Modified pluripotent cells

Abstract

To provide pluripotent cells including induced pluripotent stem cell, embryonic stem cells and hypo-immune pluripotent cells that are ABO blood type O Rhesus Factor negative and evade rejection resulting from blood type antigen mismatch.SOLUTION: Provided is a modified pluripotent cell or a cell derived therefrom where the cell is ABO blood type O Rhesus Factor negative (Rh-), and the cell has: (a) reduced or eliminated ABO blood type antigen selected from the group consisting of A1, A2 and B; and / or (b) reduced or eliminated expression of Rh protein antigen selected from the group consisting of Rh C antigen, Rh E antigen, Kell K antigen (KEL), Duffy (FY) Fya antigen, Duffy Fy3 antigen, Kidd(JK), Jkb antigen, MNS antigen U and MNS antigen S.SELECTED DRAWING: None

Description

[Technical Field]

[0001] I. CROSS-REFERENCE TO RELATED APPLICATIONS This application was filed on May 10, 2019, pursuant to 35 U.S.C. § 119(e). No. 62 / 846,399 filed May 31, 2019. This application claims priority to U.S. Provisional Patent Application No. 62 / 855,499 filed on Dec. 1, 2002, and is hereby incorporated by reference. each of which is incorporated herein by reference in its entirety.

[0002] II. FIELD OF THE INVENTION The present invention relates to regenerative cell therapy. In some embodiments, the regenerative cell therapy comprises administering a cell line comprising: In some embodiments, the cell line is a cytosolic or cytosolic ester of OH. - Hypoimmunogenic pluripotent cells. In some embodiments, the regenerative cell therapy comprises a cell transplantation regimen. In some embodiments, the recipient's immune system is less likely to reject the allogeneic material. Live cell therapy is used to treat damaged organs and tissues. Live cell therapy is used to repair damaged tissue after myocardial infarction. [Background technology]

[0003] III. Background of the Invention Regenerative cell therapy is an important and promising treatment for regenerating damaged organs and tissues. Due to the limited availability of organs for transplantation and the long waiting times involved, The potential for tissue regeneration by transplanting readily available cell lines into patients is well-established. Regenerative cell therapy has been shown to improve cell viability after transplantation in animal models (e.g., after myocardial infarction). have shown promising early results in regenerating damaged tissue. The tendency of the patient's immune system to reject allogeneic materials significantly reduces the potential effectiveness of therapeutic agents. This reduces the potential positive effects associated with such treatments.

[0004] Autologous induced pluripotent stem cells (iPSCs) theoretically allow for patient-specific cell-based organ repair. However, their production presents technical and manufacturing challenges. The challenges and time-consuming process conceptually preclude any acute treatment. Allogeneic iPSC-based or embryonic stem cell-based therapies are more cost-effective from a manufacturing perspective. It is easy to generate a well-sorted, standardized, high-quality cell product. Stem cells have the potential for stem cell therapy because they can differentiate into all cell types of the three germ layers. The applications are diverse. Transplantation of progenitor cells that continue to differentiate and mature in the organ environment at the transplant site. Differentiation can be performed ex vivo or in vivo by This allows researchers or clinicians to closely monitor treatments and ensure the appropriate cell population is administered prior to transplantation. However, due to their allogeneic origin, The resulting cell product may be subject to rejection.

[0005] In the art, cells that are used to regenerate or replace diseased or defective cells are known. Pluripotent stem cells (PSCs) are cells that can rapidly produce They can be used to rapidly proliferate and differentiate into many potential cell types. contains several members produced by various techniques and with different immunogenic characteristics The patient's compatibility with the engineered cells or tissues derived from PSCs may affect the risk of immune rejection and The need for immunosuppression is determined.

[0006] Embryonic stem cells (ESCs) isolated from the inner cell mass of blastocysts are capable of mismatching with recipients. This immunological barrier is mediated by the human leukocyte antigen (HLA) of ESCs. This cannot be resolved by HLA type banking, because HLA-matched PSC transplants Even if there is a mismatch in non-HLA molecules that function as minor antigens, rejection occurs. This is also true for allogeneic induced pluripotent stem cells (iPSCs). Fits perfectly.

[0007] To avoid rejection problems, various techniques are being developed to generate patient-specific pluripotent stem cells. These include the transfer of a somatic cell nucleus into an enucleated oocyte (SCNT). NT (stem cells), fusion of somatic cells and ESCs (hybrid cells), and the use of specific transcription factors This includes reprogramming of somatic cells (induced PSCs or iPSCs). NT stem cells and iPSCs are derived from nuclear or cell donors, respectively, despite their chromosomal identity. SCNT stem cells may have immune incompatibility. NA (mtDNA). mtDNA-encoded proteins are related minor antigens. DNA and mtDNA mutations and iPS Genetic instability associated with reprogramming and culture growth of C. elegans is also associated with immune rejection. This hurdle poses a challenge for adaptation using SCNT stem cells or iPSCs. This makes large-scale manipulation of patient-specific tissue less likely to be successful.

[0008] Recently, hypoimmune pluripotency (HIP) has been reported, which allows for the host to avoid rejection by the allogeneic immune system. The emergence of erythroblastoma cells has been highly successful in allogeneic transplantation. These cells are HLA-I and HLA- Reduced II expression avoids initiation of an immune response while increasing CD47 production The inventions described herein are engineered to suppress phagocytic innate immune surveillance. will build on this technology to further reduce HIP cell rejection. Summary of the Invention [Problem to be solved by the invention]

[0009] IV. Summary of the Invention A previously unrecognized cause of transplant cell rejection is linked to blood group antigens Blood products are differentiated by the presence or absence of antigens on the surface of all red blood cells in the human body. The A, B, AB, and A1 antigens are responsible for the red blood cells. The genes for blood group antigens are determined by the sequence of oligosaccharides on the glycoproteins of blood cells. It provides instructions for making the original proteins. Blood group antigen proteins are expressed on red blood cells. They perform a variety of functions within membranes. These proteins function to interact with other proteins and molecules. transport of proteins into and out of cells, maintenance of cell structure, adhesion to other cells and molecules, and chemical Participation in reactions.

[0010] The Rhesus (Rh) blood group system is the second most important blood group system after the ABO blood group system. The Rh blood group system consists of 49 defined blood group antigens, of which five antigens, D , C, c, E, and e are the most important. An individual's Rh(D) status is usually AB It is expressed as type O followed by a positive or negative suffix. "Rh factor", "Rh positive", and The term "Rh negative" refers to the Rh(D) antigen only. Antibodies to the Rh antigen cause hemolysis. Antibodies against Rh(D) and Rh(c) antigens may be involved in fetal transfusion reactions. ABO antibodies pose a significant risk of hemolytic disease of the newborn and infant. However, rhesus antibodies in Rh-humans occur only if a person is sensitized. This occurs after the birth of an Rh+ newborn or after receiving a transfusion of Rh+ blood. So it happens. [Means for solving the problem]

[0011] The present invention provides a method for the identification of pluripotent (PSCO-) cells suitable for transplantation and / or differentiation, including the identification of ABO blood groups O and O. and / or rhesus factor-negative (O-) populations. SCs (iPSCO-), embryonic ESCs (ESCO-), and cells differentiated from these cells , e.g., O - endothelial cells, O - cardiomyocytes, O - hepatocytes, O - dopaminergic neurons , O-pancreatic islet cells, O-retinal pigmented endothelial cells, and other O-cells used in transplantation and medical treatment. These include O-chimeric antigen receptor (CAR) cells, e.g., CAR-T In some embodiments, the cells may include human CAR-NK cells, CAR-NK cells, and other engineered cell populations. The present invention further provides a method for producing or regenerating specific tissues and organs. Universally acceptable "off-the-shelf" ECO- and PS CO- and its derivatives are also provided.

[0012] Another aspect of the present invention is the use of PSCO-, iPSCO-, ESCO- and other O-cells for transplantation. The present invention also provides methods for producing a population of pluripotent or differentiated cells from transplantation of the population of pluripotent or differentiated cells. Also provided are methods for treating diseases, disorders, and conditions that would benefit from such treatments.

[0013] In some embodiments of the present invention, ABO blood group O is a type of ABO blood group protein with low expression. In another embodiment, the ABO blood group is endogenously type O. In some embodiments, the HIPO- cells are obtained by disruption of human exon 7 of the ABO gene. In some embodiments, the individual has ABO blood group O, which is the allelic variant of exon 7 of the ABO gene. In some embodiments, the gene is disrupted. The disruption is a clustered, regularly spaced, short palindromic sequence that disrupts both alleles. Clustered Regularly Interspaced Sho CRISPR / Cas9 reaction This is achieved.

[0014] In other embodiments, ABO blood group O is determined by enzymatic modification of ABO gene products on the surface of cells. In a preferred embodiment, carbohydrates are removed from the ABO gene products by enzymatic modification. In another preferred embodiment, the ABO A1 antigen, A2 antigen, or B antigen is removed by enzymatic modification. Remove carbohydrates from the antigen.

[0015] In some embodiments of the invention, the Rh blood group is intrinsically Rh-. The Rh- blood group is obtained by reducing or eliminating Rh protein expression. Rh-type is defined as Rh C antigen, Rh E antigen, Kell K antigen (KEL), Duffy ( FY) Fya antigen, Duffy Fy3 antigen, Kidd (JK) Jkb antigen, or / and / or Kidd obtained by disrupting the gene encoding SLC14A1. In some embodiments, the disruption is directed against Rh C antigen, Rh E antigen, Kell K antigen (K EL), Duffy (FY) Fya antigen, Duffy Fy3 antigen, Kidd (JK) J kb antigen and / or both alleles of the gene encoding Kidd SLC14A1 This is achieved by the CRISPR / Cas9 reaction, which disrupts the gene.

[0016] In some embodiments of the invention, O-cells of the invention (e.g., PSCO-, iPSCO- , ESCO- and cells derived therefrom) are derived from mammals, e.g., human, bovine, porcine , chickens, turkeys, horses, sheep, goats, donkeys, mules, ducks, geese, Buffalo, camel, yak, llama, alpaca, mouse, rat, dog, cat, hamster, Or derived from guinea pigs.

[0017] In a specific embodiment, the present invention provides a method for preventing rejection by the host allogeneic immune system while In addition, the immune system is hypoimmune and pluripotent, and the blood antigen type O Rhesus factor negative (HI) In some embodiments, HIPO- cells are provided. In some embodiments, HIPO- cells are provided that express HLA-I and HL Reducing or eliminating A-II expression and susceptibility of pluripotent cells to macrophage phagocytosis Increase expression of endogenous proteins that reduce the universal blood group ORh-("O") The universal blood types are engineered to include the ABO blood group A and B antigens and the R This can be achieved by eliminating h-factor expression or by starting with an O cell line. These new HIPO cells have impaired antigen-presenting capacity, protection from innate immune clearance, and They avoid host immune rejection because they have immune protection and lack blood group rejection.

[0018] In certain embodiments, the HIPO-cells of the present invention have the following advantages over unmodified pluripotent cells: , reduced endogenous major histocompatibility antigen class I (HLA-I) function; unmodified pluripotent cells and Compared with NK cells, reduced endogenous major histocompatibility antigen class II (HLA-II) function was observed. Increased expression of CD47 compared to unmodified pluripotent cells reduces susceptibility to cell killing; A BO blood group O (O); and Rhesus factor (Rh) negative (-) blood group; Human hypoimmunogenic pluripotent O- (HIPO-) cells were compared with subjects with ABO blood group or Rh factor deficiency. in subjects compared with matched, otherwise similar hypoimmunogenic pluripotent (HIP) cells When transplanted, they are less susceptible to rejection.

[0019] In certain embodiments of the invention, HIPO- cells are characterized by the expression of the beta-2 microglobulin protein. In another embodiment, the beta-2 microglobulin has reduced HLA-I function due to reduced expression. In some embodiments, the gene encoding the globulin protein is knocked out. In some embodiments, both alleles of the B2 gene are disrupted. In some embodiments, the HIPO- cells are HLA-A In another embodiment, the HLA-I function is reduced due to reduced protein expression. In another embodiment, the gene encoding the HLA AA protein is knocked out. In some embodiments, HLA-I function is reduced by reducing HLA-B protein expression. In another embodiment, the gene encoding the HLA-B protein is knocked out. HIPO- cells have reduced HLA-I function due to reduced HLA-C protein expression In some embodiments, the gene encoding the HLA-C protein is knocked out. In some embodiments, the HIPO- cells do not contain HLA-I function.

[0020] In a particular embodiment of the present invention, HIPO- cells are characterized by reduced CIITA protein expression. In another embodiment, the CIITA protein has reduced HLA-I function. In one embodiment of the present invention, the HIPO- cells are In another embodiment, the HLA-I function is reduced by reducing A-DP protein expression. In another embodiment, the gene encoding the HLA-DP protein is knocked out. HLA-II function is reduced by reducing HLA-DR protein expression. In another embodiment, the gene encoding the HLA-DR protein is knocked out. In other words, HLA-II function is reduced by reducing HLA-DQ protein expression. In one embodiment, the gene encoding HLA-DQ is knocked out. Primordial pluripotent cells do not contain HLA-II function.

[0021] In one embodiment, the HIPO-cells of the present invention are pluripotent cells for macrophage phagocytosis. In some embodiments, the cells are engineered to have increased expression of a protein that reduces the susceptibility of the cells to the disease. In some embodiments, the increased expression results from modifications to the endogenous locus. In this study, HIPO- cells had reduced susceptibility to NK cell killing, which was attributed to the CD47 In another embodiment, increased expression of the CD47 protein is achieved. Protein expression is obtained by modifications to the endogenous CD47 locus. Enhanced CD47 protein expression is achieved by the addition of a CD47 transgene. In embodiments, increased CD47 protein expression is achieved by the expression of at least one gene encoding the human CD47 gene. This is achieved by introducing two copies of the gene into the cell under the control of a promoter. In some embodiments, the promoter is a constitutive promoter.

[0022] In some embodiments, the HIPO-cells of the present invention kill poorly immunogenic pluripotent cells. In another embodiment, the suicide gene is a single Herpes simplex virus thymidine kinase gene In another embodiment, the gene is HSV-tk and the trigger is ganciclovir. The gene is the Escherichia coli cytosine deaminase gene ( EC-CD) and the trigger is 5-fluorocytosine (5-FC). In this case, the suicide gene is an inducible caspase protein, and the trigger is a protein dimer. In another more preferred embodiment, the CID is a compound that induces inflammatory bowel disease (CID). be.

[0023] One aspect of the present invention is the use of the PSCO-, iPSCO-, ESCO-, and and / or cells derived from HIPO- cells, wherein the cells express a chimeric antigen receptor ( CAR) cells, endothelial cells, dopaminergic neurons, pancreatic islet cells, and retinal pigment endothelial cells In a preferred embodiment, the CAR cell is a CAR-T cell.

[0024] The present invention relates to diseases, disorders, and conditions that would benefit from transplantation with the cells of the present invention or derivatives thereof. The present invention provides a method for treating a condition, which method comprises administering to a subject a PSCO-, iPS-, or other iPS cell line described herein. This includes administering CO-, ESCO-, HIPO- and / or other ABO-cells. In embodiments, PSCO-, iPSCO-, ESCO-, HIPO- and / or other ABO- The cells include chimeric antigen receptor (CAR) cells, endothelial cells, dopaminergic neurons, and pancreatic In some embodiments, the disease is selected from the group consisting of islet cells, and retinal pigmented endothelial cells. , type I diabetes, heart disease, nervous system disease, cancer, eye disease, and vascular disease. In some embodiments of the present invention, the method comprises: IPO-cells, and PSCO-, iPSCO-, ESCO-, and HIPO-cell derived The method includes transplanting ABO- cells of the present invention, including cells of the present invention, into a mammalian subject. In some embodiments, the subject is a human, a cow, a pig, a chicken, a turkey, a horse, Sheep, goats, donkeys, mules, ducks, geese, buffalo, camels, yaks, llamas, alpacas, etc. Pacas, mice, rats, dogs, cats, hamsters, and guinea pigs.

[0025] Another aspect of the present invention is the production of low immunogenic pluripotent ABO group ORh factor negative (H) cells from O-iPSCs. (a) a method for producing IPO- cells, which has the following advantages compared to unmodified pluripotent cells: (a) a primary pluripotent cell; Eliminate or reduce histocompatibility antigen class I (HLA-I) function (b) modifying the pluripotent cells to produce a pluripotent cell that expresses major histocompatibility complex class II (H) antigens, as compared to unmodified pluripotent cells; (c) eliminating or reducing HLA-I function; Increasing the expression of CD47 compared to the expression of CD47 in PSCs. In this embodiment, the starting iPSCs are not O-, and therefore the method further comprises: (d) Eliminating any ABO blood group antigens to result in ABO blood group O; and (e ) Eliminate any Rhesus factor (Rh) blood group antigens, resulting in Rh-negative (-) Includes steps.

[0026] The present invention also provides the artificial ABO blood group O-Rh factor(-) pluripotent (e.g., For example, one or more cells derived or differentiated from PSCO-, iPSCO-, ESCO-) cells. These cells are also derived from the ABO blood group O (O) and Rhesus factor (Rh) ) blood type negative (-), which when transplanted into a subject, is of the ABO blood group or These make the cells less susceptible to rejection than cells that are Rh factor incompatible.

[0027] The present invention also provides a method for screening and / or administering hypoimmunogenic cells to subjects. Stratification was also performed, where the ABO blood group type of the low immunogenic cells and the ABO blood group type of the subject were compared. After matching, cells are administered. For example, the present invention is directed to the following: ABO blood group A or administration of ABO blood group A hypoimmunogenic cells to subjects determined to be type AB; A ABO blood group B hypoimmune test for subjects determined to be BO blood group B or AB Administration of progenitor cells; ABO blood group A to subjects determined to be ABO blood group AB administration of type B hypoimmunogenic cells; or administration of type B hypoimmunogenic cells determined to be ABO blood group A, B, AB, or O Administration of ABO blood group O hypoimmunogenic cells to a designated subject may be performed.

[0028] Another aspect of the present invention is the screening of subjects for administration of hypoimmunogenic cells and and / or stratification, wherein the ABO blood group and Rh blood type of the hypoimmunogenic cells are compared with the test subject. After matching the recipient's ABO blood group and Rh blood type, cells are administered. The invention relates to a method for treating a subject who is determined to be ABO blood group A or AB and Rh positive (+). In another example, administration of ABO blood group A, Rh positive (+) hypoimmunogenic cells may be provided. The present invention relates to a subject who is determined to be ABO blood group B or AB and Rh positive (+). In another example, administration of ABO blood group B, Rh positive (+) hypoimmunogenic cells may be provided. The present invention relates to a method for treating a subject who is determined to be ABO blood type AB and Rh positive (+). In another example, administration of ABO blood group AB, Rh positive (+) hypoimmunogenic cells may be provided. The present invention relates to a blood type ABO, B, AB, or O, and Rh positive (+) Administration of ABO blood group O, Rh positive (+) hypoimmunogenic cells to a subject may be provided. In another example, the present invention relates to a method for treating a patient who has been determined to be an ABO blood group A or AB and Rh negative (-). The present invention provides for the administration of ABO blood group type A, Rh negative (-) hypoimmunogenic cells to subjects. In another example, the present invention relates to a method for treating a person who is determined to be an ABO blood group B or AB and Rh negative (-). The present invention provides for the administration of ABO blood group B, Rh negative (-) low immunogenic cells to a selected subject. In another example, the present invention provides a method for treating a patient who has been determined to be ABO blood group AB and Rh negative (-). The present invention provides for the administration of ABO blood group AB, Rh negative (-) hypoimmunogenic cells to subjects. In another example, the present invention relates to a human having an ABO blood group of A, B, AB, or O, and Rh negative (-). Injection of ABO blood group O, Rh negative (-) low immunogenic cells to subjects who were determined to have can provide a grant.

