Crispr-based compositions and methods of use

Modified crRNA and tracrRNA oligonucleotides with chemical and length modifications address the issues of immune activation and degradation in CRISPR-Cas systems, enhancing gene editing efficiency and stability.

JP2025160487APending Publication Date: 2025-10-22INTEGRATED DNA TECHNOLOGIES INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025132121
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2015-10-09
Filing Date
2025-08-07
Publication Date
2025-10-22

AI Technical Summary

Technical Problem

Current methods for delivering guide RNA into mammalian cells using CRISPR-Cas systems trigger innate immune responses and are prone to rapid degradation, limiting their effectiveness and stability.

Method used

Development of modified compositions containing chemically modified and length-modified crRNA and tracrRNA oligonucleotides, such as 2'-O-alkyl and 2'-O-fluoro RNA oligonucleotides, with terminal modifications to enhance stability and reduce immune activation.

Benefits of technology

The modified RNAs exhibit improved stability and reduced immune response, maintaining functionality in CRISPR-Cas systems, enabling efficient gene editing with enhanced longevity and reduced toxicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2025160487000001_ABST
    Figure 2025160487000001_ABST
Patent Text Reader

Abstract

To provide modified compositions for use in CRISPR systems and methods of using them.SOLUTION: Described are length-modified and chemically-modified forms of crRNA and tracrRNA for use as reconstituted guide RNAs for interaction with Cas9 of CRISPR systems. The resultant length-modified and chemically-modified forms of crRNA and tracrRNA are economical to produce and can be tailored to have unique properties relevant to their biochemical and biological activity in the context of the CRISPR Cas9 endonuclease system.SELECTED DRAWING: Figure 10
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of priority under 35 U.S.C. § 119 to U.S. provisional patent applications entitled "CRISPR-BASED COMPOSITIONS AND METHODS OF USE," filed December 18, 2014 and October 9, 2015, bearing serial numbers 62 / 093,588 and 62 / 239,546, the contents of which are incorporated herein by reference in their entireties.

[0002] Sequence Listing This application contains a Sequence Listing that has been submitted in ASCII format via EFS-Web and is incorporated herein by reference in its entirety. This ASCII copy, created December 18, 2015, is named IDT01-008-US_ST25.txt and is 177,163 bytes in size.

[0003] The present invention relates to modified compositions for use in CRISPR systems and methods of their use. [Background technology]

[0004] The use of clustered regularly interspaced short palindromic repeats (CRISPR) and associated Cas proteins (CRISPR-Cas systems) for site-specific DNA cleavage has shown great potential for many biological applications. CRISPR has been used for genome editing, genome-scale specific targeting of transcriptional repressors (CRISPRi) and activators (CRISPRa) to endogenous genes, and RNA-directed DNA targeting by Cas enzymes, among other applications.

[0005] CRISPR-Cas systems are native to bacteria and archaea and provide adaptive immunity against viruses and plasmids. While there are three classes of CRISPR-Cas systems that could potentially be adapted for testing and therapeutic applications, type II CRISPR systems have the desirable feature of using a single CRISPR-associated (Cas) nuclease (specifically, Cas9) in complex with either an appropriate guide RNA, a bipartite RNA system similar to the natural complex in bacteria containing a CRISPR-activating RNA:trans-activating crRNA (crRNA:tracrRNA) pair, or an artificial chimeric single guide RNA (sgRNA) to mediate double-stranded breaks in target DNA. In mammalian systems, these RNAs have been introduced by transfection of RNA Pol III promoters (such as U6 or H1) driving RNA transcription, viral vectors, and DNA cassettes containing single-stranded RNA following in vitro transcription (see Xu, T., et al., Appl Environ Microbiol, 2014. 80(5):1544-52).

[0006] In the CRISPR-Cas9 system, using the system present in Streptococcus pyogenes (S.py. or Spy) as an example, the native crRNA is approximately 42 bases long and contains a 5' region of approximately 20 bases complementary to the target sequence (also referred to as the protospacer sequence) and a 3' region of typically approximately 22 bases corresponding to the region of complementarity of the tracrRNA sequence. The native tracrRNA is approximately 85-90 bases long, with a 5' region containing the region complementary to the crRNA and an approximately 10-base region upstream of the 5' region. The remaining 3' region of the tracrRNA contains secondary structure (referred to herein as the "tracrRNA 3' tail").

[0007] Jinek et al. extensively investigated the portions of crRNA and tracrRNA required for the normal function of the CRISPR-Cas9 system (Science, 2012, 337(6096):pp. 816-21). They devised truncated crRNA:tracrRNA fragments that could still function in CRISPR-Cas9, with the crRNA being 42 nucleotides long and the tracrRNA being truncated to 75 nucleotides. They also developed an embodiment in which the crRNA and tracrRNA are linked by a linker loop to form a single guide RNA (sgRNA), which varies between 99 and 123 nucleotides in different embodiments. The configuration of the natural bipartite crRNA:tracrRNA complex is shown in Figure 1, and a 99-nucleotide embodiment of an artificial sgRNA single guide is shown in Figure 2.

[0008] At least two groups have solved the crystal structure of Streptococcus pyogenes Cas9 (SpyCas9). In Jinek, M. et al., the structure did not show the nuclease in complex with either guide RNA or target DNA. They performed molecular modeling experiments to reveal predicted interactions between the protein in complex with RNA and DNA (Science, 2014.343, p. 1215, DOI: 10.1126 / science / 1247997).

[0009] In Nishimasu, H. et al., the crystal structure of SpyCas9 is presented at 2.5 Å resolution in complex with the sgRNA and its target DNA (Cell, 2014. 156(5): pp. 935-49, incorporated herein in its entirety). The crystal structure identified two lobes for the Cas9 enzyme: the recognition lobe (REC) and the nuclease lobe (NUC). The sgRNA:target DNA heteroduplex (negatively charged) resides in the positively charged groove between the two lobes. The REC lobe, which shows no structural similarity to known proteins and thus resembles a Cas9-specific functional domain, interacts with portions of the crRNA and tracrRNA that are complementary to each other.

[0010] Another group, Briner et al. (Mol Cell, 2014. 56(2):333-9, incorporated herein in its entirety), identified and characterized six conserved modules within the natural crRNA:tracrRNA duplex and sgRNA.

[0011] The CRISPR-Cas9 system is used in genome engineering as follows: a portion of the crRNA hybridizes to the target sequence; a portion of the tracrRNA hybridizes to a portion of the crRNA; the Cas9 nuclease binds to the entire construct and directs cleavage. The Cas9 contains two domains homologous to the endonucleases HNH and RuvC; the HNH domain cleaves the DNA strand complementary to the crRNA, and the RuvC-like domain cleaves the non-complementary strand. This results in a double-strand break in the genomic DNA. When repaired by non-homologous end joining (NHEJ), this break typically shifts by one or more bases, leading to disruption of the native DNA sequence and, in many cases, frameshift mutations when this event occurs within a coding exon of a protein-encoding gene. The break can also be repaired by homology-dependent recombination (HDR), allowing for experimental manipulation of new genetic material into the cleavage site created by Cas9 cleavage.

[0012] Some current methods for delivering guide RNA into mammalian cells include transfection of double-stranded DNA (dsDNA) containing an RNA Pol III promoter for endogenous transcription, viral delivery, transfection of RNA as an in vitro transcription (IVT) product, or microinjection of the IVT product. Each of these methods has its own drawbacks. Unmodified exogenous RNA introduced into mammalian cells is known to initiate innate immune responses through recognition by Toll-like receptors (TLRs), RIG-I, OASI, and other receptors that recognize pathogen-associated molecular patterns (PAMPs). However, most published studies have delivered in vitro transcribed (IVT) RNA using T7 RNA polymerase into cells. This type of RNA payload has been shown to trigger innate immune responses. Each of the above alternative delivery methods has its own drawbacks as well. For example, dsDNA cassettes can lead to integration, guide RNA transcription driven endogenously by an RNA Pol II promoter can be constitutively continuous, and the amount of transcribed RNA cannot be controlled.

[0013] RNA is rapidly degraded by nucleases present in serum and cells. Unmodified CRISPR RNA triggers (crRNA, tracrRNA, and sgRNA) produced by IVT or chemical synthesis are rapidly degraded during or after delivery into mammalian cells. When RNA is chemically modified to confer nuclease resistance, better activity is observed. The most potent degradative activity present in serum and cells is 3' exonuclease (Eder et al., Antisense Research and Development 1:141-151, 1991). Therefore, "end-blocking" synthetic oligonucleotides often improves nuclease stability. Chemical modification of single-stranded antisense oligonucleotides (ASOs) and double-stranded small interfering RNAs (siRNAs) has been thoroughly studied, and successful approaches are now being implemented (for reviews, see Kurreck, Eur. J. Biochem., 270:1628-1644, 2003; Behlke, Oligonucleotides, 18:305-320, 2008; Lennox et al., Gene Therapy, 18:1111-1120, 2011). Therefore, it is desirable to devise chemical modification strategies for use with the RNA components of CRISPR / Cas. While the basic toolbox of available chemical modifications is well known to those skilled in the art, the effects of site-specific modifications on the interaction of RNA species and effector proteins are not easily predicted, and effective modification patterns must usually be empirically determined. In some cases, the sequence of the RNA can affect the effectiveness of the modification pattern, necessitating adjustment of the modification patterns used for different sequence contexts, making practical application of such methods more difficult.

[0014] Thus, there is a need to modify guide RNAs to reduce their toxicity to cells and extend their lifespan and functionality in mammalian cells, while still serving their intended purpose in CRISPR / Cas systems. The methods and compositions of the invention described herein provide RNAs and modified RNA oligonucleotides for use in CRISPR-Cas systems. These and other advantages of the invention, as well as additional inventive features, will be apparent from the description of the invention provided herein. [Prior art documents] [Non-patent literature]

[0015] [Non-Patent Document 1] Xu,T.,et al.,Appl Environ Microbiol,2014.80(5):p.1544-52 [Non-patent document 2] Science,2012.337(6096):p.816-21 [Non-patent document 3] Science,2014.343,p.1215,DOI:10.1126 / science / 1247997 [Non-patent document 4] Cell,2014.156(5):p.935-49 [Non-patent document 5] Mol Cell,2014.56(2):p.333-9 [Non-patent document 6] Eder et al., Antisense Research and Development 1:141-151, 1991 [Non-Patent Document 7] Kurreck,Eur.J.Biochem.,270:1628-1644,2003 [Non-patent document 8] Behlke,Oligonucleotides,18:305-320,2008 [Non-Patent Document 9] Lennox et al.,Gene Therapy,18:1111-1120,2011 Summary of the Invention

[0016] The present invention relates to modified compositions for use in CRISPR systems and methods of their use. These compositions contain modified internucleotide linkages and 2'-O-alkyl and 2'-O-fluoro modified RNA oligonucleotides that function as the guide strand (crRNA, tracrRNA, or sgRNA) of the CRISPR-Cas system. The compositions also contain terminal modifications such as inverted dT bases or other non-nucleotide modifiers (e.g., propanediol groups (C3 spacers), naphthyl-azo modifiers, or others known in the art) that prevent exonuclease attack.

[0017] In a first aspect, an isolated tracrRNA is provided that comprises a length-modified form of SEQ ID NO: 18. The isolated tracrRNA exhibits activity in the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) (CRISPR-Cas) endonuclease system.

[0018] In a second aspect, an isolated crRNA is provided comprising a length-modified form of formula (I):

[0019]

number

[0020] In a third aspect, an isolated tracrRNA is provided that comprises a chemically modified form of one of SEQ ID NOS: 2, 18, 30-33, and 36-39. The isolated tracrRNA exhibits activity in the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) (CRISPR-Cas) endonuclease system.

