Antisense oligomer compounds

Abstract

To provide a modified antisense oligonucleotide of about 10 to about 40 nucleobases.SOLUTION: The oligonucleotide comprises a targeting sequence having a region complementary to at least one string of three or more identical contiguous nucleobases in a target sequence. The target sequence comprises at least one additional nucleobase compared to the region of the targeting sequence. The at least one additional nucleobase has no complementary nucleobase in the region of the targeting sequence. The targeting region complementary to the at least one string of three or more identical contiguous nucleobases is internal to the targeting sequence.SELECTED DRAWING: None

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 62 / 573,985, entitled "ANTISENSE OLIGOMER COMPOUNDS," filed October 18, 2017, the disclosure of which is incorporated herein by reference.

[0002] The present disclosure relates to antisense oligomeric compounds in which the stretch of nucleobases present in the oligomeric compound is disrupted by the deletion of at least one nucleobase, and methods of using such compounds. [Background technology]

[0003] Antisense oligomers offer great pharmaceutical potential, as evidenced by the number of antisense drugs currently in clinical development and supported by the fact that several potential limitations of antisense oligomers have been successfully addressed in recent years (e.g., Devi et al., 2002; Antisense Nucleic Acids Acid Drug Dev.; see also, for example, Stein et al., 2001; Antisense Nucleic Acid Drug Dev.). Novel uncharged oligomeric backbones have been developed to improve cellular uptake and resistance to nuclease degradation (see, for example, Iversen et al., 2001; Antisense Drug Technology). For some oligomeric structures, such as morpholino-based structures, modified backbones have been shown to enhance the binding affinity for their target nucleic acids (see, for example, Iversen et al., 2001; Antisense Drug Technology; see also, Summerton et al., 1997; Antisense Nucleic Acid Drug Dev.). In some antisense applications, the optimal targeting sequence that antisense oligomers are directed to may comprise a biological palindrome sequence, or alternatively, a stretch of 3, 4 or more nucleic acid bases.Unexpectedly, it has been found that antisense oligomer compounds directed to target sequences that have a stretch of 3 or more consecutive identical nucleic acid bases, or alternatively, a biological palindrome sequence, may impair the antisense activity of the compound and present difficulties in the manufacturing process. [Prior art documents] [Non-patent literature]

[0004] [Non-Patent Document 1] Devi et al.,2002;Antisense Nucleic Acid Drug Dev. [Non-patent document 2] Stein et al.,2001;Also Antisense Nucleic Acid Drug Dev. [Non-patent document 3] Iversen et al.,2001;Antisense Drug Technology [Non-patent document 4] Iversen et al.,2001;Antisense Drug Technology [Non-patent document 5] Summerton et al.,1997;Antisense Nucleic Acid Drug Dev. Summary of the Invention [Means for solving the problem]

[0005] In various aspects, modifications to antisense oligomeric compounds are provided that have a stretch of three, four, or more nucleobases, or alternatively, a biological palindromic sequence, which in various embodiments improve the antisense activity of the compound and / or its manufacturing methods, including, but not limited to, aggregation that may occur during certain manufacturing methods.

[0006] In a further aspect, modified antisense oligonucleotides of about 10 to about 40 nucleobases are provided. The subject oligonucleotides comprise a targeting sequence having a region complementary to at least one stretch of three or more consecutive identical nucleobases in a target sequence, wherein the target sequence comprises at least one additional nucleobase compared to a region of the targeting sequence, and the at least one additional nucleobase does not have a nucleobase complementary to the region of the targeting sequence, and wherein the targeting region complementary to the at least one stretch of three or more consecutive identical nucleobases is internal to the targeting sequence. In embodiments, the targeting sequence comprises at least one stretch of three nucleobases. In embodiments, the targeting sequence comprises at least one stretch of four nucleobases. In embodiments, the at least one stretch of three or more nucleobases comprises at least one stretch of three or more guanine bases. In embodiments, the modified antisense oligonucleotide is conjugated to a peptide. In embodiments, the target sequence comprises an exon target associated with Duchenne muscular dystrophy (DMD). In embodiments, the target sequence comprises exon 44 in the processing of preprocessed mRNA of human dystrophin. In embodiments, the targeting sequence comprises any one of SEQ ID NOS: 2-7. In embodiments, the target sequence comprises exon 45, 51, or 53 in the processing of preprocessed mRNA of human dystrophin. In embodiments, the targeting sequence comprises any one of SEQ ID NOS: 72-120. In embodiments, the target sequence comprises an exon target associated with spinal muscular atrophy (SMA). In embodiments, the target sequence comprises a region adjacent to exon 7 in the processing of preprocessed mRNA of human SMN2. In embodiments, the targeting sequence comprises any one of SEQ ID NOS: 9-25. In embodiments, the target sequence comprises an exon target associated with glycogen storage disease type II (GSD-II). In embodiments, the target sequence comprises a region associated with exon 2 in the preprocessed mRNA of human acid alpha-glucosidase. In an embodiment, the targeting sequence comprises any one of SEQ ID NOs: 26-68.

[0007] In further aspects, the subject nucleotides comprise a targeting sequence having a region complementary to at least one biological palindromic sequence in the target sequence, wherein the target sequence comprises at least one additional nucleobase that does not have a nucleobase complementary to a region of the targeting sequence, wherein the targeting region complementary to the at least one biological palindromic sequence is internal to the targeting sequence. In embodiments, the at least one biological palindromic sequence comprises at least 5, at least 6, or at least 7 or more nucleobases. In embodiments, the modified antisense oligonucleotide is conjugated to a peptide. In embodiments, the targeting sequence comprises an exon target associated with Duchenne muscular dystrophy. In embodiments, the targeting sequence comprises exon 44 in the processing of human dystrophin preprocessed mRNA. In embodiments, the targeting sequence comprises any one of SEQ ID NOs: 2-7. In embodiments, the targeting sequence comprises exon 45, 51, or 53 of human dystrophin preprocessed mRNA. In embodiments, the targeting sequence comprises any one of SEQ ID NOs: 72-120. In embodiments, the targeting sequence comprises an exon target associated with spinal muscular atrophy. In embodiments, the targeting sequence comprises a region adjacent to exon 7 in the processing of preprocessed mRNA of human SMN2. In embodiments, the targeting sequence comprises any one of SEQ ID NOs: 9-25. In embodiments, the targeting sequence comprises an exon target associated with glycogen storage disease type II. In embodiments, the targeting sequence comprises a region associated with exon 2 of preprocessed mRNA of human acid alpha-glucosidase. In embodiments, the targeting sequence comprises any one of SEQ ID NOs: 26-68.

[0008] In various aspects and embodiments, the subject oligonucleotides are referred to as deletion sequences. The deletion sequence comprises any one of SEQ ID NOs: 1-128, wherein at least one nucleobase in any one of SEQ ID NOs: 1-128 is deleted. In embodiments, the deleted at least one nucleobase is within the sequence of any one of SEQ ID NOs: 1-128. In various embodiments, the deletion sequence comprises CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 69; eteplirsen); GTTGCCTCCGGTTCTGAAGGTGTTC (SEQ ID NO: 70; golodirsen); or CAATGCCATCCTGGAGTTCCTG (SEQ ID NO: 71; casimersen). In various embodiments, the deletion sequence comprises any one of SEQ ID NOs: 69-71, wherein at least one nucleobase in any one of SEQ ID NOs: 69-71 is deleted. In embodiments, the deleted at least one nucleobase is within the sequence of any one of SEQ ID NOs: 69-71. In an embodiment of the present invention, for example, the following items are provided: (Item 1) A modified antisense oligonucleotide of about 10 to about 40 nucleobases comprising a targeting sequence having a region complementary to at least one stretch of three or more consecutive identical nucleobases in a target sequence, wherein the target sequence comprises at least one additional nucleobase compared to said region of the targeting sequence, the at least one additional nucleobase does not have a nucleobase complementary to said region of the targeting sequence, and the targeting region complementary to the at least one stretch of three or more consecutive identical nucleobases is located within the targeting sequence. (Item 2) 2. The modified antisense oligonucleotide of item 1, wherein the targeting sequence comprises at least one stretch of three nucleobases. (Item 3) 2. The modified antisense oligonucleotide of item 1, wherein the targeting sequence comprises at least one stretch of four nucleobases. (Item 4) 2. The modified antisense oligonucleotide of item 1, wherein the at least one stretch of three or more nucleobases comprises at least one stretch of three or more guanine bases. (Item 5) 2. The modified antisense oligonucleotide of item 1, wherein the modified antisense oligonucleotide is conjugated to a peptide. (Item 6) 2. The modified antisense oligonucleotide of item 1, wherein the target sequence comprises an exon target associated with Duchenne muscular dystrophy. (Item 7) Item 8. The modified antisense oligonucleotide of Item 6, wherein the target sequence comprises exon 44 in the processing of preprocessed mRNA of human dystrophin. 7. The modified antisense oligonucleotide according to item 6, wherein the targeting sequence comprises any one of SEQ ID NOs: 2 to 7. (Item 9) 7. The modified antisense oligonucleotide of item 6, wherein the target sequence comprises exon 45, 51, or 53 in the processing of preprocessed mRNA of human dystrophin. (Item 10) 10. The modified antisense oligonucleotide according to item 9, wherein the targeting sequence comprises any one of SEQ ID NOs: 72 to 120. (Item 11) 2. The modified antisense oligonucleotide of item 1, wherein the target sequence comprises an exon target associated with spinal muscular atrophy. (Item 12) 12. The modified antisense oligonucleotide of item 11, wherein the target sequence comprises a region adjacent to exon 7 in the processing of preprocessed mRNA of human SMN2. (Item 13) 12. The modified antisense oligonucleotide according to item 11, wherein the targeting sequence comprises any one of SEQ ID NOs: 9 to 25. (Item 14) 2. The modified antisense oligonucleotide of item 1, wherein the target sequence comprises an exon target associated with glycogen storage disease type II. (Item 15) 15. The modified antisense oligonucleotide of item 14, wherein the target sequence comprises a region associated with exon 2 of the preprocessed mRNA of human acid alpha-glucosidase. (Item 16) 15. The modified antisense oligonucleotide according to item 14, wherein the targeting sequence comprises any one of SEQ ID NOs: 26 to 68. (Item 17) A modified antisense oligonucleotide of about 10 to about 40 nucleic acid bases containing a deletion sequence, wherein the deletion sequence comprises at least one nucleic acid sequence according to SEQ ID NOs: 1 to 128, at least one nucleic acid base is deleted from the base sequence, and the deleted at least one nucleic acid base is located within the base sequence. (Item 18) 18. The modified antisense oligonucleotide according to Item 17, wherein the base sequence is SEQ ID NO: 69, SEQ ID NO: 70, or SEQ ID NO: 71.

[0009] These and other objects and features of the present disclosure will become more fully apparent from the following detailed description read in conjunction with the accompanying drawings. [Brief explanation of the drawings]

[0010] [Figure 1] Figure 1 details the exon skipping percentage of the exon 44-directed deletion sequence. [Figure 2] Figure 2 details the specific deletion sequences. [Figure 3] FIG. 3 details the exon skipping percentages of the deleted sequences detailed in FIG. 2 for the regions flanking exons 7 and 8. [Figure 4] Figure 4 details a full dose-response experiment identifying a subset of highly active single-base deletion sequences. [Figure 5]Figure 5 details a full dose-response experiment identifying a subset of highly active single-base deletion sequences. [Figure 6] Figures 6A and 6B detail SCX HPLC chromatograms (PMO and PPMO) of SEQ ID NO: 125. (A) Details the chromatogram of SEQ ID NO: 125 PMO. (B) Details the chromatogram of SEQ ID NO: 125 as PPMO, showing the unconjugated PMO, the expected main peak of the conjugated PPMO, and high molecular weight aggregates in SEQ ID NO: 125 PPMO. [Figure 7] Figures 7A and 7B detail SCX HPLC chromatograms (PMO and PPMO) of SEQ ID NO: 126. (A) Details the chromatogram of SEQ ID NO: 126 PMO. (B) Details the chromatogram of SEQ ID NO: 126 as PPMO, showing the expected main peaks for the unconjugated PMO, the conjugated PPMO, and high molecular weight aggregates for SEQ ID NO: 126 PPMO. DETAILED DESCRIPTION OF THE INVENTION

[0011] I. Definitions and Interpretation Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the subject matter of this disclosure, preferred methods and materials are described. For purposes of this disclosure, the following terms are defined below.

[0012] As used herein, the articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical referent of the article. By way of example, "an element" means one element or more than one element.

[0013] As used herein, "about" means an amount, level, value, number, frequency, percentage, dimension, size, amount, weight, or length that varies by about 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1% of the reference amount, level, value, number, frequency, percentage, dimension, size, amount, weight, or length.

[0014] As used herein, unless the context otherwise requires, the words "comprise", "comprises", and "comprising" will be understood to imply the inclusion of the specified step or element or group of steps or elements, but not the exclusion of any other step or element or group of steps or elements.

[0015] As used herein, "consisting of" means including and limited to whatever follows the phrase "consisting of:." Thus, the phrase "consisting of" indicates that the listed elements are required or essential, and that other elements may not be present. "Consisting essentially of" means including any elements listed after the phrase and is limited to other elements that do not interfere with or contribute to the activity or function specified in this disclosure for the listed elements. Thus, the phrase "consisting essentially of" indicates that the listed elements are required or essential, but that other elements are optional and may or may not be present depending on whether they substantially affect the activity or function of the listed elements.

[0016] As used herein, "antisense oligonucleotide," "antisense oligomer," or "oligonucleotide" refers to a linear sequence of nucleotides or nucleotide analogs whose nucleobases are capable of hybridizing to a target sequence in RNA by Watson-Crick base pairing to form an oligomeric RNA heteroduplex within the target sequence. The terms "antisense oligonucleotide," "modified antisense oligonucleotide," "antisense oligomer," "oligomer," and "compound" may be used interchangeably to refer to an oligomer. The cyclic subunits may be based on ribose or another pentose sugar, or, in certain embodiments, on morpholino groups (see the description of morpholino oligomers herein). Also contemplated are peptide nucleic acids (PNAs), locked nucleic acids (LNAs), tricyclic DNA oligomers, tricyclophosphorothioate oligomers, and 2'-O-methyl oligomers, among other antisense agents known in the art. Non-naturally occurring oligomers, or "oligonucleotide analogs," include oligomers having (i) modified backbone structures, e.g., backbones other than the standard phosphodiester linkages found in naturally occurring oligonucleotides and polynucleotides, and / or (ii) modified sugar moieties, e.g., morpholino moieties rather than ribose or deoxyribose moieties. Oligomeric analogs support bases capable of hydrogen bonding by Watson-Crick base pairing with standard polynucleotide bases, where the analog backbone exhibits bases that permit such hydrogen bonding in a sequence-specific manner between the oligomeric analog molecule and bases in a standard polynucleotide (e.g., single-stranded RNA or single-stranded DNA). Preferred analogs are those having a substantially uncharged, phosphorus-containing backbone.

[0017] As used herein, a "nuclease-resistant" oligomer refers to one whose backbone, in either its unhybridized or hybridized form, is substantially resistant to nuclease cleavage by common extracellular and intracellular nucleases in the body (e.g., by 3'-exonucleases, endonucleases, exonucleases such as RNase H); i.e., the oligomer exhibits little or no nuclease cleavage under normal nuclease conditions in the body to which the oligomer is exposed. A "nuclease-resistant heteroduplex" refers to a heteroduplex formed by binding of an antisense oligomer to its complementary target, such that the heteroduplex is substantially resistant to in vivo degradation by intracellular and extracellular nucleases capable of cleaving double-stranded RNA / RNA or RNA / DNA complexes. A "heteroduplex" refers to a duplex between an antisense oligomer and the complementary portion of a target RNA.

[0018] As used herein, "coding sequence" means any nucleic acid sequence that contributes to the coding of the polypeptide product of a gene. In contrast, the term "non-coding sequence" refers to any nucleic acid sequence that does not directly contribute to the coding of the polypeptide product of a gene.

[0019] As used herein, the terms "contacting a cell," "introducing," or "delivering" include delivery of an oligomer of the present disclosure to a cell by methods conventional in the art, such as transfection (e.g., liposomes, calcium phosphate, polyethyleneimine), electroporation (e.g., nucleofection), or microinjection.

[0020] As used herein, the term "alkyl" is intended to include linear (i.e., unbranched or acyclic), branched, cyclic, or polycyclic non-aromatic hydrocarbon groups, optionally substituted with one or more functional groups. Unless otherwise specified, "alkyl" groups contain 1 to 8, and preferably 1 to 6, carbon atoms. C1-C6 alkyl is intended to include C1, C2, C3, C4, C5, and C6 alkyl groups. Lower alkyl refers to an alkyl group containing 1 to 6 carbon atoms. Examples of alkyl include, but are not limited to, methyl, ethyl, n-propyl, isopropyl, cyclopropyl, butyl, isobutyl, sec-butyl, tert-butyl, cyclobutyl, pentyl, isopentyl, tert-pentyl, cyclopentyl, hexyl, isohexyl, cyclohexyl, and the like. Alkyl can be substituted or unsubstituted. Exemplary substituted alkyl groups include, but are not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, 2-fluoroethyl, 3-fluoropropyl, hydroxymethyl, 2-hydroxyethyl, 3-hydroxypropyl, benzyl, substituted benzyl, phenethyl, substituted phenethyl, and the like.

[0021] As used herein, "alkenyl" refers to an unsaturated monovalent group containing carbon and hydrogen, which may be branched, straight-chained, or cyclic. Alkenyl groups can be monounsaturated or polyunsaturated. Generally, alkenyl groups having 1 to 6 carbon atoms, referred to as "lower alkenyl," are preferred.

[0022] As used herein, the term "alkoxy" refers to a moiety of alkyl having an alkyl group, as defined above, having the indicated number of carbon atoms attached through an oxygen bridge. For example, "alkoxy" refers to the group -O-alkyl, where the alkyl group contains 1 to 8 carbon atoms in a linear, branched, or cyclic configuration. Examples of "alkoxy" include, but are not limited to, methoxy, ethoxy, n-propoxy, i-propoxy, t-butoxy, n-butoxy, s-pentoxy, and the like.

[0023] As used herein, the term "aryl," used alone or as part of a larger moiety, such as in "aralkyl," "aralkoxy," or "aryloxy-alkyl," refers to an aromatic ring group having 6 to 14 ring atoms, such as phenyl, 1-naphthyl, 2-naphthyl, 1-anthracyl, and 2-anthracyl. The "aryl" ring may contain one or more substituents. The term "aryl" may be used interchangeably with the term "aryl ring." "Aryl" also includes fused polycyclic aromatic ring systems in which an aromatic ring is fused to one or more rings. Non-limiting examples of useful aryl ring groups include phenyl, hydroxyphenyl, halophenyl, alkoxyphenyl, dialkoxyphenyl, trialkoxyphenyl, alkylenedioxyphenyl, naphthyl, phenanthryl, anthryl, phenanthro, etc., as well as 1-naphthyl, 2-naphthyl, 1-anthracyl, and 2-anthracyl. Also included within the scope of the term "aryl," as it is used herein, are groups in which an aromatic ring is fused to one or more non-aromatic rings, such as in indanyl, phenanthridinyl, or tetrahydronaphthyl, where the linking group or point of attachment is on the aromatic ring. "Aralkyl" refers to an alkyl, preferably lower (C1-C4, more preferably C1-C2) alkyl, substituent further substituted with an aryl group; examples are benzyl (-CH2C6H5) and phenethyl (-CH2CH2C6H5).

