Aptamer against flavivirus and use thereof

Abstract

To provide a neutralizing molecule against a flavivirus.SOLUTION: An aptamer against a flavivirus comprising the nucleotide sequence set forth in SEQ ID NO:1 (where, in the nucleotide sequence set forth in SEQ ID NO:1, at least one nucleotide may be deleted at any of positions 3 to 8, 10 to 16, 18 to 22, 24 to 29, 35 to 43, 46 to 47, and 51 to 54).SELECTED DRAWING: None

Description

[Technical Field]

[0001] The present invention relates to an aptamer against a flavivirus and uses thereof (such as a pharmaceutical composition containing the aptamer for treating or preventing a flavivirus infection). [Background technology]

[0002] Flaviviruses are enveloped viruses with a single-stranded positive-sense RNA genome. They include over 70 species, most of which are transmitted by blood-sucking arthropods (e.g., mosquitoes and ticks). Among them, dengue virus, Japanese encephalitis virus, and Zika virus can cause severe symptoms such as hemorrhagic fever and encephalitis, making them a major public health problem of global concern. However, there are no effective antiviral drugs or specific treatments for flavivirus infections, and their development is urgently needed.

[0003] For example, infection with dengue virus (DENV) not only causes dengue fever, a transient febrile illness, but also dengue hemorrhagic fever, which can be fatal in severe cases. This infectious disease is spreading not only in tropical and subtropical regions but also worldwide through imported infections. However, the development of effective vaccines and neutralizing antibodies has been challenging. One of the main reasons for this is the exacerbation of symptoms due to antibody-dependent enhancement (ADE). DENV exists in four serotypes (types 1 to 4). Neutralizing antibodies against a specific serotype, while cross-reactive with other serotypes, do not exhibit neutralizing activity. Furthermore, complexes between the antibody and virus efficiently adsorb to monocytes and other cells with Fc receptors, promoting infection and exacerbating symptoms. Therefore, there is a need for neutralizing molecules that have neutralizing activity against multiple serotypes without the risk of exacerbating symptoms. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] International Publication No. 2021 / 006305 [Non-patent literature]

[0005] [Non-Patent Document 1] Masaki Takahashi et al., Proc Natl Acad Sci USA, 2021 May 4;118(18):e2019497118. [Non-patent document 2] Masaki Takahashi et al., Mol Ther Nucleic Acids., 2022 Jun 29:29:969-978. [Non-patent document 3] Khalid K Alam et al., Mol Ther Nucleic Acids, 2015 Mar 3;4(3):e230. [Non-patent document 4] Ryoga Ishida et al., Nucleic Acids Res., 2020 Aug 20;48(14):e82. [Non-patent document 5] Natsuki Iwano et al., Nat Comput Sci., 2022 Jun;2(6):378-386. Summary of the Invention [Problem to be solved by the invention]

[0006] The present invention has been made in view of the problems inherent in the prior art, and has as its object to provide a neutralizing molecule against flaviviruses. [Means for solving the problem]

[0007] The present inventors previously developed an aptamer selection method (VLP-SELEX method, Patent Document 1, Non-Patent Documents 1 and 2) for the creation of aptamers against membrane proteins. This method utilizes materials in which target membrane proteins are expressed on the membrane of virus-like particles (VLPs). Based on this selection method, we then optimized the SELEX method for dengue virus-like particles (DENV-VLPs). To efficiently select molecules that specifically bind to non-DENV-VLPs in silico, we optimized a statistical analysis method using a high-throughput sequencer (HTS) and aptamer-specific bioinformatics software (FASTAptamer, Non-Patent Document 3). Next, we established and optimized a method for predicting the binding and neutralizing activity of aptamers and VLPs based on surface plasmon resonance (SPR), and evaluated the binding and neutralizing abilities of candidate sequences. As a result, we successfully selected aptamers that bind to VLPs of all serotypes, from DENV1 to DENV4. Furthermore, by shortening and optimizing the sequences and modifying the glycosylation chain, we succeeded in obtaining sequences with binding abilities equal to or greater than those before these modifications (e.g., candidate 1 (D_26_1_5_L_A11CU38G)). Furthermore, we found that these aptamers exhibit competitive inhibition (neutralization ability) against existing neutralizing antibodies.

[0008] Furthermore, using the SELEX data obtained above, we conducted a re-search for potential candidate sequences by in silico analysis. Specifically, we searched for new aptamer candidate sequences using RaptRanker (Non-Patent Document 4), an analytical method that discovers potential sequences based on local sequence and secondary structure, and RaptGen (Non-Patent Document 5), an analytical method that utilizes artificial intelligence technology, and selected sequences with high binding ability. Furthermore, as described above, we shortened and optimized the sequences and modified their glycosylation, and succeeded in obtaining further sequences with high binding and neutralizing abilities (e.g., candidate 2 (Freq_raw5_log3_c20_1_54_dU15_C16GG33U)).

[0009] More specifically, using the VLP-SELEX method, we successfully identified candidate 1 (SEQ ID NO: 6) and candidate 2 (SEQ ID NO: 9) as aptamers for DENV. Furthermore, by summarizing the characteristics of all sequences whose binding activity was confirmed during the process of identifying these, the inventors clarified that they were the candidate 1 series (SEQ ID NO: 5) and candidate 2 series (SEQ ID NO: 8). Furthermore, by combining these two nucleotide sequences, we were able to find a shared sequence called the candidate 1&2 series (SEQ ID NO: 3).

[0010] In addition, in the Doped-SELEX performed to identify the above candidate 1 and candidate 2, the characteristics of all sequences in which binding activity was observed were summarized. From the Doped-SELEX that generated candidate 1, 1 st From the doped-SELEX that generated candidate 1 (including candidate 1) (SEQ ID NO: 4) and candidate 2, 2 nd The present inventors have demonstrated that candidate 1 and candidate 2 share a common sequence characteristic of Lb05N40 (SEQ ID NO: 2), which is doped (including candidate 2) (SEQ ID NO: 5). Furthermore, by summarizing the characteristics of all sequences for which binding activity was observed during the identification of sequences for creating the above-mentioned doped library linking candidate 1 and candidate 2, the inventors were able to identify a common sequence, Lb05N40 (SEQ ID NO: 2).

[0011] Furthermore, the inventors have revealed that the characteristics of all sequences whose binding activity was confirmed throughout the entire process of identifying candidate 1 and candidate 2, as sequences shared by all of the above, can be summarized and represented as ALL (SEQ ID NO: 1).

[0012] The researchers then demonstrated that this aptamer has binding activity not only to all serotypes of dengue virus, from DENV1 to DENV4, but also to virus-like particles (VLPs) of other flaviviruses (Japanese encephalitis viruses). They also found that the aptamer not only has binding activity but also neutralizing activity against all serotypes of dengue virus, and that this neutralizing activity is maintained even when the aptamer is multimerized. They also demonstrated that this neutralizing activity is aptamer concentration-dependent and is not accompanied by enhanced infection efficiency (ADE), leading to the completion of the present invention.

[0013] That is, the present invention provides the following aspects.

[0014] [1] An aptamer for a flavivirus, comprising the nucleotide sequence set forth in SEQ ID NO: 1 (however, at least one nucleotide may be deleted from positions 3 to 8, 10 to 16, 18 to 22, 24 to 29, 35 to 43, 46 to 47, and 51 to 54 in the nucleotide sequence set forth in SEQ ID NO: 1).

[0015] [2] An aptamer for a flavivirus, comprising at least one of the nucleotide sequences set forth in SEQ ID NO: 2 and 3 (however, at least one nucleotide may be deleted from positions 3 to 7, 10 to 16, 18, 20 to 22, 24 to 29, 35 to 43, 46 to 47, and 51 to 54 in the nucleotide sequence set forth in SEQ ID NO: 2; and at least one nucleotide may be deleted from positions 15, 18 to 21, 24, and 34 in the nucleotide sequence set forth in SEQ ID NO: 3).

[0016] [3] An aptamer for a flavivirus, comprising at least one of the nucleotide sequences set forth in SEQ ID NOs: 4, 5, 7, and 8 (wherein at least one nucleotide may be deleted at positions 8, 15, 16, 20, and 21 in the nucleotide sequence set forth in SEQ ID NO: 4; at least one nucleotide may be deleted at positions 20 and 21 in the nucleotide sequence set forth in SEQ ID NO: 5; at least one nucleotide may be deleted at positions 11, 12, 14 to 16, 18 to 22, 24, 27, 28, 35, and 36 in the nucleotide sequence set forth in SEQ ID NO: 7; and at least one nucleotide may be deleted at positions 15, 18 to 20, and 33 in the nucleotide sequence set forth in SEQ ID NO: 8).

[0017] In the nucleotide sequences of SEQ ID NOs: 1 to 9, each T independently represents thymine or uracil, each M independently represents adenine or cytosine, each R independently represents adenine or guanine, each W independently represents adenine, thymine, or uracil, each S independently represents cytosine or guanine, each Y independently represents cytosine, thymine, or uracil, and each K independently represents each V independently represents adenine, cytosine, or guanine; each H independently represents adenine, cytosine, thymine, or uracil; each D independently represents adenine, guanine, thymine, or uracil; each B independently represents cytosine, guanine, thymine, or uracil; and each N independently represents adenine, cytosine, guanine, thymine, or uracil.

[0018] [4] The aptamer according to any one of [1] to [3], wherein at least one nucleotide is a modified nucleotide.

[0019] [5] The aptamer described in [4], wherein the modified nucleotide is a nucleotide in which the hydroxyl group at the 2' position of the ribose at each of the positions is independently replaced with an atom or group selected from the group consisting of a hydrogen atom, a fluorine atom, and a methoxy group.

[0020] [6] The aptamer according to [1], which has, in the nucleotide sequence of SEQ ID NO: 1, a stem structure in which nucleotides 1 to 5 are paired with nucleotides 56 to 52, a loop structure formed by nucleotides 6 and 51, a stem structure in which nucleotides 7 and 8 are paired with nucleotides 50 to 49, a loop structure formed by nucleotides 48 to 44, a stem structure in which nucleotides 9 to 19 are paired with nucleotides 43 to 33 (including some bulge-out residues), and a loop structure formed by nucleotides 20 to 32.

[0021] [7] An aptamer multimer formed by linking at least two aptamers selected from the aptamers according to [1] to [6].

[0022] [8] A pharmaceutical composition for treating or preventing flavivirus infections, comprising at least one aptamer selected from the aptamers described in [1] to [6] or the aptamer multimer described in [7].

[0023] [9] The pharmaceutical composition described in [8], wherein the flavivirus infection is an infection with dengue virus or Japanese encephalitis virus. [Effects of the Invention]

[0024] According to the present invention, it is possible to treat or prevent flavivirus infections. In particular, the aptamer of the present invention exhibits broad cross-reactivity and can target all serotypes of dengue virus and Japanese encephalitis virus. Furthermore, the treatment or prevention is possible without accompanying enhanced infection (ADE). [Brief explanation of the drawings]

