Expanding chemical substrates to include long-chain carbon and cyclic amino acids for genetic code reprogramming, for genetic code reprogramming
Novel beta-amino acid substrates are synthesized and incorporated into peptides using engineered translation apparatus, addressing the challenge of incorporating long carbon chains and cyclic structures into sequence-based polymers.
Patent Information
- Application Number
- JP2025119110
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2020-03-27
- Filing Date
- 2025-07-15
- Publication Date
- 2025-11-05
AI Technical Summary
Existing methods struggle to incorporate amino acid analogs with long carbon chains and cyclic structures into sequence-based polymers using flexizyme-mediated tRNA charging and genetic code reprogramming.
Synthesis of novel beta-amino acid substrates that can be acylated and conjugated to tRNA, enabling their site-specific incorporation into ribosomal peptides using engineered translation apparatus in vitro.
Expands the scope of chemical substrates that can be incorporated into peptides, demonstrating efficient incorporation of non-canonical amino acids into sequence-specific polymers.
Smart Images

Figure 2025165960000001_ABST
Abstract
Description
[Background technology]
[0001] Statement Regarding Federally Sponsored Research or Development
[0002] This invention was made with government support under W911NF-16-1-0372 funded by the Army Research Office. The government has certain rights in this invention.
[0003] Cross-reference to related patent applications
[0004] This application claims the benefit of priority under U.S.C. § 119(e) to U.S. Provisional Application No. 62 / 976,672, filed February 14, 2020, and U.S. Provisional Application No. 63 / 001,165, filed March 27, 2020, each of which is incorporated by reference in its entirety.
[0005] background
[0006] The field of the invention relates to components and methods for preparing sequence-specific polymers, and in particular to components and methods for use in genetic code reprogramming and in flexizyme-catalyzed acylation reactions.
[0007] Site-specific incorporation of non-canonical amino acids into polypeptides through genetic code reprogramming is a powerful approach to producing bio-based products that transcend the limits of nature. While ribosome-mediated polymerization can utilize a diverse repertoire of chemical substrates, the incorporation of amino acid analogs with long carbon chains and cyclic structures into sequence-based polymers using flexizyme (Fx)-mediated tRNA charging and genetic code reprogramming approaches remains elusive.
[0008] Here, we demonstrate the preparation of novel beta-amino acid substrates using wild-type and engineered ribosomes and their site-specific incorporation into sequence-based polymers in vitro. To this end, we synthesized new beta-amino substrates that could be acylated and conjugated to tRNA under optimized reaction conditions, and these acylated substrates could be incorporated into ribosomal peptides using in vitro translation. Our work expands the scope of chemical substrates and demonstrates that such substrates can be incorporated into peptides using an engineered translation apparatus in vitro. Summary of the Invention
[0009] Disclosed are methods, systems, components, and compositions for synthesizing sequence-specific polymers. These methods, systems, components, and compositions can be utilized to incorporate novel substrates, including non-standard amino acid monomers and non-amino acid monomers, into sequence-specific polymers. As disclosed herein, the novel substrates can be utilized for acylation of tRNAs through flexizyme-catalyzed reactions. Thus, the tRNAs acylated with the novel substrates can be utilized in a synthesis platform for incorporating novel substrates into sequence-specific polymers.
[0010] The components disclosed herein include acylated tRNA molecules and donor molecules for preparing the acylated tRNA molecules, which comprise monomers that can be incorporated into sequence-specific polymers. The disclosed acylated tRNA molecules are acylated using a moiety present in the donor molecule, which may be referred to herein as "R."
[0011] The disclosed acylated tRNA molecules have the formula: [ka] (Note that in this formula, The tRNA is a transfer RNA (i.e., the tRNA is acylated with RC(O)- at the C3 hydroxyl group); R includes amino acid moieties (e.g., non-limiting examples of which are alpha-amino acid moieties, beta-amino acid moieties, gamma-amino acid moieties, delta-amino acid moieties, epsilon-amino acid moieties, or longer chain amino acid moieties). R also includes amino acid moieties that include, for example, amino acids at the beta position (e.g., non-limiting examples of which are cyclic amino acid moieties).
[0012] In some embodiments, R is selected from alkyl optionally substituted with amino; cycloalkyl, heterocycloalkyl; (heterocycloalkyl)alkyl; alkenyl; cyanoalkyl; aminoalkyl; aminoalkenyl; carboxyalkyl; alkylcarboxyalkyl ester; haloalkyl; nitroalkyl; aryl; heteroaryl; (aryl)alkyl; (heteroaryl)alkyl; or (aryl)alkenyl; wherein the cycloalkyl, heterocycloalkyl, aryl, heteroaryl, (aryl)alkyl, (heteroaryl)alkyl, or (aryl)alkenyl is optionally substituted with one or more substituents selected from alkyl, hydroxyl, hydroxyalkyl, amino, aminoalkyl, azido, cyano, acetyl, nitro, nitroalkyl, halo, alkoxy, formyl, oxo, and alkynyl.
[0013] In other embodiments, R is a group of the formula: [ka] (However, in this formula, n is 0 to 6; R 1 or R 2is selected from hydrogen, alkyl optionally substituted with amino; cycloalkyl; heterocycloalkyl; (heterocycloalkyl)alkyl; alkenyl; cyanoalkyl; aminoalkyl; aminoalkenyl; carboxyalkyl; alkylcarboxyalkyl ester; haloalkyl; nitroalkyl; aryl; heteroaryl; (aryl)alkyl; heteroaryl(alkyl); or (aryl)alkenyl, wherein aryl or heteroaryl is optionally substituted with one or more substituents selected from alkyl, hydroxyl, hydroxylalkyl, amino, aminoalkyl, azido, cyano, acetyl, nitro, nitroalkyl, halo, alkoxy, formyl, and alkynyl; R 1 and R 2 combine to form a carbocyclic ring, optionally 3-, 4-, 5-, 6-, 7-, or 8-membered carbocyclic ring, optionally substituted with one or more substituents selected from hydroxyl, hydroxylalkyl, amino, aminoalkyl, azido, cyano, acetyl, nitro, nitroalkyl, halo, alkoxy, and alkynyl.
[0014] In some embodiments, the disclosed acylated tRNA molecules have the formula: [ka] You can have.
[0015] In some embodiments, the disclosed acylated tRNA molecules have the formula: [ka] You can have.
[0016] In some embodiments, the disclosed acylated tRNA molecules have the formula: [ka] (where X is (CH2)m and m is, for example, 1 to 6, i.e., R 1 and R 2 together form a 3-, 4-, 5-, 6-, 7-, or 8-membered carbocyclic ring)
[0017] The disclosed acylated tRNA molecules can be prepared by reacting a tRNA molecule with a donor molecule in the presence of flexizyme (Fx). These methods involve reacting (i) flexizyme (Fx): (ii) a tRNA molecule; and (ii) a molecule of the formula: [ka] A donor molecule having R is the moiety defined above; LG is a leaving group; wherein X is O or S. In this preparation method, Fx catalyzes the acylation reaction between a tRNA molecule and a donor molecule to prepare an acylated tRNA molecule.
[0018] formula: [ka] A donor molecule having R is the moiety defined above; LG is a leaving group; X is O or S) are also disclosed herein. Suitable leaving groups (LG) for the donor molecule include the leaving group (LG) (formula: [ka] and 4-((2-aminoethyl)carbomoyl)benzyl, etc.).
[0019] The disclosed methods, systems, components, and compositions can be used to prepare sequence-specific polymers in vitro and / or in vivo. In some embodiments, the disclosed methods can be practiced to prepare sequence-specific polymers in a cell-free synthetic system, where the sequence-specific polymer is prepared by translating an mRNA containing a codon corresponding to the anticodon of an acylated tRNA molecule. In the disclosed methods, the R group of the acylated tRNA molecule is incorporated into the sequence-specific polymer during translation of the mRNA. The disclosed methods can be practiced to prepare polymers selected from, but not limited to, polyolefin polymers, aramid polymers, polyurethane polymers, polyketide polymers, conjugated polymers, D-amino acid polymers, β-amino acid polymers, γ-amino acid polymers, and polycarbonate polymers. [Brief explanation of the drawings]
[0020] [Figure 1A] Crystal structure of flexizyme (SEQ ID NO: 22). (Xiao, H., Murakami, H., Suga, H. & Ferre-D'Amare, AR Structural basis of specific tRNA aminoacylation by a small in vitro selected ribozyme. Nature 454, 358-361 (2008)). [Figure 1B] A leaving group commonly used in flexizyme-mediated tRNA acylation and preparation of activated ester substrates. [Figure 2] Preparation of Chemical Substrates. Boc-protected α-amino acids and Boc-protected β-amino acids were converted into esterified substrates for acylation. [Figure 3] Optimization of Flexizyme (Fx)-catalyzed aminoacylation. [Figure 4] Reprogramming of the genetic code. Sub1, Sub2, and Sub3 indicate the codons corresponding to the reprogrammed tRNAs. [Figure 5]Schematic representation of methods for incorporating amino acids into polypeptides. [Figure 6] Characterization of synthetic polypeptides containing incorporated amino acids. [Figure 7] Possible polymer backbones that can be formed using tRNAs charged with ester, thioester, or ABC monomers. [Figure 8] Expanding the chemical substrate range of Flexizyme for genetic code reprogramming. a) Flexizyme (Fx) recognizes the 3'-CCA sequence of tRNA59 and catalyzes the acylation of tRNA with acidic substrates. Fx has previously been used to incorporate a limited set of the most common amino acids and hydroxy acids. In this work, we explore the substrate specificity of Fx for additional non-canonical acidic substrates containing aromatic groups in either the side chain or leaving group (purple). b) Using an Escherichia coli cell-free protein synthesis system reconstituted from purified wild-type translation machinery (PURExpress™), we generated peptides containing such non-canonical acidic substrates60. This approach of incorporating non-canonical monomers at the N-terminus of peptides is well established. c) Thirty-two non-canonical acidic substrates containing a wide range of functional groups were incorporated at the N-terminus of peptides. [Figure 9] Optimized reaction conditions facilitate Fx-catalyzed acylation with novel substrates. Acid-denaturing PAGE analysis of Fx-catalyzed acylation of microhelical tRNA (22 nt) with Phe (A) and various structural Phe analogs (B–G) under various conditions. The acylation reaction was carried out using eFx (45 nt) or aFx (47 nt) and monitored over 120 h at two different pHs (7.5 vs. 8.8). [Figure 10]The range of Fx substrates was expanded to include analogs with various scaffolds. The range of non-canonical substrates compatible with Fx was further expanded with four different monomeric structures (Phe analogs, benzoic acid derivatives, heteroaromatic, and aliphatic substrates). eFx and aFx charge substrates by recognizing the aryl group of the substrate. Acylation reactions were performed using a microhelical RNA (22 nt) with its cognate Fx (eFx: 45 nt, aFx: 47 nt) and monitored over 120 h at two different pHs (7.5 vs. 8.8). Reaction conditions were 50 mM HEPES (pH 7.5) or bicine (pH 8.8), 60 mM MgCl2, 1 μM microhelix, 5 μM Fx, and 5 mM substrate in 20% (v / v) DMSO. All acylation heat maps are shaded by the microhelix conversion rate. See Figure 15 for acylation values. [Figure 11] Simulation of molecular interactions between selected substrates and the binding pocket of eFx. The tetrahedral intermediate model of CME ester was optimized and Monte Carlo energy optimization was performed using Rosetta. a) Phe (A), b) hydrocinnamic acid (B), c) cinnamic acid (C), d) benzoic acid (D), e) phenylacetic acid (E); dark yellow. f) pyrrole-2-carboxylic acid (25) and g) 2-thiophenecarboxylic acid (26) do not show strong interactions with the guanine residue. [Figure 12]Ribosomal synthesis of N-terminally functionalized peptides using non-canonical substrates. a) Overall schematic of peptide synthesis and characterization. N-terminally functionalized peptides were prepared using Fx-charged tRNAfMet in a PURExpress™ system, purified with a Strep tag, denatured with SDS, and characterized by MALDI mass spectrometry. b) Mass spectra of peptides in the presence of all 20 natural amino acids but in the absence of Fx-charged tRNA. c) Mass spectra of peptides in the presence of methionine and in the absence of Fx-charged tRNA. d-i) Mass spectra of peptides with N-termini incorporating non-canonical substrates. *: A small amount of peptides containing phenylalanine at the N-terminus were found to be non-formylated. NH2-FWSHPQFEKST-OH (SEQ ID NO: 14); [M+Na]+=1415, A: phenylalanine, B: hydrocinnamic acid, C: cinnamic acid, D: benzoic acid, E: phenylacetic acid, G: propanoic acid. [Figure 13] Acylation of microhelices using seed substrates. The Fx-catalyzed acylation reactions using six representative substrates (Phe-CME (A), hcinA-CME (B), cinA-CME (C), benA-CME (D), PhAACME (E), penA-CME (F), and penA-ABT (G)) were monitored over 120 h at two different pH values (7.5 and 8.8). In general, a higher pH (pH 8.8) and a longer incubation time (120 h) resulted in higher reaction yields. Figure 9 was generated using a portion of Figures 8a (lanes A–C), 8b (lanes A–C), and 8d (lanes C–G). LG: leaving group. Fx: flexizyme; CME: cyanomethyl ester; ABT: (2-aminoethyl)amidocarboxybenzylthioester. [Figure 14]Undesired hydrolysis of acylated microhelices. Microhelices charged with PhPA(B) were acylated in 100% yield at 16 h, but the acylation yield was found to decrease (76%) at 144 h, likely due to undesired hydrolysis by water on the ester bond. Lane 1: microhelix; Lanes 2 and 3: crude acylated product observed at 16 and 144 h, respectively. Based on this observation, the reaction time was limited to 120 h. [Figure 15] Numerical values for acylation yields of microhelices obtained with extended substrates. The acylation reaction yields of microhelices with 32 non-canonical chemical substrates were determined by quantifying band intensities on 20% polyacrylamide gels (pH 5.2, 50 mM NaOAc, Figures 16-18). [Figure 16] Analysis of acylation using 1–6. Acylation yields were analyzed by electrophoresis on a 20% polyacrylamide gel containing 50 mM NaOAc (pH 5.2). Crude products containing chemical substrates (1–6) were loaded onto the gel and separated by electrophoretic migration at 135 mV in a cold room for 2–3 h. Reactions were monitored for 120 h, and yields were quantified using densitometric analysis (ImageJ software). [Figure 17] Analysis of acylation with 7-21. The crude acylation reaction mixtures charged with substrates (7-21) were analyzed using the same method as described in FIG. [Figure 18]Analysis of acylation using 22–32. Crude products charged with chemical substrates (22–32) were analyzed. The gel was stained with GelRed (Biotium) and visualized by a 20-second exposure on a 630 nm filter in a Gel Doc XR+ (Bio-Rad). The band containing mihx charged with coumarin (24) in the orange box shows relatively greater intensity than the other nucleic acid bands when the gel is exposed to shorter wavelengths (560 nm). Note that the yields were obtained from reactions with substrates containing leaving groups CME and ABT, respectively. (Coumarin excitation / emission wavelengths: 380 nm / 410–470 nm). [Figure 19] Acylation studies of pyrrole-ABT and thiophene-ABT. In case eFx did not recognize small aromatic rings, additional substrates were tested for pyrrole and thiophene substrates (25a and 26a with ABT). However, no new bands corresponding to the charged microhelices were observed in the gel. eFx and aFx were used in lanes 1 and 3 and 2 and 4, respectively. (NMR spectroscopic data were obtained but are not presented here.) [Figure 20] Representative compounds containing a linear primary amine moiety. [Figure 21] Representative compounds containing a cyclic primary amine moiety. [Figure 22] Representative compounds containing a cyclic secondary amine moiety. [Figure 23] Beta-amino acids with linear carbon chains are incorporated into peptides by WT ribosomes. [Figure 24] Beta-amino acids with cyclic carbon chains are inefficient substrates for incorporation by WT ribosomes. [Figure 25] Wild-type ribosomes exhibit some ability to incorporate beta-amino acids at the C-terminus of peptides. [Figure 26] An additional translation factor (EF-P) assists in the incorporation of cyclic beta amino acids at the C-terminus of the peptide. [Figure 27] A typical beta-amino acid. [Figure 28]Expanding the range of chemical substrates in the translational machinery to include long-chain carbon and cyclic amino acids. (a) Substrates for translation compatible with Flexizyme (Fx) and cell-free protein synthesis (CFPS) platforms. Incorporation of long-chain carbon (lcc) amino acids into peptides has proven challenging. (b) Examples of major polyamide polymers with significantly different properties (e.g., tensile strength (TS)) based on backbone length, monomer function, and / or monomer sequence. (c) tRNA charging of lcc amino acids by the Fx system remains challenging due to the resulting intramolecular lactam formation. (d) Strategies for incorporating long-chain carbon amino acids by Fx and in vitro translation. [Figure 29] Systematic design of long carbon chain and cyclic amino acids. (a) The range of amino acids with linear carbon chains was expanded to include γ-, δ-, ε-, and ζ-amino acids. Greater acylation yields by Fx were observed with increasing amino acid chain length. This is likely because lactamization leads to larger (>5-membered) ring formation, which is kinetically more unfavorable than 5-membered ring formation. (b) Introduction of cyclic and rigid linkages into the substrates aids in increasing Fx acylation yields. (c) Increased acylation yields (from approximately 6% for 7 to approximately 95% for 12) were obtained with γ-amino acids with rigid linkages (7) or cyclic structures (11–15). These data suggest that the rigid carbon scaffold effectively inhibits intramolecular 5-membered lactam formation. The acylation yield for each substrate represents the yield of microhelical tRNA observed at 24 h and 120 h. Data are representative of three independent experiments. [Figure 30] Observation of lactam formation in Fx-mediated acylation of γ-amino acids. Observation of lactam formation in Fx-mediated acylation of substrate 2ii. Extracted ion chromatogram a for the Fx reaction mixture incubated on ice for 24 h showed a new peak corresponding to the theoretical mass of lactam b. Data are representative of three independent experiments. [Figure 31]Ribosomal synthesis of N-terminally functionalized peptides using backbone-extended monomers. (a) tRNAfMet(CAU), in which all backbone-extended amino acids (3–15) were charged with Fx, was incorporated into the N-terminus of the peptide by ribosome-mediated polymerization in the PURExpress™ system. The peptide was purified with a streptavidin tag (WSHPQFEK) and characterized by MALDI mass spectrometry. The observed mass for each peptide corresponds to the theoretical mass, which is: (b) [M+H]+ = 1345; [M+Na]+ = 1367, (c) [M+H]+ = 1359; [M+Na]+ = 1381, (d) [M+H]+ = 1373; [M+Na]+ = 1395, (e) [M+H]+ = 1369; [M+Na]+ = 1391, (f) [M+Na]+ = 1351, (g) [M+H]+ = 1379; [M+Na]+ = 1401, (h) [M+H] + = 1371; [M+Na] + = 1393, (i) [M+H] + = 1372; [M+Na] + = 1394, (j) [M+H] + = 1343; [M+Na] + = 1365, (k) [M+Na] + = 1365, (l) [M+H] + = 1357; [M+Na] + = 1379, (m) [M+H] + = 1371; [M+Na] + = 1393, (n) [M+H] + = 1371; [M+Na] + = 1393. The peak marked with an asterisk is a truncated peptide lacking the target substrate at the N-terminus ([M+H] + = 1246; [M+Na] + = 1268). Data are representative of three independent experiments. [Figure 32]Ribosomal synthesis of peptides using aminocyclobutane-carboxylic acid (ACB). (a) Peptides were synthesized using Fx-mediated tRNAPro1E2(GGU) in the PURExpress™ system, purified using streptavidin tags, and characterized by MALDI mass spectrometry. (b) and (c) cis-ACB and trans-ACB are not incorporated into peptides at the C-terminus by wild-type ribosomes. (d) Engineered ribosomes facilitate the incorporation of cis / trans-ACB into peptides at the C-terminus and mid-chain. (e) and (f) cis-ACB and trans-ACB. When engineered ribosomes developed by Maini et al.24, 58 were added to in vitro protein translation reactions, peptides containing cis / trans-ACB at the C-terminus were observed. (g) and (h) cis-ACB and trans-ACB. After incorporation of cis / trans-ACB, additional amino acid residues (Ile and Ala) were elongated. This demonstrates that the engineered ribosomes enabled site-specific incorporation of ACB. Data are representative of three independent experiments. See Figure 34 for full spectrum. [Figure 33] Acylation of microhelices using substrates 1–15 and 2i–2v. (a–d) The Fx-catalyzed acylation reactions using the 20 substrates were monitored for 120 h at two different pH values (7.5 and 8.8) for three different flexizymes (eFx, dFx, and aFx). Fx: flexizyme (43–45 nt), mihx: microhelix (22 nt). The yield of each reaction was determined by quantifying the relative band intensities of unacylated microhelices (red arrows) and acylated microhelices (blue arrows) on the gel using ImageJ software. The substrate structures of 1–15 and 2i–2v are shown in the characterization data above. Data represent multiple independent experiments (n = 1–3). [Figure 34]Characterization of C-terminally functionalized peptides with cis- and trans-ACBs (11-12). (a) Structure and molecular weight of the target peptide and the truncated peptide by-product generated in the PURExpress™ translation reaction. (b) MALDI-TOF mass spectrometry data from an attempt to incorporate cis-ACB (11) using wild-type ribosomes. (c) Addition of Hecht ribosomes (040329) under the same PURExpress™ reaction conditions as in (b) resulted in a peak corresponding to the theoretical mass of the target peptide containing cis-ACB at the C-terminus. (d) Incorporation of 11 can be followed by extension with additional amino acids Ile and Ala. This suggests that the engineered ribosomes enable site-specific incorporation. (e) MALDI-TOF data from an attempt to incorporate trans-ACB (12) using wild-type ribosomes. (f) Addition of Hecht ribosomes under the same conditions as in (e) resulted in a peak corresponding to the theoretical mass of the target peptide containing 12 at the C-terminus. (g) The same additional amino acid residues (Ile and Ala) are elongated after incorporation of p12. The theoretical masses of the truncated peptides are [M+H]+ = 1089; [M+Na]+ = 1111 for p1 (green arrow), [M+H]+ = 1217; [M+Na]+ = 1239 for p2 (blue arrow), and [M+H]+ = 1304; [M+Na]+ = 1326 for p3 (orange arrow). Sixteen peaks marked with stars ([M+H]+ = 1334; [M+Na]+ = 1356, black arrow) were not identified. Figures 32b, c, and e–h were generated using the highlighted (purple) regions. The yield of the target peptide was calculated based on the relative peak area (PA) of the target polypeptide to the total amount of truncated polypeptide and target polypeptide (i.e., relative yield (%) = Σ PA (target peptide) / Σ PA (P1 + P2 + P3 + target peptide) × 100). Data are representative of three independent experiments. [Figure 35]We will extend the range of chemical substrates for ribosome-mediated polymerization to cyclic β-amino acid substrates. We will explore the substrate specificity of the native translation machinery for cyclic β-amino acid (cβAA) substrates using flexizyme-catalyzed acylation and ribosome-mediated incorporation. We will examine 10 non-canonical cβAAs, including a variety of bulky cyclic structures. [Figure 36] Ribosomal incorporation of α- and β-amino acids. Peptides were prepared using Fx-mediated tRNAPro1E2(GGU) in the PURExpress™ system, purified with a Strep tag (WSHPQFEK), and characterized by MALDI. When equal amounts of α- and β-Pu-charged tRNAPro1E2(GGU) were added to the PURE reaction, peptides containing α-Pu were found to be 14-fold more abundant than peptides with β-Pu at the C-terminus, likely due to the native translation machinery's preference for L-α-amino acids. The observed masses are 1481 [M+H]+, 1503 [M+Na]+, 1525 [M-H+2Na]+, and 1547 [M-2H+3Na]+ Da for the peptide with α-Pu incorporated at the C-terminus, and 1496 [M+H]+ and 1518 [M+Na]+ Da for the peptide with β-Pu, respectively. [Figure 37] Flexizyme-mediated acylation yields (%) for 10 cβAAs. The acylation reactions were performed under six different conditions (two different pHs (7.5 and 8.8) and three different Fxs (e, d, and aFx)) to find the optimal reaction conditions. 4-cβAA (1–2) was charged inefficiently, likely due to its tendency to form the cyclic lactam product, whereas 5-cβAA (3–6) and 6-cβAA (7–10) were charged in high yields (40–60%, n = 3; mean values, where n represents the number of experiments; see Figure 39). [Figure 38]Incorporation of bulky cβAAs in the presence of EF-P. 10 μM (final) EF-P in an in vitro protein translation system enhances the intensity of peptides containing 5- and 6-cβAAs at the C-terminus. a), b). The circles represent the masses of the peptide containing 5-cβAA at the C-terminus, corresponding to [M+H]+ = 1415, [M+Na]+ = 1437, and [M-H+2Na]+ = 1459, respectively. c), d). The circles represent the peptide containing 6-cβAA, corresponding to [M+H]+ = 1429, [M+Na]+ = 1451, and [M-H+2Na]+ = 1473, respectively. See SI for full spectra. The bars represent a peptide with the sequence fMWSHPQFEKST, where fM is formylated Met. [Figure 39] Acylation of microhelices using substrates 1–12. The Fx-catalyzed acylation reactions using 20 different substrates were monitored over 24 hours at two different pHs (7.5 or 8.8) for three different flexizymes (eFx, dFx, and aFx). The yield of each reaction was determined by quantifying the relative band intensities of unacylated and acylated microhelices on a gel using ImageJ software. [Figure 40] Characterization of an N-terminally functionalized peptide bearing 5-cβAA(3-6). The sequence of the green peptide is WSHPQFEKST, corresponding to the theoretical mass of the peptide without the N-terminal substrate: [M+H]+ = 1246; [M+Na]+ = 1268. It can be seen that all 5-cβAA(3-6) are incorporated into the N-terminus by the native translation machinery: [M+H]+ = 1357; [M+Na]+ = 1279. [Figure 41] Characterization of N-terminally functionalized peptides bearing 6-cβAA(7-10). It was found that all 6-cβAA(7-10) were incorporated into the N-terminus by the native translation machinery. [M+H]+ = 1371; [M+Na]+ = 1393. [Figure 42]The addition of EF-P enhances the C-terminal incorporation of 5-cβAA (3–6) into the target polypeptide. Addition of EF-P (c, e, g, and i) under the same reaction conditions in the PURExpress™ system resulted in peaks with enhanced intensity corresponding to the theoretical mass of a peptide containing the 5-cβAA substrate at its C-terminus. The theoretical mass of the peptide is [M+H]+ = 1415; [M+Na]+ = 1437; [M+Na]+ = 1459. The sequence of the blue peptide is fMWSHPQFEKS, which corresponds to the theoretical mass of the peptide without the substrate at its N-terminus: [M+H]+ = 1304; [M+Na]+ = 1326. The peaks marked with an asterisk ([M+H]+ = 1334; [M+Na]+ = 1356) were not identified. The highlighted (yellow) regions were used to generate Figures 38a–b. [Figure 43] The addition of EF-P increases the C-terminal incorporation of 6-cβAA into target polypeptides (7–10). Addition of EF-P (c, e, g, and i) under the same reaction conditions in the PURExpress™ system resulted in an enhanced peak corresponding to the theoretical mass of a peptide containing the 6-cβAA substrate at its C-terminus. The theoretical mass of the peptide is [M+H]+ = 1429; [M+Na]+ = 1451; [M-H+2Na]+ = 1473. The sequence of the blue peptide is fMWSHPQFEKST, which corresponds to the theoretical mass of the peptide without the substrate at its N-terminus: [M+H]+ = 1304; [M+Na]+ = 1326. The highlighted (yellow) region was used to generate Figures 38c–d. [Figure 44]Analysis of C-terminal incorporation of cβAA. a) Addition of EF-P under the same reaction conditions in the PURExpress™ system resulted in enhanced signals for all peaks corresponding to the theoretical masses of peptides containing cβAA (2a-2d and 3a-3d) at the C-terminus. This suggests an increase in the amount of target peptide in the sample. The signal-to-noise ratio (S / N) was normalized using the S / N of the peak at position 1353 present in the entire spectrum as an internal reference, then multiplied by an arbitrary number (1,000) and quantitatively compared with the peak signals in Figure 38. b) The C-terminal incorporation efficiency (CIE, %) was calculated based on the relative peak area (PA) of the target polypeptide to the total amount of truncated polypeptide and target polypeptide. The incorporation efficiency of cβAA increased by approximately 0.6-70.6% depending on the monomer after addition of EF-P. The S / N ratio and peak area were processed using Compass DataAnalysis 4.2 software (Bruker). DETAILED DESCRIPTION OF THE INVENTION
[0021] The subject matter of the present disclosure is described herein using several definitions set forth below and throughout the application.
[0022] definition
[0023] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described herein.
[0024] Unless the context otherwise states or indicates, the terms "a," "an," and "the" mean "one or more." For example, "a component" should be construed to mean "one or more components."
[0025] As used herein, the terms "about," "approximately," "substantially," and "significantly" will be understood by those of ordinary skill in the art and will vary to some extent depending on the context in which they are used. If these terms are used in a way that is not clear to those of ordinary skill in the art, given the context in which they are used, then "about" and "approximately" will mean plus or minus 10% or less of the term, and "substantially" and "significantly" will mean plus or minus 10% or more of the term.
[0026] As used herein, the terms "comprise" and "comprising" have the same meaning as the terms "include" and "comprising," which are "open" transitional terms that do not limit a claim to the elements immediately following the transitional term. The term "consisting of" is encompassed by the term "comprising" but should be understood as a "closed" transitional term that limits a claim to only the elements immediately following the transitional term. The phrase "consisting essentially of" is encompassed by the term "comprising" but should be understood as a "partially closed" transitional term that allows for additional elements following the transitional term, but only if those additional elements do not materially affect the basic and novel features of the claim.
[0027] Ranges described herein include not only the boundaries set forth herein, but also subranges encompassing any unspecified numerical values within the range. For example, the range of about 0.01 mM to about 10.0 mM encompasses both 0.01 mM and 10.0 mM. Exemplary unspecified numerical values within this range that are also contemplated include, for example, 0.05 mM, 0.10 mM, 0.20 mM, 0.51 mM, 1.0 mM, 1.75 mM, 2.5 mM, 5.0 mM, 6.0 mM, 7.5 mM, 8.0 mM, 9.0 mM, and 9.9 mM. Exemplary exemplary subranges within this range include about 0.01 mM to about 5.0 mM; about 0.1 mM to about 2.5 mM; and about 2.0 mM to about 6.0 mM.
[0028] chemicals
[0029] Disclosed herein are new chemical entities and uses of the chemical entities, which can be described using terms known in the art and are discussed further below.
[0030] As used herein, an asterisk "*" or a plus sign "+" may be used to refer to the point of attachment of any group or substituent (eg, "R" as discussed herein).
[0031] The term "alkyl" as used herein includes straight-chain or branched alkyl groups, including all isomeric forms thereof (e.g., linear or branched groups having 1 to 12, 1 to 10, or 1 to 6 carbon atoms, referred to herein as C1-C12 alkyl, C1-C10-alkyl, and C1-C6-alkyl, respectively).
[0032] The term "alkylene" refers to a diradical of a straight chain alkyl group or a branched alkyl group (i.e., a diradical of a straight chain or branched C1-C6 alkyl group). Non-limiting examples of representative alkylene groups include -CH2-, -CH2CH2-, -CH2CH2CH2-, -CH(CH3)CH2-, -CH2CH(CH3)CH2-, -CH(CH2CH3)CH2-, and the like.
[0033] The term "haloalkyl" means an alkyl group substituted with at least one halogen, for example, -CHF, -CHF, -CF, -CHCF, -CFCF, and the like.
[0034] The term "heteroalkyl," as used herein, refers to an "alkyl" group in which at least one carbon atom has been replaced with a heteroatom (e.g., an O, N, or S atom). One type of heteroalkyl group is an "alkoxy" group.
[0035] The term "alkenyl" as used herein means an unsaturated linear or branched hydrocarbon having at least one carbon-carbon double bond (e.g., a linear or branched group having 2 to 12, 2 to 10, or 2 to 6 carbon atoms, referred to herein as C2-C12-alkenyl, C2-C10-alkenyl, and C2-C6-alkenyl, respectively).
[0036] The term "alkynyl," as used herein, means an unsaturated linear or branched hydrocarbon having at least one carbon-carbon triple bond (e.g., a linear or branched group having 2 to 12, 2 to 10, or 2 to 6 carbon atoms, referred to herein as C2-C12-alkynyl, C2-C10-alkynyl, and C2-C6-alkynyl, respectively).
[0037] The term "cycloalkyl" refers to a monovalent saturated cyclic, bicyclic, or bridged cyclic (e.g., adamantyl) hydrocarbon radical of 3 to 12, 3 to 8, 4 to 8, or 4 to 6 carbons, such as those derived from cycloalkane, and are referred to herein as "C4-8-cycloalkyl." Unless otherwise specified, a cycloalkyl group is optionally substituted at one or more ring positions with, for example, alkanoyl, alkoxy, alkyl, haloalkyl, alkenyl, alkynyl, amido or carboxyamido, amidino, amino, aryl, arylalkyl, azide, carbamate, carbonate, carboxy, cyano, cycloalkyl, ester, ether, formyl, halo, haloalkyl, heteroaryl, heterocyclyl, hydroxyl, imino, ketone, nitro, phosphate, phosphonato, phosphinato, sulfate, sulfide, sulfonamido, sulfonyl, or thiocarbonyl. In certain embodiments, a cycloalkyl group is unsubstituted, i.e., unsubstituted.
[0038] The term "cycloheteroalkyl" means a monovalent saturated cyclic, bicyclic, or bridged cyclic hydrocarbon group of 3 to 12, 3 to 8, 4 to 8, or 4 to 6 carbons in which at least one carbon of the cycloalkane is replaced with a heteroatom (e.g., N, O, and / or S).
[0039] The term "cycloalkylene" refers to a cycloalkyl group that is unsaturated at one or more of the ring bond positions.
[0040] The term "partially unsaturated carbocycle" refers to a monovalent cyclic hydrocarbon containing at least one double bond between ring atoms, wherein at least one ring of the carbocycle is not aromatic. Partially unsaturated carbocycles can be characterized according to the number of ring carbon atoms. For example, a partially unsaturated carbocycle can contain 5 to 14, 5 to 12, 5 to 8, or 5 to 6 ring carbon atoms, and thus be referred to as a 5-14, 5-12, 5-8, or 5-6-membered partially unsaturated carbocycle, respectively. Partially unsaturated carbocycles can be monocyclic, bicyclic, tricyclic, bridged, spirocyclic, or in the form of other carbocycle systems. Representative partially unsaturated carbocycle groups include partially unsaturated cycloalkenyl groups and bicyclic carbocycle groups. Unless otherwise specified, partially unsaturated carbocyclic groups are optionally substituted at one or more ring positions with, for example, alkanoyl, alkoxy, alkyl, haloalkyl, alkenyl, alkynyl, amido or carboxyamido, amidino, amino, aryl, arylalkyl, azide, carbamate, carbonate, carboxy, cyano, cycloalkyl, ester, ether, formyl, halogen, haloalkyl, heteroaryl, heterocyclyl, hydroxyl, imino, ketone, nitro, phosphate, phosphonato, phosphinato, sulfate, sulfide, sulfonamido, sulfonyl, or thiocarbonyl. In certain embodiments, partially unsaturated carbocyclic rings are unsubstituted, i.e., unsubstituted.
[0041] The term "aryl" is art-recognized and refers to a carbocyclic aromatic group. Representative aryl groups include phenyl, naphthyl, anthracenyl, and the like. The term "aryl" includes polycyclic ring systems having two or more carbon rings where two or more carbons are common to two adjacent rings (the rings are "fused rings"), in which at least one ring is aromatic and the other rings can be, for example, cycloalkyl, cycloalkenyl, cycloalkynyl, and / or aryl. Unless otherwise specified, aromatic rings can be substituted at one or more ring positions with, for example, halogen, azido, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, alkoxyl, amino, nitro, sulfhydryl, imino, amido or carboxyamido, carboxylic acid, -C(O)alkyl, -CO2alkyl, carbonyl, carboxyl, alkylthio, sulfonyl, sulfonamido, sulfonamido, ketone, aldehyde, ester, heterocyclyl, aryl, or heteroaryl moiety, -CF3, -CN, and the like. In some embodiments, the aromatic ring is substituted at one or more ring positions with halogen, alkyl, hydroxyl, or alkoxyl. In some other embodiments, the aromatic ring is unsubstituted. In some embodiments, the aryl group is a 6-10 membered ring structure.
[0042] The terms "heterocyclyl" and "heterocyclic group" are art-recognized and refer to saturated, partially unsaturated, or aromatic 3- to 10-membered ring structures or 3- to 7-membered rings that include from one to four heteroatoms (such as nitrogen, oxygen, and sulfur) in the ring structure. The number of ring atoms in a heterocyclyl group can be specified using the nomenclature Cx-Cx, where x is an integer that specifies the number of ring atoms. For example, a C3-C7 heterocyclyl group refers to a saturated or partially unsaturated 3- to 7-membered ring structure that contains from one to four heteroatoms (such as nitrogen, oxygen, and sulfur). The designation "C3-C7" indicates that the heterocycle contains a total of 3 to 7 ring atoms, including any heteroatoms occupying ring atom positions.
[0043] The terms "amine" and "amino" are art-recognized and refer to both unsubstituted and substituted amines (e.g., mono- or di-substituted amines), where the substituents can include, for example, alkyl, cycloalkyl, heterocyclyl, alkenyl, and aryl.
[0044] The terms "alkoxy" or "alkoxyl" are art-recognized and refer to an alkyl group, as defined above, having an oxygen radical attached thereto. Representative alkoxy groups include methoxy, ethoxy, t-butoxy, and the like.
[0045] An "ether" is two hydrocarbons covalently linked by an oxygen. Thus, the substituent on an alkyl that makes it an ether is or resembles an alkoxyl (such as may be represented by one of -O-alkyl, -O-alkenyl, -O-alkynyl, etc.).
[0046] The term "carbonyl" as used herein refers to the group -C(O)-.
[0047] The term "oxo" refers to a divalent oxygen atom -O-.
[0048] The term "carboxamide" refers herein to the group -C(O)NRR', where R and R' can be the same or different. R and R' can be, for example, independently hydrogen, alkyl, aryl, arylalkyl, cycloalkyl, formyl, haloalkyl, heteroaryl, or heterocyclyl.
[0049] The term "carboxy" as used herein refers to the group -COOH or its corresponding salts (such as -COONa).
[0050] The term "amide" or "amido" or "amidyl" as used herein refers to a group consisting of -R 1 C(O)N(R 2 )-, -R 1C(O)N(R 2 )R 3 -, -C(O)NR 2 R 3 or a group of the form -C(O)NH2 (wherein R 1 , R 2 , and R 3 are, for example, independently of each other, hydrogen, alkyl, alkoxy, alkenyl, alkynyl, amido, amino, aryl, arylalkyl, carbamate, cycloalkyl, ester, ether, formyl, halogen, haloalkyl, heteroaryl, heterocyclyl, hydrogen, hydroxyl, ketone, or nitro).
[0051] The compounds of the present disclosure may contain one or more chiral centers and / or double bonds and therefore may exist as stereoisomers (e.g., geometric isomers, enantiomers, or diastereomers). The term "stereoisomer," as used herein, consists of any geometric isomer, enantiomer, or diastereomer. These compounds may be designated by the symbols "R" or "S," or "+" or "-," depending on the conformation of substituents around asymmetric carbon atoms and / or the observed optical rotation. The present invention encompasses various stereoisomers of these compounds and mixtures thereof. Stereoisomers include enantiomers and diastereomers. Although mixtures of enantiomers or diastereomers may be indicated by (±)" in the nomenclature, one of skill in the art will recognize that a structure may implicitly depict chiral centers. Graphic representations of chemical structures (e.g., generic chemical structures) are understood to encompass all stereoisomeric forms of the specified compound unless otherwise indicated. Also contemplated herein are compositions comprising, consisting essentially of, or consisting of optically pure compounds, which can comprise, consist essentially of, or consist of at least about 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of a single enantiomer of a given compound (e.g., at least about 99% R enantiomer of a given compound).
[0052] Reaction with nucleic acids
[0053] The terms "nucleic acid" and "oligonucleotide," as used herein, refer to polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polynucleotides (containing D-ribose), and any other type of polynucleotide that is an N-glycoside of a purine or pyrimidine base. No distinction in length is intended between the terms "nucleic acid," "oligonucleotide," and "polynucleotide," and these terms are used interchangeably. These terms refer only to the primary structure of the molecule; thus, these terms encompass double- and single-stranded DNA, as well as double- and single-stranded RNA. For use herein, oligonucleotides can include nucleotide analogs with modified bases, sugars, or phosphate backbones, as well as non-purine or non-pyrimidine nucleotide analogs.
[0054] Oligonucleotides can be prepared by any suitable method, including direct chemical synthesis, such as the phosphotriester method of Narang et al., 1979, Meth. Enzymol. 68:90-99; the phosphodiester method of Brown et al., 1979, Meth. Enzymol. 68:109-151; the phosphodiester method of Beaucage et al., 1981, Tetrahedron Letters 22:1859-1862; and the solid-support method of U.S. Patent No. 4,458,066 (each of which is incorporated herein by reference).A general overview of the synthesis of oligonucleotide and modified nucleotide conjugates is provided in Goodchild, 1990, Bioconjugate Chemistry 1(3):165-187, which is incorporated herein by reference.
[0055] The term "amplification reaction" refers to any chemical reaction (including enzymatic reactions) that results in the multiplication of copies of a template nucleic acid sequence or the transcription of a template nucleic acid. Amplification reactions include reverse transcription, polymerase chain reaction (PCR) (including real-time PCR (see U.S. Patent Nos. 4,683,195 and 4,683,202; PCR Protocols: A Guide to Methods and Applications (Innis et al., eds, 1990))), and ligase chain reaction (LCR) (see Barany et al., U.S. Patent No. 5,494,810). Representative "amplification reaction conditions" or "amplification conditions" typically involve either a two-step or a three-step cycle. A two-step cycle has a high-temperature denaturation step followed by a hybridization / extension (or ligation) step. A three-step cycle involves a denaturation step, followed by a hybridization step, followed by another extension step.
[0056] The terms "target," "target sequence," "target region," and "target nucleic acid" are used synonymously herein and refer to a region or sequence of a nucleic acid that is to be amplified, sequenced, or detected.
[0057] The term "hybridization" as used herein refers to the formation of a double-stranded structure by the formation of complementary base pairs between two single-stranded nucleic acids.Hybridization can occur between completely complementary nucleic acid strands or between "substantially complementary" nucleic acid strands that contain small mismatched regions.Conditions that are highly favorable for the hybridization of completely complementary nucleic acid strands are called "stringent hybridization conditions" or "sequence-specific hybridization conditions."Stable duplexes of substantially complementary sequences can be achieved under less stringent hybridization conditions; the degree of mismatch tolerance can be controlled by appropriately adjusting the hybridization conditions. Those skilled in the art of nucleic acid technology can determine duplex stability empirically, taking into account numerous variables (including, for example, the length and base pair composition of the oligonucleotide, ionic strength, and the occurrence of mismatched base pairs), following guidance provided in the art (see, e.g., Sambrook et al., 1989, Molecular Cloning—A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York; Wetmur, 1991, Critical Review in Biochem. and Mol. Biol. 26(3 / 4):227-259; and Owczarzy et al., 2008, Biochemistry, 47: 5336-5353, which are incorporated herein by reference).
[0058] The term "primer," as used herein, refers to an oligonucleotide that can function as a point of initiation for DNA synthesis under appropriate conditions, including conditions that induce synthesis of a primer extension product complementary to a nucleic acid strand in the presence of four different nucleoside triphosphates and an extension agent (e.g., DNA polymerase or reverse transcriptase) in a suitable buffer at a suitable temperature.
[0059] The primer is preferably single-stranded DNA. The appropriate length of the primer depends on the intended use of the primer but typically ranges from about 6 to about 225 nucleotides, including intermediate ranges (e.g., 15 to 35 nucleotides, 18 to 75 nucleotides, and 25 to 150 nucleotides). Shorter primer molecules generally require lower temperatures to form a sufficiently stable hybrid complex with the template. The primer need not reflect the exact sequence of the template nucleic acid, but must be sufficiently complementary to hybridize to the template. The design of primers suitable for amplifying a given target sequence is well known in the art and is described in the references cited herein.
[0060] Primers may contain additional features that allow for detection or immobilization of the primer but do not alter the primer's basic property (functioning as a starting point for DNA synthesis). For example, primers may contain additional nucleic acid sequences that do not hybridize to the target nucleic acid but that facilitate cloning or detection of the amplified product, or additional nucleic acid sequences that allow for transcription of RNA (e.g., by including a promoter) or that enhance transcription (e.g., a 5'-UTR (internal ribosome entry site (IRES)) or a 3'-UTR element (poly(A))). n The 5' end may contain additional nucleic acid sequences that allow for protein translation, such as by including a sequence (where n ranges from about 20 to about 200). The region of the primer that is sufficiently complementary to the template to hybridize is referred to herein as the hybridizing region.
[0061] As used herein, a primer is "specific" for a target sequence if it hybridizes primarily to the target nucleic acid when used in an amplification reaction under sufficiently stringent conditions. Typically, a primer is specific for a target sequence if the primer-target duplex stability is greater than the stability of a duplex formed between the primer and any other sequence found in the sample. Those skilled in the art will recognize that various factors (such as salt conditions, primer base composition, and mismatch location) affect primer specificity and that routine experimentation is often required to confirm primer specificity. Hybridization conditions can be selected that allow the primer to form a stable duplex only with the target sequence. Therefore, target-specific primers can be used under moderately stringent amplification conditions to selectively amplify target sequences containing the target primer binding site.
[0062] As used herein, "polymerase" refers to an enzyme that catalyzes the polymerization of nucleotides. "DNA polymerase" catalyzes the polymerization of deoxyribonucleotides. Known DNA polymerases include, for example, Pyrococcus furiosus (Pfu) DNA polymerase, Escherichia coli DNA polymerase I, T7 DNA polymerase, and Thermus aquaticus (Taq) DNA polymerase. "RNA polymerase" catalyzes the polymerization of ribonucleotides. The above examples of DNA polymerases are also known as DNA-dependent DNA polymerases. RNA-dependent DNA polymerases also fall within the scope of DNA polymerases. Reverse transcriptase (including viral polymerases encoded by retroviruses) is an example of an RNA-dependent DNA polymerase. Known examples of RNA polymerases ("RNAPs") include, for example, bacteriophage polymerases (non-limiting examples of which include T3 RNA polymerase, T7 RNA polymerase, SP6 RNA polymerase, and E. coli RNA polymerase, among others). The above examples of RNA polymerases are also known as DNA-dependent RNA polymerases. The polymerase activity of any of the above enzymes can be measured by means well known in the art.
[0063] The term "promoter" refers to a cis-acting DNA sequence that directs RNA polymerase and other trans-acting transcription factors to initiate RNA transcription from a DNA template containing the cis-acting DNA sequence.
[0064] As used herein, the phrase "sequence-defined biopolymer" refers to a biopolymer having a specific primary sequence. A sequence-defined biopolymer can be equivalent to a defined biopolymer encoded by a gene, if the gene encodes a biopolymer having a specific primary sequence.
[0065] As used herein, "expression template" refers to a nucleic acid that serves as a substrate for the transcription and translation of at least one RNA into a sequence-specific biopolymer (e.g., a polypeptide or protein). Expression templates include nucleic acids composed of DNA or RNA. Suitable sources of DNA for use as nucleic acids for expression templates include genomic DNA, cDNA, and RNA that can be converted to cDNA. The genomic DNA, cDNA, and RNA can be from any biological source, particularly tissue samples, biopsies, swabs, sputum, blood samples, fecal samples, urine samples, scrapings, etc. The genomic DNA, cDNA, and RNA can originate from host cells or viruses and from any species, including extant and extinct organisms. As used herein, "expression template" and "transcription template" have the same meaning and are used interchangeably.
[0066] As used herein, "translation template" refers to an RNA product transcribed from an expression template that can be utilized by ribosomes to synthesize a polypeptide or protein.
[0067] As used herein, coupled transcription / translation ("Tx / Tl") refers to the de novo synthesis of both RNA and sequence-specific biopolymers from the same extract. For example, coupled transcription / translation of a given sequence-specific biopolymer can occur in an extract containing an expression template and a polymerase capable of generating a translation template from the expression template. Coupled transcription / translation can occur using a cognate expression template and a polymerase from the organism used to prepare the extract. Coupled transcription / translation can also occur using an exogenously supplied expression template and a polymerase from an orthogonal host organism different from the organism used to prepare the extract. In the case of an extract prepared from yeast, an example of an exogenously supplied expression template includes a translation open reading frame operably coupled to a bacteriophage polymerase-specific promoter, and an example of a polymerase from an orthogonal host organism includes the corresponding bacteriophage polymerase.
[0068] The term "reaction mixture," as used herein, refers to a solution containing reagents necessary to carry out a given reaction. An "amplification reaction mixture" refers to a solution containing reagents necessary to carry out an amplification reaction, typically containing oligonucleotide primers and a DNA polymerase in a suitable buffer. A "PCR reaction mixture" typically contains oligonucleotide primers, a DNA polymerase (most typically a thermostable DNA polymerase), dNTPs, and a divalent metal cation in a suitable buffer.
[0069] Cell-free protein synthesis (CFPS)
[0070] The disclosed subject matter relates, in part, to methods, systems, components, and compositions for cell-free protein synthesis. Cell-free protein synthesis (CFPS) is known and has been described in the prior art. (See, e.g., U.S. Patent Nos. 6,548,276; 7,186,525; 8,734,856; 7,235,382; 7,273,615; 7,008,651; 6,994,986; 7,312,049; 7,776,535; 7,817,794; 8,298,759; 8,715,958; 9,005,920; U.S. Publication No. 2014 / 0349353; and U.S. Publication No. 2016 / 0060301, the contents of which are incorporated herein by reference in their entireties). A "CFPS reaction mixture" typically contains a crude or partially purified yeast extract, an RNA translation template, and a reaction buffer suitable for promoting cell-free protein synthesis from the RNA translation template. In some aspects, a CFPS reaction mixture can include an exogenous RNA translation template. In other aspects, a CFPS reaction mixture can include a DNA expression template encoding an open reading frame operably linked to a promoter element for a DNA-dependent RNA polymerase. In these other aspects, a CFPS reaction mixture can also include a DNA-dependent RNA polymerase that directs transcription of the RNA translation template encoding the open reading frame. In these other aspects, a CFPS reaction mixture can include additional NTPs and divalent cation cofactors. A reaction mixture is said to be complete if it contains all of the reagents necessary to enable the reaction, and incomplete if it contains only a portion of the necessary reagents.Those skilled in the art will understand that the reaction components are typically stored as separate solutions, each containing a portion of the total component, for reasons of convenience, storage stability, or to allow for adjustment of the component concentrations depending on the application, and that the reaction components are combined to form a complete reaction mixture prior to reaction. Furthermore, those skilled in the art will understand that the reaction components are packaged separately for commercial sale, and that useful commercial kits can contain any portion of the reaction components of the present invention.
[0071] A platform for preparing sequence-specific biopolymers
[0072] One aspect of the present invention is a platform for in vitro preparation of sequence-specific biopolymers of proteins. The platform for in vitro preparation of sequence-specific polymers or proteins includes cell extracts from GRO organisms, as described above. Because CFPS utilizes a group of catalytic proteins prepared from crude cell lysates, the cell extract (whose composition is sensitive to growth medium, lysis method, and processing conditions) is the most important component of the extract-based CFPS reaction. A variety of methods exist for preparing extract components for cell-free protein synthesis, including U.S. Patent Application Serial No. 14 / 213,390, filed March 14, 2014, by Michael C. Jewett et al., entitled "Method for Cell-Free Protein Synthesis" (published October 2, 2014 as U.S. Patent Application Publication No. 2014 / 0295492), and U.S. Patent Application Serial No. 14 / 840,249, filed August 31, 2015, by Michael C. Jewett et al., entitled "Improved In Vitro Protein Synthesis Method Using Proteins Containing Non-Standard Amino Acids" (published March 3, 2016 as U.S. Patent Application Publication No. 2016 / 0060301), the contents of which are incorporated by reference.
[0073] A platform can include an expression template, a translation template, or both an expression template and a translation template. An expression template serves as a substrate onto which at least one RNA can be transcribed into a sequence-specific biopolymer (e.g., a polypeptide or protein). A translation template is an RNA product that can be used by ribosomes to synthesize a sequence-specific biopolymer. In certain embodiments, a platform includes both an expression template and a translation template. In certain particular embodiments, a platform can be a coupled transcription / translation ("Tx / Tl") system in which the translation template and the sequence-specific biopolymer are synthesized from the same cell extract.
[0074] The platform can include one or more polymerases capable of generating a translation template from an expression template. The polymerase can be provided exogenously or from the organism used to prepare the extract. In some particular embodiments, the polymerase is expressed from the organism used to prepare the extract and / or from a plasmid present at an integration site in the genome of the organism used to prepare the extract.
[0075] The platform can include an orthogonal translation system. The orthogonal translation system can include one or more orthogonal components designed to operate in parallel and / or independently of the orthogonal translation machinery of an organism. In some embodiments, the orthogonal translation system and / or orthogonal components are configured to incorporate unnatural amino acids. The orthogonal components can be orthogonal proteins or orthogonal RNAs. In some embodiments, the orthogonal proteins can be orthogonal synthetases. In some embodiments, the orthogonal RNAs can be orthogonal tRNAs or orthogonal rRNAs. Examples of orthogonal rRNA components are described in Application No. PCT / US2015 / 033221, filed May 29, 2015, by Michael C. Jewett et al., entitled "Linked Ribosomes and Methods of Making and Using Same" (now published as WO2015184283), and U.S. Patent Application Serial No. 15 / 363,828, filed November 29, 2016, by Michael C. Jewett et al., entitled "Ribosomes with Linked Subunits" (published March 16, 2017 as U.S. Patent Application Publication No. 2017 / 0073381), the contents of which are incorporated by reference. In certain embodiments, one or more orthogonal components can be prepared by expressing an oligonucleotide template in vivo or in vitro. The one or more orthogonal components can be expressed from a plasmid present in the genetically modified organism, expressed from an integration site within the genome of the genetically modified organism, co-expressed from both a plasmid present in the genetically modified organism and an integration site within the genome of the genetically modified organism, expressed in in vitro transcription and translation reactions, or added exogenously as a factor (e.g., an orthogonal tRNA or orthogonal synthetase added to the platform or reaction mixture).
[0076] Altering the physiochemical environment of the CFPS reaction to better mimic the cytoplasm can improve protein synthesis activity. The following parameters can be considered alone or in combination with one or more other components to improve a robust CFPS reaction platform based on crude cell extracts (e.g., S12, S30, and S60 extracts):
[0077] The temperature can be any temperature suitable for CFPS. The temperature can be in the general range of about 10°C to about 40°C, including specific intermediate ranges within this general range, such as about 15°C to about 35°C, about 15°C to about 30°C, and about 15°C to about 25°C. In some aspects, the reaction temperature can be about 15°C, about 16°C, about 17°C, about 18°C, about 19°C, about 20°C, about 21°C, about 22°C, about 23°C, about 24°C, or about 25°C.
[0078] The CFPS reactants can include any organic anion suitable for CFPS. In one aspect, the organic anion can be glutamate or acetate, among others. In one aspect, the concentration of the organic anion is independently in the general range of about 0 mM to about 200 mM, including specific intermediate values within this general range, such as about 0 mM, about 10 mM, about 20 mM, about 30 mM, about 40 mM, about 50 mM, about 60 mM, about 70 mM, about 80 mM, about 90 mM, about 100 mM, about 110 mM, about 120 mM, about 130 mM, about 140 mM, about 150 mM, about 160 mM, about 170 mM, about 180 mM, about 190 mM, and about 200 mM.
[0079] The CFPS reactant can also include any halide anion suitable for CFPS. In one aspect, the halide anion can be chloride, bromide, or iodide, among others. One preferred halide anion is chloride. In general, the concentration of the halide anion, when present in the reactant, is within the general range of about 0 mM to about 200 mM, including intermediate specific values within this general range, such as those generally disclosed herein for organic anions.
[0080] The CFPS reactant can also include any organic cation suitable for CFPS. In one aspect, the organic cation can be a polyamine, particularly spermidine or putrescine. Preferably, a polyamine is present in the CFPS reactant. In one aspect, the concentration of the organic cation in the reactant can generally be from about 0 mM to about 3 mM, from about 0.5 mM to about 2.5 mM, or from about 1 mM to about 2 mM. In one aspect, two or more organic cations can be present.
[0081] The CFPS reactant can include any inorganic cation suitable for CFPS. For example, suitable inorganic cations can include monovalent cations (e.g., sodium, potassium, and lithium, among others); divalent cations (e.g., magnesium, calcium, and manganese, among others). In one aspect, the inorganic cation is magnesium. In such an aspect, the magnesium concentration can be within the general range of about 1 mM to about 50 mM, including specific intermediate values within this general range, such as about 1 mM, about 2 mM, about 3 mM, about 5 mM, about 6 mM, about 7 mM, about 8 mM, about 9 mM, and about 10 mM. In a preferred aspect, the inorganic cation concentration can be within the specific range of about 4 mM to about 9 mM, more preferably about 5 mM to about 7 mM.
[0082] The CFPS reactant includes NTPs. In one aspect, the reactant uses ATP, GTP, CTP, and UTP. In one aspect, the concentration of each NTP is in the range of about 0.1 mM to about 2 mM.
[0083] The CFPS reactants can also include any alcohol suitable for CFPS. In one aspect, the alcohol can be a polyol, more specifically, glycerol. In one aspect, the alcohol is present in the general range of about 0% (v / v) to about 25% (v / v), particularly including certain intermediate values of about 5% (v / v), about 10% (v / v), about 15% (v / v), and about 20% (v / v).
[0084] Methods for preparing proteins and sequence-specific biopolymers
[0085] One aspect of the present invention is a method for in vitro cell-free protein synthesis of sequence-specific biopolymers or proteins. The method involves contacting an RNA template encoding the sequence-specific biopolymer with a reaction mixture containing a cell extract from the GRO described above. Methods for cell-free protein synthesis of sequence-specific biopolymers have been previously described [1, 18, 26].
[0086] In some embodiments, the sequence-specific biopolymer or protein includes a product prepared by a method or platform that includes an amino acid. In some embodiments, the amino acid can be a natural amino acid. As used herein, a natural amino acid is a proteinogenic amino acid directly encoded by a codon in the universal genetic code. In some embodiments, the amino acid can be an unnatural amino acid. As used herein, an unnatural amino acid is an amino acid that does not produce a protein. An unnatural amino acid can also be referred to as a non-standard amino acid (NSAA) or non-canonical amino acid. In some embodiments, the sequence-specific biopolymer or protein can include multiple unnatural amino acids. In particular embodiments, the sequence-specific biopolymer or protein can include multiple of the same unnatural amino acid. The sequence-specific biopolymer or protein can include at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, or at least 40 unnatural amino acids, either the same or different.
[0087] Non-limiting examples of unnatural, non-canonical, and / or non-standard amino acids include p-acetyl-L-phenylalanine, p-iodo-L-phenylalanine, O-methyl-L-tyrosine, p-propargyloxyphenylalanine, p-propargyl-phenylalanine, L-3-(2-naphthyl)alanine, 3-methyl-phenylalanine, O-4-allyl-L-tyrosine, 4-propyl-L-tyrosine, tri-O-acetyl-GlcNAcp β-serine, L-dopa, fluorinated phenylalanine, isopropyl- L-phenylalanine, p-azido-L-phenylalanine, p-acyl-L-phenylalanine, p-benzoyl-L-phenylalanine, L-phosphoserine, phosphonoserine, phosphonotyrosine, p-bromophenylalanine, p-amino-L-phenylalanine, isopropyl-L-phenylalanine, non-natural analogues of the tyrosine amino acid; non-natural analogues of the glutamine amino acid; non-natural analogues of the phenylalanine amino acid; non-natural analogues of the serine amino acid; non-natural analogues of the threonine amino acid; non-natural analogues of the methionine amino acid; leucine amino acid non-natural analogs of acids; non-natural analogs of isoleucine amino acid; alkyl, aryl, acyl, azido, cyano, halo, hydrazine, hydrazide, hydroxyl, alkenyl, alkynyl, ether, thiol, sulfonyl, seleno, ester, thioacid, borate, boronate, 24UF24H, phosphono, phosphine, heterocycle, enone, imine, aldehyde, hydroxylamine, keto, or amino substituted amino acids, or combinations thereof; amino acids with photoactivatable crosslinkers; spin-labeled amino acids; fluorescent amino acids; metal-bonded amino acids. Synthetic amino acids; Metal-containing amino acids; Radioactive amino acids; Photocaged and / or photoisomerizable amino acids; Amino acids containing biotin or biotin analogs; Keto-containing amino acids; Amino acids containing polyethylene glycol or polyethers; Heavy atom substituted amino acids; Chemically or photocleavable amino acids; Amino acids with extended side chains; Amino acids containing toxic groups; Sugar-substituted amino acids; Amino acids containing carbon-linked sugars; Redox-active amino acids; α-hydroxy-containing acids; Aminothioacids; α,α-disubstituted amino acids; β-amino acids;γ-amino acids, cyclic amino acids other than proline or histidine, and aromatic amino acids other than phenylalanine, tyrosine, or tryptophan;
[0088] The methods described herein allow for the preparation of sequence-specific biopolymers or proteins with high fidelity to an RNA template. In other words, the methods described herein allow for the precise incorporation of unnatural, non-canonical, and / or non-standard amino acids encoded by the RNA template. In certain embodiments, the sequence-specific biopolymer encoded by the RNA template contains at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, or at least 40 unnatural, non-canonical, and / or non-standard amino acids, and the product prepared from the method encompasses at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the encoded unnatural, non-canonical, and / or non-standard amino acids.
[0089] The methods described herein also enable the preparation of a plurality of products prepared by the method. In some embodiments, at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% of the products prepared by the method are full-length. In some embodiments, the sequence-specific biopolymer encoded by the RNA template contains at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, or at least 40 unnatural, non-canonical, and / or non-standard amino acids, and at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% of the plurality of products prepared by the method include 100% of the encoded unnatural, non-canonical, and / or non-standard amino acids.
[0090] In some embodiments, the sequence-specific biopolymer or protein encodes a therapeutic product, a diagnostic product, a biomaterial product, an adhesive product, a biocomposite product, or an agricultural product.
[0091] Miscellaneous
[0092] Any methods described herein can be performed in any suitable order unless otherwise indicated herein or clearly contradicted by context. Any examples or exemplary language (e.g., "etc.") presented herein are intended merely to facilitate understanding of the invention and do not impose limitations on the scope of the invention unless otherwise recited in the claims. Nothing in the specification should be construed as indicating any non-claimed element essential to the practice of the invention.
[0093] Preferred aspects of the present invention are described herein, including the best mode known to the inventors for carrying out the invention. Variations of these preferred aspects will become apparent to those of skill in the art upon reading the foregoing description. The inventors expect that skilled artisans will utilize such variations as appropriate, and the inventors also envision that the invention may be practiced otherwise than as specifically described herein. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto to the extent permitted by applicable law. Moreover, the invention encompasses any combination of the above-described elements in all possible variations thereof unless otherwise specified herein or otherwise clearly contradicted by context.
[0094] Expanding chemical substrates for genetic code reprogramming
[0095] The subject matter disclosed herein relates to methods, systems, components, and compositions that can be used to synthesize sequence-specific polymers. In particular, these methods, systems, components, and compositions can be used to incorporate novel substrates, including non-standard amino acid monomers and non-amino acid monomers, into sequence-specific polymers. As disclosed herein, the novel substrates can be used to acylate tRNAs via flexizyme-catalyzed reactions. Thus, tRNAs acylated with the novel substrates can be used in synthesis platforms to incorporate the novel substrates into sequence-specific polymers.
[0096] The components disclosed herein include acylated tRNA molecules and donor molecules for preparing the acylated tRNA molecules. The disclosed acylated tRNA molecules are acylated with a moiety present in the donor molecule, which may be referred to herein as "R," and can be incorporated into a polymer (e.g., a sequence-specific polymer). R can include an amino acid moiety, non-limiting examples of which include an alpha-amino acid moiety, a beta-amino acid moiety, or a gamma-amino acid moiety.
[0097] In some embodiments, the acylated tRNA molecule is [ka] where: tRNA is a transfer RNA linked via a 3'-terminal ribonucleotide (for example, an ester bond formed between the 3'-terminal adenosine and the ribose).
[0098] In some embodiments, R is alkyl (e.g., butyl); cycloalkyl optionally substituted with amino (e.g., cyclobutyl, cyclopentyl, or cyclohexyl); heterocycloalkyl (e.g., cyclic secondary amines such as piperidinyl or piperazinyl); (heterocycloalkyl)alkyl (e.g., cyclic secondary amines such as (piperidinyl)methyl or (piperazinyl)methyl); alkenyl (e.g., 1-buten-4-yl); cyanoalkyl (e.g., cyanomethyl or cyanoethyl); aminoalkyl (e.g., aminopropyl, aminobutyl, aminopentyl, 1,1-dimethyl-3-amino-propanyl, methylaminopropyl, or aminohexyl); aminoalkenyl (e.g., 1-amino-2-propenyl); carboxylalkyl; alkylcarboxyalkyl esters (e.g., methylcarboxyethyl ester); haloalkyl (e.g., 2-bromo-propan-2-yl); nitroalkyl (e.g., nitromethyl); aryl ( For example, it can be selected from phenyl, pyrrolyl, thiophenyl, furanyl, pyridinyl, coumarinyl; (aryl)alkyl (e.g., benzyl, (phenyl)ethyl, or (pyrrolyl)ethyl); or (aryl)alkenyl (e.g., (phenyl)ethenyl); wherein the aryl or heteroaryl is optionally substituted with one or more substituents selected from hydroxyl (e.g., 3,4-dihydroxylphenyl), hydroxylalkyl (e.g., hydroxylmethyl), amino, aminoalkyl (e.g., aminomethyl), azido, cyano, acetyl, nitro, nitroalkyl (e.g., nitromethyl), halo, alkoxy (e.g., methoxy), and alkynyl.
[0099] In other embodiments, R is of the formula: [ka] (However, in this formula, n is 0 to 6; R 1 or R 2is selected from hydrogen, alkyl optionally substituted with amino (e.g., hexyl); cycloalkyl (e.g., cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl); heterocycloalkyl (e.g., piperidinyl); (heterocycloalkyl)alkyl (e.g., (piperidinyl)methyl); alkenyl; cyanoalkyl; aminoalkyl; aminoalkenyl; carboxyalkyl; alkylcarboxyalkyl ester; haloalkyl; nitroalkyl; aryl (e.g., phenyl); heteroaryl (e.g., pyridinyl); aryl(alkyl) (e.g., benzyl); heteroaryl(alkyl) (e.g., (pyridinyl)methyl); (aryl)alkenyl; wherein aryl or heteroaryl is optionally substituted with one or more substituents selected from alkyl, hydroxyl, hydroxylalkyl, amino, aminoalkyl, azido, cyano, acetyl, nitro, nitroalkyl, halo, alkoxy, and alkynyl; R 1 and R 2 combine to form a carbocyclic ring, optionally 3-, 4-, 5-, 6-, 7-, or 8-membered carbocyclic ring, optionally substituted with one or more substituents selected from hydroxyl, hydroxylalkyl, amino, aminoalkyl, azido, cyano, acetyl, nitro, nitroalkyl, halo, alkoxy, and alkynyl.
[0100] In some embodiments of the acylated tRNA molecule, R, R 1 , or R 2 is a substituted (aryl)alkyl. Optionally, R, R 1 , or R 2 may be selected from (3,4-dihydroxyphenyl)methyl, (pyrrol-2-yl)methyl, and (4-amino-phenyl)methyl.
[0101] In some embodiments of the acylated tRNA molecule, R, R 1 , or R 2is a substituted phenyl. Optionally, R can be selected from 4-nitrophenyl, 4-cyanophenyl, 4-azidophenyl, 3-acetylphenyl, 4-nitromethylphenyl, 2-fluorophenyl, 4-methoxyphenyl, 3-hydroxy-4-nitrophenyl, 3-amino-4-nitrophenyl, and 3-nitro-4-aminophenyl.
[0102] In some embodiments of the acylated tRNA molecule, R, R 1 , or R 2 is heteroaryl or substituted heteroaryl. Optionally, R, R 1 , or R 2 may be selected from pyridinyl (eg, pyridin-4-yl), fluoropyridinyl (eg, 3-fluoro-pyridin-3-yl), coumarinyl, pyrrolyl (eg, pyrrol-2-yl), thiophen-2-yl, and 5-aminomethyl-furan-3-yl.
[0103] In some embodiments of the acylated tRNA molecule, R, R 1 , or R 2 contains a primary amine group or a secondary amine group. Optionally, R, R 1 , or R 2 may be selected from 3-aminopropyl, 4-aminobutyl, 5-aminobutyl, 1,1-dimethyl-3-aminopropanyl, 3-methylamino-propanyl, 6-aminohexyl, 3-amino-1-propenyl, 2-aminocyclobutyl (e.g., 2(R)-aminocyclobutyl or 2(S)-aminocyclobutyl), 2-aminocyclopentyl (e.g., 2(R)-aminocyclopentyl or 2(S)-aminocyclopentyl), 2-aminocyclohexyl (e.g., 2(R)-aminocyclohexyl or 2(S)-aminocyclohexyl).
[0104] In some embodiments of the acylated tRNA molecule, R, R 1 , or R 2 optionally includes an amino-substituted cycloalkyl group. 1, or R 2 may be selected from cyclobutyl or aminocyclobutyl (such as 2-aminocyclobutyl (e.g., 2(R)-aminocyclobutyl or 2(S)-aminocyclobutyl)), cyclopentyl or aminocyclopentyl (such as 2-aminocyclopentyl (e.g., 2(R)-aminocyclopentyl or 2(S)-aminocyclopentyl)), and cyclohexyl or aminocyclohexyl (such as 2-aminocyclohexyl (e.g., 2(R)-aminocyclohexyl or 2(S)-aminocyclohexyl)).
[0105] In some embodiments of the acylated tRNA molecule, R, R 1 , or R 2 contains a cyclic secondary amine (such as piperidinyl or piperazinyl). 1 , or R 2 is selected from piperidin-4-yl, (piperidin-4-yl)methyl, piperazin-4-yl, and (piperazin-4-yl)methyl.
[0106] In some embodiments of the acylated tRNA molecule, R, R 1 , or R 2 is selected from alkyl (eg, butyl), alkenyl (eg, 3-butenyl), cyanoalkyl (eg, cyanomethyl or cyanoethyl), and alkylcarboxylalkyl ester (eg, methylcarboxylethyl ester).
[0107] Non-limiting examples of suitable R moieties can include those disclosed in Figure 15 of the present application, R 1 Part, or R 2 The R portion, R 1 Part, or R 2 The moieties can be incorporated into a polymer (eg, a sequence-directed polymer as disclosed herein).
[0108] The disclosed acylated tRNA molecules can include any suitable tRNA molecule. Non-limiting examples of suitable tRNA molecules can include tRNA molecules that contain an anticodon corresponding to any naturally occurring amino acid.
[0109] The disclosed acylated tRNA molecules can be prepared by reacting a tRNA molecule with a donor molecule in the presence of flexizyme (Fx).
[0110] In some embodiments, the preparation method comprises: (i) a flexizyme (Fx); (ii) a tRNA molecule; and (ii) a tRNA molecule of the formula: [ka] A donor molecule having tRNA is a transfer RNA linked via its 3'-terminal ribonucleotide (e.g., by an ester bond formed between the ribose of the 3'-terminal adenosine); R is as defined above; X is O or S; wherein LG is a leaving group.
[0111] Non-limiting examples of suitable R moieties for donor molecules can include those disclosed in Figure 15 of the present application. Non-limiting examples of suitable donor molecules can include those disclosed in Figures 20-22 and 27 of the present application.
[0112] In this preparation method, Fx catalyzes the acylation reaction between the 3'-terminal ribonucleotide of tRNA and a donor molecule, producing an acylated tRNA molecule (e.g., by forming an ester bond between the ribose and R moiety of the 3'-terminal adenosine of the tRNA molecule).
[0113] Any suitable Fx can be used in the disclosed preparation methods. Non-limiting examples of suitable Fx include aFx, dFx, and eFx.
[0114] Any suitable tRNA can be used in the preparation method. Non-limiting examples of tRNA molecules suitable for the preparation method can include tRNA molecules containing anticodons corresponding to any naturally occurring amino acid. In some embodiments, the tRNA contains the anticodon CAU (i.e., the anticodon for methionine). In other embodiments, the tRNA contains the anticodon GGU (i.e., the anticodon for threonine), the anticodon GAU (i.e., the anticodon for isoleucine), or the anticodon GGC (i.e., the anticodon for alanine).
[0115] The donor molecule for the R moiety in the preparation typically comprises a leaving group (LG). In some embodiments, LG comprises a cyanomethyl moiety, and the donor molecule comprises cyanomethyl ester (CME). In other embodiments, LG comprises a dinitrobenzyl moiety, and the donor molecule comprises dinitrobenzyl ester (DNB). In further embodiments, LG comprises a (2-aminoethyl)amidocarboxybenzyl moiety, and the donor molecule comprises (2-aminoethyl)amidocarboxybenzyl thioester (ABT).
[0116] The disclosed preparation methods are carried out under conditions that maximize the yield of acylated tRNA. In some embodiments, the preparation methods are carried out under reaction conditions that result in at least about 50% of the tRNA in the reaction mixture being acylated after reacting the reaction mixture for 120 hours, preferably under reaction conditions that result in at least about 50% of the tRNA in the reaction mixture being acylated after reacting the reaction mixture for 16 hours.
[0117] The disclosed methods, systems, components, and compositions can be used to prepare sequence-specific polymers in vitro and / or in vivo. In some embodiments, the disclosed methods can be performed in a cell-free synthetic system to prepare sequence-specific polymers, where the sequence-specific polymers are prepared by translating an mRNA that contains a codon that corresponds to the anticodon of an acylated tRNA molecule.
[0118] In the disclosed methods, the R group of an acylated tRNA molecule is incorporated into a sequence-specific polymer during translation of an mRNA. In some embodiments of the disclosed methods, the R group of an acylated tRNA molecule is incorporated into a sequence-specific polymer at the start codon (AUG) of the mRNA during translation of the mRNA. In other embodiments of the disclosed methods, the R group of an acylated tRNA molecule is incorporated into a sequence-specific polymer at the codon for threonine (e.g., ACC), isoleucine (e.g., AUC), or alanine (e.g., GCC) during translation of the mRNA.
[0119] The disclosed methods can be practiced to prepare polymers selected from, by way of non-limiting example, polyolefin polymers, aramid polymers, polyurethane polymers, polyketide polymers, conjugated polymers, D-amino acid polymers, β-amino acid polymers, γ-amino acid polymers, δ-amino acid polymers, ε-amino acid polymers, ζ-amino acid polymers, and polycarbonate polymers.
[0120] Also disclosed herein are novel donor molecules or monomers that can be incorporated into polymers (e.g., sequence-specific polymers disclosed herein) as disclosed herein.
[0121] In some embodiments, the polymer containing the incorporated novel donor molecule or monomer has the formula: [ka] A polymer having a formula selected from the group consisting of: R is as defined above; Y is O, S, or N). A "polymer" is a polymer into which novel donor molecules or monomers have been incorporated, for example, at one or both ends and / or within. Illustrative Embodiments
[0122] The following embodiments are illustrative and are not intended to limit the scope of the claimed subject matter.
[0123] Embodiment 1. Ester or thioester substrates as donor molecules for acylation of tRNA or synthetic tRNA (e.g., microhelical RNA), and methods for synthesizing ester and thioester substrates, wherein the ester substrates are derived from 1) linear (long) carbon chain (γ-, δ-, ε-, and ζ-) amino acids, or 2) cyclic amino acids containing a cyclobutane, cyclopentane, cyclohexene, furan, piperidine, or piperazine moiety, and the ester substrates include a leaving group optionally present in cyanomethyl esters (CME), dinitrobenzyl esters (DNB), or (2-aminoethyl)amidocarboxybenzylthioesters (ABT).
[0124] Embodiment 2. Use of a flexizyme (Fx) system (e.g., including eFx, dFx, or aFx) to acylate a tRNA and / or a microhelix molecule with a donor moiety of a donor molecule, wherein said donor moiety may be defined as "R" as disclosed herein, and R may be a non-canonical amino acid substrate or a non-amino acid substrate.
[0125] Embodiment 3. Acylation of a microhelix or tRNA with a non-canonical amino acid or non-amino acid substrate.
[0126] Embodiment 4. Incorporation of non-canonical amino acid or non-amino acid substrates into sequence-specific polymers by adding pre-charged tRNA to an in vitro (cell-free) protein synthesis platform.
[0127] Embodiment 5. Identification of criteria for compatibility between donor molecules and flexizymes to achieve acylation of tRNA or microhelical RNA.
[0128] Embodiment 6. tRNA synthesis using non-canonical synthetic substrates (fMet(CAU))Use of eFx, dFx, and aFx to redefine
[0129] Embodiment 7. tRNA synthesis using non-canonical synthetic substrates (Pro1E2(GGU)) Use of eFx, dFx, and aFx to redefine
[0130] Embodiment 8. The use of reprogrammed tRNAs to incorporate non-canonical substrates into the start codon (ATG) of transcribed mRNA in a cell-free protein synthesis system.
[0131] Embodiment 9. The use of reprogrammed tRNA to incorporate non-canonical substrates into Thr codons (ACC) of transcribed mRNA in a cell-free protein synthesis system.
[0132] Embodiment 10. Purification and characterization of sequence-specific polymers comprising non-canonical substrates as disclosed herein.
[0133] Embodiment 11. The non-canonical substrates or variants thereof (and / or tRNAs acylated with the non-canonical substrates or variants thereof) disclosed herein as novel monomers for use in cell-free (in vitro) protein or polymer synthesis, including different types of long carbon chain and cyclic amino acids.
[0134] Embodiment 12. A non-canonical substrate or variant thereof (and / or a tRNA acylated with a non-canonical substrate or variant thereof) disclosed herein as a monomer for use in in vivo polymer synthesis, including different types of long carbon chain and cyclic amino acids.
[0135] Embodiment 13. A non-canonical substrate or variant thereof (and / or a tRNA acylated with a non-canonical substrate or variant thereof) disclosed herein for synthesizing a polymer using a non-natural amino acid monomer and / or a non-amino acid monomer non-α-amino acid monomer (NNA), such as a polyolefin polymer, a polyaramid polymer, a polyurethane polymer, a polyketide polymer, a polycarbonate polymer, a conjugated polymer, a gamma-amino acid polymer, a delta-amino acid polymer, an epsilon-amino acid polymer, a zeta-amino acid polymer, an oligosaccharide, an oligonucleotide, a polyvinyl polymer, and a polyfuran polymer.
[0136] Embodiment 14. The novel monomers disclosed herein or variants thereof (and / or tRNAs acylated with non-canonical substrates or variants thereof) for synthesizing polymers using non-natural amino acid monomers and / or non-amino acid monomers non-α-amino acid monomers (NNAs), such as polyolefin polymers, polyaramid polymers, polyurethane polymers, polyketide polymers, polycarbonate polymers, conjugated polymers, gamma-amino acid polymers, delta-amino acid polymers, epsilon-amino acid polymers, zeta-amino acid polymers, oligosaccharides, oligonucleotides, polyvinyl polymers, and polyfuran polymers.
[0137] Embodiment 15. 1) Synthesis of 16 β-amino acid ester substrates derived from 2-aminocyclohexylcarboxylic acid (2-ACHC), 2-aminocyclopentylcarboxylic acid (2-ACPC), 2-aminocyclobutylcarboxylic acid (2-ACBC), and 2-aminocyclopropancarboxylic acid (2-ACPrC).
[0138] Embodiment 16. 2-ACHC and 2-ACPC have four different stereochemical properties.
[0139] Embodiment 17. 2-ACBC and 2-ACPrC are commercially available only in isomeric forms, i.e., the racemic mixtures cis-ACBC, trans-ACBC, cis-ACPrC, and trans-ACPrC.
[0140] Embodiment 18. Synthesis of (1R,2R)-2-ACHC, (1R,2S)-2-ACHC, (1S,2R)-2-ACHC, and (1S,2S)-2-ACHC using dinitrobenzyl ester (DNB) leaving groups.
[0141] Embodiment 19. Synthesis of (1R,2R)-2-ACPC, (1R,2S)-2-ACPC, (1S,2R)-2-ACPC, and (1S,2S)-2-ACPC using a dinitrobenzyl ester (DNB) leaving group.
[0142] Embodiment 20. Synthesis of cis-2-ACBC and trans-2-ACBC using dinitrobenzyl ester (DNB) and (2-aminoethyl)amidocarboxybenzylthioester ABT leaving groups.
[0143] Embodiment 21. Synthesis of cis- and trans-2-ACPrC using dinitrobenzyl ester (DNB) and (2-aminoethyl)amidocarboxybenzylthioester ABT leaving groups.
[0144] Embodiment 22. Utilizing an Fx system (eFx, dFx, and aFx) to optimize tRNA / microhelix acylation with said amino acid.
[0145] Embodiment 23. Acylation of a microhelix and a tRNA with said non-canonical amino acid substrate.
[0146] Embodiment 24. Incorporation of said non-canonical substrate into a peptide by adding said pre-charged tRNA to an in vitro (cell-free) protein synthesis platform.
[0147] Embodiment 25. Utilizing eFx, dFx, and aFx to redefine tRNA(fMet(CAU)) using said 26 non-canonical synthetic substrates.
[0148]
[0033] Embodiment 26. The method for producing tRNAs using the 266 non-canonical synthetic substrates. Pro1E2 Utilizing eFx, dFx, and aFx to redefine (GGU).
[0149] Embodiment 27. The use of reprogrammed tRNAs to incorporate the 14 non-canonical substrates into the start codon (ATG) of transcribed mRNA in a cell-free protein synthesis system.
[0150] Embodiment 28. The use of reprogrammed tRNAs to incorporate the 14 non-canonical substrates at the Thr codon (ACC) of transcribed mRNA in a cell-free protein synthesis system.
[0151] Embodiment 29. Purification and characterization of functionalized peptides.
[0152] Embodiment 30. Non-canonical substrates or variants thereof (including two different types of long carbon chain and cyclic amino acids) disclosed herein as novel monomers for use in cell-free (in vitro) protein or polymer synthesis.
[0153] Embodiment 31. Utilizing the non-canonical substrates or variants thereof disclosed herein (including two different types: long carbon chain and cyclic amino acids) as novel monomers for in vivo polymer synthesis.
[0154] Embodiment 32. The use of cyclic beta-amino acids and cyclic gamma-amino acids and their incorporation into polymers by ribosomes.
[0155] Embodiment 33. Use of novel monomers and variants thereof for the synthesis of polymers using non-natural non-α-amino acid monomers (NNA) required for the biosynthesis of sequence-defined nylons, spider silks, polyolefins, polyaramids, polyurethanes, polyketides, polycarbonates, conjugated polymers, gamma-amino acid polypeptides, delta-amino acid polypeptides, epsilon-amino acid polypeptides, zeta-amino acid polypeptides, oligosaccharides and oligonucleotides, polyvinyls, polyfurans.
[0156] Embodiment 34. Use of novel monomers and variants thereof for the synthesis of polymers using non-natural non-α-amino acid monomers (NNA) required for the biosynthesis of sequence-defined nylons, spider silks, polyolefins, polyaramids, polyurethanes, polyketides, polycarbonates, conjugated polymers, gamma-amino acid polypeptides, delta-amino acid polypeptides, epsilon-amino acid polypeptides, zeta-amino acid polypeptides, oligosaccharides and oligonucleotides, polyvinyls, polyfurans. [Example]
[0157] The following examples are illustrative and are not intended to limit the scope of the claimed subject matter.
[0158] Example 1 – Expanding Chemical Substrates for Genetic Code Reprogramming
[0159] summary
[0160] Through the development of Flexizyme, a ribozyme that promiscuously charges any amino acid monomer onto tRNA, traditional amino acid-tRNA assignment has been expanded to encompass non-canonical chemical substrate-tRNA pairs, which are then incorporated into ribosomal peptides in a site-directed manner. However, most substrates used with Flexizymes have so far been limited to amino acids and hydroxy acids, fundamentally limiting the range of sequence-specific polymers that can be synthesized using genetic code reprogramming approaches. In this work, we provide comprehensive empirical data for a variety of non-canonical substrates in Flexizyme-catalyzed acylation reactions. Based on our results, we extend the range of such substrates to six different types, including phenylalanine analogs, benzoic acid derivatives containing electron-withdrawing or electron-donating groups, heteroatom rings, and aliphatic chains. From this data, we hypothesize design rules that may play an essential role in expanding the range of substrates compatible with Flexizymes. Furthermore, using wild-type translation machinery in a cell-free protein synthesis system and reprogrammed fMet-tRNA, we demonstrate the incorporation of 32 non-canonical substrates into ribosomal peptides. The engineered translation machinery allows for the introduction of additional compounds, thereby significantly expanding the range of functionalized polymers that can be produced by the cellular translation apparatus.
[0161] application
[0162] Non-limiting examples of applications of the disclosed technology include: (i) establishing design rules for chemical substrates compatible with Fx; (ii) expanding the range of non-canonical chemical substrates to enable the creation of novel functional polymers; (iii) utilizing genetic code reprogramming approaches to redefine tRNAs with non-canonical substrates; (iv) creating engineered peptides by incorporating new functionality; and (v) understanding the most (and non-critical) molecular interactions within the catalytic site of Fx through computer modeling.
[0163] advantage
[0164] Non-limiting examples of the advantages of the disclosed technology include: (i) the expansion of Fx-compatible substrates to non-canonical chemical substrates (i. phenylalanine analogs, ii. heteroaromatic substrates, iii. aliphatic substrates, and iv-v. benzoic acid derivatives with electron-withdrawing and electron-donating groups); (ii) enabling Fx to charge substrates with high acylation yields; (iii) determining design rules for non-canonical substrates based on substituent effects (electronic and steric); (iv) demonstrating the incorporation of the 32 non-canonical substrates into the N-terminus of peptides in a cell-free platform, most of which have never been discovered or studied before; and (v) the ability to synthesize these 32 peptides. (vi) demonstrated computational modeling to identify substrate interactions in the active site of Fx; (vii) this work opens the possibility of generating novel functional peptides containing exotic monomers, thereby enabling the generation of sequence-specific polymers in the ribosome with novel covalent bonds (e.g., carbon-carbon or carbon-nitrogen bonds) between the monomers; and (viii) additionally, this work extends research to engineer ribosome variants and other related translational apparatus that enable the synthesis of such novel polymers.
[0165] Description of the technique
[0166] Current studies have reported that over 150 non-canonical substrates can be charged to tRNAs and incorporated into peptides using the Fx approach, and many strategies have been devised to synthesize tRNAs charged with non-canonical amino acids. However, limitations and gaps still exist in the substrate range. Misacylated tRNAs can be synthesized by using protected pdCpA followed by ligation with a truncated tRNA lacking the 3'-terminal CA nucleotide using an enzyme (e.g., T4 RNA ligase). However, this method is synthetically cumbersome and often results in poor results due to the generation of cyclic tRNA byproducts that inhibit ribosomal peptide synthesis. Ester bonds for misacylated tRNAs can also be obtained using engineered synthetase / orthogonal tRNA pairs. However, only the high specificity of synthetases for amino acid substrates allows them to charge a narrow substrate pool, which often requires extensive work (e.g., directed evolution) to develop new synthetases.
[0167] Another method for generating misacylated tRNAs is the use of flexizyme (Fx). Fx is an artificial ribozyme capable of aminoacylating any tRNA. The Fx system has been widely successful over the last decade, incorporating a wide range (>150) of chemical substrates (α-amino acids, β-amino acids, γ-amino acids, D-amino acids, non-standard amino acids, N-protected (alkylated) amino acids, and hydroxy acids) into ribosomal peptide chains via misacylated tRNAs.
[0168] Here, we systematically expand the substrate scope of the Fx and WT translational apparatus to a variety of non-canonical substrates (Phe analogs, benzoic acid derivatives, heteroatoms, and aliphatic chains) that remain acceptable. We further demonstrate that the use of the E. coli translation machinery through a purified reconstituted system (PURExpress) enables the generation of numerous functionalized peptides. Compared to our work, previous studies have mostly focused on amino acid variants as Fx-compatible substrates. Second, hydroxy acid variants have only been discovered as possible substituents for non-amino acid substrates. Third, no theoretical basis for the design of Fx-compatible chemical substrates that would significantly expand the boundaries of the substrate pool has been developed. Finally, no computational studies exist that identify molecular interactions in the Fx binding pocket and facilitate the efficient design of monomers for de novo polymer synthesis.
[0169] Our rationale for designing substrates for Fx-catalyzed acylation may shorten the timeline for developing and testing monomers that can provide new functionality. Furthermore, because information on the molecular interactions of substrates with the Fx binding pocket is currently lacking, our computational modeling results on intermediates formed during Fx-catalyzed acylation reactions may serve as a fundamental resource for chemists, biochemists, and molecular biologists, as well as protein engineers, to select appropriate noncanonical substrates. Specifically, our results may aid in the study of efficient mutations within the Fx active site, which could derive significant computational benefits.
[0170] Additionally, the discovery of 32 noncanonical substrates across five distinct subsets provides an overview of substrate diversity and characterizes its impact on peptide synthesis, potentially allowing these findings to serve as prototypes for other noncanonical chemical substrates. Finally, our set of substrate variants may be readily applicable to chemical substrate variants for the synthesis of a variety of peptides, including precursors for therapeutic drugs and macrocycles. This novel and comprehensive study has benefits for basic biology and synthetic / engineering biology.
[0171] Related technologies
[0172] Related technology may be described in one or more of the following patent and non-patent documents (which are incorporated herein by reference in their entireties): U.S. