Compositions for use as prophylactic agent to those at risk of infection of tuberculosis, or as secondary agents for treating infected tuberculosis patients

The MTBVAC vaccine, with targeted genetic deletions in M. tuberculosis, addresses the limitations of BCG by providing improved immunogenicity and safety, enhancing protection against TB in high-risk populations.

JP2025160294APending Publication Date: 2025-10-22ウニベルシダッドデサラゴサ +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025122753
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2018-02-19
Filing Date
2025-07-22
Publication Date
2025-10-22

Smart Images

  • Figure 2025160294000023
    Figure 2025160294000023
  • Figure 2025160294000024
    Figure 2025160294000024
  • Figure 2025160294000025
    Figure 2025160294000025
Patent Text Reader

Abstract

To provide a novel vaccine to prevent tuberculosis.SOLUTION: Provided is a vaccine composition for use in intradermally administering a single dose of the vaccine composition to a human newborn, the vaccine composition comprising an isolated M. tuberculosis strain, the isolated M. tuberculosis strain having a PhoP-phenotype due to deletion of the Rv0757 gene and a PDIM-phenotype due to deletion of the Rv2930 (fadD26) gene, the isolated M. tuberculosis strain being the M. tuberculosis MT103 strain or the M. tuberculosis MTBVAC strain, and the single dose of the vaccine composition comprising 1.5×105 CFU / 0.05 ml to 8.5×105 CFU / 0.05 ml of the isolated M. tuberculosis strain.SELECTED DRAWING: None
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to pharmaceutical compositions, such as vaccines, and methods of making and using such compositions. [Background technology]

[0002] Bacillus Calmette-Guerin (BCG) vaccine BCG is a weakened strain of Mycobacterium bovis, the causative agent of tuberculosis (TB). BCG was first developed in 1921, approximately 100 years ago, when mothers were given the vaccine at birth. It was first introduced into clinical use when it was given orally to an infant who died of TB the next day. The infant showed no adverse events to vaccination with BCG and, importantly, did not develop TB. At the time, oral BCG administration was considered the natural (gastrointestinal) route of TB acquisition in infants and children fed unpasteurized milk. TB is associated with poverty and poses a significant burden in poor and developing regions of the world. The incidence of TB is increasing worldwide due to poverty and inequality and has worsened with the HIV / AIDS pandemic, which significantly increases the risk of infection progressing to active disease. Diabetes, metabolic syndrome, smoking, and more recently, vitamin deficiencies due to malnutrition and poor socioeconomic status have emerged as important risk factors for TB. Importantly, how these factors may affect the efficacy evaluation of new TB vaccines requires particular attention when defining study or clinical trial designs, including patient populations with various such risk factors. With increasing globalization and the emergence of multidrug-resistant (MDR) strains of TB and broad-spectrum drug use, With the emergence of extensively drug resistant (XDR) strains, TB is becoming an increasingly serious threat to the entire world.

[0003] Today, as reported by the latest World Health Organization (WHO) Global TB Report 2018, TB has reached alarming proportions with 10 million cases and 1.6 million deaths attributed to the disease. Globally, approximately 50 million people are already latently infected with MDR M. tuberculosis strains and are facing a future with inadequate treatment options. Nevertheless, the WHO Global End TB Strategy aims to reduce TB incidence by 90% by 2035. has pledged to reduce TB mortality by 95% and has recognized the urgent need for rapid, reliable and more accessible diagnostic tools, new less toxic and more effective antibiotics to shorten treatment, and ultimately new vaccines to prevent pulmonary TB, to achieve this ambitious goal. Summary of the Invention [Problem to be solved by the invention]

[0004] The present invention contributes to the goal of providing a new vaccine for preventing TB. [Means for solving the problem]

[0005] The present invention relates to a live attenuated M. tuberculosis vaccine composition, preferably a reconstituted composition after freeze-drying, comprising an isolated microorganism belonging to the MTBVAC strain having i) a PhoP- phenotype due to inactivation by genetic deletion of the Rv0757 gene, and ii) a deletion of a second gene Rv2930 (fadD26) that prevents PDIM production (PDIM- phenotype), wherein the composition comprises the following components (in percentages) per mL:

[0006] [Table 1]

[0007] Other objects, advantages and novel features of the present invention will become apparent from the following detailed description of the invention when considered in conjunction with the accompanying drawings. [Brief explanation of the drawings]

[0008] [Figure 1] Growth of strain SO2 in Middlebrook 7H9 medium and synthetic Sauton medium. OD and Cfu / mL results for culture passage 1 and culture passage 2. [Figure 2] FIG. 1 shows the OD results of MTBVAC cultures in Sauton, SD and SDG media. [Figure 3] FIG. 1 shows stability results at 2° C. to 8° C. and −30° C. for the lots or batches identified in Table 15. [Figure 4] Figure 1 shows protection in mice. Data in the figure represent a pool of two independent experiments (n = 12 mice / group). All data are mean ± SEM. The protection index is defined as the difference in bacterial load (expressed as a decimal logarithm) between the unvaccinated and vaccinated groups. [Figure 5] Figure 1 shows immunogenicity in mice. Data in the figure are from one experiment (n=5 mice / group). All data are mean±SEM. SFC: spot-forming colony. [Figure 6] Vaccination of neonates in endemic TB settings with escalating doses of MTBVAC resulted in predominantly Th1 (IFN-γ, IL-2, or TNF-α) antigen-specific CD4 T cell responses. The highest dose, 2.5 × 10 CFU of MTBVAC, induced the greatest antigen-specific CD4 T cell cytokine responses at day 70. The lowest dose, 2.5 × 10 CFU of MTBVAC, was the least immunogenic. [Figure 7]Vaccination of newborns in an endemic TB setting with escalating doses of MTBVAC resulted in a dose-response profile of quantitative QFT assay values ​​at 180 and 360 days post-vaccination. QFT values ​​were stratified into three distinct areas according to the risk of developing active TB according to Andrews JR, Nemes E, Tameris M et al. Serial QuantiFERON testing and tuberculosis disease risk among young children: an observational cohort study. Lancet Respir Med, (2017). [Figure 8] FIG. 1 shows the absence of pathogenic mycobacteria in guinea pig working seed lots. [Figure 9] FIG. 1 shows stability studies of master seed lots and working seed lots. [Figure 10] Figure 1 shows long-term stability studies of MTBVAC vaccine at doses of 3 x 103 cfu / 0.1 mL to 17 x 103 cfu / 0.1 mL, 3 x 104 cfu / 0.1 mL to 17 x 104 cfu / 0.1 mL, and 3 x 106 cfu / 0.1 mL to 17 x 106 cfu / 0.1 mL stored at -15°C to -30°C (A) and +2°C to +8°C (B). [Figure 11] Figure 1 shows the stepwise construction of SO2 to MTBVAC. The final double deletion strain is phenotypically identical to the prototype SO2 (phoP-based PDIM deletion) but ensures greater genetic stability. Light blue indicates the phoP gene, the fadD26 gene is shown in light orange, the antibiotic resistance cassettes kmr and hygr are in magenta, and yellow triangles indicate the res sites flanking Ωhygr in the deleted region or residual res sites, which do not contain any exogenous coding sequence. DETAILED DESCRIPTION OF THE INVENTION

[0009] MTBVAC strain definition and detailed description The term "MTBVAC strain" is used to refer to an isolated M. tuberculosis strain that lacks the Rv0757 gene of the M. tuberculosis MT103 clinical strain and also contains a deletion of the Rv2930 (fadD26) gene. Thus, the strain presents two independent mutations derived from M. tuberculosis, and the independent phoP deletions do not affect the vaccine properties resulting from the inactivation of the genes. Therefore, the "MTBVAC strain" is characterized by the deletion of the Rv2930 (fadD26) gene, which inactivates PDIM production, and therefore the strain is characterized by the deletion of the Rv2930 and Rv0757 genes.

[0010] Therefore, the MTBVAC strain was constructed to contain two independent non-reverting deletion mutations without an antibiotic marker, and it is important to note that it meets the first Geneva consensus safety requirements for advancing a live mycobacterial vaccine into Phase I clinical evaluation. The MTBVAC strain was genetically engineered to resemble the prototype SO2 strain phenotypically and functionally. SO2 is an Mt103 phoP mutant (Mt103phoP::kmr) marked by the insertion of a kanamycin resistance cassette (kmr) (see Figure 11). In addition to the engineered PhoP-deficient phenotype, SO2 spontaneously loses PDIM biosynthesis, which has been described as common in M. tuberculosis, as a result of repeated subculture and manipulation in the laboratory (see Figure 2 in Dessislava Marinova, Jesus Gonzalo-Asensio, Nacho Aguilo & Carlos Martin (2017) MTBVAC from discovery to clinical trials in tuberculosis-endemic countries, Expert Review of Vaccines, 16:6, 565-576, DOI:10.1080 / 14760584.2017.1324303).