[0021] In a fourth aspect, there is provided an isolated crRNA comprising a chemically modified form of formula (I):

[0022]

number

[0023] [Figure 1] 1 is a diagram of the wild-type (WT) native bipartite crRNA:tracrRNA complex with a 42-nt unmodified crRNA (SEQ ID NO: 46) and an 89-nt unmodified tracrRNA (SEQ ID NO: 18). Lowercase letters represent RNA. [Figure 2]

[0023] Figure 1 is a diagram of a 99-nt artificial single guide RNA (SEQ ID NO: 428) (sgRNA) that fuses the crRNA and tracrRNA elements into a single sequence through the addition of a new hairpin loop. Lowercase letters represent RNA. [Figure 3]Figure 1 shows an alignment of the full-length and truncated tracrRNA species tested in Example 2. The sequences are RNA and are shown 5' to 3'. The alignment is based on the top 89-nt WT tracrRNA sequence (SEQ ID NO: 18). Internal gaps represent sites of internal truncations / deletions. Capital letters represent RNA. [Figure 4] Figure 1 shows an alignment of the full-length and truncated crRNA and tracrRNA species tested in Example 3. The alignment is based on the 42-nt WT crRNA (SEQ ID NO: 46) and 89-nt WT tracrRNA (SEQ ID NO: 18) sequences at the top of their respective groupings. The 20-nt 5' domain of the crRNA is sequence-specific and targets human HPRT1. The underlined 3' domain binds to the region toward the 5' end of the tracrRNA. The 5' domain of the tracrRNA that binds to the 3' end of the crRNA is underlined. Capital letters represent RNA. [Figure 5] Schematic of the cleaved bipartite crRNA:tracrRNA complex with a 36-nt crRNA (SEQ ID NO: 48) and a 67-nt tracrRNA (SEQ ID NO: 2). Lowercase letters represent RNA. [Figure 6] 1 is a schematic showing the structure of one embodiment of an optimized truncated and chemically modified tracrRNA (SEQ ID NO: 134). The length is 67 bases. RNA is in lowercase and 2'OMe RNA is in uppercase. Phosphorothioate (PS) internucleotide linkages are indicated by "*". Residues that lead to a large loss of function when converted from RNA to 2'OMe RNA are identified by large arrows, and residues that lead to a moderate loss of function when converted from RNA to 2'OMe RNA are identified by small arrows. [Figure 7]Schematic showing the structure of one embodiment of an optimized cleaved and chemically modified crRNA (SEQ ID NO: 239). The length is 36 bases. RNA is in lowercase, and 2'OMe RNA is in uppercase. Phosphorothioate (PS) internucleotide linkages are indicated by "*". Residues that lead to a large loss of function when converted from RNA to 2'OMe RNA are identified by large arrows, and residues that lead to a moderate loss of function when converted from RNA to 2'OMe RNA are identified by small arrows. The 5'-terminal 20-base protospacer target-specific guide domain is shown, which in this case is a sequence specific for the human HPRT1 gene. The 3'-terminal 16-base tracrRNA-binding domain is shown. [Figure 8] Schematic showing the structure of one embodiment of the optimized cleavage / modification crRNA:tracrRNA complex used in Example 8. The crRNA is positioned on top with the 20-base underlined 5' protospacer domain, which in this case is specific for the target human HPRT1 site 38285, and at the 3' end is the 16-base tracrRNA-binding domain. The tracrRNA is aligned below. The RNA is in lowercase, the 2'OMe RNA is in uppercase, and the "*" indicates a phosphorothioate internucleotide linkage modification. This figure shows the complex formed by crRNA SEQ ID NO:178 and tracrRNA SEQ ID NO:100. [Figure 9] Schematic showing the structure of one embodiment of a highly modified, optimized cleavage / modification crRNA:tracrRNA complex. The crRNA is positioned on top with the 20-base underlined 5' protospacer domain, which in this case is specific for the target human HPRT1 site 38285, and at the 3' end is the 16-base tracrRNA-binding domain. The tracrRNA is aligned below. The RNA is in lowercase, the 2'OMe RNA is in uppercase, and the "*" indicates a phosphorothioate internucleotide linkage modification. This figure shows the complex formed by crRNA SEQ ID NO:446 and tracrRNA SEQ ID NO:134. [Figure 10]1 is a schematic showing the crRNA modification patterns used in Example 10. The 5'-3' oligonucleotide sequences (SEQ ID NOS: 429-439, respectively, in order of appearance) are shown. Lowercase = RNA, underline = 2'-O-methyl RNA, C3 = C3 spacer (propanediol modifier), * = phosphorothioate internucleotide linkage, ZEN = naphthyl-azo modifier. The 5' target-specific protospacer domain is shown. Because the sequence of each target site is different, bases are indicated by "N" within this domain, but the modification pattern used remains constant. The 3' universal tracrRNA binding domain is shown. Modification patterns are numbered for reference between Table 10 and Figure 10. [Figure 11] 1 is a plot of the data from Table 10 showing functional gene editing observed using the T7E1 assay in mammalian cells using crRNAs made with 11 different modification patterns tested at 12 different sites within the human HPRT1 gene. All crRNA variants were paired with the optimized modified tracrRNA (SEQ ID NO: 100). [Figure 12] Schematic showing the structure of one embodiment of an optimized cleaved / modified crRNA:tracrRNA complex highly modified using crRNA modification pattern 6, which is universal and can be applied in any sequence context. The crRNA (SEQ ID NO: 440) is positioned on top with the 5' protospacer domain 20 bases underlined (N bases), and at the 3' end is the 16-base tracrRNA-binding domain. The tracrRNA is aligned below (SEQ ID NO: 134). The RNA is in lowercase, the 2'OMe RNA is in uppercase, and the "*" indicates a phosphorothioate internucleotide linkage modification. [Figure 13] 1 shows a plot of RT-qPCR data from HEK-Cas9 cells transfected with different CRISPR gRNAs, showing the relative expression levels of IFIT1 and IFITM1, two genes involved in the interferon signaling pathway. DETAILED DESCRIPTION OF THE INVENTION

[0024] Aspects of the present invention relate to modified compositions for use in CRISPR systems and methods of their use.

[0025] As used herein, the term "oligonucleotide" refers to polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), and any other type of polynucleotide that is an N-glycoside of a purine or pyrimidine base (a single nucleotide is also referred to as a "base" or "residue"). There is no intended distinction in length between the terms "nucleic acid," "oligonucleotide," and "polynucleotide," and these terms may be used interchangeably. These terms refer only to the primary structure of the molecule. Thus, these terms include double- and single-stranded DNA, as well as double- and single-stranded RNA. For use in the present invention, oligonucleotides can also include nucleotide analogs with modified bases, sugars, or phosphate backbones, as well as non-purine or non-pyrimidine nucleotide analogs. Oligonucleotides may contain ribonucleotides, deoxyribonucleotides, modified nucleotides (e.g., nucleotides with 2' modifications, synthetic base analogs, etc.), or combinations thereof.

[0026] The compositions of the present invention may contain any modification that potentially reduces activation of the innate immune system. The modification may be placed or substituted in a conventional phosphodiester bond, in the ribose sugar, or in the nucleobase of RNA. Such compositions may contain modified nucleotides, such as 2'-O-methyl modified RNA.

[0027] In a broader sense, the term "modified nucleotide" refers to a nucleotide having one or more modifications to the nucleoside, nucleobase, pentose ring, or phosphate group. For example, modified nucleotides exclude ribonucleotides containing adenosine monophosphate, guanosine monophosphate, uridine monophosphate, and cytidine monophosphate, as well as deoxyribonucleotides containing deoxyadenosine monophosphate, deoxyguanosine monophosphate, deoxythymidine monophosphate, and deoxycytidine monophosphate. Modifications include naturally occurring modifications resulting from modifications by nucleotide-modifying enzymes, such as methyltransferases. Modified nucleotides also include synthetic or non-naturally occurring nucleotides. Modifications also include base analogs and universal bases. Synthetic or non-naturally occurring modifications in nucleotides include those with 2' modifications, such as 2'-O-alkyl (including 2'-O-methyl), 2'-fluoro, 2'-methoxyethoxy, 2'-allyl, 2'-O-[2-(methylamino)-2-oxoethyl], 4'-thio, bicyclic nucleic acid, 4'-CH2-O-2'-bridge, 4'-(CH2)2-O-2'-bridge, 2'-LNA, and 2'-O-(N-methylcarbamate), or those containing base analogs. Such modified groups are described, for example, in U.S. Patent No. 5,672,695 to Eckstein et al. and U.S. Patent No. 6,248,878 to Matulic-Adamic et al.

[0028] The use of 2'-O-methyl has been documented in the siRNA literature (see Behlke, MA, Oligonucleotides, 2008.18(4):pp.305-19) as well as mRNA delivery (see Sahin, U. et al., Nat Rev Drug Discov, 2014.13(10):pp.759-80). Sahin et al. describe 2'-OMe modifications and modifications of mRNA therapeutics that extend beyond "non-immunogenic" mRNAs.

[0029] The term "ribonucleotide" encompasses natural and synthetic, unmodified and modified ribonucleotides. Modifications include changes to the sugar moiety, the base moiety, and / or the linkages between ribonucleotides within an oligonucleotide.

[0030] The term "Cas9 protein" encompasses wild-type and mutant Cas9s that have biochemical and biological activity when complexed with a suitable guide RNA (e.g., sgRNA or dual crRNA:tracrRNA compositions) to form an active CRISPR-Cas endonuclease system. This includes orthologs and Cas9 variants with different amino acid sequences from the Streptococcus pyogenes Cas9 used as an example in the present invention.

[0031] The term "length-modified," as the term modifies RNA, refers to a shortened or truncated form of the reference RNA that lacks a nucleotide sequence, or to an elongated form of the reference RNA that includes an additional nucleotide sequence.

[0032] The term " chemically modified " refers to the standard RNA form that contains chemically modified nucleotide, or the non-nucleotide chemical group that is covalently bound to the RNA, when the term modifies RNA.The chemically modified RNA described herein generally refers to the synthetic RNA that is prepared by using oligonucleotide synthesis method, and modified nucleotide is incorporated during the synthesis of RNA oligonucleotide.However, chemically modified RNA also includes the synthetic RNA oligonucleotide that is modified with suitable modifying agent after synthesis.

[0033] Applicants have discovered novel crRNA and tracrRNA oligonucleotide compositions that exhibit robust activity in the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) (CRISPR-Cas) endonuclease system. The oligonucleotide compositions include length-modified forms of crRNA and tracrRNA, as well as chemically modified forms of crRNA and tracrRNA. The length-modified forms of crRNA and tracrRNA allow for cost-effective, efficient oligonucleotide synthesis protocols to routinely prepare active forms of these RNAs. The chemically modified forms of crRNA and tracrRNA provide tunable active agents with certain properties, such as improved stability, in cellular and in vivo settings. The length-modified forms of crRNA and tracrRNA may also contain modifications that allow access to a wide range of compositions active in the context of the CRISPR-Cas endonuclease system. These oligonucleotide compositions and their properties in the CRISPR-Cas endonuclease system are described below.

[0034] Length-modified forms of crRNA and tracrRNA

[0035] FIG. 1 shows a representation of a wild-type Streptococcus pyogenes crRNA:tracrRNA complex, in which an exemplary isolated crRNA (SEQ ID NO: 46) is paired with an isolated tracrRNA (SEQ ID NO: 18). In a first aspect, an isolated tracrRNA comprising a length-modified form of SEQ ID NO: 18 is provided. The isolated tracrRNA exhibits activity in a CRISPR-Cas endonuclease system. In one aspect, the isolated tracrRNA comprises a length-modified form of SEQ ID NO: 18 nucleotides with deleted sequence information. In some embodiments, the length-modified form of SEQ ID NO: 18 includes a shortened or truncated form of SEQ ID NO: 18, which may be shortened by 1 to 20 nucleotides at the 5' end and 1 to 10 nucleotides at the 3' end. Such a shortened or truncated form of SEQ ID NO: 18 retains activity when paired with a functionally competing crRNA in a CRISPR-Cas endonuclease system. When the 5' end of the tracrRNA is shortened and extended to a sequence that pairs with the 3' end of the crRNA, improved activity can be obtained by using chemical modifications that enhance binding affinity in these domains. When the 3' end of the crRNA is shortened and extended to a sequence that pairs with the 5' end of the tracrRNA, improved activity can be obtained by using chemical modifications that enhance binding affinity in these domains. Preferred examples of length-modified forms of SEQ ID NO:18 with shortened or truncated forms include SEQ ID NOs:2, 30-33, and 36-39. Highly preferred examples of length-modified forms of SEQ ID NO:18 with shortened or truncated forms include SEQ ID NO:2. In the case of the aforementioned exemplary length-modified forms of SEQ ID NO:18 with each shortened or truncated form, SEQ ID NOs:2, 30-33, and 36-69 are composed of chemically unmodified nucleotides.

[0036] In a second aspect, an isolated crRNA is provided comprising a length-modified form of formula (I):

[0037]

number

[0038] The target-specific protospacer domain (X domain in formula (I)) typically contains about 20 nucleotides that are complementary to the region of DNA targeted by the CRISPR-Cas endonuclease system. The tracrRNA binding domain (Z domain in formula (I)) typically contains about 20 nucleotides in most CRISPR endonuclease systems (in the native S.py. version, this domain is 22 nucleotides). The isolated crRNA exhibits activity in the CRISPR-Cas endonuclease system.

[0039] In one aspect, the isolated crRNA comprises a length-modified form of Formula (I) with deleted sequence information. In some embodiments, the length-modified form of Formula (I) includes a shortened or truncated form of Formula (I), which may be shortened by 1 to 8 nucleotides at the 3' end of the Z domain. The length-modified form of Formula (I) may be shortened at the 5' end of the X domain to accommodate a target-specific protospacer domain having 17, 18, 19, or 20 nucleotides. Highly preferred examples of such length-modified forms of Formula (I) include target-specific protospacer domains having 19 or 20 nucleotides. Exemplary length-modified forms of Formula (I), including shortened or truncated forms with a target-specific protospacer (X domain) that is 17 to 20 nucleotides in length and / or lacks 1 to 8 nucleotides at the 3' end of the Z domain, may consist of chemically unmodified nucleotides.

[0040] Such shortened or truncated forms of Formula (I) retain activity when paired with a competing tracrRNA in the CRISPR-Cas endonuclease system. Preferred embodiments of the isolated crRNA of Formula (I) having length-modified forms of Formula (I) may include chemically unmodified and chemically modified nucleotides.

