown in Table 6b, three specific ADAR1 p150 targeting regions (regions 1 and 2 in Table 5) were identified. A, B, and C) were identified, and ADAR1 targeting one of these three regions was identified. The p150 aRNA antisense sequence increased ADAR1 p150 transcription by up to 350%. Indicates addition. [Table 8]
[0042] ADAR1P110 protein levels were measured using semi-quantitative Western blotting. An exemplary A gene comprising the sense of SEQ ID NO: 65 and the antisense of SEQ ID NO: 66 is In HELA cells transfected with 100 nM and 10 nM of DAR aRNA, The percentage of ADAR1 protein in the 100 nM and 10 nM samples is provided in Table 6c. The ADAR1 protein in HELA cells transfected with non-targeting aRNA of M was also expressed. The non-targeting aRNA is the sense strand (UCCUAUGACUGUAGAUUUUAU SEQ ID NO: 135) and the antisense strand (AUAAAAUCUACAGUCAUAGGA AU SEQ ID NO: 136). HELA cells treated with recombinant IFN-beta for 24 hours ADAR1 protein levels in untreated HELA cells are also provided as a positive control. Shown as a percentage of ADAR1 protein compared to cells. [Table 9]
[0043] Example 2C. ADAR2 transfected with ADAR2 aRNA substantially as described herein. The expression levels of ADAR2 mRNA and protein in HeLa cells were evaluated. Control ADAR2 in HeLa cells not transfected with ADAR2 aRNA Briefly, HeLa cells were cultured in serum-free medium (Opti-MEM, 10,000 cells on a 96-well plate (Cat. No. 11058021) Cells were then plated at 1000 x g / well. The cells were then incubated with a vehicle (Lipofectamine RNAiMax, Carbohydrate, PEG-1000). 100 nM of ADAR2 aRNA (listed in Table 8) containing the IgG1a-specific ... antisense sequence), or vehicle alone (ADAR2 aRNA) as a control. The treated and untreated cells were treated with α-glucan (not transfected with α-glucan) for 12 hours or more. Change the medium to complete medium (DMEM + 10% FBS) 8-12 hours after transfection. Maintain cell culture until end point. ADAR2 mRNA levels were measured according to the manufacturer's instructions. According to (SYBR Green Fast Advanced Cells-to-c T Kit, catalog number A35379), quantitative RT-PCR (TaqMan(TM) Fast Advanced Master Mix, Catalog No. 4444965 As shown in Table 8, three specific ADAR2 targeting regions (regions 1 and 2 in Table 7) were used for the measurement. Three regions (denoted as A, B, C, and D) have been identified, and ADAs targeting one of these three regions have been developed. The R2 aRNA antisense sequence shows an increase in ADAR2 transcription of up to 200%. [Table 10] [Table 11]
[0044] Example 3: ADAR-catalyzed RNA editing Evaluation of ADAR aRNA candidates for RNA editing therapy can be performed using methods substantially as described herein. ADAR aRNA candidates can be evaluated to determine whether they are designed to edit a target RNA. This can be delivered with a therapeutic RNA (e.g., guide RNA) that is designed to In vitro assays can be performed in vitro and / or in vivo. DAR aRNA and therapeutic RNA were transfected into target cell lines for 24, 48, and 72 hours. Additionally, the ADAR aRNA and therapeutic RNA can be transfected into a delivery vehicle. Can be bound or encapsulated (e.g., GalNAc conjugation, liposomes, etc.) .
[0045] Following transfection, cell lysates were processed for RNA sequencing techniques. Target transcript analysis can be performed using the R can be used to assess the efficacy of RNA editing (ADAR aRNA or therapeutic RNA) (compared to a control group containing only transfected cells).