[0011] As depicted in Figure 11, the MTBVAC strain was constructed following a stepwise approach. First, an unmarked deletion of fadD26 was introduced into SO2, resulting in SO2ΔfadD26. Consequently, the MTBVAC strain was generated by an unmarked deletion in phoP of SO2ΔfadD26. In the construction of MTBVAC, a suicide plasmid carrying the deleted fadD26 and phoP genes was used, and the deleted region was transcribed with a hygromycin resistance marker (hyg) flanked on both sides by res sites. r )(res::hyg rThe γδ-resolvase from E. coli catalyzes the excision of the antibiotic resistance cassette following recognition of the res site, leaving a residual res "scar" copy at the site of the deletion (Malaga, et al. 2003), preventing the res site from accepting any exogenous code. The final construct SO2ΔfadD26::ΔphoP was named MTBVAC strain. In the MTBVAC strain, fadD26 contains an unmarked sequence. The introduction of the deletion ensures a genetically stable abolition of PDIM biosynthesis. The deletion in gene fadD26 encompasses 1511 bp, resulting in the complete inactivation of this essential gene in PDIM biosynthesis. The wild-type gene is 1752 bp (583 amino acids). The remaining rescar is responsible for the hygase-mediated γδ-resolvase. r This deletion resulted in a reduction in the transcription levels of the following five genes in the PDIM locus (fadD26-ppsE), completely eliminating PDIM biosynthesis in MTBVAC (Ainhoa ​​Arbues PhD Thesis). The PDIM locus of M. tuberculosis contains 13 genes clustered on a 50 kb fragment of the chromosome. This region is the largest operon in the M. tuberculosis genome (Camacho, et al. 2001; Camacho, et al. 1999; Cox, et al. 1999; Trivedi, et al. 2005).

[0012] In M. tuberculosis, phoP (744 bp) maps upstream of phoR (1458 bp), and both genes are transcribed in the same direction. Replacement of a 94-bp deletion in the phoP gene with the remaining res site requires the presence of multiple stop codons, while resulting in the loss of translation of the DNA-binding domain of PhoP (corresponding to 92 amino acids) in MTBVAC.

[0013] The deletion of the phoP and fadD26 genes in MTBVAC can be detected / localized using a presence / absence approach of RT-PCR, in which fluorescent PCR reagents (primers and probes) are used to indicate the presence of res sites in the ΔphoP and ΔfadD26 genes and the absence of the wild-type phoP and fadD26 genes.

[0014] Below, we provide the open reading frame (ORF) sequences of the fadD26 gene in Mt103a) and MTBVAC(ΔfadD26)b) and the ORF sequences of the phoP gene in Mt103c) and MTBVAC(ΔphoP)d). Nucleotide sequences corresponding to the deleted gene regions in fadD26 (a) and phoP (c) are shown in lowercase, with the remaining res sites highlighted in gray. For fluorescent PCR detection, primers for each target are underlined, and TaqMan probes are shown in bold.

[0015] a) Wild-type fadD26 gene in Mt103 SEQ ID NO: 1 ATGCCGGTGACCGACCGTTCAGTGCCCTCTTTGCTGCAAGAGAGGGCCGACCAGCAGCCTGACAGCACTGCATATACGTACATCGACTACGGATCCgaccccaagggatttgctgacagcttgacttggtcgcaggtctacagtcgtgcatgcatcattgctgaagaactcaagttatgcgggttacccggagatcgagtggcggtttta gcgccacaaggactggaat atgtccttgcattcctgggcgcac ttcaggctggatttatcgcg gcaacgatccaggagatcaccggtggacgggccgcggcgatcgcagtgcccgacgacatcaccgaacaactggtggcgatcatcgaattcaagcgacgcggtagtaccgccgaagaggtcatgctcaagctccgctcggtgaagcgtgaggtcacctccgcGATATCGAAGTCACACAGCCTGCGGGTGGCCGATCTCGTTCTGGTGTCACCTGGTTCGATTCCCATCACCACCAGCGGCAAGATCCGGCGGTCAGCCTGCGTCGAACGCTATCGCAGCGACGGCTTCAAGCGGCTGGACGTAGCCGTATGA

[0016] b) ΔfadD26 in MTBVAC SEQ ID NO: 2 ATGCCGGTGACCGACCGTTCAGTGCCCTCTTTGCTGCAAGAGAGGGCCGACCAGCA GCCTGACAGCACTGCATATACG TACATCGACTACGGATCCACTA GTTCTAGAGCAACCGTCCGAA ATATTATAAATTATCGCACACATAAAAACAGTGCTGTTAATGTGTCTATTAAATCGATTTTTTGTTATAACAGACACTGCTTGTCCGATATTTGATTTAGGATACATTTTTATGAGATCCCCCGGGCTGCAGGAATTCGATATCGAAGTCACACAGCCTGCGGGTGGCCGATCTCGTTCTGGTGTCACCTGGTTCGATTCCCATCACCACCAGCGGCAAGATCCGGCGGTCAGCCTGCGTCGAACGCTATCGCAGCGACGGCTTCAAGCGGCTGGACGTAGCCGTATGA

[0017] c) Wild-type phoP gene in Mt103 SEQ ID NO: 3 ATGCGGAAAGGGGTTGATCTCGTGACGGCGGGAACCCCAGGCGAAAACACCACACCGGAGGCTCGTGTCCTCGTGGTCGATGATGAGGCCAACATCGTTGAACTGCTGTCGGTGAGCCTCAAGTTCCAGGGCTTTGAAGTCTACACCGCGACCAACGGGGCACAGGCGCTGGATCGGGCCCGGGAAACCCGGCCGGACGCGGTGATCCTCGATGTGATGATGCCCGGGATGGACGGCTTTGGGGTGCTGCGCCGGCTGCGCGCCGACGGCATCGATGCCCCGGCGTTGTTCCTGACGGCCCGTGACTCGCTACAGGACAAGATCGCGGGTCTGACCCTGGGTGGTGACGACTATGTGACAAAGCCCTTCAGTTTGGAGGAGGTCGTGGCCAGGCTGCGGGTCATCCTGCGACGCGCGGGCAAGGGCAACAAGGAACCACGTAATGTTCGACTGACGTTCGCCGATatcgagctcgacgaggagaccc acgaagtgtggaaggcgg gccaaccggtgtcgctgtcgcccaccgaattcac cctgctgcgctatttcgtG ATCAACGCGGGCACCGTGCTGAGCAAGCCTAAGATTCTCGACCACGTTTGGCGCTACGACTTCGGTGGTGATGTCAACGTCGTCGAGTCCTACGTGTCGTATCTGCGCCGCAAGATCGACACTGGGGAGAAGCGGCTGCTGCACACGCTGCGCGGGGTGGGCTACGTACTGCGGGAGCCTCGATGA

[0018] d) ΔphoP in MTBVAC SEQ ID NO: 4 ATGCGGAAAGGGGTTGATCTCGTGACGGCGGGAACCCCAGGCGAAAACACCACACCGGAGGCTCGTGTCCTCGTGGTCGATGATGAGGCCAACATCGTTGAACTGCTGTCGGTGAGCCTCAAGTTCCAGGGCTTTGAAGTCTACACCGCGACCAACGGGGCACAGGCGCTGGATCGGGCCCGGGAAACCCGGCCGGACGCGGTGATCCTCGATGTGATGATGCCCGGGATGGACGGCTTTGGGGTGCTGCGCCGGCTGCGCGCCGACGGCATCGATGCCCCGGCGTTGTTCCTGACGGCCCGTGACTCGCTACAGGACAAGATCGCGGGTCTGACCCTGGGTGGTGACGACTATGTGACAAAGCCCTTCAGTTTGGAGGAGGTCGTGGCCAGGCTGCGGGTCATCCTGCGACGCGCGGGCAAGGGCAA CAAGGAACCACGTAATGTTCGA CTGACGTTCGCCGATATCGA ATTCCTGCAGCCCGGG GGATCTCATAAAAATGTATCCTAAATCAAATATCGGACAAGCAGTGTCTGTTATAACAAAAAATCGATTTAATAGACACATTAACAGCACTGTTTTTATGTGTGCGATAATTTATAATATTTCGGACGGTTGCTCTAGAACTAGTGGATCAACGCGGGCACCGTGCTGAGCAAGCCTAAGATTCTCGACCACGTTTGGCGCTACGACTTCGGTGGTGATGTCAACGTCGTCGAGTCCTACGTGTCGTATCTGCGCCGCAAGATCGACACTGGGGAGAAGCGGCTGCTGCACACGCTGCGCGGGGTGGGCTACGTACTGCGGGAGCCTCGATGA

[0019] SO2 has a thorough and complete preclinical history demonstrating a robust safety and attenuation profile and promising efficacy compared to BCG in relevant animal models. Fortunately, most of these preclinical studies were replicated with MTBVAC to confirm the functional profile and biological activity of the doubly attenuated PhoP-PDIM phenotype. Lipid profile analysis demonstrated that MTBVAC and its prototype SO2 are phenotypically equivalent and lack DATs, PATs, and PDIMs.