[0041] Chemically modified forms of crRNA and tracrRNA

[0042] In a third aspect, an isolated tracrRNA is provided that includes chemically modified nucleotides or non-nucleotide chemical modifiers. The isolated tracrRNA exhibits activity in a CRISPR-Cas endonuclease system. In one aspect, the isolated tracrRNA includes chemically modified nucleotides having a modification selected from the group consisting of a ribose modification, a terminal modification group, and an internucleotide modified linkage. Exemplary ribose modifications include 2'O-alkyl (e.g., 2'OMe), 2'F, bicyclic nucleic acid, and locked nucleic acid (LNA). Exemplary terminal modification groups include a propanediol (C3) spacer and a naphthyl-azo modifier (N,N-diethyl-4-(4-nitronaphthalen-1-ylazo)-phenylamine, or "ZEN"), as well as an inverted dT residue. Exemplary internucleotide modified linkages include phosphorothioate modifications. In one embodiment, isolated tracrRNAs with chemically modified forms include SEQ ID NO: 46 and length-modified forms thereof, such as shortened or truncated forms of SEQ ID NO: 46. Preferred shortened or truncated forms of SEQ ID NO: 46 with chemically modified nucleotides include SEQ ID NOs: 2, 30-33, and 36-39 with chemically modified nucleotides. Further examples of isolated tracrRNAs with chemically modified nucleotides that have robust activity in the CRISPR-Cas endonuclease system are provided in the Examples.

[0043] In a fourth aspect, an isolated crRNA containing chemically modified nucleotides is provided. The isolated crRNA exhibits activity in a CRISPR-Cas endonuclease system. In one aspect, the isolated crRNA contains chemically modified nucleotides having a modification selected from the group consisting of a ribose modification, a terminal modification group, and an internucleotide modified linkage. Exemplary ribose modifications include 2'O-alkyl (e.g., 2'OMe), 2'F, bicyclic nucleic acid, and locked nucleic acid (LNA). Exemplary terminal modification groups include a propanediol (C3) spacer and a naphthyl-azo modifier (N,N-diethyl-4-(4-nitronaphthalen-1-ylazo)-phenylamine, or "ZEN"), and an inverted dT residue. Exemplary internucleotide modified linkages include a phosphorothioate modification. In one aspect, the isolated crRNA having a chemically modified form includes the crRNA of Formula (I) and its length-modified form. Preferred truncated or truncated forms of crRNA of Formula (I) with chemically modified nucleotides include SEQ ID NOs: 429-439. Highly preferred examples of isolated crRNA with chemically modified nucleotides include SEQ ID NOs: 434 and 435. These specific isolated crRNA species represent "universal" crRNAs with chemically modified nucleotides that exhibit high activity when complexed with competent tracrRNA in the CRISPR-Cas endonuclease system. Further examples of isolated crRNAs with chemically modified nucleotides that have robust activity in the CRISPR-Cas endonuclease system are provided in the Examples.

[0044] The isolated, length-modified, and chemically-modified crRNA and tracrRNA preferably contain chemical modifications at the 2'-OH group (e.g., 2'OMe, 2'F, bicyclic nucleic acids, locked nucleic acids, among others) and terminal-blocking modifications (e.g., ZEN, C3 spacer, inverted dT). The use of both types of common modifications provides the isolated, length-modified, and chemically-modified crRNA and tracrRNA with biochemical stability and immune tolerance in biological contexts.

[0045] The aforementioned isolated, length-modified, and chemically-modified crRNAs and tracrRNAs can be mixed in different combinations to form active crRNA:tracrRNAs as guide RNAs for Cas9. For example, isolated, length-modified tracrRNAs can be combined with isolated, chemically-modified crRNAs to form active crRNA:tracrRNAs as guide RNAs for Cas9. The Examples provide illustrations of different combinations of isolated, length-modified, and chemically-modified crRNAs and tracrRNAs that result in active crRNA:tracrRNAs as guide RNAs for Cas9.

[0046] The extent to which specific chemically modified nucleotides contained in either (or both) of the isolated, length-modified, and chemically modified crRNA and tracrRNA are required depends on the application in which the resulting active crRNA:tracrRNA functions as a guide RNA for Cas9. In certain biochemical assays of the CRISPR-Cas endonuclease system, particularly when nucleases may be minimal or absent, extensively chemically modified crRNA and tracrRNA may not be required to produce robust activity of the resulting guide RNA for Cas9 of the CRISPR-Cas endonuclease system. This is due to the fact that chemically modified nucleotides that confer resistance to nucleases are not essential when nucleases are minimal or absent. In certain biological (in vivo) situations, mixtures containing crRNA and tracrRNA are delivered to cells in carrier vehicles such as liposome nanoparticles; isolated, length-modified, and chemically-modified crRNA and tracrRNA may require less extensive chemically modified nucleotides than mixtures of crRNA and tracrRNA delivered directly to the bloodstream or injected into organ systems as isolated "naked" RNA mixtures. The degree of chemical modification present in chemically-modified crRNA and tracrRNA can dictate the half-life of the associated RNA molecules in vivo (i.e., in the relevant biological context, e.g., in the bloodstream or within cells). Thus, the modification profile of chemically-modified crRNA and tracrRNA can be used to fine-tune the biochemical and biological activity of the resulting crRNA:tracrRNA duplex as a guide RNA for Cas9 in the CRISPR-Cas endonuclease system.

[0047] While prior art has focused on the structure of Cas9 as it interacts with sgRNA, the design patterns disclosed herein contemplate the aforementioned crRNA:tracrRNA duplex RNA system. Single-stranded guide RNAs offer several benefits, such as simplicity in therapeutic design. However, standard solid-phase phosphoramidite RNA synthesis exhibits a decline in oligonucleotide yield as length increases, a problem that becomes more apparent at lengths beyond 60-70 bases. This precludes robust, cost-effective synthesis of some tracrRNAs as well as chimeric sgRNAs, particularly at the larger scales required for some commercial or therapeutic applications. For this reason, the present invention contemplates the implementation of not only sgRNAs but also alternative duplex crRNA:tracrRNAs as guide RNAs for Cas9. However, isolated guide RNAs with robust activity when complexed with Cas9 in the CRISPR-Cas endonuclease system can be engineered based on the isolated, length-modified, and chemically modified forms of crRNA and tracrRNA provided herein by combining or synthesizing appropriate crRNA and tracrRNA as artificial unimolecular sgRNAs. Long single guides of this type can be obtained by direct synthesis of shorter strands or by post-synthetic chemical conjugation.

[0048] The design of length-modified and chemically modified tracrRNA compositions addresses potential synthetic challenges associated with tracrRNA oligonucleotides greater than 80 nucleotides in length. The coupling efficiency of 2′-OMe-modified RNA monomers (effectively containing a protecting group on the 2′-OH) is superior to that of RNA monomers. Incorporating 2′-OMe-modified RNA offers several advantages. First, it allows longer oligonucleotides to be synthesized as either fully 2′-OMe or mixed RNA / 2′-OMe oligonucleotides. Second, the methods and compositions of the present invention lead to the synthesis and transfection of crRNA:tracrRNA, which may evade detection by the immune system. It is also well known that exogenous, unmodified RNA elicits innate immune responses in mammalian cells and whole animals. The use of 2′-OMe-modified oligonucleotides can confer RNA stability against nucleases (a third advantage) and reduce cell death and toxicity associated with immunogenic triggers. These advantages are not inherent to the 2'-OMe modification itself, as other disclosed modified nucleotides with different chemical moieties (e.g., 2'F, other 2'O-alkyls, LNA, and other bicyclic nucleotides) can provide similar gains and advantages with respect to conferring resistance to nucleases.

[0049] In another embodiment, the portion of the tracrRNA that is complementary to the crRNA contains at least one modified nucleotide; in a further embodiment, the portion of the tracrRNA that is complementary to the crRNA is composed of more than 10% modified residues; in a further embodiment, the portion of the tracrRNA that is not complementary to the crRNA is composed of more than 50% modified residues; and in a further embodiment, the portion of the tracrRNA that is not complementary to the crRNA is composed of more than 90% modified residues.

[0050] In another embodiment, the crRNA portion is unmodified and the tracrRNA portion is composed of at least one modified nucleotide. In a further embodiment, the crRNA portion is unmodified and the tracrRNA portion is composed of more than 10% modified bases.

[0051] In another embodiment, isolated crRNAs of Formula (I) are designed with empirically determined modifications. As depicted in Figures 7 and 10, 12 nucleotides at the 3' end of the Z domain (tracrRNA-binding domain) and 10-12 nucleotides at the 5' end of the X domain (within the protospacer domain) represent universal nucleotides amenable to substitution with chemically modified nucleotides, and the resulting RNAs retain robust activity in the CRISPR-Cas endonuclease system. Additional nucleotides within the 5' end of the Z domain (tracrRNA-binding domain) are intolerant to substitution with chemically modified nucleotides (Figure 7). However, the ability of other sites within isolated crRNAs of Formula (I) to tolerate chemically modified nucleotides and retain activity in the CRISPR-Cas endonuclease system is primarily determined empirically. The tracrRNA-binding domain (Z domain) of the crRNA is constant (i.e., its sequence does not change across different target sites), and therefore the modification patterns described herein are universal and broadly applicable to all crRNAs, regardless of target site. The protospacer (X domain) of crRNAs varies by target, and the tolerance to chemical modification of some base positions within this domain varies depending on the sequence configuration, potentially benefiting from empirical optimization if maximum chemical modification of the site is desired. However, some residues within the target-specific protospacer (X) domain can be modified without consideration of sequence configuration. The 10–12 residues at the 5′ end of this domain can be replaced with 2′-modified residues with the expectation that full activity of the modified crRNA will be maintained. The remaining 8–10 bases toward the 3′ end of the protospacer (X) domain may or may not tolerate modification, depending on the sequence configuration. Figure 7 shows one sequence configuration in which 17 of the 20 bases in the protospacer (X) domain can be modified while maintaining full activity. The site exhibits reduced activity upon modification.

[0052] The applications of Cas9-based tools are many and varied, including, but not limited to, plant gene editing, yeast gene editing, rapid generation of knockout / knockin animal lines, generation of animal models of disease states, correction of disease states, insertion of reporter genes, and whole genome functional screening.

[0053] The utility of the present invention is further expanded by including mutant versions of Cas enzymes, such as the D10A and H840a double mutant of Cas9, as fusion proteins with transcriptional activators (CRISPRa) and repressors (CRISPRi) (see Xu, T., et al., Appl Environ Microbiol, 2014. 80(5): pp. 1544-52). Cas9-sgRNA complexes can also be used to similarly target single-stranded mRNA (see O'Connell, MR, et al., Nature, 516:263, 2014). In a manner similar to targeting dsDNA, crRNA:tracrRNA can be used with a PAMmer DNA oligonucleotide to direct Cas9 cleavage to the target mRNA, or it can be used in the mRNA capture assay described by O'Connell.

[0054] The synthetic RNA oligonucleotide delivery approach for CRISPR / Cas9 applications allows for: 1) confirmation of distinct RNA sequences using mass spectroscopy; 2) selective insertion of 2'-OMe-modified RNA into well-tolerated locations to confer stability and functional efficacy while avoiding immunogenicity; 3) specific control of the amount of RNA introduced into cells for a controlled, transient effect; and 4) elimination of concerns regarding the introduction of dsDNA, which is endogenously transcribed into RNA but can also be a substrate for either homology-directed repair pathways or non-homologous end-joining, resulting in integration events. These integration events can lead to long-term, unwanted expression of the crRNA or tracrRNA elements. Furthermore, integration can disrupt other genes in a random and unpredictable manner, altering the cell's genetic material in unwanted, potentially harmful ways. Thus, the present invention is desirable as a means to introduce transient expression of CRISPR pathway elements in cells in a manner that is transient and leaves no lasting evidence or changes to the genome other than any modifications intended to be directed by the crRNA guide.

[0055] CRISPR-Cas endonuclease system

[0056] The competent CRISPR-Cas endonuclease system comprises a ribonucleoprotein (RNP) complex formed with an isolated Cas9 protein and an isolated guide RNA selected from one of a dual crRNA:tracrRNA combination and a chimeric sgRNA. In some embodiments, the isolated, length-modified, and / or chemically modified forms of the crRNA and tracrRNA are complexed with purified Cas9 protein (e.g., SEQ ID NOs: 407-410), isolated mRNA encoding the Cas9 protein (e.g., SEQ ID NO: 413), or a gene encoding the Cas9 protein (e.g., SEQ ID NOs: 411 and 412) in an expression vector. In certain assays, the isolated, length-modified, and / or chemically modified forms of the crRNA and tracrRNA can be introduced into a cell line stably expressing the Cas9 protein from an endogenous expression cassette encoding the Cas9 gene. In other assays, a mixture of length-modified and / or chemically modified forms of crRNA and tracrRNA can be introduced into cells in combination with either Cas9 mRNA or Cas9 protein. [Example]

[0057] Example 1 This example demonstrates the functionality of chemically modified and cleaved guide RNAs in an in vitro Cas9 DNA cleavage assay.

[0058] CrRNA and tracrRNA oligonucleotides were synthesized with various chemical modifications and truncations relative to the WT sequence as indicated (Table 1).