[0046] The editing efficacy of the therapeutic RNA is assessed in vitro substantially as described herein. Briefly, HeLa cells were cultured in serum-free medium (Opti-MEM, Cat. No. 10,000 cells / well were seeded onto a 96-well plate in 1000kJ / well of PBS (11058021). Cells were treated with 100 nM of therapeutic RNA (either beta-actin or GAPDH gene) Transfected with therapeutic RNA (ASO targeting either of these) The cells were co-treated within 12 hours with either: (i) 100 nM A DAR p150 aRNA (antisense sequence listed in Table 9) and vehicle (Lipofectamine) (ii) tammin RNAiMax, catalog no. 13778100), or (ii) vehicle alone. 8-12 hours after transfection, change the medium to complete medium (DMEM + 10% FBS). ADAR1 mRNA levels were measured using SYBR Grease according to the manufacturer's instructions. en Fast Advanced Cells-to-cT Kit, Catalog No. A 35379), quantitative RT-PCR (TaqMan™ Fast Advanced Editing efficiency is measured using Master Mix (Cat. No. 4444965). The editing efficiency is assessed by Sanger sequencing (i.e., A to G editing efficiency is quantified). As shown in Table 9a, the therapeutic RNA of the beta-actin gene, ADAR1p1 Co-transfection with 50 aRNA increased ADAR1 transcription by up to 600% As shown in Table 9b, the GAPDH gene demonstrates up to 350% enhancement of editing efficiency. Co-transfection of therapeutic RNA with ADAR1p150 aRNA was shown to inhibit AD We demonstrate up to a 1000% increase in AR1 transcription and up to a 150% enhancement in editing efficiency. [Table 12] [Table 13]
[0047] Example 4: Regulation of ADAR3 expression Embodiments of the present disclosure provide ADAR3 aRNA for upregulating endogenous ADAR3. In certain embodiments, the ADAR3 aRNA is an ADAR1-catalyzed or AD It can be delivered to tissues for the treatment of diseases associated with excessive AR2-catalyzed transcriptional editing. Therefore, upregulation of endogenous expression of ADAR3 may result in, for example, competitive inhibition, decreased binding efficiency, and decreased activity. and / or ADAR2 activity, through reduced expression and / or reduced activity of ADAR1 and / or ADAR2. This may allow us to control excessive transcript editing catalyzed by ADAR1 or ADAR2. In some specific embodiments, the ADAR3 aRNA may inhibit the ADAR1-catalyzed or provide therapeutic benefit in diseases associated with ADAR2-catalyzed hyperactive transcript editing The drug is co-delivered with a therapeutic RNA designed to edit the target RNA to achieve the desired effect.
[0048] Briefly, ADAR3 aRNA can be synthesized according to the methods provided herein by using the sequence Nos. 12 and / or 13 are prepared with respect to the ADAR3 aRNA target sequence. and can be prepared substantially as described in Example 1. In vitro ADAR3 expression can be Both at baseline and after ADAR3 aRNA transfection, The ADAR3 gene can be evaluated using the methods described in the specification and Example 2. aRNA and ADAR1- or ADAR2-catalyzed hyperactive transcript editing designed to edit target RNA to provide therapeutic benefit in relevant diseases. Co-delivery of the therapeutic RNA was evaluated substantially as described herein and in Example 3. It can be valued.
[0049] According to certain embodiments, ADAR3 aRNA upregulation of endogenous ADAR3 is associated with AD Excessive transcript editing catalyzed by ADAR1 or ADAR2 may lead to CNS tissue damage. Tissues (with or without therapeutic RNAs designed to edit target RNAs) In a more specific embodiment, the ADAR3 aR of endogenous ADAR3 is delivered to the NA upregulation is associated with brain tumors (including glioblastoma), tumorigenesis, and / or chronic neurological disorders The ADAR1-catalyzed and ADAR2-catalyzed transcriptional editing pathways are essential for the regulation of overactive transcription. In some embodiments, the ADAR3 is delivered to central nervous system tissue. 3 aRNA upregulation is a key factor in tumorigenesis, metastasis, immune and autoimmune diseases (e.g., systemic erythrocyte sedimentation). ADAR1-catalyzed or ADAR2-catalyzed hyperactive transcripts, including leukemia (leukemia-associated leukemia) For the control of cancer diseases, non-CNS tissues (e.g., peripheral tissues) (to edit target RNAs) The cells are delivered to the target organ (with or without a therapeutic RNA designed for the target organ).
[0050] Illustrative Embodiments 1. Adenosine deaminase (ADAR)-activating RNA (aRN) A) upregulating ADAR expression; ADAR aRNA contains an antisense oligonucleotide sequence and is directed to an RNA enzyme. Adenosine deaminase (ADAR)-activating RNA (aRNA) is used. 2. The ADAR aRNA of embodiment 1, wherein the ADAR is ADAR1p110. . 3. The ADAR aRNA of embodiment 1, wherein the ADAR is ADAR1p150. . 4. The ADAR aRNA of embodiment 1, wherein the ADAR is ADAR2. 5. The ADAR aRNA of embodiment 1, wherein the ADAR is ADAR3. 6. The antisense oligonucleotide sequence is about 15 to about 50 nucleotides. An ADAR aRNA according to any one of embodiments 1 to 5. 7. The antisense oligonucleotide sequence is about 19 to about 30 nucleotides. An ADAR aRNA according to any one of embodiments 1 to 5. 8. The ADAR aRNA of embodiments 1 to 5 further comprises a sense oligonucleotide sequence. 8. The ADAR aRNA according to any one of 7. 