[0020] In the context of the present invention, however, BCG will be used hereinafter to refer to the current vaccine used against tuberculosis since 1921. This vaccine was first subcultured in the laboratory and then It is a live attenuated vaccine derived from a strain of M. bovis that has lost its pathogenicity and is now known to have over 100 genes deleted. Behr, MA BCG - different strains, different vaccines Lancet Infect Dis 2002, 2(2), 86-92.

[0021] In the context of the present invention, H37Rv will hereinafter be used to refer to the sequenced pathogenic M. tuberculosis strain, and Cole et al. refer to these genes as Rv (see Cole et al 1998 Deciphering the biology of M. tuberculosis from the complete genome sequence. Nature 393:537-544).

[0022] In the context of the present invention, MT103 will be used hereinafter to refer to the M. tuberculosis clinical isolate. Camacho et al. 1999 Identification of a virulence gene cluster of M. tuberculosis by signature-tagged transposon mutagenesis. Mol Microbiol 34:257-267.

[0023] In the context of the present invention, PDIM-strains will hereinafter be used to refer to strains of the M. tuberculosis complex that are unable to synthesize phthiocerol dimycocerosate, a key lipid associated with the pathogenicity of M. tuberculosis.

[0024] In the context of the present invention, SO2+pSO5 will hereafter be used to refer to the M. tuberculosis SO2 strain in which the mutation in Rv0757 is complemented by the Rv0757 gene by transformation of a replicating plasmid containing the mycobacterial phoP gene, but which is unable to complement PDIM synthesis, and its phenotype is PhoP+PDIM-.

[0025] In the context of the present invention, hereinafter, M. tuberculosis phoP- will be used to refer to an M. tuberculosis strain that has been inactivated by deletion of the Rv0757 gene between the EcoRV-BspEI sites, and whose phenotype is phoP-PDIM+.

[0026] In the context of the present invention, Rv2930 (fadD26) will be used hereinafter to refer to the gene at the beginning of the operon responsible for the synthesis of phthiocerol dimycocerosate (PDIM) (Camacho et al.), and elimination of this gene in M. tuberculosis confers a stable PDIM- phenotype.

[0027] explanation The use of a vaccine to prevent TB in humans has proven a major challenge for nearly a century now. BCG, derived from M. bovis, is the only licensed TB vaccine currently in use and is the most widely used vaccine worldwide. Since the early 1920s, the development and general administration of BCG vaccines has progressed significantly with the prospect of eradicating TB from the world. However, these early prospects have not been achieved, and the results of numerous efficacy trials make it clear that the BCG vaccine in its current form has limited use in controlling the respiratory form of the disease in adults, particularly in Third World areas where the disease is endemic. Fine, P.E. Variation in protection by BCG: implications of and for heterologous immunity. Lancet 1995, 346(8986), 1339-1345. M. Tuberg With more knowledge about the pathogenicity of M. tuberculosis and the immune response model that leads to the generation of protective immunity, it will be possible to develop a vaccine that is better than BCG. The observation that higher levels of protection are achieved when hosts are vaccinated with BCG suggests that viability and persistence are fundamental properties required for the success of a tuberculosis vaccine. In this sense, US Patent No. 8,287,886 describes the use of a M. tuberculosis strain provided for a prototypic single-dose live vaccine, which has an inactivated Rv0757 (phoP) gene and a second independent mutation in phoP that prevents PDIM synthesis, and which is more attenuated than BCG in immunodeficient SCID mice and which produces a virulence comparable to that conferred by BCG in mice. It was shown to provide a level of protection comparable to that of BCG in guinea pigs.

[0028] The phoP gene, together with phoR, forms part of a two-component system that shows high similarity to other two-component systems that control the transcription of key virulence genes in intracellular pathogens. This two-component system also controls the expression of many other genes not directly involved in virulence. Groisman, E. A. The pleiotropic two-component regulatory system PhoP-PhoQ. J Bacteriol 2001, 183(6), 1835-1842. Elimination of virulence genes itself does not appear to be the only way to attenuate M. tuberculosis. M. tuberculosis, which is unable to synthesize pantothenic acid de novo, is a strain of M. tuberculosis that lacks the ability to synthesize pantothenic acid de novo. We have shown that pantothenate-auxotrophic mutants of M. tuberculosis persist in SCID mice without causing disease. Sambandamurthy, VK, Wang, X., Chen, B. et al. A pantothenate auxotroph of M. tuberculosis is highly attenuated and protects mice against tuberculosis. Nat Med 2002, 8(10), 1171-1174. Furthermore, individual leucine-auxotrophic strains are strongly attenuated and unable to replicate in vivo in SCID mice. Hondalus, MK, Bardarov, S., Russell, R., Chan, J., Jacobs, WR, Jr. & Bloom, BR. Attenuation of and protection induced by a leucine auxotroph of M. tuberculosis. Infect Immun 2000, 68(5), 2888-2898. Thus, the principle that vaccine strains based on M. tuberculosis can be successfully attenuated while retaining genes that are suppressed in M. bovis BCG is now generally accepted.

[0029] Prior to U.S. Patent No. 8,287,886, the search for more effective vaccines than BCG was based on the idea that the loss of virulence by BCG itself was a contributing factor to the lack of complete protection. Behr, MA, Wilson, MA, Gill, WP et al. Comparative genomics of BCG vaccines by whole-genome DNA microarray. Science 1999, 284(5419), 1520-1523. It was therefore speculated that new attenuated mutant strains of M. tuberculosis might be less pathogenic and more effective as vaccines. However, in this regard, it has been shown that natural infection with M. tuberculosis and vaccination with BCG are no different in their ability to confer protective immunity against tuberculosis. Sampson, SL, Dascher, CC, Sambandamurthy, VK et al. Protection elicited by a double leucine and pantothenate auxotroph of M. tuberculosis in guinea pigs. Infect Immun 2004, 72(5), 3031-3037. M. tuberculosis-infected individuals with latent tuberculosis have a 79% lower risk of progressive tuberculosis after reinfection compared with uninfected individuals (Andrews 2012. CID 54:784-790). Furthermore, considering the fact that most of these individuals may have been vaccinated with BCG, this suggests that there may actually be differences in the protective immunity provided by BCG and M. tuberculosis. This raises the question of whether it is possible to improve BCG through rational attenuation of M. tuberculosis. In this context, the observation that a mutant M. tuberculosis strain described in U.S. Patent No. 8,287,886, which harbors a combination of two independent mutations in PhoP protein synthesis and PDIM synthesis, is more attenuated than BCG in a SCID mouse model and provides a greater degree of protection than BCG in a guinea pig model, even when applied at a dose 10 times higher than BCG, was considered particularly relevant.

[0030] The mutant M. tuberculosis strain described in U.S. Patent No. 8,287,886 was characterized as an isolated microorganism belonging to the genus Mycobacterium that contained an inactivation of the Rv0757 (phoP) gene and an inactivation of a second gene that prevented PDIM (phthiocerol dimycocerosate) production. In particular, such a mutant M. tuberculosis strain (strain SO2) described in U.S. Patent No. 8,287,886 was characterized by an inactivation of the Rv0757 (phoP) gene and a second, independent mutation in phoP that prevented PDIM production.

[0031] Interestingly, as described in U.S. Pat. No. 8,287,886, strain SO2 Six guinea pigs inoculated with 50 times the vaccine dose of this type were not found to be virulent. Furthermore, their survival rates and weight curves were studied. The survival rate was 100% after the six-month experimental period. Figure 12 in U.S. Pat. No. 8,287,886 shows the weight gain observed in all animals over a six-month period, demonstrating the non-virulence of the SO2 strain (Y = body weight in grams and X = infection time in weeks). Furthermore, the survival rates of vaccinated guinea pigs after infection with M. tuberculosis were also studied in U.S. Pat. No. 8,287,886 (Figure 13). The protection study in guinea pigs followed the survival rates of guinea pigs after 300 days. Survival curves were measured for unvaccinated guinea pigs (saline) and guinea pigs vaccinated with the current BCG vaccine, the M. tuberculosis phoP strain, or the SO2 strain (phoP and PDIM mutants). After subcutaneous vaccination, animals were challenged with a high dose of a virulent strain of M. tuberculosis (H37Rv) to study survival rates. Sixty days later, six unvaccinated guinea pigs (saline) died, while the groups vaccinated with the SO2 strain, phoP-, and BCG survived. Three guinea pigs vaccinated with BCG and phoP- died 300 days after infection, compared with only one in the SO2-vaccinated group. This indicates that protection with the phoP mutant strain is similar to that of the current BCG vaccine, but vaccination with the SO2 strain, a phoP- and PDIM- double mutant, provided better protection in the guinea pig model. Furthermore, Figure 14 in U.S. Patent No. 8,287,886 shows the 400-day survival of the guinea pigs tracked in Figure 13. Six unvaccinated guinea pigs died after 60 days. At 400 days after infection, three guinea pigs from the group vaccinated with the SO2 strain survived (Figure 14a), whereas only one guinea pig from the group vaccinated with BCG (Figures 14a and 14b) and phoP (Figure 14b) survived, again indicating that protection with the phoP mutant was similar to that of BCG, while vaccination with the phoP and PDIM double mutant SO2 strain provided better protection 400 days into the experiment.

[0032] In conclusion, the results described in U.S. Patent No. 8,287,886 demonstrate that the SO2 strain, and thus microorganisms belonging to the Mycobacterium genus (particularly those from the M. tuberculosis complex) with the phoP-PDIM- phenotype, are more effective vaccines than BCG by many criteria. The SO2 strain is more attenuated than BCG in SCID mice, provides mice with protective immunity at least as good as BCG, and induces a stronger cellular immune response. Furthermore, in protection experiments conducted in guinea pigs against infection with a high dose of H37Rv, the strain with the PDIM-PhoP- phenotype induced 100% survival in guinea pigs, whereas BCG achieved only a 33% survival rate. This protection is associated with reduced disease severity and bacterial load.

[0033] Given these results, the present authors proceeded to develop a live-attenuated M. tuberculosis vaccine containing the MTBVAC strain, presented as a lyophilized pellet in a 3 mL amber glass vial. As previously shown, the MTBVAC strain was constructed to contain two independent, non-reverting deletion mutations without an antibiotic marker, fulfilling the First Geneva Consensus safety requirements. In this sense, the MTBVAC strain was genetically engineered to resemble its prototype, SO2, phenotypically and functionally. In the MTBVAC strain, an unmarked deletion in fadD26 ensures genetically stable abolition of PDIM biosynthesis. It should be noted that SO2 has a thorough and complete preclinical history demonstrating a robust safety and attenuation profile, as well as promising efficacy compared to BCG in relevant animal models. As previously shown, most of these preclinical studies were replicated with MTBVAC to confirm the functional profile and biological activity of the doubly attenuated PhoP- / PDIM-deficient phenotype.

[0034] Based on the above, the authors of the present invention prepared a vaccine containing the MTBVAC strain. A single dose of 0.05 mL of the vaccine was administered intradermally to newborns, similar to BCG. Therefore, the first objective of the authors of the present invention was to obtain a vaccine, preferably freeze-dried, useful in newborns for the treatment or prevention of TB in this particular age group of the population. With that in mind, the authors of the present invention performed the experiments described in Examples 2 and 3 of the present application in newborns, and as a result of these experiments, 2.5 x 10 4 CFU or 2.5 x 10 5 We conclude that vaccination with MTBVAC at an estimated dose of ≥ CFU is immunogenic in neonates in the TB endemic setting.

[0035] It should be noted that in this application the term "neonates" is understood as newborn children (or other mammals) or infants less than four weeks old.

[0036] Based on the above results, we are currently conducting a Phase 2a randomized controlled dose-ranging study of the safety and immunogenicity of MTBVAC in healthy, BCG-naive, HIV-unexposed South African newborns. The study will be conducted in a cohort of 99 HIV-unexposed, BCG-naive newborns with no known household exposure to M. tuberculosis. The estimated study duration (first participant vaccinated until completion of data collection) is approximately 36 months. In this study, MTBVAC will be administered at three dose levels: 1.5 x 10 4 CFU / 0.05ml ~ 8.5 x 10 4 CFU / 0.05ml, 1.5 x 10 5 CFU / 0.05ml ~ 8.5 x 10 5 CFU / 0.05 ml, and 1.5 × 10 6 CFU / 0.05ml ~ 8.5 x 10 6 CFU / 0.05ml will be administered to newborns. The active control will be the BCG vaccine. Participants will receive a single dose of MTBVAC or BCG administered intradermally on study day 0. The objectives of this study are:

[0037] Primary endpoint: The safety and reactogenicity of escalating dose levels of MTBVAC will be evaluated compared with BCG vaccine in healthy, BCG-naive, HIV-unexposed South African newborns. To evaluate the immunogenicity of escalating dose levels of MTBVAC in healthy, BCG-naive, HIV-unexposed South African newborns.

[0038] Secondary endpoints: To evaluate QuantiFERON-TB Gold Plus (QFT) conversion rates in neonates receiving MTBVAC at escalating dose levels.

[0039] Exploratory evaluation items: To assess differences in major histocompatibility (MHC)-restricted T cell responses induced by MTBVAC and BCG vaccination. Differences in donor-unrestricted T cell responses induced by MTBVAC and BCG vaccination will be assessed.

[0040] Example 2 and Example 3 are 2.5 × 10 4 CFU or 2.5 x 10 5 Taking into account the fact that vaccination with MTBVAC at an estimated dose of ≥ 1.5 × 10 CFU was previously shown to be immunogenic in newborns in the TB endemic setting and that the reactogenicity of the MTBVAC vaccine was significantly lower than that produced by the BCG vaccine, we hypothesized that vaccination with MTBVAC at 1.5 × 10 CFU was immunogenic in newborns in the TB endemic setting. 4 CVU / 0.05ml~8.5×10 4 CVU / 0.05ml, 1.5 x 10 5 CFU / 0.05ml ~ 8.5 x 10 5 CFU / 0.05 ml, or 1.5 x 10 6 CFU / 0.05ml ~ 8.5 x 10 6 It seems plausible that administration to neonates at a dose of 1 CFU / 0.05 ml could be useful as a prophylactic agent for neonates at risk of acquiring M. tuberculosis infection or developing tuberculosis disease. can.

[0041] Thus, in a first aspect, the present invention relates to a composition comprising an isolated microorganism belonging to the M. tuberculosis complex, preferably a clinical isolate of M. tuberculosis, more preferably a clinical isolate of M. tuberculosis, with a PhoP-phenotype due to inactivation by genetic deletion of the Rv0757 gene and a deletion of a second gene Rv2930 (fadD26) preventing PDIM production (PDIM-phenotype), more preferably characterized in that said microorganism is the MTBVAC strain, and the composition contains at least 1.5 x 10 4 The composition contains isolated microorganisms in an amount of 1.5 x 10 cfu / 0.05 ml or more. 4 cfu / 0.05ml ~ 8.5 x 10 6 Preferably, the composition contains 1.5 x 10 cfu / 0.05 ml of isolated microorganisms. 4 cfu / 0.05ml ~ 8.5 x 10 4 cfu / 0.05 ml, or 1.5 x 10 5 cfu / 0.05ml ~ 8.5 x 10 5 cfu / 0.05 ml, or 1.5 x 10 6 cfu / 0.05ml ~ 8.5 x 10 6 More preferably, it contains cfu / 0.05 ml of isolated microorganisms.

[0042] In a second aspect of the invention, the composition of the first aspect is administered for the prophylaxis of infection caused by the M. tuberculosis complex, preferably M. tuberculosis, in newborns at risk of becoming infected with M. tuberculosis or at risk of developing tuberculosis disease, or for use in preventing or inhibiting the onset of clinical symptomatology associated with active disease caused by the M. tuberculosis complex, preferably M. tuberculosis, in human newborns at risk of developing tuberculosis disease and suffering from latent tuberculosis infection ... the prevention or inhibition of the development of clinical symptomatology associated with active disease caused by the M. tuberculosis complex, preferably M. tuberculosis, in human newborns suffering from latent and / or active TB disease in newborns. or for use in revaccination, booster vaccination or booster dosing in prophylactic or preventative treatment against infection caused by the M. tuberculosis complex, preferably M. tuberculosis, in human newborns at risk of M. tuberculosis infection, or for use as a second-line agent for the prevention of any unrelated infection other than tuberculosis disease caused by M. tuberculosis, including infections with non-tuberculous mycobacteria in newborns. More preferably, the composition is administered to newborns via the intradermal route.

[0043] In addition to the above, it is further noted that the inventors are currently conducting a double-blind, randomized, BCG-comparison, dose-escalation safety and immunogenicity study in adults with latent tuberculosis infection (LTBI) as measured by the QuantiFERON-TB Gold Plus (QFT) assay and adults without LTBI. This is a Phase 1b / 2a, double-blind, randomized, BCG-comparison, dose-escalation safety and immunogenicity study in healthy adults with LTBI and healthy adults without LTBI. All participants have previously been vaccinated with BCG as children. The study product is available at four dose levels: 5x10 3 CFU, 5 × 10 4 CFU, 5 × 10 5 CFU, and 5 × 10 6The active control was BCG (5 × 10 5 CFU).

[0044] Participants who meet the inclusion / exclusion criteria will be randomized within study cohorts and will receive a single dose of MTBVAC or BCG revaccination administered intradermally on study day 0. The study will be conducted at a single site in South Africa. Participants will be enrolled in one of eight cohorts and will follow safety and immunogenicity endpoints through study day 182. The estimated time to complete enrollment is approximately 9 months.

[0045] Cohorts 1 to 8 include QFT-negative (Cohorts 1 to 4) and QFT-positive (Cohorts 5 to 8) participants. Participants were randomized within each cohort. , receive either MTBVAC or BCG.