[0025] [Figure 1] FIG. 1 shows an overview of a sequence (Lb05_D13_Abs_c1_1) that was highly enriched in VLP-SELEX performed using a mixture of virus-like particles (VLPs) of dengue virus serotype 1 (DENV1) and serotype 3 (DENV3), and sensorgrams showing the results of analyzing the binding activity of the sequence to VLPs of dengue virus of each serotype (DENV1 to DENV4) and its binding inhibition (competitiveness) with the neutralizing antibody 4G2 monoclonal antibody. [Figure 2] FIG. 1 shows an overview of Lb05_D13_Abs_c1_1 and short chains No. 11, 12, 13, 27, and 28 derived therefrom, as well as sensorgrams showing the results of analyzing the binding activity of these sequences to DENV-VLP. [Figure 3] FIG. 1 shows the cleavage site in No. 28 and a sensorgram showing the results of analyzing the binding activity of the cleaved sequences Nos. 46 to 51 to DENV-VLP. [Figure 4] FIG. 1 shows the cleavage site in No. 49 and a sensorgram showing the results of analyzing the binding activity of the cleaved sequences Nos. 56 to 65 to DENV-VLP. [Figure 5] FIG. 1 shows the cleavage site in No. 62 and a sensorgram showing the results of analyzing the binding activity of the cleaved sequences Nos. 66 to 89 to DENV-VLP. [Figure 6] FIG. 1 shows the cleavage site in No. 76 and a sensorgram showing the results of analyzing the binding activity of the cleaved sequences Nos. 90 to 98 to DENV-VLP. [Figure 7] FIG. 1 shows the cleavage site in No. 62 and a sensorgram showing the results of analyzing the binding activity of the cleaved sequences Nos. 99 to 106 to DENV-VLP. [Figure 8] FIG. 1 shows the cleavage site in No. 49 and a sensorgram showing the results of analyzing the binding activity of the cleaved sequences Nos. 107 to 115 to DENV-VLP. [Figure 9] This is a sensorgram showing the results of analyzing the binding activity of partially randomized No. 62 to DENV-VLP. [Figure 10] This figure shows an overview of D_26_1, the sequence in which the stem sequence at its terminal has been shortened (D_26_1_0_S), and substitution products based on this sequence, as well as sensorgrams showing the results of analyzing the binding activity of these sequences to DENV-VLP. [Figure 11] This figure shows an overview of the sequence substitution variant of D_26_1_5_S (D_26_1_5_L (=D_26_1_15)), a sensorgram showing the results of analyzing the binding activity of the substitution variant to DENV-VLP and its competitiveness with 4G2 monoclonal antibody, and a graph showing the results of quantifying the competitiveness. [Figure 12] FIG. 1 shows an overview of sequence substitutions of D_26_1_5_L (=D_26_1_15) and sensorgrams showing the results of analyzing the binding activity of the substitutions to DENV-VLP. [Figure 13] This figure shows an overview of sequence substitutions of D_26_1_5_L (=D_26_1_15) and sensorgrams showing the results of analyzing the binding activity of these substitutions to DENV-VLP. The main purpose of this figure is to verify the No. 16 aptamer, and in addition, the results of re-examining and evaluating the aptamers that did not appear to be properly immobilized on the sensor chip used for SPR analysis in Figure 12 are also shown. Therefore, all aptamers except No. 16 are overlapping in Figure 12 and Figure 13. Furthermore, the binding results in Figure 13 for No. 14 are considered to be correct. [Figure 14] This is a diagram showing an overview of the substitution product of D_26_1_5_L (=D_26_1_15). [Figure 15] This figure shows an overview of 12 sequences that underwent further sequence substitution based on "No. 16," which has the highest binding activity among the optimized sequences based on D_26_1_5_L (=D_26_1_15), and sensorgrams showing the results of analyzing the binding activity of these substitutions against DENV-VLP. [Figure 16]This figure shows an overview of four sequences that underwent further sequence substitution based on the substitution product "No. 3" of D_26_1_5_L (=D_26_1_15), and sensorgrams showing the results of analyzing the binding activity of these substitution products against DENV-VLP. [Figure 17] This figure shows an outline of four sequences that were further substituted based on the substitution product "No. 3" of D_26_1_5_L (=D_26_1_15). [Figure 18] This figure shows an overview of the sequence "No. 3 (D_26_1_5_LA11CU38G)" which has been substituted with bases based on D_26_1_5_L (=D_26_1_15), a sensorgram showing the results of analyzing the competitiveness of the substituted product with the 4G2 monoclonal antibody, and a graph showing the results of analyzing the neutralizing activity of the substituted product. [Figure 19] FIG. 1 shows an overview of the sites where 2'OMe sugar chain modifications were added in D_26_1_5_L. [Figure 20] FIG. 1 shows an outline of the site where further 2'OMe sugar chain modification was added in glycosylated derivative No. 11 of D_26_1_5_L, and an outline of the site where 2'OMe sugar chain modification was added in the corresponding substitution product, D_26_1_5_LA11CU38G. [Figure 21] FIG. 1 shows an outline of the sites where further 2'OMe sugar chain modifications were added in glycosylated derivative No. 14 of D_26_1_5_LA11CU38G. [Figure 22] FIG. 1 shows an outline of the sites where further 2'OMe sugar chain modifications were added in glycosylated derivative No. 14 of D_26_1_5_LA11CU38G. [Figure 23] FIG. 1 shows an outline of the sites where further 2'OMe sugar chain modifications were added in glycosylated derivative No. 14 of D_26_1_5_LA11CU38G. [Figure 24] FIG. 1 shows an outline of the sites where further 2'OMe sugar chain modifications were added in glycosylated derivative No. 14 of D_26_1_5_LA11CU38G. [Figure 25]FIG. 1 shows an outline of the sites where further 2'OMe sugar chain modifications were added in glycosylated derivative No. 14 of D_26_1_5_LA11CU38G. [Figure 26] FIG. 10 shows an outline of the site where further 2'OMe sugar chain modification was added in glycosylated derivative No. 23 of D_26_1_5_LA11CU38G. [Figure 27] FIG. 10 shows an outline of the site where further 2'OMe sugar chain modification was added in glycosylated derivative No. 23 of D_26_1_5_LA11CU38G. [Figure 28] FIG. 10 shows an outline of the site where further 2'OMe sugar chain modification was added in glycosylated derivative No. 23 of D_26_1_5_LA11CU38G. [Figure 29] FIG. 10 shows an outline of the sites where further 2'OMe sugar chain modifications were added in glycosylated derivative No. 41 of D_26_1_5_LA11CU38G. [Figure 30] FIG. 10 shows an outline of the sites where further 2'OMe sugar chain modifications were added in glycosylated derivative No. 41 of D_26_1_5_LA11CU38G. [Figure 31] FIG. 10 shows an outline of the sites where further 2'OMe sugar chain modifications were added in glycosylated derivative No. 41 of D_26_1_5_LA11CU38G. [Figure 32] FIG. 10 shows an outline of the sites where further 2'OMe sugar chain modifications were added in glycosylated derivative No. 41 of D_26_1_5_LA11CU38G. [Figure 33] This figure shows an overview of glycosylated derivative No. 41 of D_26_1_5_LA11CU38G, a sensorgram showing the results of analyzing the competitiveness of the glycosylated derivative with the 4G2 monoclonal antibody, whose terminal has been modified with polyethylene glycol (PEG), and a graph showing the results of quantifying the competitiveness. [Figure 34] FIG. 1 shows an overview of Freq-raw_5 and Freq-log_3, and sensorgrams showing the results of analyzing the binding activity of these sequences to DENV-VLP. [Figure 35]FIG. 1 shows an overview of the shortened sequences of Freq-raw_5 and Freq-log_3 (Freq-raw_5_s, Freq-log_3_s), and sensorgrams showing the results of analyzing the binding activity of these sequences to DENV-VLP. [Figure 36] This figure shows an overview of "Freq-raw_5_log_3_S", in which one base has been inserted into Freq-raw_5, and a sensorgram showing the results of analyzing the binding activity of this sequence to DENV-VLP. [Figure 37] This is a sensorgram showing the results of analyzing the binding activity to DENV-VLPs, although the results were partially randomized based on Freq-raw_5_log_3_S. [Figure 38] This is a sensorgram showing the results of analyzing the binding activity to DENV-VLPs, although the results were partially randomized based on Freq-raw_5_log_3_S. [Figure 39] FIG. 1 shows an outline of a shortened sequence based on a substitution product of Freq-raw_5_log_3_S (Freq-raw5_log3_c20_1 (Clone No. d10)). [Figure 40] 10 is a sensorgram showing the results of analyzing the binding activity of shortened sequences of Freq-raw5_log3_c20_1 to DENV-VLP. [Figure 41] FIG. 1 shows an outline of the sequence substitutions further made to the shortened sequence of Freq-raw5_log3_c20_1 (Freq_raw5_log3_c20_1_54_dU15), and sensorgrams showing the results of analyzing the binding activity of these sequence substitutions to DENV-VLP. [Figure 42] FIG. 1 shows an overview of the sequence substitution (M2: Freq_raw5_log3_c20_1_54_dU15_C16GG33U) further performed on the sequence substitution variant (s2: Freq_raw5_log3_c20_1_54_dU15) of Freq_raw5_log3_c20_1_54_dU15, and a sensorgram showing the results of analyzing the binding activity of the sequence substitution variant to DENV-VLP. [Figure 43] FIG. 1 shows an overview of the sites where 2'OMe sugar chain modifications were added in Freq_raw5_log3_c20_1_54_dU15_C16GG33U. [Figure 44] FIG. 1 shows an overview of the sites where 2'OMe sugar chain modifications were added in Freq_raw5_log3_c20_1_54_dU15_C16GG33U. [Figure 45] FIG. 1 shows an overview of the sites where 2'OMe sugar chain modifications were added in Freq_raw5_log3_c20_1_54_dU15_C16GG33U. [Figure 46] FIG. 1 shows an overview of the sites where 2'OMe sugar chain modifications were added in Freq_raw5_log3_c20_1_54_dU15_C16GG33U. [Figure 47] FIG. 1 shows an overview of the sites where 2'OMe sugar chain modifications were added in Freq_raw5_log3_c20_1_54_dU15_C16GG33U. [Figure 48] FIG. 1 shows an overview of the sites where 2'OMe sugar chain modifications were added in Freq_raw5_log3_c20_1_54_dU15_C16GG33U. [Figure 49] This figure shows an overview of candidate 1 (glycosylated derivative No. 41 of D_26_1_5_LA11CU38G) and candidate 2 (glycosylated derivative No. 17 of Freq_raw5_log3_c20_1_54_dU15_C16GG33U), sensorgrams showing the results of analyzing the competitiveness of these glycosylated derivatives with 4G2 monoclonal antibody, and a graph showing the results of quantifying the competitiveness. [Figure 50]This figure shows an overview of ALL (a summary of the characteristics of all sequences for which binding activity was confirmed during the entire process of identifying candidate 1 (D_26_1_5_L_A11CU38G) and candidate 2 (Freq_raw5_log3_c20_1_54_dU15_C16GG33U)) and Lb05 (Lb05N40: a summary of the characteristics of all sequences for which binding activity was observed during the identification of a group of sequences for creating a doped library leading to candidate 1 and candidate 2). [Figure 51] FIG. 1 shows an overview of the characteristics of all sequences (1st Doped, 2nd Doped) in which binding activity was observed in Doped-SELEX performed to identify Candidate 1 and Candidate 2. [Figure 52] This figure shows an overview of the characteristics of all sequences (D_26 series (candidate1 series), Freq_raw5_log3 series (candidate2 series)) for which binding activity was confirmed in the process of identifying candidate 1 (D_26_1_5_L_A11CU38G) and candidate 2 (Freq_raw5_log3_c20_1_54_dU15_C16GG33U). [Figure 53] This figure shows an overview of the combined sequence of the D_26 series and Freq_raw5_log3 series (D_26 & Freq_raw5_log 3 series (candidate1&2 series)). [Figure 54] 1 shows sensorgrams illustrating the results of analyzing the binding activity of Candidate 1 (D_26_1_5_LA11CU38G) to VLPs corresponding to all serotypes of dengue virus (DENV1 to DENV4) and to VLPs of Japanese encephalitis virus (JEV). [Figure 55] 10 shows sensorgrams illustrating the results of analyzing the competitiveness of Candidate 1 (D_26_1_5_LA11CU38G) with the 4G2 monoclonal antibody. [Figure 56]This figure shows an overview of a glycosylated form of Candidate 1 (No. 41) and a dimer (bivalent form) formed by linking two of these glycosylated forms, as well as a graph showing the results of analyzing their neutralizing activity against DENV2. [Figure 57] 10 shows a graph illustrating the results of analyzing the neutralizing activity of a glycosylated form of Candidate 1 (No. 41) and its dimer against DENV1 to DENV4. [Figure 58] 1 is a graph showing the results of PRNT analysis of the glycosylated form of Candidate 1 (No. 41) and its dimer, performed using BHK cells overexpressing Fc-gamma receptor in the presence of 4G2 monoclonal antibody. [Figure 59] 1 shows a sensorgram illustrating the results of analyzing the binding activity of Candidate 1 to DENV1-VLP. [Figure 60] 1 is a sensorgram showing the results of analyzing the binding activity of Candidate 1 to DENV3 envelope protein (ENV). DETAILED DESCRIPTION OF THE INVENTION

[0026] <Aptamer> The present invention relates to an aptamer for flavivirus. The term "aptamer" refers to a nucleotide molecule that has binding activity to a specific target molecule. An aptamer can inhibit the activity of a specific target molecule by binding to the specific target molecule. The aptamer of the present invention is an aptamer that has binding activity to flavivirus. It may also be an aptamer that can exhibit neutralizing activity against flavivirus. The aptamer of the present invention may also be RNA, DNA, modified nucleic acid, or a mixture thereof.

[0027] The flavivirus targeted by the aptamer of the present invention will be described later. Examples of the "flavivirus site" to which the aptamer of the present invention binds include a flavivirus membrane protein (E protein, involved in receptor binding and membrane fusion) from the viewpoint of exhibiting the neutralizing activity described below. The "binding activity" with the flavivirus is not particularly limited, but may be a dissociation constant (K D ), preferably 1 × 10 -8 M~1×10 -11 M, and more preferably 1×10 -9 M~5×10 -11 M. Note that K D is calculated from ka (association rate constant) and kd (dissociation rate constant) (K D = kd / ka). ka and kd are rate constants in the binding / dissociation reaction between two molecules, and can be determined by, for example, surface plasmon resonance (SPR) measurements, as shown in the Examples below. SPR measurements of the binding between an aptamer and a target molecule are well known, and those skilled in the art can determine the ka and kd of an aptamer based on such well-known techniques, and can also determine the K D can be calculated.

[0028] In the present invention, the term "neutralizing activity" refers to the activity of suppressing flavivirus infection, and can be evaluated by, for example, a plaque reduction neutralization test (PRNT) analysis, as shown in the Examples below. 50is preferably 5000 nM or less, more preferably 1000 nM or less, even more preferably 500 nM or less, more preferably 200 nM or less, even more preferably 100 nM or less, more preferably 50 nM or less, even more preferably 30 nM or less, more preferably 10 nM or less, even more preferably 5 nM or less, more preferably 2 nM or less, even more preferably 1 nM or less, and even more preferably 0.5 nM or less. Furthermore, the "neutralizing activity" according to the present invention can be evaluated using competitive inhibitory activity against a flavivirus neutralizing antibody (e.g., 4G2 monoclonal antibody) as an index, as shown in the Examples below. Such competitive inhibitory activity is expressed as IC for the aptamer of the present invention. 50 is preferably 10 nM or less, more preferably 5 nM or less, further preferably 3 nM or less, and more preferably 2 nM or less.

[0029] Furthermore, as will be shown in the Examples below, it is desirable that the aptamer of the present invention does not have antibody-dependent enhancement (ADE) activity.

[0030] The "length" of the aptamer of the present invention is not particularly limited, but may typically be 25 to 200 nucleotides per monomer (monovalent form), for example, 100 nucleotides or less, preferably 80 nucleotides or less, more preferably 60 nucleotides or less, and even more preferably 56 nucleotides or less (e.g., 55 nucleotides or less, 54 nucleotides or less, 53 nucleotides or less). A smaller total number of nucleotides facilitates chemical synthesis and mass production, and also offers significant cost benefits. Furthermore, chemical modification is easier, in vivo stability tends to be higher, and toxicity tends to be lower. Meanwhile, the length of the aptamer of the present invention is preferably about 30 nucleotides or more, more preferably about 40 nucleotides or more, and even more preferably 50 nucleotides or more (e.g., 51 nucleotides or more, 52 nucleotides or more, 53 nucleotides or more, 54 nucleotides or more, 55 nucleotides or more, 56 nucleotides or more). If the total number of nucleotides is too small, the potential tertiary structure becomes unstable, and in some cases, the aptamer may not have activity.

[0031] As shown in the Examples below, the "sequence" of the aptamer of the present invention is, for example, (A) an aptamer for a flavivirus, comprising the nucleotide sequence set forth in SEQ ID NO: 1 (however, at least one nucleotide may be deleted from the nucleotide sequence set forth in SEQ ID NO: 1 at positions 3 to 8, 10 to 16, 18 to 22, 24 to 29, 35 to 43, 46 to 47, and 51 to 54. The number of deleted nucleotides is preferably 10 or less, more preferably 6 or less, and even more preferably 5 or less (for example, 5, 4, 3, 2, or 1)), (B) an aptamer for a flavivirus, comprising the nucleotide sequence set forth in SEQ ID NO: 2 (wherein at least one nucleotide may be deleted from positions 3 to 7, 10 to 16, 18, 20 to 22, 24 to 29, 35 to 43, 46 to 47, and 51 to 54 in the nucleotide sequence set forth in SEQ ID NO: 2. The number of deleted nucleotides is preferably 10 or less, more preferably 6 or less, and even more preferably 5 or less (for example, 5, 4, 3, 2, or 1)), (C) an aptamer for a flavivirus, comprising the nucleotide sequence set forth in SEQ ID NO: 3 (however, at least one nucleotide may be deleted at positions 15, 18 to 21, 24, and 34 in the nucleotide sequence set forth in SEQ ID NO: 3. The number of deleted nucleotides is preferably 7 or less, more preferably 6 or less, and even more preferably 5 or less (for example, 5, 4, 3, 2, or 1)), (D) an aptamer for a flavivirus, comprising the nucleotide sequence set forth in SEQ ID NO: 4 (however, at least one nucleotide may be deleted at positions 8, 15, 16, 20, and 21 in the nucleotide sequence set forth in SEQ ID NO: 4. The number of deleted nucleotides is preferably 5 or less (for example, 5, 4, 3, 2, or 1)); (E) an aptamer for flavivirus, comprising the nucleotide sequence set forth in SEQ ID NO: 5 (however, at least one nucleotide may be deleted at positions 20 and 21 in the nucleotide sequence set forth in SEQ ID NO: 5. The number of deleted nucleotides is preferably two or less (e.g., two or one)); (F) an aptamer for a flavivirus, comprising the nucleotide sequence set forth in SEQ ID NO: 7 (however, at least one nucleotide may be deleted from the nucleotide sequence set forth in SEQ ID NO: 7 at positions 11, 12, 14 to 16, 18 to 22, 24, 27, 28, 35, and 36. The number of deleted nucleotides is preferably 10 or less, more preferably 6 or less, and even more preferably 5 or less (for example, 5, 4, 3, 2, or 1)), (G) an aptamer for flavivirus, comprising the nucleotide sequence set forth in SEQ ID NO: 8 (however, at least one nucleotide may be deleted at positions 15, 18 to 20, and 33 in the nucleotide sequence set forth in SEQ ID NO: 8. The number of deleted nucleotides is preferably 5 or less (for example, 5, 4, 3, 2, or 1)); (H) an aptamer against flavivirus, comprising the nucleotide sequence set forth in SEQ ID NO: 6; (I) An aptamer against flavivirus, comprising the nucleotide sequence set forth in SEQ ID NO: 9 The following are some of the reasons:

[0032] In the nucleotide sequences of SEQ ID NOs: 1 to 9, each T independently represents thymine or uracil, each M independently represents adenine or cytosine, each R independently represents adenine or guanine, each W independently represents adenine, thymine, or uracil, each S independently represents cytosine or guanine, each Y independently represents cytosine, thymine, or uracil, and each K independently represents each V independently represents adenine, cytosine, or guanine; each H independently represents adenine, cytosine, thymine, or uracil; each D independently represents adenine, guanine, thymine, or uracil; each B independently represents cytosine, guanine, thymine, or uracil; and each N independently represents adenine, cytosine, guanine, thymine, or uracil.