9. The embodiment wherein the antisense sequence is at least 80% complementary to the target sequence 8. ADAR aRNA. 10. The target sequence is located between -3000 and +150 nucleotides of the ADAR target sequence transcription start site. 10. The ADAR aRNA of embodiment 9, wherein the ADAR aRNA is within 11. The target sequence is SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 and / or 13. 12. Antisense oligonucleotide sequences and sense oligonucleotide sequences 12. The AD of any one of embodiments 1 to 11, wherein at least one of the following comprises a 3' tail: AR aRNA. 13. Antisense oligonucleotide sequences and sense oligonucleotide sequences 13. Any of embodiments 1 to 12, wherein at least one of the The ADAR aRNA according to any one of the preceding claims. 14. At least one modified nucleotide is thio-modified, amino-modified, phosphate-modified, co-modified, or Esterol-triethylene glycol (TEG) modification, methyl modification, and fluoro modification 14. The method of claim 13, comprising a nucleotide modification from at least one of the nucleotides. ADAR aRNAs. 15. The antisense oligonucleotide sequence and the sense oligonucleotide sequence are 15. The method of claim 1, wherein each of the sequences is independently about 15 to about 50 nucleotides. ADAR aRNA. 16. The antisense oligonucleotide sequence and the sense oligonucleotide sequence are 15. The method of claim 1, wherein each of the first and second nucleotides is independently about 19 to about 30 nucleotides. ADAR aRNA. 17. The antisense and sense oligonucleotide sequences are each 22 nucleotides. The ADAR aRNA according to any one of embodiments 1 to 14. 18. The antisense and sense oligonucleotide sequences are each 21 nucleotides. The ADAR aRNA according to any one of embodiments 1 to 14. 19. Antisense oligonucleotide sequences and sense oligonucleotide sequences 19. The method of any one of embodiments 1 to 18, wherein at least one of the following comprises three overhangs: ADAR aRNA. 20. Antisense oligonucleotide sequences and sense oligonucleotide sequences 20. The method according to any one of embodiments 1 to 19, wherein at least one of the following is contained on a nucleic acid vector: ADAR aRNAs. 21. Any of embodiments 1-20, wherein the aRNA is linked to a ligand targeting moiety. ADAR aRNAs described in one. 22. The ADAR a ligand of embodiment 21, wherein the ligand targeting moiety is GalNAc. RNA. 23. Any one of embodiments 1 to 22, wherein the aRNA is linked to a second RNA. ADAR aRNAs as described. 24. The ADAR aRNA of embodiment 23, wherein the second RNA is a therapeutic RNA. . 25. The therapeutic RNA is mRNA, miRNA, sgRNA, aRNA, iRNA, or 25. The ADAR aRNA of embodiment 24, wherein the ADAR aRNA comprises one of the ASOs. 26. Any one of embodiments 1 to 25, wherein the aRNA binds to the AGO2 protein. ADAR aRNAs as described. 27. Any one of embodiments 1 to 26, wherein the aRNA is linked to a delivery vehicle. ADAR aRNAs as described. 28. The delivery vehicle is an antibody or a fragment thereof, scFv, peptide, GalNAc 28. The ADAR aR of embodiment 27, comprising one of: a medicament for treating atherosclerosis; an apatamer; or a nanoparticle. N / A. 29. The method of embodiment 1, wherein the aRNA is fully or partially encapsulated within a delivery vehicle. to 27. An ADAR aRNA according to any one of claims 1 to 27. 30. The delivery vehicle is a lipidoid, liposome, lipoplex, polymer, or nanoparticle. 30. The ADAR aRNA of embodiment 29, comprising one of the following particles: 31. The antisense oligonucleotide sequence is selected from the group consisting of SEQ ID NOs: 14 to 134. The ADAR aRN according to any one of embodiments 1 to 4 and 6 to 30, including any one of A. 32. Antigens given by one of SEQ ID NOs: 14-36 and 100-107 ADAR1p110 aRNA containing a sense oligonucleotide sequence. 33. A nucleic acid sequence represented by one of SEQ ID NOs: 37-99, 108-113, and 134. ADAR1p150 aRNA containing an antisense oligonucleotide sequence. 34. Antisense oligonucleotides represented by one of SEQ ID NOs: 114 to 133 ADAR2 aRNA containing the nucleotide sequence. 35. The ADAR a according to any one of embodiments 1 to 34, 60, and 74 to 76. A method of modulating ADAR expression, comprising administering RNA to a patient. 36. The method of embodiment 35, wherein ADAR expression is increased. 37. The method of embodiment 36, wherein ADAR expression is increased by at least 20%. 38. The method of embodiment 36, wherein ADAR expression is increased by at least 30%. 39. The method of embodiment 36, wherein ADAR expression is increased by at least 40%. 40. The method of embodiment 36, wherein ADAR expression is increased by at least 50%. 41. RNA editing therapeutic agents, A therapeutic RNA; and an ADAR aRNA according to any one of embodiments 1 to 34, 60, and 74 to 76. Hmm, RNA editing therapeutics. 42. The therapeutic RNA is mRNA, miRNA, sgRNA, aRNA, iRNA, or The RNA editing therapeutic of embodiment 41, comprising one of the ASOs. 43. A method for treating a disease in a human, comprising administering a therapeutically effective amount of an RNA editing therapeutic agent to the human. and administering to the subject the RNA therapeutic agent, as described in any one of embodiments 1 to 34, 60, and 61. and the ADAR aRNA according to any one of items 74 to 76. 44. The method of embodiment 43, wherein the therapeutic RNA and the ADAR aRNA are administered simultaneously. method. 45. The method of embodiment 43, wherein the therapeutic RNA and the ADAR aRNA are co-formulated. method. 46. The method of embodiment 43, wherein the therapeutic RNA and the ADAR aRNA are linked. method. 47. At least one of the therapeutic RNA and the ADAR aRNA is a delivery vehicle 47. The method of any one of embodiments 43 to 46, wherein the carrier is completely or partially encapsulated within a carrier. 48. The delivery vehicle is a lipidoid, liposome, lipoplex, polymer, or nanoparticle. 48. The method of embodiment 47, comprising one of the following particles: 49. At least one of the therapeutic RNA and the ADAR aRNA is a delivery vehicle 47. The method of any one of embodiments 43 to 46, wherein the nucleotide sequence is linked within the nucleotide sequence. 50. The delivery vehicle is an antibody or a fragment thereof, scFv, peptide, GalNAc 50. The method of embodiment 49, comprising one of the following: a hydroxybenzoate, an apatamer, or a nanoparticle. 51. Therapeutic RNA and The ADAR aRNA according to any one of embodiments 1 to 34, 60, and 74 to 76. and, and at least one pharmaceutically acceptable excipient. 52. The therapeutic RNA is mRNA, miRNA, sgRNA, aRNA, iRNA, or 52. The pharmaceutical composition of embodiment 51, wherein the composition comprises one of the ASOs. 53. A method for treating a disease in a human, comprising administering to the human a therapeutically effective amount of a pharmaceutical composition. and administering to a subject a therapeutic RNA, the pharmaceutical composition comprising a therapeutic RNA and a therapeutic agent according to any one of the embodiments 1 to 34, 60 and 74. 76 and a pharmaceutically acceptable excipient. Hmm, a method. 54. The method of embodiment 53, wherein the therapeutic RNA and the ADAR aRNA are administered simultaneously. method. 55. The therapeutic RNA and the ADAR aRNA are co-formulated, as described in embodiment 53. How to do it. 56. The method of embodiment 53, wherein the therapeutic RNA and the ADAR aRNA are linked. method. 57. At least one of the therapeutic RNA and the ADAR aRNA is a delivery vehicle 57. The method of any one of embodiments 53 to 56, wherein the carrier is completely or partially encapsulated within a carrier. 58. The delivery vehicle is a lipidoid, liposome, lipoplex, polymer, or nanoparticle. 58. The method of embodiment 57, comprising one of the following particles: 59. At least one of the therapeutic RNA and the ADAR aRNA is a delivery vehicle 59. The method of any one of embodiments 53 to 58, wherein the 60. The delivery vehicle is an antibody or a fragment thereof, scFv, peptide, GalNAc 60. The method of embodiment 59, comprising one of the following: a hydroxybenzoate, an apatamer, or a nanoparticle. 61. The ADAR is ADAR3 and the target sequence is within SEQ ID NO: 12 and / or 13 , an ADAR aRNA according to any one of embodiments 5 to 25 and 27 to 30. 62. A method for treating a disease in a human, comprising administering a therapeutically effective amount of the ADA of embodiment 61. A method comprising administering R3 aRNA to a human. 63. A combination of ADAR3 aRNA and ADAR1 and / or ADAR2 overexpression 63. The method of embodiment 62, wherein the composition is delivered to the tissue. 64. The method of embodiment 62 or 63, wherein the ADAR3 aRNA is delivered to the CNS. method. 65. A method for producing a delivery vehicle in which the ADAR3 aRNA is fully or partially encapsulated within the delivery vehicle. The method according to any one of embodiments 62 to 64. 66. The delivery vehicle is a lipidoid, liposome, lipoplex, polymer, or nanoparticle. 66. The method of embodiment 65, comprising one of the following particles: 67. The method of any one of embodiments 62 to 66, wherein the ADAR3 aRNA is linked to a delivery vehicle. The method according to any one of the preceding claims. 68. The delivery vehicle is an antibody or a fragment thereof, scFv, peptide, GalNAc 68. Any one of embodiments 65 to 67, comprising one of: a hydroxybenzoate; an apatamer; or a nanoparticle. The method described. 69. Embodiment 62, further comprising administering a therapeutically effective amount of a therapeutic RNA to a human. 68. A method according to any one of claims 1 to 68. 70. The therapeutic RNA and ADAR3 aRNA are administered simultaneously, as described in embodiment 69. How to do it. 71. The therapeutic RNA and the ADAR3 aRNA are co-formulated, as described in embodiment 70. How to do it. 72. The therapeutic RNA and the ADAR3 aRNA are linked, according to embodiment 70 or 7. The method described in 1. 73. The disease is characterized by excessive transcriptional editing catalyzed by ADAR1 or ADAR2. The method of any one of embodiments 62 to 72, wherein 74. Diseases include cancer, tumor formation, metastasis, brain tumors including glioblastoma, chronic neurological disorders, and immune disorders. or an autoimmune disease, including systemic lupus erythematosus. 2 to 72. 75. ADAR is ADAR1p110 and the target sequence is SEQ ID NO: 1, 2 and / or 3 33. The ADAR aRNA of any one of embodiments 2, 6 to 30, and 32, wherein the ADAR aRNA is within . 76. ADAR is ADAR1p150 and the target sequence is SEQ ID NO: 4, 5, 6 and / or 34. The ADAR aR of any one of embodiments 3, 6 to 30, and 33, wherein N / A. 77. The ADAR is ADAR2 and the target sequence is SEQ ID NO: 8, 9, 10 and / or 11 31. The ADAR aRNA of any one of embodiments 4 and 6 to 30, wherein the ADAR aRNA is within
[0051] Sequence Listing SEQ ID NO: 1: ADAR1 p110 target sequence, region A, -715 to -322 (5'-3' (Flip to
Chem.