[0046] Based on this, in a third aspect, the present invention relates to a composition comprising an isolated microorganism belonging to the M. tuberculosis complex, preferably an M. tuberculosis clinical isolate, more preferably the M. tuberculosis isolate MT103, characterized in that it has a PhoP-phenotype due to inactivation by genetic deletion of the Rv0757 gene and a deletion of a second gene Rv2930 (fadD26) that prevents PDIM production (PDIM-phenotype), more preferably wherein said microorganism is the MTBVAC strain, and the composition comprises at least 3 x 10 3 The composition contains isolated microorganisms in an amount of 3×10 cfu / 0.1 ml or more. 3 CFU / 0.1ml ~ 17 x 10 6 Preferably, the composition contains 3×10 cfu / 0.1 ml of isolated microorganisms. 3 cfu / 0.1ml ~ 17 x 10 3 cfu / 0.1 ml, or 3 x 10 4 cfu / 0.1ml ~ 17 x 10 4 cfu / 0.1 ml, or 3 x 10 5 cfu / 0.1ml ~ 17 x 10 5 cfu / 0.1 ml, or 3 x 10 6cfu / 0.1ml ~ 17 x 10 6 More preferably, it contains cfu / 0.1 ml of isolated microorganisms.

[0047] In a fourth aspect of the invention, the composition of the third aspect is administered for the prevention or inhibition (including booster vaccination) of infection caused by the M. tuberculosis complex, preferably M. tuberculosis, in non-neonatal humans, such as children, adolescents and adults at risk of infection by M. tuberculosis. More preferably, the composition is administered via the intradermal route.

[0048] In a fifth aspect of the invention, the composition of the third aspect is administered to non-neonatal humans, such as children, adolescents and adults at risk of developing tuberculosis disease and suffering from latent tuberculosis infection, to prevent or inhibit the development of clinical symptomatology associated with active disease caused by the M. tuberculosis complex, preferably M. tuberculosis. More preferably, the composition is administered via the intradermal route.

[0049] In a sixth aspect of the invention, the composition of the third aspect is administered for use as a second line agent to treat patients with latent and / or active TB infection in neonates and non-neonatal humans such as children, adolescents and adults, more preferably via the intradermal route.

[0050] In a seventh aspect of the invention, the composition of the third aspect is administered for revaccination or booster dosing in prophylactic or preventative treatment against infection caused by the M. tuberculosis complex, preferably M. tuberculosis, in non-neonatal humans, such as children, adolescents, and adults at risk of infection by M. tuberculosis. In this sense, it is noted that a booster injection or booster dosing after initial immunization is a re-exposure to the immunizing antigen. Re-exposure is intended to increase immunity to that antigen back to a protective level after memory against that antigen has waned over time.

[0051] Meanwhile, the present authors have carried out numerous studies to establish the most appropriate production process for the MTBVAC vaccine, using the MTBVAC strain to implement any of the above-mentioned aspects of the invention, in order to achieve consistent results and a preferred method to minimize the loss of viability after lyophilization during the development process, providing a product with a shelf life of at least 2 years stored at +2° C. to +8° C. As a first approximation, different culture media as well as different stabilizer compositions were tested.

[0052] The first challenge in the production of the MTBVAC vaccine was to cultivate it in a medium with a defined composition and free of components of animal origin. For this purpose, experiments were carried out using the SO2 strain. It should be noted that, as mentioned, the MTBVAC strain was genetically engineered to be phenotypically and functionally similar to its prototype strain SO2, and therefore, the SO2 strain was considered a suitable starting point for establishing the most appropriate production process for the MTBVAC vaccine.

[0053] Using strain SO2, different culture media that do not contain any animal-derived components in their composition have been developed and tested. Some of the culture media that have been tested are: Middlebrook 7H9 and modifications (Media for Tubercle Bacilli, Dubos, RJ and Middlebrook, G. American Review of Tuberculosis and Pulmonary Diseases, 1947 Vol. 56 No.4 pp. 334-45 ref.15). Sauton's synthetic medium (Handbook of Microbiological Media, Fourth Edition, Ronald M. Atlas, CRC Press, 2010. Page 1540) and modifications.

[0054] The compositions of Sauton's and Middlebrook's media are detailed in the table below:

[0055] [Table 2]

[0056] [Table 3]

[0057] In Sauton medium, growth was similar to the reference medium (unmodified Middlebrook medium, Table 2). Figure 1 compares the growth curves in Middlebrook and Sauton culture medium. In parallel with the composition of the culture medium, these studies began to profile other variables at laboratory scale, such as culture time, culture passage number, and growth type, static or agitated (see Table 3).

[0058] [Table 4]

[0059] Finally, Sauton's synthetic medium was selected under static growth conditions because it is effective for the growth of strain SO2. Non-static growth conditions were also possible, but the culture must be under aerobic conditions.

[0060] The next stage of development was to study the freeze-drying process. Freeze-drying is a critical step in the production of live vaccines. Achieving stability of freeze-dried vaccines is a complex process, as microorganisms are not only susceptible to environmental factors after freeze-drying, such as temperature, but growth and formulation conditions can also affect the success of the process. The yield of viable bacteria after freeze-drying and subsequent storage stability can be affected by factors such as the freeze-drying cycle, the composition of stabilizers, and the presence of residual moisture and air.

[0061] During the development phase with SO2, up to 11 different stabilizer compositions were tested. The table below shows the stabilizer compositions tested.

[0062] [Table 5]

[0063] In the stabilizer studies, different formulations were also tested, varying the amount of lyophilization as well as the proportion of stabilizer and culture medium in addition to the composition. In all studies, the viability loss of the lyophilisate and its stability after 30 days at 37° were determined. A limit of 90% and / or a maximum of 80% loss in viability after accelerated stability testing at 37°C was established as a criterion for selecting stabilizers for future studies (see results in Table 5).

[0064] [Table 6]

[0065] After the preliminary studies mentioned above, it was concluded that stabilizers should be added to the culture medium to be freeze-dried, as the loss in freeze-drying without stabilizers was greater than 99%, and the best stabilizer that met the specifications for loss in freeze-drying at 37°C and the specifications for accelerated stabilization was GSA (monosodium glutamate and sucrose).

[0066] After reaching the above conclusions, the inventors received the MTBVAC strain in the form of a freeze-dried pre-master seed lot, and immediately thereafter, they initiated cell culture of this particular strain. For the growth of the MTBVAC strain, a first Sauton medium (see Table 1) with the same composition as that used in the growth study of the parent strain SO2 was used. However, unexpectedly, in the case of MTBVAC, lower growth was observed in the Sauton synthetic medium than that observed for the SO2 strain. Furthermore, problems were also detected during the amplification phase of the MTBVAC strain. To solve these problems, tests were conducted to add and remove components from the composition of the Sauton medium. Such modifications consisted of adding or removing supplements such as glucose, zinc sulfate, biotin, glycerol, and polysorbate.

[0067] Enrichment of Sauton's synthetic medium with zinc sulfate and biotin gave poor results, and no growth of MTBVAC was observed. Enrichment with glucose, polysorbate, and glycerol gave good results, and sufficient growth of MTBVAC was obtained.

[0068] As a result of these growth studies, SD and SDG media were developed, and MTBVAC cultures were grown in these media. Growth of MTBVAC was good in both SD and SDG media; however, some cultures stopped growing after serial passages in SDG medium, so SD medium was chosen for amplification passages. Figure 2 shows the OD results of MTBVAC cultures in Sauton, SD, and SDG media.

[0069] However, when MTBVAC cultures were initiated from lyophilized or freeze-dried master seed lot vials, we observed that growth could not be initiated in SD medium, and therefore modified its composition to develop a seed medium. As a result of these studies, we selected seed medium as a means of initiating cultures for future pilot and industrial trials, SD medium as a means for amplification and subculturing, and SDG medium as a means for large-scale culture prior to lyophilization. Furthermore, it is important to note that the lyophilization process was performed exclusively in SDG medium, as the composition of SD medium, combined with stabilizers, affected the lyophilization process and tablet appearance.

[0070] We provide herein the compositions of seed medium, SD medium and SDG medium.

[0071] [Table 7]

[0072] In this sense, the following three tables demonstrate the consistency of the results obtained with the measures developed in the study. 5 The results of industrial-scale production of five batches of

[0073] [Table 8]

[0074] [Table 9]

[0075] [Table 10]

[0076] [Table 11]

[0077] In our previous development studies using strain SO2, we concluded that the freeze-drying process requires the use of stabilizers to reduce the loss of viable bacteria and improve the stability of the freeze-dried product. The same stabilizers selected for the SO2 studies were used in the development of MTBVAC. The objective was to obtain a 3 x 10 3 cfu / 0.1ml ~ 17 x 10 6 cfu / 0.1 ml, preferably in the range of 3 x 10 3 cfu / 0.1ml ~ 17 x 10 3 cfu / 0.1 ml, or 3 x 10 4 cfu / 0.1ml ~ 17 x 10 4 cfu / 0.1 ml, or 3 x 10 5 cfu / 0.1ml ~ 17 x 10 5 cfu / 0.1 ml, or 3 x 10 6 cfu / 0.1ml ~ 17 x 10 6 The goal of the development process was to obtain a lyophilized vaccine containing the MTBVAC strain at a concentration ranging from cfu / 0.1 ml, minimizing loss of viability after lyophilization, to provide a product with consistent results and a shelf life of at least 2 years when stored at 2°C to 8°C.