[0033] The aptamer of the present invention may be one in which the sugar residue (e.g., ribose) of each constituent nucleotide is "modified" to enhance binding affinity to flavivirus, stability, drug delivery, etc. Such modified nucleotides include, for example, nucleotides in which an atom or group at at least one position selected from the 2'-, 3'-, and 4'-positions of the sugar residue is replaced with another atom or group. Examples of types of modification include fluorination, O-alkylation (e.g., O-methylation, O-ethylation), O-allylation, S-alkylation (e.g., S-methylation, S-ethylation), S-allylation, and amination (e.g., -NH2). Such modifications of sugar residues can be carried out by methods known per se (see, for example, Sproat et al., (1991) Nucle. Acid. Res. 19, 733-738; Cottonet et al., (1991) Nucl. Acid. Res. 19, 2629-2635; Hobbs et al., (1973) Biochemistry 12, 5138-5145).

[0034] In the aptamer of the present invention, all pyrimidine nucleotides are substituted at the 2'-position of ribose independently (either identically or differently), preferably with an atom or group selected from the group consisting of a hydrogen atom, a hydroxyl group, and a methoxy group. Specific examples of sugar modifications in the aptamer of the present invention are shown in Tables 12 and 13. Furthermore, those skilled in the art can select suitable sites and types of modifications for such sugar modifications by referring to the results shown in the Examples below (particularly Tables 12 and 13).

[0035] In this specification, the modification of the sugar residue in the nucleotide is described assuming that the nucleotide constituting the aptamer is RNA (i.e., the sugar residue is assumed to be ribose), but this does not mean that DNA is excluded from the nucleotides constituting the aptamer, and it can be interpreted as a modification to DNA as appropriate. For example, when the nucleotide constituting the aptamer is DNA, the substitution of the hydroxyl group at the 2'-position of ribose with another group or atom can be interpreted as the substitution of one of the hydrogen atoms at the 2'-position of deoxyribose with another atom or group.

[0036] Furthermore, sugar residues can be artificial nucleic acids such as bridged nucleic acid (BNA) (linked nucleic acid) that form a bridge at the 2' and 4' positions. Such modifications of sugar residues can also be carried out by known methods (see, for example, Tetrahedron Lett., 38, 8735-8738 (1997); Tetrahedron, 59, 5123-5128 (2003); Rahman S. M. A., Seki S., Obika S., Yoshikawa H., Miyashita K., Imanishi T., J. Am. Chem. Soc., 130, 4886-4896 (2008)).

[0037] The aptamers of the present invention may also be modified (e.g., chemically substituted) in the nucleic acid base (e.g., purine, pyrimidine) to enhance binding activity to a target molecule. Such modifications include, for example, modification of the pyrimidine at position 5, modification of the purine at positions 6 and / or 8, modification with an exocyclic amine, substitution with 4-thiouridine, and substitution with 5-bromo- or 5-iodo-uracil. Furthermore, the phosphate group contained in the aptamer of the present invention may be modified to impart resistance to nucleases and hydrolysis, or to enhance binding activity to a target molecule. For example, the phosphate group P(O)O group may be substituted with P(O)S (thioate), P(S)S (dithioate), P(O)NR (amidate), P(O)R, R(O)OR', CO, CH (formacetal), or 3'-amine (-NH-CH-CH-) (wherein each R or R' is independently H or a substituted or unsubstituted alkyl (e.g., methyl, ethyl)). Among these, phosphorothioated or phosphorodithioated aptamers are preferred, in which at least one phosphate group P(O)O group is substituted with P(O)S (thioate) or P(S)S (dithioate). The activity of the aptamer of the present invention can be improved by phosphorothioating or phosphorodithioating at least one of the phosphate groups contained in the aptamer. Modifications may also include 3' and 5' modifications, such as capping.

[0038] The aptamers of the present invention can bind to target molecules through a variety of binding modes, including ionic bonds utilizing the negative charge of phosphate groups, hydrophobic and hydrogen bonds utilizing ribose, and hydrogen bonds and stacking interactions utilizing nucleic acid bases. In particular, ionic bonds utilizing the negative charges of the phosphate groups present in the same number as the constituent nucleotides are strong and bind to the positive charges of lysine and arginine present on the surface of proteins. Therefore, nucleic acid bases not involved in direct binding with target substances can be substituted. Regarding modification of the 2' position of ribose, although the functional group at the 2' position of ribose occasionally interacts directly with the target molecule, in many cases it is unrelated and can be replaced with other modified molecules. Thus, aptamers often retain their activity unless the functional group involved in direct binding with the target molecule is replaced or deleted. It is also important that the overall three-dimensional structure does not change significantly.

[0039] In addition to the sugar modifications, the aptamers of the present invention may be modified with polyethylene glycol (PEG), amino acids, peptides, inverted dT, nucleic acids, nucleosides, myristoyl, lithocolic-oleyl, docosanyl, lauroyl, steeroyl, palmitoyl, oleoyl, linoleoyl, other lipids, steroids, cholesterol, caffeine, vitamins, dyes, fluorescent substances, anticancer drugs, toxins, enzymes, radioactive substances, biotin, and the like. The attachment site is not particularly limited, but is typically the 5'-end and / or 3'-end of the aptamer of the present invention. If necessary, the substance may be attached to the aptamer of the present invention via a linker. Examples of such linkers include nucleotide linkers, peptide linkers, and linkers containing -SS- (disulfide) bonds. Such modifications can be performed with reference to, for example, U.S. Patent Nos. 5,660,985 and 5,756,703.

[0040] In particular, when the modification of the aptamer of the present invention is carried out by terminal addition of PEG, the molecular weight of PEG is not particularly limited, but is preferably 1,000 to 100,000, more preferably 30,000 to 90,000. PEG may be linear or may be branched into two or more chains (branched PEG, multi-arm PEG). Such PEG is not particularly limited, and those skilled in the art can appropriately select and use commercially available or known PEG (see, for example, http: / / www.peg-drug.com / peg_product / branched.html). However, specific examples of suitable PEG to be applied to the aptamer of the present invention include branched PEG with a molecular weight of 40,000 (SKU: Y-NHS-40K, manufactured by Jenkem Technology), bibranched GS PEG with a molecular weight of 40,000 (SUNBRIGHT GL2-400GS, manufactured by NOF Corp.), bibranched TS PEG with a molecular weight of 40,000 (SUNBRIGHT GL2-400TS, manufactured by NOF Corp.), tetrabranched TS PEG with a molecular weight of 40,000 (SUNBRIGHT GL4-400TS, manufactured by NOF Corp.), bibranched TS PEG with a molecular weight of 80,000 (SUNBRIGHT GL2-800TS, manufactured by NOF Corp.), and tetrabranched TS PEG with a molecular weight of 80,000 (SUNBRIGHT GL4-400TS, manufactured by NOF Corp.). Examples of suitable linkers include PEG (GL4-800TS, manufactured by NOF Corp.). The method for attaching PEG to the aptamer of the present invention is not particularly limited, and attachment can be performed via a linker appropriately selected according to the attachment site, the type of PEG, and the like. Examples of such linkers include linkers having an amino group. Specific examples include ssH Linker (SAFC) and DMS(O)MT-AMINO-MODIFIER (GLENRESEARCH) when attaching to the 5' end, and TFA Amino C-6 lcaa CPG (ChemGenes) when attaching to the 3' end. When such a linker is selected, the aptamer of the present invention can be linked to PEG via the linker by adding an active group, for example, N-hydroxysuccinimide, to PEG and then reacting this with the amino group on the linker.

[0041] Examples of "secondary structures" that the aptamer of the present invention can have include, for example, as shown in the Examples described below (Figures 50 to 53, etc.), in the nucleotide sequence set forth in SEQ ID NO: 1, a stem structure in which nucleotides 1 to 5 are paired with nucleotides 56 to 52, a loop structure formed by nucleotides 6 and 51, a stem structure in which nucleotides 7 and 8 are paired with nucleotides 50 to 49, a loop structure formed by nucleotides 48 to 44, a stem structure in which nucleotides 9 to 19 are paired with nucleotides 43 to 33 (including some bulge-out residues), and a loop structure formed by nucleotides 20 to 32. In general, in the art, a region containing a loop structure formed by nucleotides 6 and 51 is also referred to as an internal loop, a region containing a loop structure formed by nucleotides 48 to 44 is also referred to as a bulge loop, and a region containing a loop structure formed by nucleotides 20 to 32 is also referred to as a hairpin loop.

[0042] Furthermore, as shown in the Examples below, the aptamer of the present invention may be a "multimer." Such a multimer is formed by linking at least one sequence selected from the sequences (monomers) described in (A) to (I) above. The number of sequences to be linked is not particularly limited, but is two or more (e.g., 2, 3, 4, or 5). The types of sequences to be linked may all be the same sequence (e.g., a homomultimer. More specifically, a homomultimer formed by linking multiple nucleotide sequences described in SEQ ID NO: 6) or different sequences (e.g., a heteromultimer. More specifically, a heteromultimer formed by linking multiple nucleotide sequences described in SEQ ID NO: 6 and SEQ ID NO: 9). Furthermore, the aptamer may be a multimer formed by linking multiple aptamers (monomers) having the same sequence but different modifications. Such linking is usually performed in tandem. A linker may be used for linking. Such linkers include nucleotide chains (e.g., 1 to about 20 nucleotides) and non-nucleotide chains (e.g., -(CH2)n- linker, -(CH2CHO)n- linker, hexaethylene glycol linker, TEG linker, peptide linker, linker containing an -SS- bond, linker containing a -CONH- bond, linker containing an -OPO3- bond).

[0043] The aptamers of the present invention can be synthesized by methods known in the art. One synthesis method uses RNA polymerase. DNA containing a target sequence and an RNA polymerase promoter sequence is chemically synthesized, and the target RNA can be obtained by using this as a template and transcribing it using a known method. Synthesis can also be performed using DNA polymerase. DNA containing a target sequence is chemically synthesized and amplified using the template by the known polymerase chain reaction (PCR). This is then converted into a single-stranded strand by known methods such as polyacrylamide electrophoresis or enzymatic treatment. When synthesizing a modified aptamer, the efficiency of the extension reaction can be increased by using a polymerase with a mutation introduced at a specific position. The aptamer obtained in this manner can be easily purified using known methods.

[0044] The aptamers of the present invention can be synthesized in large quantities by chemical synthesis methods such as the amidite method and the phosphoramidite method. The synthesis methods are well known and are as described in Nucleic Acid (Vol. 2) [1] Synthesis and Analysis of Nucleic Acid (Editor: Yukio Sugiura, Hirokawa Publishing Company), etc. More specifically, the aptamers of the present invention can be prepared using an automated oligonucleotide synthesizer such as OligoPilot 100 or OligoProCeSS manufactured by Cytiva, Inc., and purification by known methods such as chromatography.

[0045] A functional substance can be added to the aptamer of the present invention after synthesis by introducing an active group such as an amino group during chemical synthesis by the phosphoramidite method, etc. For example, by introducing an amino group to the terminus of the aptamer, a polyethylene glycol chain having a carboxyl group introduced therein can be condensed.

[0046] The aptamers of the present invention can be prepared using the SELEX method and its modifications (e.g., Ellington et al., (1990) Nature, 346, 818-822; Tuerk et al., (1990) Science, 249, 505-510). In the SELEX method, aptamers with stronger binding affinity to the target molecule are enriched and selected by increasing the number of rounds or using a competing substance, thereby making the selection conditions more stringent. Therefore, by adjusting the number of SELEX rounds and / or changing the competitive conditions, it may be possible to obtain aptamers with different binding affinity, aptamers with different binding forms, or aptamers with the same binding affinity or binding form but different nucleotide sequences. Furthermore, the SELEX method includes a PCR amplification process, and introducing mutations during this process, for example by using manganese ions, can enable SELEX with greater diversity.

[0047] The present invention also provides a complex comprising the aptamer of the present invention and a functional substance bound thereto (hereinafter also referred to as the "complex of the present invention"). The bond between the aptamer and the functional substance in the complex of the present invention can be a covalent bond or a non-covalent bond. The complex of the present invention can be one in which the aptamer of the present invention is bound to one or more (e.g., two or three) functional substances of the same or different types. The functional substance is not particularly limited, as long as it can newly add some function to the aptamer of the present invention or can change (e.g., improve) some property that the aptamer of the present invention can possess. Examples of functional substances include proteins, peptides, amino acids, lipids, carbohydrates, monosaccharides, polynucleotides, and nucleotides.The functional substance may also be, for example, an affinity substance (e.g., biotin, streptavidin, a polynucleotide having affinity for a target complementary sequence, an antibody, glutathione sepharose, histidine), a labeling substance (e.g., a fluorescent substance, a luminescent substance, a radioisotope), an enzyme (e.g., horseradish peroxidase, alkaline phosphatase), a drug delivery vehicle (e.g., a liposome, a microsphere, a peptide, a polyethylene glycol), a drug (e.g., those used in missile therapy such as calicheamicin and duocarmycin, nitrogen mustard analogs such as cyclophosphamide, melphalan, ifosfamide, or trofosfamide, ethyleneimines such as thiotepa, nitrosoureas such as carmustine, alkylating agents such as temozolomide or dacarbazine, methotrexate, or These include folate-like antimetabolites such as raltitrexed, purine analogs such as thioguanine, cladribine, or fludarabine, pyrimidine analogs such as fluorouracil, tegafur, or gemcitabine, vinca alkaloids and their analogs such as vinblastine, vincristine, or vinorelbine, etoposide, taxanes, podophyllotoxin derivatives such as docetaxel or paclitaxel, anthracyclines and analogs such as doxorubicin, epirubicin, idarubicin, and mitoxantrone, other cytotoxic antibiotics such as bleomycin and mitomycin, platinum compounds such as cisplatin, carboplatin, and oxaliplatin, pentostatin, miltefosine, estramustine, topotecan, irinotecan, and bicalutamide, and toxins (e.g., ricin toxin, riatoxin, and verotoxin). These functional molecules may eventually be removed. Furthermore, the nucleic acid may be a peptide that can be recognized and cleaved by an enzyme such as thrombin, matrix metalloproteinase (MMP) or Factor X, or a polynucleotide that can be cleaved by a nuclease or restriction enzyme.

[0048] (Pharmaceutical composition) As shown in the Examples below, the aptamer of the present invention suppresses flavivirus infection. Therefore, the present invention provides a pharmaceutical composition for treating or preventing flavivirus infection, comprising the above-mentioned aptamer, etc.

[0049] In the present invention, the term "flavivirus" refers to a virus belonging to the genus Flavivirus in the family Flaviviridae, and examples thereof include dengue virus (DENV), Japanese encephalitis virus (JEV), Zika virus (ZIKV), tick-borne encephalitis virus (TBEV), yellow fever virus (YFV), West Nile virus (WNV), St. Louis encephalitis virus (SLEV), Murray Valley encephalitis virus (MVEV), Omsk hemorrhagic fever virus, and Kyasanur Forest Disease virus. Furthermore, there are no particular limitations on the serotype of such flaviviruses, and as will be shown in the Examples below, all serotypes of DENV (DENV1 to DENV4) can be targets of the present invention.