[0059] [Table 1] TIFF2025160487000006.tif200170TIFF2025160487000007.tif203170TIFF2025160487000008.tif203170TIFF2025160487000009.tif201170TIFF2025160487000010.tif174170The 5'-3' sequences of the oligonucleotides are shown. Lowercase letters indicate RNA, underlined letters indicate 2'-O-methyl RNA, and italicized letters indicate 2'-fluoro RNA. The length of the RNA oligonucleotide is indicated (in bases). The relative efficiency of DNA target cleavage by recombinant Cas9 with each of the crRNA:tracrRNA pairs, visualized by agarose gel electrophoresis, is indicated by "+++" indicating complete cleavage, "++" and "+" indicating intermediate levels of cleavage, and "-" indicating no cleavage.

[0060] The crRNA contained a 19-base protospacer guide sequence matching a site in the human HPRT1 gene adjacent to a suitable "NGG" PAM site. A 938-base pair region from the human HPRT1 gene was cloned into the pCR-Blunt vector (Life Technologies). Prior to use in the Cas9 cleavage assay, the plasmid was phylothesized by digestion with the restriction endonuclease XmaI (New England BioLabs). The sequence of the HPRT1 target fragment is shown below. The target PAM site is shown in bold, and the protospacer guide sequence binding site is underlined.

[0061] [ka]

[0062] The crRNA and tracrRNA pairs were tested for their ability to direct the degradation of a lineaged plasmid DNA containing a cloned fragment of the human HPRT1 gene by recombinant Spy Cas9 (New England BioLabs). The crRNA:tracrRNA was annealed at a concentration of 150 nM in Duplex Buffer (30 mM HEPES pH 7.5, 100 mM potassium acetate). Spy Cas9 (15 nM) was preincubated with the crRNA:tracrRNA at a 1:1 molar ratio for 10 minutes at 37°C. Then, 3 nM of the lineaged target plasmid was added and incubated at 37°C for 1 hour. The reaction products were separated on a 1% agarose gel at 125 V for 1 hour. Bands were visualized by post-staining with GelRed (Biotium) according to the manufacturer's protocol. The gel was imaged on a UV transilluminator, and the results are summarized in Table 1 above.

[0063] Natural wild-type (WT) CRISPR RNA has a 19- to 20-base protospacer domain (a guide for binding to the target nucleic acid) at the 5' end and a 22-base domain that binds to the tracrRNA at the 3' end. Therefore, WT crRNA is 41- to 42-bases long. WT tracrRNA is 89-bases long. We observed that the WT crRNA:tracrRNA pair supported complete cleavage of the target DNA (cr / tracrRNA pair 2D). Additionally, we observed that a truncated version of the reagent, with a 35-base crRNA (19-base protospacer and a 16-base tracrRNA-binding domain) paired with a 67-base tracrRNA, supported complete cleavage of the target RNA (cr / tracrRNA pair 1A). The crRNA tracrRNA-binding region was truncated 6 bases at the 3' end (SEQ ID NO: 1). The tracrRNA was cleaved at both ends (SEQ ID NO: 2). Pairing of short crRNA with long tracrRNA showed similar cleavage as pairing of long crRNA with short tracrRNA (pair 2A). These findings are important because they allow the use of short RNA components to direct Cas9 target recognition and cleavage. Shorter RNA oligonucleotides are cheaper and less difficult to chemically synthesize, require less purification, and offer higher yields than longer RNA oligonucleotides.

[0064] Functional sgRNAs (Figure 2) were generated by deleting certain elements of the native crRNA and tracrRNA (Figure 1). However, the amount of duplex nucleic acid linking the crRNA to the tracrRNA within the sgRNA is limited to 11 base pairs, which is typically too short for duplex formation under biological salt conditions. While the complex is stable in the sgRNA format due to a unimolecular hairpin structure, the same sequence split into two RNAs is unstable. Therefore, it was unclear what length of duplex domain was required to create a minimal yet functional two-molecule (bipartite) CRISPR complex, or whether this complex would function to direct target cleavage by Cas9. This example demonstrates that base-pairing of as few as 15 bases enables the bipartite crRNA:tracrRNA complex to function, directing Cas9 nuclease activity to targets complementary to the crRNA protospacer domain (SEQ ID NOS: 1 and 2).

[0065] Complete chemical modification of crRNA with 2'OMe RNA was not tolerated (vs. 3A and v. 5A). Furthermore, complete 2'OMe modification of the 22-nt tracrRNA-binding domain of crRNA did not support target cleavage (vs. 4A and v. 6A), and complete 2'OMe modification of the protospacer-guide domain did not support cleavage (vs. 7A). Complete chemical modification of tracrRNA with 2'OMe RNA was also not tolerated (vs. 1B and 1C, and v. 2B and 2C).

[0066] Importantly, some highly 2'OMe-modified versions of both CRISPR RNA species supported cleavage. Pair 1K shows high cleavage activity with tracrRNA having 29 2'OMe residues at the 3' end (SEQ ID NO: 11). Pair 1L shows high cleavage activity with 9 2'OMe residues at the 5' end and 29 2'OMe residues at the 3' end (SEQ ID NO: 13). Thus, 38 of the 67 RNA residues in the shorter version of tracrRNA can be converted to 2'OMe RNA (57%) without loss of activity in in vitro cleavage assays.

[0067] Pair 14A demonstrates that 11 bases at the 3' end of the crRNA (50% of the 22-base tracrRNA-binding domain) are modified with 2'OMe RNA and can support target cleavage (SEQ ID NO: 14). The modified crRNA retains full activity when paired with modified tracrRNA (Pair 14L, SEQ ID NOs: 13 and 14). Eleven base modifications toward the 5' end of the crRNA (in the guide, protospacer domain, bases 2-12) support target cleavage (Pair 15A), and these modifications are also functional when paired with modified tracrRNA (Pair 15L, SEQ ID NOs: 13 and 15). 2'OMe modifications toward the 5' and 3' ends of the crRNA, even when paired with modified tracrRNA (Pair 16L, SEQ ID NOs: 13 and 16), can still complex to support cleavage (Pair 16A) even when 22 of 35 residues are modified (63%) (SEQ ID NO: 16).

[0068] All of the crRNA:tracrRNA pairs described above used 2'OMe RNA as the modifier. Additional testing showed that 2'F modifications were also tolerated by Cas9, enabling target DNA cleavage. Pair 9A used a crRNA with 2'F modifications at all pyrimidine bases (SEQ ID NO: 23), and this design supported complete target cleavage. Similarly, complete 2'F modifications of the crRNA supported complete target cleavage (Pair 10A, SEQ ID NO: 24). The combined use of 2'OMe and 2'F modifications may enable complete modification of both the crRNA and tracrRNA. The tests in this example are used in in vitro biochemical analysis. Performance may differ in the context of mammalian gene editing, where sequences must function in a nuclear environment.

[0069] Example 2 This example demonstrates the function of truncated tracrRNA to direct genome editing by Spy Cas9 nuclease in mammalian cells.

[0070] Both a functional Cas9 nuclease and RNA trigger (either a single sgRNA or a dual crRNA:tracrRNA pair) must be present in the nucleus of mammalian cells for CRISPR genome editing to occur. Transfection of large plasmid vectors expressing Cas9 is inefficient and adds variability to experimental results. To accurately assess the effects of altering the length and chemical composition of the crRNA and tracrRNA in mammalian cells in the absence of other variables, cell lines stably expressing Spy Cas9 were constructed.

[0071] A HEK293 cell line with constitutive expression of SpyCas9 (human codon-optimized) with stable vector integration and selection under G418 was developed as follows. Human-optimized SpyCas9 was ligated into the pcDNA3.1 expression vector (Life Technologies) and transfected into HEK293 cells using Lipofectamine 2000 (Life Technologies). Transfected cells were grown for 2 days before being placed under selective pressure using neomycin. After 7 days, cells were seeded into single colonies using limiting dilution techniques. Monoclonal colonies were screened for Cas9 activity, and clones with the highest levels of expression were used for subsequent testing. Cas9 single-copy integration events were determined using droplet digital PCR (ddPCR). Western blot analysis using an anti-Cas9 antibody showed low but consistent Cas9 protein expression. This cell line is hereafter referred to as "HEK-Cas9."

[0072] This HEK-Cas9 cell line was used for further studies. In a reverse transfection format, the anti-HPRT1 crRNA:tracrRNA complex was mixed with Lipofectamine RNAiMAX (Life Technologies) and transfected into HEK-Cas9 cells. Transfections were performed in a 96-well plate format using 40,000 cells per well. RNA was introduced at a final concentration of 30 nM in 0.75 μL of lipid reagent. Cells were incubated at 37°C for 48 hours. Genomic DNA was isolated using QuickExtract solution (Epicentre). Genomic DNA was amplified with KAPA HiFi DNA polymerase (Roche) and primers targeting the HPRT region of interest (HPRT forward primer: AAGAATGTTGTGATAAAAGGTGATGCT (SEQ ID NO: 28), HPRT reverse primer: ACACATCCATGGGACTTCTGCCTC (SEQ ID NO: 29)). PCR products were dissolved and reannealed in NEB buffer 2 (New England BioLabs) to allow heteroduplex formation, followed by digestion with 2 units of T7 endonuclease 1 (T7EI, New England BioLabs) for 1 hour at 37°C. Digested products were visualized on a fragment analyzer (Advanced Analytics). The percent cleavage of targeted DNA was calculated as the average molar concentration of cleaved products / (average molar concentration of cleaved products + molar concentration of uncleaved band) × 100.

[0073] TracrRNAs (Table 2) were synthesized with deletions at the 5' end, 3' end, internally, or a combination thereof. The tracrRNA was complexed with an unmodified cleaved anti-HPRT1 crRNA SEQ ID NO:1 (Table 1), which contains a 19-base protospacer domain targeting HPRT1 at the 5' end and a 16-base tracrRNA-binding domain at the 3' end. The paired crRNA:tracrRNA RNA oligonucleotides were transfected into HEK-Cas9 cells and treated as described above. Relative gene editing activity was assessed by comparing cleavage rates within the HPRT1 gene using a T7EI mismatch endonuclease cleavage assay, along with quantitative product measurements performed using a fragment analyzer. A representation of the wild-type S. pyogenes crRNA:tracrRNA complex is shown in Figure 1 (crRNA SEQ ID NO:46 is paired with tracrRNA SEQ ID NO:18). The relative locations of the deletions within the tracrRNA tested in this example are shown in sequence alignment format in Figure 3.

[0074] [Table 2] TIFF2025160487000013.tif215155TIFF2025160487000014.tif28156The 5'-3' oligonucleotide sequences are shown. Lowercase letters = RNA. The length of the RNA oligonucleotide is indicated (in bases). The number of RNA residues removed in the cleavage assay at the 5' end, 3' end, and internal (int) is indicated. The relative functional activity of each species is indicated by the % cleavage in the T7EI heteroduplex assay.

[0075] This example demonstrates that for gene editing purposes in mammalian cells, tracrRNA can tolerate significant deletions from both the 5' and 3' ends and retain full functionality. An 18-base deletion from the 5' end was well tolerated. A 20-base deletion from the 5' end led to reduced activity, likely due to lower affinity of crRNA binding. This reduced length or even shorter lengths may be functional if Tm-enhancing modifications are used to stabilize short duplex-forming regions. Deletions of up to 10 bases from the 3' end were well tolerated. Additional deletions resulted in loss of activity. Internal deletions that interrupted the hairpin element or the spacing between hairpin elements were not functional.

[0076] In summary, this example demonstrates that truncation of the wild-type (WT, SEQ ID NO: 18) 89-base length tracrRNA to 67 bases (SEQ ID NO: 2), 62 bases (SEQ ID NO: 38), or 61 bases (SEQ ID NO: 39) retained high functional activity. The use of these truncated tracrRNAs is less expensive and easier to produce by chemical methods than the WT 89-base RNA. Some of the truncated species (SEQ ID NO: 2, SEQ ID NO: 38, and SEQ ID NO: 39) exhibited increased functional activity over the 89-base WT tracrRNA. Thus, in addition to being less expensive and easier to produce by chemical methods, the truncated tracrRNAs of the present invention exhibited improved activity.

[0077] Example 3 Examples 1 and 2 demonstrated that crRNA:tracrRNA complexes shorter than the WT length of 42 and 89 bases, respectively, can exhibit higher functional activity in mammalian gene editing. This example demonstrates further optimization of the length of these RNA species.

[0078] A series of crRNAs and tracrRNAs (Table 3) were synthesized with different lengths as indicated. Cleavage was performed at the 3' end of the crRNA, the 5' end of the tracrRNA, and / or the 3' end of the tracrRNA. The crRNAs and tracrRNAs were paired as shown in Table 3. All crRNAs used a 20-base protospacer domain (tracrRNA-binding domain) that targets HPRT1 at the 5' end and variable length 3' end. An alignment of the crRNA and tracrRNA sequences tested in this example is shown in Figure 4, revealing the location of cleavage relative to each functional domain.