[0024] As used herein, the term "substituted" with respect to an alkyl, alkenyl, alkynyl, aryl, aralkyl, or alkaryl group refers to the replacement of a hydrogen atom with a heteroatom-containing substituent such as, for example, halogen, hydroxy, alkoxy, thiol, alkylthio, amino, alkylamino, imino, oxo(keto), nitro, cyano, or various acids or esters, e.g., carboxylic, sulfonic, or phosphonic acids or esters.

[0025] As used herein, the term "acyl" refers to a C(O)R group, where R represents H, alkyl, or aryl as defined above. Examples of acyl groups include formyl, acetyl, benzoyl, phenylacetyl, and similar groups.

[0026] As used herein, the term "homolog" refers to compounds that differ systematically by the sequential addition of the same chemical groups. For example, homologs of a compound may differ by the addition of one or more -CH2- groups, amino acid residues, nucleotides, or nucleotide analogs.

[0027] As used herein, the terms "cell-penetrating peptide" (CPP) or "peptide moiety that enhances cellular uptake" are used interchangeably and refer to cationic cell-penetrating peptides, also referred to as "transport peptides," "carrier peptides," or "peptide transduction domains." These peptides, as demonstrated herein, have the ability to induce cell penetration in about or at least about 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% of the cells in a given cell culture population, enabling the translocation of macromolecules within multiple tissues in vivo upon systemic administration. In some embodiments, the CPP is of the formula -[(C(O)CHR'NH)m]R" where R' is the side chain of a naturally occurring amino acid or its one- or two-carbon homolog, R" is selected from hydrogen or acyl, and m is an integer of 50 or less. A CPP may also have the formula -[(C(O)CHR'NH)m]Ra, where R' is the side chain of a naturally occurring amino acid or its one- or two-carbon homolog, and Ra is selected from hydrogen, acyl, benzoyl, or stearoyl. A CPP of any structure may be linked to the 3' or 5' end of an antisense oligomer via a "linker," such as -C(O)(CH2)5NH-, -C(O)(CH2)2NH-, -C(O)(CH2)2NH-C(O)(CH2)5NH-, or -C(O)CH2NH-. Additional CPPs are known in the art and are disclosed, for example, in U.S. Patent Application Publication No. 2010 / 0016215, which is incorporated by reference in its entirety. In other embodiments, m is an integer selected from 1 to 50, and when m is 1, the moiety is a single amino acid or derivative thereof.

[0028] As used herein, "amino acid" refers to a compound consisting of a primary amino group, a carboxylic acid group, a side chain, and a carbon atom to which a hydrogen atom is attached. For example, the term "amino acid" includes, but is not limited to, glycine, alanine, valine, leucine, isoleucine, asparagine, glutamine, lysine, and arginine. In addition, as used herein, "amino acid" also includes derivatives of amino acids, such as esters, amides, and salts, as well as other derivatives, including derivatives that have pharmaceutical properties and become active upon metabolism. Thus, the term "amino acid" is understood to include naturally occurring and non-naturally occurring amino acids.

[0029] As used herein, "electron pair" refers to a valence pair of electrons that is not bonded to or shared with another atom.

[0030] As used herein, "homology" refers to the percentage number of amino acids that are identical or that make conservative substitutions. Homology may be determined using sequence comparison programs such as GAP (Deveraux et al., 1984, Nucleic Acids Research 12, 387-395. In this method, sequences of similar or substantially different lengths to those described herein can be compared by inserting gaps in the alignment, such gaps being determined, for example, by the comparison algorithm used in GAP.

[0031] As used herein, "isolated" refers to material that is substantially or essentially free from components that normally accompany it in its natural state. For example, an "isolated polynucleotide," "isolated oligonucleotide," or "isolated oligomer," as used herein, can refer to a polynucleotide that has been purified or removed from sequences adjacent to it in its naturally occurring state, e.g., a DNA fragment that has been removed from sequences that flank the fragment in the genome. The term "isolate," when it refers to a cell, refers to the purification of a cell (e.g., a fibroblast, lymphoblast) from a source subject (e.g., a subject with a polynucleotide repeat disease). In the context of mRNA or protein, "isolate" refers to the recovery of the mRNA or protein from a source, e.g., a cell.

[0032] As used herein, the term "modulate" includes "increasing" or "decreasing" one or more quantifiable parameters by a defined and / or statistically significant amount, as appropriate. "Increase" or "increasing," "enhance" or "enhancing," or "stimulate" or "stimulating" generally refer to the ability of one or more antisense compounds or compositions to produce or cause a greater physiological response (i.e., downstream effect) in a cell or subject compared to the response caused by either no antisense compound or a control compound. Relevant physiological or cellular responses (in vivo or in vitro) will be apparent to those of skill in the art. An "increased" or "enhanced" amount is typically a "statistically significant" amount and can include an increase of 1.1, 1.2, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, or more (e.g., 500, 1000-fold) (including all integers and decimals in between and greater than 1, e.g., 1.5, 1.6, 1.7, 1.8)) over the amount produced without the antisense compound (no agent) or with a control compound. The terms "reduce" or "inhibit" generally refer to the ability of one or more antisense compounds or compositions to "lessen" a relevant physiological or cellular response, such as a symptom of a disease or condition described herein, as measured by routine techniques in the diagnostic arts. Relevant physiological or cellular responses (in vivo or in vitro) will be apparent to those skilled in the art and can include a reduction in the symptoms or pathology of a glycogen storage disease, such as Pompe disease, e.g., a reduction in glycogen accumulation in one or more tissues. A "reduction" in response may be "statistically significant" when compared to the response produced by no antisense compound or a control composition and may include a reduction of 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% (including all integers in between).

[0033] As used herein, "nucleobase" (Nu), "base-pairing moiety," or "base" are used interchangeably to refer to the purine or pyrimidine bases (uracil, thymine, adenine, cytosine, and guanine) found in natural DNA or RNA, as well as analogs of naturally occurring purines and pyrimidines that confer improved properties, such as binding affinity, to oligomers. Exemplary analogs include hypoxanthine (the base component of the nucleoside inosine); 2,6-diaminopurine; 5-methylcytosine; C5-propynyl-modified pyrimidines; 9-(aminoethoxy)phenoxazine (G-clamp); and the like. Further examples of base pairing moiety include, but are not limited to, uracil, thymine, adenine, cytosine, guanine and hypoxanthine, whose amino groups are protected by acyl protecting groups, 2-fluorouracil, 2-fluorocytosine, 5-bromouracil, 5-iodouracil, 2,6-diaminopurine, azacytosine, pseudoisocytosine and pseudouracil, and other modified nucleobases, such as 8-substituted purine, xanthine or hypoxanthine (the latter two are natural degradation products).Also contemplated are the modified nucleobases disclosed in Chiu and Rana, RNA, 2003, 9, 1034-1048, Limbach et al. Nucleic Acids Research, 1994, 22, 2183-2196 and Revankar and Rao, Comprehensive Natural Products Chemistry, vol.7, 313. Further examples of base-pairing moieties include, but are not limited to, extended-size nucleobases to which one or more benzene rings have been added. Glen Research Catalog (www.glenresearch.com); Krueger AT et al., Acc. Chem. Res., 2007, 40, 141-150; Kool, ET, Acc. Chem. Res., 2002, 35, 936-943; Benner The nucleobase replacements described in SA, et al., Nat. Rev. Genet., 2005, 6, 553-543; Romesberg, FE, et al., Curr. Opin. Chem. Biol., 2003, 7, 723-733; Hirao, I., Curr. Opin. Chem. Biol., 2006, 10, 622-627 are contemplated as useful in the synthesis of the oligomers described herein. Examples of extended size nucleobases are shown below: [ka]

[0034] A nucleic acid base covalently linked to a ribose, sugar analog, or morpholino comprises a nucleoside. A "nucleotide" is a nucleoside combined with a single phosphate group. The phosphate groups covalently link adjacent nucleotides to each other to form an oligomer.

[0035] As used herein, the terms "deletion sequence," "gapmer," or "blebmer" generally refer to an oligomeric sequence of nucleobases that has at least one less nucleobase than its target sequence. In various aspects and embodiments, the terms "deletion sequence," "gapmer," or "blebmer" specifically refer to a targeting sequence having a region complementary to at least one stretch of three or more consecutive identical nucleobases in the target sequence, wherein the targeting sequence contains at least one additional nucleobase compared to this region of the targeting sequence, and this at least one additional nucleobase does not have a nucleobase complementary to a region of the targeting sequence, and wherein the targeting region complementary to the at least one stretch of three or more consecutive identical nucleobases is internal to the targeting sequence. Alternatively or additionally, in further aspects and embodiments, any of the terms "deletion sequence," "gapmer," or "blebmer" may also specifically refer to a targeting sequence having a region complementary to at least one biological palindrome sequence in a target sequence, wherein the target sequence includes at least one additional nucleobase that does not have a nucleobase complementary to this region of the targeting sequence, and wherein the targeting region complementary to the at least one biological palindrome sequence is internal to the targeting sequence.

[0036] As used herein, the term "biological palindromic sequence" refers to an oligonucleotide sequence in which one portion of the oligonucleotide sequence, when read in reverse, is antisense to another portion of the oligonucleotide sequence.

[0037] As used herein, an oligomer "specifically hybridizes" to a target polynucleotide if the oligomer hybridizes to the target under physiological conditions at a Tm substantially greater than 40°C or 45°C, preferably at least 50°C, and typically 60°C to 80°C or higher. Such hybridization preferably corresponds to stringent hybridization conditions. At a given ionic strength and pH, the Tm is the temperature at which 50% of the target sequence hybridizes to a complementary polynucleotide. Such hybridization can occur with "near" or "substantial" complementarity of the antisense oligomer to the target sequence, as well as exact complementarity.

[0038] As used herein, "sufficient length" refers to an antisense oligomer or its targeting sequence that is complementary to at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 or more consecutive nucleobases, e.g., 8-40, and e.g., 15-40, in the GAA intron 1, exon 2, or intron 2 region, or a region spanning any of the foregoing. An antisense oligomer of sufficient length has at least the minimum number of nucleotides required for specific hybridization to a region of the GAA pre-mRNA repeat, e.g., in a mutant RNA. Preferably, an oligomer of sufficient length is 8-30 nucleotides in length. More preferably, an oligomer of sufficient length is 9-27 nucleotides in length. Even more preferably, the full length oligomer is 15 to 40 nucleotides in length.

[0039] As used herein, the term "sequence identity," or, for example, including "a sequence 50% identical to," refers to the degree to which sequences are identical nucleotide-by-nucleotide or amino acid-by-amino acid over a comparison window. Thus, "percentage sequence identity" can be calculated by comparing two optimally aligned sequences over a comparison window, determining the number of positions where the same nucleic acid base (e.g., A, T, C, G, I) or the same amino acid residue (e.g., Ala, Pro, Ser, Thr, Gly, Val, Leu, Ile, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gln, Cys, and Met) occurs in both sequences to obtain the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window (i.e., the window size), and multiplying the result by 100 to obtain the percentage of sequence identity. Optimal sequence alignment for the alignment of the comparison window was determined using algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package release 7.0, Genetics Computer Group, 575 Science The alignment may be performed by computer implementations of the BLAST program (BioScience Drive Madison, Wis., USA) or by visual inspection, and the best alignment (i.e., the one resulting in the highest percentage homology over the comparison window) may be generated by any of a variety of methods selected. For example, reference may also be made to the BLAST family of programs as disclosed by Altschul et al., Nucl. Acids Res. 25:3389, 1997.

[0040] As used herein, a "subject" or a "subject in need thereof" includes, but is not limited to, a mammalian subject, such as a human subject. Exemplary mammalian subjects have or are at risk of having GSD-II (or Pompe disease), or SMA, or DMD.

[0041] As used herein, the term "target" refers to an RNA region, and by way of non-limiting example, a region identified by the GAA gene. In a non-limiting embodiment, the target is a region within intron 1 of the GAA-encoding pre-mRNA that is involved in repressing a signal that promotes incorporation of exon 2. In another embodiment, the target region is a region of the GAA exon 2 mRNA. In a further embodiment, the target comprises one or more distinct subregions of intron 1 of the GAA-encoding pre-mRNA.

[0042] As used herein, the term "target sequence" refers to the portion of a target RNA to which an oligomeric analog is directed, i.e., the sequence to which the oligomeric analog will hybridize by Watson-Crick base pairing of a complementary sequence.

[0043] As used herein, the term "targeting sequence" refers to a sequence in an oligomer or oligomer analog that is complementary (which also means substantially complementary) to a "target sequence" in an RNA genome. The entire sequence of an antisense oligomer may be complementary to the target sequence, or only a portion of the sequence. For example, in an oligomer having 20-30 bases, approximately 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 may be targeting sequences complementary to the target region. Typically, the targeting sequence is formed by consecutive bases in the oligomer, but may alternatively be formed by non-contiguous sequences that, when placed together (e.g., from opposite ends of the oligomer), span the target sequence.

[0044] As used herein, a "targeting sequence" may have "near" or "substantial" complementarity with a target sequence and still function for purposes of the present disclosure, i.e., still be "complementary." In embodiments, oligomeric analog compounds used in the present disclosure have at most one mismatch with a target sequence within 10 nucleotides, and preferably at most one mismatch within 20 nucleotides. In embodiments, oligomeric analog compounds used in the present disclosure have at least one mismatch with a target sequence within 10 nucleotides, and preferably at least one mismatch within 20 nucleotides. Alternatively, the antisense oligomers used have at least 90% sequence identity, and preferably at least 95% sequence identity, with the exemplary targeting sequences as specified herein.

[0045] As used herein, the term "TEG" or "triethylene glycol tail" refers to a triethylene glycol moiety conjugated to an oligonucleotide, e.g., at its 3' or 5' end. For example, in some embodiments, "TEG" includes, e.g., T of a compound of Formula (I), (VI), or (VII), is [ka] It is of the formula:

[0046] As used herein, the terms "quantify," "quantification," or other related phrases refer to determining the amount, mass, or concentration in a unit volume of a nucleic acid, polynucleotide, oligomer, peptide, polypeptide, or protein.

[0047] As used herein, "treatment" of a subject (e.g., a mammal such as a human) or cell is any type of intervention used to alter the natural course of an individual or cell. Treatment includes, but is not limited to, the administration of a pharmaceutical composition and can be performed prophylactically or after the onset of a pathological event or after contact with a pathogen. It also includes "prophylactic" treatment, which may be directed to reducing the rate of progression of the disease or condition being treated, delaying the onset of the disease or condition, or reducing the severity of its onset. "Treatment" or "prevention" does not necessarily refer to the complete eradication, cure, or prevention of the disease or condition, or its associated symptoms.

[0048] As used herein, "heterocycle" refers to a non-aromatic ring, preferably a 5- to 7-membered ring, whose ring atoms are selected from the group consisting of carbon, nitrogen, oxygen, and sulfur. Preferably, the ring atoms contain 3 to 6 carbon atoms. Examples of such heterocycles include pyrrolidine, piperidine, piperazine, and morpholine.

[0049] As used herein, a "morpholino oligomer" is an oligonucleotide analog composed of morpholino subunit structures, where (i) the structures are 1 to 3 atoms long, preferably 2 atoms long, and preferably uncharged, and are linked together by phosphorus-containing linkages connecting the morpholino nitrogen of one subunit to the 5' exocyclic carbon of an adjacent subunit, and (ii) Pi and Pj are purine or pyrimidine base-pairing moieties effective to bind to bases of a polynucleotide by base-specific hydrogen bonding. The purine or pyrimidine base-pairing moieties are typically adenine, cytosine, guanine, uracil, or thymine. The synthesis, structure, and binding properties of morpholino oligomers are described in detail in U.S. Patent Nos. 5,698,685; 5,217,866; 5,142,047; 5,034,506; 5,166,315; 5,521,063; and 5,506,337, all of which are incorporated herein by reference. Desirable chemical properties of morpholino-based oligomers include the ability of oligomers as short as 8-14 bases to selectively hybridize with complementary base target nucleic acids, including target RNAs, with high Tm, the ability to be actively transported into mammalian cells, and the ability of oligomeric RNA heteroduplexes to resist RNase degradation.

[0050] As used herein, a "substantially uncharged" morpholino oligomer contains at most one charged inter-subunit linkage for every four, preferably ten, and more preferably twenty uncharged inter-subunit linkages. Any charged linkages are preferably charged phosphoramidate (or thiophosphoramidate) linkages. Preferably, the morpholino oligomer is completely uncharged.

[0051] As used herein, an "amino acid subunit" is preferably an α-amino acid residue (i.e., -CO-CHR-NH-); it may also be a β- or other amino acid residue (e.g., -CO-CHCHR-NH-), where R is a side chain.

[0052] As used herein, "G-quadruplex" includes stacked, planar, hydrogen-bonded guanine tetramers that can force guanine-rich nucleic acids into inter- and intramolecular quadruplex structures stabilized by the presence of the G-quadruplex.

[0053] As used herein, the term "unnatural amino acid" refers to an amino acid that is not found in naturally occurring proteins, such as β-alanine (β-Ala) or 6-aminohexanoic acid (Ahx).

[0054] As used herein, the abbreviation "DMD" refers to Duchenne muscular dystrophy.

[0055] As used herein, the abbreviation "SMA" refers to spinal muscular atrophy.

[0056] II. Description of the Disclosure A. Antisense Oligomeric Compounds In some embodiments, antisense oligomer compounds are synthetic oligomers, such as antisense oligonucleotide analogs, that have base-specific binding ability to target sequences of polynucleotides.Such analogs, which modify the backbone structure, cyclic structure, or less frequently the base structure of natural polynucleotides, are well known, and include charged analogs such as phosphorothioate-linked oligonucleotides, and uncharged analogs such as methylphosphonates and peptide nucleic acids.Some analogs, such as N3'→P5' phosphoramidate, can be charged or uncharged depending on the substitution of the linking moiety.

[0057] In embodiments, the antisense oligomeric compound is a morpholino oligomer, as defined above, which is about 8 to 40 subunits in length. More typically, the oligomer is about 10 to 30, or about 12 to 25 subunits in length. For some applications, such as antibacterial short oligomers, lengths of, for example, about 8 to 12 subunits may be particularly advantageous, particularly when attached to peptide transporters as disclosed herein. Preferably, the oligomer is an uncharged phosphorodiamidate-linked morpholino oligomer (PMO), also defined above. PMOs can be of any sequence, where the base-pairing groups supported include standard or modified A, T, C, G, I, and U bases.