[0052] SEQ ID NO: 2: ADAR1 p110 target sequence, region B, -1469 to -1137 (5'- 3' (reversal)
Chem.
[0053] SEQ ID NO: 3: ADAR1 p110 target sequence, region C, -1619 to -1500 (5'- 3' inverted)
Chem.
[0054] SEQ ID NO: 4: ADAR1 p150 target sequence, region A, -828 to -456 (5'-3 ') <(...)8>
Chem.
[0055] SEQ ID NO: 5: ADAR1 p150 target sequence, region B, -1136 to -934 (5'- 3' inverted)
Chem.
[0056] SEQ ID NO: 6: ADAR1 p150 target sequence, region C, -1274 to -1211 (5' -3' inverted)
Chem.
[0057] SEQ ID NO: 7: ADAR1 p150 target sequence, region D, -1539 to -1370 (5' [[ID=7(...)9>
Chem.
[0058] SEQ ID NO: 8: ADAR2 target sequence, region A, -801 to -500
change
[0059] SEQ ID NO: 9: ADAR2 target sequence, region B, -1324 to -835
change
[0060] SEQ ID NO: 10: ADAR2 target sequence, region C, -1773 to -1566
change
[0061] SEQ ID NO: 11: ADAR2 target sequence, region D, -3000 to -1924
change
[0062] SEQ ID NO: 12: ADAR3 target sequence, region A, -1165 to -300 (5'-3' reversed) Transfer
change
[0063] SEQ ID NO: 13: ADAR3 target sequence, region B, -2937 to -1288 (5'-3' Invert)
change
[0064] SEQ ID NO: 14: Exemplary ADAR1p110 aRNA antisense sequence
change
[0065] SEQ ID NO: 15: Exemplary ADAR1p110 aRNA antisense sequence
change
[0066] SEQ ID NO: 16: Exemplary ADAR1p110 aRNA antisense sequence
change
[0067] SEQ ID NO: 17: Exemplary ADAR1p110 aRNA antisense sequence
change
[0068] SEQ ID NO: 18: Exemplary ADAR1p110 aRNA antisense sequence
change
[0069] SEQ ID NO: 19: Exemplary ADAR1p110 aRNA antisense sequence
change
[0070] SEQ ID NO: 20: Exemplary ADAR1p110 aRNA antisense sequence
change
[0071] SEQ ID NO: 21: Exemplary ADAR1p110 aRNA antisense sequence
change
[0072] SEQ ID NO: 22: Exemplary ADAR1p110 aRNA antisense sequence
change
[0073] SEQ ID NO: 23: Exemplary ADAR1p110 aRNA antisense sequence
change
[0074] SEQ ID NO: 24: Exemplary ADAR1p110 aRNA antisense sequence
change
[0075] SEQ ID NO: 25: Exemplary ADAR1p110 aRNA antisense sequence
change
[0076] SEQ ID NO: 26: Exemplary ADAR1p110 aRNA antisense sequence
change
[0077] SEQ ID NO: 27: Exemplary ADAR1p110 aRNA antisense sequence
change
[0078] SEQ ID NO: 28: Exemplary ADAR1p110 aRNA antisense sequence
change
[0079] SEQ ID NO: 29: Exemplary ADAR1p110 aRNA antisense sequence
change
[0080] SEQ ID NO: 30: Exemplary ADAR1p110 aRNA antisense sequence
change
[0081] SEQ ID NO: 31: Exemplary ADAR1p110 aRNA antisense sequence
change
[0082] SEQ ID NO: 32: Exemplary ADAR1p110 aRNA antisense sequence
change
[0083] SEQ ID NO: 33: Exemplary ADAR1p110 aRNA antisense sequence
change
[0084] SEQ ID NO: 34: Exemplary ADAR1p110 aRNA antisense sequence
change
[0085] SEQ ID NO: 35: Exemplary ADAR1p110 aRNA antisense sequence
change
[0086] SEQ ID NO: 36: Exemplary ADAR1p110 aRNA antisense sequence
change
[0087] SEQ ID NO: 37: Exemplary ADAR1p150 aRNA antisense sequence
change
[0088] SEQ ID NO: 38: Exemplary ADAR1p150 aRNA antisense sequence
change
[0089] SEQ ID NO: 39: Exemplary ADAR1p150 aRNA antisense sequence
change
[0090] SEQ ID NO: 40: Exemplary ADAR1p150 aRNA antisense sequence
change
[0091] SEQ ID NO: 41: Exemplary ADAR1p150 aRNA antisense sequence
change
[0092] SEQ ID NO: 42: Exemplary ADAR1p150 aRNA antisense sequence
change
[0093] SEQ ID NO: 43: Exemplary ADAR1p150 aRNA antisense sequence
change
[0094] SEQ ID NO: 44: Exemplary ADAR1p150 aRNA antisense sequence
change
[0095] SEQ ID NO: 45: Exemplary ADAR1p150 aRNA antisense sequence