[0029] Another aspect of the present invention is the screening of subjects for administration of hypoimmunogenic cells and and / or stratification, wherein the ABO blood group type of the hypoimmunogenic cells and the ABO blood group type of the subject are The Rh blood type of the hypoimmunogenic cells is compatible with the Rh blood type of the subject, but the Rh blood type of the hypoimmunogenic cells is not compatible with the Rh blood type of the subject. In this embodiment, the cells are administered only if the patient is Rh negative (-) and the cells are administered only if the patient is Rh negative (-). For example, the present invention is directed to subjects with ABO blood group A or A ABO blood group A, Rh negative for subjects who were determined to be type B and Rh positive (+) In another example, the present invention provides for the administration of ABO blood group B or ABO blood group B, Rh negative for subjects who were determined to be AB type and Rh positive (+) In another example, the present invention provides for the administration of ABO blood group AB cells. ABO blood group AB, Rh negative for subjects who were determined to be type AB and Rh positive (+) In another example, the present invention provides for the administration of ABO blood groups A, B, C, D, E, E, F ... or ABO blood group O for subjects determined to be type AB and Rh positive (+) , administration of Rh-negative (-) hypoimmunogenic cells may be provided. [Brief explanation of the drawings]

[0030] [Figure 1]Figure 1A shows that hypoimmunogenic B2M- / -CITA- / - rhesus CD47tg endothelial cells did not activate adaptive or innate immune cells in immunoassays using blood from rhesus macaques (Macaque Rhesus) in which the cells did not survive. Hypoimmunogenic B2M- / -CITA- / - rhesus CD47tg endothelial cells were rejected by T cells, cytotoxic T cells, or NK cells. Figure 1B shows that hypoimmunogenic B2M- / -CITA- / - rhesus CD47tg endothelial cells did not trigger antibody production and were not rejected by macrophages. These results suggest another mechanism for cell death, as the cells were eliminated from the macaques. [Figure 2] Figure 2A shows that adaptive immune cells (T cells, cytotoxic T cells, and B cells) were activated in an immunoassay using blood from a rhesus macaque (Macaque Rhesus) that rejected unmodified human iPSC-derived endothelial cells. Figure 2B shows that innate immune cells (NK cells and macrophages) were activated in an immunoassay using blood from a rhesus macaque (Macaque Rhesus) that rejected HLA-I-deficient / HLA-II-deficient human iPSC-derived endothelial cells. Figure 2C shows that rhesus macaque (Rhesus) blood group B serum induces complement-dependent cytotoxicity (CDC) of wild-type (wt) induced endothelial cells (iECs) from blood group A. Figure 2D shows that iECs from blood group O were unaffected. Figure 2E shows that embryonic stem cell-derived ECs undergo the same ABO blood group-dependent CDC as iPSC-derived iECs. [Figure 3] Targeted cell killing by ABO-incompatible serum was confirmed by incubating human B2M- / -CITA- / - rhesus CD47tg hypoimmunogenic endothelial cells with rhesus monkey serum. Human hypoimmunogenic endothelial cells (blood type A) were rapidly killed when incubated with rhesus monkey serum (blood type B). The lack of either IgM or IgG antibodies demonstrated that the ABO-antibodies were IgM-derived. [Figure 4]Human B2M- / -CITA- / - rhesus CD47tg cells were not rejected by other pre-existing antibodies when transplanted across a xenogeneic barrier. Human B2M- / -CITA- / - rhesus CD47tg iPSC-derived endothelial cells (blood type A) were killed when incubated with ABO-incompatible rhesus monkey serum (blood type B). However, human cells survived when serum from blood type AB rhesus monkeys was used. [Figure 5] Figure 5A shows that human hypoimmunogenic iPSC-derived cardiomyocytes (blood type A) survive when incubated with allogeneic human serum blood types A and AB. However, serum containing pre-existing antibodies to A (blood types O and B) immediately killed the cells. Figure 5B shows that mature cardiomyocytes (blood type A) survive when incubated with ABO-matched allogeneic human serum (blood types A and AB) but are killed when incubated with serum containing pre-existing antibodies to A (blood types O and B). [Figure 6] Figure 6 shows that blood group A human hepatocytes survive when incubated with ABO-compatible serum (blood groups A and AB) but are killed when incubated with ABO-incompatible serum (blood groups O and B). Similarly, blood group AB human hepatocytes survive when incubated with ABO-compatible serum (blood group AB) but are killed when incubated with ABO-incompatible serum (blood groups A, B, and O). [Figure 7]Figure 7A shows that endothelial cells (blood type A Rh+ or Rh-) can survive when incubated with either Rh+ or Rh- ABO-compatible serum (blood type A) if the serum has not been pre-sensitized to Rh factors. Figure 7B shows that endothelial cells (blood type A or B Rh+) ​​are killed when incubated with ABO-compatible serum (blood type AB) that is Rh- if the serum contains anti-Rh antibodies due to pre-sensitization to Rh factors. Endothelial cells (blood type A Rh-) are not killed when incubated with the same blood type AB serum containing anti-Rh antibodies because EC cells do not express Rh antigens. Hypoimmunogenic endothelial cells (B2M- / -CITA- / -CD47tg) (blood type A Rh+) ​​are also killed when incubated with ABO-compatible serum (blood type AB) that is Rh- and pre-sensitized to Rh factors. Figure 7C shows that endothelial cells with blood type O Rh+ were killed using O Rh- serum pre-sensitized to Rh factors. Figure 7D shows that H9-derived ECs with blood type A Rh+ underwent CDC killing when incubated with ABO-compatible serum containing Rh antibodies. Figure 7E shows that HEK293 cells incubated with serum containing Rh antibodies did not undergo killing. DETAILED DESCRIPTION OF THE INVENTION

[0031] VI. Detailed Description of the Invention The present invention provides rhesus factor-negative pluripotent cells of any ABO blood type, e.g., type O. However, these cells may contain one or more genes or enzyme manipulations as outlined herein. These cells act to evade or minimize the host immune response. They lack the major blood group and immune antigens required for immune defense, and are not subject to rejection, phagocytosis, or killing. This allows for the creation of specialized tissues and organs. This will allow for the derivation of "off-the-shelf" cell products for human allogeneic PSCO- The use of iPSCO-, ESCO-, or HIPO-cells and their derivatives offers important benefits and as such, the long-term supportive immunity commonly seen in allogeneic transplantation. It has been shown that cell graft rejection can be avoided without the need for suppressive therapy and the use of drugs. This also allows for the use of cell therapy that does not require individual treatment for each patient. Recently, cells generated from autologous cell sources have become available. The cell product may be subject to immune rejection due to few or even a single antigenic mutation. Therefore, autologous cell products are not inherently non-immunogenic. Autologous cells are not suitable for acute treatment because cell manipulation and quality control for patients require a huge amount of effort and expense. Allogeneic cell products are rarely available as an option for immune hard Only after overcoming these limitations can it be used in a larger patient population. The PSCO-, iPSCO-, ESCO-, and HIPO-cells of the present invention, as well as These cell lines can be used as universal cells to generate universally acceptable derivatives. It will provide a source of supply.

[0032] In addition to the O blood type, the present invention also takes advantage, in part, of the maternal-fetal immune tolerance that exists in pregnant women. The fetus's human leukocyte antigens (HLA) are paternally inherited, and the fetus has major HLA incompatibility. Although the fetus expresses antigens, the maternal immune system does not recognize the fetus as an allogeneic entity, e.g. Maternal-fetal tolerance is primarily due to the fact that the immune system does not initiate an immune response similar to that seen in the host-versus-graft response. This is mediated by syncytiotrophoblast cells at the maternal-fetal interface. The cells express proteins of the major histocompatibility complexes I and II (MHC-I and MHC-II). They exhibit little or no phagocytic innate immune surveillance and elimination of HLA-deficient cells. known as the "don't eat me" protein that inhibits Remarkably, the same tolerant gene that prevents fetal rejection during pregnancy also increases CD47 expression. The cytotoxic mechanism also allows the HIPO-cells of the present invention to avoid rejection and to express these cells after allogeneic transplantation. This allows for promoting long-term cell survival and engraftment.

[0033] Maternal-fetal immune tolerance was achieved with only three gene modifications (compared to unmodified iPSCs, e.g., hiPSCs). Compared to: two activity reductions ("knockouts" as further described herein) and one The gene can be introduced by increasing one of its activities ("knock-in" as described herein). Overall, others have attempted to suppress the immunogenicity of iPSCs, but with only partial success. Not mentioned: Rong et al., Cell Stem Cell 14:121-1 30 (2014) and Gornalusse et al., Nature Biote ch doi:10.1038 / nbt.3860), International Publication No. 2018 / 13278 No. 3 and U.S. Provisional Patent Application Nos. 62 / 698,941 and 62 / 69 Specification No. 8,965, Specification No. 62 / 698,973, Specification No. 62 / 698,978 Specifications, 62 / 698,981 and 62 / 698,984 ( each of which is incorporated herein by reference in its entirety).

[0034] Autologous induced pluripotent stem cells (iPSCs) are a patient-specific, autologous cell-based organ repair strategy However, as previously mentioned, autologous iPSCs constitute an unlimited cell source for The generation of endothelial cells and their subsequent differentiation into tissue cells presents technical and manufacturing challenges, making it difficult to provide acute treatment. It is a long process to use them in modalities. By making available pre-fabricated, ready-to-use cell or tissue products of human origin, This can be overcome.

[0035] Starter cell lines for off-the-shelf, ready-to-use cell or tissue products of allogeneic origin are The PSCO-, iPSCO-, ESCO-, or Hipo-cells are then maintained, differentiated into desired cell and tissue types, and finally, transformed into the desired tissues. For the first time, readily available non-immunogenic pluripotent cells for transplantation of their derivatives into patients with Provide it to customers.

[0036] definition The term "pluripotent cells" refers to cells that are capable of self-renewal and proliferation while maintaining an undifferentiated state. It refers to cells that can be differentiated into specific cell types under appropriate conditions. The term "pluripotent cells" as used herein refers to embryonic stem cells and other types of stem cells. The present invention encompasses stem cells, including fetal, amniotic, or adult stem cells. An exemplary human stem cell line is the H9 human embryonic stem cell line. National Institutes of Health Human Embr yonic Stem Cell Registry and Howard Hughes Made available from the Medical Institute HUES Collection (Cowan, CA et al., which is incorporated herein by reference in its entirety). As described in l., New England J. Med. 350:13. (2004) ).

[0037] As used herein, "pluripotent stem cells" refer to stem cells that can be derived from one of three germ layers: endoderm (e.g., the lining of the stomach, gastrointestinal tract, lungs, etc.), mesodermal (e.g., muscle, bone, blood, urogenital tissue, etc.) or ectodermal ( The term "pluripotent" refers to the ability to differentiate into any of the following tissues: epidermal tissue and nervous system tissue. "Stem cells," as used herein, also refer to "induced pluripotent stem cells," or "iPSCs," i.e. In other words, it also includes types of pluripotent stem cells derived from non-pluripotent cells. Examples of parent cells include: Reprogrammed cells to induce a pluripotent, undifferentiated phenotype by various means These "iPS" or "iPSC" cells induce the expression of specific regulatory genes. These can be produced by introducing specific proteins into the cells or by the external application of specific proteins. Methods for deriving PS cells are known in the art and are described in more detail below. Zhou et al., Stem Cells 27(11):2667-74( 2009);Huangfu et al.,Nature Biotechnol.2 6(7):795(2008);Woltjen et al.,Nature 458 (7239):766-770(2009); and Zhou et al., Cell See Stem Cell 8:381-384 (2009); each of these (The entire contents of which are incorporated herein by reference.) Creation of Induced Pluripotent Stem Cells (iPSCs) As used herein, "hiPSCs" refers to human induced pluripotent stem cells (hiPSCs), the production of which is outlined below. "miPSC" is a mouse induced pluripotent stem cell.

[0038] Several characteristics of pluripotent stem cells distinguish them from other cells. Under appropriate conditions, all three germ layers (endoderm, mesoderm, and ectoderm) can be used to generate lineage-related embryos. The ability to produce offspring that can undergo differentiation into cell types that collectively exhibit the characteristics required for pluripotency is called pluripotency. The expression or non-expression of specific combinations of molecular markers also characterizes pluripotent stem cells. For example, human pluripotent stem cells are characterized by the following non-limiting list: SSEA-3, SS EA-4, TRA-1-60, TRA-1-81, TRA-2-49 / 6E, ALP, S Markers from ox2, E-cadherin, UTF-1, Oct4, Rex1, and Nanog In some embodiments, the pluripotent stem cells express at least some, and in some embodiments, all, of the phospholipids. Cell morphology associated with endothelial progenitor cells and / or It is not necessary to go through pluripotency to be reprogrammed into hepatocytes.

[0039] As used herein, "multipotent" or "multipotent cells" refers to a limited number of other specific For example, induced multipotent cells can be used to generate endothelial cells. In addition, multipotent blood stem cells can form lymphocytes, monocytes, neutrophils, etc. They can differentiate into several types of blood cells, including erythrocytes and blastocysts.

[0040] As used herein, the term "oligopotent" refers to an adult stem cell that is capable of giving rise to a small number of different cells. For example, lymphoid or myeloid stem cells have the ability to differentiate only into lymphoid or myeloid types, respectively. It can generate cells of the pancreatic or myeloid lineages.

[0041] As used herein, the term "unipotent" refers to a cell that has the ability to form a single cell type. For example, spermatogonial stem cells can only form sperm cells.

[0042] As used herein, the term "totipotency" refers to the ability of a cell to form an entire organism. For example, in mammals, only the zygote and first cleavage stage blastomeres are totipotent.

[0043] As used herein, a "non-pluripotent cell" refers to a mammalian cell that is not a pluripotent cell. Examples of such cells include differentiated cells as well as progenitor cells. tissues selected from, but not limited to, bone marrow, skin, skeletal muscle, adipose tissue, and peripheral blood Exemplary cell types include, but are not limited to, fibroblasts, hepatocytes, These include cells such as myoblasts, neurons, osteoblasts, osteoclasts, and T cells. The starting cells used to generate cells, endothelial progenitor cells, and hepatocytes are also non-pluripotent cells. It is possible.

[0044] Differentiated cells include, but are not limited to, multipotent cells, oligopotent cells, unipotent cells, and progenitor cells. In certain embodiments, the less potent cells are more potent than the more potent cells. In terms of force cells, they are considered "differentiated."

[0045] Somatic cells are the cells that make up the body of an organism. Somatic cells are the cells that make up the organs, skin, and blood of an organism. , which contain cells that make up bone and connective tissue, but do not contain germ cells.

[0046] The cells may be, for example, of human or non-human mammalian origin. Non-human mammals include, but are not limited to, mice, rats, cats, dogs, rabbits, and lumots, hamsters, sheep, pigs, horses, cattle, and non-human primates. In some embodiments, the cells are from an adult or non-human mammal. In some embodiments, the cells are from a neonatal, adult, or non-human mammal.

[0047] As used herein, the term "subject" or "patient" refers to a human subject, such as a domestic animal, a zoo animal, or a "Subject" or "patient" refers to any animal, including a dog, cat, bird, The subject may be a mammal, such as a mammal, a domestic animal, or a human. Specific examples of "subject" and "patient" include: These include, but are not limited to, liver, heart, lungs, kidneys, pancreas, brain, nervous tissue, blood, bone, and bone marrow. and individuals (particularly humans) with diseases or disorders associated with the disease.

[0048] The mammalian cells may be from a human or non-human mammal. Mammals include, but are not limited to, mice, rats, cats, dogs, rabbits, guinea pigs, Hamsters, sheep, pigs, horses, cattle, and non-human primates (e.g., chimpanzees) , macaques, and apes).

[0049] As used herein, "low immunogenic pluripotent" cells or "HIP" cells are cells that are pluripotent in nature and possess the following characteristics: and multipotent stem cells that retain the immune system and, when transplanted into an allogeneic host, result in a reduced immune rejection response. In a preferred embodiment, HIP cells do not generate an immune response. Thus, "low immunogenicity" refers to the immunogenicity of unmodified or wild-type (i.e., "wt") pluripotent cells, i.e., A significantly reduced or eliminated immune response compared to the immune response of the cells prior to the immuno-engineering as outlined in the subsection. In many cases, HIP cells are immunologically silent and Moreover, they still retain their pluripotent potential. Assays for HIP characteristics are outlined below. do.

[0050] As used herein, the terms "low immunogenic pluripotent cells O-" and "low immunogenic pluripotent ORh-" cells are used. A "HIPO-" cell is a HIP-cell that is ABO blood group 0 and Rhesus factor negative. HIPO- cells are cells that are either produced from O- cells or produced by enzymes that convert them to O-. It may either be modified or genetically engineered to be O-.

[0051] As used herein, "HLA" or "human leukocyte antigen" complex refers to the major antigens in humans. The HLA complex refers to the complex of genes that encode the major histocompatibility complex (MHC) proteins. These cell surface proteins that make up the body are responsible for regulating the immune response to antigens. In the case of , there are two MHC, class I and class II, "HLA-I" and "HLA-II" HLA-I is composed of three proteins that present peptides from inside the cell: HLA- The antigens presented by the HLA-I complex include HLA-A, HLA-B, and HLA-C. - T cells (also called CD8+ T cells or cytotoxic T cells). HLA-II is a type of HLA-II antigen that binds to β-2 microglobulin (B2M). , five proteins, HLA-DP, HLA-DM, HLA-DOB, HLA-DQ and These contain HLA-DR, which present antigens to T lymphocytes from the outside of the cell. It stimulates CD4+ cells (also known as T helper cells). It should be understood that any use of "HLA" is not intended to be limiting. When referring to biological cells, these terms may be used interchangeably herein.

[0052] As used herein, "gene knockout" refers to the knockout of a specific gene from a host in which it normally resides. Inactivate it in the cell, thereby preventing the production of the protein of interest or the process of rendering it inactive. As will be explained in more detail below, this can be achieved in several different ways. Such methods include, for example, removing nucleic acid sequences from genes or substituting other sequences. These include disrupting the sequence, altering the reading frame, or altering the regulatory elements of the nucleic acid. For example, all or part of the coding region of a gene of interest may be removed, or a "nonsense" sequence may be inserted. and can be substituted with a sequence, removing or replacing all or part of a regulatory sequence such as a promoter. The translation initiation sequence can be removed or replaced, etc.

[0053] As used herein, "gene knock-in" refers to the process of imparting gene function to a host cell. This results in increased levels of the encoded protein. As will be appreciated, this can be accomplished in several ways, including: The addition of one or more copies of a gene to a host cell or the expression of the protein to be produced Alterations to the regulatory elements of endogenous genes can increase expression. This can include promoter modifications, different This can be achieved by adding promoters, adding enhancers, or modifying other gene expression sequences. It is possible.

[0054] "β-2 microglobulin" or "β2M" or "B2M" protein is shown below. The human gene is designated by accession number NC_000015.10:44711487-44718159.

[0055] The "CD47 protein" refers to a human CD47 protein having the amino acid and nucleic acid sequences shown below. Refers to the CD47 protein; the human gene has accession number NC_000016.1 0:108662208-10941562.

[0056] The "CIITA protein" is a human CIITA protein having the amino acid and nucleic acid sequences shown below. The human CIITA protein is identified under the accession number NC_000003 .12:108043094-108094200.

[0057] As used herein, "wild-type" in reference to a cell means a naturally occurring cell. However, in the context of pluripotent stem cells as used herein, this refers to nucleic acids that confer pluripotency. may contain modifications, but have not been subjected to the gene editing methods of the present invention to achieve low immunogenicity. It also means iPSCs.

[0058] As used herein, "syngeneic" refers to immunological compatibility; e.g., a condition in which an immune response does not occur. It refers to the genetic similarity or identity between the host organism and the cell graft.

[0059] As used herein, "allogeneic" refers to a genetically engineered host organism and cell graft in which no immune response occurs. It means genetic dissimilarity.

[0060] As used herein, "B2M- / -" refers to a mutant in which the B2M gene is inactivated on both chromosomes. As described herein, this can be accomplished in a variety of ways. This can be done.

[0061] As used herein, "CIITA- / -" refers to a mutation in which the CIITA gene is inactive on both chromosomes. As described herein, this can be accomplished in a variety of ways. This can be done.

[0062] As used herein, "CD47tg" (for "transgene") refers to a gene that expresses a CD47tg gene in a host cell that: In some cases, having at least one additional copy of the CD47 gene This means that the cells express CD47.

[0063] "Oct polypeptide" refers to a naturally occurring member of the octamer family of transcription factors. It refers to either the bar or its variants, which are the most closely related naturally occurring family - Similar transcription factor activity within at least 50%, 80%, or 90% compared to members The Oct polypeptide also maintains at least one of the naturally occurring family members. It may also contain a DNA binding domain and may further contain a transcription activation domain. Representative Oct polypeptides include Oct-1, Oct-2, Oct-3 / 4, and Oct- Oct-6, Oct-7, Oct-8, Oct-9, and Oct-11. / 4 (referred to herein as "Oct4"), as well as the POU domain, Pit-1, O Contains a 150 amino acid sequence conserved among ct-1, Oct-2, and uric-86 . (Ryan,AK&Rosenfeld,MG,Genes Dev.11: 1207-1225 (1995), the entire contents of which are incorporated herein by reference. In some embodiments, the variants are members of the naturally occurring Oct polypeptide family. members, such as those listed above, or Genbank accession number NP- 002692.1 (human Oct4) or NP-038661.1 (mouse Oct4) At least 85%, 90%, or 95% of the amino acids across the entire sequence compared to Oct polypeptides (e.g., Oct-3 / 4 or Oct4) have sequence identity with It may be of human, murine, rat, bovine, porcine, or other animal origin. The Oct polypeptide is a non-pluripotent protein. It may also be a pluripotency factor that can assist in the induction of multipotency in sex cells.