[0050] In the present invention, "flavivirus infection" refers to symptoms associated with flavivirus infection, and more specifically includes fever, headache, viremia, hemorrhage, hemorrhagic fever, increased vascular permeability, thrombocytopenia, encephalitis, meningitis, encephalitis, etc. In the present invention, "treatment" includes recovery, improvement, and inhibition of progression of the symptoms, and "prevention" includes inhibition of flavivirus infection and inhibition of recurrence of the symptoms, etc.

[0051] The pharmaceutical composition of the present invention may contain a pharmaceutically acceptable carrier in addition to the aptamer of the present invention as an active ingredient. Examples of the "pharmaceutically acceptable carrier" include excipients such as sucrose, starch, mannitol, sorbitol, lactose, glucose, cellulose, talc, calcium phosphate, and calcium carbonate, binders such as cellulose, methylcellulose, hydroxypropylcellulose, polypropylpyrrolidone, gelatin, gum arabic, polyethylene glycol, sucrose, and starch, disintegrants such as starch, carboxymethylcellulose, hydroxypropyl starch, sodium glycol-starch, sodium bicarbonate, calcium phosphate, and calcium citrate, and magnesium stearate. These include, but are not limited to, lubricants such as aerosil, talc, sodium lauryl sulfate, fragrances such as citric acid, menthol, glycyrrhizin ammonium salt, glycine, orange powder, preservatives such as sodium benzoate, sodium bisulfite, methylparaben, propylparaben, stabilizers such as citric acid, sodium citrate, acetic acid, suspending agents such as methylcellulose, polyvinylpyrrolidone, aluminum stearate, dispersing agents such as surfactants, diluents such as water, saline, orange juice, and base waxes such as cocoa butter, polyethylene glycol, and white kerosene.

[0052] The route of administration of the pharmaceutical composition of the present invention is not particularly limited, but examples thereof include oral administration and parenteral administration.

[0053] Suitable formulations for "oral administration" include liquid preparations in which an effective amount of the aptamer of the present invention is dissolved in a diluent such as water or saline; capsules, sachets, or tablets containing an effective amount of the aptamer of the present invention as a solid or granule; suspensions in which an effective amount of the aptamer of the present invention is suspended in a suitable dispersant; emulsions in which a solution in which an effective amount of the aptamer of the present invention is dissolved is dispersed and emulsified in a suitable dispersant; and C10, which promotes the absorption of water-soluble substances.

[0054] Furthermore, the pharmaceutical composition of the present invention can be coated by known methods, if necessary, for purposes such as taste masking, enteric coating, or sustained release. Examples of coating agents used for coating include hydroxypropylmethylcellulose, ethylcellulose, hydroxymethylcellulose, hydroxypropylcellulose, polyoxyethylene glycol, Tween 80, Pluronic (registered trademark) F68, cellulose acetate phthalate, hydroxypropylmethylcellulose phthalate, hydroxymethylcellulose acetate succinate, Eudragit (manufactured by Rohm, Germany, methacrylic acid-acrylic acid copolymer), and dyes (e.g., red iron oxide, titanium dioxide, etc.). The pharmaceutical composition may be in either an immediate-release or sustained-release formulation.

[0055] "Parenteral administration" includes, for example, intravenous administration, subcutaneous administration, intramuscular administration, topical administration, intraperitoneal administration, and nasal administration. Suitable formulations for parenteral administration include aqueous and non-aqueous isotonic sterile injection solutions, which may contain antioxidants, buffers, bacteriostats, isotonicity agents, etc. Also included are aqueous and non-aqueous sterile suspensions, which may contain suspending agents, solubilizers, thickeners, stabilizers, preservatives, etc. Such formulations can be packaged in unit doses or multiple doses in containers such as ampoules or vials. Alternatively, the active ingredient and a pharmaceutically acceptable carrier can be freeze-dried and stored in a state in which they can be dissolved or suspended in an appropriate sterile solvent immediately before use.

[0056] Sustained-release formulations are also suitable. Examples of the dosage form of sustained-release formulations include sustained-release forms using biodegradable substrates. Examples of biodegradable substrates include liposomes, cationic liposomes, poly(lactic-co-glycolic) acid (PLGA), atelocollagen, gelatin, hydroxyapatite, and the polysaccharide schizophyllan. Devices that deliver drugs continuously or intermittently from outside the body to the body or locally, such as drug pumps and osmotic pumps, can also be used as sustained-release formulations.

[0057] Furthermore, in addition to the above-mentioned injection solutions, suspensions and sustained-release preparations, inhalants suitable for pulmonary administration, ointments suitable for transdermal administration and the like can also be used.

[0058] In the case of inhalants, the freeze-dried active ingredient is pulverized and administered by inhalation using an appropriate inhalation device. Inhalants can also contain surfactants, oils, seasonings, cyclodextrin or its derivatives, etc., as needed. Inhalants can be manufactured according to conventional methods. That is, the aptamer of the present invention can be made into a powder or liquid form, blended with an inhalation propellant and / or carrier, and then filled into an appropriate inhalation container. Furthermore, when the aptamer of the present invention is in powder form, a conventional mechanical powder inhaler can be used, and when it is in liquid form, an inhaler such as a nebulizer can be used. Here, a wide range of conventionally known inhalation propellants can be used, including, for example, fluorocarbon compounds such as fluorocarbon-11, fluorocarbon-12, fluorocarbon-21, fluorocarbon-22, fluorocarbon-113, fluorocarbon-114, fluorocarbon-123, fluorocarbon-142c, fluorocarbon-134a, fluorocarbon-227, fluorocarbon-C318, and 1,1,1,2-tetrafluoroethane; hydrocarbons such as propane, isobutane, and n-butane; ethers such as diethyl ether; and compressed gases such as nitrogen gas and carbon dioxide gas.Examples of surfactants include oleic acid, lecithin, diethylene glycol dioleate, tetrahydrofurfuryl oleate, ethyl oleate, isopropyl myristate, glyceryl trioleate, glyceryl monolaurate, glyceryl monooleate, glyceryl monostearate, glyceryl monoricinoate, cetyl alcohol, stearyl alcohol, polyethylene glycol 400, cetylpyridinium chloride, sorbitan trioleate (trade name Span 85), sorbitan monooleate (trade name Span 80), sorbitan monolaurate (trade name Span 20), polyoxyethylene hydrogenated castor oil ( Examples of suitable oils include hydroxypropyl methylcellulose (HMC), ...

[0059] In the case of ointments, a suitable pharmaceutically acceptable base (yellow petrolatum, white petrolatum, paraffin, plastibase, silicone, white ointment, beeswax, lard, vegetable oil, hydrophilic ointment, hydrophilic petrolatum, purified lanolin, hydrous lanolin, water-absorbing ointment, hydrophilic plastibase, macrogol ointment, etc.) is used, mixed with the active ingredient, the aptamer of the present invention, and formulated for use.

[0060] The dosage of the pharmaceutical composition of the present invention varies depending on the form of the aptamer or composition of the present invention, the severity of symptoms, the animal species to be administered, the drug tolerance, body weight, age, etc. of the subject, but is usually 0.0001 to 100 mg / kg, for example 0.0001 to 10 mg / kg, and preferably about 0.005 to 1 mg / kg, of the active ingredient per day for an adult.

[0061] The present invention also provides a method for treating or preventing a flavivirus infection, comprising administering to a subject an effective amount of an aptamer of the present invention.

[0062] The "subject" of treatment, etc. in the present invention is not particularly limited and may be not only a human but also a non-human animal. The non-human animal is not particularly limited and may be various livestock, poultry, pets, laboratory animals, etc., but the subject of the present invention is usually a human and is not limited by gender, age, race, etc. More specifically, examples of the subject include humans who are at risk of infection with flavivirus, humans infected with flavivirus, and humans with a recurrence of flavivirus infection.

[0063] The administration method and dosage of the composition of the present invention are as described above. The administration schedule is also adjusted appropriately depending on the various factors described above, and may be a single administration or multiple continuous or periodic administrations. Furthermore, the severity of symptoms may be monitored after administration, and the timing of administration may be determined based on the results. The administration may be discontinued depending on the degree of recovery, but may be continued without discontinuation from the perspective of preventing recurrence. The term "continuous" may refer to daily administration or continuous administration at intervals.

[0064] Furthermore, the treatment method of the present invention may be used in combination with other known treatment methods. Such other treatment methods include QDENGA (Takeda Pharmaceuticals), CYD-TVD / Dengvaxia (Sanofi Pasteur), IC51 / IXIARO (WRAIR), JE-VAX (The Research Foundation for Microbial Disease of Osaka University), SA 14-14-2 (Chengdu Institute of Biological Product), IMOJEV / JE-CV (Sanofi Pasture), TBE-Moscow (Chumakov Institute of Poliomyelitis and Viral Encephalitides), EnceVir (Microgen), FSME-IMMUN (Baxter), Encepur (Novartis), YFV-17DD (Bio-Manguinhos (Fiocruz)), YFV-17D-204 (Sanofi Pasteur Institute) Chiron / Novartis), YFV-17D-213 (Federal State Unitary Enterprise of Chumakov) Examples of vaccines that may be used include, but are not limited to, vaccines such as those from the Institute (FDA-approved vaccines), JNJ-1802 (Janssen), and therapeutic drugs described in the literature (Antiviral Res. 2023 Feb:210:105517).

[0065] Although preferred embodiments of the present invention have been described above, the present invention is not limited to these embodiments. The present invention also provides, for example, a solid support on which the aptamer or complex of the present invention is immobilized. Examples of solid supports include substrates, resins, plates (e.g., multiwell plates), filters, cartridges, columns, and porous materials. Substrates can be those used in DNA chips, protein chips, etc., such as nickel-PTFE (polytetrafluoroethylene) substrates, glass substrates, apatite substrates, silicon substrates, and alumina substrates, including substrates coated with polymers. Examples of resins include agarose particles, silica particles, copolymers of acrylamide and N,N'-methylenebisacrylamide, polystyrene-crosslinked divinylbenzene particles, particles of dextran crosslinked with epichlorohydrin, cellulose fibers, crosslinked polymers of allyl dextran and N,N'-methylenebisacrylamide, monodisperse synthetic polymers, monodisperse hydrophilic polymers, Sepharose, and Toyopearl. These resins also include resins to which various functional groups are attached. The solid phase carrier of the present invention can be useful, for example, for detecting and quantifying flaviviruses.

[0066] The aptamer or complex of the present invention can be immobilized on a solid support by known methods. For example, one method involves introducing the affinity substance or a predetermined functional group into the aptamer or complex of the present invention, and then immobilizing the aptamer or complex on a solid support using the affinity substance or the predetermined functional group. The present invention also provides such a method. The predetermined functional group may be a functional group that can be subjected to a coupling reaction, such as an amino group, a thiol group, a hydroxyl group, or a carboxyl group. The present invention also provides an aptamer having such a functional group introduced therein.

[0067] The present invention also provides a method for purifying and concentrating a flavivirus. The purification and concentration method of the present invention may comprise adsorbing a flavivirus to a solid phase carrier of the present invention and eluting the adsorbed flavivirus with an elution solution. Adsorption of a flavivirus to a solid phase carrier of the present invention may be carried out by a known method. For example, a sample containing a flavivirus (e.g., blood from a flavivirus-infected individual) is introduced into a solid phase carrier of the present invention or a substance containing the solid phase carrier. The elution solution for eluting the flavivirus may be appropriately selected taking into account the known properties of the flavivirus. The purification and concentration method of the present invention may further comprise washing the solid phase carrier with a washing solution after adsorption of the flavivirus. The washing solution may be appropriately selected taking into account the known properties of the flavivirus. The purification and concentration method of the present invention may further comprise heat-treating the solid phase carrier. This step enables the solid phase carrier to be regenerated and sterilized.

[0068] The present invention also provides methods for detecting and quantifying flaviviruses. The detection and quantification methods of the present invention may involve measuring flaviviruses using the aptamers of the present invention (e.g., by using the complexes or solid-phase carriers of the present invention). The detection and quantification methods of flaviviruses can be performed in a manner similar to immunological methods, except that the aptamers of the present invention are used instead of antibodies. Therefore, by using the aptamers of the present invention as probes instead of antibodies, detection and quantification can be performed in a manner similar to enzyme immunoassays (EIA) (e.g., direct competitive ELISA, indirect competitive ELISA, sandwich ELISA), radioimmunoassays (RIA), fluorescent immunoassays (FIA), Western blotting, immunohistochemical staining, cell sorting, and the like. The aptamers of the present invention can also be used as molecular probes for PET and the like. Such methods may be useful, for example, for measuring the amount of flaviviruses in living organisms or biological samples and for diagnosing flavivirus infections. [Example]

[0069] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to the following examples. These examples were carried out using the following methods.

[0070] (Virus-like particle (VLP)-SELEX) First, a double-stranded Lb05N40 DNA library was prepared by primer extension using the single-stranded Lb05N40 DNA library and the forward primer. The sequences of the DNA library and primers used are shown below. Lb05N40 DNA library [5'-GGGTGTCAGCTGCTAGTATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTACGTACAGCTAGCCC-3' (SEQ ID NO: 10, N is present in the proportions of A and C 25%, G 30%, and C 20%). Forward primer for SELEX [5'- TAATACGACTCACTATA GGGCTAGCTGTACGTACC-3' (SEQ ID NO: 11, the underlined part indicates the T7 promoter sequence)], Reverse primer for SELEX [5'-GGGTGTCAGCTGCTAGTATC-3' (SEQ ID NO: 12)]. The DNA library and primers were synthesized by GeneDesign, Inc. and Fasmac Co., Ltd. The primer extension reaction was performed using TaKaRa ExTaq reagent (TaKaRa Bio). A 300 μL extension reaction mixture was prepared with a final concentration of 1× ExTaq buffer, 0.2 mM dNTP mix, 6 μM forward primer, 3 μM single-stranded Lb05N40 DNA library, and 0.17 U / μL ExTaq. The reaction mixture was then incubated at 95°C for 3 minutes, 55°C for 5 minutes, and 68°C for 20 minutes in a thermal cycler. The double-stranded DNA library was then purified by phenol-chloroform treatment (14,000 × g, 2 minutes, room temperature) and ethanol precipitation (14,000 × g, 20 minutes, -9°C).

[0071] Next, an initial (unsorted) single-stranded RNA pool was prepared from the double-stranded DNA library by in vitro transcription using the T7 RNA polymerase Y639F mutant. A 200 μL transcription reaction mixture containing the entire double-stranded DNA library was prepared at a final concentration of 40 mM HEPES-NaOH (pH 8.0), 20 mM NaCl, 20 mM MgCl2, 1 mM spermidine, 0.01% (v / v) Triton X-100, 2.5 mM 2'-deoxy-ATP, 2.5 mM 2'-fluoro-UTP, 2.5 mM 2'-hydroxy-GTP, 2.5 mM 2'-fluoro-CTP, 10 mM DTT, 2.5 mM MnCl2, and 0.025 mg / mL T7 RNA polymerase Y639F mutant. The reaction mixture was incubated overnight at 37°C. The RNA was then purified by phenol-chloroform treatment (14,000 × g, 2 minutes, room temperature) to remove proteins and ultrafiltration (14,000 × g, 3 minutes, room temperature, 5 washes) using an Amicon Ultra 0.5 mL ultrafiltration column (molecular weight cutoff: 30 kDa) (Merck) to remove NTPs. The purified single-stranded RNA pool was then quantified by measuring UV absorption at 260 nm using a UV-visible spectrophotometer. The purified single-stranded RNA pool was diluted to the desired concentration with DNase / RNase-free sterile water, heated at 95°C for 5 minutes, and then rapidly cooled on ice.