[0078] During the development phase with MTBVAC, up to seven different stabilizer compositions were tested. Table 11 below describes the stabilizer compositions tested.

[0079] [Table 12]

[0080] Tables 12 and 13 below show the results in terms of percentage loss of viability in accelerated stability studies of laboratory-scale freeze-drying tests of MTBVAC. The tables show the effect of the composition of the freeze-drying medium in combination with stabilizers on the freeze-drying process. From these studies, it was concluded that stabilizers were required for the freeze-drying of MTBVAC, and that the GSA stabilizer was the one that gave the best results for the parameters tested.

[0081] [Table 13]

[0082] [Table 14]

[0083] Finally, the table below shows the results of freeze-drying four batches of MTBVAC.

[0084] [Table 15]

[0085] Figure 3 shows the stability results for the lots or batches identified in Table 14 above between 2°C and 8°C and -30°C. Additionally, Table 15 below provides further results from parallel lyophilization of the cultures of Table 11 (SDG medium) in pilot and industrial plants.

[0086] [Table 16]

[0087] All of the above results were obtained by growing the MTBVAC strain, preferably at 1 x 10 8 cfu / mL ~5×10 8 The cells were obtained by freeze-drying SDG medium grown in a range of cfu / mL. Note that to perform the freeze-drying, sodium glutamate and sucrose (GSA) were added, preferably at concentrations of 10 g / L to 40 g / L of sodium glutamate and 100 g / L to 400 g / L of sucrose.

[0088] Thus, as further described below, specific formulations and methods are described herein that can be used to prepare pharmaceuticals based on live MTBVAC strains. The formulations of the present invention may comprise or consist of any of the compositions detailed below that can be used to cultivate MTBVAC strains. The compositions are detailed below.

[0089] [Table 17]

[0090] Therefore, an eighth aspect of the invention relates to a composition comprising or consisting of a seed medium as characterized above.

[0091] A ninth aspect of the present invention relates to a composition comprising or consisting solely of the SD medium characterized above.

[0092] A tenth aspect of the present invention relates to a composition comprising or consisting solely of the SDG medium characterized above.

[0093] An eleventh aspect of the present invention relates to a seed medium, either an SD medium or an SDG medium, as characterized above, wherein the MTBVAC strain grown therein is preferably at a concentration of 1 x 10 8 cfu / mL ~5×10 8 Further included in the range of cfu / mL.

[0094] A twelfth aspect of the present invention relates to the use of any of the above-characterized seed medium, SD medium or SDG medium for cultivating or expanding the MTBVAC strain under aerobic conditions. In this sense, preferably, seed medium is selected as a means for initiating the MTBVAC strain culture, SD medium is selected as a means for amplifying and passage, and SDG medium is selected as a means for mass cultivation before lyophilization. In a particularly preferred embodiment of the twelfth aspect of the present invention, the present invention relates to a method for producing a ready-to-use, freeze-dried live attenuated M. tuberculosis vaccine composition, said composition comprising an isolated microorganism belonging to the M. tuberculosis strain, more preferably the MTBVAC strain, having i) a PhoP phenotype due to inactivation by genetic deletion of the Rv0757 gene, and ii) a deletion of a second gene, Rv2930 (fadD26), that prevents PDIM production (PDIM phenotype), the method comprising initiating a culture of the M. tuberculosis strain and expanding or amplifying the bacterium using a suitable cell culture medium, characterized in that the method uses SDG medium for mass cultivation before lyophilization. Preferably, the method comprises initiating a culture of an M. tuberculosis strain in a seed medium, growing or amplifying the bacterium using SD medium, and using SDG medium for bulk culture prior to lyophilization. More preferably, the method further comprises a freeze-drying step by adding sucrose and monosodium glutamate as stabilizers to the SDG medium used for bulk culture prior to the lyophilization step.

[0095] Additionally, certain components (e.g., certain stabilizers, bulking agents, and buffers) have been found to be advantageous in the preparation of lyophilized MTBVAC strain vaccines. The present invention also relates to reconstituted vaccines and prophylactic and therapeutic methods utilizing the compositions described herein. The compositions and methods of the present invention are further described as follows.

[0096] In particular, a thirteenth aspect of the present invention provides a live attenuated M. tuberculosis vaccine composition comprising an isolated microorganism belonging to an M. tuberculosis strain, The microorganism is i) PhoP- phenotype due to inactivation by genetic deletion of the Rv0757 gene; ii) a deletion of a second gene, Rv2930 (fadD26), that prevents PDIM production (PDIM-phenotype), preferably wherein the M. tuberculosis strain is an MTBVAC strain; the composition is a freeze-dried composition, the composition is obtained by freeze-drying a culture medium containing the microorganism by adding sucrose and monosodium glutamate as stabilizers, More preferably, in a thirteenth aspect, the present invention provides a live attenuated M. tuberculosis vaccine composition comprising an isolated microorganism belonging to an M. tuberculosis strain having i) a PhoP- phenotype due to inactivation by genetic deletion of the Rv0757 gene, and ii) a deletion of a second gene, Rv2930 (fadD26), that prevents PDIM production (PDIM- phenotype), preferably wherein the M. tuberculosis strain is the MTBVAC strain, and wherein the live attenuated M. tuberculosis vaccine composition is obtained or obtainable by the method of the twelfth aspect of the present invention.

[0097] More preferably, the present invention provides a live attenuated M. tuberculosis vaccine composition, preferably a reconstituted composition after freeze-drying, comprising an isolated microorganism belonging to an M. tuberculosis strain having i) a PhoP- phenotype due to inactivation by genetic deletion of the Rv0757 gene, and ii) a deletion of a second gene Rv2930 (fadD26) that prevents PDIM production (PDIM- phenotype), preferably wherein said M. tuberculosis strain is the MTBVAC strain, and wherein said composition comprises or consists of the following components (in percentages) per mL:

[0098] [Table 18]

[0099] More preferably, the live attenuated M. tuberculosis vaccine composition referred to in the above paragraph is freeze-dried or is a reconstituted composition obtained by adding water, preferably sterile water for injection, to a freeze-dried composition.

[0100] In a preferred embodiment of the thirteenth aspect of the invention, or any of its preferred embodiments, the composition contains at least 3 x 10 per 0.1 ml, preferably per 0.1 ml of water. 3 Preferably, the composition contains a microbial strain with a concentration of 3 x 10 cfu or more per 0.1 ml. 4 cfu ~ 17 x 10 per 0.1 ml 6 More preferably, the composition contains 3 x 10 cfu of said isolated microbial strain per 0.1 ml. 4 cfu ~ 17 × 10 4 cfu, or 3 x 10 per 0.1 ml 5 cfu ~ 17 × 10 5 cfu, or 3 x 10 per 0.1 ml 6 cfu ~ 17 × 10 6 cfu of the isolated microbial strain. More preferably, 1.5 x 10 5 cfu / 0.05ml ~ 8.5 x 10 5 The release specifications for the freeze-dried MTBVAC vaccine containing cfu / 0.05 ml of MTBVAC strain are detailed in the table below.

[0101] [Table 19]

[0102] Furthermore, as shown herein, stability data demonstrate that both the master cell bank and working cell bank prepared from the pre-master seed are stable (see Figure 8), and that the vaccine MTBVAC stored at -15°C to 30°C and +2 to +8°C is stable for more than 24 months (see Figures 3 and 10).

[0103] Furthermore, in-use stability studies have shown that once reconstituted, the MTBVAC vaccine is stable at room temperature for at least 8 hours.