[0079] Paired crRNA:tracrRNA RNA oligonucleotides were transfected into HEK-Cas9 cells and processed as described in Example 2. Relative gene editing activity was assessed by comparing cleavage rates within the HPRT1 gene using a T7EI mismatch endonuclease cleavage assay, with quantitative measurement of products performed using a fragment analyzer. Results are shown in Table 3. The relative positions of the deletions are shown in Figure 4 in sequence alignment format.

[0080] [Table 3] TIFF2025160487000016.tif221155TIFF2025160487000017.tif220155TIFF2025160487000018.tif164156The 5'-3' oligonucleotide sequences are shown. Lowercase letters = RNA. The length of the RNA oligonucleotide is indicated (in bases). The relative functional activity of each crRNA:tracrRNA pair is indicated by % cleavage in the T7EI heteroduplex assay.

[0081] All of the tested compounds directed CRISPR / Cas editing at the HPRT1 locus in HEK-Cas9 cells. Efficiency varied widely, ranging from 6% to 57%. The most effective crRNA+tracrRNA combination was a 36-mer crRNA (SEQ ID NO: 48) and a 67-mer tracrRNA (SEQ ID NO: 2). A schematic representation of the truncated, optimized crRNA:tracrRNA complex is shown in Figure 5. In this case, the tracrRNA-binding domain of the crRNA was truncated to 16 bases (3' end) from the WT 22-mer sequence. This hybridizes to the crRNA-binding domain at the 5' end of the tracrRNA. The tracrRNA was truncated by 18 bases at the 5' end and 4 bases at the 3' end to generate an active 67-mer product. In this pair, rounded ends are formed upon hybridization of the 3' end of the crRNA with the 5' end of the tracrRNA. Another version containing a 42-nt (WT) crRNA (SEQ ID NO: 46) paired with a 70-nt tracrRNA (SEQ ID NO: 51) also showed high activity.

[0082] The shortest crRNA tested was 34 bases long (SEQ ID NO: 49) and generally showed lower activity than longer variants. The shorter duplex domain formed between this variant and tracrRNA had reduced binding affinity (Tm) compared to the 36-base crRNA variant, and the 34-base complex was unstable at 37°C. The use of chemical modifications that increase binding affinity (Tm), such as 2'OMe RNA, 2'F RNA, or LNA residues, increases the stability of this short duplex domain, leading to improved activity and enabling the use of very short crRNAs of this design. The extensive use of Tm-enhancing modifications allows for the use of even shorter tracrRNA-binding domains, e.g., 13, 12, 11, 10, 9, 8, or shorter, depending on the type and number of modified residues used in the crRNA.

[0083] Example 4 Examples 1, 2, and 3 demonstrated that crRNA:tracrRNA complexes shorter than the WT length of 42 bases and 89 bases, respectively, can exhibit higher functional activity in mammalian gene editing. In these examples, all truncations were made in the universal domain of the RNA. This example examines the effect that truncations have on the target-specific protospacer domain of the guide crRNA.

[0084] A series of crRNAs (Table 4) with protospacer domain lengths of 20, 19, 18, or 17 bases were synthesized, as indicated. A 16-mer universal tracrRNA binding sequence was used at the 3' end, and cleavage was performed at the 5' end of the crRNA. The crRNAs were paired with an unmodified 67-mer tracrRNA (SEQ ID NO: 2). The crRNAs targeted four different sites within the same exon of the human HPRT1 gene.

[0085] The paired crRNA:tracrRNA RNA oligonucleotides were transfected into HEK-Cas9 cells and treated as described in Example 2. Relative gene editing activity was assessed by comparing cleavage rates within the HPRT1 gene using a T7EI mismatch endonuclease cleavage assay, along with quantitative measurement of products using a fragment analyzer. The results are shown in Table 4.

[0086] [Table 4] TIFF2025160487000020.tif44156 The 5' to 3' oligonucleotide sequence is shown. Lowercase letters = RNA. The target-specific protospacer domain is underlined and its length (in bases) is indicated. The relative functional activity of each species is indicated by % cleavage in the T7EI heteroduplex assay.

[0087] Of the four sites tested, one (site 38087) showed high activity with all four crRNAs and no change when the protospacer domain was shortened. Site 38285 showed similar efficacy with the 20- and 19-nt protospacer crRNAs (SEQ ID NOs: 48 and 1), a slight decrease with the 18-nt version (SEQ ID NO: 54), and a significant decrease with the 17-nt version (SEQ ID NO: 55). Site 38094 showed similar efficacy with the 20- and 19-nt protospacer crRNAs (SEQ ID NOs: 64 and 65), a moderate decrease with the 18-nt version (SEQ ID NO: 66), and no activity with the 17-nt version (SEQ ID NO: 67). Site 38358 showed good activity with the 20-nt version (SEQ ID NO: 60), poor activity with the 19-nt version (SEQ ID NO: 61), even poorer activity with the 18-nt version (SEQ ID NO: 62), and no activity with the 17-nt version (SEQ ID NO: 63).

[0088] The use of a shortened 17-base protospacer guide domain can reduce the occurrence of unwanted off-target events compared to the wild-type 20-base domain (Fu et al., Nature Biotechnol., 32:279, 2014). It has been observed that on-target efficacy varies sequence context-specifically, and that 20-base and 19-base protospacer guide domains are generally effective, but activity begins to decrease when an 18-base protospacer domain is used, and activity is significantly reduced when a 17-base protospacer domain is used. Therefore, to maintain desirable on-target efficiency, the use of 20- and 19-base target-specific protospacer guide domains is used herein. Significant truncation of the protospacer guide domain often reduces on-target cleavage of DNA targets by the Cas9 endonuclease. The use of chemical modifications that strengthen the Tm (increase the binding affinity of the protospacer target-specific domain of the crRNA to the target DNA sequence) may allow the use of shorter sequences, such that a 17-base protospacer guide may exhibit similar on-target efficacy as an unmodified 20-base protospacer guide domain.

[0089] Example 5 This example demonstrates that truncated crRNA:tracrRNA complexes exhibit improved gene editing activity at multiple sites. Previous examples tested the effectiveness of truncated RNAs as triggers for CRISPR gene editing in mammalian cells at a single site within the human HRPT1 gene. Site / sequence-specific effects may exist. This example demonstrates the improved performance of the truncated species of the present invention at 12 sites within the exons of the human HPRT1 gene.

[0090] A series of crRNAs (Table 5) were synthesized with 20-nt protospacer domain lengths specific for 12 sites within the human HPRT1 gene, each with a 16-mer universal tracrRNA binding sequence at its 3' end. The crRNAs were paired with an unmodified 67-mer tracrRNA (SEQ ID NO: 2). The same 12 sites were tested using a WT-length crRNA:tracrRNA complex, in which the crRNA contained a 20-nt protospacer guide with a 22-mer universal tracrRNA binding sequence at its 3' end complexed with a WT 89-mer tracrRNA (SEQ ID NO: 18).

[0091] The paired crRNA:tracrRNA RNA oligonucleotides were transfected into HEK-Cas9 cells and treated as described in Example 2. Relative gene editing activity was assessed by comparing cleavage rates within the HPRT1 gene using a T7EI mismatch endonuclease cleavage assay, along with quantitative measurement of products using a fragment analyzer. The results are shown in Table 5.

[0092] [Table 5] TIFF2025160487000022.tif220170TIFF2025160487000023.tif219170TIFF2025160487000024.tif219152TIFF2025160487000025.tif30170The 5'-3' oligonucleotide sequences are shown. Lowercase letters = RNA. The length of the RNA oligonucleotide is indicated (in bases). The relative functional activity of each crRNA:tracrRNA pair is indicated by % cleavage in the T7EI heteroduplex assay.

[0093] The relative efficiency of CRISPR-mediated gene editing in HEK-Cas9 cells varied depending on the sequence configuration. However, in all cases, the shorter optimized RNA guides (36-mer crRNA and 67-mer tracrRNA) showed higher efficiency than WT RNA (42-mer crRNA and 89-mer tracrRNA). The use of the shortened, optimized guide RNAs of the present invention improves Cas9 cleavage of targeted DNA relative to WT RNA, improving gene editing rates.

[0094] Example 6 Example 1 describes the chemical modification patterns functionalized with Cas9 in an in vitro biochemical targeted DNA cleavage assay. This example demonstrates the function of chemically modified tracrRNA to direct genome editing by SpyCas9 nuclease in mammalian cells. The optimal modification patterns differ between in vitro and in vivo applications.

[0095] A series of tracrRNAs (Table 6) were synthesized with various chemical modifications, including ribose-modified 2'OMe RNA and LNA; terminal modifiers, propanediol spacers and naphthyl-azo modifiers (N,N-diethyl-4-(4-nitronaphthalen-1-ylazo)-phenylamine, or "ZEN"); and selected internucleotide linkages with phosphorothioate modifications. For naphthyl-azo-modified structures and the use of naphthyl-azo and propanediol modifiers as terminal groups to block exonuclease attack, see Lennox et al., Molecular Therapy Nucleic Acids 2:e117 2013. The tracrRNAs listed in Table 6 were conjugated to the unmodified truncated anti-HPRT1 crRNA SEQ ID NO: 1 (Table 1), which contains a 19-base protospacer domain targeting HPRT1 at the 5' end and a 16-base tracrRNA-binding domain at the 3' end. Paired crRNA:tracrRNA RNA oligonucleotides were transfected into HEK-Cas9 cells and treated as described above. Relative gene editing activity was assessed by comparing cleavage rates within the HPRT1 gene using a T7EI mismatch endonuclease cleavage assay, with quantitative measurement of products performed using a fragment analyzer.

[0096] [Table 6] TIFF2025160487000027.tif221155TIFF2025160487000028.tif221156TIFF2025160487000029.tif220155TIFF2025160487000030.tif219155TIFF2025160487000031.tif140156The 5' to 3' positions of the oligonucleotide sequences are shown. Uppercase letters = DNA, lowercase letters = RNA; underlined = 2'-O-methyl RNA; italicized = 2'-fluoro RNA; +a, +c, +t, +g = LNA; C3 = C3 spacer (propanediol modifier); * = phosphorothioate internucleotide linkage; ZEN-naphthyl-azo modifier; Inv-dT = inverted dT. The relative functional activity of each species is indicated by % cleavage in the T7EI heteroduplex assay.

[0097] Modifications are essential for synthetic nucleic acids to function well in intracellular environments due to the presence of exonucleases and endonucleases that typically degrade unmodified oligonucleotides. A wide range of modifications have been described to confer nuclease resistance to oligonucleotides. The precise combination and order of modifications that are successful for a given application may vary depending on the sequence composition and the nature of the protein interactions required for biological function. Extensive prior research has been conducted on the chemical modification of antisense oligonucleotides (which interact with RNase H1) and siRNAs (which interact with DICER, AGO2, and other proteins). Chemical modifications are expected to improve the function of the CRISPR crRNA:tracrRNA complex. However, it is impossible to predict whether the type and / or pattern of modifications will be compatible with the functional complexation of synthetic RNA with Cas9. The present invention defines minimal, moderate, and extensive chemical modification patterns for tracrRNA that retain a high level of function in directing Cas9-mediated gene editing in mammalian cells.

[0098] The results in Table 6 demonstrate that a wide range of modifications are tolerated throughout the 5' and 3' terminal domains of tracrRNA. Modifications of the internal domains of tracrRNA showed reduced activity, likely due to altered structure of the folded RNA and / or blocking of protein contacts with the 2'-OH of key RNA residues by 2'OMe modifications. For example, compound SEQ ID NO: 100 has 39 / 67 residues modified with 2'OMe RNA (58%) and retains full activity compared to the unmodified sequence. SEQ ID NO: 134 has 46 / 67 residues modified with 2'OMe RNA (69%) and retains nearly full activity compared to the unmodified sequence (Figure 6). SEQ ID NO: 134 is a truncated 67-mer variant of tracrRNA. Using SEQ ID NO: 134 as a model, modifications of 11 consecutive residues within the 5' domain with 2'OMe RNA were tolerated without loss of activity. Modification of 35 consecutive residues within the 3' domain with 2'OMe RNA was tolerated without loss of activity. Although the two hairpin structures present in the 3' domain are essential for function, as loss of either of these features results in loss of activity (Example 2, Figure 3), it is worth noting that both of these domains can be fully modified by 2'OMe RNA without compromising function. Note that both SEQ ID NOs: 134 and 100 also have phosphorothioate (PS)-modified internucleotide linkages at the 5' and 3' ends, which provides additional protection against exonuclease attack.

[0099] Specific residues were identified that, when modified, led to a significant reduction or complete loss of activity. Using the 67-nt tracrRNA (e.g., SEQ ID NO: 134) as a reference, starting from the 5' end of the 2'OMe RNA sequence substitutions of the native RNA at residues U12, A15, G26, U27, G30, U31, and U32 led to a substantial loss of activity (Figure 6). Specific residues were also identified that, when modified, led to a smaller but significant reduction in activity. Using the 67-nt tracrRNA (e.g., SEQ ID NO: 134) as a reference, starting from the 5' end of the 2'OMe RNA sequence substitutions of the native RNA at residues U13, U18, C23, U24, and C28 led to a reduction in activity (Figure 6). This testing was performed using the 2'OMe RNA. The use of other modifications, such as 2'F, LNA, or DNA, at these positions may be better tolerated. The central 21-residue domain of the unmodified RNA in SEQ ID NO: 134 was modified completely (SEQ ID NO: 141) or partially (SEQ ID NOs: 142 and 143) with 2'-F RNA. These variants were not functional. The central 21-residue domain of the unmodified RNA in SEQ ID NO: 134 was modified completely (SEQ ID NO: 138) or partially (SEQ ID NOs: 139 and 140) with DNA. These variants were not functional. While modifications of isolated residues within this domain can be functional, large contiguous blocks of modifications within this domain reduce the activity of tracrRNA.

[0100] To further explore which individual residues could be modified, a single-base modified 2'OMe RNA "walk" was performed using 2'OMe RNA within the central domain of tracrRNA (SEQ ID NOs: 144-162). Within this series, modifications to residues A14, A19, A20, G21, G22, A25, and C29 did not show loss of activity and are candidates for modification.

[0101] Antisense oligonucleotides are often made with complete PS modification, with all nucleotide linkages being phosphorothioate-modified. This extensive level of modification is possible because the protein effector molecule RNase H1 (which mediates ASO-directed mRNA degradation) tolerates PS modification within ASOs when forming a functional substrate / enzyme complex. On the other hand, siRNAs do not tolerate complete PS modification, and extensive PS modification prevents productive interaction with the effector protein AGO2 (which mediates siRNA-directed mRNA degradation). Extensive PS modification of tracrRNA within the internal RNA loop prevents functional interaction with Cas9 (SEQ ID NO: 133, 29 PS modifications). Limited PS end modifications can be made without loss of activity (SEQ ID NOs: 98 and 101, 2-3 PP bonds at each end). Less extensive PS modification can be tolerated within the central domain. In particular, RNase cleavage mapping (using incubation of tracrRNA in a series of serum or cell extract dilutions to find the sites most susceptible to RNase attack) can be used to identify key sites where PS modification of only one or a few linkages may stabilize the RNA without interfering with function.

[0102] There are applications in which PS modifications contribute to chemical toxicity. In these cases, the use of other methods to block exonuclease attack is desirable. Options include terminal modifiers such as inverted dT, or abasic groups such as d-spacers, C3 spacers (propanediol), and ZEN (naphthyl-azo modifiers). The placement of such terminal modifiers may eliminate the need for terminal PS internucleotide linkages.

[0103] Example 7 Example 1 describes the chemical modification patterns functionalized with Cas9 in an in vitro biochemical target DNA cleavage assay. This example demonstrates the function of chemically modified crRNAs to direct genome editing by Spy Cas9 nuclease in mammalian cells. The optimal modification patterns differ between in vitro and in vivo applications.

[0104] We synthesized a series of crRNAs (Table 7) with various chemical modifications, including ribose-modified 2'OMe RNA, 2'F, and LNA; terminal modifiers propanediol spacers and naphthyl-azo modifiers (N,N-diethyl-4-(4-nitronaphthalen-1-ylazo)-phenylamine, or "ZEN"), and inverted dT residues; and selected internucleotide linkages with phosphorothioate modifications. For naphthyl-azo-modified structures and the use of naphthyl-azo and propanediol modifiers as terminal groups to block exonuclease attack, see Lennox et al., Molecular Therapy Nucleic Acids 2:e117 2013. The crRNAs contained either a 19-nt protospacer domain targeting HPRT1 at the 5' end (SEQ ID NOS: 1, 9, 10, 14-16, 22-24, 163-173) or a 20-nt protospacer domain targeting the same site with a 16-nt tracrRNA-binding domain at the 3' end (SEQ ID NOS: 48, 174-237). The crRNAs listed in Table 7 were complexed with either the unmodified truncated (67-nt) tracrRNA SEQ ID NOS: 2 (Table 1) or the chemically modified truncated (67-nt) tracrRNA SEQ ID NOS: 100 (Table 6). The use of two tracrRNAs allows for the determination of whether the chemically modified crRNA functions differently when paired with the modified tracrRNA. The paired crRNA:tracrRNA RNA oligonucleotides were transfected into HEK-Cas9 cells and treated as described above. Relative gene editing activity was assessed by comparing cleavage rates within the HPRT1 gene using a T7EI mismatch endonuclease cleavage assay, along with quantitative measurement of products using a fragment analyzer.

[0105] [Table 7] TIFF2025160487000033.tif213155TIFF2025160487000034.tif214155TIFF2025160487000035.tif214155TIFF2025160487000036.tif213155TIFF2025160487000037.tif211155TIFF2025160487000038.tif211155TIFF2025160487000039.tif213155TIFF2025160487000040.tif187156The 5' to 3' sequence of the oligonucleotide is shown. Uppercase = DNA, lowercase = RNA; underline = 2'-O-methyl RNA; italic = 2'-fluoro RNA; +a, +c, +t, +g = LNA; C3 = C3 spacer (propanediol modifier); * = phosphorothioate internucleotide linkage; ZEN-naphthyl-azo modifier; InvT = inverted dT. The relative functional activity of each species is indicated by % cleavage in a T7EI heteroduplex assay when the indicated crRNA is paired with the indicated tracrRNA. ND = not determined.

[0106] Some types of chemical modifications are essential for synthetic nucleic acids to function well in intracellular environments due to the presence of exonucleases and endonucleases that typically degrade unmodified oligonucleotides. A wide range of modifications have been described to confer nuclease resistance to oligonucleotides. The exact combination and order of modifications successful for a given application may vary depending on the sequence composition and the nature of protein interactions required for biological function. Extensive prior research has been conducted on the chemical modification of antisense oligonucleotides (which interact with RNase H1) and siRNAs (which interact with DICER, AGO2, and other proteins). Chemical modifications are expected to improve the function of the CRISPR crRNA:tracrRNA complex. However, it is impossible to predict whether the type and / or pattern of modifications will be compatible with the RNA's functional association with Cas9. The present invention defines minimal, moderate, and extensive chemical modification patterns of crRNA that retain a high level of function for directing Cas9-mediated gene editing in mammalian cells. The study in Example 7 was conducted targeting a single site within the human HPRT1 gene. Note that the modification pattern of the 20-nt 5'-terminal protospacer guide domain of a well-functioning crRNA may vary depending on the sequence context. However, the modification pattern of a well-functioning 3'-terminal tracrRNA-binding domain, as defined herein, is affected by changes in the sequence of the adjacent protospacer domain when different sites are targeted, so the 3'-domain modifications shown here are potentially "universal."

[0107] The results in Table 7 demonstrate that a wide range of modifications is tolerated throughout the 5' and 3' ends of the crRNA. Modification of certain select positions within the internal domain of the crRNA leads to reduced or complete blockage of activity, likely due to altered structure of the folded RNA and / or blocking of protein contacts with the 2'-OH of key RNA residues by 2'OMe modifications. For example, compound SEQ ID NO:204 has 21 / 36 residues modified with 2'OMe RNA (58%) and retains full activity compared to the unmodified sequence. Compound SEQ ID NO:239 has 30 / 36 residues modified with 2'OMe RNA (83%) and retains full activity compared to the unmodified sequence. Both of these compounds also have three phosphorothioate (PS)-modified internucleotide linkages at the 5' and 3' ends, which provides additional protection against exonuclease attack. In contrast, SEQ ID NO:165 has only 4 / 36 residues (11%) modified with 2'OMe RNA but has a complete loss of activity.

[0108] While large blocks of sequence tolerated 2'OMe modifications at the 5' and 3' ends of the crRNA, modification of certain residues in the central portion of the molecule led to inactivation. To further explore which individual residues could be modified using 2'OMe RNA within the central domain of the crRNA, a single-base-modified 2'OMe RNA "walk" was performed (SEQ ID NOs: 272-286). Specific residues (positions within the crRNA) that led to a significant reduction or complete loss of activity were identified. Using the 36-base crRNA SEQ ID NO: 239 as a model, numbering from the 5' end of the sequence, substitution of 2'OMe RNA for the native RNA at residues U15 and U16 led to a substantial loss of activity, while residue U19 led to a moderate loss of activity (Figure 7). Because these three sites are within the target-specific protospacer guide domain, their sequences vary depending on the target (residues 15, 16, and 19, Figure 7). In certain sequence configurations, these sites can be tolerant to modification. Within the universal tracrRNA-binding domain (residues 21-36), substitution of 2'OMe RNA for native RNA at residues U22, U23, and U24 led to a substantial loss of activity. Given that this domain is invariant in sequence composition, these sites may not differ in modification tolerance as the target sequence varies. The sequence-specific effects of modifications within the 20-base target-specific protospacer guide domain are examined in more detail in Example 10.

[0109] Antisense oligonucleotides are often made with complete PS modification, with all nucleotide linkages being phosphorothioate modified. This extensive level of modification is possible because the protein effector molecule RNase H1 tolerates PS modification within ASOs when forming a functional substrate / enzyme complex. On the other hand, siRNAs do not tolerate complete PS modification, and extensive PS modification prevents productive interaction with the effector protein AGO2. Limited PS terminal modification of crRNAs can be made without loss of activity (e.g., SEQ ID NOS: 177, 178, 239, etc., have three PS bonds at each end). Terminal modification is desirable because it adds additional protection from exonuclease attack. PS modification at selected internal sites may also be tolerated and may provide additional protection from endonuclease attack. Using SEQ ID NO:264 as the base modification pattern, internal linkages were PS-modified within the tracrRNA-binding domain (SEQ ID NO:265), within the 3' end of the protospacer-guide domain (seed region) (SEQ ID NO:266), or in both regions (SEQ ID NO:267). Increased levels of PS modification lead to reduced functional activity, with SEQ ID NO:267 possessing approximately 50% of the activity of the less modified SEQ ID NO:264 variant. SEQ ID NO:267 has 21 of the 35 internucleotide linkages modified, making it stable against nuclease exposure. When exposure to a high nuclease environment is required (such as direct IV administration for research or therapeutic applications), this highly modified variant actually exhibits higher activity and is degraded more rapidly than the less modified variant.

[0110] There are experimental settings in which PS modifications contribute to chemical toxicity. In these cases, the use of other methods to block exonuclease attack is desirable. The crRNA has a C3 spacer (propanediol modifier) ​​or ZEN (naphthyl-azo modifier) ​​placed at either or both of the 5' and 3' ends to block exonuclease attack, eliminating the need for PS modification. This strategy can be used to eliminate PS end-blocking modifications (see SEQ ID NOS: 179-186). This strategy can be used to reduce the PS content of more highly modified crRNA variants. SEQ ID NOS: 271 has an internal protospacer domain and tracrRNA-binding domain with PS modifications in the same pattern as SEQ ID NOS: 267, but uses only 15 PS internucleotide linkages (instead of 21), demonstrating improved activity. Therefore, a combination of abasic end-blocks with internal PS modifications can be used to increase nuclease activity while maintaining high activity.

[0111] Example 8 The following examples demonstrate the improved potency of the modified CRISPR crRNA and tracrRNA of the present invention. Examples 2-7 used the transfection of human HEK-Cas9 cells with the crRNA:tracrRNA complex at a concentration of 30 nM. Experimental studies have previously shown that this dose represents the upper shoulder of the dose-response curve, whereby using higher doses of RNA did not improve gene editing efficiency, while using lower doses resulted in lower gene editing efficiency. These measurements were performed using unmodified RNA. This example reexamines the dose-response of the new, optimized chemically modified RNA of the present invention compared to unmodified RNA and demonstrates that the chemical modification (i.e., nuclease stabilization) results in more potent compounds that can be used at lower doses.

[0112] Example 5 demonstrated that the truncated guide RNAs of the present invention performed better than WT RNA at 12 sites within the human HPRT1 gene. Four of these sites (38087, 38231, 38133, and 38285) were selected for comparison between unmodified and modified RNAs in this example. Unmodified crRNA was paired with unmodified tracrRNA (SEQ ID NO: 2) at a 1:1 molar ratio. Unmodified crRNA was paired with modified tracrRNA (SEQ ID NO: 100) at a 1:1 molar ratio. Modified crRNA was paired with modified tracrRNA (SEQ ID NO: 100) at a 1:1 molar ratio. The sequences are shown in Table 8. RNAs were transfected into HEK-Cas9 cells at 30 nM, 10 nM, and 3 nM concentrations as described above. Cells were incubated at 37°C for 48 hours, then DNA was processed and tested for evidence of gene editing activity by comparing the rate of cleavage at the HPRT1 locus with T7EI mismatch endonuclease activity, and quantitative measurement of the product was performed using a fragment analyzer as described above. The results are shown in Table 8.

[0113] [Table 8] TIFF2025160487000042.tif172156 shows the 5'-3' oligonucleotide sequence. Lowercase letters = RNA, underline = 2'-O-methyl RNA, * = phosphorothioate internucleotide linkage. Unmodified crRNA = Un-cr. Unmodified tracrRNA = Un-tr. Modified crRNA = Mod-cr. Modified tracrRNA = Mod-tr. The relative functional activity of each species is indicated by % cleavage in the T7EI heteroduplex assay for each dose tested.

[0114] In general, crRNA and tracrRNA modifications had little effect on gene editing efficiency when RNA was transfected at high doses in excess RNA. At lower doses, modified reagents showed improved potency, in some cases significantly. The degree of improvement varied by site. The highly competent site 38087 showed highly efficient gene editing at 30 nM and 10 nM doses with all crRNA / tracrRNA variants tested, and the use of 3 nM modified tracrRNA (along with either crRNA) showed improved activity. Low-potency sites, such as 38231, showed improved gene editing efficiency even at the highest dose tested (30 nM) using modified RNA. Modification of tracrRNA alone showed gains alone, but the greatest gains were observed when both crRNA and tracrRNA were modified. Figure 8 shows a schematic of one effective modified crRNA (SEQ ID NO: 178) paired with a modified tracrRNA (SEQ ID NO: 100) specific for HPRT1 site 38285. Figure 9 also shows a schematic of a more highly modified pair, a highly functional crRNA (SEQ ID NO: 239) paired with a modified tracrRNA (SEQ ID NO: 134) specific for HPRT1 site 38285.

[0115] This example demonstrates the transfection of crRNA:tracrRNA complexes into HEK-Cas9 cells, which constitutively express the Cas9 protein. Therefore, the transfected RNA can immediately bind to the Cas9 protein, minimizing the risk of cytoplasmic degradation by nucleases. The benefits of chemically modifying the crRNA and / or tracrRNA are expected to be greater when the transfected RNA must survive exposure to cellular nucleases while the Cas9 protein is being produced. This is expected to occur when using protocols in which Cas9 mRNA or a Cas9 expression vector is co-transfected with the target RNA, thereby preventing Cas9 from being expressed in the cell. The benefits of using highly modified RNA would be greatest for in vivo applications (e.g., medical treatments) when the RNA may be exposed to both nucleases present in serum (after IV administration) and cellular cytoplasmic nucleases.

[0116] Example 9 Examples 2-8 demonstrate the activity of truncated and / or chemically modified CRISPR crRNA and / or tracrRNA to induce Cas9-mediated genome editing in mammalian cells that constitutively express Cas9. The examples demonstrate that truncated modified RNA compositions of the invention can bind to Cas9 protein, that this complex can be transfected into human cells, and that transfection of the ribonucleoprotein (RNA) complex is sufficient to induce highly efficient genome editing.

[0117] Reagents specific for human HPRT1 site 38285 were used in this example. Unmodified crRNA was paired with unmodified tracrRNA at a 1:1 molar ratio. Modified crRNA was paired with modified tracrRNA at a 1:1 molar ratio. Modified crRNA was paired with modified tracrRNA at a 1:1 molar ratio. Sequences are shown in Table 9. RNA was transfected into unmodified HEK293 cells as described above, except that Cas9 protein (Caribou Biosciences) was used at a 10 nM concentration in a 1:1 complex with crRNA:tracrRNA using increasing amounts of RNAiMAX lipid transfection reagent (1.2 μL, for 30 nM RNA-only transfection in HEK-Cas9 cells, increasing over the 0.75 μL volume used per 100 μL transfection in a 96-well format). Cells were incubated at 37°C for 48 hours, then DNA was processed and tested for evidence of gene editing activity by comparing the rate of cleavage at the HPRT1 locus with T7EI mismatch endonuclease activity, and quantitative measurement of the product was performed using a fragment analyzer as described above. The results are shown in Table 9.

[0118] [Table 9] The 5' to 3' positions of the oligonucleotide sequences are shown. Lowercase letters = RNA, underline = 2'-O-methyl RNA, * = phosphorothioate internucleotide linkage. Unmodified crRNA = Un-cr. Unmodified tracrRNA = Un-tr. Modified crRNA = Mod-cr. Modified tracrRNA = Mod-tr. The relative functional activity of each complex is indicated by % cleavage in the T7EI heteroduplex assay for each dose tested.

[0119] All three CRISPR RNA complexes performed well in the RNP transfection protocol for mammalian genome editing. The unmodified crRNA + unmodified tracrRNA pair (SEQ ID NOs: 48 and 2) and the unmodified crRNA + modified tracrRNA pair (SEQ ID NOs: 48 and 100) performed 2.5-fold better at 10 nM doses in the RNP protocol than in the HEK-Cas9 protocol, consistent with less modified RNA degradation during transfection and subsequent complexation with the Cas9 protein in the cytoplasm or nucleus. Thus, a higher dose is required for unmodified RNA, and in some settings, unmodified RNA may not be able to direct any genome editing activity. On the other hand, modified crRNA + modified tracrRNA (SEQ ID NOs: 178 and 100) functioned with high efficiency in both protocols.

[0120] The modified truncated CRISPR RNAs of the present invention work well with direct Cas9 RNP transfection methods.

[0121] Example 10 The chemical modification optimization studies performed in Examples 6 and 7 tested the activity of crRNAs with various modification patterns paired with tracrRNAs with various modification patterns. The tracrRNA is universal, using the same sequence at all target sites. The performance of various tracrRNA modification patterns is expected to be similar across different target sites. However, the crRNAs differ in sequence across different target sites. In the optimized versions tested in Examples 7 and 8, the 5′-20 bases of the crRNA are target-specific (i.e., the "protospacer domain"), and the 3′-16 bases are universal (i.e., the "tracrRNA-binding domain"). Like tracrRNA, the performance of various modification patterns within the universal 16-base 3′ domain of the crRNA is expected to be similar across all target sites. However, the performance of different modification patterns may be affected by the sequence structure present within the 5′-20 base target-specific domain.

[0122] It is well established that effective modification patterns for small interfering RNAs (siRNAs) are influenced by the sequence environment (Behlke, Oligonucleotides 18:305-320, 2008). In the case of siRNAs, a particular "limited modification" pattern can be applied to all sites, but in the case of "heavy modifications," it is impossible to predict which patterns will be functional for a given sequence, and empirical testing is essential. This example examines the effect of sequence context on crRNAs, testing different modification patterns at different sites within the 5'-20 base target-specific domain.

[0123] The modification studies in Examples 6 and 7 used a single crRNA PAM in the human HPRT1 gene. This study compares the functional performance of different modification patterns, examines 12 sites within the human HPRT1 gene, including previously examined sites, and establishes a single modification pattern that can be used with good results at all sites. See Example 5 for other studies on these 12 sites.

[0124] A series of crRNAs (Table 10) were synthesized, each with a 20-base protospacer domain specific for 12 sites within the human HPRT1 gene, containing a 16-mer universal tracrRNA binding sequence at the 3' end. The crRNAs were generated using a variety of chemical modifications, including ribose-modified 2'OMe RNA, terminal propanediol spacers, and naphthyl-azo modifiers (N,N-diethyl-4-(4-nitronaphthalen-1-ylazo)-phenylamine, or "ZEN"), inverted dT residues, and selected internucleotide linkages with phosphorothioate modifications. A schematic representation of the different modifications used is shown in Figure 10.

[0125] The crRNA was paired with a highly modified 67-mer tracrRNA (SEQ ID NO: 100). The paired crRNA:tracrRNA RNA oligonucleotides were transfected into HEK-Cas9 cells and treated as described in Example 2. Relative gene editing activity was assessed by comparing cleavage rates within the HPRT1 gene using a T7EI mismatch endonuclease cleavage assay, with quantitative measurement of the product performed using a fragment analyzer. The results are shown in Table 10 and Figure 11.

[0126] [Table 10] TIFF2025160487000045.tif211155TIFF2025160487000046.tif211155TIFF20251604 87000047.tif211155TIFF2025160487000048.tif210155TIFF2025160487000049.tif2 13155TIFF2025160487000050.tif213155TIFF2025160487000051.tif209155TIFF2025160487000052.tif212155TIFF2025160487000053.tif138156 The 5' to 3' oligonucleotide sequences are shown. Lowercase letters = RNA, underline = 2'-O-methyl RNA, C3 = C3 spacer (propanediol modifier), * = phosphorothioate internucleotide linkage, ZEN = naphthyl-azo modifier. The relative functional activity of each species is indicated by the % cleavage in a T7EI heteroduplex assay when the indicated crRNA is paired with the indicated tracrRNA at each of the 12 sites within human HRPT1.

[0127] The modified crRNA was universal and used a fixed modification pattern within the 16-nt 3'-terminal domain that binds to tracrRNA. Different modification patterns were tested and compared within the 5'-terminal domain, which is target-specific (i.e., the sequence varies depending on the target site). The test configuration included variants with 0, 3, 4, 6, 8, 10, 12, 13, or 14 consecutive 2'OMe RNA residues starting at the 5' end and proceeding toward the 3' end. These modification patterns avoided positions previously demonstrated to reduce the functional performance of crRNA (Example 7). The use of a non-basic modifier terminal group (C3 spacer, or ZEN) was also tested (without additional modifications). In this study, when functional activity was compared across all 12 sites, all tested sites showed full activity when 0 to 10 RNA residues at the 5' end were replaced with 2'OMe RNA residues. Only 1 / 12 sites showed a slight reduction in activity with 12 residues modified, 3 / 12 sites showed reduced activity when 13 residues were modified, and 4 / 12 sites showed reduced activity when 14 residues were modified. The terminal modifiers (C3, ZEN) showed full activity at all sites.

[0128] The highest level of crRNA modification that showed full activity at all sites tested involved modification patterns 6 and 7 (Figure 10), which represent 61% and 67% of the bases in the crRNA modified with 2'OMe RNA, respectively.

[0129] [ka]

[0130] The data in this example also demonstrate that individual sites can be modified to the highest level and retain potency. For example, 8 of the 12 sites tested showed full activity using modification pattern 8, which had 72% of the residues modified. Furthermore, Example 7 shows that HPRT1 crRNA target site 38285 (SEQ ID NO: 239) has full activity and has 30 / 36 residues modified (83%, leaving only 6 unmodified RNA residues). Base modification patterns such as modification pattern 6 or modification pattern 7 can be used as a starting point for testing to empirically determine the degree to which a particular sequence can be modified before activity is lost. Figure 12 shows a schematic of modification pattern 6 crRNA paired with the highly modified tracrRNA SEQ ID NO: 134.

[0131] Example 11 The examples herein use the Cas9 endonuclease from Streptococcus pyogenes. The native amino acid sequence of S.py.Cas9 (SpyCas9) is shown below (SEQ ID NO: 407).

[0132] The native Cas9 DNA sequence was codon-optimized for expression in E. coli, with elements added for mammalian nuclear localization (nuclease localization signal) and to aid in protein purification (His tag). The final amino acid sequence of the recombinant protein is shown (SEQ ID NO: 408). The DNA sequence used to express the recombinant protein in E. coli is shown (SEQ ID NO: 409).

[0133] The native Cas9 DNA sequence was codon-optimized for expression in human cells, and elements were added for additional antibody recognition (V5 epitope) and mammalian nuclear localization (nuclease localization signal, NLS). The final amino acid sequence (SEQ ID NO:410) is shown, followed by the DNA sequence (SEQ ID NO:411).

[0134] The native S.py Cas9 DNA sequence was codon-optimized for expression in human cells and assembled as a T7 RNA polymerase expression cassette (SEQ ID NO: 412). This sequence contains a T7 RNA polymerase promoter, a V5 epitope tag, a nuclear localization signal, a codon-optimized Cas9 sequence, a second nuclear localization signal, and a BGH (bovine growth hormone) gene 3' UTR element with a polyadenylation signal. The sequence of the mRNA produced from this expression cassette is shown (SEQ ID NO: 413).

[0135] S.py.Cas9 amino acid sequence (SEQ ID NO: 407).

[0136] [ka] S.py Cas9 amino acid sequence (SEQ ID NO: 408) expressed from DNA codon-optimized for expression in E. coli, including 3 NLS sequences and a purified His tag.

[0137] [ka] Codon-optimized S.py Cas9 DNA sequence for expression in E. coli (SEQ ID NO: 409) including 3 NLS sequences and a purification His tag.

[0138] [ka] TIFF2025160487000058.tif156156 S.py Cas9 amino acid sequence (SEQ ID NO: 410) expressed from DNA codon-optimized for expression in human cells, including a V5 epitope tag and two NLS sequences.

[0139] [ka] TIFF2025160487000060.tif61156 Codon-optimized S.py Cas9 DNA sequence for expression in human cells containing a V5 epitope tag and 2 NLS sequences (SEQ ID NO: 411).

[0140] [ka] TIFF2025160487000062.tif136151 S.py Cas9 DNA sequence (SEQ ID NO:412) that has been codon-optimized for expression in human cells as a T7 RNA polymerase expression cassette. This sequence contains a T7 RNA polymerase promoter, a V5 epitope tag, a nuclear localization signal, a codon-optimized Cas9 sequence, a second nuclear localization signal, and a BGH (bovine growth hormone) gene 3' UTR element with a polyadenylation signal.

[0141] [ka] TIFF2025160487000064.tif229170TIFF2025160487000065.tif11170 S.py Cas9 mRNA (SEQ ID NO:413) generated from the expression cassette (SEQ ID NO:412). This sequence contains a V5 epitope tag, a nuclear localization signal, a codon-optimized Cas9 sequence, a second nuclear localization signal, and a BGH (bovine growth hormone) gene 3' UTR element and poly-A tail.