[0064] "Klf polypeptide" refers to the protein that encodes Krüppel-like factor (Klf). Drosophila embryonic pattern, a naturally occurring member of the Milli Zinc phosphate contains an amino acid sequence similar to that of the zinc phosphate regulatory factor Krueppel. protein, or the closest naturally occurring family member. maintain transcription factor activity (within at least 50%, 80%, or 90% activity) Variants of existing members, or at least DNA of naturally occurring family members A-binding domain and further includes a transcription activation domain. (Dang, D.T., Pev, the entire contents of which are incorporated herein by reference. sner, J. & Yang, VW, Cell Biol. 32:1103-112 1 (2000). Exemplary Klf family members include Klf1 , Klf2, Klf3, Klf-4, Klf5, Klf6, Klf7, Klf8, Klf 9, Klf10, Klf11, Klf12, Klf13, Klf14, Klf15, Kl Klf2 and Klf4 are involved in iP regulation in mice. It was found that this factor can produce S cells, and the related genes Klf1 and Klf 5 was also possible, albeit with lower efficiency (see, e.g., ref. 1, which is incorporated herein by reference in its entirety). Nakagawa, et al., Nature Biotechnology 26:101-106 (2007). In some embodiments, the variant is a naturally occurring Klf polypeptide family member, such as those listed above, or Genbank accession number CAX16088 (mouse Klf4) or CAX Compared with 14962 (human Klf4), at least 85% across the entire sequence, 0%, or 95% amino acid sequence identity. Klf1, Klf4, and Klf5) can be derived from humans, mice, rats, cows, pigs, or other animals. Generally, the protein is of the same species as the cell being engineered. The polypeptide may be a pluripotency factor. Expression of the Klf4 gene or polypeptide These may be useful in inducing multipotency in a population of developing or starting cells.

[0065] "Myc polypeptide" refers to any naturally occurring member of the Myc family. (See, e.g., Adhikary, S., incorporated herein by reference in its entirety. .&Eilers, M., Nat. Rev. Mol. Cell Biol. 6:635- 645 (2005)). This is also the most closely related naturally occurring family maintain similar transcription factor activity compared to the other members (i.e., at least 50%, 80%) %, or within 90% activity). a polypeptide comprising at least the DNA binding domain of a member thereof, and further comprising a transcription factor It may also contain an activation domain. Exemplary Myc polypeptides include, for example, c-Myc, In some embodiments, variants include naturally occurring N-Myc and L-Myc. Myc polypeptide family members, such as those listed above, or Genban Compared with the k accession number CAA25015 (human Myc), Myc polypeptides have at least 85%, 90%, or 95% amino acid sequence identity with the Myc polypeptide. The peptide (e.g., c-Myc) may be derived from human, mouse, rat, bovine, porcine, or other animal Generally, proteins from the same species as the cells being engineered are used. The polypeptide may be a pluripotency factor.

[0066] "Sox polypeptides" are polypeptides that bind to SR proteins, characterized by the presence of a high mobility group (HMG) domain. Naturally occurring members of the Y-related HMG-box (Sox) transcription factors, or their closest natural relatives maintain similar transcription factor activity compared to naturally occurring family members (i.e., This refers to either a variant (within 50%, 80%, or 90% of the activity) Also, polypeptides containing at least the DNA binding domain of naturally occurring family members The peptide may also include a transcription activation domain (see, e.g., see, e.g., the entirety of Dang, DT et al., Int. J. Biol. See Chem. Cell Biol. 32:1103-1121 (2000). Exemplary Sox polypeptides include, for example, Sox1, Sox2, Sox3, Sox4, Sox5, Sox6, Sox7, Sox8, Sox9, Sox10, Sox11, Sox12, Sox13, Sox14, Sox15, Sox16, Sox17, Sox18, Sox19 ... 4, Sox5, Sox6, Sox7, Sox8, Sox9, Sox10, Sox11, S ox12, Sox13, Sox14, Sox15, Sox17, Sox18, Sox21 Sox1 is a marker for iPS cell production with similar efficiency to Sox2. The genes Sox3, Sox15, and Sox18 have also been shown to be efficient in S Although somewhat less potent than ox2, it has been shown to produce iPS cells (see reference in its entirety). Nakagawa, et al., Nature Biol. (See Technology 26:101-106 (2007)). In embodiments, the variant is a naturally occurring Sox polypeptide family member, e.g. , listed above, or Genbank accession number CAA83435 (human So x2) across the entire sequence, at least 85%, 90%, or 95% of the sequences Sox polypeptides (e.g., Sox1, Sox2, Sox3) share amino acid sequence identity with 3, Sox15, or Sox18) in humans, mice, rats, cows, pigs, or other animals. Generally, proteins from the same species as the cells being engineered are used. The x polypeptide may be a pluripotency factor. As discussed herein, the Sox2 protein Proteins are particularly useful for generating iPSCs.

[0067] "Differentiated ABO-cells" refer to, for example, differentiated PSCO- or HIPO-cells as described herein. means pluripotent cells that are blood group O, Rh factor-, which are low immunogenic (e.g., B (by knockout of 2M and CIITA and knock-in of CD47) The cells may be generated and then differentiated into a cell type for eventual transplantation into the subject. For example, HIPO-cells may be hepatocytes ("dHIPO-hepatocytes"), β-like pancreatic cells, or pancreatic Islet organoid-like pancreatic cells ("dHIPO-β cells"), endothelial cells ("dHIPO-endothelial cells") These cells can be differentiated into various types of cells, such as epithelial cells.

[0068] In the context of two or more nucleic acid or polypeptide sequences, the term percent "identity" refers to The sequence comparison algorithms described below (e.g., BLASTP and BLASTN or the like) The comparison is made using one of the algorithms (or other algorithms available to the manufacturer) or by visual inspection. Nucleotides or amino acids that are the same when compared and aligned for maximum correspondence Refers to two or more sequences or subsequences with a specified percentage of residues. Therefore, the percent "identity" is calculated over a region of the sequences being compared, e.g., functionally. Alternatively, the sequence of the two sequences to be compared may be across the sex domain. For sequence comparison, typically one sequence is used to compare a test sequence. When using a sequence comparison algorithm, test and reference sequences Enter the sequence into the computer, specify subsequence coordinates if necessary, and run the sequence algorithm program. Specify program parameters. The sequence comparison algorithm then runs Based on the quantitation, the percent sequence identity of the test sequence relative to the reference sequence is calculated.

[0069] Optimal alignment of sequences for comparison can be performed using, for example, the method of Smith & Waterman and the local homology algorithm of Adv. Appl. Math. 2:482 (1981). According to Needleman & Wunsch, J. Mol. Biol. 48:44 3 (1970) by the homology alignment algorithm of Pearson & Li pman,Proc.Nat'l.Acad.Sci.USA 85:244(1988 ) allows computerized implementations of these algorithms. d implementation)(Wisconsin Genetics Sof tware Package,Genetics Computer Group,57 GAP, BESTFIT, F at 5 Science Dr., Madison, Wis. ASTA, and TFASTA) or by visual inspection (overview in Ausubel et al. al., infra).

[0070] An example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is , BLAST algorithm, which is described by Altschul et al. J. Mol. Biol. 215:403-410 (1990). BLAST analysis was performed. The software for this is available from the National Center for Biotechnology Information. Center for Biotechnology Information)(ht publicly available through http: / / www.ncbi.nlm.nih.gov / do.

[0071] "Inhibitors," "activators," and "modulators" are agents that inhibit the function or activity of biologically relevant molecules. The term "modulator" encompasses both inhibitors and activators. These include in vitro and in vivo assays for the expression or activity of target molecules. can be used to identify.

[0072] An "inhibitor" is a molecule or protein that inhibits, for example, expression or binds to and targets a molecule or protein. These are drugs that target the targeting receptors. These block stimulation partially or completely, or These may have protease inhibitor activity, such as target protein inactivation, desensitization, etc. or may inhibit, reduce, prevent or delay activation, including downregulating its activity. The inhibitor may be an antagonist of the target molecule or protein.

[0073] Activators are, for example, agents that induce or activate the function or expression of a target molecule or protein. These are drugs that bind to, stimulate, increase, or utilize the activity of a target molecule. An activator may enable, activate, or promote the activation of a target molecule or protein. It may also be an antagonist.

[0074] A "homologue" is a molecule that is different from a reference molecule at the nucleotide sequence, peptide sequence, function, or structure level. A homolog is a biologically active molecule that shares a specific percent identity with a reference sequence. Thus, in one embodiment, a homologous or derivative sequence may include at least In certain embodiments, homologous or derivative sequences share at least 70% sequence identity. In certain embodiments, homologs or derivatives share at least 80 or 85% sequence identity. The sequences share at least 90% sequence identity. In certain embodiments, homology or derivative The nucleotide sequences share at least 95% sequence identity. The homologous or derivative sequence may be at least 50, 55, 60, 65, 70, 75, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or Homologous or derivative nucleic acid sequences also share 99% sequence identity. Defined by its ability to maintain binding to a reference nucleic acid sequence under hybridization conditions. A homologue that has structural or functional similarity to a reference molecule can be expressed as a reference molecule. Structural and functional homologs and derivatives can be detected, generated, and screened. Methods of leaning are known in the art.

[0075] "Hybridization" generally refers to the process in which complementary strands are present in an environment below their melting temperature. The ability of denatured DNA to reanneal when hybridized with a probe is crucial. The higher the degree of homology desired between possible sequences, the higher the relative temperature that can be used. Consequently, higher relative temperatures will tend to make the reaction conditions more stringent. Stringency of the hybridization reaction is determined by the temperature at which the reaction is performed, whereas lower temperatures result in lower stringency. For further details and explanation, see, for example, Ausubel et al.,Current Protocols in Mole cular Biology,Wiley Interscience Publishing See ers (1995).

[0076] The "stringency" of a hybridization reaction can be readily determined by one skilled in the art, and generally is an empirical calculation that varies depending on probe length, washing temperature, and salt concentration. The longer the probe, the higher the temperature required for proper annealing, and the longer the probe The shorter the time, the lower the required temperature.

[0077] As defined herein, "stringent conditions" or "high stringency conditions" include the following: (1) washing For low ionic strength and high temperature, for example, 0.015M sodium chloride / 0. (2) using 0.15M sodium citrate / 0.1% sodium dodecyl sulfate; During hybridization, at 42°C, a denaturing agent, e.g., formaldehyde, e.g., 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 7 50Mm Sodium Chloride, 75Mm Sodium Citrate, 50Mm Phosphorus, pH 6.5 those using 50% (v / v) formaldehyde containing sodium acid buffer; or (3) 42°C in 50% formaldehyde, 5× SSC (0.75 M NaCl, 0 0.075M Sodium Citrate), 50Mm Sodium Phosphate (Ph 6.8), 0.1% Sodium pyrophosphate, 5x Denhardt's solution, sonicated salmon sperm DNA (50 μl / ml l), 0.1% SDS, and 10% dextran sulfate overnight hybridization. 10 min at 42°C in 0.2x SSC (sodium chloride / sodium citrate) followed by a 10-minute high stringency wash consisting of 0.1x SSC containing EDTA at 55°C. can be identified by the

[0078] All maximum numerical limits given throughout this specification are to be interpreted as if the lower numerical limits were as follows: This document is intended to encompass all such numerical lower limits as if they were expressly set forth in this document. Every minimum numerical limit given throughout the specification is to be interpreted as if a numerical upper limit were defined herein. It is intended to encompass all such numerical limits as if expressly stated. All numerical ranges given throughout this document are to be interpreted as if each narrower numerical range were included herein. Any such narrower numerical range that is included within a broader numerical range is treated as if expressly stated. It encompasses the entire area.

[0079] As used herein, the term "modified" refers to the process of converting a modified molecule into a parent molecule. In one embodiment, the modified hydroxybenzoates prepared according to the methods described herein are , CD47, HSVtk, EC-CD, or iCasp9 mutant polypeptides The acid alterations may be compared with the corresponding parent, e.g., wild-type, that has not been modified according to the methods described herein. a naturally occurring mutant protein, or such a mutant polypeptide In another embodiment, the mutant polypeptide is The polypeptide may comprise one or more amino acids that distinguish the function of the mutant polypeptide from the unmodified polypeptide. For example, amino acid changes in a variant polypeptide may alter its receptor binding profile. In other embodiments, the mutant polypeptides have substitutions, deletions, or other similar mutations that affect the function of the polypeptide. In another embodiment, the mutant polypeptide comprises a variant, an insertional modification, or a combination thereof. The variant polypeptide has a reduced affinity for the receptor compared to the affinity of the unmodified polypeptide. It contains one or more modifications that enhance its activity.

[0080] In one embodiment, the variant polypeptide has one or more amino acid residues relative to the corresponding native or parent sequence. In certain embodiments, the variant polypeptide comprises multiple modifications, insertions, or deletions. , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, It includes 31 to 40, 41 to 50, or 51 or more modifications.

[0081] The term "about" is used herein to mean approximately, in the region of, roughly, or around. When the term "about" is used in conjunction with numerical values / ranges, it means that the stated Changes a given value / range by expanding the boundaries above and below that value. The term "about" is used herein to modify a numerical value above and below the stated numerical value by a variance of 20%. It is used to change

[0082] "Modulated" as used herein in reference to protein expression , the protein expression level is increased or decreased compared to the corresponding wild-type level of the protein. means that the expression of a protein in modified pluripotent cells is decreased compared to unmodified If the protein expression level is increased or decreased compared to (wild-type) pluripotent cells, the It is quantized.

[0083] As used herein, an "episomal vector" refers to a vector that exists in the cytoplasm of a cell and replicates autonomously. This refers to a genetic vector that can be produced by transfecting the genomic DNA of a host cell. Several episomal vectors are known in the art and are described below. Posted.

[0084] As used herein, "avoiding rejection," ... The terms "avoid reaction," "avoid reaction," and similar terms are used interchangeably and are intended to describe the process of the present invention. Genetically or otherwise modified cells according to the present invention. Cells that are less susceptible to rejection when transplanted into a subject compared with their non-transplanted counterparts In some embodiments, the genetically modified cells of the present invention are derived from ABO blood that is incompatible with the subject. Compared with corresponding cells of the same blood group or Rh factor, when transplanted into a subject, Hard to accept.

[0085] VII. Cells of the Invention The present invention provides compositions and methods for generating blood type O-pluripotent (PSCO-) cells. In some aspects of the invention, the cells are O-induced pluripotent stem (iPSCO-) cells, O Embryonic stem (ESCO-) cells, low immunogenic pluripotent O- (HIPO-) cells, or In other embodiments, the non-differentiated cell type is O-. In another embodiment, the cells are enzymatically or genetically modified to be O-Rh- blood type.

[0086] A. Methods of Genetic Modification The present invention provides a method for generating pluripotent cells and pluripotent stem cells by modifying nucleic acid sequences in cells or in cell-free conditions. The present invention includes methods for generating HIP cells, including homologous recombination, knock-in, and other methods. , ZFN (Zinc Finger Nuclease), TALEN (Transcription Activator-Like Effector These include CRISPR / Cas9, CRISPR / Cas9, and other site-specific nuclease technologies. These techniques allow for double-stranded DNA breaks at the desired locus. These controlled double-strand breaks promote homologous recombination at specific loci. The process recognizes and binds to specific sequences, inducing double-strand breaks in nucleic acid molecules. The use of endonucleases to target specific sequences in nucleic acid molecules such as chromosomes The double-strand break is the site of non-homologous end joining (NHEJ) or homologous recombination (HR). Either one will fix it.

[0087] As will be appreciated by those skilled in the art, several different techniques can be used to identify blood type O, Rh negative, Furthermore, optionally, the multipotent antibodies of the present invention may be modified to be less immunogenic as outlined herein. In addition to manipulating cells, PSCs or iPSCs can be manipulated.

[0088] In general, these techniques can be used individually or in combination. For the generation of IP cells, viral techniques to knock-in CD47 functionality (e.g., CRISPR was used in conjunction with lentivirus to express active B2M and / or C in engineered cells. The expression of the IITA protein can be reduced. In one embodiment, a CRISPR step to knock out B2M, then CII CRISPR step to knock out TA, followed by knock-in of CD47 functionality These genes are then transfected into different lentiviruses, which are then used as the final step in the transfection process. The techniques can be used to perform different operations in different sequences.

[0089] As described in more detail below, to generate / derive pluripotent stem cells, generally: Transient expression of reprogramming genes is used.

[0090] a.CRISPR technology In one embodiment, cells are transformed using CRISPR / Cas technology as known in the art. Using CRISPR, starting PSCO-, iPSCO-, or ESCO- - or to generate HIPO-cells from PSCO-, iPSCO-, or ESCO- There are many CRISPR-based techniques, see, for example, ref. Doudna and Charpentier, Science, incorporated herein by reference. nce doi:10.1126 / science.1258096. C RISPR technology and kits are commercially available.

[0091] b.TALEN technology In some embodiments, transcription activator-like effector nuclease (TALEN) technology is used. TALENs can be used to generate HIP cells of the present invention. Restriction in combination with a nuclease that can be engineered to bind and cleave it TALEN is an enzyme. TALEN kits are commercially available.

[0092] c. Zinc finger technology In one embodiment, zinc finger nuclease technology is used to engineer cells. The zinc finger nucleases combine the zinc finger DNA binding domain with the DNA cleavage domain. The zinc finger domain is an artificial restriction enzyme created by fusing can be engineered to target a specific desired DNA sequence, thereby Link finger nucleases are targeted to unique sequences within complex genomes. By using these reagents, endogenous DNA repair mechanisms can be utilized. Like CRISPR and TALEN, it can precisely modify the genomes of higher organisms. .

[0093] d. Virus-based technology Various species that can be used to generate HIP cells of the present invention (as well as to initially generate iPSCs) There are a variety of viral technologies, including but not limited to retroviruses, Examples include the use of antiviral, adenoviral and Sendai virus vectors. The episomal vectors used to generate SCs are described below.

[0094] e. Gene downregulation using interfering RNA In another embodiment, genes encoding proteins used in HLA molecules are expressed using RNAi. RNA interference (RNAi) is a technique whereby RNA molecules are used to downregulate specific It is a process that inhibits gene expression by degrading the mRNA molecules. types of RNA molecules, namely, microRNA (miRNA) and small interfering RNA (siR) RNAi (RNA) are central to RNA interference. They bind to target mRNA molecules and inhibit their activity. RNAi is a process that increases or decreases the activity of parasitic nucleic acids, such as those derived from viruses and transposons. RNAi also affects development.

[0095] sdRNA molecules are asymmetric siRNAs containing a guide (antisense) strand of 19–21 bases. A class of pyrimidines. These include 5' phosphate, 2'Ome or 2'F modified pyrimidines, and and six phosphothioates at the 3' position. These also contain 3'-conjugated sterol moieties. , two phosphothioates at the 3' position, and a sense strand containing a 2'Ome-modified pyrimidine Either strand may have a 2'omega-3 amino acid sequence with a continuous stretch of unmodified purines no longer than 3' in length. sdRNA is a purine-containing RNA, as described in U.S. Pat. No. 6,433,999, which is incorporated herein by reference in its entirety. It is disclosed in U.S. Pat. No. 8,796,443.

[0096] All of these techniques can be performed using well-known recombinant techniques as outlined herein. In certain embodiments, the recombinant nucleic acid (a desired polypeptide, For example, CD47, or any of the sequences encoding the interfering sequences) in one or more of the expression constructs. The regulatory nucleotide sequence may be operably linked to more than one regulatory nucleotide sequence. Generally, the method will be appropriate for the host cell and subject to be treated. A wide variety of suitable expression vectors and suitable regulatory sequences are known in the art. The one or more regulatory nucleotide sequences may include, but are not limited to, a promoter sequence, a leader sequence, a or signal sequence, ribosome binding site, transcription initiation and termination sequences, translation initiation and termination sequences The sequences may include enhancer or activator sequences. Inducible or inducible promoters are also contemplated. A promoter may be a naturally occurring promoter or Hybrid promoters that combine elements of more than one promoter. The expression construct may be present in the cell on an episome, for example, a plasmid. Alternatively, the expression construct may be inserted into a chromosome. In certain embodiments, the expression vector The vector contains a selectable marker gene to allow for the selection of transformed host cells. Embodiments include encoding a mutant polypeptide operably linked to at least one regulatory sequence. As used herein, a regulatory sequence includes an expression vector containing a nucleotide sequence that encodes a regulatory sequence. Examples include promoters, enhancers, and other expression control elements. In embodiments, the expression vector is compatible with the host cell to be transformed, the specific gene to be expressed, and the the mutant polypeptide of the vector, the copy number of the vector, the ability to control that copy number, or the vector Selection of the expression of any other proteins encoded by the vector, e.g., antibiotic markers, etc. Designed for selection.