[0058] In some embodiments, the target nucleic acid sequence to which the oligomeric compound is directed comprises a region having a stretch of three or more consecutive identical nucleobases. In some embodiments, the three or more consecutive identical nucleobases are three consecutive identical nucleobases. In some embodiments, the three or more consecutive identical nucleobases are four consecutive identical nucleobases. In some embodiments, the three or more consecutive identical nucleobases are five consecutive identical nucleobases. In some embodiments, the three or more consecutive identical nucleobases are six consecutive identical nucleobases. In some embodiments, the three or more consecutive identical nucleobases are seven consecutive identical nucleobases. In some embodiments, the three or more consecutive identical nucleobases are eight consecutive identical nucleobases. In some embodiments, the three or more consecutive identical nucleobases are nine or more consecutive identical nucleobases.

[0059] In embodiments, three or more consecutive identical nucleobases are reduced to two consecutive identical nucleobases. In embodiments, three consecutive identical nucleobases are reduced to two consecutive identical nucleobases (i.e., one nucleobase is removed). In embodiments, four consecutive identical nucleobases are reduced to two consecutive identical nucleobases (i.e., two nucleobases are removed). In embodiments, five consecutive identical nucleobases are reduced to two consecutive identical nucleobases (i.e., three nucleobases are removed). In embodiments, six consecutive identical nucleobases are reduced to two consecutive identical nucleobases (i.e., four nucleobases are removed). The same nucleobase removal technique can also be performed on more than six consecutive identical nucleobases.

[0060] In further embodiments, the stretch of three or more consecutive identical nucleobases is a stretch of three or more consecutive G nucleobases. In embodiments, the stretch of three or more consecutive G nucleobases is three consecutive G nucleobases. In embodiments, the stretch of three or more consecutive G nucleobases is 4, 5, 6, 7, 8, 9, or more consecutive G nucleobases.

[0061] In embodiments, three or more consecutive G nucleobases are reduced to two consecutive G nucleobases. In embodiments, three consecutive G nucleobases are reduced to two consecutive G nucleobases (i.e., one G nucleobase is removed). In embodiments, four consecutive G nucleobases are reduced to two consecutive G nucleobases (i.e., two G nucleobases are removed). In embodiments, five consecutive G nucleobases are reduced to two consecutive G nucleobases (i.e., three G nucleobases are removed). In embodiments, six consecutive G nucleobases are reduced to two consecutive G nucleobases (i.e., four G nucleobases are removed). The same nucleobase removal technique can also be performed on more than six identical consecutive G nucleobases.

[0062] In certain embodiments, the target nucleic acid sequence to which the oligomeric compound is directed comprises a region with a biological palindromic sequence. Alternatively, the target region may comprise or be adjacent to a donor or acceptor splice site of a preprocessed mRNA, where it is desirable to prevent correct splicing at that site in order to generate either a splice variant polypeptide or an abortive or inactive peptide. In yet another embodiment, the target may be a cis-acting element of a viral genome, where binding of the oligomer (which may be targeted to either the + or - viral genome strand) is effective in preventing viral replication in virally infected cells.

[0063] For exemplary target sequences containing stretches of three, four, or more nucleobases or biological palindromic sequences for each of these target types, reference can be made to public sequence databases known to those skilled in the art. However, it should be understood that the various deletions in targeting sequences described throughout this disclosure are exemplary of how oligomeric compounds can be modified to achieve the benefits of the present invention.

[0064] Transporters can be linked to the compound to be delivered by a variety of methods available to those skilled in the art. In one example, the transporter is a peptide containing a single cysteine ​​residue, the side chain thiol of which is used for linkage. The linkage point can be at various positions along the transporter. In selected embodiments, it is at the end of the transporter. Typically, it is adjacent to the hydrophobic residue of the transporter. Multiple transporters can be attached to a single compound if desired.

[0065] The linker may also be any combination of two β-Ala and / or Ahx residues attached to the 5'-terminus of the PMO and the C-terminus of the peptide transporter. A preferred embodiment is to attach an Ahx residue to the C-terminus of the peptide transporter and a β-Ala residue to the 5'-terminus of the PMO.

[0066] When the compound is a PMO, the transporter can be attached to the 5'-terminus of the PMO, for example, via the 5'-hydroxyl group or via an amine capping moiety. Alternatively, the transporter may be attached to the 3'-terminus, for example, via a morpholino ring nitrogen or via a side chain of an intersubunit linkage at either a terminal or internal linkage. The linker may also include a direct bond formed, for example, by carbodiimide-promoted condensation, between the carboxy terminus of the transporter peptide and an amine or hydroxy group of the PMO.

[0067] The linker can be selected from those containing, for example, a thioether or carbamate bond that is not cleavable under normal conditions of use. In some embodiments, it may be desirable to include an in vivo cleavable bond between the transporter moiety and the compound. In vivo cleavable bonds are known in the art and include, for example, carboxylic acid esters that are enzymatically hydrolyzed and disulfides that are cleaved in the presence of glutathione. It may also be feasible to cleave photolytically cleavable bonds, such as ortho-nitrophenyl ethers, in vivo by application of radiation of an appropriate wavelength.

[0068] For example, preparation of conjugates with disulfide linkers using the reagents N-succinimidyl 3-(2-pyridyldithio)propionate (SPDP) or succinimidyloxycarbonyl α-methyl-α-(2-pyridyldithio)toluene (SMPT). Exemplary heterobifunctional linking agents further comprising a cleavable disulfide group include N-hydroxysuccinimidyl 3-[(4-azidophenyl)dithio]propionate and others described in (see Vanin and Ji, 1981).

[0069] In embodiments, antisense targeting sequences are designed to hybridize with one or more regions in the target sequence.The selected antisense targeting sequence can be short (for example, about 12 bases) or long (for example, about 40 bases), and can contain a small number of mismatches, as long as the sequence is sufficiently complementary to cause splice regulation when hybridized to the target sequence, and optionally forms a heteroduplex with RNA with a Tm of 45°C or higher.

[0070] In embodiments, the degree of complementarity between the target sequence and the antisense targeting sequence is sufficient to form a stable duplex. The region of complementarity with the target RNA sequence in the antisense oligomer can be as short as 8-11 bases, but can also be 12-15 bases or longer, for example, 10-40 bases, 12-30 bases, 12-25 bases, 15-25 bases, 12-20 bases, or 15-20 bases (including all integers between these ranges). An antisense oligomer of about 14-15 bases is generally long enough to have a unique complementary sequence. In certain embodiments, as discussed herein, a minimum length of complementary bases may be required to achieve the required binding Tm.

[0071] In embodiments, oligomers as long as 40 bases may be suitable, where at least a minimum number of bases, e.g., 10-12 bases, are complementary to the target sequence. In some embodiments, enhanced uptake or active uptake in cells is optimized at oligomer lengths of less than about 30 bases. For the PMO oligomers described further herein, the optimal balance between binding stability and uptake generally occurs at lengths of 18-25 bases. The present disclosure includes about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 base antisense oligomers (e.g., PMO, PMO-X, PNA, LNA, 2'-OMe), where at least about 6, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 contiguous or non-contiguous bases are complementary to the target sequence.

[0072] In embodiments, the antisense oligomer typically comprises a base sequence sufficiently complementary to a sequence or region within or adjacent to intron 1, exon 2, or intron 2 of the pre-mRNA sequence of the human GAA gene. Ideally, the antisense oligomer is capable of effectively modulating aberrant splicing of the GAA pre-mRNA, thereby increasing expression of active GAA protein. This requirement is met, as appropriate, if the oligomeric compound is capable of being actively taken up by mammalian cells and, after uptake, of forming a stable duplex (or heteroduplex) with the target mRNA, as appropriate, with a Tm greater than about 40°C or 45°C.

[0073] In embodiments, the antisense oligomer typically comprises a base sequence sufficiently complementary to a sequence or region within or adjacent to an exon associated with DMD, SMA, or Pompe disease.

[0074] In embodiments, antisense oligomers may be 100% complementary to a target sequence, or may contain mismatches (e.g., to accommodate variants), so long as the heteroduplex formed between the oligomer and the target sequence is sufficiently stable to withstand the action of cellular nucleases and other degradation modes that may occur in vivo. Thus, certain oligomers may have substantial complementarity between the oligomer and the target sequence, i.e., about or at least about 70% sequence complementarity, e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence complementarity. The oligomer backbone discussed herein is less susceptible to nuclease cleavage. Mismatches, if present, are typically less unstable at the terminal regions of the hybrid duplex than in the center. The number of mismatches tolerated depends on the length of the oligomer, the percentage of G:C base pairs in the duplex, and the position of one or more mismatches in the duplex, according to well-understood principles of duplex stability. Such antisense oligomers are not necessarily 100% complementary to the target sequence, but are effective in stably and specifically binding to the target sequence so as to regulate the splicing of the target pre-RNA.

[0075] The stability of the duplex formed between an oligomer and a target sequence varies depending on the binding Tm and the susceptibility of the duplex to cellular enzymatic cleavage. The Tm of an oligomer with respect to the RNA of the complementary sequence can be measured by conventional methods, such as those described by Hames et al., Nucleic Acid Hybridization, IRL Press, 1985, pp. 107-108, or as described by Miyada CG and Wallace RB, 1987, Oligomer Hybridization Techniques, Methods Enzymol. Vol. 154, pp. 94-107. In certain embodiments, the antisense oligomer can have a binding Tm with respect to the RNA of the complementary sequence that is greater than body temperature, and preferably greater than about 45°C or 50°C. Tms in the range of 60-80°C or higher are also included. According to well-known principles, the Tm of an oligomer with respect to a complementary RNA hybrid can be increased by increasing the ratio of C:G paired bases in the duplex and / or by increasing the length (in base pairs) of the heteroduplex. At the same time, it may be advantageous to limit the size of the oligomer for purposes of optimizing cellular uptake. Thus, compounds that exhibit high Tm (45-50°C or higher) at lengths of 25 bases or less are generally preferred compared to compounds requiring more than 25 bases for high Tm values.

[0076] The activity of antisense oligomers and their variants can be assayed according to conventional techniques in the art. For example, the splice forms and expression levels of the RNA and protein being investigated can be assayed by any of a wide variety of well-known methods for detecting the splice forms and / or expression of transcribed nucleic acids or proteins. Non-limiting examples of such methods include RT-PCR of spliced ​​forms of RNA followed by size separation of the PCR products, nucleic acid hybridization methods such as Northern blots and / or nucleic acid arrays; nucleic acid amplification methods; immunological protein detection methods; protein purification methods; and protein function or activity assays.

[0077] RNA expression levels may be assessed by preparing mRNA / cDNA (i.e., transcribed polynucleotides) from cells, tissues, or organisms and hybridizing the mRNA / cDNA with a reference polynucleotide that is the complement of the nucleic acid being assayed, or a fragment thereof. The cDNA may be amplified, if desired, using any of a variety of polymerase chain reaction or in vitro transcription methods prior to hybridization with the complementary polynucleotide; preferably, it is not amplified. Expression of one or more transcripts may also be detected using quantitative PCR to assess the expression level of one or more transcripts.

[0078] B. Antisense Oligomer Chemistry i. General Characteristics Certain antisense oligomers of the present disclosure specifically hybridize to intron splice silencer elements or exon splice silencer elements. In certain embodiments, the antisense oligomer comprises a non-natural chemical backbone selected from a phosphoramidate or phosphorodiamidate morpholino oligomer (PMO), a peptide nucleic acid (PNA), a locked nucleic acid (LNA), a phosphorothioate oligomer, a tricyclo DNA oligomer, a tricyclophosphorothioate oligomer, a 2'O-Me-modified oligomer, or any combination of the foregoing, and a targeting sequence complementary to a region within intron 1, intron 2, or exon 2 of the pre-mRNA of the human acid alpha-glucosidase (GAA) gene.

[0079] Antisense oligomers of the present disclosure generally comprise multiple nucleotide subunits, each carrying nucleobases that together form or comprise a targeting sequence. Thus, in some embodiments, antisense oligomers range in length from about 10 to about 40 subunits, more preferably from about 10 to 30 subunits, and typically from 15 to 25 subunits. For example, antisense compounds of the present disclosure can be 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 subunits in length, or in the range of 10 to 40 subunits, 10 to 30 subunits, 14 to 25 subunits, 15 to 30 subunits, 17 to 30 subunits, 17 to 27 subunits, 10 to 27 subunits, 10 to 25 subunits, and 10 to 20 subunits. In certain embodiments, the antisense oligomer is about 10 to about 40 or about 5 to about 30 nucleotides in length. In some embodiments, the antisense oligomer is about 14 to about 25 or about 17 to about 27 nucleotides in length.

[0080] In various embodiments, the antisense oligomer comprises a fully modified backbone, e.g., 100% of the backbone is modified (e.g., a 25-mer antisense oligomer comprises an entire backbone modified with any combination of backbone modifications as described herein). In various embodiments, the antisense oligomer may comprise between about 100% and 2.5% of its backbone modified. In various embodiments, the antisense oligomer may comprise about 99%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, or 2.5% of its backbone modified, and intervening repeats. In other embodiments, the antisense oligomer may comprise any combination of backbone modifications as described herein.

[0081] In various embodiments, the antisense oligomer is a phosphoramidate morpholino oligomer and a phosphorodiamidate morpholino oligomer (PMO), a phosphorothioate modified oligomer, a 2'O-methyl modified oligomer, a peptide nucleic acid (PNA), a locked nucleic acid (LNA), a phosphorothioate oligomer, a 2'O-MOE modified oligomer, a 2'-fluoro modified oligomer, a 2'O,4'C-ethylene bridged nucleic acid (ENA), a tricycloDNA, a tricycloDNA phosphorothioate nucleotide, a 2'-O-[2-(N-methylcarbamoyl)ethyl] modified oligomer, a morpholino oligomer, a peptide conjugated phosphoramidate morpholino oligomer (PPMO), ... Phosphorodiamidate morpholino oligomers (PMO+) having a phosphorus atom with (i) a covalent bond to the nitrogen atom of a morpholino ring and (ii) a second covalent bond to a (1,4-piperazin)-1-yl substituent or substituted (1,4-piperazin)-1-yl, and phosphorodiamidate morpholino oligomers (PMO-X) having a phosphorus atom with (i) a covalent bond to the nitrogen atom of a morpholino ring and (ii) a second covalent bond to the ring nitrogen of 4-aminopiperdin-1-yl (i.e., APN) or a derivative of 4-aminopiperdin-1-yl, including any combination of the foregoing.

[0082] In some embodiments, the antisense oligomers described herein include antisense PPMO oligomers. In embodiments, the antisense PPMO oligomers include 3, 4, 5, 6, 7, 8, 9, or more consecutive internal nucleobases. In embodiments, one or more of the consecutive nucleobases are removed, leaving only two consecutive nucleobases, thereby eliminating the aggregate structure.

[0083] In embodiments, the antisense PPMO oligomer comprises 3, 4, 5, 6, 7, 8, 9 or more consecutive internal G nucleobases. In embodiments, removal of one or more of the consecutive G nucleobases is performed so that only two consecutive G nucleobases are present, resulting in elimination of the aggregate structure.

[0084] In various embodiments, the backbone of the antisense oligomer is substantially uncharged and, if necessary, is recognized as a substrate for active or facilitated transport across the cell membrane. In some embodiments, all internucleoside linkages are uncharged. The ability of an oligomer to form a stable duplex with a target RNA can also be related to other characteristics of the backbone, including the length and degree of complementarity of the antisense oligomer to the target, the G:C to A:T base match ratio, and the location of any mismatched bases. The ability of an antisense oligomer to resist cellular nucleases can promote survival and ultimate delivery of the drug to the cytoplasm.

[0085] In certain embodiments, the antisense oligomer has at least one internucleoside linkage that is positively charged or cationic at physiological pH. In some embodiments, the antisense oligomer has at least one internucleoside linkage that exhibits a pKa of about 5.5 to about 12. In further embodiments, the antisense oligomer contains about, at least about, or at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 internucleoside linkages that exhibit a pKa of about 4.5 to about 12. In some embodiments, the antisense oligomer contains about or at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% internucleoside linkages exhibiting a pKa of about 4.5 to about 12. Optionally, the antisense oligomer has at least one internucleoside linkage that contains both a basic nitrogen and an alkyl, aryl, or aralkyl group. In specific embodiments, one or more cationic internucleoside linkages comprises a 4-aminopiperdin-1-yl (APN) group, or a derivative thereof. Without being bound by any one theory, it is believed that the presence of one or more cationic linkages (e.g., APN groups or APN derivatives) in the oligomer facilitates binding to the negatively charged phosphate in the target nucleotide. Thus, heteroduplex formation between the mutant RNA and the oligomer containing the cationic linkages may be held together by both ionic attraction and Watson-Crick base pairing.

[0086] In some embodiments, the number of cationic linkages is at least two and up to about half of the total number of internucleoside linkages, e.g., about or at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 cationic linkages. However, in some embodiments, up to all internucleoside linkages are cationic linkages, e.g., about or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 of the total number of internucleoside linkages are cationic linkages. In specific embodiments, oligomers of about 19-20 subunits may have 2-10, e.g., 4-8, cationic linkages, with the remainder being uncharged. In other specific embodiments, oligomers of 14-15 subunits may have 2-7, e.g., 2, 3, 4, 5, 6, or 7, cationic linkages, with the remainder being uncharged. Thus, the total number of cationic linkages in the oligomer may vary from about 1 to 10 to 15 to 20 to 30 or more (including all integers in between), and may be dispersed throughout the oligomer.

[0087] In various embodiments, the antisense oligomer can have about or up to about 1 cationic linkage for every 2-5 or 2, 3, 4, or 5 uncharged links, such as about 4-5 or 4 or 5 for every 10 uncharged links.

[0088] Certain embodiments include antisense oligomers containing about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% cationic linkages. In certain embodiments, optimal improvement in antisense activity may be seen when about 25% of the backbone linkages are cationic. In certain embodiments, enhancement may be seen with a low number of cationic linkages, e.g., 10-20%, or when the number of cationic linkages is in the range of 50-80%, such as about 60%.

[0089] In various embodiments, the cationic bonds are interspersed along the backbone. Such oligomers optionally contain at least two consecutive uncharged bonds; i.e., the oligomers do not optionally have a strictly alternating pattern along their entire length. In specific examples, one or two cationic bonds are each separated by at least one, two, three, four, or five uncharged bonds along the backbone.

[0090] Also included are oligomers having blocks of cationic linkages and blocks of uncharged linkages. For example, a central block of uncharged linkages may be flanked by blocks of cationic linkages, or vice versa. In some embodiments, the oligomer has 5', 3', and central regions of approximately equal length, and the percentage of cationic linkages in the central region is greater than about 50%, 60%, 70%, or 80% of the total number of cationic linkages.