[0104] As discussed in more detail elsewhere herein, the compositions of the present invention are particularly advantageous in terms of the stability and viability of the active ingredients, which is due in large part to the formulation and the method by which the product is prepared, including lyophilization. Generally, this method includes the steps of freezing, primary drying, secondary drying, and stoppering. This method is described in more detail in the experimental examples below, but an example of the method is as follows: In the freezing step, the shelves of the freeze dryer are pre-cooled to -50°C. Once all trays are loaded, the shelves are held at -50°C for 120 minutes. For the primary drying step, the vacuum is set at 25mT and the shelf temperature is ramped at +0.1°C / min to -40°C and held for 500 minutes; at +0.1°C / min to -35°C and held for 500 minutes; and ramped at +0.1°C / min to -30°C and held for 500 minutes, then ramped at +0.1°C / min to -25°C and held for 800 minutes. For the secondary drying step, the vacuum remains at 25mT and the shelf temperature is ramped at +0.1°C / min to +20°C and held for 800 minutes. If necessary, the product can be held at +20°C and 25mT for up to an additional 24 hours before stoppering. In the stoppering step, the chamber is evacuated with 0.22 μm filtered dry nitrogen gas, a vacuum is set to 800 mbar (slight vacuum), and the stopper is pressed into the vial. Alternative freeze-drying cycles that can be used in the present invention are well known in the art. Thus, the method of the present invention may include freezing at or to about a temperature of, for example, −70° C. to −30° C. (e.g., −60° C. to −40° C., or −50° C.). Freezing can be carried out for about 30 minutes to 240 minutes (e.g., 60 minutes to 120 minutes) or longer. The material may then be subjected to one or more drying steps, as described herein. In these steps, a vacuum can be applied (e.g., 25 mT) and the temperature can be gradually changed (e.g., 0.1°C / min to 1.0°C / min, or 0.5°C / min) over a period of time (e.g., 100 min to 1000 min, e.g., 200 min to 600 min, or 300 min to 500 min). In primary drying, the temperature can be increased, for example, from -30°C to +10°C, e.g., from -20°C to +5°C, or from -15°C to 0°C, while in secondary drying, the temperature can be changed, for example, from +5°C to +35°C, e.g., from 10°C to 30°C, or from 15°C to 20°C. As known to those skilled in the art, these parameters (e.g., temperature, hold time, ramp rate, and vacuum level) can be varied, for example, based on the results obtained.

[0105] The vaccine compositions of the thirteenth aspect of the invention may be administered as a primary prophylactic agent to individuals at risk of infection with M. tuberculosis or developing tuberculosis disease, or may be used as a secondary agent to treat infected patients, in accordance with the fourteenth aspect of the invention. The strains in these compositions are attenuated, making them particularly suitable for administration to "at-risk individuals," such as neonates, children, adolescents, adults, and the elderly. Such vaccines may also be used in veterinary settings.

[0106] A preferred embodiment of the fourteenth aspect of the present invention relates to an MTBVAC vaccine for immunizing individuals against symptoms caused by tuberculosis. It should be noted that the vaccine may be suitable not only for the treatment of bladder cancer, but also for the treatment or prevention of TB, or as a vector or adjuvant. It is preferred to immunize individuals against symptoms caused by TB.

[0107] In another preferred embodiment of the fourteenth aspect of the invention, the composition of the thirteenth aspect is administered to newborns at risk of infection with M. tuberculosis or at risk of developing TB disease for the prevention of infection caused by the M. tuberculosis complex, preferably M. tuberculosis. More preferably, the composition is administered to the newborn via the intradermal route.

[0108] In another preferred embodiment of the fourteenth aspect of the invention, the composition of the thirteenth aspect is administered for the prevention or inhibition (including booster vaccination) of infection caused by the M. tuberculosis complex, preferably M. tuberculosis, in non-neonatal humans, such as children, adolescents and adults at risk of infection by M. tuberculosis. More preferably, the composition is administered via the intradermal route.

[0109] In another preferred embodiment of the fourteenth aspect of the invention, the composition of the thirteenth aspect is administered to prevent or inhibit the development of clinical symptomatology associated with active disease caused by the M. tuberculosis complex, preferably M. tuberculosis, in non-neonatal humans, such as children, adolescents and adults at risk of developing TB disease and with latent tuberculosis infection. More preferably, the composition is administered via the intradermal route.

[0110] In another preferred embodiment of the fourteenth aspect of the invention, the composition of the thirteenth aspect is adapted to inhibit latent and / or active HIV-1 infection in neonates and non-neonatal humans, such as children, adolescents and adults. It is administered for use as a second line agent to treat patients infected with TB. More preferably, the composition is administered via the intradermal route.

[0111] In another preferred embodiment of the fourteenth aspect of the invention, the composition of the thirteenth aspect is administered for revaccination or booster dosing in prophylactic or preventative treatment against infection caused by the M. tuberculosis complex, preferably M. tuberculosis, in non-neonatal humans, such as children, adolescents, and adults at risk of infection by M. tuberculosis. In this sense, it should be noted that a booster injection or booster dosing after initial immunization is a re-exposure to the immunizing antigen. Re-exposure is intended to increase immunity to that antigen back to a protective level after memory against that antigen has waned over time.

[0112] Throughout the specification and claims, the word "comprises" and variations thereof do not imply the exclusion of other technical features, additives, ingredients, or steps. For those skilled in the art, other objects, advantages, and properties of the present invention will arise partly from the specification and partly from the practice of the invention. The following examples and figures are provided by way of non-limiting illustration of the present invention. [Example]

[0113] Example 1. Immunogenicity and protection are independent of dose of MTBVAC in neonatal mice Newborn C3H mice (1-3 days old) were injected with 25 μl of BCG containing one clinical dose (approximately 2.5 × 10 5Animals were vaccinated intradermally with either BCG or MTBVAC at the indicated CFU dose. For the BCG group, commercially available vials of the Danish strain of BCG, corresponding to Lot 111053F and Lot 113033C, were used. For MTBVAC, animals were immunized with MTBVAC vaccine produced by lyophilization of SDG medium in which the MTBVAC strain had been grown. To perform the lyophilization, monosodium glutamate and sucrose (GSA) were added at concentrations ranging from 10 g / L to 40 g / L of monosodium glutamate and 100 g / L to 400 g / L of sucrose. The lyophilized preparation was resuspended.

[0114] Defensive Effectiveness Research Eight weeks after vaccination, mice were challenged intranasally with 150 CFU of M. tuberculosis strain H37Rv. Four weeks later, mice were sacrificed and bacterial burden in the lungs was determined by plating tissue homogenates on 7H11S solid medium. The results are shown in Figure 4.

[0115] Immunogenicity studies Eight weeks after vaccination, mice were sacrificed and splenocytes were isolated for immunogenicity assessment. One million splenocytes were incubated for 24 hours in the presence of purified protein derivative (PPD) at 10 μg / ml, overlapping ESAT6 or CFP10 peptides at 2 μg / ml, or no antigen (negative control). Interferon-gamma (IFNγ)-producing cells were analyzed by ELISPOT. The results are shown in Figure 5.

[0116] conclusion Neither the protective efficacy nor the immunogenicity specific to PPD, ESAT6 or CFP10 induced by MTBVAC was shown to be dose-dependent in a neonatal mouse model.

[0117] Example 2. Phase 1B Immunogenicity Data in Neonates (South Africa) Objective: We sought to determine the immunogenicity and characterize the induced immune response following vaccination of newborns with the MTBVAC vaccine described in this invention.

[0118] Methods: Thirty-six HIV-unexposed, BCG-naive, healthy newborns were randomized 1:3 to receive 2.5 × 10 3 CFU, 2.5 × 10 4 CFU or 2.5 x 10 5 Mice were given either CFU of BCG (SSI strain) or MTBVAC, and MTBVAC-specific cytokine responses in whole blood were measured by whole blood intracellular cytokine staining and flow cytometry on a BD LSRFortessa (18-color, blue-red-purple-green configuration) at days 7, 28, and 70.

[0119] Whole Blood ICS Assay Narrative: Fresh heparinized whole blood was immediately stimulated with BCG, MTBVAC, or phytohemagglutinin (PHA) or left unstimulated (Nil) for 12 hours at 37°C. Stimulation conditions included half the blood volume [250 μL (0.25 ml)] and Nil alone, MTBVAC, and BCG. After 7 hours of stimulation, supernatants (for soluble cytokine / chemokine analysis) were collected from all conditions, frozen at -BOC, and stored for delivery to the sponsor for further analysis. After supernatant removal, brefeldin A was added to the remaining whole blood and tubes. The cells were then incubated in a programmable water bath for an additional 5 hours. The water bath was switched off after a total of 12 hours of stimulation. The following morning, FACS lysis solution was added to lyse red blood cells and fix white blood cells. Fixed white blood cells were then frozen for subsequent intracellular cytokine staining and flow cytometry analysis. Flow cytometry staining and acquisition were performed in batches at later time points. Measurement of the frequency and pattern of specific type 1 cytokines and IL-17 expression by CD4 T cells was assessed. The immunogenicity time points were selected based on a recent study conducted by SATVI, which showed that BCG-induced T cell responses in infants peak around 6 to 10 weeks of age.

[0120] Results: Vaccination with escalating doses of MTBVAC resulted in predominantly Th1 (IFN-γ, IL-2, or TNF-α) antigen-specific CD4 T cell responses. At the highest dose of 2.5 × 10 5 CFU of MTBVAC induced the greatest antigen-specific CD4 T cell cytokine responses at day 70. The lowest dose, 2.5 × 10 3 CFU MTBVAC was the least immunogenic. The results are further illustrated in FIG.

[0121] Conclusion: These data suggest that 2.5 × 10 4 CFU or 2.5 x 10 5 We demonstrate that vaccination with ≥ CFU of MTBVAC is immunogenic in neonates in endemic TB settings.

[0122] Example 3. Randomized, double-blind, dose-escalation clinical trial of MTBVAC compared with BCG vaccine SSI, neonates with a safety arm in adults living in TB endemic areas

[0123] Objective: To evaluate the safety and immunogenicity of three doses of MTBVAC versus BCG in newborns in TB endemic areas.