[0097] Examples of suitable mammalian promoters include, for example, promoters from the following genes: Hamster ubiquitin / S72a promoter (International Publication No. WO 97 / 15664) pamphlet), Simian vacuolating virus 40 (SV40) early promoter, adenovirus Rous major late promoter, mouse metallothionein-I promoter, Rous sarcoma virus (RSV) long terminal repeat region, mouse mammary tumor virus (MMTV) promoter, Moro The long terminal repeat region of the mouse leukemia virus (MLV) and human cytomegalovirus (CMV) Other heterologous mammalian promoters include actin, immunoglobulin V, and These include phosphorylation or heat shock promoters.

[0098] In another embodiment, the promoter used in a mammalian host cell is a polyomavirus promoter. , fowlpox virus (UK Patent No. 2,211,504 published July 5, 1989) Book), bovine papillomavirus, avian sarcoma virus, cytomegalovirus, retrovirus The genomes of viruses such as flu, hepatitis B virus, and simian virus 40 (SV40) In yet another embodiment, a heterologous mammalian promoter is used. Examples include the actin promoter, immunoglobulin promoter, and heat shock promoter. The early and late promoters of SV40 are advantageously used in the SV40 virus. It is obtained as an SV40 restriction fragment that also contains the SV40 origin of replication. ure273:113-120(1978). Immediate early promoter of human cytomegalovirus The data is conveniently obtained as a HindIII E restriction fragment. , PJ et al., Gene 18:355-360 (1982). The references are incorporated herein by reference in their entirety.

[0099] B. Generation of Pluripotent Cells The present invention provides a method for producing non-immunogenic pluripotent cells from pluripotent cells. In the first step, pluripotent stem cells are provided.

[0100] Mouse and human pluripotent stem cells (generally referred to as iPSCs; in the case of mouse cells, m The generation of iPSCs, or hiPSCs in the case of human cells, is generally known in the art. As will be appreciated by those skilled in the art, there are a variety of different methods for generating iPSCs. The initial induction is mediated by four transcription factors: Oct3 / 4, Sox2, c-Myc, and Kl. f4 viral transduction was performed from mouse embryonic or adult fibroblasts; Hashi and Yamanaka Cell 126:663-676(2006 ) (which is incorporated herein by reference in its entirety, and in particular for the techniques outlined therein) ). Since then, several methods have been developed; for an overview, see Se ki et al., World J.Stem Cell 7(1):116-125 (2015), and Lakshmipathy and Vermuri, ed. rs,Methods in Molecular Biology:Pluripot ent Stem Cell,Methods and Protocols,Spri Inger 2013 (all of these, in particular, methods for generating hiPSCs (e.g. See, for example, Chapter 3 of the latter publication, which is incorporated herein by reference. I want to be illuminated.

[0101] Generally, iPSCs are derived from one or more "reprogramming factors" in a host cell. These factors are typically produced by transient expression, and are usually introduced using episomal vectors. Under these conditions, a small number of cells are induced to become iPSCs (typically through a selection matrix). (This step is less efficient because no target is used.) Once the cells are "reprogrammed," Once they are pluripotent, they lose the episomal vector and use the endogenous gene. This loss of the episomal vector results in a "zero footprint" The fewer genetic modifications (especially those of the host cell) the more cells are produced, called "cells." This is desirable because the resulting hiPSCs are therefore suitable for permanent genetic inheritance. It is preferable to not include any child modifiers.

[0102] As will be appreciated by those skilled in the art, reprogramming agents that can be used or will be used The number of reprogramming factors can vary. Generally, the fewer reprogramming factors used, the faster the differentiation. The efficiency of transformation of cells into a pluripotent state, as well as "pluripotency," is reduced, e.g., by reprogramming When the growth factor is low, the cells are not fully pluripotent but can differentiate into only a few cell types. It is possible to obtain cells that can be used in this way.

[0103] In some embodiments, one reprogramming factor, OCT4, is used. In one embodiment, two reprogramming factors, OCT4 and KLF4, are used. In this state, three reprogramming factors are used: OCT4, KLF4, and SOX2. In another embodiment, four reprogramming factors, OCT4, KLF4, SOX2 and c- Myc is used. In another embodiment, SOKMNLT; SOX2, OCT4 (POU 5F1), KLF4, MYC, NANOG, LIN28, and SV40LT antigens Five, six or seven reprogramming factors can be used.

[0104] Generally, these reprogramming factor genes are known in the art and commercially available. The vector may be provided on an episomal vector, such as those listed in ThermoFisher. / Invitrogen Sendai virus for zero-footprint generation of hiPSCs We sell a reprogramming kit (see catalog number A34546). ThermoFisher also offers an EBNA-based system (catalog number A1470 (See also product number 3)

[0105] In addition, there are several commercially available hiPSC lines; e.g., zero-footprint , Gibco® Episoma, a viral integration-free human iPSC cell line See the hiPSC line, K18945 (see also Burridge et al. .,2011, see also op. cit.).

[0106] Generally, as known in the art, iPSCs can be reprogrammed as described herein. Transient expression of factors allows the differentiation of non-pluripotent cells such as CD34+ cord blood cells and fibroblasts. It is produced from sex cells.

[0107] For example, omitting c-Myc and including Oct3 / 4 and S resulted in reduced reprogramming efficiency. iPSCs were successfully generated using ox2 and Klf4 alone.

[0108] In general, iPSCs express KLF4, Nanog, OCT4, SOX2, ESRRB, TB For the purposes of this invention, the expression of certain factors, including X3, c-Myc, and TCL1, is De novo or increased expression of these factors for the purpose of regulating the expression of endogenous genes is possible through induction or modulation of the endogenous locus. This can be via transcription or from expression from a transgene.

[0109] For example, mouse iPSCs are described in Diecke et al., Sci Rep. 2015, Jan.28;5:8081(doi:10.1038 / screp08081)(that The present invention is incorporated herein by reference in its entirety, and in particular for methods and reagents for generating miPSCs. miPSCs can be produced using the method described above and reagents for producing miPSCs. For example, Burridge et al., PloS One, 2011 6(4): 18293 (in its entirety, and in particular with respect to the methods outlined therein, the disclosure of which is hereby incorporated by reference). See also "Incorporating into

[0110] In some cases, the pluripotency of cells can be determined as outlined herein, e.g., by the ability to express pluripotency. Commonly accepted markers, e.g., Nanog, Oct4, Sox2, Esrrb, T The pluripotency of cells can be measured or confirmed by assaying for Tc11, bx3, and Tc11. Alternatively, the pluripotency of cells can be confirmed by carrying out the differentiation reactions outlined in the Examples. It can be measured or confirmed.

[0111] C. Generation of Pluripotent O-Cells In some aspects of the present invention, iPSC cells generated as described above are , would have started with pluripotent cells with O- blood type, so already blood type O, Rh factor negative It may be a cell.

[0112] In another embodiment of the invention, iPSCs are converted to blood type O by enzymatic conversion of A and B antigens. In a preferred embodiment, the B antigen is converted to O using an enzyme. In the present study, the enzyme is α-galactosidase, which reacts with the terminal galactose residues of B antigen. Another embodiment of the invention involves the enzymatic conversion of A antigen to O. In a preferred embodiment The A antigen is converted to O using α-N-acetylgalactosaminidase. For more information, see, for example, Olsson et al., Transfusion Clinics que et Biologique 11:33-39(2004);U.S. Pat. No. 4, Specification No. 427,777, Specification No. 5,606,042, No. 5,633,130 Specification, Specification No. 5,731,426, Specification No. 6,184,017, No. 4, 609,627, and 5,606,042; and WO 99 No. 23120, each of which is incorporated herein by reference in its entirety. This is discussed in

[0113] Another embodiment of the present invention is the exon 1 of the ABO gene (NCBI gene ID: 80908). iPSCs can be genetically modified by engineering the cells to knock out phenotype 7. Including blood type O. CRISPR, TALEN, Zn finger, or homologous recombination Any knockout method known in the art or described herein, such as It may also be used.

[0114] Another embodiment of the present invention is directed to the C and / or E antigens of the Rh blood group system (RH), K K in the ell system (KEL), Fya and FY3 in the Duffy system (FY), Ki Knock Jkb of the dd system (JK) or U and / or S of the MNS blood group system or rendering blood type O pluripotent cells Rh negative by quenching the blood type O pluripotent cells; The cells of the present invention express the SLC14A1(JK) gene (NCBI gene ID: 6563). Silencing can also make the individual Rh-negative. CRISPR, TALE Any of the methods known in the art or described herein, such as N-, Zn-finger, or homologous recombination. Any method for knockout that is feasible may be used.

[0115] D. Generation of Hypoimmunogenic Pluripotent (HIP) Cells HIP cells from pluripotent cells, or HIPO cells from PSCO- and iPSCO- cells Creation is achieved through only three gene modifications, minimizing disruption of cellular activity but causes immune silencing of cells.

[0116] The first two gene alterations are MHCI and II (HLAI and II if the cells are of human origin). This involves reducing or eliminating the activity of proteins of the HLA II. This can be achieved by modifying the gene encoding it. ISPRs are used to disrupt the coding region or regulatory sequence of a gene. The third modification is the reduction of gene translation by using interfering RNA technology. Genes that regulate sensitivity to the effect, e.g., increasing expression of CD47 This can be achieved using gene "knock-in" via viral or transgene technology. This can be done.

[0117] In some cases where CRISPR is used for genetic modification, high efficiency in cell lines is Using hiPSC or hiPSC-cells containing Cas9 constructs that allow editing For example, Human Epstein-Barr virus from Life Technologies See isomal Cas9 iPSC cell line, A33124.

[0118] 1. HLA-reduction The HIPO-cells of the present invention have HLA I function (HLA I if the cells are of human origin). This includes reducing

[0119] As will be appreciated by those skilled in the art, the reduction in functionality can be achieved in several ways: As such, removal of a nucleic acid sequence from a gene, disruption of that sequence by another sequence, or Examples of such modifications include modifications of nucleic acid regulatory elements, such as the complete coding region of a gene of interest. or frameshift mutations that remove or replace a portion with a "nonsense" sequence. Creating a regulatory sequence, removing or replacing all or part of a regulatory sequence such as a promoter, or Sequences can be removed or replaced, etc.

[0120] As will be appreciated by those skilled in the art, MHCI function of pluripotent cells (if the cells are derived from human cells) can be achieved by Suitable reduction of HLAI) can be achieved by techniques known in the art or described below; for example, Use labeled antibodies that bind to HLA complexes; for example, human major histocompatibility HLA classes FACS technology using commercially available HLA-A, B, or C antibodies that bind to the α chain of the I antibody. It can be measured using techniques.

[0121] a.B2M modification In one embodiment, the reduction in HLA-I activity is achieved by reducing beta-2 microglobulin expression. This is achieved by transfecting the β-2 microglobulin gene (the human This modification is accomplished by disrupting the expression of the nucleotide sequence of the target gene (the sequence of which is disclosed herein). Generally referred to as a gene "knockout," in the HIP cells of the present invention, this is The disruption is performed on both alleles in the cell. Generally, the techniques for performing both disruptions are , is the same.

[0122] In particularly useful embodiments, CRISPR technology is used to disrupt genes. In some cases, CRISPR technology has been used to engineer small genes to produce functional proteins. Small deletions or insertions are introduced into the coding region of a gene, often resulting in a frameshift. The mutation results in a stop codon and produces a truncated, non-functional protein.

[0123] Therefore, a useful technique is to clone the coding sequence of the mouse B2M gene or the human B2M gene. The use of CRISPR sequences designed to target a gene sequence. After gene editing, the transfected iPSC culture is dissociated into single cells. The cells were grown to small colonies and then screened in the presence of aberrant sequences from the CRISPR cut sites. Test for CRISPR editing by screening. These clones are selected to contain the deletion, as demonstrated by PCR. , do not express B2M, and do not express HLA-I as demonstrated by FACS analysis ( See, for example, Examples 1 and 6).

[0124] Assays for testing whether the B2M gene is inactivated are known, In one embodiment, the assay involves the use of antibodies against B2M protein. In another embodiment, the reverse is a Western blot of a cell lysate probed with Verify the presence of the inactivating modification by transcriptase polymerase chain reaction (rt-PCR) .

[0125] Furthermore, to confirm that the HLAI complex is not expressed on the cell surface, we This can be done by testing for one or more HLA cell surface components, as previously described. It can be assayed by FACS analysis using antibodies against the protein.

[0126] 2. HLA-II reduction In addition to reducing HLAI, the HIPO-cells of the present invention also have MHCII function (cells that are human cells). If derived from the cytoplasm, HLA II is also absent.

[0127] As will be appreciated by those skilled in the art, the reduction in functionality can be achieved in several ways: As such, the removal of nucleic acid sequences from genes, the addition of nucleic acid sequences to genes, the disruption of the sequence, disruption of the sequence by other sequences, or alteration of the regulatory elements of the nucleic acid. In one embodiment, all or part of the coding region of a gene of interest is removed. In another embodiment, the promoter or Any regulatory sequence may be removed or replaced, the translation initiation sequence may be removed or replaced, and the like.

[0128] MHC II function of pluripotent cells or their derivatives (HLA II if the cells are derived from human cells) Suitable reduction of the protein can be achieved by techniques known in the art, for example, by using antibodies against the protein. Measurements can be performed using Western blotting, FACS, rt-PCR, etc. This can be done.

[0129] a. CIITA modification In one embodiment, the reduction of HLA-II activity is achieved by activating the CIITA gene (the HLA-II gene) of the pluripotent cell. This is done by disrupting the expression of a gene encoding a target gene (the target sequence of which is disclosed herein). Thus, referred to herein as a gene "knockout," in the HIPO- cells of the present invention , this is done for both alleles in the host cell.

[0130] Assays for testing whether the CIITA gene is inactivated are known. In one embodiment, the assay is performed to detect a CIITA protein. 1 is a Western blot of cell lysates probed with antibodies against confirmed the presence of inactivating modifications by reverse transcriptase polymerase chain reaction (rt-PCR). I acknowledge it.

[0131] Furthermore, to confirm that HLAII complexes are not expressed on the cell surface, Again, this assay is known in the art and is outlined below. Thus, it binds to human HLA class II HLA-DR, DP, and most other DQ antigens. The results were analyzed using either Western blot or FACS analysis, based on commercially available antibodies compatible with the assay. It will be carried out.

[0132] In a particularly useful embodiment, CRISPR technology is used to disrupt the CIITA gene. CRISPR encodes the CIITA gene, an essential transcription factor for MHCII molecules. After gene editing, transfection Dissociate iPSC cultures into single cells. Expand single cells into full-size colonies and then , by screening for aberrant sequences from the CRISPR cleavage site. Test for CRISPR editing. Clones containing deletions are identified as CRISPR-edited. They do not express CIITA and are MHCII / HLA- Does not express II.

[0133] 3. Reduced phagocytosis In addition to the reduction of HLA-I and II (or MHCI and II), B2M and CI are also commonly Using ITA knockout, the present HIPO-cells were able to inhibit macrophage phagocytosis and N The resulting HIPO- cells have reduced susceptibility to K cell killing. The CD47 transgene "escapes" the immune macrophage and innate pathways.

[0134] a. Increased CD47 In some embodiments, the reduction in macrophage phagocytosis and NK cell killing susceptibility is due to HIP This occurs due to increased CD47 expression on O-cells, as will be understood by those skilled in the art. This can be done in a variety of ways, such as using "knock-in" or transgenic techniques. In some cases, increased CD47 expression is due to one or more CD47 transgenes. This is achieved.

[0135] Thus, in some embodiments, one or more copies of the CD47 gene are inducible or constitutively expressed. The HIPO- gene is added to cells under the control of a transgenic promoter, the latter being preferred. In some embodiments, lentiviral constructs may be used as described herein or known in the art. The CD47 gene is expressed under the control of a suitable promoter, as known in the art. and can be integrated into the genome of the host cell.

[0136] HIPO- cell lines can be generated from B2M- / -CIITA- / - iPSCs Cells containing lentiviral vectors expressing CD47 were transfected with blasticidin. The CD47 gene sequence can be synthesized and its DNA can be inserted into the blastocyst. The lentivirus plenti6 / V5 (Thermo Fischer) carrying the α-amycin resistance plasmid The clones were cloned into the genomic DNA of interest (Hermès Scientific, Waltham, MA).

[0137] In some embodiments, the regulatory sequence of the endogenous CD47 gene is modified, e.g., the endogenous promoter is By replacing the promoter with a constitutive promoter or a different inducible promoter, CD 47 gene expression can be increased. This is generally achieved by using known methods such as CRISPR. This can be done using technology.

[0138] Once modified, the modified polypeptide can be purified using known techniques, such as those described in the Examples, for example, by using an anti-CD47 antibody. Western blot, ELISA assay or FACS assay were used to confirm sufficient C The presence of the D47 invention can be assayed. Generally, "sufficient" in this context means This indicates increased expression of CD47 on the cell surface, which inhibits NK cell killing. Its natural expression level in cells is such that once their MHCI is removed, NK cell lysis and too low to protect them from

[0139] 4. Other Modifications In some embodiments, the hypoimmunogenic cells are those described in, for example, WO 2016 / 073955 No. 10 / 019,599, filed on Oct. 1, 2002, in its entirety, and particularly with respect to the related art outlined therein, For example, using a gene expression system such as CRISPR or TALEN, as described in Using genome editing tools, the CCR5 and / or CXCR4 genes can be edited to and / or by reducing or eliminating CXCR4 protein surface expression. In some embodiments, the hypoimmunogenic cells are those described in WO 2016 / 073955. , which is incorporated herein by reference in its entirety, and particularly with respect to the related art outlined therein. As described in the 2014 Japanese Journal of Clinical Oncology (Journal of Clinical Oncology), in addition to the B2M gene, CCR5 and / or CXCR4 genes The gene is created by editing the offspring to reduce or eliminate MHC class 1 surface expression.

[0140] In some embodiments, the hypoimmunogenic cells are those described in WO 2016 / 183041. No. 6,299,495, filed on Dec. 1, 2002, which is incorporated herein by reference in its entirety, and in particular with respect to the related art outlined therein. Incorporating genome editing tools such as CRISPR or TALEN into the vectors, as described in and editing the NILRC5, CIITA, and / or B2M genes using reducing or eliminating the surface expression and / or activity of CIITA, B2M, and / or B2M proteins In some embodiments, the hypoimmunogenic pluripotent cells are prepared by removing the No. 2016 / 183041 (in its entirety, and in particular the related art outlined therein) HLA-A, HLA-B, HLA-C, HLA-D, HLA-E, HLA-F ... -B, HLA-C, HLA-E, HLA-G, PD-L1, CTLA-4-Ig, CD4 7, Cl- inhibitors, and expression of one or more tolerogenic factor genes such as IL-35 In some embodiments, the hypoimmunogenic cells are produced by modulating expression of: WO 2016 / 183041 (in its entirety, and in particular the provisions outlined therein) As described in the related art (which is incorporated herein by reference), RFX-5 , RFXAP, RFXANK, NFY-A, NFY-B, NFY-C, and / or IRF These compounds are produced by modulating the expression of one or more genes, such as IL-1. In yet another embodiment, the further modifications to the cells are those described in WO 2016 / 1830 41 (incorporated by reference in its entirety, particularly with respect to the related art outlined therein) OX40, GITR, 4-1BB, CD2 8, B7-1, B7-2, ICOS, CD27, HVEM, SLAM, CD226, PD 1, CTL4, LAG3, TIGIT, TIM3, CD160, BTLA, CD244, CD30, TLT, VISTA, B7-H3, PD-L2, LFA-1, CD2, CD5 8, ICAM-3, TCRA, TCRB, FOXP3, HELIOS, ST2, PCSK 9, CCR5, and / or APOC3 This includes:

[0141] In some embodiments, the hypoimmunogenic cells are those described in WO 2018 / 227286. No. 6,299,495, filed on Dec. 1, 2002, which is incorporated herein by reference in its entirety, and in particular with respect to the related art outlined therein. PDL-1, HLA-G, CD47, CD200, FA, as described in one or more of SLG, CLC21, MFGE8, and / or SERPIN B9 Several transgenes, including PDL-1, HLA-G, CD47, CD200, and FAS Acts as an agonist of LG, CLC21, MFGE8, and / or SERPIN B9 In some embodiments, the antibody is produced by the introduction of a gene encoding a biological agent that inhibits the immune response. Sex cells are described in WO 2018 / 227286 (in its entirety, and in particular the With respect to the related art reviewed in, (which is incorporated herein by reference), TGFβ, CD73, CD39, LAG3, IL1R2, ACKR2, TNFRSF22 , TNFRSF23, TNFRS10, DAD1, and / or IFNγR1 d39 one or more transgenes, or TGFβ, CD73, CD39, LAG3, IL1R2, ACKR2, TNFRSF22, TNFRSF23, TNFRS10, DA D1, and / or IFNγR1 d39. It is produced by introducing a gene.