[0091] In certain antisense oligomers, the majority of cationic linkages (e.g., 70, 75%, 80%, 90% of the cationic linkages) are distributed near "central region" backbone linkages, e.g., the 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 most central linkages. For example, a 16-, 17-, 18-, 19-, 20-, 21-, 22-, 23-, or 24-mer oligomer may have at least 50%, 60%, 70%, or 80% of the total number of cationic linkages located at the 8, 9, 10, 11, or 12 most central linkages.

[0092] ii. Skeletal chemistry Antisense oligomers can utilize a variety of antisense chemistries. Examples of oligomer chemistries include, but are not limited to, phosphoramidate morpholino oligomers and phosphorodiamidate morpholino oligomers (PMO), phosphorothioate-modified oligomers, 2'O-methyl-modified oligomers, peptide nucleic acids (PNAs), locked nucleic acids (LNAs), phosphorothioate oligomers, 2'O-MOE-modified oligomers, 2'-fluoro-modified oligomers, 2'O,4'C-ethylene-bridged nucleic acids (ENAs), tricycloDNA, tricycloDNA phosphorothioate nucleotides, 2'-O-[2-(N-methylcarbamoyl)ethyl]-modified oligomers, morpholino oligomers, peptide-conjugated phosphoramidate morpholino oligomers ( PPMO), phosphorodiamidate morpholino oligomers (PMO+) having a phosphorus atom with a covalent bond to the nitrogen atom of the morpholino ring and (ii) a second covalent bond to a (1,4-piperazin)-1-yl substituent or substituted (1,4-piperazin)-1-yl, and phosphorodiamidate morpholino oligomers (PMO-X) having a phosphorus atom with a covalent bond to the nitrogen atom of the morpholino ring and (ii) a second covalent bond to the ring nitrogen of 4-aminopiperdin-1-yl (i.e., APN) or a derivative of 4-aminopiperdin-1-yl, including combinations of any of the foregoing. Generally, PNA and LNA chemistries have relatively high target binding strength compared to PMO and 2'O-Me modified oligomers, allowing for the use of shorter targeting sequences. Phosphorothioate and 2'O-Me modification chemistries can be combined to create 2'O-Me-phosphorothioate backbones. See, e.g., WO 2013 / 112053 and WO 2009 / 008725 (hereby incorporated by reference in their entireties).

[0093] In some examples, antisense oligomers such as PMOs can be conjugated to cell-penetrating peptides (CPPs) to facilitate intracellular delivery. Peptide-conjugated PMOs are called PPMOs, and specific embodiments include those described in International Publication No. 2012 / 150960 (incorporated herein by reference in its entirety). In some embodiments, an arginine-rich peptide sequence can be used that is conjugated or linked to the 3'-end of an antisense oligomer, for example, as described herein. In certain embodiments, an arginine-rich peptide sequence can be used that is conjugated or linked to the 5'-end of an antisense oligomer, for example, as described herein.

[0094] 1. Peptide nucleic acid (PNA) Peptide nucleic acids (PNAs) are analogs of DNA, whose backbone is structurally isomorphous with a deoxyribose backbone, consisting of N-(2-aminoethyl)glycine units to which pyrimidine or purine bases are attached. PNAs containing natural pyrimidine and purine bases hybridize to complementary oligomers according to Watson-Crick base pairing rules, mimicking DNA in terms of base pair recognition (see Egholm, Buchardt et al., 1993). Because the backbone of PNAs is formed by peptide bonds rather than phosphodiester bonds, PNAs are well suited for antisense applications (see structure below). The backbone is uncharged, resulting in PNA / DNA or PNA / RNA duplexes that exhibit higher thermal stability than normal. PNAs are not recognized by nucleases or proteases. Non-limiting examples of PNAs are shown below: [ka]

[0095] Despite their radical structural changes relative to their native structure, PNAs possess the ability to bind sequence-specifically to DNA or RNA in a helical configuration. PNA characteristics include high binding affinity to complementary DNA or RNA, destabilizing effects caused by single-base mismatches, resistance to nucleases and proteases, salt-independent hybridization to DNA or RNA, and triplex formation with homopurine DNA. PANAGENE™ has developed its proprietary Bts PNA monomer (Bts; benzothiazole-2-sulfonyl group) and proprietary oligomerization method. PNA oligomerization using the Bts PNA monomer consists of repeated cycles of deprotection, coupling, and capping. PNAs can be synthetically prepared using any technique known in the art. See, e.g., U.S. Patent Nos. 6,969,766, 7,211,668, 7,022,851, 7,125,994, 7,145,006, and 7,179,896. For the preparation of PNAs, see also U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262. For further teachings on PNA compounds, see Nielsen et al., Science, 254:1497-1500, 1991. Each of the foregoing is incorporated by reference in its entirety.

[0096] 2. Locked Nucleic Acid (LNA) Antisense oligomeric compounds may also contain "locked nucleic acid" subunits (LNAs). "LNAs" are members of a modified class called bridged nucleic acids (BNAs). BNAs are characterized by a covalent bond that locks the conformation of the ribose ring to a C30 endo-type (Northern) sugar pucker. For LNAs, the bridge consists of a methylene between the 2'-O and 4'-C positions. LNAs enhance backbone preorganization and base stacking, increasing hybridization and thermal stability.

[0097] For the structure of LNA, see, for example, Wengel, et al., Chemical Communications (1998) 455; Tetrahedron (1998) 54:3607, and Accounts of Chem. Research (1999) 32:301; Obika, et al., Tetrahedron Letters (1997) 38:8735; (1998) 39:5401, and Bioorganic Medicinal Chemistry (2008) 16:9230 (which are hereby incorporated by reference in their entirety). Non-limiting examples of LNA are shown below: [ka]

[0098] The compounds of the present disclosure may incorporate one or more LNAs; in some cases, the compounds may be composed entirely of LNAs. Methods for synthesizing individual LNA nucleoside subunits and their incorporation into oligomers are described, for example, in U.S. Patent Nos. 7,572,582, 7,569,575, 7,084,125, 7,060,809, 7,053,207, 7,034,133, 6,794,499, and 6,670,461 (each of which is incorporated by reference in its entirety). Typical intersubunit linkers include phosphodiester and phosphorothioate moieties; alternatively, non-phosphorus-containing linkers may be used. Further embodiments include LNA-containing compounds in which each LNA subunit is separated by a DNA subunit. Certain compounds are composed of alternating LNA and DNA subunits in which the intersubunit linker is phosphorothioate.

[0099] 2'O,4'C-ethylene-bridged nucleic acids (ENAs) are another member of the BNA class. Non-limiting examples are shown below: [ka]

[0100] ENA oligomers and their preparation are described in Obika et al., Tetrahedron Ltt 38(50):8735, hereby incorporated by reference in its entirety. Compounds of the present disclosure may incorporate one or more ENA subunits.

[0101] 3. Phosphorothioates "Phosphorothioates" (or S-oligos) are variants of normal DNA in which one of the non-bridging oxygens has been replaced with a sulfur. Non-limiting examples of phosphorothioates are shown below: [ka]

[0102] Sulfuration of internucleotide bonds reduces the action of endonucleases and exonucleases, including 5'→3' and 3'→5' DNA POL 1 exonuclease, nucleases S1 and P1, RNases, serum nucleases, and snake venom phosphodiesterases. Phosphorothioates are made by two major routes: by the action of a solution of elemental sulfur in carbon disulfide on hydrogen phosphonates, or by sulfurizing a phosphite triester with either tetraethylthiuram disulfide (TETD) or 3H-1,2-bensodithiol-3-one 1,1-dioxide (BDTD) (see, e.g., Iyer et al., J. Org. Chem. 55, 4693-4699, 1990, hereby incorporated by reference in its entirety). The latter method avoids the insolubility of elemental sulfur in most organic solvents and the toxicity of carbon disulfide. The TETD and BDTD methods also yield phosphorothioates of higher purity.

[0103] 4. Tricyclo-DNA and tricyclophosphorothioate nucleotides Tricycle-DNA (tc-DNA) is a class of constrained DNA analogues in which each nucleotide is modified by introducing a cyclopropane ring to restrict conformational flexibility of the backbone and optimize the backbone geometry at the torsion angle γ. Homobasic adenine- and thymine-containing tc-DNAs form highly stable AT base pairs with complementary RNA. Tricycle-DNA and its synthesis are described in International Publication WO 2010 / 115993, which is hereby incorporated by reference in its entirety. Compounds of the present disclosure may incorporate one or more tricycle-DNA nucleotides; in some cases, a compound may be composed entirely of tricycle-DNA nucleotides.

[0104] Tricyclophosphorothioate nucleotides are tricyclo-DNA nucleotides containing phosphorothioate intersubunit bonds. Tricyclophosphorothioate nucleotides and their synthesis are described in International Publication No. WO 2013 / 053928 (hereby incorporated by reference in its entirety). Compounds of the present disclosure may incorporate one or more tricycle-DNA nucleotides; in some cases, the compound may be entirely composed of tricycle-DNA nucleotides. Non-limiting examples of tricycle-DNA / tricyclophosphorothioate nucleotides are shown below: [ka]

[0105] 5. 2'O-Methyl, 2'O-MOE, and 2'-F Oligomers A "2'O-Me oligomer" molecule carries a methyl group at the 2'-OH residue of a ribose molecule. 2'-O-Me-RNA behaves the same as (or similar to) DNA, but is protected from nuclease degradation. 2'-O-Me-RNA can also be combined with a phosphorothioate oligomer (PTO) for further stabilization. 2'O-Me oligomers (phosphodiester or phosphorothioate) can be synthesized according to conventional techniques in the art (see, for example, Yoo et al., Nucleic Acids Res. 32:2008-16, 2004, which is hereby incorporated by reference in its entirety). Non-limiting examples of 2'O-Me oligomers are shown below: [ka]

[0106] 2'O-Me oligomers can also contain phosphorothioate linkages (2'O-Me phosphorothioate oligomers). 2'O-Me methoxyethyl oligomers (2'-O MOE), like 2'O-Me oligomers, carry a methoxyethyl group on the 2'-OH residue of the ribose molecule, and are discussed in Martin et al., Helv. Chim. Acta, 78, 486-504, 1995 (hereby incorporated by reference in its entirety). Non-limiting examples of 2'O-MOE nucleotides are shown below: [ka]

[0107] In contrast to the alkylated 2'OH ribose derivatives described above, 2'-fluoro oligomers contain a fluoro group at the 2' position instead of the 2'OH. Non-limiting examples of 2'-F oligomers are shown below: [ka] 2'-Fluoro oligomers are further described in WO 2004 / 043977, which is hereby incorporated by reference in its entirety. Compounds of the present disclosure may incorporate one or more 2'O-methyl, 2'O-MOE, and 2'-F subunits and may utilize any intersubunit linkage described herein. In some examples, compounds of the present disclosure may be composed entirely of 2'O-methyl, 2'O-MOE, or 2'-F subunits. One embodiment of a compound of the present disclosure is composed entirely of 2'O-methyl subunits.

[0108] 6. 2'-O-[2-(N-methylcarbamoyl)ethyl]oligonucleotide (MCE) MCE is another example of a 2'O-modified ribonucleoside useful in the compounds of the present disclosure, where the 2'OH is derivatized to a 2-(N-methylcarbamoyl)ethyl moiety to increase nuclease resistance. A non-limiting example of an MCE oligomer is shown below: [ka] MCEs and their synthesis are described in Yamada et al., J. Org. Chem., 76(9):3042-53, which is hereby incorporated by reference in its entirety. Compounds of the present disclosure may incorporate one or more MCE subunits.

[0109] 7. Stereospecific Oligomers Stereospecific oligomers are those in which the stereochemistry of each phosphorus-containing linkage is determined by synthetic methods that produce a substantially pure, single oligomer. Non-limiting examples of stereospecific oligomers are shown below: [ka]

[0110] In the above example, each phosphorus of the oligomer has the same stereochemistry. Further examples include the oligomers described above. For example, LNA, ENA, tricycloDNA, MCE, 2'O-methyl, 2'O-MOE, 2'-F, and morpholino-based oligomers can be prepared that contain stereospecific phosphorus-containing internucleoside linkages, such as phosphorothioate, phosphodiester, phosphoramidate, phosphorodiamidate, or other phosphorus-containing internucleoside linkages. Stereospecific oligomers, methods of preparation, chiral controlled synthesis, chiral designs, and chiral auxiliaries used in the preparation of such oligomers are described in detail, for example, in WO2015107425, WO2015108048, WO2015108046, WO2015108047, WO2012039448, WO2010064146, WO2011034072, WO2014010250, WO2014012081, WO20130127858, and WO2011005761, each of which is hereby incorporated by reference in its entirety.

[0111] 8. Morpholino-based oligomers Morpholino-based oligomer refers to an oligomer that includes morpholino subunits that support nucleobases and contains a morpholine ring instead of ribose.Exemplary internucleoside linkages include, for example, phosphoramidate or phosphorodiamidate internucleoside linkages that connect the morpholine ring nitrogen of one morpholino subunit to the 4' exocyclic carbon of an adjacent morpholino subunit.Each morpholino subunit contains a purine or pyrimidine nucleobase that is effective for binding to a base in an oligonucleotide through base-specific hydrogen bonding.

[0112] For morpholino-based oligomers (including antisense oligomers), see, e.g., U.S. Pat. Nos. 5,698,685; 5,217,866; 5,142,047; 5,034,506; 5,166,315; 5,185,444; 5,521,063; 5,506,337 and pending U.S. patent applications Ser. Nos. 12 / 271,036; 12 / 271,040; and WO 2009 / 064471 and WO 2012 / 043730, as well as Summerton et al. 1997, Antisense and Nucleic Acid Drug Development, 7, 187-195 (which are hereby incorporated by reference in their entireties). Within the oligomeric structure, the phosphate groups are generally referred to as forming the "internucleoside linkage" of the oligomer. The naturally occurring internucleoside linkage in RNA and DNA is a 3'→5' phosphodiester bond. A "phosphoroamidate" group contains a phosphorus with three bonded oxygen atoms and one bonded nitrogen atom, while a "phosphorodiamidate" group contains a phosphorus with two bonded oxygen atoms and two bonded nitrogen atoms. The uncharged or cationic intersubunit linkages of the morpholino-based oligomers described herein always have one nitrogen pendant to the backbone chain. The second nitrogen in the phosphorodiamidate linkage is typically the ring nitrogen of the morpholine ring structure.

[0113] "PMO-X" refers to a phosphorodiamidate morpholino-based oligomer having a phosphorus atom with (i) a covalent bond to the nitrogen atom of a morpholino ring and (ii) a second covalent bond to the ring nitrogen of 4-aminopiperdin-1-yl (i.e., APN) or a derivative of 4-aminopiperdin-1-yl. Exemplary, non-limiting PMO-X oligomers are described in PCT Application No. PCT / US2011 / 38459 and International Publication No. WO 2013 / 074834, which are hereby incorporated by reference in their entireties. PMO-X includes "PMO-apn" or "APN," which refers to a PMO-X oligomer containing at least one internucleoside linkage, in which the phosphorus atom is linked to the morpholino group and the ring nitrogen of 4-aminopiperdin-1-yl (i.e., APN). In specific embodiments, antisense oligomers comprising a targeting sequence include at least one APN-containing or APN-derivative-containing linkage. Various embodiments include morpholino-based oligomers having about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% APN / APN-derivative-containing linkages, where the remaining linkages (if less than 100%) are uncharged linkages, e.g., For example, about or at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 of the total internucleoside linkages are APN / APN derivative-containing linkages.

[0114] In some embodiments, the antisense oligomer comprises a compound of formula (I): [ka] or a pharmaceutically acceptable salt thereof, wherein: each Nu is a nucleobase that together form a targeting sequence; Z is an integer from 8 to 38; Each Y is O and -NR 4 wherein each R 4 is H, C1-C6 alkyl, aralkyl, -C(=NH)NH2, -C(O)(CH2) n NR 5 C(=NH)NH2, -C(O)(CH2)2NHC(O)(CH2)5NR 5 C(=NH)NH2, and G, wherein R 5 is selected from H and C1-C6 alkyl, and n is an integer from 1 to 5; T is a group consisting of OH and the formula: [ka] is selected from the part During the ceremony: A is -OH, -N(R 7 )2, and R 1 wherein each R 7 are independently selected from H and C1-C6 alkyl; R 6 is OH, -N(R 9 )CH2C(O)NH2, and the formula: [ka] is selected from the part During the ceremony: R 9 is selected from H and C1-C6 alkyl; R 10 is G, -C(O)-R 11 OH, acyl, trityl, 4-methoxytrityl, -C(=NH)NH2, -C(O)(CH2) m NR 12 C(=NH)NH2 and -C(O)(CH2)2NHC(O)(CH2)5NR 12 C(=NH)NH2, wherein: m is an integer from 1 to 5; R11 is of the formula -(O-alkyl) y wherein y is an integer from 3 to 10; each of the y alkyl groups is independently selected from C2-C6 alkyl; R 12 is selected from H and C1-C6 alkyl; R 1 Each example of -N(R 13 )2(in the formula, each R 13 are independently selected from H and C1-C6 alkyl; Formula (II): [ka] Part [In formula: R 15 is H, G, C1-C6 alkyl, -C(=NH)NH2, -C(O)(CH2) q NR 18 C(=NH)NH2 and -C(O)(CH2)2NHC(O)(CH2)5NR 18 C(=NH)NH2, wherein: R 18 is selected from H and C1-C6 alkyl; q is an integer from 1 to 5; Each R 17 are independently selected from H and methyl; and Formula (III): [ka] Part [In formula: R 19 is H, C1-C6 alkyl, -C(=NH)NH2, -C(O)(CH2) r NR 22 C(=NH)NH2, -C(O)CH(NH2)(CH2)3NHC(=NH)NH2, -C(O)(CH2)2NHC(O)(CH2)5NR 22 C(=NH)NH2, -C(O)CH(NH2)(CH2)4NH2 and G, wherein: R 22 is selected from H and C1-C6 alkyl; r is an integer from 1 to 5; R 20 is selected from H and C1-C6 alkyl; or R 19 and R 20 together with the nitrogen atom to which they are attached form a heterocyclic or heteroaryl ring having 5 to 7 ring atoms and optionally containing additional heteroatoms selected from oxygen, nitrogen, and sulfur. are independently selected from; R 2 is H, G, acyl, trityl, 4-methoxytrityl, benzoyl, stearoyl, C1-C6 alkyl, -C(=NH)NH2, -C(O)-R 23 , -C(O)(CH2) s NR 24 C(=NH)NH2, -C(O)(CH2)2NHC(O)(CH2)5NR 24 C(=NH)NH2, -C(O)CH(NH2)(CH2)3NHC(=NH)NH2, and the formula: [ka] Part [In the formula, R 23 is of the formula -(O-alkyl) v -OH, where v is an integer from 3 to 10, and each of the v alkyl groups is independently selected from C2 to C6 alkyl; R 24 is selected from H and C1-C6 alkyl; s is an integer from 1 to 5; L is selected from —C(O)(CH)C(O)— and —C(O)(CH)S(CH)C(O)—; Each R 25 is the formula -(CH2)2OC(O)N(R 26 ) 2, wherein each R 26 is of formula -(CH2)6NHC(=NH)NH2] is selected from wherein G is —C(O)(CH)NH-CPP, —C(O)(CH)NH-CPP, —C(O)(CH)NHC(O)(CH)NH-CPP, —C(O)CHNH-CPP, and: [ka] a cell penetrating peptide ("CPP") and a linker moiety selected from wherein the CPP is attached to the linker moiety via an amide bond at the CPP carboxy terminus; wherein G may be present in one occurrence or absent.