[0142] [ka] TIFF2025160487000067.tif110170

[0143] Example 12 The following examples demonstrate reduced stimulation of the innate immune system in mammalian cells by the truncated, chemically modified crRNA:tracrRNA complexes of the invention when compared to unmodified IVT sgRNA.

[0144] Mammalian cells possess a variety of receptors designed to identify and respond to foreign RNA as part of antiviral immunity. These include receptors such as TLR-3, TLR-7, TLR8, RIG-I, MDA5, OAS, and PKR. Broadly speaking, RNAs that are short or contain chemical modifications present in mammalian cells (e.g., 2'OMe RNA) either avoid detection or are less stimulatory than long, unmodified RNAs. This example compares the level of stimulation of two immune response-related genes (IFIT1 and IFITM1) when mammalian HEK293 cells are transfected with a cleaved, unmodified, or cleaved, modified crRNA:tracrRNA complex of the present invention using a commercial IVT sgRNA (Thermo Fisher Scientific, Waltham, MA).

[0145] A CRISPR guide RNA specific for human HPRT1 site 38285 was used. The sequences are shown in Table 11 below. The unmodified crRNA:tracrRNA complex (SEQ ID NOs: 48 and 2), the modified crRNA:tracrRNA complex (SEQ ID NOs: 178 and 100), and the sgRNA (SEQ ID NO: 414) were transfected into HEK-Cas9 cells at 30 nM concentrations, as outlined in Example 2 above. RNA was prepared 24 hours post-transfection using an SV96 total RNA isolation kit (Promega, Madison, WI). cDNA was synthesized using 150 ng of total RNA with SuperScript™-II reverse transcriptase (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions, using both random hexamer and oligo-dT priming. All transfection experiments were performed a minimum of three times.

[0146] Quantitative real-time PCR was performed using Immolase™ DNA polymerase (Bioline, Randolph, MA), 200 nM primers, and 200 nM probe, with 10 ng of cDNA per 10 μL reaction. The cycling conditions used were: 95°C for 10 minutes, followed by 40 cycles of two-step PCR at 95°C for 15 seconds and 60°C for 1 minute. PCR and fluorescence measurements were performed using an ABI Prism™ 7900 Sequence Detector (Applied Biosystems Inc., Foster City, CA). All reactions were performed in triplicate using two-color multiplexing. Expression data were normalized to the average of two endogenous control genes. Copy number standards were linearized, and amplification products were cloned for all assays. Unknowns were estimated by extrapolation relative to the standards to establish absolute quantitative measurements. Housekeeping endogenous control normalization assays were HPRT1 (primers and probes SEQ ID NOS: 415-417) and SFRS9 (primers and probes SEQ ID NOS: 418-420). Immune activation pathway assays were IFITM1 (primers and probes SEQ ID NOS: 421-423), IFIT1 (primers and probes SEQ ID NOS: 424-426). These results were normalized using untransfected cells as the baseline and are shown in Figure 13.

[0147] [Table 11] TIFF2025160487000069.tif56170 1 Compound I is an oligonucleotide having the formula SEQ ID NO:417-(ZEN)-SEQ ID NO:441. 2 Compound II is an oligonucleotide having the formula SEQ ID NO:420-(ZEN)-SEQ ID NO:442. 3 Compound III is an oligonucleotide having the formula SEQ ID NO:423-(ZEN)-SEQ ID NO:443. 4 Compound IV is an oligonucleotide having the formula SEQ ID NO:426-(ZEN)-SEQ ID NO:444. The 5' to 3' positions of the oligonucleotide sequences are shown. Uppercase letters = DNA; lowercase letters = RNA; underline = 2'-O-methyl RNA; * = phosphorothioate internucleotide linkage; ppp = triphosphate; ZEN = naphthyl-azo modifier, dark quencher; FAM = 6-carboxyfluorescein; HEX = hexachlorofluorescein.

[0148] Treatment with unmodified or chemically modified truncated crRNA:tracrRNA complexes did not result in a detectable increase in IFIT1 or IFITM1 expression above baseline. In contrast, treatment with the longer IVT sgRNAs resulted in a 45-fold induction of IFITM1 and a 220-fold induction of IFIT1. Thus, using sgRNAs, a significant stimulation of the innate immune system occurred that was absent when using the short crRNA:tracrRNA complexes of the present invention.

[0149] Example 13 The following examples combine the modification patterns identified in Examples 6 and 7 as particularly useful to demonstrate new, highly modified crRNA and tracrRNA compositions that perform with high efficiency in mammalian CRISPR genome editing applications.

[0150] A series of crRNAs and tracrRNAs (Table 12) were synthesized with chemical modifications as indicated. The crRNAs utilized a 20-base protospacer domain at the 5' end targeting the same site in the human HPRT1 gene (38285) with a 16-base tracrRNA-binding domain at the 3' end. TracrRNAs with chemical modifications were synthesized using 67- or 62-nucleotide truncated versions of the tracrRNA sequence as indicated. The crRNAs and tracrRNAs listed in Table 12 were paired as indicated, transfected into HEK-Cas9 cells at a concentration of 30 nM, and treated as described in the previous examples. Relative gene editing activity was assessed by comparing cleavage rates within the HPRT1 gene using a T7EI mismatch endonuclease cleavage assay, along with quantitative measurement of products using a fragment analyzer.

[0151] [Table 12]

[0152] The 5' to 3' positions of the oligonucleotide sequences are shown. Lowercase letters = RNA, underlined = 2'-O-methyl RNA, lowercase italic = 2'F RNA; * = phosphorothioate internucleotide linkage. The relative functional activity of each complex is indicated by % cleavage in the T7EI heteroduplex assay for each dose tested.

[0153] crRNA:tracrRNA pairs #1 and #2 show that a highly 2'F RNA-modified crRNA (SEQ ID NO:448, 22 / 36 residues modified, or 61%) is highly functional when paired with either an unmodified tracrRNA (SEQ ID NO:2) or a highly 2'OMe-modified tracrRNA (SEQ ID NO:100). crRNA:tracrRNA pairs #3 and #4 show that moderate levels (SEQ ID NO:450, 19 / 67 residues modified, or 28%) or high levels (SEQ ID NO:449, 46 / 67 residues modified, or 69%) of 2'F RNA modification are highly functional. Information obtained from Example 6 (particularly the 2'OMe "walk," SEQ ID NOs:144-162) was used to identify specific residues that can be modified within the internal domain of the tracrRNA (see Figure 6). crRNA:tracrRNA pair #5 demonstrates that a highly modified tracrRNA, in this case a truncated 62-nucleotide design (SEQ ID NO: 451, 51 / 62 residues modified with 2'OMe RNA, or 82%), is highly potent at inducing CRISPR genome editing in mammalian cells. Thus, the original 89 RNA nucleotide wild-type tracrRNA was optimized herein to a form in which only 11 RNA residues remain (11 / 62), thereby significantly reducing the risk of RNA-mediated activation of the mammalian innate immune system and reducing the nuclease-sensitive RNA content of the tracrRNA to a minimal level.

[0154] All references cited herein, including publications, patent applications, and patents, are herein incorporated by reference to the same extent as if each reference was individually and specifically indicated to be incorporated by reference and was set forth in its entirety herein.

[0155] The use of the terms "a," "an," and "the," and similar referents in the context of describing the present invention (particularly in the context of the claims below) are to be construed as including both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms "comprising," "having," "including," and "containing" are to be construed as open ended terms (i.e., meaning "including, but not limited to"), unless otherwise stated. The recitation of ranges of values ​​herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated herein as if it were individually recited herein. All methods described herein can be performed in any suitable order, unless otherwise indicated herein or clearly contradicted by context. The use of any and all examples or exemplary language (e.g., "etc.") provided herein is intended merely to better elucidate the invention and does not pose a limitation on the scope of the invention unless otherwise required. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

[0156] Preferred embodiments of the present invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of such preferred embodiments may become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect those skilled in the art to employ such variations as they see fit, and the inventors intend for the invention to be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited within the scope of the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the present invention unless otherwise indicated herein or otherwise clearly contradicted by context.

Claims

1. An isolated tracrRNA comprising a length-modified form of SEQ ID NO: 18, wherein the isolated tracrRNA exhibits activity in the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) (CRISPR-Cas) endonuclease system.

2. The isolated tracrRNA of claim 1, wherein the length-modified form of SEQ ID NO: 18 consists of the shortened form of SEQ ID NO:

18.

3. The truncated form of SEQ ID NO: 18 is SEQ ID NO: 18, lacking 1 to 20 nucleotides at the 5' end; SEQ ID NO: 18 lacking 1 to 10 nucleotides at the 3' end, and SEQ ID NO: 18 lacking 1 to 20 nucleotides at the 5' end and 1 to 10 nucleotides at the 3' end 3. The isolated tracrRNA of claim 2, comprising a member selected from the group consisting of:

4. 3. The isolated tracrRNA of claim 2, wherein the truncated form of SEQ ID NO: 18 consists of a member selected from the group consisting of SEQ ID NOs: 2, 30-33, and 36-39.

5. The isolated tracrRNA of claim 2, wherein the truncated form of SEQ ID NO: 18 consists of SEQ ID NO: 2 or 38.

6. The isolated tracrRNA of claim 1, further comprising at least one chemically modified nucleotide.

7. An isolated crRNA having a length-modified form of formula (I), [Equation 1] wherein X represents a sequence comprising a target-specific protospacer domain comprising about 20 universal nucleotides; Z represents a sequence comprising a tracrRNA binding domain comprising about 20 nucleotides; An isolated crRNA, wherein the isolated crRNA exhibits activity in a clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) (CRISPR-Cas) endonuclease system.

8. 8. The isolated crRNA of claim 7, wherein the length-modified form of formula (I) consists of the shortened form of formula (I).

9. wherein said shortened form of formula (I) is Formula (I) lacking 1 to 8 nucleotides at the 3' end of the Z domain; and Formula (I) lacking nucleotides at the 5' end of the X domain to correspond to a target-specific protospacer domain having 17, 18, 19, or 20 nucleotides 9. The isolated crRNA of claim 8, consisting of a member selected from the group consisting of:

10. The isolated crRNA of claim 7, further comprising at least one chemically modified nucleotide.

11. 11. The isolated crRNA of claim 10, wherein the length-modified form of formula (I) consists of SEQ ID NOs: 429-439.

12. An isolated tracrRNA comprising a chemically modified form of one of SEQ ID NOs: 2, 18, 30-33, and 36-39, wherein the isolated tracrRNA exhibits activity in a clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) (CRISPR-Cas) endonuclease system.

13. 13. The isolated tracrRNA of claim 12, wherein the chemically modified form of one of SEQ ID NOs: 2, 18, 30-33, and 36-39 comprises chemically modified nucleotides having a modification selected from the group consisting of a ribose modification, a terminal modification group, and a modified internucleotide linkage.

14. 14. The isolated tracrRNA of claim 13, wherein the chemically modified nucleotide having a modification comprises a ribose modification selected from the group consisting of 2'OMe, 2'F, bicyclic nucleic acid, and locked nucleic acid (LNA).

15. 14. The isolated tracrRNA of claim 13, wherein the chemically modified nucleotide having a modification comprises a terminal modification group selected from the group consisting of a propanediol (C3) spacer, N,N-diethyl-4-(4-nitronaphthalen-1-ylazo)-phenylamine ("ZEN"), and an inverted dT residue.

16. 14. The isolated tracrRNA of claim 13, wherein the chemically modified nucleotide having a modification comprises an internucleotide modified bond comprising a phosphorothioate modification.

17. 14. The isolated tracrRNA of claim 13, wherein the isolated tracrRNA is selected from the group consisting of SEQ ID NOs: 100, 129, 130, 131, 132, 134, 136, 449, and 551.

18. An isolated crRNA comprising a chemically modified form of formula (I), [Equation 2] wherein X represents a sequence comprising a target-specific protospacer domain comprising about 17 nucleotides to about 20 nucleotides; and Z represents a sequence comprising a tracrRNA binding domain comprising about 12 nucleotides to about 19 nucleotides; An isolated crRNA, wherein the isolated crRNA exhibits activity in a clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated (Cas) (CRISPR-Cas) endonuclease system.

19. 19. The isolated crRNA of claim 18, wherein the chemically modified form of formula (I) comprises a chemically modified nucleotide having a modification selected from the group consisting of a ribose modification, a terminal modification group, and a modified internucleotide linkage.

20. 20. The isolated crRNA of claim 19, wherein the chemically modified nucleotide having a modification comprises a ribose modification selected from the group consisting of 2'OMe, 2'F, bicyclic nucleic acid, and locked nucleic acid (LNA).

21. 20. The isolated crRNA of claim 19, wherein the chemically modified nucleotide having a modification comprises a terminal modification group selected from the group consisting of a propanediol (C3) spacer, N,N-diethyl-4-(4-nitronaphthalen-1-ylazo)-phenylamine ("ZEN"), and an inverted dT residue.

22. 20. The isolated tracrRNA of claim 19, wherein the chemically modified nucleotide having a modification comprises an internucleotide modified bond comprising a phosphorothioate modification.

23. The isolated tracrRNA of claim 19, wherein the chemically modified form of formula (I) is selected from SEQ ID NOs: 429 to 439.