[0124] Methods: Eighteen HIV-, QuantiFERON (QFT)-, previously BCG-vaccinated healthy adults were randomized 1:1 to receive MTBVAC (5 × 10 5 Thirty-six HIV-unexposed, BCG-naive, healthy newborns were then randomized 1:3 to receive 2.5 × 10 CFU or BCG SSI within 96 hours of birth. 3 CFU, 2.5 × 10 4 CFU or 2.5 x 10 5 CFU BCG SSI or MTBVAC were given. QFT was performed on days 180 and 360, and QFT+ infants (>0·35 IU / mL) were referred for isoniazid prophylaxis.

[0125] Results: All adults experienced local injection site reactions: 18 (100%) had swelling, 16 (88.9%) had redness, and 10 (55.5%) had ulcers. Nine reactions were reported as moderate. One swelling event was severe (35 mm). No SAEs were reported at 28 days.

[0126] Due to the unavailability of BCG vaccine SSI, the highest dose of MTBVAC was administered open-label to six infants. Sixteen infants (44.4%) across all three cohorts experienced local reactions (2 [16.6%], 3 [25%], and 11 [91.6%]), with swelling in 14 (38.9%), erythema in 5 (13.9%), and scarring in 9 (25.0%), all rated as mild. No ulcers were observed. Systemic AEs were similar across cohorts (n = 32 / 42 / 40), with 9 rated as moderate (n = 3 / 4 / 2) and 8 rated as severe (n = 4 / 2 / 2). Six infants experienced seven unrelated SAEs, including an unrelated death due to viral pneumonia confirmed by autopsy.

[0127] Dose-related QFT conversion was observed at day 180 in MTBVAC recipients in Cohort 1 (n = 3, 37.5%), Cohort 2 (n = 6, 75%), and Cohort 3 (n = 7, 77.8%), but not in seven BCG recipients. At day 360, as shown in Figure 7, positive QFT was observed in zero (0.0%) MTBVAC recipients in Cohort 1, two (25.0%) in Cohort 2, and four (44.4%) in Cohort 3.

[0128] Conclusions: MTBVAC appears safe at three dose levels in South African newborns and appears to produce transient, dose-dependent QFT conversion, which may be a promising indicator of immunogenicity in TB endemic areas. Furthermore, the reactogenicity of MTBVAC vaccine is significantly lower than that produced by BCG vaccine: BCG vaccine produced scarring in 5 of 8 newborns (62%), whereas the highest dose of MTBVAC produced scarring in only 2 of 10 newborns (20%).

Claims

1. 1. A method for producing a ready-to-use freeze-dried live-attenuated M. tuberculosis vaccine composition, comprising: The composition comprises: i) a PhoP- phenotype due to inactivation by genetic deletion of the Rv0757 gene, wherein the open reading frame (ORF) sequence of PhoP consists of SEQ ID NO: 4; ii) a deletion of a second gene, Rv2930 (fadD26), that prevents PDIM production (PDIM-phenotype), wherein the fadD26 open reading frame (ORF) sequence consists of SEQ ID NO: 2; The isolated microorganism belongs to the M. tuberculosis MTBVAC strain, and has the formula: The method comprises initiating a culture of the MTBVAC strain and expanding or amplifying the bacterium using one or more suitable cell culture media; The method comprises the steps of: 【Table 1】 The method is characterized by using an SDG medium having the quantitative and qualitative composition shown in The method, wherein the method is carried out under aerobic conditions.

2. 10. The method of claim 1, wherein the method comprises initiating a culture of the MTBVAC strain in a seed medium as defined in the table below, and expanding or amplifying the bacterium using SD medium as defined in the table below. 【Table 2】

3. The method may further comprise a freeze-drying step by adding sucrose and monosodium glutamate as stabilizers to the SDG medium used for large-scale culture prior to the freeze-drying step. The method of claim 1 or 2, comprising:

4. 1. A live-attenuated M. tuberculosis vaccine composition comprising an isolated microorganism belonging to the MTBVAC strain, The microorganism is i) PhoP- phenotype due to inactivation by genetic deletion of the Rv0757 gene; ii) deletion of a second gene, Rv2930 (fadD26), that prevents PDIM production (PDIM-phenotype); and the composition is a freeze-dried composition, the composition is obtained by freeze-drying a culture medium containing the microorganism by adding sucrose and monosodium glutamate as stabilizers, A vaccine composition, wherein the culture medium is SDG medium.

5. 4. A live-attenuated M. tuberculosis vaccine composition comprising an isolated microorganism belonging to the MTBVAC strain having i) a PhoP- phenotype due to inactivation by genetic deletion of the Rv0757 gene, and ii) a deletion of a second gene, Rv2930 (fadD26), that prevents PDIM production (PDIM- phenotype), wherein said live-attenuated M. tuberculosis vaccine composition is obtained or obtainable by the method of any one of claims 1 to 3.

6. 1. A live-attenuated M. tuberculosis vaccine composition, preferably a reconstituted composition after freeze-drying, comprising an isolated microorganism belonging to the MTBVAC strain having i) a PhoP- phenotype due to inactivation by genetic deletion of the Rv0757 gene, and ii) a deletion of a second gene, Rv2930 (fadD26), that prevents PDIM production (PDIM- phenotype), characterized in that said composition contains the following components per mL: 【Table 3】

7. A freeze-dried live-attenuated M. tuberculosis vaccine composition.

8. A reconstituted composition obtained by adding water, preferably sterile water for injection, to the freeze-dried composition according to claim 4 or 7.

9. The composition contains at least 3 x 10 per 0.1 ml, preferably per 0.1 ml of water 3 The live attenuated M. tuberculosis vaccine composition according to any one of claims 4 to 8, comprising a microbial strain of at least cfu.

10. The composition contains 3 x 10 per 0.1 ml 4 cfu ~ 17 x 10 per 0.1 ml 6 9. The live-attenuated M. tuberculosis vaccine composition of any one of claims 4 to 8, comprising cfu of said isolated microbial strain.

11. The composition contains 3 x 10 per 0.1 ml 4 cfu ~ 17 x 10 4 cfu, or 3 x 10 per 0.1 ml 5 cfu ~ 17 x 10 5 cfu, or 3 x 10 per 0.1 ml 6 cfu ~ 17 x 10 6 9. The live-attenuated M. tuberculosis vaccine composition of any one of claims 4 to 8, comprising cfu of said isolated microbial strain.

12. The composition has a concentration of at least 3 x 10 per 0.1 ml 3 The isolated microbial strains had more than 17 x 10 cfu per 0.1 ml. 6 9. The live-attenuated M. tuberculosis vaccine composition of any one of claims 4 to 8, comprising cfu of said isolated microbial strain.

13. The composition contains 3 x 10 per 0.1 ml 4 cfu ~ 17 x 10 4 cfu, or 3 x 10 per 0.1 ml 5 cfu ~ 17 x 10 5 cfu, or 3 x 10 per 0.1 ml 6 cfu ~ 17 x 10 6 9. The live-attenuated M. tuberculosis vaccine composition of any one of claims 4 to 8, comprising cfu of said isolated microbial strain.

14. 14. The live-attenuated M. tuberculosis vaccine composition according to any one of claims 4 to 13, for use in preventing or inhibiting infection caused by the M. tuberculosis complex, preferably M. tuberculosis, in newborns at risk of infection with M. tuberculosis.

15. 14. The live, attenuated M. tuberculosis vaccine composition of any one of claims 4 to 13 for use in preventing or inhibiting (including booster vaccination) infection caused by the M. tuberculosis complex, preferably M. tuberculosis, in non-neonatal humans, such as children, adolescents and adults, who are at risk of infection with M. tuberculosis.

16. 14. The live-attenuated M. tuberculosis vaccine composition of any one of claims 4 to 13 for use in preventing or inhibiting the development of clinical symptomatology associated with active disease caused by the M. tuberculosis complex, preferably M. tuberculosis, in human newborns and non-neonatal humans, such as children, adolescents and adults, who are at risk of developing tuberculosis disease and have latent tuberculosis infection.

17. 14. The live-attenuated M. tuberculosis vaccine composition of any one of claims 4 to 13, for use as a second-line agent for treating patients with latent and / or active TB infection in newborns and non-neonatal humans, such as children, adolescents, and adults.

18. 14. The live, attenuated M. tuberculosis vaccine composition of any one of claims 4 to 13 for use in revaccination, booster vaccination or booster dosing in prophylactic or preventative treatment against infection caused by the M. tuberculosis complex, preferably M. tuberculosis, in human newborns and non-neonatal humans, such as children, adolescents and adults, who are at risk of infection by M. tuberculosis.

19. Nontuberculous mycobacteria in neonates and non-neonatal humans, including children, adolescents, and adults 14. The live-attenuated M. tuberculosis vaccine composition of any one of claims 4 to 13, for use as a secondary agent for the prevention of any unrelated infectious disease other than tuberculosis disease caused by M. tuberculosis, including infection by M. tuberculosis.