[0115] In some embodiments, R 2 is the expression: [ka] wherein L is selected from —C(O)(CH)C(O)— or —C(O)(CH)S(CH)C(O)—; Each R 25 is the formula -(CH2)2OC(O)N(R 26 ) 2, wherein each R 26 is of the formula —(CH)NHC(═NH)NH. Such moieties are further described in U.S. Pat. No. 7,935,816, which is incorporated herein by reference in its entirety.

[0116] In certain embodiments, R 2 may contain any of the following parts: [ka]

[0117] In certain embodiments, each R 1is -N(CH3)2. In some embodiments, about 50-90% of the R1 groups are dimethylamino (i.e., -N(CH3)2). In certain embodiments, about 66% of the R1 groups are dimethylamino.

[0118] In some non-limiting embodiments, each R 1 is —N(CH 3 ) 2 and X is selected from uracil (U) or thymine (T).

[0119] In some embodiments of the present disclosure, R1 is [ka] [ka] may be selected from:

[0120] In some embodiments, at least one R 1 teeth [ka] is. In certain embodiments, T is [ka] is selected from. Each occurrence of Y is O. In some embodiments, R 2 is selected from H, G, acyl, trityl, 4-methoxytrityl, benzoyl, and stearoyl.

[0121] In various embodiments, T is [ka] is selected from Y is O for each occurrence and R 2 is G.

[0122] In some embodiments, T has the formula: [ka] It is of R 6 is the expression: [ka] It is of Y is O for each occurrence and R 2 is G.

[0123] In certain embodiments, T has the formula: [ka] It is of Y is O for each occurrence and R 2 is G. In some embodiments, T is of the formula: [ka] It is of Y is O for each occurrence and R 1 is -N(CH3)2 and R 2 is G.

[0124] In certain embodiments, T has the formula: [ka] It is of Each occurrence of Y is O. In some embodiments, T has the formula: [ka] It is of Y is O for each occurrence and R 1 is -N(CH3)2 and R 2is acetyl.

[0125] In certain embodiments, T has the formula: [ka] where Y is O for each occurrence and each R 1 is -N(CH3)2 and R 2 is H.

[0126] In some embodiments, R 2 is selected from H, acyl, trityl, 4-methoxytrityl, benzoyl, and stearoyl.

[0127] In various embodiments, R 2 is selected from H or G. In particular embodiments, R 2 is G. In some embodiments, R 2 is H or acyl. In some embodiments, each R 1 is —N(CH). In some embodiments, R 1 At least one example of is —N(CH) . In certain embodiments, R 1 Each example is -N(CH3)2.

[0128] In some embodiments, G is of the formula: [ka] It is of In the formula, R a is selected from H, acyl, benzoyl, and stearoyl. a is acetyl.

[0129] In certain embodiments, the CPP has the formula: [ka] It is of In the formula, R a is selected from H, acyl, benzoyl, and stearoyl. a is acetyl.

[0130] In another embodiment, the antisense oligomer comprises a compound of formula (Ia): [ka] or a pharmaceutically acceptable salt thereof, wherein: each Nu is a nucleobase that together form a targeting sequence; Z is an integer from about 13 to about 38; Each Y is O and -NR 4 wherein each R 4 is H, C1-C6 alkyl, aralkyl, -C(=NH)NH2, -C(O)(CH2) n NR 5 C(=NH)NH2, -C(O)(CH2)2NHC(O)(CH2)5NR 5 C(=NH)NH2, and G, wherein R 5 is selected from H and C1-C6 alkyl, and n is an integer from 1 to 5; T is a group consisting of OH and the formula: [ka] is selected from the part During the ceremony: A is -OH, -N(R 7 )2, and R 1 is selected from: Each R 7 are independently selected from H and C1-C6 alkyl; R 6 is OH, -N(R 9 )CH2C(O)NH2, and the formula: [ka] is selected from the part During the ceremony: R 9 is selected from H and C1-C6 alkyl; R 10 is G, -C(O)-R 11 OH, acyl, trityl, 4-methoxytrityl, -C(=NH)NH2, -C(O)(CH2) m NR 12 C(=NH)NH2 and -C(O)(CH2)2NHC(O)(CH2)5NR 12 C(=NH)NH2, wherein: m is an integer from 1 to 5; R 11 is of the formula -(O-alkyl) y wherein y is an integer from 3 to 10; each of the y alkyl groups is independently selected from C2-C6 alkyl; R 12 is selected from H and C1-C6 alkyl; R 1 Each example of -N(R 13 )2(in the formula, each R 13 are independently selected from H and C1-C6 alkyl; Formula (II): [ka] Part [In formula: R 15 is H, G, C1-C6 alkyl, -C(=NH)NH2, -C(O)(CH2) q NR 18 C(=NH)NH2 and -C(O)(CH2)2NHC(O)(CH2)5NR 18 C(=NH)NH2, wherein: R 18 is selected from H and C1-C6 alkyl; q is an integer from 1 to 5; Each R 17 are independently selected from H and methyl; and Formula (III): [ka] Part [In formula: R 19 is H, C1-C6 alkyl, -C(=NH)NH2, -C(O)(CH2) r NR 22 C(=NH)NH2, -C(O)CH(NH2)(CH2)3NHC(=NH)NH2, -C(O)(CH2)2NHC(O)(CH2)5NR 22 C(=NH)NH2, -C(O)CH(NH2)(CH2)4NH2 and G, wherein: R 22 is selected from H and C1-C6 alkyl; r is an integer from 1 to 5; R 20 is selected from H and C1-C6 alkyl; or R 19 and R 20 together with the nitrogen atom to which they are attached form a heterocyclic or heteroaryl ring having 5 to 7 ring atoms and optionally containing additional heteroatoms selected from oxygen, nitrogen, and sulfur. are independently selected from; R 2 is H, G, acyl, trityl, 4-methoxytrityl, benzoyl, stearoyl, C1-C6 alkyl, -C(=NH)NH2, -C(O)-R 23 , -C(O)(CH2) s NR 24 C(=NH)NH2, -C(O)(CH2)2NHC(O)(CH2)5NR 24 C(=NH)NH2, -C(O)CH(NH2)(CH2)3NHC(=NH)NH2, and the formula: [ka] Part [In the formula, R 23 is of the formula -(O-alkyl) v-OH, where v is an integer from 3 to 10, and each of the v alkyl groups is independently selected from C2 to C6 alkyl; R 24 is selected from H and C1-C6 alkyl; s is an integer from 1 to 5; L is selected from —C(O)(CH)C(O)— and —C(O)(CH)S(CH)C(O)—; Each R 25 is the formula -(CH2)2OC(O)N(R 26 ) 2, wherein each R 26 is of formula -(CH2)6NHC(=NH)NH2] is selected from wherein G is a cell penetrating peptide (“CPP”) having the formula —C(O)CHNH-CPP and a linker moiety, wherein CPP has the formula: [ka] It is of In the formula, R a is H or acyl, wherein G may be present in one occurrence or absent.

[0131] In certain embodiments, T is [ka] is selected from Each occurrence of Y is O. In some embodiments, R 2 is selected from H, G, acyl, trityl, 4-methoxytrityl, benzoyl, and stearoyl.

[0132] In various embodiments, T is [ka] is selected from Y is O for each occurrence and R 2 is G.

[0133] In some embodiments, T has the formula: [ka] R 6 is the expression: [ka] It is of Y is O for each occurrence and R 2 is G.

[0134] In certain embodiments, T has the formula: [ka] It is of Y is O for each occurrence and R 2 is G. In some embodiments, T is of the formula: [ka] It is of Y is O for each occurrence and R 1 is -N(CH3)2 and R 2 is G.

[0135] In certain embodiments, T has the formula: [ka] It is of Each occurrence of Y is O. In some embodiments, T has the formula: [ka] It is of Y is O for each occurrence and R 1 is -N(CH3)2 and R 2is acetyl.

[0136] In certain embodiments, T has the formula: [ka] where Y is O for each occurrence and each R 1 is -N(CH3)2 and R 2 is H.

[0137] In some embodiments, R 2 is selected from H, acyl, trityl, 4-methoxytrityl, benzoyl, and stearoyl.

[0138] In various embodiments, R 2 is selected from H or G. In particular embodiments, R 2 is G. In some embodiments, R 2 is H or acyl. In some embodiments, each R 1 is —N(CH). In some embodiments, R 1 At least one example of is —N(CH) . In certain embodiments, R 1 Each example is -N(CH3)2.

[0139] In some embodiments, R a is acetyl.

[0140] For example, in embodiments, including embodiments of antisense oligomers of Formula (I) and (Ia), the targeting sequence is complementary to a target region within intron 1 of the pre-mRNA of the human alpha-glucosidase (GAA) gene. For example, in embodiments, including embodiments of antisense oligomers of Formula (I) and (Ia), the targeting sequence is complementary to a target region within intron 1 of the pre-mRNA of the human alpha-glucosidase (GAA) gene, wherein the target region comprises at least one additional nucleobase compared to the targeting sequence, wherein the at least one additional nucleobase does not have a nucleobase complementary to the targeting sequence, and wherein the at least one additional nucleobase is within the target region.

[0141] In an embodiment, a sequence with 100% complementarity is selected, and one or more nucleobases are removed (or alternatively synthesized with one or more missing nucleobases), so that the resulting sequence has one or more missing nucleobases compared to its natural complement in the target region. It is intended that, apart from the portion where one or more nucleobases are removed, the remaining portion is 100% complementary. However, it is within the scope of the present invention that there may be a reduced level of complementarity.

[0142] In certain embodiments, the antisense oligomer of the present disclosure comprises a compound of formula (IVa): [ka] or a pharmaceutically acceptable salt thereof, wherein: each Nu is a nucleobase that together form a targeting sequence; Z is an integer from 8 to 38; T is a group consisting of OH and the formula: [ka] is selected from the part During the ceremony: A is -OH, -N(R 7 )2R8 , and R 1 is selected from: Each R 7 are independently selected from H and C1-C6 alkyl; R 8 is selected from an electron pair and H, R 6 is OH, -N(R 9 )CH2C(O)NH2, and the formula: [ka] is selected from the part During the ceremony: R 9 is selected from H and C1-C6 alkyl; R 10 is -C(O)-R 11 OH, acyl, trityl, 4-methoxytrityl, -C(=NH)NH2, -C(O)(CH2) m NR 12 C(=NH)NH2 and -C(O)(CH2)2NHC(O)(CH2)5NR 12 C(=NH)NH2, wherein: m is an integer from 1 to 5; R 11 is of the formula -(O-alkyl) y wherein y is an integer from 3 to 10; each of the y alkyl groups is independently selected from C2-C6 alkyl; R 12 is selected from H and C1-C6 alkyl; R 1 Each example of -N(R 13 )2R 14 where each R 13 are independently selected from H and C1-C6 alkyl; R 14 is selected from an electron pair and H; R 2 is selected from H, acyl, trityl, 4-methoxytrityl, benzoyl, stearoyl, and C1-C6 alkyl.

[0143] In certain embodiments, T is [ka] is selected from Each occurrence of Y is O. In some embodiments, R 2 is selected from H, acyl, trityl, 4-methoxytrityl, benzoyl, and stearoyl.

[0144] In various embodiments, T is [ka] is selected from.

[0145] In some embodiments, T has the formula: [ka] It is of R 6 is the expression: [ka] It is of the type.

[0146] In certain embodiments, T has the formula: [ka] It is of the type.

[0147] In some embodiments, R 2 is H, trityl, or acyl. 1 At least one example of is -N(CH). In some embodiments, each R 1 is -N(CH3)2.

[0148] In certain embodiments, the antisense oligomer of the present disclosure comprises a compound of formula (IVb): [ka] or a pharmaceutically acceptable salt thereof, wherein: each Nu is a nucleobase that together form a targeting sequence; Z is an integer from 8 to 38; T is a group having the formula: [ka] is selected from the part In the formula, R 3 is selected from H and C1-C6 alkyl; R 1 Each example of -N(R 4 )2, where each R 4 are independently selected from H and C1-C6 alkyl; R 2 is selected from H, acyl, trityl, 4-methoxytrityl, benzoyl, stearoyl, and C1-C6 alkyl. In various embodiments, R 2 is selected from H or acyl. 2 is H.

[0149] In certain embodiments, T has the formula: [ka] is of; R 2 is hydrogen.

[0150] In certain embodiments, the antisense oligomer of the present disclosure comprises a compound of formula (IVc): [ka] or a pharmaceutically acceptable salt thereof, wherein: each Nu is a nucleobase that together form a targeting sequence; Z is an integer from 8 to 38; each Y is O; Each R 1 independently, [ka] is selected from the group consisting of wherein at least one R 1 is -N(CH3)2.

[0151] In some embodiments, X is selected from uracil (U) or thymine (T). 1 is -N(CH3)2.

[0152] In certain embodiments, the antisense oligomer comprises a compound of formula (V): [ka] or a pharmaceutically acceptable salt thereof, wherein: each Nu is a nucleobase that together form a targeting sequence; Z is an integer from 8 to 38.

[0153] For example, in some embodiments, including the antisense oligomers of formula (IVa), (IVb), (IVc), and (V), the targeting sequence is complementary to a target region containing an exon target associated with Duchenne muscular dystrophy. In certain embodiments, the targeting sequence is complementary to a target sequence containing exon 44 in the processing of preprocessed mRNA of human dystrophin. Furthermore, in certain embodiments, a sequence with 100% complementarity is selected, and one or more nucleobases are removed (or alternatively synthesized with one or more missing nucleobases), so that the resulting sequence has one or more missing nucleobases compared to its natural complement in the target region. It is intended that the remaining portion, excluding the portion where one or more nucleobases are removed, is 100% complementary. However, it is within the scope of the present invention that there may be a reduced level of complementarity. In embodiments, at least one nucleobase is removed when the targeting sequence would otherwise contain a stretch of three or four or more consecutive identical nucleobases or a biological palindromic sequence.

[0154] For example, in some embodiments, including those of the antisense oligomers of formulas (IVa), (IVb), (IVc), and (V), the targeting sequence is complementary to a target region containing an exon target associated with spinal muscular atrophy. In certain embodiments, the targeting sequence is complementary to a target sequence containing a region adjacent to exon 7 in the processing of preprocessed mRNA of human SMN2. Furthermore, in certain embodiments, a sequence with 100% complementarity is selected and one or more nucleobases are removed (or alternatively synthesized with one or more missing nucleobases), such that the resulting sequence has one or more missing nucleobases compared to its natural complement in the target region. It is contemplated that, apart from the portion where one or more nucleobases have been removed, the remaining portion is 100% complementary. However, it is within the scope of the present invention that there may be a reduced level of complementarity. In embodiments, at least one nucleobase is removed when the targeting sequence would otherwise contain a stretch of three or four or more consecutive identical nucleobases or a biological palindromic sequence.

[0155] In some embodiments, including, for example, antisense oligomer embodiments of Formulas (IVa), (IVb), (IVc), and (V), the targeting sequence is complementary to a target region within intron 1 of the pre-mRNA of the human alpha-glucosidase (GAA) gene. In various embodiments, including, for example, antisense oligomer embodiments of Formulas (IVa), (IVb), (IVc), and (V), the targeting sequence is complementary to a target region associated with exon 2 of the pre-mRNA of the human alpha-glucosidase (GAA) gene, wherein the target region comprises at least one additional nucleobase compared to the targeting sequence, wherein the at least one additional nucleobase does not have a nucleobase complementary to the targeting sequence, and wherein the at least one additional nucleobase is within the target region. Furthermore, in certain embodiments, a sequence with 100% complementarity is selected, and one or more nucleobases are removed (or alternatively synthesized with one or more missing nucleobases), so that the resulting sequence has one or more missing nucleobases compared to its natural complement in the target region. It is intended that, apart from the portion where one or more nucleobases are removed, the remaining portion is 100% complementary. However, it is within the scope of the present invention that there may be a reduced level of complementarity. In embodiments, when the targeting sequence would otherwise contain a stretch of three or four or more consecutive identical nucleobases or a biological palindrome sequence, at least one nucleobase is removed.

[0156] In various aspects, the antisense oligomer comprises a deletion sequence of any one of SEQ ID NOs: 1-128, wherein at least one nucleobase in any one of SEQ ID NOs: 1-128 is deleted. In various embodiments, the oligonucleotide comprises CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 69; eteplirsen); GTTGCCTCCGGTTCTGAAGGTGTTC (SEQ ID NO: 70; golodirsen); or CAATGCCATCCTGGAGTTCCTG (SEQ ID NO: 71; casimersen). In various embodiments, the deletion sequence comprises any one of SEQ ID NOs: 69-71, wherein at least one nucleobase in any one of SEQ ID NOs: 72-74 is deleted. In embodiments, the deleted at least one nucleobase is within the sequence of any one of SEQ ID NOs: 69-71.

[0157] In certain embodiments, the antisense oligomer comprises a compound of formula (VI): [ka] or a pharmaceutically acceptable salt thereof; wherein each Nu is a nucleobase that together form a targeting sequence; Z is an integer from 8 to 38; T is [ka] Selected from; Each R 1 teeth, [ka] are independently selected from the group consisting of: R 2 is selected from H, G, acyl, trityl, 4-methoxytrityl, benzoyl, and stearoyl; wherein G is -C(O)(CH2)5NH-CPP, -C(O)(CH2)2NH-CPP, -C(O)(CH2)2NHC(O)(CH2)5NH-CPP, -C(O)CH2NH-CPP, and [ka] a cell penetrating peptide ("CPP") and a linker moiety selected from wherein the CPP is attached to the linker moiety via an amide bond at the CPP carboxy terminus; In the formula, T is [ka] or R 2 is G.

[0158] In certain embodiments, T has the formula: [ka] It is of R 2 is G. In certain embodiments, R 1 At least one occurrence of is -N(CH3)2. In some embodiments, R 1 is —N(CH 3 ) 2 . In some embodiments, T is a group of the formula: [ka] It is of the type.

[0159] In certain embodiments, R 1 At least one occurrence of is -N(CH3)2. In some embodiments, R 1 Each occurrence of is -N(CH3)2.

[0160] In some embodiments, T has the formula: [ka] It is of R 2 is G and R 1 Each occurrence of is -N(CH3)2.