change
[0096] SEQ ID NO: 46: Exemplary ADAR1p150 aRNA antisense sequence
change
[0097] SEQ ID NO: 47: Exemplary ADAR1p150 aRNA antisense sequence
change
[0098] SEQ ID NO: 48: Exemplary ADAR1p150 aRNA antisense sequence
change
[0099] SEQ ID NO: 49: Exemplary ADAR1p150 aRNA antisense sequence
change
[0100] SEQ ID NO: 50: Exemplary ADAR1p150 aRNA antisense sequence
change
[0101] SEQ ID NO: 51: Exemplary ADAR1p150 aRNA antisense sequence
change
[0102] SEQ ID NO: 52: Exemplary ADAR1p150 aRNA antisense sequence
change
[0103] SEQ ID NO: 53: Exemplary ADAR1p150 aRNA antisense sequence
change
[0104] SEQ ID NO: 54: Exemplary ADAR1p150 aRNA antisense sequence
change
[0105] SEQ ID NO: 55: Exemplary ADAR1p150 aRNA antisense sequence
change
[0106] SEQ ID NO: 56: Exemplary ADAR1p150 aRNA antisense sequence
change
[0107] SEQ ID NO: 57: Exemplary ADAR1p150 aRNA antisense sequence
change
[0108] SEQ ID NO: 58: Exemplary ADAR1p150 aRNA antisense sequence
change
[0109] SEQ ID NO: 59: Exemplary ADAR1p150 aRNA antisense sequence
change
[0110] SEQ ID NO: 60: Exemplary ADAR1p150 aRNA antisense sequence
change
[0111] SEQ ID NO: 61: Exemplary ADAR1p150 aRNA antisense sequence
change
[0112] SEQ ID NO: 62: Exemplary ADAR1p150 aRNA antisense sequence
change
[0113] SEQ ID NO: 63: Exemplary ADAR1p150 aRNA antisense sequence
change
[0114] SEQ ID NO: 64: Exemplary ADAR1p150 aRNA antisense sequence
change
[0115] SEQ ID NO: 65: Exemplary ADAR1p150 aRNA sense sequence
change
[0116] SEQ ID NO: 66: Exemplary ADAR1p150 aRNA antisense sequence
change
[0117] SEQ ID NO: 67: Exemplary ADAR1p150 aRNA sense sequence
change
[0118] SEQ ID NO: 68: Exemplary ADAR1p150 aRNA antisense sequence
change
[0119] SEQ ID NO: 69: Exemplary ADAR1p150 aRNA sense sequence
change
[0120] SEQ ID NO: 70: Exemplary ADAR1p150 aRNA antisense sequence
change
[0121] SEQ ID NO: 71: Exemplary ADAR1p150 aRNA sense sequence
change
[0122] SEQ ID NO: 72: Exemplary ADAR1p150 aRNA antisense sequence
change
[0123] SEQ ID NO: 73: Exemplary ADAR1p150 aRNA sense sequence
change
[0124] SEQ ID NO: 74: Exemplary ADAR1p150 aRNA antisense sequence
change
[0125] SEQ ID NO: 75: Exemplary ADAR1p150 aRNA sense sequence
change
[0126] SEQ ID NO: 76: Exemplary ADAR1p150 aRNA antisense sequence
change
[0127] SEQ ID NO: 77: Exemplary ADAR1p150 aRNA sense sequence
change
[0128] SEQ ID NO: 78: Exemplary ADAR1p150 aRNA antisense sequence
change
[0129] SEQ ID NO: 79: Exemplary ADAR1p150 aRNA sense sequence
change
[0130] SEQ ID NO: 80: Exemplary ADAR1p150 aRNA sense sequence
change
[0131] SEQ ID NO: 81: Exemplary ADAR1p150 aRNA antisense sequence
change
[0132] SEQ ID NO: 82: Exemplary ADAR1p150 aRNA sense sequence
change
[0133] SEQ ID NO: 83: Exemplary ADAR1p150 aRNA antisense sequence
change
[0134] SEQ ID NO: 84: Exemplary ADAR1p150 aRNA sense sequence
change
[0135] SEQ ID NO: 85: Exemplary ADAR1p150 aRNA antisense sequence
change
[0136] SEQ ID NO: 86: Exemplary ADAR1p150 aRNA sense sequence
change
[0137] SEQ ID NO: 87: Exemplary ADAR1p150 aRNA antisense sequence
change
[0138] SEQ ID NO: 88: Exemplary ADAR1p150 aRNA sense sequence
change
[0139] SEQ ID NO: 89: Exemplary ADAR1p150 aRNA antisense sequence
change
[0140] SEQ ID NO: 90: Exemplary ADAR1p150 aRNA sense sequence
change
[0141] SEQ ID NO: 91: Exemplary ADAR1p150 aRNA antisense sequence
change
[0142] SEQ ID NO: 92: Exemplary ADAR1p150 aRNA sense sequence
change
[0143] SEQ ID NO: 93: Exemplary ADAR1p150 aRNA antisense sequence
change
[0144] SEQ ID NO: 94: Exemplary ADAR1p150 aRNA sense sequence
change
[0145] SEQ ID NO: 95: Exemplary ADAR1p150 aRNA antisense sequence
change
[0146] SEQ ID NO: 96: Exemplary ADAR1p150 aRNA sense sequence
change
[0147] SEQ ID NO: 97: Exemplary ADAR1p150 aRNA antisense sequence
change
[0148] SEQ ID NO: 98: Exemplary ADAR1p150 aRNA sense sequence
change
[0149] SEQ ID NO: 99: Exemplary ADAR1p150 aRNA antisense sequence
change
[0150] SEQ ID NO: 100: Exemplary ADAR1p110 aRNA antisense sequence
change
[0151] SEQ ID NO: 101: Exemplary ADAR1p110 aRNA antisense sequence
change
[0152] SEQ ID NO: 102: Exemplary ADAR1p110 aRNA antisense sequence
change
[0153] SEQ ID NO: 103: Exemplary ADAR1p110 aRNA antisense sequence
change
[0154] SEQ ID NO: 104: Exemplary ADAR1p110 aRNA antisense sequence
change
[0155] SEQ ID NO: 105: Exemplary ADAR1p110 aRNA antisense sequence
change
[0156] SEQ ID NO: 106: Exemplary ADAR1p110 aRNA antisense sequence
change
[0157] SEQ ID NO: 107: Exemplary ADAR1p110 aRNA antisense sequence
change
[0158] SEQ ID NO: 108: Exemplary ADAR1p150 aRNA antisense sequence
change
[0159] SEQ ID NO: 109: Exemplary ADAR1p150 aRNA antisense sequence
change
[0160] SEQ ID NO: 110: Exemplary ADAR1p150 aRNA antisense sequence
change
[0161] SEQ ID NO: 111: Exemplary ADAR1p150 aRNA antisense sequence
change
[0162] SEQ ID NO: 112: Exemplary ADAR1p150 aRNA antisense sequence
change
[0163] SEQ ID NO: 113: Exemplary ADAR1p150 aRNA antisense sequence
change
[0164] SEQ ID NO: 114: Exemplary ADAR2 aRNA antisense sequence
change
[0165] SEQ ID NO: 115: Exemplary ADAR2 aRNA antisense sequence
change
[0166] SEQ ID NO: 116: Exemplary ADAR2 aRNA antisense sequence
change
[0167] SEQ ID NO: 117: Exemplary ADAR2 aRNA antisense sequence
change
[0168] SEQ ID NO: 118: Exemplary ADAR2 aRNA antisense sequence
change
[0169] SEQ ID NO: 119: Exemplary ADAR2 aRNA antisense sequence
change
[0170] SEQ ID NO: 120: Exemplary ADAR2 aRNA antisense sequence
change
[0171] SEQ ID NO: 121: Exemplary ADAR2 aRNA antisense sequence
change
[0172] SEQ ID NO: 122: Exemplary ADAR2 aRNA antisense sequence
change
[0173] SEQ ID NO: 123: Exemplary ADAR2 aRNA antisense sequence
change
[0174] SEQ ID NO: 124: Exemplary ADAR2 aRNA antisense sequence
change
[0175] SEQ ID NO: 125: Exemplary ADAR2 aRNA antisense sequence
change
[0176] SEQ ID NO: 126: Exemplary ADAR2 aRNA antisense sequence
change
[0177] SEQ ID NO: 127: Exemplary ADAR2 aRNA antisense sequence
change
[0178] SEQ ID NO: 128: Exemplary ADAR2 aRNA antisense sequence
change
[0179] SEQ ID NO: 129: Exemplary ADAR2 aRNA antisense sequence
change
[0180] SEQ ID NO: 130: Exemplary ADAR2 aRNA antisense sequence
change
[0181] SEQ ID NO: 131: Exemplary ADAR2 aRNA antisense sequence
change
[0182] SEQ ID NO: 132: Exemplary ADAR2 aRNA antisense sequence
change
[0183] SEQ ID NO: 133: Exemplary ADAR2 aRNA antisense sequence
change
[0184] SEQ ID NO: 134: Exemplary ADAR1p150 aRNA sense sequence
change
[0185] SEQ ID NO: 135: Non-targeting (e.g., scrambled) sense sequence
change
[0186] SEQ ID NO: 136: Non-targeting (e.g., scrambled) antisense sequence
change
Claims
1. Adenosine deaminase (ADAR)-activating RNA (aRNA) that acts on RNA enzymes wherein the expression of ADAR is upregulated; The ADAR aRNA comprises an antisense oligonucleotide sequence. Adenosine deaminase (ADAR)-activating RNA (aRNA) that acts on the
2. ADAR is ADAR1p110, ADAR1p150, ADAR2 or ADAR3 The ADAR aRNA of claim 1 .
3. the antisense oligonucleotide sequence is from about 15 to about 50 nucleotides. The ADAR aRNA according to claim 1 or 2.
4. the antisense oligonucleotide sequence is from about 19 to about 30 nucleotides. The ADAR aRNA according to any one of claims 1 to 3.
5. 5. The ADAR aRNA according to claim 1, wherein the ADAR aRNA further comprises a sense oligonucleotide sequence. The ADAR aRNA described in any one of the above.
6. 6. The antisense sequence of claim 5, wherein the antisense sequence is at least 80% complementary to the target sequence. The ADAR aRNA described in
7. The target sequence is located between nucleotides −3000 and +150 of the ADAR target sequence transcription start site. The ADAR aRNA of claim 6, which is within a nucleotide sequence.
8. The target sequence is SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 or The ADAR aRNA of claim 7, wherein:
9. The antisense oligonucleotide sequence and the sense oligonucleotide sequence at least one of which contains at least one modified nucleotide; The at least one modified nucleotide may be thio-modified, amino-modified, phosphate-modified, cholesterol-modified, or the like. Tetrahydro-triethylene glycol (TEG)-modified, methyl-modified, and fluoro-modified nucleic acids 9. The method of claim 1, further comprising the step of: The ADAR aRNA of any one of claims 1 to 4.
10. The antisense oligonucleotide sequence and the sense oligonucleotide sequence are each A according to any one of claims 1 to 9, which is independently from about 19 to about 30 nucleotides DAR aRNA.
11. The antisense and sense oligonucleotide sequences are each 21 nucleotides. or the antisense and sense oligonucleotide sequences each comprise 21 nucleotides. The ADAR aRNA of claim 10,
12. The antisense oligonucleotide sequence and the sense oligonucleotide sequence At least one of the nucleic acids according to any one of claims 1 to 11 includes a 3' overhang. ADAR aRNA.
13. 12. The method according to claim 1, wherein the aRNA is linked to a therapeutic RNA. The ADAR aRNA described above.
14. The therapeutic RNA is selected from the group consisting of mRNA, miRNA, sgRNA, aRNA, iRNA, or The ADAR aRNA of claim 13, comprising one of ASO.
15. The aRNA of any one of claims 1 to 14, wherein the aRNA is linked to a delivery vehicle. ADAR aRNA.
16. The delivery vehicle may be an antibody or a fragment thereof, an scFv, a peptide, a GalNAc, 16. The ADAR aRNA of claim 15, comprising one of an apatamer or a nanoparticle. 。
17. the aRNA is fully or partially encapsulated within a delivery vehicle; The delivery vehicle may be a lipidoid, a liposome, a lipoplex, a polymer, or a nanoparticle. The ADAR aRNA of claim 15, comprising one of the following particles:
18. The antisense oligonucleotide sequence is selected from the group consisting of SEQ ID NOs: 14 to 134. The ADAR aRNA of any one of claims 1 to 17, further comprising one or more of the following:
19. Antisense provided by one of SEQ ID NOs: 14-36 and 100-107 An ADAR1p110 aRNA comprising an oligonucleotide sequence.
20. An antigen binding site designated by one of SEQ ID NOs: 37-99, 108-113, and 134. An ADAR1p150 aRNA containing an antisense oligonucleotide sequence.
21. Antisense oligonucleotides represented by one of SEQ ID NOs: 114-133 ADAR2 aRNA containing a nucleotide sequence.
22. The ADAR aRNA according to any one of claims 1 to 34, 60, and 74 to 76. A method of modulating ADAR expression, comprising administering to a patient:
23. ADAR expression is increased, ADAR expression is at least 20%, at least 30%, at least 40%, or 23. The method of claim 22, wherein the increase is at least 50%.
24. 1. A method of treating a disease in a human, comprising: administering a therapeutically effective amount of a therapeutic RNA to a human; Administering the ADAR aRNA of any one of claims 1 to 21 to the human. A method including:
Citation Information
Patent Citations
saRNA composition and method of use
JP2018512876A