[0072] The RNA pool was then refolded by incubation at 25°C for 10 minutes in 1x SELEX buffer (20 mM Tris-HCl (pH 7.6), 145 mM NaCl, 5.4 mM KCl, 0.8 mM MgCl2, 1.8 mM CaCl2, 0.01% Tween 80), 0.1 mg / mL low molecular weight heparin (approximately 5,000 Da) (dalteparin, Pfizer), and 0.05 mg / mL yeast tRNA (Roche). The refolded single-stranded RNA pool was mixed with dengue virus-like particles (serotypes 1 and 3) (hereafter referred to as "DENV-VLPs"; NativeAntigen) and incubated at room temperature for 30–60 minutes on a rotary mixer. The mixture was then transferred to a Vivaspin500 ultrafiltration column (molecular weight cutoff: 100 kDa) (Sartorius AG) and centrifuged at 14,000 × g for 5 minutes at room temperature. After discarding the flow-through fraction, 500 μL of 1× SELEX buffer was added and centrifuged again. This washing procedure was repeated 6 to 10 times to remove unbound and weakly bound RNA molecules. Except for the first round, the RNA pool was passed through an empty Vivaspin500 ultrafiltration column 1 to 3 times to remove RNA molecules nonspecifically adsorbed to the column or membrane. DENV-VLP selection was then performed using this RNA pool. After washing, membrane fractions containing RNA and DENV-VLP complexes were collected for rounds 1 to 4. From the fifth round onward, the collected membrane fraction was treated with anti-flavivirus mouse monoclonal neutralizing antibody (4G2) (NativeAntigen) at a final concentration of 1 μM. The mixture was incubated at room temperature for 30 minutes on a rotary mixer, then passed through a Vivaspin 500 ultrafiltration column, and the flow-through fraction was collected. This procedure selectively selected molecules that bind to the same or nearby epitopes as the neutralizing antibodies and exhibit competitive binding (i.e., molecules with neutralizing activity). The collected fraction was then treated with phenol-chloroform (14,000 × g, 2 minutes, room temperature) and ethanol-precipitated with the coprecipitant Dr.GenTLE (TaKaRa Bio) (14,000 × g, 20 minutes, 4°C) to recover bound RNA.In rounds 7 to 9, the recovered RNA was refolded again and passed through an empty Vivaspin500 ultrafiltration column 1 to 3 times to remove RNA molecules nonspecifically adsorbed to the column or membrane.

[0073] The entire recovered RNA was then subjected to reverse transcription to convert it into complementary single-stranded DNA. SuperScript IV reagent (Thermo Fisher Scientific) was used for the reverse transcription reaction. The recovered RNA was dissolved in DNase / RNase-free sterile water, and then a dNTP mix and reverse primer were added. The mixture was heated at 95°C for 5 minutes and then at 65°C for 5 minutes using a thermal cycler, followed by quick cooling on ice. The following reagents and enzymes were then added to a 20μL reverse transcription reaction mixture: 1x SSIV buffer, 0.2mM dNTP mix, 5μM reverse primer, 5mM DTT, 2U / μL RNase inhibitor, and 1U / μL SuperScript Reverse Transcriptase. The reaction mixture was then heated at 65°C for 20 minutes and then at 85°C for 10 minutes using a thermal cycler. The entire complementary single-stranded DNA was amplified by PCR using TaKaRa ExTaq reagent. A 250 μL extension reaction mixture was prepared with a final concentration of 1x ExTaq buffer, 0.2 mM dNTPs, 3 μM forward primer, 3 μM reverse primer, and 0.1 U / μL ExTaq. The reaction mixture was then heated at 95°C for 3 minutes, followed by amplification at 95°C for 20 seconds, 58°C for 20 seconds, and 72°C for 30 seconds, for an appropriate number of cycles. The entire amplified double-stranded DNA was subjected to in vitro transcription using the T7 RNA polymerase Y639F mutant, and a single-stranded RNA pool was prepared for the next round under the aforementioned transcription conditions. From the second round onward, the reaction volumes for PCR and in vitro transcription were reduced by half or less. The above selection and amplification procedures were repeated for nine rounds to enrich for DENV-VLP-binding sequences within the pool.

[0074] To improve binding activity through sequence optimization, a library for Doped-SELEX was designed based on the shortened aptamer sequence, and VLP-SELEX was performed again. The library sequence and primer sequences used are shown below. The six Doped-SELEX1 libraries are: Lb05_D13_c1_1_53_doped-Lb01 [5'-GGGTGTCAGCTGCTAGTATCGNNNNNACAGTAGCGCCNNNNNNNNNNNAGCATACTGTCGGTACGTACAGCTAGCCC-3' (SEQ ID NO: 13)], Lb05_D13_c1_1_53_doped-Lb02 [5'-GGGTGTCAGCTGCTAGTATCGTANNNNNNNNNCAGTAGCGCNNNNNNNNNNNNNGCATACTGNNNNTACGGTACGTACAGCTAGCCC-3' (SEQ ID NO: 14)], Lb05_D13_c1_1_53_doped-Lb03 [5'-GGGTGTCAGCTGCTAGTATCggtgaaacagtagcgccgccgattgttaagcatactgtcGGTACGTACAGCTAGCCC-3' (SEQ ID NO: 15)], Lb05_D13_c1_1_49_doped-Lb01 [5'-CGTGACTCGACGTGCAAGCTCGGATCGNNNNNACAGTAGCGCCNNNNNNNNNNNAGCATACTGTCGGTCCGCTGAACACTCGGTCAGTCCC-3' (SEQ ID NO: 16)], Lb05_D13_c1_1_49_doped-Lb02 [5'-CGTGACTCGACGTGCAAGCTCGGANNNNNNNNNCAGTAGCGCNNNNNNNNNNNNNGCATACTGNNNNTCCGCTGAACACTCGGTCAGTCCC-3' (SEQ ID NO: 17)], Lb05_D13_c1_1_49_doped-Lb03 [5'-CGTGACTCGACGTGCAAGCTCggatcggtgaaacagtagcgccgccgattgttaagcatactgtcggtccGCTGAACACTCGGTCAGTCCC-3' (SEQ ID NO: 18)]. The three types of Doped-SELEX2 libraries are: Freq-raw_5_s_doped [5'-GGGTGTCAGCTGCTAGTATCggtgaaacagtagccccgccgattgttaaatgcatactgtcGGTACGTACAGCTAGCCC-3' (SEQ ID NO: 19)], Freq-raw_5-log_3_doped [5'-GGGTGTCAGCTGCTAGTATCggtgaaacagtagccccgccgattgttaaagcatactgtcGGTACGTACAGCTAGCCC-3' (SEQ ID NO: 20)], Freq-log3_s_doped [5'-GGGTGTCAGCTGCTAGTATCggtgaaacagtagcgccgccgattgttaaatgcatactgtcGGTACGTACAGCTAGCCC-3' (SEQ ID NO: 21)]. N indicates a sequence containing 25% A and C, 30% G, and 20% C, and lowercase letters indicate a 30%-doped sequence (70% of the bases identical to the original aptamer sequence and 3 × 10% of other bases).

[0075] The forward and reverse primers for the Doped-SELEX1 library (Lb05_D13_c1_1_53_doped-Lb01,02,03) and the Doped-SELEX2 library were [5'- TAATACGACTCACTATAThe forward and reverse primers for the remaining Doped-SELEX1 library (Lb05_D13_c1_1_49_doped-Lb01,02,03) were [5'-TAATACGACTCACTATAGGGACTGACCGAGTGTTCAGC-3' (SEQ ID NO: 22, the underlined portion indicates the T7 promoter sequence)] and [5'-CGTGACTCGACGTGCAAGCTC-3' (SEQ ID NO: 23)], respectively.

[0076] The libraries and primers for Doped-SELEX were synthesized by GeneDesign, Inc. and Fasmac Co., Ltd. For VLP-SELEX, 800–100 pmol of single-stranded RNA pool was mixed with 1–0.00625 μg of a mixture of DENV1 and DENV3-VLPs. For Doped-SELEX, 400 or 200 pmol of single-stranded RNA pool was mixed with 0.5–0.125 μg of DENV1 or a mixture of DENV1 and DENV3-VLPs. Both SELEX methods were supplemented with 0.1 mg / mL low-molecular-weight heparin and 0.05 mg / mL yeast tRNA. The mixture was incubated for 30–60 minutes at room temperature using a rotary mixer, and then washed 6–10 times using a Vivaspin 500 ultrafiltration column. Subsequently, membrane fractions containing RNA and DENV-VLP complexes were collected from rounds 1 to 4 of VLP-SELEX and from rounds 1 to the final 3 of Doped-SELEX. From round 5 of VLP-SELEX, a neutralizing antibody (4G2) was added to the collected membrane fraction to a final concentration of 1 μM, and the fraction was passed through a Vivaspin 500 ultrafiltration column after 30 minutes of incubation at room temperature using a rotary mixer. To remove RNA molecules nonspecifically adsorbed to the Vivaspin 500, the single-stranded RNA pool before mixing with VLPs was passed through an empty Vivaspin 500 ultrafiltration column 1 to 3 times from rounds 2 to 9 (excluding round 1) of VLP-SELEX and from rounds 1 to the final 3 of Doped-SELEX. Furthermore, in the 7th to 9th rounds of VLP-SELEX and in the 3rd round of Doped-SELEX, the RNA recovered after selection was refolded and passed through an empty Vivaspin500 ultrafiltration column 1 to 3 times.

[0077] (High-throughput sequencing (HTS) analysis) HTS analysis was performed using an iSeq 100 sequencer (Illumina). First, double-stranded DNA from each round of VLP-SELEX experiments was purified on a non-denaturing polyacrylamide gel. Next, accessory sequences were added to the double-stranded DNA using PCR with iSeq 100 sequencer accessory sequence primers and TaKaRa ExTaq reagent (TaKaRa Bio). A 25 μL reaction mixture containing 1x ExTaq buffer, 0.2 mM dNTPs, 3 μM forward primer, 3 μM reverse primer, and 0.1 U / μL ExTaq was prepared. The reaction mixture was heated at 95°C for 3 minutes, then amplified for the appropriate number of cycles using a thermal cycler under the following conditions: 95°C for 20 seconds, 50°C for 20 seconds, and 72°C for 30 seconds. The amplification was then purified on a non-denaturing polyacrylamide gel. The primer sequences used are shown below. Forward primer for HTS analysis [5'-AATGATACGGCGACCACCGAGATCTACAC CCGCGGTT ACACTCTTTCCCTACACGACGCTCTTCCGATCTTAATACGACTCACTATA-3' (SEQ ID NO: 24, the underlined part indicates the barcode sequence, which changes for each round)], Reverse primer for HTS analysis [5'-CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGGTGTCAGCTGCTAGTATC-3' (SEQ ID NO: 25)].

[0078] The purified accessory sequence-tagged double-stranded DNA was quantified by real-time PCR using SYBR Green PCR Master Mix (ThermoFisherScientific). A 20 μL reaction mixture was prepared with 1x SYBR Green PCR Master Mix, 0.4 μM forward primer, 0.4 μM reverse primer, and double-stranded DNA. Using a real-time PCR system, the reaction mixture was heated at 50°C for 2 minutes, 95°C for 10 minutes, and then amplified at 95°C for 15 seconds and 60°C for 60 seconds for up to 25 cycles. The concentration was then calculated based on a calibration curve created by amplifying double-stranded DNA of known concentration. The primer sequences used are shown below. Real-time PCR forward primer [5'-AATGATACGGCGACCACCGA-3' (SEQ ID NO: 26)], Reverse primer for real-time PCR [5'-CAAGCAGAAGACGGCATACG-3' (SEQ ID NO: 27)]. The operation of the Seq100 sequencer and sample preparation were performed according to the instructions provided by Illumina.

[0079] (in silico analysis) First, accessory sequences (barcodes and adapter sequences) and T7 promoter sequences were removed from the HTS data obtained from the final nine rounds of the VLP-SELEX experiment using the preprocessing tools FASTX-Toolkit (http: / / hannonlab.cshl.edu / fastx_toolkit) and Cutadapt (https: / / cutadapt.readthedocs.io / en / stable / ). Next, crystallization analysis was performed using the aptamer sequence analysis program FASTAptamer (#RefPMID:25734917). Sequences with 10 or more reads and six base differences were defined as a single cluster, and the sequence with the most reads was extracted as a representative candidate sequence.

[0080] (RaptRanker analysis) Using HTS data from all rounds of SELEX experiments, we searched for candidate aptamer sequences using RaptRanker (PMID: 32537639), a method for ranking candidate aptamer sequences based on local sequence and secondary structure information. HTS data from all rounds of SELEX experiments using the Lb05N40 DNA library described above were used for analysis.

[0081] (RaptGen analysis) We also searched for candidate sequences using RaptGen (DOI: 10.1038 / s43588-022-00249-6), an artificial intelligence-based aptamer sequence analysis technology. We analyzed HTS data from the final nine rounds of SELEX experiments using the Lb05N40 DNA library. Furthermore, we analyzed HTS data from the final three rounds of Doped-SELEX experiments using the Doped-SELEX1 library (Lb05_D13_c1_1_53_doped-Lb03) and the final four rounds of Doped-SELEX experiments using the Doped-SELEX2 libraries (Freq-raw_5_s_doped, Freq-raw_5-log_3_doped, and Freq-log3_s_doped). Sequence frequency information (the number of reads for each sequence obtained from HTS analysis) was used for analysis.

[0082] (Surface plasmon resonance (SPR) analysis) SPR analysis was performed using a BIAcore 2000 (Cytiva). In the binding test between the aptamer and DENV-VLP, first, 5'-CTTCTTCTTCTTCTTC-3' oligonucleotide (SEQ ID NO: 28) with biotin attached to the 5' end was immobilized at approximately 1000 Resonance Units (RU) on all flow cells 1 to 4 of a streptavidin (SA) sensor chip (Cytiva). Next, the initial (unselected) RNA pool with the GAAGAAGAAGAAGAAG sequence (SEQ ID NO: 29) attached to the 3' end and the aptamer were immobilized on flow cells 1 and 2 to 4 via the 5'-CTTCTTCTTCTTCTTC-3' oligonucleotide (SEQ ID NO: 28). 1x SELEX buffer was used as the measurement buffer. DENV-VLPs diluted with 1x SELEX buffer to a final concentration of 20 ng / μL were injected into flow cells 1 to 4 at a flow rate of 10 μL / min for 120 seconds and allowed to dissociate for 300 seconds. The dissociation constant (K DTo calculate the RI (Reversed Ionization Rate) value, approximately 300 RU of the initial RNA pool and aptamer were immobilized on flow cells 1 and 2, respectively. DENV-VLPs diluted with 1x SELEX buffer to a final concentration of 0.0625–2 nM were then injected into flow cells 1 and 2 at a flow rate of 40 μL / min for 120 seconds, followed by 600 seconds of dissociation. The molar concentration of DENV-VLPs was calculated from the molecular weight of DENV1 particles (PDB:4CCT, approximately 11.2 MDa). To regenerate the sensor chip, i.e., to remove the bound DENV-VLPs, the immobilized initial RNA pool, and the aptamer, regeneration buffer 1 [20 mM TrisHCl (pH 7.6), 4 M urea, 5 mM EDTA] was injected for 1 minute. Next, in a neutralization activity estimation test using the competitive inhibitory effect on the binding of neutralizing antibody 4G2 to VLP as an index, approximately 2,000 RU of recombinant protein A / G (PROSPEC) was immobilized on flow cells 1 and 2 of a CM5 sensor chip (Cytiva) using the amine coupling method. Next, neutralizing antibody 4G2 diluted with 1x SELEX buffer to a final concentration of 100 nM was injected into flow cell 2 at a flow rate of 2 μL / min for 600 seconds, resulting in approximately 3,000 RU of immobilization. A mixture of VLP or 10 ng / μL VLP with 0.2 to 1,000 nM aptamer was prepared and incubated at room temperature for 30 minutes using a rotary mixer. The mixture was then injected into flow cells 1 and 2 at a flow rate of 5 μL / min for 240 seconds, followed by 300 seconds of dissociation. To regenerate the sensor chip, regeneration buffer 2 [10 mM Glycine-HCl (pH 1.5)] was injected for 1 minute. To eliminate the influence of nonspecific binding of DENV-VLPs and aptamers to the sensor chip surface, 5'-CTTCTTCTTCTTCTTC-3' oligo (SEQ ID NO: 28), and Protein A / G, the sensorgram of flow cell 1 was subtracted from the sensorgrams of flow cells 2 to 4. DThe values ​​were calculated using the Langmuir (1:1) binding model of BIAevaluation (Cytiva). The 50% inhibitory concentration (IC50) was calculated using Microsoft Excel or GraphPad Prism 9 (GraphPad Software).

[0083] (Aptamer shortening and sequence optimization) Aptamer shortening and sequence optimization were performed based on secondary structure information predicted by MXfold2 (http: / / ws.sato-lab.org / mxfold2 / ).

[0084] First, Lb05_D13_Abs_c1_1 [78 bases, 5'-GGG CUAGCUG UACGUACCGACAGUAUGCUUUAACAAUCGGCGGCGCUACUGUUUCACCGAUACUAGCAGCUGACACCC-3' (SEQ ID NO: 30)], st Truncation Nos. 11, 12, 13, 27, and 28 were prepared and subjected to binding tests by SPR analysis. Among them, Lb05_D13_Abs_c1_1_62 [62 bases, 1 st Truncation No. 28, 5'-GGG UACG UACCGACAGUAUGCUUUAACAAUCGGCGGCGCUACUGUUUCACCGAUA CUAG CCC-3' (SEQ ID NO: 31)] was used as the backbone sequence for the next step of shortening.

[0085] Next, based on Lb05_D13_Abs_c1_1_62, 1 st Truncation Nos. 46 to 51 were prepared and subjected to binding tests by SPR analysis. Among them, Lb05_D13_Abs_c1_1_54 [54 bases, 1 st truncation No.49, 5'-GGGUACCGACAGUAUGCUU UAACAAUCGGCGGCGCUACUGUUUCACCGAUACCC-3' (SEQ ID NO: 32)] was used as the backbone sequence for the next step of shortening.

[0086] Next, based on Lb05_D13_Abs_c1_1_54, 1 st Truncation Nos. 56 to 65 were prepared and subjected to binding tests by SPR analysis. Among them, Lb05_D13_Abs_c1_1_53_dU20 [53 bases, 1 base] was selected by removing the underlined uridine (U) from Lb05_D13_Abs_c1_1_54. st truncation No.62, 5'-GGGUACCGACAGUAUUGCUUAA C AAUCGGCGGCGCUACUGUUUCACCGAUACCC-3' (SEQ ID NO: 33)] was used as the backbone sequence for the next step of shortening.

[0087] Next, based on Lb05_D13_Abs_c1_1_53_dU20, 1 st Truncation Nos. 66 to 89 were prepared and subjected to binding tests by SPR analysis. Among them, Lb05_D13_Abs_c1_1_53_dU20 was depleted of the underlined sequence to obtain Lb05_D13_Abs_c1_1_52_dC_1 [52 bases, 1 st Truncation No. 76, 5'-GGGUACCGACAGUAUGCUUAAAAUCGGCGGCGCUACUGUUUCACCGAUACCC-3' (SEQ ID NO: 34)] was used as the backbone sequence for the next step of shortening.

[0088] Next, based on Lb05_D13_Abs_c1_1_52_dC_1, 1 st We prepared truncation Nos. 90 to 98 and performed binding tests using SPR analysis, but no sequences showed high activity. Therefore, we again used Lb05_D13_Abs_c1_1_53_dU20 [53 bases, 1 sttruncation No. 62, 5'-GGGUACCGACAGUAUGCUUAACAAUCGGCGGCGCUACUGUUUCACCGAUACCC-3' (SEQ ID NO: 33)] as a backbone sequence. st We prepared truncation sequences No. 99 to 106 and performed binding tests using SPR analysis. However, no sequences showed high activity.

[0089] Based on the above results, we have succeeded in shortening the chain to 53 bases, which has high binding activity. st The truncation was successfully shortened to 49 bases while retaining a slight binding activity with truncation No. 62 Lb05_D13_Abs_c1_1_53_dU20. st A Doped-SELEX1 library was designed using truncation No. 99 Lb05_D13_Abs_c1_1_49_dGC_UA as a backbone sequence.

[0090] First, Freq-raw_5 [78 bases, 5'-GGG CUAGCUGUACG UACCGACAGUAUGCUUUAACAAUCGGCGGGGCUACUGUUUCACCGAUA CUAGCAGCUGACA The underlined sequence of [54 bases, 5'-GGGUACCGACAGUAUGCUUUAACAAUCGGCGGGGCUACUGUUUCACCGAUACCC-3' (SEQ ID NO: 35)] was removed to prepare Freq-raw_5_s [54 bases, 5'-GGGUACCGACAGUAUGCUUUAACAAUCGGCGGGGCUACUGUUUCACCGAUACCC-3' (SEQ ID NO: 36)].

[0091] Next, Freq-log_3 [79 bases, 5'-GGG CUAGCUGUACG UACCGACAGUAUGCAUUUAACAAUCGGCGGCGCUACUGUUUCACCGAUA CUAGCAGCUGACAThe underlined sequence of Freq-raw_5_s [55 bases, 5'-GGGUACCGACAGUAUGCAUUUAACAAUCGGCGGCGCUACUGUUUCACCGAUACCC-3' (SEQ ID NO: 37)] was removed to generate Freq-log_3_s [55 bases, 5'-GGGUACCGACAGUAUGCAUUUAACAAUCGGCGGCGCUACUGUUUCACCGAUACCC-3' (SEQ ID NO: 38)]. Furthermore, an adenosine (A) was inserted between the 17th cytidine (C) and the 18th uridine (U) from the 5' end of the Freq-raw_5_s sequence to generate Freq-raw_5-log_3_S [55 bases, 5'-GGGUACCGACAGUAUGCAUUUAACAAUCGGCGGGGCUACUGUUUCACCGAUACCC-3' (SEQ ID NO: 39)].

[0092] Next, we designed the Doped-SELEX2 library using Freq-raw_5_s, Freq-log_3_s, and Freq-raw_5-log_3_S as backbone sequences. The Doped-SELEX1 library Lb05_D13_c1_1_53_doped-Lb03 derived from D_26_1_0_Full [77 bases, 5'-GG GCUAGCUGUACGU ACCGACAGUAUGGAUAACAAUCGGCGGCUGUACUGUUUCACCGAU ACUAGCAGCUGACAC CC-3' (SEQ ID NO: 40)], in which the underlined sequence was removed, nd Truncation No. D_26_1_0_S [49 bases, 5'-GGACCGACAGUAUGGAUAACAAUCGGCGGCUGUACUGUUUCACCGAUCC-3' (SEQ ID NO: 41)] was prepared. st Optimization No. D_26_1_1_S~14_S, 16 were prepared and binding tests were performed using SPR analysis.

[0093] Next, for the D_26_1_0_S scaffold, and for the D_26_1_0_S that retained binding activity, the cytosine (C) base shown in bold was replaced with an adenine (A) base, D_26_1_5_S, and the D_26_1_6_S that was replaced with a uridine (U) base, the lower stem (5'-GA / UC-3') was replaced with the stem (5'-GUA / UAC-3'), 2 nd optimization No.D_26_1_0_L(=D_26_1) [53 bases, 5'-GGGUACCGACAGUAUGGAUAACAAUCGGCGGCUGUACUGUUUCACCGAUACCC-3' (SEQ ID NO: 42)], D_26_1_5_L [53 bases, 5'-GGGUACCGACAGUAUGGAUAAAAAUCGGCGGCUGUACUGUUUCACCGAUACCC-3' (SEQ ID NO: 43)], D_26_1_6_L [53 bases, 5'-GGGUACCGACAGUAUGGAUAAUAAUCGGCGGCUGUACUGUUUCACCGAUACCC-3' (SEQ ID NO: 44)] We prepared the antibodies and performed binding tests and neutralizing activity estimation tests using SPR analysis.

[0094] Among them, D_26_1_5_L, which could be shortened to 49 bases and showed high binding and neutralizing activity, was used as the backbone sequence for the next stage of sequence optimization. rd Optimization Nos. 1 to 16 were prepared and subjected to binding tests by SPR analysis. Furthermore, among them, D_26_1_5_LA11CU38G [53 bases, 3 rd optimization No. 3, 5'-GGGUACCGACCGUAUGGAUAAAAAUCGGCGGCUGUACGGUUUCACCGAUACCC-3' (SEQ ID NO: 6)] as a backbone. rd Optimization Nos. A to P were prepared and binding tests were carried out using SPR analysis. rdNo sequence had higher activity than optimization No. 3. Therefore, D_26_1_5_LA11CU38G was selected as one of the target sequences for glycosylation described below.

[0095] Doped-SELEX2 library Freq-raw5-log3_c20_1 [78 bases, 5'-GGG CUAGCUGUACG UACCGACCAUAUGCAGUUAAAAUCGGCGGUGCUAUGGUUUCACCGAUA CUAGCAGCUGACA CCC-3' (SEQ ID NO: 45)], nd Truncation Nos. s1 to s37 were prepared and binding tests were performed by SPR analysis. Among them, Freq_raw5_log3_c20_1_54_dU15 [53 bases, Truncation No. s2, 5'-GGGUACCGACCAUAGCAGUUAAAAUCGGCGGUGCUAUGGUUUCACCGAUACCC-3' (SEQ ID NO: 46)], in which the underlined sequence and uridine (U) bases were removed from Freq_raw5_log3_c20_1, was used as the backbone sequence for the next stage of sequence optimization.

[0096] Then, based on Freq_raw5_log3_c20_1_54_dU15, 1 st Optimization Nos. M1 to M8 were prepared and binding tests were performed by SPR analysis. Among them, Freq_raw5_log3_c20_1_54_dU15_C16GG33U [53 bases, 1 st optimization No. M2, 5'-GGGUACCGACCAUAGGAGUUAAAAUCGGCGGUUCUAUGGUUUCACCGAUACCC-3' (SEQ ID NO: 9)] was selected as one of the target sequences for the following sugar chain modification.

[0097] (Aptamer glycosylation) To improve stability against nucleases and in vivo retention, the 2'-ribose, 5'-, and 3'-terminus of the constructed aptamer were chemically modified. Similar to the aforementioned shortening and sequence optimization, this modification was performed based on the secondary structure information predicted by MXfold2.

[0098] First, D_26_1_5_LA11CU38G[3 rd Based on optimization No. 3, 5'-GGGU(F)aC(F)C(F)GaC(F)C(F)GU(F)aU(F)GGaU(F)aaaaaU(F)C(F)GGC(F)GGC(F)U(F)GU(F)aC(F)GGU(F)U(F)U(F)C(F)aC(F)C(F)GaU(F)aC(F)C(F)C(F)-3', (lowercase letters indicate 2'-deoxy, uppercase letters indicate 2'-hydroxy, and F indicates 2'-fluoro ribose-containing bases), modifications 1 to 12 were prepared, and neutralization activity estimation tests using SPR analysis were performed. Among these, Modification 11 [5'-GGGU(F)aC(F)C(F)GaC(F)C(F)GU(F)aU(F)GGaU(F)aaaaaU(F)C(F)G(M)G(M)C(F)G(M)G(M)C(F)U(F)GU(F)aC(F)GGU(F)U(F)U(F)C(F)aC(F)C(F)GaU(F)aC(F)C(F)C(F)-3' (lowercase letters indicate 2'-deoxy, uppercase letters indicate 2'-hydroxy, F indicates 2'-fluoro, and M indicates 2'-O-methyl ribose-containing bases)] was used as the backbone sequence for the next step of glycosylation.

[0099] Next, based on Modification 11, Modifications 13 to 35 were prepared and neutralizing activity estimation tests were carried out using SPR analysis. Among them, Modifications 13 to 35, in which the ribose 2' site of the base in the internal stem and lower loop region was replaced with -O-methyl, 23 [5'-GGGU(F)aC(F)C(F)GaC(M)C(M)G(M)U(M)A(M)U(M)G(M)G(M)aU(F)aaaaaU(M)C(F)G(M)G(M)C(F)G(M)G(M)C(M)U(M)G(M)U(M)A(M)C(M)G(M)G(M)U(F)U(F)U(F)C(M)aC(F)C(F)GaU(F)aC(F)C(F)C(F)-3', (lowercase letters indicate 2'-deoxy, uppercase letters indicate 2'-hydroxy, F indicates 2'-fluoro, and M indicates 2'-O-methyl ribose-containing bases)] was used as the backbone sequence for the next step of glycosylation.

[0100] Next, based on Modification 23, Modifications 36 to 47 were prepared and neutralizing activity estimation tests were performed using SPR analysis. Among them, Modification 41 [5'-G(M)G(M)G(M)U(F)aC(F)C(F)G(M)aC(M)C(M)G(M)U(M)A(M)U(M)G(M)G(M)A(M)U(F)aA(M)aaA(M)U(M)C(F)G(M)G(M)C(F)G(M)G(M)C(M)U(M)G(M)U(M)A(M)C(M)G(M) )G(M)U(F)U(F)U(F)C(M)aC(F)C(F)G(M)aU(F)aC(M)C(M)C(M)-3' (lowercase letters indicate 2'-deoxy, uppercase letters indicate 2'-hydroxy, F indicates 2'-fluoro, and M indicates 2'-O-methyl ribose-containing bases) to the 5' end and branched polyethylene glycol with a molecular weight of 40 kDa (Y-shaped PEG, Jenkem Technology, SKU: Y-NHS-40K) to the 3' end.

[0101] Freq_raw5_log3_c20_1_54_dU15_C16GG33U[ 1st In optimization No.M2, 5'-GGGU(F)aC(F)C(F)GaC(F)C(F)aU(F)aGGaGU(F)U(F)aaaaU(F)C(F)GGC(F)GGU(F)U(F)C(F)U(F)aU(F)GGU(F)U(F)U(F)C(F)aC(F)C(F)GaU(F)aC(F)C(F)C(F)-3' (lowercase letters indicate 2'-deoxy, uppercase letters indicate 2'-hydroxy, and F indicates 2'-fluoro), the ribose 2' site of the base corresponding to the 2'-O-methyl modification site of D_26_1_5_LA11CU38G Modification41 was replaced with -O-methyl, and Modification 1 [5'-G(M)G(M)G(M)U(F)aC(F)C(F)G(M)aC(M)C(M)A(M)U(M)A(M)G(M)G(M)A(M)G(M)U(F)U(F)A(M)aaA(M)U(M)C(F)G(M)G(M)C(F)G(M)G(M)U(M)U(M)C(M)U(M)A(M)U(M)G(M)G(M)U(F)U(F)U(F)C(M)aC(F)C(F)G(M)aU(F)aC(M)C(M)C(M)C(M)-3', (lowercase letters indicate 2'-deoxy, uppercase letters indicate 2'-hydroxy, F indicates 2'-fluoro, and M indicates 2'-O-methyl ribose-containing bases)] was prepared.

[0102] Furthermore, based on Modification 1, Modifications 2 to 22 were prepared and neutralization activity estimation tests were performed using SPR analysis. Among them, Modification 17 [5'-G(M)G(M)G(M)U(F)aC(F)C(F)G(M)aC(M)C(M)A(M)U(M)A(M)G(M)G(M)A(M)G(M)U(M)A(M)aaA(M)U(M)C(M)G(M)G(M)C(F)] G(M)G(M)U(M)U(M)C(M)U(M)A(M)U(M)G(M)G(M)U(F)U(F)C(M)aC(F)C(F)G(M)aU(F)aC(M)C(M)C(M)-3' (lowercase letters indicate 2'-deoxy, uppercase letters indicate 2'-hydroxy, F indicates 2'-fluoro, and M indicates 2'-O-methyl ribose-containing bases)) to the 5' end was added an inverted dT, and to the 3' end was added a branched polyethylene glycol with a molecular weight of 40 kDa (Y-shaped PEG, Jenkem Technology, SKU: Y-NHS-40K).

[0103] (PRNT (plaque reduction neutralization test) analysis) To examine the inhibitory effect of the aptamer on pathogenic dengue viruses (DENV1-DNEV4), we performed a standard PRNT assay using BHK cells. Furthermore, antibody-dependent enhancement (ADE) activity was assessed using BHK cells overexpressing the Fc gamma receptor (Moi ML et al., JVirolMeth, 2010; Moi ML et al., JGenVirol, 2014). A pre-existing neutralizing antibody (4G2 monoclonal antibody) (NativeAntigen) was used as a positive control.

[0104] The experimental results obtained using the above method are shown below.

[0105] (Selection(candidate1)) To select aptamers that bind to a wide range of serotypes, we performed VLP-SELEX using a mixture of dengue virus serotype 1 (DENV1) and serotype 3 (DENV3) virus-like particles (VLPs) at a concentration ratio of 1:1. The aptamer selection method was based on a previously reported VLP-SELEX method (2021 PNAS, doi:10.1073 / pnas.2019497118). For simplicity and cost reasons, we performed a modified VLP-SELEX method in which counterselection was performed against the membrane of an ultrafiltration column, without counterselection using non-target VLPs to remove nonspecific sequences. After nine rounds of VLP-SELEX, the enriched sequences were analyzed by high-throughput sequencing. As shown in Figure 1, one sequence (Lb05_D13_Abs_c1_1) was strongly enriched. The binding of this sequence to DENV1-VLP was examined using surface plasmon resonance (SPR) analysis, and it was revealed that it binds to VLPs of all serotypes, from DENV1 to DENV4.

[0106] (Shortened chain (candidate 1)) Next, to shorten the aptamer sequence, five sequences of different lengths were prepared. stTruncation sequences No. 11, 12, 13, 27, and 28 were evaluated. As shown in Figure 2, "No. 28" was found to be the shortest and maintain its binding activity. Furthermore, sequences with different lengths and truncation sites were evaluated based on "No. 28." As shown in Figure 3, "No. 49" was found to be the shortest and have the highest binding activity. Furthermore, 10 sequences with different lengths and truncation sites were evaluated based on "No. 49." As shown in Figure 4, "No. 62" was found to be the shortest and have the highest binding activity. Furthermore, 24 sequences with different lengths and truncation sites were evaluated based on "No. 62." As shown in Figure 5, "No. 76" was found to be the shortest and have the highest binding activity. Furthermore, nine sequences with different lengths and truncation sites were evaluated based on "No. 76." As shown in Figure 6, all sequences showed significantly reduced binding activity. Therefore, going back to "No. 62," eight sequences with different lengths and truncation sites were evaluated. As a result, as shown in Figure 7, it was found that the binding activity of all sequences was significantly reduced. Therefore, going back further from "No. 49," nine sequences with different lengths and shortening positions were evaluated. As a result, as shown in Figure 8, it was found that the binding activity of all sequences was significantly reduced. Therefore, from these results, it was found that "No. 62" was the shortest of the sequences evaluated and had the highest binding activity.

[0107] (Optimization(candidate1)) Based on "No. 62", we performed Doped-SELEX using six partially randomized Doped-libraries (Lb05_D13_c1_1_49_doped-Lb01, Lb05_D13_c1_1_49_doped-Lb02, Lb05_D13_c1_1_49_doped-Lb03, Lb05_D13_c1_1_53_doped-Lb01, Lb05_D13_c1_1_53_doped-Lb02, Lb05_D13_c1_1_53_doped-Lb03) to search for sequences with even higher activity. Nos. D_1_1 to D_31_1 were evaluated by SPR analysis. As a result, as shown in Figure 9, the sequences obtained from the Lb05_D13_c1_1_53_doped-Lb03 library showed strong binding.

[0108] Based on these results, we analyzed the sequence data from the third round of Doped-SELEX performed on the Lb05_D13_c1_1_53_doped-Lb03 library using RaptGen and RaptGen with frequency information added, in an attempt to search for and generate further candidate sequences. As a result, although not shown in the figure, 18 sequences ("Lb05_1stDoped_Lb03_3R_mc4_0" to "Lb05_1stDoped_Lb03_3R_mc4_18") were obtained from the RaptGen analysis, and 6 sequences ("Lb05_1stDoped_Lb03_3R_mc4_freqlog_1", "Lb05_1stDoped_Lb03 The displayed sequences were "Lb05_1stDoped_Lb03_3R_mc4_freqlog_2," "Lb05_1stDoped_Lb03_3R_mc4_freqlog_6," "Lb05_1stDoped_Lb03_3R_mc4_freqlog_7," "Lb05_1stDoped_Lb03_3R_mc4_freqlog_8," and "Lb05_1stDoped_Lb03_3R_mc4_freqlog_9." Because the displayed sequences were approximately 77 bases long, shortened sequences were created to 53 bases based on the shortening results described above and subjected to SPR analysis. Although not shown in the figure, all of the clones exhibited binding activity. However, their activity was not greater than that of "Clone No. D_26_1_0_L (= D_26_1)." Therefore, based on this "Clone No. D_26_1_0_L (= D_26_1)", we attempted to increase the activity by shortening the chain and optimizing the sequence (substitution / mutation) as described above.

[0109] First, as shown in Figure 10, a sequence "D_26_1_0_S" was created by shortening the terminal stem sequence based on "D_26_1_0_L (=D_26_1)," and 16 sequences including "D_26_1_0_S" were evaluated to optimize the sequence. As a result, while the binding activity was generally reduced due to the shortening, "D_26_1_5_S" showed high binding activity.

[0110] Next, to restore the reduced binding activity due to the shortening, the terminal stem sequence was restored to the same length as the unshortened "D_26_1_0_L (=D_26_1)" and the binding activity of all 14 sequences (D_26_1_1_L to D_26_1_14_L) was evaluated. As a result, as shown in Figure 11, "D_26_1_5_L (=D_26_1_15)" with the sequence substitution "D_26_1_5_S" was found to have the highest binding activity. Furthermore, when the binding inhibition (competitiveness) of the antibody with the existing neutralizing antibody 4G2 monoclonal antibody was evaluated by SPR analysis, the binding inhibition ability (IC50) of the antibody with DENV1-VLP was 3.6 nM, as shown in Figure 11.

[0111] Furthermore, 16 sequences were evaluated for sequence optimization based on "D_26_1_5_L (=D_26_1_15)." As a result, as shown in Figures 12 and 13, the binding activity of "No. 10" and "No. 13" was reduced by about half, and the other sequences were found to have binding activity equal to or greater than that of the original ("D_26_1_5_L (=D_26_1_15)").

[0112] To estimate the neutralizing activity of 12 sequences (Nos. 3-9, 11, 12, 14-16, see Figure 14) that had binding activity equal to or greater than that of "D_26_1_5_L (=D_26_1_15)," we evaluated the binding inhibition (competitiveness) of various aptamers (4 nM, fixed concentration) with the neutralizing antibody 4G2 monoclonal antibody in the same manner as above. As a result, as shown in Table 1 below, all of them had competitive activity with the neutralizing antibody equal to or greater than that of "D_26_1_5_L (=D_26_1_15)" before optimization.

[0113] [Table 1]

[0114] Furthermore, among the optimized sequences based on the above "D_26_1_5_L (=D_26_1_15)", "3" had high binding activity. rd 12 sequences that were replaced based on "optimization No. 16" (see Figure 15),rd Four sequences (see Figure 16) that had been substituted based on "optimization No. 3" were evaluated. As a result, as shown in Figures 15 and 16, it was found that all of the substituted sequences had binding activity equivalent to that of the sequence before substitution.

[0115] "3 rd The four sequences (see Figure 17) that were subjected to sequence substitution based on "optimization No. 3" were subjected to the same evaluation system to estimate neutralizing activity as above. As a result, as shown in Table 2 below, the neutralizing activity was significantly higher than that of "3" before substitution, as well as the binding activity. rd It was found that the activity was comparable to that of "optimization No. 3".

[0116] [Table 2]

[0117] Based on the above results, when compared side by side, the sequence "3" was selected as the sequence with the highest binding activity and estimated neutralizing activity by substituting bases based on "D_26_1_5_L (=D_26_1_15)". rd The estimated neutralizing activity of "optimization No. 3 (D_26_1_5_LA11CU38G)" was calculated as IC50. As a result, as shown in Figure 18, the estimated neutralizing activity of "D_26_1_5_L (=D_26_1_15)" was 1.5 nM, while "3 rd The value for "optimization No.3 (alias: D_26_1_5_LA11CU38G)" was 0.9nM.

[0118] (Glycosylation (candidate1)) Next, based on "D_26_1_5_LA11CU38G," 2'OMe sugar chain modifications were added to confer resistance to nucleic acid degradation in blood and improve stability, as shown in Figure 19. First, 12 sequences were prepared and evaluated, and all showed high predicted neutralizing activity. However, as shown in Table 3 below, "Modification 11," which had the most 2'OMe modifications, was found to have predicted neutralizing activity equal to or higher than that of the unmodified sample.

[0119] [Table 3]

[0120] Furthermore, based on "Modification 11," 23 sequences (Modifications 13 to 35) shown in Figures 20 to 25 were prepared and evaluated. As a result, as shown in Table 4 below, "Modification 23" was found to be able to tolerate a large number of 2'OMe modifications among all sequences, including the unmodified "D_26_1_5_LA11CU38G," and to have a high predicted neutralizing activity.

[0121] [Table 4]

[0122] On the other hand, the estimated neutralizing activity of 10 sequences (Modifications 19, 20, 25, 26, 29 to 34) was less than half that of the unmodified "D_26_1_5_LA11CU38G," as shown in Table 4. This demonstrates that the sugar chains present at the relevant positions and their combinations have an important effect on the estimated neutralizing activity of the present invention.

[0123] Next, based on "Modification 23," 12 sequences (Modifications 36 to 47) shown in Figures 26 to 28 were prepared and evaluated. As a result, as shown in Table 5 below, the estimated neutralizing activity was maintained or improved overall, and it was found that "Modification 41" in particular could tolerate a large number of 2'OMe modifications among all sequences, including the unmodified "D_26_1_5_LA11CU38G," and had high estimated neutralizing activity.

[0124] [Table 5]

[0125] Next, based on "Modification 41," 16 sequences (Modifications 48 to 63) shown in Figures 29 to 32 were prepared and evaluated. As a result, as shown in Table 6 below, the estimated neutralizing activity tended to be maintained or slightly decreased except for three sequences (Modifications 53, 61, and 62).

[0126] [Table 6]

[0127] Three sequences (Modifications 41, 51, and 63) with high predicted neutralizing activity were selected and their IC50 was evaluated by SPR analysis. As a result, as shown in Table 6 above, all of them, including "Modification 41," showed high values ​​(1.6 to 2.1 nM).

[0128] Furthermore, based on "Modification 41," we evaluated the IC50 of the estimated neutralizing activity for sequences modified with polyethylene glycol (PEG), a common terminal modification for aptamers. As a result, as shown in Figure 33, it became clear that PEG modification did not significantly reduce activity.

[0129] (Selection (candidate2)) Using the SELEX data (using the Lb05N40 library) that identified candidate 1, we conducted in silico re-search for potential candidate sequences. Specifically, we used RaptRanker (PMID: 32537639), an analytical method that uncovers potential sequences based on local sequence and secondary structure, and RaptGen (DOI: 10.1038 / s43588-022-00249-6), an analytical method that utilizes artificial intelligence technology, to search for new aptamer candidate sequences. For RaptGen, we not only used the analytical method itself, but also added sequence frequency information to RaptGen, and combined SPR analysis results with Bayesian optimization to search for and generate new candidate sequences.

[0130] The 37 sequences (Lb05_w1 to Lb05_w24, w_M0 to w_M7, Freq-raw_5, Freq-log_3, Freq-log_4, Freq-log_5, Freq-log_8) presented by these multiple analytical methods were evaluated by SPR analysis in the same manner as above. As a result, as shown in Figure 34, it was found that two sequences (Freq-raw_5, Freq-log_3) exhibited high binding activity to DENV1-VLP.

[0131] (Shortened chain (candidate2)) Next, we attempted to shorten the two sequences (Freq-raw_5, Freq-log_3). Since both differ by one or two bases from the sequence (Lb05_D13_Abs_c1_1) that forms the basis of candidate 1, we assumed that similar shortening would be possible. We therefore created shortened sequences for each (Freq-raw_5_s, Freq-log_3_s) and evaluated them. As a result, as shown in Figure 35, we found that "Freq-raw_5_s" could be shortened while maintaining binding activity.

[0132] Furthermore, the sequence of "Freq-raw_5_s," which had high binding activity, was evaluated using "Freq-raw_5_log_3_S," which incorporates one inserted base that was not present in the "Lb05_D13_Abs_c1_1" sequence observed in "Freq-log_3" before shortening. As a result, as shown in Figure 36, it was found that the binding activity was slightly higher than that of "Freq-raw_5_s."

[0133] (Optimization (candidate2)) Based on "Freq_raw_5_s," "Freq-raw_5_log_3_S," and "Freq-log_3," we performed Doped-SELEX using three partially randomized Doped-libraries (Freq-raw_5_s_doped, Freq-raw_5-log_3_doped, Freq-log_3_s_doped) to search for sequences with even higher activity, and 30 candidate sequences (Clone Nos. d1 to d30) were evaluated by SPR analysis. As a result, as shown in Figures 37 and 38, "Freq-raw5_log3_c20_1 (Clone No. d10)" showed the highest binding activity.

[0134] Using this "Freq-raw5_log3_c20_1 (Clone No. d10)", we attempted to increase the activity by shortening the chain and optimizing the sequence (substitution and mutation) in the same manner as described above.

[0135] First, based on the sequence of "Freq-raw5_log3_c20_1 (Clone No. d10)," as shown in Figure 39, the terminal stem sequence was shortened to create sequence "s1" by referring to the example of the shortened form obtained with candidate 1. To further shorten this sequence, a total of eight sequences, including "s2" to "s8" and "s37," were evaluated. As a result, as shown in Figures 40 and 41, it was found that, like candidate 1, shortening down to approximately 53 bases was possible while maintaining binding activity. Subsequently, the shortened form "s2," which maintained high binding activity, was used to optimize the base sequence (substitution and mutation).

[0136] Based on "s2" (Freq_raw5_log3_c20_1_54_dU15), eight sequences were evaluated for sequence optimization. As a result, as shown in Table 7 below, all of the sequences had high binding activity.

[0137] [Table 7]

[0138] Taking "M2" (Freq_raw5_log3_c20_1_54_dU15_C16GG33U) as an example, the estimated neutralizing activity was compared with that of the optimized sequence (D_26_1_5_L_A11CU38G) before glycosylation of candidate 1. As a result, as shown in Figure 42 and Table 8 below, it was found that they have similar levels of activity.

[0139] [Table 8]

[0140] (Glycan modification (candidate2)) Next, based on "M2" (Freq_raw5_log3_c20_1_54_dU15_C16GG33U), 2'OMe modifications were added to the glycan, with the aim of imparting resistance to nucleic acid degradation in blood and improving stability, while taking the results of candidate 1 into consideration. First, 22 sequences shown in Figures 43 to 48 were prepared and evaluated. As a result, as shown in Table 9 below, all showed high predicted neutralizing activity, but among them, "Modification 17" was found to have a high number of 2'OMe modifications added and to have a predicted neutralizing activity as high as candidate 1.

[0141] [Table 9]

[0142] From the above results, as shown in Tables 10 and 11 below, the characteristics of all sequences in which binding activity was confirmed (10 RU or more was observed in SPR analysis) in the process of identifying candidate 1 (D_26_1_5_L_A11CU38G) (SEQ ID NO: 6) and candidate 2 (Freq_raw5_log3_c20_1_54_dU15_C16GG33U) (SEQ ID NO: 9) can be summarized as follows: "D_26series(candidate1 series)" = [5'-GGGUACCGACNBUABBBDDUUAAHAVWCGGCGGVBBUAVNGUUUCACCGAUACCC-3' (SEQ ID NO: 5; at least one nucleotide may be deleted at positions 20 and 21 in the nucleotide sequence set forth in SEQ ID NO: 5)], "Freq_raw5_log3series(candidate2 series)" = It was found that the nucleotide sequence was [5'-GGGUACCGACCRUAUGSVRUWAAAAUCGGCGGBBCUAYGGUUUCACCGAUACCC-3' (SEQ ID NO: 8. At least one nucleotide may be deleted at positions 15, 18 to 20, and 33 in the nucleotide sequence set forth in SEQ ID NO: 8)]. Furthermore, when these two base sequences are combined, "D_26 series&Freq_raw5_log3 series(candidate1&2 series)" = A shared sequence was found: [5'-GGGUACCGACNNUABBBNDUWAAHAVWCGGCGGNBBUANNGUUUCACCGAUACCC-3' (SEQ ID NO: 3. At least one nucleotide may be deleted at positions 15, 18 to 21, 24, and 34 in the nucleotide sequence set forth in SEQ ID NO: 3.)]

[0143] In addition, in the Doped-SELEX performed to identify the above candidate 1 and candidate 2, the characteristics of all sequences in which binding activity was observed were summarized as follows: "1 st doped(including candidate1)”= [5'-GGGUACCGACNBNRBBNDDUUAMHAVHCGGCGGNNNUHNNGUUUCACCGAUACCC-3' (SEQ ID NO: 4; at least one nucleotide may be deleted at positions 8, 15, 16, 20, and 21 in the nucleotide sequence set forth in SEQ ID NO: 4)], From the Doped-SELEX that generated candidate 2 "2 nd doped(including candidate2)”= It was found to have the following sequence characteristics: [5'-GGGUACCGACNNNDKBNNDHDNWNNRAWYDRYGGNNNYNNNRKUDYRSHGAUACCC-3' (SEQ ID NO: 7. At least one nucleotide may be deleted at positions 11, 12, 14 to 16, 18 to 22, 24, 27, 28, 35, and 36 in the nucleotide sequence set forth in SEQ ID NO: 7.)]

[0144] Furthermore, the characteristics of all sequences in which binding activity was observed during the identification of sequences for creating the above-mentioned doped library linked to candidate 1 and candidate 2 can be summarized as follows: A shared sequence was found: [5'-GGRUACCGWCANUAUGCRYUUAAHWAAUCGGCGGSSCUAYUGUUUYACCGAUACCC-3' (SEQ ID NO: 2; at least one nucleotide may be deleted at positions 3 to 7, 10 to 16, 18, 20 to 22, 24 to 29, 35 to 43, 46 to 47, and 51 to 54 in the nucleotide sequence set forth in SEQ ID NO: 2).

[0145] Furthermore, the characteristics of all sequences whose binding activity was confirmed in the entire process of identifying candidate 1 (D_26_1_5_L_A11CU38G) and candidate 2 (Freq_raw5_log3_c20_1_54_dU15_C16GG33U) as sequences shared by all of the above can be summarized as "ALL" = It was found that this can be expressed as [5'-GGRUACCGWCNNNDBBNNNHDNHNNVAHYDRYGGNNNHNNNRKUDYRSHGAUACCC-3' (SEQ ID NO: 1; at least one nucleotide may be deleted at positions 3 to 8, 10 to 16, 18 to 22, 24 to 29, 35 to 43, 46 to 47, and 51 to 54 in the nucleotide sequence set forth in SEQ ID NO: 1)].

[0146] [Table 10]

[0147] [Table 11]

[0148] Each T independently represents thymine or uracil, each M independently represents adenine or cytosine, each R independently represents adenine or guanine, each W independently represents adenine, thymine, or uracil, each S independently represents cytosine or guanine, each Y independently represents cytosine, thymine, or uracil, each K independently represents guanine, thymine, or uracil, each V independently represents adenine, cytosine, or guanine, each H independently represents adenine, cytosine, thymine, or uracil, each D independently represents adenine, guanine, thymine, or uracil, each B independently represents cytosine, guanine, thymine, or uracil, and each N independently represents adenine, cytosine, guanine, thymine, or uracil.

[0149] In Tables 10 and 11, and Tables 12 and 13 below, the numbers indicating the sites are based on the order in the nucleotide sequence set forth in SEQ ID NO:1. That is, numbers 1 to 26 and 28 to 56 in these tables (SEQ ID NO: 1) correspond to numbers 1 to 26 and 27 to 55 in SEQ ID NOs: 3 to 5, respectively; numbers 1 to 19, 22 to 26 and 28 to 56 in these tables (SEQ ID NO: 1) correspond to numbers 1 to 19, 20 to 24 and 25 to 53 in SEQ ID NO: 6, respectively; numbers 1 to 23, 25 to 26 and 28 to 56 in these tables (SEQ ID NO: 1) correspond to numbers 1 to 23, 24 to 25 and 26 to 54 in SEQ ID NO: 8, respectively; and numbers 1 to 19, 21 to 23, 25 to 26 and 28 to 56 in these tables (SEQ ID NO: 1) correspond to numbers 1 to 19, 20 to 22, 23 to 24 and 25 to 53 in SEQ ID NO: 9, respectively. In these tables, nucleotides in bold indicate nucleotides that can be deleted, as described above. Examples of secondary structures that can be taken by each of these sequences are shown in Figures 50 to 53.

[0150] Furthermore, from the results of each of the above glycosylation tests, as shown in Tables 12 and 13 below and FIG. 49, the sites in each of the sequences of candidate 1 and candidate 2 that are permissive for glycosylation were revealed.

[0151] [Table 12]

[0152] [Table 13]

[0153] In Tables 12 and 13, "OMe" indicates an acceptable site for 2'OMe modification.

[0154] (Verification of cross-reactivity) The sequence of candidate 1 above before glycosylation is "3 rdThe binding of "optimization No. 3 (D_26_1_5_LA11CU38G)" was evaluated against VLPs corresponding to all serotypes of dengue virus (DENV1 to DENV4) and VLPs of Japanese encephalitis virus (JEV), which is also a member of the Flavivirus genus. As a result, as shown in Figure 54, it was revealed that the antibody had binding activity against all types of VLPs.

[0155] (Evaluation of neutralizing activity against pathogenic dengue virus and the effect of aptamer multimerization) The neutralizing activity of candidate 1 ("Modification 41"), which had undergone the above-mentioned sugar chain modification, against pathogenic dengue viruses (DENV1 to DENV4) was evaluated. Furthermore, because increased activity due to aptamer multimerization has been reported (PMID: 33182593), the activity of "Modification 41" was evaluated as a monomer, as well as a dimer formed by linking two of these monomers (see Figure 56). The dimer was an oligonucleotide with three "Spacer18" molecules inserted as spacers between the aptamers, and was synthesized by Gene Design, Inc., just like the monomer.

[0156] The neutralizing activity against DENV1 to DENV4 was evaluated by PRNT (plaque reduction neutralization test) analysis using BHK cells. As a result, the IC50 values ​​for the monomers were 833.3 nM (DENV1), 374.7 nM (DENV2), 3091 nM (DENV3), and 1749 nM (DENV4), as shown in Figure 56 and Table 14. Furthermore, the IC50 values ​​for the dimers were 20.1 nM (DENV1), 0.327 nM (DENV2), 128.6 nM (DENV3), and 176.1 nM (DENV4), as shown in Figure 57 and Table 14 below.

[0157] [Table 14]

[0158] Furthermore, we confirmed that the aptamer does not induce antibody-dependent enhancement, a side effect often observed with antibody drugs. We performed PRNT analysis by adding various concentrations of the antibody (4G2 monoclonal antibody) to BHK cells overexpressing the Fc-gamma receptor. As shown in Figure 58, the infection efficiency of DENV1 increased at a specific low concentration range (around 0 to 100 nM). On the other hand, neither the monomer nor the dimer of the aptamer exhibited such an enhancement in infection efficiency, and only concentration-dependent neutralizing activity (infection-inhibitory effect) was observed.

[0159] (dissociation constant) SPR analysis was performed to evaluate the dissociation constant of the aptamer. The aptamer was the sequence "3" before glycosylation of the candidate 1. rd The dissociation constants for DENV1-VLP and the purified DENV3 recombinant envelope protein (DEMV3-ENV) were evaluated using "optimization No. 3 (D_26_1_5_LA11CU38G)." The results were 5.1 x 10^-11 M and 1.72 x 10^-9 M, respectively, as shown in Figures 59 and 60 and Table 15 below.

[0160] [Table 15] [Industrial Applicability]

[0161] As described above, the present invention enables the treatment or prevention of flavivirus infections. In particular, the aptamer of the present invention exhibits broad cross-reactivity and can target all serotypes of dengue virus and Japanese encephalitis virus, etc. Furthermore, the treatment or prevention is possible without accompanying enhanced infection (ADE). Therefore, the present invention is useful for the development of therapeutic and prophylactic agents for flavivirus infections.

Claims

1. An aptamer against flavivirus comprising the nucleotide sequence set forth in SEQ ID NO: 1 (However, at least one nucleotide may be deleted from the positions 3 to 8, 10 to 16, 18 to 22, 24 to 29, 35 to 43, 46 to 47, and 51 to 54 in the nucleotide sequence of SEQ ID NO:

1. In the nucleotide sequence set forth in SEQ ID NO: 1, each T independently represents thymine or uracil, each R independently represents adenine or guanine, each W independently represents adenine, thymine, or uracil, each S independently represents cytosine or guanine, each Y independently represents cytosine, thymine, or uracil, each K independently represents guanine, thymine, or uracil, each V independently represents adenine, cytosine, or guanine, each H independently represents adenine, cytosine, thymine, or uracil, each D independently represents adenine, guanine, thymine, or uracil, each B independently represents cytosine, guanine, thymine, or uracil, and each N independently represents adenine, cytosine, guanine, thymine, or uracil.

2. An aptamer against flavivirus, comprising at least one of the nucleotide sequences set forth in SEQ ID NOs: 2 and 3. (However, at least one nucleotide may be deleted at positions 3 to 7, 10 to 16, 18, 20 to 22, 24 to 29, 35 to 43, 46 to 47, and 51 to 54 in the nucleotide sequence of SEQ ID NO:

2. At least one nucleotide may be deleted at positions 15, 18 to 21, 24, and 34 in the nucleotide sequence of SEQ ID NO:

3. In the nucleotide sequences set forth in SEQ ID NOs: 2 and 3, each T independently represents thymine or uracil, each R independently represents adenine or guanine, each W independently represents adenine, thymine, or uracil, each S independently represents cytosine or guanine, each Y independently represents cytosine, thymine, or uracil, each V independently represents adenine, cytosine, or guanine, each H independently represents adenine, cytosine, thymine, or uracil, each D independently represents adenine, guanine, thymine, or uracil, each B independently represents cytosine, guanine, thymine, or uracil, and each N independently represents adenine, cytosine, guanine, thymine, or uracil.

3. An aptamer against flavivirus, comprising at least one of the nucleotide sequences set forth in SEQ ID NOs: 4, 5, 7 and 8. (However, at least one nucleotide may be deleted at positions 8, 15, 16, 20, and 21 in the nucleotide sequence of SEQ ID NO:

4. At least one nucleotide may be deleted at positions 20 and 21 in the nucleotide sequence of SEQ ID NO:

5. At least one nucleotide may be deleted at positions 11, 12, 14 to 16, 18 to 22, 24, 27, 28, 35, and 36 in the nucleotide sequence of SEQ ID NO:

7. At least one nucleotide may be deleted at positions 15, 18 to 20, and 33 in the nucleotide sequence of SEQ ID NO: 8.) In the nucleotide sequences set forth in SEQ ID NOs: 4, 5, 7, and 8, each T independently represents thymine or uracil, each M independently represents adenine or cytosine, each R independently represents adenine or guanine, each W independently represents adenine, thymine, or uracil, each S independently represents cytosine or guanine, each Y independently represents cytosine, thymine, or uracil, and each K independently represents each V independently represents adenine, cytosine, or guanine; each H independently represents adenine, cytosine, thymine, or uracil; each D independently represents adenine, guanine, thymine, or uracil; each B independently represents cytosine, guanine, thymine, or uracil; and each N independently represents adenine, cytosine, guanine, thymine, or uracil).

4. The aptamer of claim 1 , wherein at least one nucleotide is a modified nucleotide.

5. The aptamer of claim 4, wherein the modified nucleotide is a nucleotide in which, independently, the hydroxyl group at the 2' position of the ribose at each site is replaced with an atom or group selected from the group consisting of a hydrogen atom, a fluorine atom, and a methoxy group.

6. The aptamer of claim 1, which has, in the nucleotide sequence of SEQ ID NO: 1, a stem structure in which nucleotides 1 to 5 are paired with nucleotides 56 to 52, a loop structure formed by nucleotides 6 and 51, a stem structure in which nucleotides 7 and 8 are paired with nucleotides 50 to 49, a loop structure formed by nucleotides 48 to 44, a stem structure in which nucleotides 9 to 19 are paired with nucleotides 43 to 33 (including some bulge-out residues), and a loop structure formed by nucleotides 20 to 32.

7. An aptamer multimer comprising at least two aptamers linked together, the aptamers being selected from the group consisting of the aptamers according to claims 1 to 6.

8. A pharmaceutical composition for treating or preventing flavivirus infections, comprising at least one aptamer selected from the group consisting of the aptamers of claims 1 to 6.

9. The pharmaceutical composition according to claim 8, wherein the flavivirus infection is a dengue virus or Japanese encephalitis virus infection.

Images