[0161] In certain embodiments, R2 is selected from H, acetyl, trityl, 4-methoxytrityl, benzoyl, and stearoyl, and T is a group of the formula: [ka] In various embodiments, R 2 is acetyl. In certain embodiments, R 1 At least one occurrence of is -N(CH3)2. In some embodiments, R 1 Each occurrence of is -N(CH3)2.

[0162] In various embodiments, R 2 is selected from H, acyl, trityl, 4-methoxytrityl, benzoyl, and stearoyl.

[0163] In certain embodiments, R2 is acetyl and T is a group of the formula: [ka] R 1 Each occurrence of is -N(CH3)2.

[0164] In some embodiments, wherein G is of the formula: [ka] It is of In the formula, R a is selected from H, acyl, benzoyl, and stearoyl. a is acetyl.

[0165] In some embodiments, the CPP has the formula: [ka] It is of In the formula, R a is selected from H, acyl, benzoyl, and stearoyl. a is acetyl.

[0166] In certain embodiments, the antisense oligomer comprises a compound of formula (VII): [ka] or a pharmaceutically acceptable salt thereof; wherein each Nu is a nucleobase that together form a targeting sequence; Z is an integer from 8 to 38; T is [ka] Selected from; Each R 1 -N(R 4 )2, where each R 4 are independently C1-C6 alkyl; R 2 is selected from H, G, acyl, trityl, 4-methoxytrityl, benzoyl, and stearoyl; wherein G is —C(O)(CH)NH-CPP, —C(O)(CH)NH-CPP, —C(O)(CH)NHC(O)(CH)NH-CPP, —C(O)CHNH-CPP, and: [ka] a cell penetrating peptide ("CPP") and a linker moiety selected from wherein the CPP is attached to the linker moiety via an amide bond at the CPP carboxy terminus; In the formula, T is [ka] or R 2 is G.

[0167] In some embodiments, R 1 At least one example of is —N(CH) . In certain embodiments, R 1 Each example is -N(CH3)2.

[0168] In certain embodiments, T has the formula: [ka] R 2 is G. In some embodiments, R 1 At least one example of is —N(CH) . In certain embodiments, R 1 Each example is -N(CH3)2. In various embodiments, G has the formula: [ka] It is of In the formula, R a is selected from H, acyl, benzoyl, and stearoyl. a is acetyl.

[0169] In certain embodiments, the CPP has the formula: [ka] It is of In the formula, R a is selected from H, acetyl, benzoyl, and stearoyl. a is acetyl.

[0170] In certain embodiments, the antisense oligomer comprises a compound of formula (VIIa): [ka] or a pharmaceutically acceptable salt thereof; wherein each Nu is a nucleobase that together form a targeting sequence; Z is an integer from 8 to 38; T is [ka] Selected from: R 1 Each example is -N(R 4 )2, where each R 4 are independently C1-C6 alkyl; G is —C(O)(CH)NH-CPP, —C(O)(CH)NH-CPP, —C(O)(CH)NHC(O)(CH)NH-CPP, —C(O)CHNH-CPP, and: [ka] a cell penetrating peptide ("CPP") and a linker moiety selected from wherein the CPP is attached to the linker moiety through an amide bond at the carboxy terminus of the CPP.

[0171] In some embodiments, R 1 At least one example of is —N(CH) . In certain embodiments, R 1 Each example is -N(CH3)2.

[0172] In some embodiments, G is of the formula: [ka] It is of In the formula, R ais selected from H, acyl, benzoyl, and stearoyl. a is acetyl.

[0173] In various embodiments, R 1 Each instance of is -N(CH3)2, and G is a group of the formula: [ka] It is of R a is acetyl.

[0174] In certain embodiments, the CPP has the formula: [ka] It is of In the formula, R a is selected from H, acyl, benzoyl, and stearoyl. a is acetyl. In various embodiments, R 1 Each example is -N(CH3)2, and CPP has the formula: [ka] It is of R a is acetyl.

[0175] In various embodiments, the antisense oligonucleotides of the present disclosure comprise a compound of formula (VIIb): [ka] or a pharmaceutically acceptable salt thereof, wherein: wherein each Nu is a nucleobase that together form a targeting sequence; Z is an integer from 8 to 38; R 1 Each example is -N(R 4)2, where each R 4 are independently C1-C6 alkyl; G is —C(O)(CH)NH-CPP, —C(O)(CH)NH-CPP, —C(O)(CH)NHC(O)(CH)NH-CPP, —C(O)CHNH-CPP, and: [ka] a cell penetrating peptide ("CPP") and a linker moiety selected from wherein the CPP is attached to the linker moiety through an amide bond at the carboxy terminus of the CPP.

[0176] In some embodiments, R 1 At least one example of is —N(CH) . In certain embodiments, R 1 Each example is -N(CH3)2. In some embodiments, G is of the formula: [ka] It is of In the formula, R a is selected from H, acyl, benzoyl, and stearoyl. a is acetyl.

[0177] In various embodiments, each instance of R is —N(CH 3 ) 2 and G is a group of the formula: [ka] It is of R a is acetyl.

[0178] In certain embodiments, the CPP has the formula: [ka] It is of In the formula, R a is selected from H, acyl, benzoyl, and stearoyl. a is acetyl. In various embodiments, R 1 Each example is -N(CH3)2, and CPP has the formula: [ka] It is of R a is acetyl.

[0179] In various embodiments, the antisense oligonucleotides of the present disclosure comprise a compound of formula (VIIc): [ka] or a pharmaceutically acceptable salt thereof, wherein: wherein each Nu is a nucleobase that together form a targeting sequence; Z is an integer from 8 to 38; G is —C(O)(CH)NH-CPP, —C(O)(CH)NH-CPP, —C(O)(CH)NHC(O)(CH)NH-CPP, —C(O)CHNH-CPP, and: [ka] a cell penetrating peptide ("CPP") and a linker moiety selected from wherein the CPP is attached to the linker moiety through an amide bond at the carboxy terminus of the CPP.

[0180] In some embodiments, G is of the formula: [ka] It is of In the formula, R ais selected from H, acyl, benzoyl, and stearoyl. a is acetyl.

[0181] In various embodiments, G has the formula: [ka] It is of R a is acetyl.

[0182] In certain embodiments, the CPP has the formula: [ka] It is of In the formula, R a is selected from H, acyl, benzoyl, and stearoyl. a is acetyl. In various embodiments, the CPP has the formula: [ka] It is of R a is acetyl.

[0183] In various embodiments, the antisense oligomer of the present disclosure comprises a compound of formula (VIId): [ka] and During the ceremony: each Nu is a nucleobase that together form a targeting sequence; Z is an integer from 8 to 38; R 1 Each example is -N(R 4 )2, where each R 4 are independently C1-C6 alkyl; R 2is selected from H, trityl, 4-methoxytrityl, acetyl, benzoyl, and stearoyl; G is -C(O)(CH2)5NH-CPP, -C(O)(CH2)2NH-CPP, -C(O)(CH2)2NHC(O)(CH2)5NH-CPP, -C(O)CHNH-CPP, and: [ka] a cell penetrating peptide ("CPP") and a linker moiety selected from wherein the CPP is attached to the linker moiety through an amide bond at the carboxy terminus of the CPP.

[0184] In some embodiments, at least one instance of R is —N(CH). In certain embodiments, R 1 Each example is -N(CH3)2.

[0185] In some embodiments, G is of the formula: [ka] It is of In the formula, R a is selected from H, acyl, benzoyl, and stearoyl. a is acetyl.

[0186] In various embodiments, R 1 Each instance of is -N(CH3)2, and G is a group of the formula: [ka] It is of R a is acetyl.

[0187] In certain embodiments, the CPP has the formula: [ka] It is of In the formula, R a is selected from H, acyl, benzoyl, and stearoyl. a is acetyl. In various embodiments, R 1 Each example is -N(CH3)2, and CPP has the formula: [ka] It is of R a is acetyl.

[0188] In various embodiments, the antisense oligonucleotides of the present disclosure comprise a compound of formula (VIIe): [ka] or a pharmaceutically acceptable salt thereof, wherein: each Nu is a nucleobase that together form a targeting sequence; Z is an integer from 8 to 38; R 2 is selected from H, trityl, 4-methoxytrityl, acetyl, benzoyl, and stearoyl; G is —C(O)(CH)NH-CPP, —C(O)(CH)NH-CPP, —C(O)(CH)NHC(O)(CH)NH-CPP, —C(O)CHNH-CPP, and: [ka] a cell penetrating peptide ("CPP") and a linker moiety selected from wherein the CPP is attached to the linker moiety through an amide bond at the carboxy terminus of the CPP.

[0189] In some embodiments, G is of the formula: [ka] It is of In the formula, R a is selected from H, acyl, benzoyl, and stearoyl. a is acetyl.

[0190] In various embodiments, G has the formula: [ka] It is of R a is acetyl.

[0191] In certain embodiments, the CPP has the formula: [ka] It is of In the formula, R a is selected from H, acyl, benzoyl, and stearoyl. a is acetyl. In various embodiments, the CPP has the formula: [ka] It is of R a is acetyl.

[0192] For example, in various embodiments, including the antisense oligomer embodiments of formulas (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), the targeting sequence is complementary to a target region containing an exon target associated with Duchenne muscular dystrophy. In certain embodiments, the targeting sequence is complementary to a target sequence containing exon 44 in the processing of preprocessed mRNA of human dystrophin. Furthermore, in certain embodiments, a sequence with 100% complementarity is selected, and one or more nucleobases are removed (or alternatively synthesized with one or more missing nucleobases), so that the resulting sequence has one or more missing nucleobases compared to its natural complement in the target region. It is contemplated that the remaining portion, excluding the portion where one or more nucleobases are removed, is 100% complementary. However, it is within the scope of the present invention that there may be a reduced level of complementarity. In embodiments, at least one nucleobase is removed when the targeting sequence would otherwise contain a stretch of three or four or more consecutive identical nucleobases or a biological palindromic sequence.

[0193] For example, in various embodiments, including those of the antisense oligomers of formulas (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), the targeting sequence is complementary to a target region containing an exon target associated with spinal muscular atrophy. In certain embodiments, the targeting sequence is complementary to a target sequence containing a region adjacent to exon 7 in the processing of preprocessed mRNA of human SMN2. Furthermore, in certain embodiments, a sequence with 100% complementarity is selected and one or more nucleobases are removed (or alternatively synthesized with one or more missing nucleobases), such that the resulting sequence has one or more missing nucleobases compared to its natural complement in the target region. It is contemplated that, apart from the portion where one or more nucleobases have been removed, the remaining portion is 100% complementary. However, it is within the scope of the present invention that there may be a reduced level of complementarity. In embodiments, at least one nucleobase is removed when the targeting sequence would otherwise contain a stretch of three or four or more consecutive identical nucleobases or a biological palindromic sequence.

[0194] For example, in various embodiments, including antisense oligomer embodiments of Formulas (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), the targeting sequence is complementary to a target region within intron 1 of the pre-mRNA of the human alpha-glucosidase (GAA) gene. For example, in various embodiments, including antisense oligomer embodiments of Formulas (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), the targeting sequence is complementary to a target region associated with exon 2 of the pre-mRNA of the human alpha-glucosidase (GAA) gene, wherein the target region comprises at least one additional nucleobase compared to the targeting sequence, wherein the at least one additional nucleobase does not have a nucleobase complementary to the targeting sequence, and wherein the at least one additional nucleobase is within the target region. Furthermore, in certain embodiments, a sequence with 100% complementarity is selected, and one or more nucleobases are removed (or alternatively synthesized with one or more missing nucleobases), so that the resulting sequence has one or more missing nucleobases compared to its natural complement in the target region. It is intended that, apart from the portion where one or more nucleobases are removed, the remaining portion is 100% complementary. However, it is within the scope of the present invention that there may be a reduced level of complementarity. In embodiments, when the targeting sequence would otherwise contain a stretch of three or four or more consecutive identical nucleobases or a biological palindrome sequence, at least one nucleobase is removed.

[0195] In various aspects, the antisense oligomer comprises a deletion sequence of any one of SEQ ID NOs: 1-128, wherein at least one nucleobase in any one of SEQ ID NOs: 1-128 is deleted. In various embodiments, the oligonucleotide comprises CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 69; eteplirsen); GTTGCCTCCGGTTCTGAAGGTGTTC (SEQ ID NO: 70; golodirsen); or CAATGCCATCCTGGAGTTCCTG (SEQ ID NO: 71; casimersen).

[0196] In some embodiments of any of the antisense oligomers, methods, or compositions described herein, Z is an integer between 8 and 28, 15 and 38, 15 and 28, 8 and 25, 15 and 25, 10 and 38, 10 and 25, 12 and 38, 12 and 25, 14 and 38, or 14 and 25. In some embodiments of any of the antisense oligomers, methods, or compositions described herein, Z is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, or 38. In some embodiments of any of the antisense oligomers, methods, or compositions described herein, Z is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28. In some embodiments of any of the antisense oligomers, methods, or compositions described herein, Z is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25.

[0197] In some embodiments, each Z in the modified antisense oligomers of the present disclosure, including compounds of Formula (I), (Ia), (IVa), (IVb), (IVc), (V), (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), is an integer from 8 to 28.

[0198] In some embodiments, each Z in the modified antisense oligomers of the present disclosure, including compounds of Formula (I), (Ia), (IVa), (IVb), (IVc), (V), (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), is an integer from 15 to 38.

[0199] In some embodiments, each Z in the modified antisense oligomers of the present disclosure, including compounds of Formula (I), (Ia), (IVa), (IVb), (IVc), (V), (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), is an integer from 15 to 28.

[0200] In some embodiments, each Z in the modified antisense oligomers of the present disclosure, including compounds of Formula (I), (Ia), (IVa), (IVb), (IVc), (V), (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), is an integer from 8 to 25.

[0201] In some embodiments, each Z in the modified antisense oligomers of the present disclosure, including compounds of Formula (I), (Ia), (IVa), (IVb), (IVc), (V), (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), is an integer between 15 and 25.

[0202] In some embodiments, each Z in the modified antisense oligomers of the present disclosure, including compounds of Formula (I), (Ia), (IVa), (IVb), (IVc), (V), (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), is an integer from 10 to 38.

[0203] In some embodiments, each Z in the modified antisense oligomers of the present disclosure, including compounds of Formula (I), (Ia), (IVa), (IVb), (IVc), (V), (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), is an integer from 10 to 25.

[0204] In some embodiments, each Z in the modified antisense oligomers of the present disclosure, including compounds of Formula (I), (Ia), (IVa), (IVb), (IVc), (V), (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), is an integer from 12 to 38.

[0205] In some embodiments, each Z in the modified antisense oligomers of the present disclosure, including compounds of Formula (I), (Ia), (IVa), (IVb), (IVc), (V), (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), is an integer from 12 to 25.

[0206] In some embodiments, each Z in the modified antisense oligomers of the present disclosure, including compounds of Formula (I), (Ia), (IVa), (IVb), (IVc), (V), (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), is an integer from 14 to 38.

[0207] In some embodiments, each Z in the modified antisense oligomers of the present disclosure, including compounds of Formula (I), (Ia), (IVa), (IVb), (IVc), (V), (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), is an integer from 14 to 25.

[0208] In some embodiments, each Z in the modified antisense oligomers of the disclosure, including compounds of Formula (I), (Ia), (IVa), (IVb), (IVc), (V), (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, or 38.

[0209] In some embodiments, each Z in the modified antisense oligomers of the disclosure, including compounds of Formula (I), (Ia), (IVa), (IVb), (IVc), (V), (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28.

[0210] In some embodiments, each Z in the modified antisense oligomers of the disclosure, including compounds of Formula (I), (Ia), (IVa), (IVb), (IVc), (V), (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25.

[0211] In some embodiments, each Nu of the antisense oligomers of the present disclosure, including compounds of Formula (I), (Ia), (IVa), (IVb), (IVc), (V), (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), is independently selected from the group consisting of adenine, guanine, thymine, uracil, cytosine, hypoxanthine, 2,6-diaminopurine, 5-methylcytosine, C5-propynyl-modified pyrimidine, and 9-(aminoethoxy)phenoxazine.

[0212] In some embodiments, the targeting sequence of the antisense oligomers of the present disclosure, including compounds of Formula (I), (Ia), (IVa), (IVb), (IVc), (V), (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), is complementary to 10 or more contiguous nucleotides of a target region within intron 1, intron 2, or exon 2 of the pre-mRNA of the human acid alpha glucosidase (GAA) gene. In certain embodiments, the targeting sequence of the antisense oligomers of the present disclosure, including compounds of Formula (I), (Ia), (IVa), (IVb), (IVc), (V), (VI), (VII), (VIIa), (VIIb), (VIIc), (VIId), (VIIe), and (VIII), is a fragment of at least 12 contiguous nucleotides or a variant having at least 90% sequence identity to the sequence, where X can be selected from uracil (U) or thymine (T).

[0213] Additional antisense oligomers / chemistries that can be used in the present disclosure include those described in the following patents and patent publications, the contents of which are incorporated herein by reference: WO 2007 / 002390; WO 2010 / 120820; and WO 2010 / 148249; U.S. Patent No. 7,838,657; and U.S. Patent Application Publication No. 2011 / 0269820.

[0214] Antisense oligonucleotides can be prepared by stepwise solid phase synthesis using methods known in the art and described herein and in the references cited therein.

[0215] iii. Preparation of PMO-X with a basic nitrogen internucleoside linker Morpholino subunits, modified intersubunit linkages, and oligomers comprising same can be prepared as described, for example, in U.S. Patent Nos. 5,185,444 and 7,943,762, which are incorporated by reference in their entireties. Morpholino subunits can be prepared according to the following general reaction scheme I.

[0216] Reaction Scheme 1. Preparation of Morpholino Subunits [ka] Referring to Reaction Scheme 1 (where B represents a base-pairing moiety and PG represents a protecting group), morpholino subunits can be prepared from the corresponding ribonucleoside (1) as shown. Morpholino subunit (2) can be protected, if necessary, by reaction with a suitable protecting group precursor, such as trityl chloride. The 3' protecting group is generally removed during solid-state oligomer synthesis, as described in more detail below. The base-pairing moiety can be suitably protected for solid-phase oligomer synthesis. Suitable protecting groups include benzoyl for adenine and cytosine, phenylacetyl for guanine, and pivaloyloxymethyl for hypoxanthine (I). The pivaloyloxymethyl group can be introduced at the N1 position of the hypoxanthine heterocyclic base. While unprotected hypoxanthine subunits can be used, yields in the activation reaction are much better when the base is protected. Other suitable protecting groups include those disclosed in co-pending US patent application Ser. No. 12 / 271,040, hereby incorporated by reference in its entirety.

[0217] Reaction of 3 with activated phosphorus compound 4 yields morpholino subunit 5 bearing the desired linking moiety. Compounds of structure 4 can be prepared using a number of methods known to those skilled in the art. For example, such compounds may be prepared by reaction of the corresponding amine with phosphorus oxychloride. In this regard, the amine starting material can be prepared using any method known in the art, such as those described in this example and in U.S. Pat. No. 7,943,762.