[0142] 5. Suicide Gene In some embodiments, the present invention provides a HIPO that comprises a "suicide gene" or "suicide switch." - cells, which should be able to grow and differentiate in an undesirable manner should the poorly immunogenic pluripotent cells grow and differentiate in an undesirable manner. Acts as a "safety switch" that can trigger their death if differentiated The "suicide gene" ablation method involves the activation of specific compounds. gene delivery vectors that encode proteins that cause cell killing only when activated These include suicide genes in bacteria that selectively convert non-toxic compounds into highly toxic metabolites. This allows the targeted elimination of cells that express the enzyme. In some embodiments, the suicide gene is herpesvirus thymidine kinase (HSV- tk) gene and the trigger is ganciclovir. The enzyme is Escherichia coli cytosine deaminase (EC-CD ) gene, and the trigger is 5-fluorocytosine (S-FC) (Barese et al.,Mol.Therap.20(10):1932-1943(2012 ), Xu et al., Cell Res.8:73-8(1998), (which is incorporated herein by reference in its entirety).

[0143] In other embodiments, the suicide gene is an inducible caspase protein. Caspase proteins are one of the few caspase proteins that can induce apoptosis. In one embodiment, the portion of a caspase protein includes a portion thereof, such as SEQ ID NO: 6. In a preferred embodiment, the inducible caspase protein is iCas9. This is linked via a series of amino acids to the gene encoding human caspase 9. Contains the sequence of human FK506-binding protein, FKBP12, with the F36V mutation FKBP12-F36V binds with high affinity to the small molecule dimerizer, AP1903. Therefore, the suicide function of iCas9 of the present invention is mediated by a protein dimer-inducing compound (CID). In one embodiment, CID is triggered by administration of the small molecule drug AP1903. Dimerization leads to rapid induction of apoptosis. (International Publication No. 2011114 Pamphlet No. 6862; Stasi et al, N. Engl. J. Med 365 ;18(2011);Tey et al.,Biol.Blood Marrow T transplant. 13:913-924 (2007) (each of which is incorporated herein by reference in its entirety) (Incorporated herein by reference).

[0144] 6. Assay for Retention of the HipO-phenotype and Pluripotency Once HIPO-cells are generated, they are cultured as described in WO 2018 / 132783 ( and its low immunogenicity and / or may be assayed for retention of pluripotency.

[0145] For example, several techniques can be used to assay for low immunogenicity. The technique involves transplantation into an allogeneic host followed by HIPO-cell expansion (e.g., HIPO-2) that evades the host immune system. This includes monitoring for the development of teratomas (e.g., teratomas). After transfection, the cells can be tracked using bioluminescence imaging. The T cell and / or B cell response of the host animal to the IP cells is examined to determine whether the HIP cells are a It can be confirmed that the antibody does not induce an immune response in animals. T cell function is confirmed by Elis by pot, Elisa, FACS, PCR, or mass cytometry (CYTOF) B cell or antibody responses can be assessed using FACS or Luminex. Additionally or alternatively, the innate immune response, e.g., NK cell killing, can be evaluated. Cells may be assayed for their ability to evade cytolytic activity in vitro or by immunohistochemistry. It can be evaluated in vivo.

[0146] Similarly, retention of pluripotency can be tested in several ways. As outlined in the specification and WO 2018 / 132783 Additionally or alternatively, pluripotency is assayed by the expression of certain pluripotency-specific factors, as described above. Alternatively, HIPO-cells can be differentiated into one or more cell types as an indicator of pluripotency. can.

[0147] E. Embodiments of the Invention iPSCO-, ESCO-, and HIPO-cells of the present invention, or their derivatives, can be used to to treat type 1 diabetes, heart disease, neurological disorders, cancer, blindness, vascular disease, and those who respond to regenerative medicine therapies. In particular, the present invention provides a method for the treatment of various diseases / disorders, including the differentiation of various cell types. Thus, the present disclosure contemplates the use of HIPO-cells in allogeneic transplants, such as transplants from human patients. The system host is provided with iPSCO-, ESCO-, and HIPO-cells, or differentiated forms of these cells. When transplanted as either a pluripotent or pluripotent product, they exhibit pluripotency but do not elicit a host immune response. iPSCO-, ESCO-, and HIPO-cells, or derivatives thereof, are provided.

[0148] In one aspect, the present invention provides an isolated antibody comprising a nucleic acid encoding a chimeric antigen receptor (CAR). The present invention provides iPSCO-, ESCO-, and HIPO-cells or derivatives thereof, Here, endogenous beta-2 microglobulin (B2M) gene activity and endogenous class II translocation C1ITA gene activity is eliminated and CD47 expression is increased. AR can include an extracellular domain, a transmembrane domain, and an intracellular signaling domain. In some embodiments, the extracellular domain is selected from the group consisting of CD19, CD20, CD22, CD38, Consists of CD123, CS1, CD171, BCMA, MUC16, ROR1, and WT1 In certain embodiments, the extracellular domain binds to an antigen selected from the group consisting of: In some embodiments, the transmembrane domain comprises a CD3ζ, CD4 , CD8α, CD28, 4-1BB, OX40, ICOS, CTLA-4, PD-1, L In certain embodiments, the intracellular signaling domain comprises: CD3ζ, CD28, 4-1BB, OX40, ICOS, CTLA-4, PD-1, LA Includes G-3 and BTLA.

[0149] In certain embodiments, the CAR comprises an anti-CD19 scFv domain, a CD28 transmembrane domain, and In some embodiments, the CAR comprises a CD3ζ signaling intracellular domain, Anti-CD19 scFv domain, CD28 transmembrane domain, 4-1BB signaling intracellularly domain, and the CD3ζ signaling intracellular domain.

[0150] In another aspect of the invention, the iPSCO-, ESCO-, and HI Isolation produced by in vitro differentiation of PO-cells or any one of their derivatives. O-CAR-T (O-CAR-T) or hypoimmune O-CAR-T (HIPO-CAR In some embodiments, HIPO-CAR-T cells are provided. It is a HIPO-CAR-T cell.

[0151] In various embodiments, in vitro differentiation is achieved by the use of bFGF, EPO, Flt3L, IGF IL-3, IL-6, IL-15, GM-SCF, and VEGF. The CAR construct is carried in a medium containing one or more growth factors or cytokines. Culturing iPSCO-, ESCO-, and HIPO-cells, or their derivatives In some embodiments, the medium comprises a BMP activator, a GSK3 inhibitor, Consists of a ROCK inhibitor, a TGF receptor / ALK inhibitor, and a NOTCH activator The composition further comprises one or more growth factors or cytokines selected from the group:

[0152] In certain embodiments, iPSCO-, ESCO-, and Isolated OCs produced by in vitro differentiation of either OCs or HIPO-cells AR-T or HIPO-CAR-T cells can be used to treat cancer.

[0153] In another aspect of the present invention, the isolated O-CAR-T or HIPO-C described herein and treating cancer patients by administering a composition comprising a therapeutically effective amount of any of the AR-T cells. In some embodiments, the composition further comprises a therapeutically effective amount of a carrier. do.

[0154] In some embodiments, the administering step includes intravenous administration, subcutaneous administration, intralymph node administration, tumor administration, or the like. In certain cases, administration may be by intravenous, intrathecal, intrathoracic, or intraperitoneal route. including by bolus or continuous perfusion.

[0155] In some embodiments, the cancer is selected from the group consisting of leukemia, lymphoma, and myeloma. In various embodiments, the cancer is a solid tumor cancer or a liquid tumor cancer.

[0156] In another aspect, the present invention provides an isolated O-CAR-T or HIPO described herein. - a method for producing CAR-T cells, comprising the steps of: Differentiating either SCO-, ESCO-, or HIPO-cells in vitro wherein the in vitro differentiation comprises the administration of bFGF, EPO, Flt3L, IGF, IL- 2, consisting of IL-3, IL-6, IL-7, IL-15, GM-SCF, and VEGF iPS cells are cultured in a medium containing one or more growth factors or cytokines selected from the group consisting of: In some embodiments, the method further comprises culturing CO-, ESCO-, or HIPO-cells. The medium contains BMP activators, GSK3 inhibitors, ROCK inhibitors, TGF receptor / one or more selected from the group consisting of an ALK inhibitor and a NOTCH activator The composition further contains a growth factor or cytokine.

[0157] In some embodiments, in vitro differentiation is iPSCO-, ESCO-, or HIPO- In various embodiments, the in vitro method comprises culturing the cells on feeder cells. The differentiation includes culturing under simulated microgravity. In certain cases, the differentiation includes culturing under simulated microgravity. The incubation is carried out for at least 72 hours.

[0158] In some embodiments, provided herein are iPSCO-, ESCO-, or HIPO-cells. engineered hypoimmune cardiac cells (hypoimmunogenic cardiac cells), e.g., cardiomyocytes, differentiated and isolated from is provided.

[0159] Cardiomyocytes were previously thought to lack ABO blood group antigens. It was found that differentiation of a group B human embryonic stem cell line into cardiomyocyte-like cells results in the loss of B antigen. This indicates that loss of these antigens can occur early during human embryonic development. For example, Moelne et al., Transplantation.86 (10):1407-13 (2008), which is incorporated herein by reference in its entirety. Other studies have also shown that differentiation of induced human pluripotent stem cells into cardiomyocyte-like cells is possible. It has been reported that this leads to a gradual loss of ABO blood group A antigens in these cells. Saeljoe et al.,Scientific Reports.13072: 1-14 (2017). However, surprisingly, the present inventors found that cardiomyocytes , ABO blood group antibodies that can cause rejection of these cells in incompatible recipients. We found that the original protein was expressed.

[0160] Thus, in some aspects, methods of treating a patient suffering from a cardiac disease or disorder are provided herein. This method can be used to culture iPSCO-, ESCO-, or HIPO-cells as described herein. Derived from either one population of isolated, engineered O- or hypoimmune O-cardiac cells In some embodiments, the composition further comprises administering a therapeutically effective amount of the composition. and a therapeutically effective amount of a carrier.

[0161] In some embodiments, administration can be by implantation into the patient's cardiac tissue, intravenous injection, intra-arterial injection, coronary Intra-arterial injection, intramuscular injection, intrathoracic injection, intramyocardial injection, transendocardial injection, transepicardial injection, or Including injections.

[0162] In some embodiments, the heart disease or disorder is pediatric cardiomyopathy, age-related cardiomyopathy, dilated cardiomyopathy, cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, chronic ischemic cardiomyopathy, peripartum cardiomyopathy, inflammatory cardiomyopathy, and Other cardiomyopathy, myocarditis, myocardial ischemia-reperfusion injury, ventricular dysfunction, heart failure, congestive heart failure, Coronary artery disease, end-stage heart failure, atherosclerosis, ischemia, hypertension, restenosis, angina, rheumatoid artery disease The disease is selected from the group consisting of idiopathic heart disease, arteritis, or cardiovascular disease.

[0163] In some embodiments, provided herein are methods for producing HIPO-cells from a population of HIPO-cells by in vitro differentiation. A method for producing a population of O-hypoimmune cardiac cells is provided, wherein unmodified iPSCO-cells and In comparison, endogenous beta-2 microglobulin (B2M) gene activity and endogenous class II Trans-acting factor (CIITA) gene activity is eliminated, resulting in increased CD47 expression The method involves: (a) culturing a population of HIPO- cells in a medium containing a GSK inhibitor; (b) culturing the HIPO-cells in a medium containing a WNT antagonist; (c) culturing the cells to produce a population of cardiac progenitor cells; and Culturing the population of cardiac progenitor cells in a culture medium to produce a population of O-hypoimmune cardiac cells. In some embodiments, the GSK inhibitor is CHIR-99021, a derivative thereof, or In some cases, the GSK inhibitor has a potency in the range of about 2 μM to about 10 μM. In some embodiments, the WNT antagonist is IWR1, a derivative thereof, or a combination thereof. In some cases, the WNT antagonist is from about 2 μM to about Concentrations in the range of 10 μM.

[0164] In some embodiments, provided herein are iPSCO-, ESCO-, or HIPO-cells. The present invention provides engineered O- or O-hypoimmune endothelial cells differentiated and isolated from the endothelial cells. In this study, isolated and manipulated O- or O-hypoimmune endothelial cells were used to differentiate into capillary endothelial cells, vascular The cell is selected from the group consisting of endothelial cells, aortic endothelial cells, brain endothelial cells, and kidney endothelial cells.

[0165] In some aspects, provided herein are methods of treating a patient suffering from a vascular disease or disorder. In some embodiments, the method comprises administering to a subject an isolated, engineered O- or O-hypoimmune intracellular antigen (IUIA) antibody. The method includes administering a composition comprising a therapeutically effective amount of a population of epithelial cells.

[0166] In some embodiments, the methods include the use of isolated, engineered O- or O-low administering a composition comprising a therapeutically effective amount of any one population of immune endothelial cells. In some embodiments, the composition further comprises a therapeutically effective carrier. In this study, administration can be by implantation into the patient's cardiac tissue, intravenous injection, intra-arterial injection, intracoronary injection, or intramuscular injection. This includes intravenous injection, intrathoracic injection, intramyocardial injection, transendocardial injection, transepicardial injection, or infusion.

[0167] In some embodiments, the vascular disease or disorder is a vascular injury, cardiovascular disease, vascular disease, ischemic disease, or Disease, myocardial infarction, congestive heart failure, hypertension, ischemic tissue injury, lower limb ischemia, stroke, neuropathy, and cerebrovascular disease.

[0168] In some embodiments, provided herein are methods for producing HIPO-cells from a population of HIPO-cells by in vitro differentiation. A method for producing a population of O-hypoimmune endothelial cells is provided, wherein in HIPO- cells , endogenous beta-2 microglobulin (B2M) gene activity and endogenous class II transactivation The effector (CIITA) gene activity is eliminated and CD47 expression is increased. The method comprises: (a) culturing a population of HIPO- cells in a first medium containing a GSK inhibitor; (b) collecting HIPO-cells in a second medium containing VEGF and bFGF; (c) culturing the cells to produce a population of endothelial progenitor cells; and (c) administering a ROCK inhibitor and A population of endothelial progenitor cells was cultured in a third medium containing an ALK inhibitor to induce hypoimmune endothelial cell proliferation. The method includes producing a population of cells.

[0169] In some embodiments, the GSK inhibitor is CHIR-99021, a derivative thereof, or a In some cases, the GSK inhibitor is a variant of In some embodiments, the ROCK inhibitor is Y-27632, a derivative thereof, or or a variant thereof. In some cases, the ROCK inhibitor is at a concentration of about 1 μM to about 20 μM. In some embodiments, the ALK inhibitor is SB-431542 at a concentration in the μM range. , a derivative thereof, or a variant thereof. In some cases, the ALK inhibitor has a potency of about 0. The concentration ranges from 5 μM to about 10 μM.

[0170] In some embodiments, the first medium contains 2 μM to about 10 μM CHIR-99021. In some embodiments, the second medium contains 50 ng / ml VEGF and 10 ng / ml In another embodiment, the second culture medium further contains Y-27632 and SB- In various embodiments, the third medium contains 10 μM Y-27632. and 1 μM SB-431542. In certain embodiments, the third medium further contains V In certain cases, the first medium and / or the second medium contain EGF and bFGF. Does not contain threonine.

[0171] In some embodiments, described herein are engineered HIPO-cells that have been differentiated and isolated from HIPO-cells. - Hypoimmune dopaminergic neurons (DNs) are provided, wherein endogenous β-2 mics are expressed. globulin (B2M) gene activity and endogenous class II transactivator (CIITA) ) gene activity is abolished, CD47 expression is increased, and neurons are resistant to blood type O and It is Rh-.

[0172] In some embodiments, the isolated O-hypoimmune dopaminergic neurons are Neuronal stem cells, neuronal progenitor cells, immature dopaminergic neurons, and mature dopaminergic neurons. and agonistic neurons.

[0173] In some aspects, provided herein are methods for treating a patient suffering from a neurodegenerative disease or condition. In some embodiments, the method comprises administering to an isolated hypoimmune dopaminergic neuron the The method includes administering a composition comprising a therapeutically effective amount of any one of the populations of agonists. In some embodiments, the composition further comprises a therapeutically effective carrier. A population of isolated, hypoimmune dopaminergic neurons is located on a biodegradable scaffold. In some embodiments, the administration may comprise implantation or injection. The disease or condition is selected from the group consisting of Parkinson's disease, Huntington's disease, and multiple myeloma. It is selected.

[0174] In some embodiments, provided herein are methods for producing HIPO-cells from a population of HIPO-cells by in vitro differentiation. Methods for producing a population of O-hypoimmune dopaminergic neurons are provided, wherein endogenous Beta-2 microglobulin (B2M) gene activity and endogenous class II transactivators CIITA gene activity was eliminated, CD47 expression was increased, and HIPO-cell In some embodiments, the method comprises sonication. Hedgehog (SHH), BDNF, EGF, bFGF, FGF8, WNT1, retinoid one selected from a phosphonate, a GSK3β inhibitor, an ALK inhibitor, and a ROCK inhibitor; Alternatively, a population of HIPO- cells may be cultured in a first medium containing multiple factors to produce immature dopaminergic cells. (b) producing a population of myelinergic neurons; and (b) a second medium different from the first medium. Culturing a population of immature dopaminergic neurons in culture media producing a population of Ron.

[0175] In some embodiments, the GSKβ inhibitor is CHIR-99021, a derivative thereof, or In some cases, the GSKβ inhibitor has a potency of about 2 μM to about 10 μM. In some embodiments, the ALK inhibitor is SB-431542, In some cases, the ALK inhibitor is at a concentration of about 1 μM to about In some embodiments, the first medium and / or the second medium is a medium containing at least one of the following: No serum is present.

[0176] In some embodiments, the method also comprises removing hypoimmune dopaminergic neurons from non-dopaminergic neurons. In some embodiments, the method also includes isolating a population of cytotoxic neurons. Further included is the step of cryopreserving the population of hypoimmune dopaminergic neurons.

[0177] In some embodiments, engineered O-hypoimmune pancreatic islet cells differentiated and isolated from HIPO- cells are Cells are provided, wherein endogenous beta-2 microglobulin (B2M) gene activity and endogenous Abrogation of CITA gene activity and increased CD47 expression His blood type is O and Rh-.

[0178] In some embodiments, the isolated O-hypoimmune islet cells are referred to as islet progenitor cells, immature islet cells, or the like. and mature pancreatic islet cells.

[0179] In some aspects, provided herein are methods of treating a patient suffering from diabetes. The method includes treating any one of the populations of isolated O-hypoimmune pancreatic islet cells described herein. In some embodiments, the composition further comprises administering a therapeutically effective amount of a composition comprising In some embodiments, the isolated population of hypoimmune pancreatic islet cells comprises a therapeutically effective carrier. The implant is on a biodegradable scaffold. In some cases, administration includes implantation or injection. nothing.

[0180] In some embodiments, provided herein are methods for producing HIPO-cells from a population of HIPO-cells by in vitro differentiation. A method for producing a population of O-hypoimmune pancreatic islet cells is provided, wherein endogenous β-2 microglobulin is expressed in the O-hypoimmune pancreatic islet cells. B2M gene activity and the intrinsic class II transactivator (CIITA) gene Gene activity was eliminated, CD47 expression was increased, and blood type The method comprises the steps of: (a) insulin-like growth factor (IGF), transmembrane (TGF), and thrombin (TGF). Transforming growth factor (TGF), fibroblast growth factor (EGF), epidermal growth factor ( EGF), hepatocyte growth factor (HGF), sonic hedgehog (SHH), and intravascular VEGF (vascular epidermal growth factor), transforming growth factor-β (TGF-β) superoxide dismutase -family, bone morphogenetic protein-2 (BMP2), bone morphogenetic protein-7 (BMP7) , GSK3β inhibitor, ALK inhibitor, BMP1 receptor inhibitor, and retinoic acid In a first medium containing one or more factors selected from the group consisting of HIPO- (b) culturing the population of cells to produce immature pancreatic islet cells; and (b) the first medium. Culturing the population of immature islet cells in a different second medium to produce a population of hypoimmune islet cells. The method includes the step of:

[0181] In some embodiments, the GSK inhibitor is CHIR-99021, a derivative thereof, or a In some cases, the GSK inhibitor is a variant of In some embodiments, the ALK inhibitor is SB-431542, its derivative In some instances, the ALK inhibitor is at a concentration of about 1 μM to about 10 In some embodiments, the first medium and / or the second medium are prepared from animal blood. Qing does not exist.

[0182] In some embodiments, the method also includes isolating a population of hypoimmune islet cells from non-islet cells. In some embodiments, the method further comprises the step of: A step of storing at room temperature is also included.

[0183] In some embodiments, the engineered O-hypo-immune retinal pigment epithelium is differentiated and isolated from hipo-cells. RPE cells are provided, wherein endogenous beta-2 microglobulin (B2M) is expressed. gene activity and endogenous class II transactivator (CIITA) gene activity are eliminated. , CD47 expression is increased, and blood type is O and Rh-.

[0184] In some embodiments, the isolated O-hypoimmune RPE cells are RPE progenitor cells, immature RPE cells, or The RPE cells are selected from the group consisting of PE cells, mature RPE cells, and functional RPE cells.

[0185] In some aspects, provided herein are methods of treating a patient suffering from an eye disease. The method includes administering any one of the populations of isolated hypoimmune RPE cells described herein. In some embodiments, the composition further comprises administering a therapeutically effective amount of the composition. In some embodiments, the isolated population of hypoimmune RPE cells comprises a therapeutically effective carrier. In some embodiments, the administration includes transferring the retina of the patient to the retina. In some embodiments, the eye disease is wet macular degeneration, dry macular degeneration, young adult macular degeneration, or ophthalmic selected from the group consisting of: aging macular degeneration, Leber's congenital amaurosis, retinitis pigmentosa, and retinal detachment It is selected.

[0186] In some embodiments, O-hypoimmune cells are isolated from a population of HIPO- cells by in vitro differentiation. A method for producing a population of retinal pigment epithelial (RPE) cells is provided, wherein the RPE cells are HIPO-cells. In the cells, endogenous beta-2 microglobulin (B2M) gene activity and endogenous class I I trans-acting factor (CIITA) gene activity was eliminated, and CD47 expression was increased. The method includes the following: (a) activin A, bFGF, BMP4 / 7, DKK1, IGF 1. Noggin, BMP inhibitor, ALK inhibitor, ROCK inhibitor, and VEGFR inhibitor HIPO-cells are cultured in a first medium containing any one of the factors selected from the group consisting of (b) culturing the population of cells to produce a population of RPE progenitor cells; and (b) a first medium. A population of RPE progenitor cells was cultured in a second medium different from the first to generate a population of hypoimmune RPE cells. The method includes the step of producing the compound.

[0187] In some embodiments, the ALK inhibitor is SB-431542, a derivative thereof, or a In some instances, the ALK inhibitor is present in a range of about 2 μM to about 10 μM. In some embodiments, the ROCK inhibitor is Y-27632, a derivative thereof, or a variant thereof. In some cases, the ROCK inhibitor is at a concentration of about 1 μM to about 10 μM. The concentration ranges from M.

[0188] In some embodiments, the first culture medium and / or the second culture medium are free of animal serum.

[0189] In some embodiments, the method also includes isolating a population of O-hypoimmune RPE cells from non-RPE cells. In some embodiments, the method further comprises the step of isolating hypoimmune RPE cells. The method also includes the step of cryopreserving the cells.

[0190] In one embodiment, human pluripotent stem cells (hiPSCO-) contain: a) B at each allele; Disruption of the 2M gene (e.g., B2M- / -), b) of the CIITA gene at each allele. disruption (e.g., CIITA, - / -), and c) overexpression of the CD47 gene (CD47+ For example, introduction of one or more additional copies of the CD47 gene or activation of the genomic gene. This allows the hiPSCO- population to be made less immunogenic by B2 In a preferred embodiment, the cells are non-immunogenic. In another embodiment, the HIPO- cells are non-immunogenic B2M- / -C cells, as described above. IITA- / -CD47tg cells, but induces them to kill cells in vivo as needed. In another embodiment, the vector is further modified by the inclusion of an inducible suicide gene. Knockout of ABO gene exon 7 or silencing of SLC14A1(JK) gene This changes the blood type to O and removes the C and E antigens of the Rh blood group system (RH), Ke K in the ll system (KEL), FYa and FY3 in the Duffy system (FY), Kid By knocking out jkb in the d system (JK) or U and S in the MNS blood group system, Therefore, when HIP cells are made Rh-, HIPO- cells are produced.

[0191] Maintenance of FO-pluripotent cells Once generated, iPSCs can be maintained as known in the art using iPSC- , ESCO-, and HIPO- cells can be maintained in an undifferentiated state. Culturing HIPO-cells on Martigel using a medium that prevents pluripotency and maintains pluripotency It is possible.

[0192] GO-Pluripotent Cell Differentiation The present invention provides iPSCO-ES cells that can be differentiated into various cell types for subsequent transplantation into a subject. As will be appreciated by those skilled in the art, differentiation methods may be used in conjunction with published methods. Depending on the desired cell type, cells can be differentiated in suspension and then cultured in a matrix using known techniques. Introduced into gel matrix forms such as Rigel and gelatin, or fibrin / thrombin forms Differentiation, as known in the art, generally involves cell-specific Assayed by assessing the presence of a marker.

[0193] In some embodiments, the iPSCO-, ESCO-, and HIPO-cells of the present invention are derived from hepatic To address loss of cellular functionality or cirrhosis, they are differentiated into hepatocytes. iPSCO-, E Several methods can be used to differentiate SCO- and HIPO-cells into hepatocytes. There are some techniques; for example, Pettinato et al., doi:10.1038 / spre32888, Snyker et al.,Methods Mol Bio l 698:305-314(2011), Si-Tayeb et al., Hepa tology 51:297-305(2010) and Asgari et al.,S tem Cell Rev(:493-504(2013) (all of them, full contents, In particular, for differentiation methods and reagents, see (expressly incorporated herein by reference). Differentiation, as known in the art, generally involves the expression of hepatocyte-associated markers and / or Certain markers (including but not limited to albumin, alpha-fetoprotein, and fibrinogen) Differentiation can also be assayed by assessing the presence of ATP (including ATP). metabolism, LDL accumulation and uptake, ICG uptake and release, and glycogen accumulation. It can also be measured by functionality.

[0194] In some embodiments, iPSCO-, ESCO-, and HIPO-cells are used to treat type 1 diabetes. These cells are differentiated into beta-like cells or pancreatic islet organoids for transplantation to address T1DM (T1DM). The cell system is a promising approach to address T1DM, and is described, for example, in the literature by reference herein. Incorporated into the book, Ellis et al., doi / 10.1038 / nrgast See ro.2017.93. In addition, Pagliuca et al. reported successful differentiation of β-cells from iPSCs (doi / 10.106 / j See .cell.2014.09.040 in its entirety, and in particular the references therein. Methods for large-scale production of functional human beta cells from human pluripotent stem cells and (The reagents are incorporated herein by reference.) Further, Vegas et al. The study aims to generate human beta cells from human pluripotent stem cells, which subsequently circumvent immune rejection by the host. (see doi:10.1038 / nm.4030) and the like, and in particular the functional human cells derived from human pluripotent stem cells as outlined therein. Methods and reagents for large-scale production of β cells are incorporated herein by reference. (Including).

[0195] Differentiation, as known in the art, generally involves the expression of β-cell-associated or specific markers. The assay is performed by assessing the presence of certain proteins (including but not limited to insulin). Metabolism can also be measured by functional measures, such as glucose metabolism, as outlined in M urano et al,doi:10.1016 / j.cels.2016.09.0 See IEEE Transactions on Clinical Chemistry and Biology (2019) 23:131–132, in its entirety, and particularly with respect to the biomarkers outlined therein. (Incorporated herein by reference).

[0196] Once iPSCO-, ESCO-, and HIPO-β cells were generated, they were then transferred to the portal vein / liver. transplanted into the liver, omentum, gastrointestinal mucosa, bone marrow, muscle, or subcutaneous pouch (as described herein). The vesicles can be either as a vesicle suspension or within a gel matrix.

[0197] In some embodiments, iPSCO-, ESCO-, and HIPO-cells improve the vision of the eye. Human pluripotent stem cells differentiate into retinal pigment epithelium (RPE) to combat threatening diseases Kamao et al., Stem Cell Reports 2014:2: 205-18 (in its entirety, and in particular the methods and reagents outlined therein for differentiation techniques and reagents) RPE cells were cultured using the techniques outlined in the literature (for reagents, which are incorporated herein by reference). and Mandai et al., doi:10.1056 / NE See also JMoa1608368 (Technology for producing RPE cell sheets and transplantation into patients) (which is incorporated herein by reference in its entirety).

[0198] Differentiation, as known in the art, generally involves the expression of RPE-associated markers and / or specific The protein may be assayed by assessing the presence of a specific marker or by measuring functionality. For example, Kamao et al., doi:10.1016 / j.stemcr See .2013.12.007 (in its entirety and in particular the first paragraph of the Results section) (The markers outlined in [the text] are incorporated herein by reference).

[0199] In some embodiments, iPSCO-, ESCO-, and HIPO-cells of the present invention are derived from cardiac To address vascular diseases, hiPSCs are differentiated into cardiomyocytes. Techniques for this are known in the art and are discussed in the Examples. Thus, in general, the presence of cardiomyocyte-associated markers or specific markers is assessed. or by measuring functionality; see, e.g., Loh et al. ,doi:10.1016 / j.cell.2016.06.001 (in its entirety, and In particular, methods for differentiating stem cells, including cardiomyocytes, are incorporated herein by reference. Please refer to.

[0200] In some embodiments, iPSCO-, ESCO-, and HIPO-cells are used to treat peripheral arterial disease. Differentiation into endothelial colony forming cells (ECFCs) to address the disease. Techniques for this purpose are well known. For example, see Prasain et al., doi:10.1 038 / nbt.3048 (in its entirety, in particular, the preparation of endothelial cells from human pluripotent stem cells) for methods and reagents for the same, as well as for transplantation techniques, ) Differentiation, as known in the art, generally involves the differentiation of endothelial cell-associated markers. by assessing the presence of specific markers or by measuring functionality. Assayed.

[0201] In some embodiments, iPSCO-, ESCO-, and HIPO-cells are used to treat autoimmune tumors. To combat thyroiditis, thyroid progenitor cells and thyroid hormone-secreting cells are required. The thyroid cells are differentiated into thyroid gland follicles or organoids. Techniques for differentiating thyroid cells are known in the art. See, e.g., Kurmann doi:10.1016 / j.stem See .2015.09.004 (in its entirety, and in particular, thyroid cells from human pluripotent stem cells) The present disclosure is incorporated herein by reference for methods and reagents for cell production, as well as for transplantation techniques. (See, e.g., the disclosure of which is expressly incorporated herein by reference). Differentiation, as known in the art, is generally by assessing the presence of thyroid cell-associated markers or specific markers, or by The assay is performed by measuring the activity of the

[0202] H. Transplantation of differentiated HIPO-cells As will be appreciated by those skilled in the art, differentiated HIPO-cells can be cultured using techniques known in the art. These techniques depend on both the cell type and the ultimate use of those cells. Generally, the differentiated iPSCO-, ESCO-, and HIPO-cells of the present invention are administered intravenously. The implant is either by injection into a specific location in the patient. In this case, cells are suspended in a gel matrix to prevent dispersion during engraftment. Good too.

[0203] In order that the invention described herein may be better understood, the following examples are set forth. These examples are for illustrative purposes only and are not intended to limit the invention in any way. should not be interpreted as [Example]

[0204] VIII. Working Examples Example 1: Generation of human iPSCs 3-plasmid, 7-factor (SOKMNLT; SOX) from ThermoFisher 2, OCT4 (POU5F1), KLF4, MYC, NANOG, LIN28, and SV 40LT antigen) EBNA-based episomal system for human episomal iPSCs The line was derived from CD34+ umbilical cord blood cells (Cat. No. A33124, Thermo Fisher Scientific). This iPSC line was derived from a reprogramming event. Since there was no integration into the genome, it is considered to have a zero footprint. iPSCs were found to have a normal XX karyotype and no programming genes. and OCT4, SOX2, NANOG (as shown by RT-PCR) OCT4, Such as SSEA4, TRA-1-60 and TRA-1-81 (as indicated by ICC) These cells have endogenous expression of pluripotency markers such as pluripotency markers. iPSCs retained their differentiation potential for ectodermal, endodermal, and mesodermal lineages. Thus, vascular, endothelial, and cardiac lineages were induced with robust efficiency.

[0205] Several gene delivery vehicles for iPSC generation have been successfully used. The vectors used include retrovirus vectors, adenovirus vectors, and Sendai virus ( Sendai virus and virus-free reprogramming method (episomal vector) vector, piggyBac transposon, synthetic mRNA, microRNA, recombinant protein These include the use of proteins and small molecule drugs.

[0206] The first of these is OCT3 / 4, SOX2, KLF4, and C-MYC, known as the Yamanaka factors. Various factors have been successfully used for reprogramming, as reported in combination. In one embodiment, only three of these factors are involved, albeit at the expense of reduced reprogramming efficiency. Success was achieved by combining these genes and omitting C-MYC.

[0207] In one embodiment, L-MYC or GLIS1 replaces C-MYC in the reprogramming In another embodiment, the reprogramming factor is a factor associated with pluripotency. It is not limited to genes.

[0208] All data are presented as ±SD or as box plots showing median and minimum to maximum range. Differences between groups were evaluated using the unpaired Student's t-test or Bonferroni's One-way analysis of variance (ANOVA) with a post-hoc test (Roni) was used as appropriate. *p<0.05, **p<0.01.

[0209] Example 2: Generation of human HIP cells Hypoimmune pluripotent (HIP) cells are described in the pamphlet of International Publication No. WO 2018 / 132783 and and U.S. Provisional Patent Application Nos. 62 / 698,941 and 62 / 698,965. Specification No. 62 / 698,973, Specification No. 62 / 698,978, No. 62 Nos. 62 / 698,981 and 62 / 698,984 (each of which (which is incorporated herein by reference in its entirety).

[0210] Human Cas9 iPSCs underwent two gene editing steps. In the first step, CR Human β- with ISPR sequence 5'-CGTGAGTAAACCTGAATCTT-3' The coding sequence of the B2-microglobulin (B2M) gene and the CRISPR sequence 5' -GATATTGGCATAAGCCTCCC-3' CRISPR technology was implemented by targeting the T7 promoter in combination with the targeting sequence. Using the linearized CRISPR sequence containing the promoter, follow the kit instructions (MEGAshorts cript T7 Transcription Kit, Thermo Fisher ) gRNA was synthesized. Next, the collected in vitro transcribed (IVT) gRNA was Using the MEGAclear Transcription Clean-Up Kit For IVT gRNA delivery, the singularized cells were electroporated using Neon Using an electroporation device, 300 ng of IVT gRNA was electroporated. After electroporation, edited Cas9 iPSCs were expanded for single cell seeding; iPSC cultures were dissociated into single cells using ypLE (Gibco) and transfected into Tra1-60 cells. Stained with Alexa Fluor® 488 and propidium iodide (PI) Cells were sorted using a FACS Aria cell sorter (BD Biosciences). Selective gating on forward and side scatter allows for the isolation of doublets and debris from the inoculum. Absence of PI and Tra1-60 Alexa Fluor 488 staining Viable pluripotent cells were selected based on the presence of . The single cells were then grown into full-sized colonies. After growth, colonies were examined for CRISPR editing. GeneArt Genomic Cleavage Detection Kit (Thermo Fisher). Genomic DNA was analyzed using 1 × 10 6 hi PSC isolation, AmpliTaq Gold 360 Master Mix, and Primer set F for B2M: 5'-TGGGGCCAAATCATGACTC-3 ' and R: 5'-TCAGTGGGGGTGAATTCAGTGT-3', and CII Primer set F for TA: 5'-CTTAACAGCGATGCTGACCCC-3 and R: 5'-TGGCCTCCATCTCCCCTCTCTT-3', The M and CIITA genomic DNA regions were PCR amplified. PCR products were purified using the PureLink PCR Purification Kit. , Thermo Fisher), Sanger sequencing for indel frequency prediction. After confirming the B2M / CIITA knockout, karyotyping and TaqMan were performed. hPSC Scorecard Panel (Thermo Fisher) The PSCs were further characterized. They were found to be pluripotent and were able to differentiate during the genome editing process. , maintained a normal (46,XX) karyotype.

[0211] In the second step, the CD47 gene was synthesized and the DNA was inserted into the EF1a promoter and p53. Cloned the lentivirus plasmid carrying rhamnomycin resistance into 1 x 10 cells. 7 Lentiviral stock (Thermo) at 6 TU / mL and 6 μg / mL of polybrene Transduction was performed using a lab-operated transfection kit (Fisher). After transduction, the medium was changed every day. Three days after transduction, Afterwards, cells were expanded and selected with 0.5 μg / mL puromycin. After 5 days of selection, antibiotic-resistant colonies appeared and were further expanded to produce stable A pool was created. CD47 levels were confirmed by qPCR. Pluripotency assay (Ta qMan hPSC Scorecard Panel, Thermo Fisher) , and karyotype analysis was performed again to confirm the pluripotent status of the cells.

[0212] Example 3: HIP cell rejection in rhesus macaques and pigs No reaction 10 million low immunogenic B2M- / -CIITA- / -Resus CD47tgiPSC-derived The endothelial cells (expressing luciferase) were subcutaneously injected into rhesus monkeys and bioluminescence imaging was performed. Cells were tracked long-term using a Xenogen IVIS® 200 S eries imaging system(Caliper Life Science In vivo imaging using a fluoroscopy system (Almeda, CA, Cat. No. 122799) For the purpose of the study, 100 mg / ml of D-luciferin (PerkinElmer) was administered from the peripheral blood. Each animal was intravenously injected with 100 mg of ribosomal steroids (Ribosomal steroids, San Jose, CA). The results of the immunization assay and validation tests showed that the cells were not rejected and showed stable BLI signals. However, the BLI signal decreased on day 6 and was significantly higher on day 16. In addition, a "bump" was observed at the injection site (data not shown). When blood was taken from the same monkeys, T cells, cytotoxic T cells, and NK cells (Figure 1A), B cell (DSA; donor-specific antibody), or macrophage activation (Fig. 1B) No blood typing was observed in the monkeys by PCR. It was confirmed that the blood type was B. Therefore, hypoimmunogenic endothelial cell transplantation is not ABO incompatible. In contrast to these results, unmodified human iPSC-derived When endothelial cells are transplanted into rhesus monkeys (Macaque Rhesus), they are rejected. and activation of adaptive immune responses (Figure 2A). Transplantation of I-deficient B2M- / -CIITA- / - human iPSC-derived endothelial cells into monkeys Cellular rejection and activation of the innate immune response occurred (Fig. 2B).

[0213] Example 4: IgM antibodies killed endothelial cells derived from hiPSCs By incubating human hypoimmunogenic endothelial cells with rhesus monkey serum, blood A liquid rejection reaction was confirmed.

[0214] Differentiation of human iPSCs into hiECs. Diluted Matrigel (Co) in a 6-well plate rning, Tewksbury, MA, Cat. No. 356231) hiPSC The cells were plated and cultured in Essential 8 Flex medium (Thermo Fisher Scientific). The cells were maintained in a medium containing 100% erythrocytes (Cat. No. A2858501). Differentiation was initiated at 60% confluency, and the medium was , 2% B-27 minus insulin (both Gibco Thermo Fisher Scientific r, Cat. No. A1895601) and 5 μM CHIR-99021 (Sellec The medium was replaced with RPMI-1640 containing 100% ethanol (Kelvin Chemical Co., Cat. No. S1263). Day 2, Reduced Medium: 2% B-27 minus insulin and 2 µM CHIR-99021 From day 4 to day 7, the medium was replaced with RPMI-1640 containing RPMI-1. 640EC medium (RPMI-1640, 2% B-27 minus insulin, 50 ng m l / l human vascular endothelial growth factor (VEGF, Peprotech, Rocky Hill ,NJ,Cat.No.100-20), 10ng ml -1 Human fibroblast growth factor ( Basic) (FGFb; Peprotech, Cat. No. 100-18B), 10 μM Y-27632 (Selleckchem, Cat. No. S1049), and 1 μM SB431542 (Reagentsdirect, Cat. No. 21-A94) The cells were exposed.

[0215] On day 7, endothelial cell clusters became visible and the cells were cultured in 10% fetal bovine serum (H1) (Gibco Thermo Fisher, Cat.No.10082147), 25ng ml- 1 VEGF, 2ng ml -1 FGFb, 10 μM Y-27632 and 1 μM SB4 EGM-2 SingleQuots medium (Lonza, Basel) supplemented with 31542 The animals were kept in a refrigerated container (Cat. No. CC-3162, Switzerland). After 14 days, The differentiation process was completed, and undifferentiated cells were separated during the differentiation process. For purification, the cells were 20μM PluriSln-1(StemCell Technologie,Cam The highly purified IgG was treated with IgG-containing ... EC was cultured in EGM-2 Single medium supplemented with supplements and 10% FCS (Gibco). The cells were cultured in eQuots medium. For subculture, TrypLE Express was used. s was used at a ratio of 1:3 every 3-4 days.

[0216] Human hypoimmunogenic B2M- / -CIITA- / - rhesus CD47tg endothelial cells (blood group A) was incubated with rhesus monkey serum (blood type B), the cells were immediately killed. The type of antibody that killed the cells was determined by antibody depletion analysis.

[0217] IgM depletion was achieved by 50 mM dithiothreitol (DTT, MilliporeSigma) a, St. Louis, MO, Cat. No. D0632). TT was mixed with 90 μl of serum.

[0218] IgG deletion was performed using Pierce Protein Beads (Thermo Fish The beads were then transferred to a centrifuge tube (Waltham, MA, Cat. No. 88803). After washing with washing buffer, the beads were collected magnetically. The cells were combined with 1 μl of rhesus serum and incubated at room temperature for 60 min with gentle inversion every 10 min. The beads were magnetically separated, and the serum was transferred to a new tube and used. It was kept on ice until use.

[0219] ABO antibodies are of the IgM type due to the absence of either IgM or IgG antibodies. In addition, IgM or IgM-mediated signaling was confirmed using HIP-derived cardiomyocytes and adult cardiac tissue (Fig. 3). The blood type rejection was also confirmed by the lack of IgG antibodies (Celprogen, Torrance, CA, Cat. No. 36044-15-625. Data shown. do not have).

[0220] Rhesus blood group B serum inhibited complement-dependent cytotoxicity (CD) of blood group A human wt iECs. C) after differentiation of human wt iPSCs with blood type A or O into wt iECs. , XCelligence Real-Time Cell Analysis (ACE A Biosciences (San Diego, CA) platform for blood typing Incubated with serum from rhesus monkeys of blood type B. Differentiating iECs of blood type A rapidly In contrast to the IL-16-positive iECs, blood group O iECs were not affected (Fig. 2D). Antibodies A were detected in this rhesus monkey (using a clinically approved agglutination test) Therefore, iECs carrying the A blood group antigen were killed, while iECs not expressing the A antigen survived. .

[0221] Embryonic stem cell-derived ECs undergo the same ABO blood group-dependent CDC as iPSC-derived iECs The ABO blood group sensitivity observed in iPSC-derived iECs is a key factor in the fixation of iPSC starter cells. The H9 human embryonic stem cell line was used to confirm the presence of ES cells. Similar to the observations obtained with iPSC-derived iECs, the Rh+ H9 cells were differentiated. H9-derived ECs were cultured in human ABO-incompatible serum (Figure 2E) and rhesus ABO-incompatible serum. When incubated with serum (data not shown), XCelligence I suffered a CD massacre on the platform.

[0222] Example 5: Human HIP-derived cardiomyocytes or mature cardiomyocytes are exposed to blood-group-compatible xenoserum survive Human B2M- / -C cells were not rejected by other pre-existing antibodies during xenotransplantation. Endothelial cells (blood type A) derived from IITA- / - rhesus CD47tg express ABO-incompatible Incubation with rhesus monkey serum (blood type B) resulted in killing. When compatible serum from a type AB rhesus macaque was used, the human cells survived (Fig. 4). Therefore, rhesus monkeys have no other pre-existing antibodies against human cells.

[0223] Human iPSCs were not differentiated into hiCMs. hiPSCs were plated onto the gel and cultured in Essential 8 Flex medium (Therm Differentiation was initiated at 90% confluency and maintained in 2% B-27 minus medium. In 5 ml of RPMI-1640 containing insulin and 6 μM CHIR-99021, After 2 days, the medium was replaced with 2% B-27 minus insulin without CHIR. The medium was replaced with RPMI-1640. On day 3, 5 μl of IWR1 (Selleck Chem, Houston, TX, Cat. No. S7086) was added to the medium for an additional 2 days. After 5 days, the cells were again cultured in RPMI-16 containing 2% B-27 minus insulin. On the 7th day, the medium was replaced with new one and the cells were left for 48 hours. The medium was replaced with RPMI-1640 containing 1000 mg of erythritol, and then replaced with the same medium every 3 days. The spontaneous beating of cardiomyocytes was observed for the first time in about 10 days after differentiation. Purification of myocytes was performed. Briefly, the medium was replaced with low glucose medium and maintained for 3 days. On day 13, the medium was replaced with RPMI-1640 containing insulin along with B27. On the 14th day, the procedure was repeated.

[0224] Human hypoimmunogenic iPSC-derived cardiomyocytes (blood type A) were synthesized from allogeneic human serum blood type A and When incubated with AB, they survive, but pre-existing antibodies to A (blood These results were compared with those obtained using mature cardiomyocytes. Adult cardiomyocytes (purchased from CELPROGEN) (blood type A) were allogeneic. They survived when incubated with ABO-compatible human serum (blood types A and AB), but When incubated with serum containing pre-existing antibodies to A (blood groups O and B), was injured (Fig. 5b).

[0225] Incubating porcine serum (blood group A) with human endothelial cells from all blood groups Only cells with blood group B or AB were killed (data not shown). (Data not shown) This suggests that human cells, when transplanted into ABO-incompatible pigs, Rejection is confirmed in the hyperacute phase.

[0226] Example 6: Hepatocytes cannot survive exposure to ABO blood group incompatible serum XCelligence Real-Time for monitoring cell survival / kill When measured using Cell Analysis (ACEA Biosciences) In this case, human hepatocytes (blood type A; Corning, cat. No. 454543) were used. When incubated with compatible human serum (blood types A and AB), it survives, but when incubated with ABO - Incompatible human serum (blood types B and O; BioChemed, Winchester, V A) killed human hepatocytes (Figure 6). The cells survived when incubated with ABO-compatible human serum (blood type AB), but Incubation with ABO-incompatible human serum (blood groups A, B, and O) resulted in killing. Ta.

[0227] This example demonstrates the importance of ABO matching in mature and differentiated hepatocytes.

[0228] Example 7: Relevance of rhesus factors in sensitized serum Endothelial cells (blood type ARh+ or blood type ARh-) were cultured with ABO-compatible human serum (blood type A). When incubated together, the sera were incompatible for Rh (Rh+ or Rh-). Even in this case, the serum survived unless it had been previously sensitized to the Rh factor antigen (Figure 1). 7A). However, endothelial cells with blood group ARh+ or blood group BRh+ are ABO-compatible. (blood type AB) but incubated with Rh-incompatible (Rh-) serum When the serum has been previously sensitized to the Rh antigen factor and contains anti-Rh antibodies The cells were killed (Figure 7B). 47tg) (blood type ARh+) is also Rh- and has not been previously sensitized to Rh antigens. and incubated with ABO-compatible serum (blood type AB) containing anti-Rh antibodies. Furthermore, endothelial cells with ORh+ blood type were killed by the Rh factor. When pre-sensitized ORh- containing anti-Rh antibodies was used, killing occurred (Figure 7 C) This example demonstrates the importance of using Rh- cells for transplantation into pre-sensitized subjects. This proves that it is possible.

[0229] Embryonic stem cell-derived ECs exhibit the same Rh blood group dependency as iPSC-derived iECs and primary wt ECs. Figure 7D shows that ECs derived from H9, who have blood type ARh+, are subjected to Rh antibody-containing AB. Incubation with O-compatible serum indicated that they had undergone CDC killing. vinegar.

[0230] Blood group ORh-ECs do not undergo ABO- or Rh-mediated CDC. Grown in tissue culture. The established EC line HEK293, a cell line derived from human embryonic kidney cells, is a blood type O Figure 7E shows that HEK293 cells incubated with serum containing Rh antibodies , indicating that no injuries or deaths were sustained.

[0231] Example 8: Generation of human HIPO-cells In some embodiments, ORh-pluripotent stem cells are used as starter cells, and HIPO-cells are generated according to the HIP cell generation protocol described. The cells are HIPO- cells.

[0232] In other embodiments, HIPO-cells are derived from non-universal blood group iPSCs, ESCs, or HIP cells. For example, the coding sequence (gene ID: 28; Ensembl: ENSG CRISP for targeting (00000175164 MIM:110300) By using R technology to create ABO gene knockout cell lines, blood type B- Embryonic or iPSC cell lines are transformed into O-. Therefore, the coding sequence of the B gene CRISPR guide RNA targeting the target gene was inserted into a vector containing a Cas9 expression cassette. The linearized CR containing the T7 promoter is ligated to the vector and then transfected into hiPSCs. Using the ISPR sequence, follow the kit instructions (MEGAshortscript T7 Tra Synthesize gRNA according to the Inscription Kit (Thermo Fisher). Next, the resulting in vitro transcribed (IVT) gRNA was transfected with MEGAclear Transfection Kit. Purify IVTgRNA using the Inscription Clean-Up Kit. To deliver Cas9 to stably expressing hiPSCs, 1,200V, 30ms , 300 ng IV using a Neon electroporation device using one pulse Electroporate cells with tgRNA.

[0233] After electroporation, edited hiPSCs were expanded for single cell seeding; hiPSC cultures were dissociated into single cells using pLE (Gibco) and Alexa F Staining with Fluor 488-conjugated anti-TRA-160 mAb and propidium iodide (PI) A FACSAria II cell sorter (BD Biosciences) was used for sorting. Selective gating on forward and side light scatter properties allowed the isolation of doublets and Based on the absence of propidium iodide and the presence of Tra1-60 staining, The single cells are then expanded into full-sized colonies, after which viable pluripotent cells are selected. , colonies are inspected for CRISPR editing by sequencing.

[0234] GeneArt Genomic Cleavage for testing the initial edit pool Using the CRISPR Detection Kit (Thermo Fisher), To evaluate the mediated cleavage, genomic DNA was collected at 1 x 100 μl for screening isolated clones. 0 6 hiPSCs were isolated and analyzed using AmpliTaq Gold 360 Master The resulting genomic DNA region is amplified using PCR using the PCR mix. The PCR products were purified using PureLink PCR Purification Kit. t, Thermo Fisher), Sanger sequencing for indel frequency prediction. After confirming the disruption, karyotype analysis and TaqMan hiPSC Scor Cells were further characterized by ecard Panel (Thermo Fisher) do.

[0235] Another example is the use of Orh+ cell lines to transfect the cells using the previously described CRISP / Cas9 technology (RHAG The gRNA sequence: CCAGTGGGGCACTATTGTAC was used to express RHAG (Rh -related glycoprotein; ammonium transport; RhD-related; chromosome 6p21-qter) The cell line is transformed into an Orh- cell line by deletion.

[0236] Example 9: Differentiation of human HIPO-cells 1. Differentiation of hHIPO-cells into Human Cardiomyocytes This is Sharma et al., J.Vis Exp.2015 doi:10 3791 / 52628 (in its entirety, and in particular with regard to techniques for differentiating cells, see The procedure is carried out using a protocol adapted from the protocol described in the previous section (which is incorporated herein by reference). HIPO-cells were plated onto diluted Matrigel (356231, Corning) and maintained in Essential 8 Flex medium (Thermo Fisher). After the cells reached 90% confluency, differentiation began and they were cultured in 2% B-27 minus insulin. (both Gibco) and 6 μM CHIR-99021 (Selleck Chem After 2 days, the medium was replaced with 5 ml of RPMI-1640 containing CHIR. Replace the medium with RPMI-1640 containing 2% B-27 minus insulin. On day 3, 5 uL of IWR1 is added to the medium for another 2 days. On day 5, 2 uL is added again. The medium was replaced with RPMI-1640 containing % B-27 minus insulin medium. Incubate for 48 hours. On day 7, add insulin (Gibco) with B27. The medium was replaced with RPMI-1640 containing 10 ... At ~12 days, spontaneous beating of cardiomyocytes can be first visualized. Briefly, the medium is replaced with low glucose medium and maintained for 3 days. On day 13, the medium was replaced with RPMI-1640 containing insulin along with B27. On day 14, this procedure is repeated. The remaining cells are highly purified cardiomyocytes. .

[0237] 2. Differentiation of HIPO-cells into Human Endothelial Cells Diluted Matrigel (356231, Corning) in a 6-well plate was coated with HI. PO- cells were plated and cultured in Essential 8 Flex medium (ThermoFilm). After the cells reached 60% confluence, differentiation was initiated and the medium was changed to 2 %B-27 minus insulin (both Gibco) and 5 μM CHIR-9902 Replace with RPMI-1640 containing 1 (Selleck Chem). Reduced medium: 2% B-27 minus insulin (both Gibco) and 2 μM CH RPMI-1640 containing IR-99021 (Selleck Chem) From day 4 to day 7, replace the medium with RPMI EC medium, i.e., 2% B-27 minor. In addition to insulin, 50 ng / mL of vascular endothelial growth factor (VEGF; R&D System tems, Minneapolis, MN, USA), 10 ng / mL fibroblast growth factor FGFb (basic) (FGFb; R&D Systems), 10 μM Y-27632 (Si gma-Aldrich, Saint Louis, MO, USA) and 1 μM SB4 Cells were exposed to RPMI 1640 containing 31542 (Sigma-Aldrich). Endothelial cell clusters were visible from day 7 onwards, and the cells were cultured in 10% FCS (Gibco o), 25 ng / mL vascular endothelial growth factor (VEGF; R&D Systems, M (Inneapolis, USA), 2 ng / mL fibroblast growth factor (basic) (FG Fb;R&D Systems), 10μM Y-27632 (Sigma-Aldri ch, Saint Louis, MO, USA) and 1 μM SB431542 (Sig EGM-2 SingleQuots medium (Lonza) supplemented with ma-Aldrich , Basel, Switzerland) for 14 days before the differentiation process. During the differentiation process, undifferentiated cells are separated. 1 Microbeads (Mitenyi, Auburn, CA) were used according to the manufacturer's protocol. Following the protocol, cells are passed through a MACS Progress column. Highly purified EC cells are then supplemented. EGM-2 Single Quots containing the substance and 10% FCShi (Gibco) The cells were cultured in a medium (Lonza, Basel, Switzerland). For feeding, use TrypLE at a 1:3 ratio every 3-4 days.

[0238] IX. Exemplary Sequences: SEQ ID NO:1 - Human beta-2 microglobulin [ka]

[0239] SEQ ID NO:2 - Human CIITA protein, 160 amino acids N-terminus [ka]

[0240] SEQ ID NO:3 - Human CD47 [ka]

[0241] SEQ ID NO: 4 - Herpes Simplex Virus thymine HSV-tk kinase [ka]

[0242] SEQ ID NO:5 - Escherichia coli cytosine deaminase (EC -CD) [ka]

[0243] SEQ ID NO:6 - Truncated human caspase 9 [ka]

[0244] All publications and patent documents disclosed or referenced herein are incorporated by reference in their entirety. The foregoing description is provided for purposes of illustration and description only. This description is not intended to limit the invention to the particular forms disclosed. It is intended that the scope of the invention be defined by the claims appended hereto.

Claims

1. A modified pluripotent cell or a cell derived therefrom, said cell comprising ABO blood group O and Rhesus factor negative (Rh-), and the cells are (a) a group consisting of A1, A2, and B and / or (b) R h C antigen, Rh E antigen, Kell K antigen (KEL), Duffy (FY) Fya anti Hara, Duffy Fy3 antigen, Kidd (JK) Jkb antigen, MNS antigen U, and MNS Reduced or eliminated expression of Rh protein antigens selected from the group consisting of antigen S , modified pluripotent cells or cells derived therefrom.

2. A modified pluripotent cell or a cell derived therefrom, comprising: (a) A1, A2, and B; and reducing or eliminating the antigenicity of one or more ABO blood group antigens selected from the group , modification of the cells to make them ABO blood group O; and / or (b) Rh C antigen, Rh E antigen antigen, Kell K antigen (KEL), Duffy (FY) Fya antigen, Duffy Fy 3 antigen, Kidd (JK) Jkb antigen, MNS antigen U, and MNS antigen S. The antigenicity of one or more selected Rh antigens is reduced or eliminated to render the cells Rh-resistant. A modified pluripotent cell or a cell derived therefrom, comprising a modification to make it h-.

3. The cells are: a. Reduced endogenous major histocompatibility complex class I (HL) expression compared to unmodified pluripotent cells AI) Function; b. Reduced endogenous major histocompatibility complex class II (HCI) expression compared to unmodified pluripotent cells. LA-II) function; and c. Increased CD47 function reduces susceptibility to NK cell killing 3. The modified pluripotent cell of claim 1 or 2, which is a low immunogenic (HIP) pluripotent cell comprising: 。

4. Modified pluripotent cells or cells derived therefrom, wherein the cells are HLA-I human leukocytes. Antigen, HLA-II human leukocyte antigen, CD47, CCR5, CXCR4, NLRC5, C IITA, B2M, HLA-A, HLA-B, HLA-C, HLA-E, HLA-G, P D-L1, CTLA-4-Ig, CD47, Cl-inhibitor, IL-35, RFX-5, RFXAP, RFXANK, NFY-A, NFY-B, NFY-C, IRF-1, OX4 0, GITR, 4-1BB, CD28, B7-1, B7-2, ICOS, CD27, HV EM, SLAM, CD226, PD1, CTL4, LAG3, TIGIT, TIM3, C D160, BTLA, CD244, CD30, TLT, VISTA, B7-H3, PD- L2, LFA-1, CD2, CD58, ICAM-3, TCRA, TCRB, FOXP3 , HELIOS, ST2, PCSK9, APOC3, CD200, FASLG, CLC2 1, MFGE8, SERPIN B9, TGFβ, CD73, CD39, LAG3, IL 1R2, ACKR2, TNFRSF22, TNFRSF23, TNFRS10, DAD1 and / or one or more of IFNγR1d39 associated with wild-type stem cells, and regulated expression of the ABO blood group O or Rhesus factor. A modified pluripotent cell or a cell derived therefrom that is Rh-negative (Rh-).

5. A modified pluripotent cell or a cell derived therefrom, said cell comprising: a. Reduced endogenous major histocompatibility antigen class (HLA) expression compared to unmodified pluripotent cells -I) Function; b. Reduced endogenous major histocompatibility antigen (HLA) class B antigens compared to unmodified pluripotent cells -II) Function; c. increased CD47 function, reducing susceptibility to NK cell killing; d. ABO blood group type O (O); and e. Optionally, Rhesus factor negative (Rh-) blood type A modified pluripotent cell or a cell derived therefrom, which is a low immunogenic pluripotent O- (HIPO-) cell, comprising Incoming cells.

6. The cells are O-induced pluripotent stem cells (iPSCO-), O-embryonic stem cells (ESCO-), , O - endothelial cells, O - cardiac myocytes, O - hepatocytes, O - dopaminergic neurons, O - pancreas O-islet cells, O-retinal pigmented endothelial cells, and O-chimeric antigen receptor (O-CAR) cells. and other O-cell types used in transplantation and medical therapy.

1. The modified pluripotent cell according to any one of claims 1 to 9, or a cell derived therefrom.

7. the O-CAR cells are O-chimeric antigen receptor T (O-CAR-T) cells. A modified pluripotent cell according to item 6 or a cell derived therefrom.

8. wherein said ABO blood group type O is obtained by reduced ABO blood group protein expression. The modified pluripotent cell according to any one of claims 1 to 7, or a cell derived therefrom.

9. The ABO blood group O type is obtained by disruption of human exon 7 of the ABO gene. The modified pluripotent cell of claim 8 or a cell derived therefrom.

10. The ABO blood group O is obtained by enzymatic modification of ABO gene products on the surface of the cells. The modified pluripotent cell or a cell derived therefrom according to any one of claims 1 to 7.

11. 11. The method of claim 10, wherein the enzymatic modification removes carbohydrates from the ABO gene product. Modified pluripotent cells or cells derived therefrom.

12. The enzymatic modification removes carbohydrates from the ABO A1, A2, and / or B antigens. The modified pluripotent cell or a cell derived therefrom according to claim 10.

13. 13. The method according to claim 1, wherein the Rh- is obtained by reduced Rh protein expression. The modified pluripotent cell according to any one of claims 1 to 4, or a cell derived therefrom.

14. The Rh- is Rh C antigen, Rh E antigen, Kell K antigen (KEL), Duff y (FY) Fya antigen, DuffyFy3 antigen, Kidd (JK) Jkb antigen, or Ki dd The modified pluripotent cells of claim 13 obtained by disruption of the SLC14A1 gene. Cells or cells derived therefrom.

15. The modified antibody according to any one of claims 1 to 7, wherein the ABO blood group type is endogenously type O. Pluripotent cells or cells derived therefrom.

16. The Rh-blood type of any one of claims 1 to 7, wherein the Rh-blood type is an intrinsic Rh-type. Modified pluripotent cells or cells derived therefrom.

17. The HLA-I function is reduced by the reduction of the expression of the β-2 microglobulin protein. The modified pluripotent cell or cells derived therefrom according to any one of claims 3 to 16, Cell.

18. The gene encoding the beta-2 microglobulin protein is knocked out.

18. The modified pluripotent cell of claim 17 or a cell derived therefrom.

19. wherein the HLA-I function is reduced by reducing the expression of HLA-A protein. Item 17. The modified pluripotent cell according to any one of Items 3 to 16, or a cell derived therefrom.

20. The method according to claim 19, wherein the gene encoding the HLA-A protein is knocked out. The modified pluripotent cells described above or cells derived therefrom.

21. wherein the HLA-I function is reduced by reducing the expression of HLA-B proteins. Item 17. The modified pluripotent cell according to any one of Items 3 to 16, or a cell derived therefrom.

22. The method according to claim 21, wherein the gene encoding the HLA-B protein is knocked out. The modified pluripotent cells described above or cells derived therefrom.

23. wherein the HLA-I function is reduced by reducing the expression of HLA-C protein. Item 17. The modified pluripotent cell according to any one of Items 3 to 16, or a cell derived therefrom.

24. The method according to claim 23, wherein the gene encoding the HLA-C protein is knocked out. The modified pluripotent cells described above or cells derived therefrom.

25. 25. The method of claim 3, wherein the HIPO-cells do not contain HLA-I function. The modified pluripotent cell described above or a cell derived therefrom.

26. The HLA-II function is reduced by reducing the expression of the CIITA protein.

26. The modified pluripotent cell according to any one of claims 3 to 25, or a cell derived therefrom.

27. The method of claim 26, wherein the gene encoding the CIITA protein is knocked out. The modified pluripotent cells described above or cells derived therefrom.

28. the HLA-II function is reduced by reducing the expression of HLA-DP protein; The modified pluripotent cell or a cell derived therefrom according to any one of claims 3 to 25.

29. 29. The method of claim 28, wherein the gene encoding the HLA-DP protein is knocked out. The modified pluripotent cell described above or a cell derived therefrom.

30. the HLA-II function is reduced by reducing the expression of HLA-DR protein; The modified pluripotent cell or a cell derived therefrom according to any one of claims 3 to 25.

31. 31. The method of claim 30, wherein the gene encoding the HLA-DR protein is knocked out. The modified pluripotent cell described above or a cell derived therefrom.

32. the HLA-II function is reduced by reducing the expression of HLA-DQ proteins; The modified pluripotent cell or a cell derived therefrom according to any one of claims 3 to 25.

33. 33. The method of claim 32, wherein the gene encoding the HLA-DQ protein is knocked out. The modified pluripotent cell described above or a cell derived therefrom.

34. 34. The method according to claim 3, wherein the low immunogenic pluripotent cells do not contain HLA-II function.

1. The modified pluripotent cell of claim 1 or a cell derived therefrom.

35. The reduced susceptibility to NK cell killing is due to increased expression of the CD47 protein. The modified pluripotent cell or a cell derived therefrom according to any one of claims 3 to 34. 。

36. The increased CD47 protein expression is obtained by modifications to the endogenous CD47 locus.

36. The modified pluripotent cell or a cell derived therefrom of claim 35.

37. wherein the increased CD47 protein expression is obtained from a CD47 transgene.

36. The modified pluripotent cell of item 35 or a cell derived therefrom.

38. The CD47 protein has at least 90% sequence identity with SEQ ID NO:

3.

38. The modified pluripotent cell or a cell derived therefrom according to any one of claims 35 to 37.

39. 39. The modification of claim 38, wherein the CD47 protein has the sequence of SEQ ID NO:

3. Pluripotent cells or cells derived therefrom.

40. The suicide gene activated by the trigger that kills the low-immunogenic pluripotent cells is further The modified pluripotent cell or cells derived therefrom according to any one of claims 3 to 39, further comprising: Cell.

41. The suicide gene is the herpes simplex virus thymidine kinase gene (HSV-tk). and the trigger is ganciclovir. cells derived from it.

42. The HSV-tk gene is a protein having at least 90% sequence identity with SEQ ID NO:

4.

42. The modified pluripotent cell of claim 41, or a cell derived therefrom, encoding a protein.

43. The HSV-tk gene encodes a protein comprising the sequence of SEQ ID NO:

4.

43. The modified pluripotent cell or a cell derived therefrom according to 42.

44. The suicide gene is an Escherichia coli cytosine deaminase The trigger is 5-fluorocytosine (5-FC).

41. The modified pluripotent cell of claim 40, or a cell derived therefrom.

45. The EC-CD gene is a protein having at least 90% sequence identity with SEQ ID NO:

5.

45. The modified pluripotent cell of claim 44, or a cell derived therefrom, encoding a gene.

46. Claim 4: The EC-CD gene encodes a protein comprising the sequence of SEQ ID NO:

5.

6. The modified pluripotent cell according to 5, or a cell derived therefrom.

47. The suicide gene encodes an inducible caspase protein, and the trigger encodes a protein 41. The modified pluripotent cell of claim 40, wherein the compound is a protein dimer-inducing compound (CID). Cells of origin.

48. The gene is an inducible caspase gene that contains at least 90% sequence identity with SEQ ID NO:

6.

48. The modified pluripotent cell or a cell derived therefrom of claim 47, which encodes a protein.

49. The gene encodes an inducible caspase protein comprising the sequence of SEQ ID NO:

6.

49. The modified pluripotent cell of claim 48 or a cell derived therefrom.

50. The modified polynucleotide according to any one of claims 47 to 49, wherein the CID is AP1903. A cell derived from a human ovarian cancer cell.

51. The cells include: O-chimeric antigen receptor (O-CAR) cells, endothelial cells, dopaminergic cells, a cell selected from the group consisting of a neuron, a cardiac cell, a pancreatic islet cell, and a retinal pigmented endothelial cell. A cell derived from the modified pluripotent cell of any one of claims 3 to 50.

52. The cell of claim 51, wherein the O-CAR cell is an O-CAR-T cell.

53. The modified pluripotent cells or cells derived therefrom are cardiomyocytes or cardiomyocyte progenitor cells.

52. The modified pluripotent cell or a cell derived therefrom according to any one of claims 1 to 51.

54. 10. The method of claim 1, further comprising reducing or eliminating expression of the CCR5 or CXCR4 gene.

54. The modified pluripotent cell according to any one of claims 1 to 53, or a cell derived therefrom.

55. 55. The method of any one of claims 1 to 54, further comprising reducing or eliminating expression of the NLRC5 gene. The modified pluripotent cell according to any one of claims 1 to 4, or a cell derived therefrom.

56. The following: HLA-A, HLA-B, HLA-C, HLA-E, HLA-G, PD-L1, CTLA-4-Ig, CD47, Cl-inhibitory factor, and IL-35.

56. The method of claim 1, further comprising the modified expression of at least one gene involved in the expression of the gene. The modified pluripotent cell described above or a cell derived therefrom.

57. Below: RFX-5, RFXAP, RFXANK, NFY-A, NFY-B, NFY-C and IRF-1. Item 57. The modified pluripotent cell according to any one of Items 1 to 56, or a cell derived therefrom.

58. Below: OX40, GITR, 4-1BB, CD28, B7-1, B7-2, ICOS, CD27, HVEM, SALM, CD226, PD1, CTL4, LAG3, TIGIT , TIM3, CD160, BTLA, CD244, CD30, TLT, VISTA, B7 -H3, PD-L2, LFA-1, CD2, CD58, ICAM-3, TCRA, TCR B, FOXP3, HELIOS, ST2, PCSK9, CCR5, and APOC3 The method of claim 1 further comprises the modified expression of at least one gene selected from the group consisting of:

58. The modified pluripotent cell of any one of 57, or a cell derived therefrom.

59. Below: PDL-1, HLA-G, CD47, CD200, FASLG, CLC21, M FGE8, and at least one transformer selected from the group consisting of SERPIN B9 Gene, or the following: PDL-1, HLA-G, CD47, CD200, FASLG, CL At least one encoding an agonist of C21, MFGE8, or SERPIN9 59. The modified pluripotent cell of any one of claims 1 to 58, further comprising a transgene of Or cells derived therefrom.

60. Below: TGFβ, CD73, CD39, LAG3, IL1R2, ACKR2, TNFR SF22, TNFRSF23, TNFRS10, DAD1, and IFNγR1 d39 at least one transgene selected from the group consisting of: TGFβ, CD7 3, CD39, LAG3, IL1R2, ACKR2, TNFRSF22, TNFRSF2 3, encoding an agonist of TNFRS10, DAD1, or IFNγR1 d39 60. The method of any one of claims 1 to 59, further comprising at least one transgene A modified pluripotent cell of or a cell derived therefrom.

61. A method for transplanting cells, comprising the step of: administering one or more cells derived from the wherein the subject is a human, a cow, a pig, a chicken, a turkey, a horse, a sheep, goats, donkeys, mules, ducks, geese, buffalo, camels, yaks, llamas, alpacas , mouse, rat, dog, cat, hamster, or guinea pig.

62. The cells derived from the modified pluripotent cells include: O-CAR cells, O-endothelial cells, O-endothelial cells, O - vasopressin-dependent neurons, O - cardiac cells, O - pancreatic islet cells, and O - retinal pigmented endothelial cells 62. The method of claim 61 , wherein the compound is selected from the group consisting of:

63. A method for treating a disease in a patient requiring transplanted cells, comprising administering to said patient a cell therapy according to any one of claims 1 to 6.

10. A method comprising administering cells derived from the modified pluripotent cells of any one of claims 1 to 8.

64. The cells derived from the modified pluripotent cells include O-CAR cells, O-endothelial cells, O-dopamine cells, and the like. O—a group consisting of agonist neurons, O—cardiac cells, O—pancreatic islet cells, and O—retinal pigmented endothelial cells 64. The method of claim 63, wherein the

65. The disease is a group consisting of type I diabetes, heart disease, nervous system disease, cancer, eye disease, and vascular disease.

64. The method of claim 63, wherein the

66. Modification of non-O-pluripotent cells to ABO blood group O and Rh factor negative (Rh-) 1. A method for producing pluripotent cells, comprising: a. Eliminate or reduce the expression of any ABO blood group antigen A1, A2, and / or B to give ABO blood type O; and / or b. Eliminate or reduce the expression of Rhesus (Rh) blood group antigens to produce Rh-negative (-) blood ) step of assigning A method comprising:

67. Low immunogenic pluripotent ABO blood group O Rh factor negative (HIP) derived from O-pluripotent cells O-) A method of producing a cell, comprising: a. Enhanced major histocompatibility antigen class I (HLA-I) function compared to unmodified pluripotent cells excluding; b. Major histocompatibility antigen class II (HLA-II) function compared to unmodified pluripotent cells eliminating the ability to c. Increasing the expression of CD47 compared to unmodified pluripotent cells A method comprising:

68. The pluripotent cells may be derived from a variety of animals, including humans, cattle, pigs, chickens, turkeys, horses, sheep, yaks, and the like. Giraffes, donkeys, mules, ducks, geese, buffalo, camels, yaks, llamas, alpacas, maws 66 or 67, derived from a mouse, rat, dog, cat, hamster, or guinea pig. The method described below.

69. wherein the ABO blood group O type is obtained by elimination of ABO blood group protein expression. Item 69. The method according to any one of items 66 to 68.

70. 70. The method of any one of claims 66 to 69, wherein the cells are endogenously type O.

71. The pluripotent cells are derived from a human, and the ABO blood group O type is a human of the ABO gene. The method of any one of claims 66 to 69, obtained by disruption of exon 7.

72. Disruption of the human exon 7 of the ABO gene disrupts both alleles of exon 7. Destroy, Clustered Regularly Interspaced Shor t Palindromic Repeats (CRISPR) / Cas9 reaction The method of claim 71, wherein

73. The ABO blood group O type is generated by enzymatic modification of ABO gene products on the surface of the pluripotent cells. The method according to any one of claims 66 to 69, obtained by

74. 74. The method of claim 73, wherein the enzymatic modification removes carbohydrates from the ABO gene product. method.

75. The enzymatic modification removes carbohydrates from the ABO A1, A2, and / or B antigens. The method of claim 74.

76. 70. The method of any one of claims 66 to 69, wherein the cells are endogenously Rh-.

77. 70. The method of any one of claims 66 to 69, comprising elimination of Rh protein expression.

78. The Rh-type is any of the following: Rh C antigen, Rh E antigen, Kell K antigen (KEL), Duffy (FY) Fya antigen, Duffy Fy3 antigen, Kidd (JK) Jkb antigen or obtained by disrupting the gene encoding Kidd SLC14A1; 78. The method of claim 77.

79. The disruption is achieved by a CRISPR / Cas9 reaction that disrupts both alleles of the gene.

79. The method of claim 78, wherein

80. The increased CD47 expression is achieved by inducing a small amount of human CD47 in the parental cells under the control of a promoter. Any of claims 67 to 69, achieved by introducing at least one copy 2. The method according to claim 1.

81. 81. The method of claim 80, wherein the promoter is a constitutive promoter.

82. Disruption of both alleles of the B2M gene (e.g., using a CRISPR / Cas9 reaction) 82. The method of any one of claims 67 to 81, comprising:

83. The HLA-I function reduces the expression of the β-2 microglobulin protein. The method according to any one of claims 67 to 82, wherein the concentration of hydroxybenzoates is reduced by 100%.

84. knocking out the gene encoding the beta-2 microglobulin protein; 84. The method of claim 83, wherein the expression of the beta-2 microglobulin protein is reduced. How to post.

85. The beta-2 microglobulin protein has at least 90% sequence identity with SEQ ID NO:

1.

85. The method of claim 84, wherein the

86. The beta-2 microglobulin protein has the sequence of SEQ ID NO:

1.

85. The method according to claim 85.

87. Reducing the expression of HLA-A protein reduces the HLA-I function.

82. The method according to any one of claims 67 to 81.

88. By knocking out the gene encoding the HLA-A protein, the HL 88. The method of claim 87, wherein the expression of A-A protein is reduced.

89. Reducing the expression of HLA-B proteins reduces the HLA-I function.

82. The method according to any one of claims 67 to 81.

90. By knocking out the gene encoding the HLA-B protein, 90. The method of claim 89, wherein the expression of LA-B protein is reduced.

91. Reducing the expression of HLA-C protein reduces the HLA-I function.

82. The method according to any one of claims 67 to 81.

92. By knocking out the gene encoding the HLA-C protein, 92. The method of claim 91, wherein the expression of LA-C protein is reduced.

93. 93. Any of claims 67 to 92, wherein the hypoimmunogenic pluripotent cells do not contain HLA-I function.

1. The method according to claim 1.

94. By reducing the expression of the CIITA protein, the HLA-II function is reduced. The method according to any one of claims 67 to 93,

95. By knocking out the gene encoding the CIITA protein, 95. The method of claim 94, wherein the expression of IITA protein is reduced.

96. The CIITA protein has at least 90% sequence identity with SEQ ID NO: 2; 96. The method of claim 95.

97. 97. The method of claim 96, wherein the CIITA protein has the sequence of SEQ ID NO:

2. Law.

98. CRISPR reaction disrupting both alleles of the CIITA gene The method of any one of claims 67 to 97, comprising reducing expression of a protein. 。

99. By reducing the expression of HLA-DP protein, the HLA-II function is reduced. The method according to any one of claims 67 to 98,

100. By knocking out the gene encoding the HLA-DP protein, 100. The method of claim 99, wherein the expression of HLA-DP protein is reduced.

101. By reducing the expression of HLA-DR protein, the HLA-II function is reduced. The method according to any one of claims 67 to 98,

102. By knocking out the gene encoding the HLA-DR protein, 102. The method of claim 101, wherein the expression of HLA-DR protein is reduced.

103. By reducing the expression of HLA-DQ protein, the HLA-II function is reduced. The method according to any one of claims 67 to 98,

104. By knocking out the gene encoding the HLA-DQ protein, 104. The method of claim 103, wherein the expression of HLA-DQ protein is reduced.

105. 105. Any of claims 67 to 104, wherein the hypoimmunogenic pluripotent cells do not contain HLA-II function. The method according to any one of claims 1 to 4.

106. The increased expression of CD47 is due to the expression of a transgene encoding the CD47 protein. The method according to any one of claims 67 to 105, which is currently being implemented.

107. The CD47 protein has at least 90% sequence identity with SEQ ID NO:

3. The method of claim 106.

108. 108. The method of claim 107, wherein the CD47 protein has the sequence of SEQ ID NO:

3. Law.

109. The hypoimmunogenic pluripotent cells express a suicide gene that is activated by a trigger that kills the cells. The method of any one of claims 67 to 108, further comprising the step of:

110. The suicide gene is the herpes simplex virus thymidine kinase gene (HSV-tk). and the trigger is ganciclovir.

111. The HSV-tk gene is a protein having at least 90% sequence identity with SEQ ID NO:

4. The method of claim 110, wherein the protein is encoded.

112. The HSV-tk gene encodes a protein comprising the sequence of SEQ ID NO:

4. The method of claim 111.

113. The suicide gene is an Escherichia coli cytosine deaminase The trigger is 5-fluorocytosine (5-FC). The method of claim 109.

114. The EC-CD gene is a protein having at least 90% sequence identity with SEQ ID NO:

5. The method of claim 113, wherein the quality is coded.

115. the EC-CD gene encodes a protein comprising the sequence of SEQ ID NO:

5. Item 115. The method according to item 114.

116. The suicide gene is an inducible caspase protein, and the trigger is a specific The method of claim 109, wherein the compound is a protein dimer inducing compound (CID).

117. The gene is an inducible caspase gene that contains at least 90% sequence identity with SEQ ID NO:

6. The method of claim 116, encoding a protein.

118. The gene encodes an inducible caspase protein comprising the sequence of SEQ ID NO:

6.

118. The method of claim 117.

119. The method according to any one of claims 116 to 118, wherein the CID is AP1903. Law.

120. Hypoimmunogenic pluripotent (HIP) cells or cells derived therefrom are administered to a subject in need thereof.

1. A method for transplanting HIP cells or cells derived therefrom into an ABO blood group, comprising: determining the ABO blood group type of said subject; and The ABO blood group type of P cells or cells derived therefrom is the ABO blood group of the subject. transplanting said HIP cells or cells derived therefrom only if they are compatible with the type of Methods including:

121. Furthermore, the following is performed: determining the rhesus (Rh) factor type of the HIP cells or cells derived therefrom. determining the Rh factor type of the subject; and only if the Rh blood type of the cells derived therefrom matches the Rh blood type of the subject. and transplanting said HIP cells or cells derived therefrom. The method described.

122. The HIP cells or cells derived therefrom are: a. Reduced endogenous major histocompatibility complex class I (HL) expression compared to unmodified pluripotent cells AI) Function; b. Reduced endogenous major histocompatibility complex class II (HCI) expression compared to unmodified pluripotent cells. LA-II) function; and c. Increased CD47 function reduces susceptibility to NK cell killing 122. The method of claim 120 or 121, comprising:

123. 12. The method of claim 11, wherein the cells derived from the HIP cells are cardiomyocytes or cardiac progenitor cells. 9 or 120.

Images