[0218] The compound of structure 5 can be used in solid-phase automated oligomer synthesis to prepare oligomers containing intersubunit linkages. Such methods are well known in the art. Briefly, the compound of structure 5 can be modified at the 5' end to contain a linker to a solid support. For example, compound 5 can be prepared by adding L 11 and L 15 It may be linked to the solid support by a linker comprising:

[0219] Morpholino oligomers containing any number of modified linkages can be prepared using methods described herein, known in the art, and / or described by reference herein. The Examples also describe global modifications of morpholino oligomers prepared as previously described (see, e.g., WO2008036127).

[0220] The term "protecting group" refers to a chemical moiety that blocks some or all reactive moieties in a compound, preventing them from participating in a chemical reaction until the protecting group is removed, such as those listed and described in T.W. Greene, P.G.M. Buts, Protective Groups in Organic Synthesis, 3rd ed., John Wiley & Sons (1999). When different protecting groups are used, it can be advantageous for each (different) protecting group to be removable by a different means. Protecting groups that are cleaved under disparate reaction conditions allow for differential removal of such protecting groups. For example, protecting groups can be removed by acid, base, and hydrogenolysis. Groups such as trityl, dimethoxytrityl, acetal, and tert-butyldimethylsilyl are acid labile and can be used to protect carboxy and hydroxy reactive moieties, in the presence of Cbz groups, which can be removed by hydrogenolysis, and amino groups protected by the base-labile Fmoc group. Carboxylic acid moieties may be blocked with base-labile groups such as, without limitation, methyl or ethyl, and hydroxy-reactive moieties may be blocked with base-labile groups such as acetyl, in the presence of amines blocked with acid-labile groups such as tert-butyl carbamate, or carbamates that are both acid- and base-stable but hydrolytically removable.

[0221] Carboxylic acid and hydroxyl reactive moieties may also be blocked with hydrolytically removable protecting groups such as benzyl groups, while amine groups may be blocked with base-labile groups such as Fmoc. A particularly useful amine protecting group for the synthesis of compounds of formula (I) is trifluoroacetamide. Carboxylic acid reactive moieties may be blocked with oxidatively removable protecting groups such as 2,4-dimethoxybenzyl, while coexisting amino groups may be blocked with fluoride-labile silyl carbamates.

[0222] Allyl blocking groups are useful in the presence of acid and base protecting groups because the former are stable and can be subsequently removed by metal or pi-acid catalysts. For example, allyl-blocked carboxylic acids can be deprotected by palladium(0) catalysis in the presence of acid-labile t-butyl carbamate or base-labile acetate amine protecting groups. Yet another form of protecting group is a resin to which a compound or intermediate can be attached. As long as the residue is attached to the resin, the functional group in question is blocked and cannot react. Upon release from the resin, the functional group becomes available for reaction.

[0223] Typical blocking / protecting groups are known in the art and include, but are not limited to, the following moieties: [ka]

[0224] Unless otherwise noted, all chemicals were obtained from Sigma-Aldrich-Fluka. Benzoyl adenosine, benzoyl cytidine, and phenylacetyl guanosine were obtained from Carbosynth Limited, UK.

[0225] The synthesis of PMO, PMO+, PPMO, and PMO-X containing further linkage modifications as described herein was carried out using methods known in the art and described in pending U.S. patent applications Ser. Nos. 12 / 271,036 and 12 / 271,040 and WO 2009 / 064471, which are hereby incorporated by reference in their entireties.

[0226] PMOs with 3' trityl modifications are synthesized essentially as described in WO 2009 / 064471, except that the detritylation step is omitted.

[0227] III. Preparations The compounds of the present disclosure may also be mixed, encapsulated, conjugated, or otherwise combined with other molecules, molecular structures, or mixtures of compounds, such as, for example, liposomes, receptor-targeted molecules, oral, rectal, topical, or other formulations, to aid uptake, distribution, and / or absorption. Representative United States patents that teach the preparation of such uptake, distribution and / or absorption-enhancing formulations include, but are not limited to, U.S. Patent Nos. 5,108,921; 5,354,844; 5,416,016; 5,459,127; 5,521,291; 5,543,158; 5,547,932; 5,583,020; 5,591,721; 4,426,330; 4,534,899; 5,013,556; 5,108,921; and 5,213,804. ; 5,227,170; 5,264,221; 5,356,633; 5,395,619; 5,416,016; 5,417,978; 5,462,854; 5,469,854; 5,512,295; 5,527,528; 5,534,259; 5,543,152; 5,556,948; 5,580,575; and 5,595,756 (each of which is incorporated by reference herein).

[0228] The antisense compounds of the present disclosure include any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compounds capable of providing (directly or indirectly) a biologically active metabolite or residue thereof upon administration to an animal, including a human. Thus, for example, the present disclosure also relates to prodrugs and pharmaceutically acceptable salts of the compounds of the present disclosure, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.

[0229] As used herein, the term "prodrug" refers to a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., a drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and / or conditions. In particular, prodrug versions of the oligomers of the present disclosure are prepared as SATE [(S-acetyl-2-thioethyl)phosphate] derivatives according to the methods described in WO 93 / 24510 to Gosselin et al., published December 9, 1993, or WO 94 / 26764 to Imbach et al., and U.S. Pat. No. 5,770,713.

[0230] As used herein, the term "pharmaceutically acceptable salts" refers to physiologically and pharmaceutically acceptable salts of the compounds of the present disclosure: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto. Examples of pharmaceutically acceptable salts and their uses for oligomers are further described in U.S. Patent No. 6,287,860, which is incorporated herein by reference in its entirety.

[0231] The present disclosure also includes pharmaceutical compositions and formulations comprising the antisense compounds of the present disclosure. The pharmaceutical compositions of the present disclosure can be administered in a number of ways, depending on whether local or systemic treatment is desired and the area to be treated. Administration can be topical (including to mucous membranes, including ophthalmic and vaginal and rectal delivery), pulmonary (e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer); intratracheal, intranasal, epidermal, and transdermal), oral, or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. Oligomers having at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration. Pharmaceutical compositions and formulations for topical administration can include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful.

[0232] The pharmaceutical formulations of the present disclosure, which may conveniently be provided in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of combining the active ingredient with a pharmaceutical carrier or excipient. In general, the formulations are prepared by uniformly and intimately bringing the active ingredient into association with a liquid carrier or a finely divided solid carrier, or both, and then, if necessary, shaping the product.

[0233] The compositions of the present disclosure may be formulated into any of many possible dosage forms, including, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present disclosure may also be formulated as suspensions in aqueous, non-aqueous, or mixed media. Aqueous suspensions may further contain substances that increase the viscosity of the suspension, including, for example, sodium carboxymethylcellulose, sorbitol, and / or dextran. The suspension may also contain stabilizers.

[0234] Pharmaceutical compositions of the present disclosure include, but are not limited to, solutions, emulsions, foams, and liposome-containing formulations. Pharmaceutical compositions and formulations of the present disclosure may include one or more penetration enhancers, carriers, excipients, or other active or inactive ingredients.

[0235] Emulsion is typically a heterogeneous system in which one liquid is dispersed in another liquid in the form of droplets, usually with a diameter of more than 0.1 μm.Emulsion may contain additional components in addition to the dispersed phase, and active drug, which may exist as a solution in either aqueous phase, oily phase, or in a separate phase.Microemulsions are included as an embodiment of the present disclosure.Emulsions and their uses are well known in the art, and are further described in U.S. Patent No. 6,287,860 (which is incorporated herein by reference in its entirety).

[0236] The formulations of the present disclosure include liposome formulations. As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in one or more spherical bilayers. Liposomes are unilamellar or multilamellar vesicles with a membrane formed from a lipophilic material and an aqueous interior containing the composition to be delivered. Cationic liposomes are positively charged liposomes that are thought to interact with negatively charged DNA molecules to form stable complexes. pH-sensitive or negatively charged liposomes are thought to entrap DNA rather than complex with it. Both cationic and non-cationic liposomes have been used to deliver DNA to cells.

[0237] Liposomes also include "sterically stabilized" liposomes, a term used herein to refer to liposomes containing one or more specialized lipids that, when incorporated into the liposome, provide improved circulation life compared to liposomes that do not contain the specialized lipids. Examples of sterically stabilized liposomes are those in which the vesicle-forming lipid portion of the liposome contains one or more glycolipids or is derivatized with one or more hydrophilic polymers, such as polyethylene glycol (PEG) moieties. Liposomes and their uses are further described in U.S. Pat. No. 6,287,860, which is incorporated herein by reference in its entirety.

[0238] The pharmaceutical formulations and compositions of the present disclosure can also comprise surfactants.The use of surfactants in drug products, formulations and emulsions is well known in the art.Surfactants and their use are further described in U.S. Patent No. 6,287,860 (which is incorporated herein by reference in its entirety).

[0239] In some embodiments, the present disclosure utilizes various permeation enhancers to affect efficient delivery of nucleic acids, particularly oligomers. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, permeation enhancers also improve the permeability of lipophilic drugs. Permeation enhancers may be classified as belonging to one of five broad categories: surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants. Permeation enhancers and their uses are further described in U.S. Pat. No. 6,287,860, incorporated herein by reference in its entirety.

[0240] Those skilled in the art will recognize that a formulation is routinely designed according to its intended use, ie, route of administration.

[0241] Formulations for topical administration include those in which the oligomers of the present disclosure are mixed with topical delivery agents such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents, and surfactants. Lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPEethanolamine, dimyristoylphosphatidylcholine DMPC, distearolyphosphatidyl choline), negative (e.g., dimyristoylphosphatidylglycerol DMPG), and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidylethanolamine DOTMA) lipids and liposomes.

[0242] For topical or other administration, the oligomers of the present disclosure may be encapsulated in or complexed with liposomes, particularly cationic liposomes. Alternatively, the oligomers may be complexed with lipids, particularly cationic lipids. Fatty acids and esters, their pharmaceutically acceptable salts, and their uses are further described in U.S. Patent No. 6,287,860 (incorporated herein in its entirety). Topical formulations are described in detail in U.S. Patent Application No. 09 / 315,298, filed May 20, 1999 (incorporated herein in its entirety).

[0243] Compositions and formulations for oral administration include powders or granules, microparticles, nanoparticles, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets, or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids, or binders may be desirable. Oral formulations are those in which the oligomers of the present disclosure are administered in combination with one or more permeation enhancers, surfactants, and chelators. Surfactants include fatty acids and / or their esters or salts, bile acids and / or their salts. Bile acids / salts and fatty acids and their uses are further described in U.S. Pat. No. 6,287,860, incorporated herein by reference in its entirety. In some embodiments, the present disclosure provides a permeation enhancer, such as a fatty acid / salt combination, in combination with a bile acid / salt. An exemplary combination is the sodium salt of lauric acid, capric acid, and UDCA. Additional permeation enhancers include polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether. The oligomers of the present disclosure may be orally delivered in granular form, including spray-dried particles, or may be complexed to form microparticles or nanoparticles. Oligomer complexing agents and their uses are further described in U.S. Patent No. 6,287,860, which is incorporated herein by reference in its entirety. Oral formulations for oligomers and their preparation are described in detail in U.S. Patent Application Nos. 09 / 108,673, filed July 1, 1998; 09 / 315,298, filed May 20, 1999; and 10 / 071,822, filed February 8, 2002, each of which is incorporated herein by reference in its entirety.

[0244] Compositions and formulations for parenteral, intrathecal, or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents, and other suitable additives, including but not limited to, permeation enhancers, carrier compounds, and other pharmaceutically acceptable carriers or excipients.

[0245] Certain embodiments of the present disclosure provide pharmaceutical compositions containing one or more oligomeric compounds and one or more other chemotherapeutic agents that function by a non-antisense mechanism. Examples of such chemotherapeutic agents include, but are not limited to, daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosourea (me), and the like. and cancer chemotherapy drugs such as thylcyclohexylnitrosurea, nitrogen mustard, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclophosphoramide, 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin, and diethylstilbestrol (DES). When used in conjunction with the compounds of the present disclosure, such chemotherapeutic agents may be used individually (e.g., 5-FU and an oligomer), sequentially (e.g., 5-FU and an oligomer for a period of time, followed by MTX and an oligomer), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and an oligomer, or 5-FU, radiation therapy and an oligomer). Anti-inflammatory agents, including but not limited to nonsteroidal anti-inflammatory agents and corticosteroids, and antiviral agents, including but not limited to ribavirin, vidarabine, acyclovir, and ganciclovir, may also be used in combination with the compositions of the present disclosure.Combinations of antisense compounds with other non-antisense drugs are also within the scope of this disclosure. Two or more combination compounds may be used together or sequentially.

[0246] In another related embodiment, the composition of the present disclosure can contain one or more antisense compounds, particularly oligomers, that are targeted to a first nucleic acid, and one or more additional antisense compounds that are targeted to a second nucleic acid target.Alternatively, the composition of the present disclosure can contain two or more antisense compounds that are targeted to different regions of the same nucleic acid target.Many examples of antisense compounds are known in the art.Two or more combination compounds can be used together or sequentially.

[0247] IV.How to use In a further aspect, the antisense oligomeric compounds described herein are used to treat a disease. In embodiments, the disease is associated with a specific exon location or region, and targeting that exon location or region with an antisense oligomeric compound results in an increase or decrease in mRNA or protein transcribed or translated from that exon location or region. In embodiments, the increase is 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a control, e.g., a control cell / subject. In embodiments, the reduction is 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a control, e.g., a control cell / subject.

[0248] In a further aspect, the antisense oligomeric compounds described herein are used to treat diseases associated with a specific exon location or region, where the specific exon location or region contains at least one stretch of three or more consecutive identical nucleobases in the target sequence, and where targeting of that exon location or region with an antisense oligomeric compound results in an increase or decrease in mRNA or protein transcribed or translated from that exon location or region. In embodiments, the increase is 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a control, e.g., a control cell / subject. In embodiments, the reduction is 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a control, e.g., a control cell / subject.

[0249] In a further aspect, the antisense oligomeric compounds described herein are used to treat diseases associated with a specific exon location or region, where the specific exon location or region contains at least one biological palindromic sequence in the target sequence, and where targeting of the exon location or region with the antisense oligomeric compound results in an increase or decrease in mRNA or protein transcribed or translated from the exon location or region. In embodiments, the increase is 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a control, e.g., a control cell / subject. In embodiments, the reduction is 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a control, e.g., a control cell / subject.

[0250] In embodiments, the antisense oligomeric compounds described herein are used to treat exon targets associated with Duchenne muscular dystrophy (DMD), as generally described in WO 2006 / 000057. In embodiments, the target sequence comprises exon 44 in the processing of preprocessed human dystrophin mRNA. In embodiments, the targeting sequence comprises any one of SEQ ID NOS: 2-7. In embodiments, the target sequence comprises exon 45, 51, or 53 of preprocessed human dystrophin mRNA. In embodiments, the targeting sequence comprises any one of SEQ ID NOS: 75-123. In embodiments, targeting the described exon position or site by the antisense oligomeric compound results in an increase or decrease in mRNA or protein transcribed or translated from that exon position or site. In embodiments, the increase is 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a control, e.g., a control cell / subject. In embodiments, the reduction is 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a control, e.g., a control cell / subject.

[0251] In embodiments, the antisense oligomeric compounds described herein are used to treat exon targets associated with spinal muscular atrophy (SMA), as generally described in WO 2017 / 040271, the contents of which are incorporated herein by reference in their entirety. In embodiments, the target sequence comprises a region adjacent to exon 7 in the processing of preprocessed mRNA of human SMN2. In embodiments, the targeting sequence comprises any one of SEQ ID NOS: 9-25. In embodiments, targeting the described exon position or site by the antisense oligomeric compound results in an increase or decrease in mRNA or protein transcribed or translated from that exon position or site. In embodiments, the increase is 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a control, e.g., a control cell / subject. In embodiments, the reduction is 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a control, e.g., a control cell / subject.

[0252] In embodiments, the antisense oligomeric compounds described herein are used to treat exon targets associated with glycogen storage disease type II (GSD-II), as generally described in PCT Patent Application No. PCT / US17 / 28002. In embodiments, the target sequence comprises a region associated with exon 2 of the preprocessed mRNA of human acid alpha-glucosidase. In embodiments, the targeting sequence comprises any one of SEQ ID NOS: 26-71. In embodiments, targeting the described exon position or site with the antisense oligomeric compound results in an increase or decrease in mRNA or protein transcribed or translated from that exon position or site. In embodiments, the increase is 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a control, e.g., a control cell / subject. In embodiments, the reduction is 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%.

[0253] In various aspects and embodiments, the antisense oligomeric compounds described herein contain deleted sequences and are used to treat diseases. In embodiments, the disease is associated with a specific exon location or region, and targeting that exon location or region with an antisense oligomeric compound results in an increase or decrease in mRNA or protein transcribed or translated from that exon location or region. In embodiments, the increase is 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a control, e.g., a control cell / subject. In embodiments, the reduction is 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% compared to a control, e.g., a control cell / subject. The deletion sequence comprises any one of SEQ ID NOs: 1-128, wherein at least one nucleobase in any one of SEQ ID NOs: 1-128 is deleted. In various embodiments, the deleted sequence comprises CTCCAACATCAAGGAAGATGGCATTTCTAG (SEQ ID NO: 69; eteplirsen); GTTGCCTCCGGTTCTGAAGGTGTTC (SEQ ID NO: 70; gologirsen); or CAATGCCATCCTGGAGTTCCTG (SEQ ID NO: 71; casimersen). In various embodiments, the deleted sequence comprises any one of SEQ ID NOs: 69-71, wherein at least one nucleobase in any one of SEQ ID NOs: 69-71 is deleted. In embodiments, the deleted at least one nucleobase is within the sequence of any one of SEQ ID NOs: 69-71.

[0254] Thus, a physician or clinician may consider applying knowledge gained from relevant pharmacogenomic studies in deciding whether to administer a therapeutic agent and in adjusting the dosage and / or treatment regimen of the therapeutic agent.

[0255] Effective delivery of antisense oligomers to target nucleic acids is one aspect of treatment. Antisense oligomer delivery routes include, but are not limited to, various systemic routes, including oral and parenteral routes, such as intravenous, subcutaneous, intraperitoneal, and intramuscular, as well as inhalation, transdermal, and topical delivery. Appropriate routes can be determined by those skilled in the art depending on the condition of the subject being treated. Vascular or extravascular circulation, blood or lymphatic system, and cerebrospinal fluid are some non-limiting sites where RNA can be introduced. Direct CNS delivery can also be used, for example, intracerebral ventricle or intrathecal administration can be used as an administration route.

[0256] In a specific embodiment, one or more antisense oligomers are administered to a subject by intramuscular injection (IM), i.e., the antisense oligomer is administered or delivered intramuscularly.Non-limiting examples of intramuscular injection sites include the deltoid muscle of the arm, the vastus lateralis muscle of the leg, and the ventral gluteus maximus muscle of the hip joint and the dorsal gluteus maximus muscle of the buttocks.In a specific embodiment, PMO, PMO-X, or PPMO is administered by IM.

[0257] In certain embodiments, a subject in need thereof has glycogen accumulation in central nervous system tissue. Examples include cases where central nervous system lesions contribute to respiratory failure in GSD-II (see, e.g., DeRuisseau et al., PNAS USA. 106:9419-24, 2009). Thus, the antisense oligomers described herein can be delivered to a subject's nervous system by any art-recognized method, for example, when the subject has GSD-II with CNS damage. For example, peripheral blood injection of the disclosed antisense oligomers can be used to deliver the reagent to peripheral neurons by diffusive and / or active means. Alternatively, antisense oligomers can be modified to facilitate passage through the blood-brain barrier (BBB), thereby achieving delivery of the reagent to neurons in the central nervous system (CNS). Particularly recently, advances in antisense oligomer technology and delivery strategies have expanded the scope of use of antisense oligomers for neuronal disorders (see, e.g., Forte, A., et al. 2005. Curr. Drug Targets 6:21-29; Jaeger, L.B., and W.A. Banks. 2005. Methods Mol. Med. 106:237-251; Vinogradov, S.V., et al. 2004. Bioconjug. Chem. 5:50-60; the entire contents of which are incorporated herein by reference). For example, the antisense oligomers of the present disclosure can be prepared as peptide nucleic acid (PNA) compounds. Each of the PNA reagents has been identified to cross the BBB (Jaeger, L.B., and W.A. Banks. 2005. Methods Mol. Med. 106:237-251). For example, treatment of a subject with a vasoactive agent has also been described to promote transport across the BBB (ibid.). Tethering an antisense oligomer of the present disclosure to an agent that is actively transported across the BBB may also be used as a delivery mechanism.Administering an antisense agent together with an imaging agent such as iohexol (e.g., separately, simultaneously, in the same formulation) can also facilitate delivery across the BBB, as described in WO 2013 / 086207 (incorporated by reference in its entirety).

[0258] In certain embodiments, the antisense oligomers of the present disclosure can be delivered by transdermal methods (e.g., by incorporating the antisense oligomer in, for example, an emulsion, where the antisense oligomer is optionally packaged in a liposome). Such transdermal and emulsion / liposome-mediated delivery methods have been described in the art for delivery of antisense oligomers, for example, in U.S. Pat. No. 6,965,025, the contents of which are incorporated herein by reference in their entirety.

[0259] The antisense oligomers described herein may also be delivered by implantable devices, the design of which is art-recognized for synthetic implant design, e.g., as described in U.S. Pat. No. 6,969,400, the contents of which are incorporated herein by reference in their entirety.

[0260] Antisense oligomers can be introduced into cells using art-recognized techniques (e.g., transfection, electroporation, fusion, liposomes, colloidal polymer particles, and viral and non-viral vectors, as well as other means known in the art). The selected delivery method will depend, at least, on the oligomer chemistry, the cells to be treated, and the cellular site, and will be apparent to those skilled in the art. For example, localization can be achieved by liposomes bearing specific markers that direct the liposomes to the surface, direct injection into tissues containing target cells, specific receptor-mediated uptake, etc.

[0261] As is known in the art, antisense oligomers may be delivered using methods involving, for example, liposome-mediated uptake, lipid conjugates, polylysine-mediated uptake, nanoparticle-mediated uptake, and receptor-mediated endocytosis, as well as additional non-endocytic delivery modalities such as microinjection, permeabilization (e.g., streptolysin O permeabilization, anionic peptide permeabilization), electroporation, and various non-invasive, non-endocytic delivery methods known in the art (see Dokka and Rojanasakul, Advanced Drug Delivery Reviews 44, 35-49, incorporated by reference in its entirety).

[0262] Antisense oligomers may be administered in any convenient physiologically and / or pharmaceutically acceptable medium or carrier. Such compositions may include any of a variety of standard pharmaceutically acceptable carriers utilized by those skilled in the art. Examples include, but are not limited to, saline, phosphate-buffered saline (PBS), water, aqueous ethanol, emulsions such as oil / water emulsions or triglyceride emulsions, tablets, and capsules. The selection of a suitable physiologically acceptable carrier will depend on the selected mode of administration. "Pharmaceutically acceptable carrier" is intended to include any solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, its use in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.

[0263] The compounds of the present disclosure (e.g., antisense oligomers) may generally be utilized as free acids or free bases. Alternatively, the compounds of the present disclosure may be used in the form of acid or base addition salts. Acid addition salts of the free amino compounds of the present disclosure may be prepared by methods well known in the art and may be formed with organic and inorganic acids. Suitable organic acids include maleic acid, fumaric acid, benzoic acid, ascorbic acid, succinic acid, methanesulfonic acid, acetic acid, trifluoroacetic acid, oxalic acid, propionic acid, tartaric acid, salicylic acid, citric acid, gluconic acid, lactic acid, mandelic acid, cinnamic acid, aspartic acid, stearic acid, palmitic acid, glycolic acid, glutamic acid, and benzenesulfonic acid.

[0264] Suitable inorganic acids include hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, and nitric acid. Base addition salts include salts formed with carboxylic acid anions, including those formed with organic and inorganic cations such as those selected from alkali and alkaline earth metals (e.g., lithium, sodium, potassium, magnesium, barium, and calcium), and ammonium ions and their substituted derivatives (e.g., dibenzylammonium, benzylammonium, 2-hydroxyethylammonium, etc.). Thus, the term "pharmaceutically acceptable salt" is intended to encompass all acceptable salt forms.

[0265] Additionally, prodrugs are also included within the context of the present disclosure. A prodrug is any covalently bonded carrier that releases the compound in vivo when such prodrug is administered to a patient. Prodrugs are generally prepared by modifying functional groups in such a way that the modification is cleaved, either by routine manipulation or in vivo, to yield the parent compound. Prodrugs include, for example, compounds of the present disclosure in which a hydroxy, amine, or sulfhydryl group is bonded to any group that will cleave upon administration to a patient to form a hydroxy, amine, or sulfhydryl group. Thus, representative examples of prodrugs include (but are not limited to) acetylate, tert-, formate, and benzoate derivatives of alcohol and amine functional groups of the antisense oligomers of the present disclosure. Furthermore, in the case of carboxylic acids (—COOH), esters such as methyl esters, ethyl esters, and the like may be used.

[0266] In some cases, liposomes may be utilized to facilitate cellular uptake of antisense oligomers (e.g., Williams, SA, Leukemia 10(12):1980-1989, 1996; Lappalainen et al., Antiviral Res. 23:119, 1994; Uhlmann et al., Antisense oligomers: a new therapeutic principle, Chemical Reviews, Volume 90, No. 4, 25 pages 544-584, 1990; Gregoriadis, G., Chapter 14, Liposomes, Drug Carriers in Biology and Medicine, pp. 287-341, Academic Press, 1979). Hydrogels can also be used as vehicles for administering antisense oligomers, as described, for example, in WO 93 / 01286. Alternatively, the oligomers can be administered in microspheres or microparticles (see, for example, Wu, GY and Wu, CH, J. Biol. Chem. 262:4429-4432, 30 1987). Alternatively, gas-filled microbubbles complexed with antisense oligomers can be used to enhance delivery to target tissues, as described in U.S. Pat. No. 6,245,747. Sustained-release compositions can also be used. These can include semipermeable polymer matrices in the form of shaped articles such as films or microcapsules.

[0267] In one embodiment, the antisense oligomer is administered in a suitable pharmaceutical carrier to a mammalian subject, such as a human or livestock, exhibiting symptoms of a lysosomal storage disorder. In one aspect of this method, the subject is a human subject, such as a patient diagnosed with GSD-II (Pompe disease). In a preferred embodiment, the antisense oligomer is delivered orally in a pharmaceutically acceptable carrier. In another preferred embodiment, the oligomer is delivered intravenously in a pharmaceutically acceptable carrier.

[0268] In one embodiment, the antisense compound is administered in an amount and manner effective to produce a peak blood concentration of the antisense oligomer of at least 200-400 nM. Typically, one or more doses of the antisense oligomer are administered, generally at regular intervals, over a period of about 1-2 weeks. A preferred dose for oral administration is about 1-1000 mg of oligomer per 70 kg of body weight. In some cases, a dose higher than 1000 mg of oligomer per patient may be required. For intravenous administration, a preferred dose is about 0.5 mg-1000 mg of oligomer per 70 kg of body weight. The antisense oligomer may be administered at regular intervals over a short period of time, for example, daily for up to two weeks. However, in some cases, the oligomer is administered intermittently over a longer period of time. Administration may precede or coincide with the administration of antibiotics or other therapeutic treatments. The treatment regimen may be adjusted (e.g., in terms of dosage, frequency, route, etc.) as indicated, based on the results of immunoassays, other biochemical tests, and physiological examinations of the subject being treated.

[0269] Effective in vivo treatment regimens using the antisense oligomers of the present disclosure may vary depending on the duration, dose, frequency, and route of administration, as well as the condition of the subject being treated (i.e., whether administered prophylactically or in response to a localized or systemic infection). Accordingly, such in vivo therapy may often require monitoring with tests appropriate for the particular type of disorder being treated, and corresponding adjustment of the dose or treatment regimen, to achieve optimal therapeutic results.

[0270] Treatment may be monitored, for example, by common disease indicators known in the art. The efficacy of the antisense oligomers of the present disclosure administered in vivo may be determined from biological samples (tissue, blood, urine, etc.) collected from the subject before, during, and after administration of the antisense oligomer. Assays of such samples include: (1) monitoring the presence or absence of heteroduplex formation with target and non-target sequences using procedures known to those skilled in the art, such as electrophoretic gel mobility assays; (2) monitoring the amount of mutant mRNA compared to a reference normal mRNA or protein, as determined by standard techniques such as RT-PCR, Northern blotting, ELISA, or Western blotting.

[0271] In some embodiments, antisense oligomers are actively taken up by mammalian cells, hi further embodiments, the antisense oligomers may be conjugated to a transport moiety (e.g., a transport peptide or CPP) as described herein to facilitate such uptake.

[0272] V. Medication The formulation of therapeutic compositions and their subsequent administration (dosing) are considered within the skill of those of ordinary skill in the art. Dosing depends on the severity and responsiveness of the disease state to be treated, with treatment courses lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the patient's body. Those of ordinary skill in the art can readily determine optimal dosages, dosing methods, and repetition rates. Optimal dosages may vary depending on the relative potency of individual oligomers and can generally be estimated based on the EC50 values ​​found to be effective in in vitro and in vivo animal models. Generally, dosages range from 0.01 μg to 100 g per kg of body weight and may be given once or more times daily, weekly, monthly, or yearly, or even once every 2 to 20 years. Those of ordinary skill in the art can readily estimate repetition rates for dosing based on the measured residence time and concentration of the drug in body fluids or tissues. After successful treatment, it may be desirable to have the patient undergo maintenance therapy to prevent recurrence of the disease state, in which the oligomer is administered at a maintenance dose ranging from 0.01 μg to 100 g per kg of body weight at least once daily up to once every 20 years.

[0273] While the present disclosure has been described with particularity in accordance with certain of its embodiments, the following examples are provided merely to illustrate the disclosure and are not intended to limit it. Each of the references, patents, patent applications, GenBank accession numbers, etc. described in this application is incorporated herein by reference in its entirety.

[0274] The following examples illustrate various embodiments of the present invention without limitation. [Example]

[0275] Example 1: Oligomers targeting sequences with multiple nucleobase stretches form aggregates This example details that sequences with multiple homologous nucleobases present a problem in PMO production.

[0276] Specifically, the synthesis of G-rich PMOs, such as GAA PMOs, can lead to aggregation due to the formation of intramolecular G-quadruplexes. Furthermore, sequences containing a series of three or more homologous nucleobases, such as adenine, thymine, or cytosine, present similar aggregation problems or other manufacturing challenges and inefficiencies.

[0277] When analyzed by analytical strong cation exchange (SCX) HPLC, GAA PMOs, or other PMOs with the same nucleobase sequence, give rise to several distinct peaks with quite different retention times, which should correspond to different aggregate forms of the conjugate.

[0278] Evidence of aggregation is provided by HPLC performed using a Thermo Propac SCX-20 column. The buffer system and HPLC operating conditions are shown in Table 1. The following procedure is used to prepare drug product test samples for 100 mg of lyophilized drug product per vial. After warming the sample to room temperature, use a 3 mL syringe and needle to dispense 2.1 mL of WFI into the vial. Vortex the sample to ensure complete dissolution. Before use, the sample is incubated at room temperature. Use a 3 mL syringe and needle to draw 2.0 mL of air into the vial. Invert the vial and transfer 2.0 mL of solution from the vial to a glass container. Use a volumetric pipette to dispense 1 mL of sample solution into a 50 mL volumetric flask. Fill the flask to capacity with PBS and mix.

[0279] [Table 1]

[0280] The expected chromatographic result is that sequences with three or more consecutive Gs will produce aggregate peaks that elute much later than the non-aggregated species, with the later eluting peaks corresponding to multimeric aggregate forms of the conjugate.

[0281] Furthermore, stretches of consecutive homologous nucleobases can present problems during PMO production. As the number of homologous nucleobases increases, the likelihood of unwanted N-1 deletions increases. For example, a sequence containing a stretch of four thymines may result in unwanted N-1 deletions, resulting in a final compound with only three thymines. In such a situation, the three-thymine compound would then be considered an impurity. Methods such as mass spectrometry can be used to decipher the N-1 deletion impurity.

[0282] Example 2: Oligomers containing deletions targeting sequences with multiple nucleobases prevent aggregation To address the issues presented by a homologous nucleobase stretch affecting PMO manufacturing, removing a single or multiple bases from the stretch should correct aggregation or other manufacturing problems. Table 2 shows fully complementary sequences and corresponding deletion sequences to test that would resolve the issues presented in Example 1. To disrupt PMO aggregation or address manufacturing issues, PMOs with deletions for guanine and thymine are synthesized.

[0283] [Table 2]

[0284] Analysis is carried out under highly concentrated SCX HPLC conditions or by mass spectrometry as directed in Example 1.

[0285] Deletion of guanines or thymines based on the sequences in Table 2 should affect the relative amount of aggregates or the efficiency of PMO production. Deletion of as few as one or two nucleobases should decrease the conjugation rate of the aggregated form compared to that of the fully complementary form, or increase the percentage of product of the desired structure compared to the fully complementary structure.

[0286] Based on the unexpected results from other examples described herein demonstrating that internal deletion of nucleobases does not significantly reduce PMO activity (exon skipping or incorporation), it is reasonably expected that deletion of one or two nucleobases to reduce the number of cognate nucleobases in Table 2 will not affect its functional activity.

[0287] Example 3: Exon skipping percentage of specific deletion sequence compounds targeting exon 44 Deletion sequence oligomers with the sequences shown in Table 3 were prepared.

[0288] [Table 3]

[0289] Various concentrations of compounds (20 μM, 10 μM, 5 μM, 2.5 μM, 1.25 μM, and 0.625 μM) were tested, and % exon skipping values ​​were determined according to WO 2014 / 153220, the contents of which are incorporated herein by reference in their entirety. The results are shown in Figure 1. Additionally, as shown in Figure 1, the fold increase in potency over control for the compounds identified in Table 3 was determined as shown in Table 4.

[0290] [Table 4]

[0291] Example 4: Percentage of exon inclusion for specific deletion sequence compounds targeting exon 7 Deletion sequence oligomers were prepared having the sequences shown in Table 5 and FIG.

[0292] [Table 5]

[0293] Various concentrations of compounds (1 μM and 0.1 μM) were tested, and % exon 7 inclusion values ​​were determined according to WO 2017 / 040271, the contents of which are incorporated herein by reference in their entirety. The results are shown in Figure 3. Gapmer / blevmer sequences 1, 2, 3, 5, 8, 9, 11, and 14 showed the best activity.

[0294] Example 5: Percentage of exon inclusion for specific deletion sequence compounds targeting exon 7 Oligomers were prepared having the sequences shown in Table 5 herein. A subset of compounds was tested at various concentrations (1 μM, 0.3 μM, 0.1 μM, 0.03 μM, and 0.01 μM), and % exon 7 inclusion values ​​were determined according to WO 2017 / 040271, the contents of which are incorporated herein by reference in their entirety. The results are shown in Figure 4.

[0295] Additionally, in a separate set of experiments, a subset of compounds was tested at various concentrations (1 μM, 0.3 μM, 0.1 μM, 0.03 μM, and 0.01 μM) and the % exon 7 inclusion values ​​were determined. The results are shown in Figure 5. For the data presented in Figures 4 and 5, gapmer / blebmer sequences 2, 7, and 11 showed the best activity.

[0296] Example 6: Modulation of GAA enzyme activity by specific deletion sequence compounds targeting exon 2 Deletion sequences were designed to treat Pompe disease (also referred to herein as glycogen storage disease type II). Table 6 details representative oligomers designed for the treatment of Pompe disease.

[0297] [Table 6]

[0298] [Table 7]

[0299] Oligomers are prepared having the sequences shown in Table 6 herein. Varying concentrations of a subset of compounds are tested and changes in GAA enzyme activity are measured according to PCT Application No. PCT / US17 / 28002, the contents of which are incorporated herein by reference in their entirety.

[0300] Example 7: Exon skipping percentages of specific deletion sequence compounds targeting exons 51, 53, and 45 Deletion sequences were designed to target exons 51, 53, and 45 of the dystrophin gene. Table 7 details representative oligomers designed to target exons 51, 53, and 45.

[0301] [Table 8]

[0302] Oligomers are prepared having the sequences shown in Table 7 herein. Various concentrations of the compounds are tested and % exon skipping values ​​are determined according to WO 2014 / 153220, the contents of which are incorporated herein by reference in their entirety.

[0303] Example 8: Reduced aggregation after deletion of one or more internal Gs in the targeting sequence Removal of one or more internal G nucleotides from the targeting sequence results in reduced aggregation. HPLC was performed on SEQ ID NO: 125 and SEQ ID NO: 126. These sequences are identical except that SEQ ID NO: 126 has an internal G deletion compared to SEQ ID NO: 125. Both sequences were tested as part of PMO and PPMO backbone structures. HPLC was performed according to the procedure described in Example 1, using the buffer system and HPLC operating conditions described in Table 1.

[0304] As shown in Figure 6B, there is a gap between the SEQ ID NO:125 PMO peak (8.961 mAU) and the SEQ ID NO:125 PPMO peak (12.683 mAU); however, high molecular weight aggregates are present (see the peaks at 14.058, 14.867, 16.579, and 17.674 mAU). This is in contrast to SEQ ID NO:126 PPMO, where high molecular weight aggregates are eliminated (Figure 7B). No high molecular weight aggregates are present in either SEQ ID NO:125 PMO or SEQ ID NO:126 PMO (Figures 6A and 7A).

Claims

[Claim 1] An object, method or system as described in this specification and drawings.

Images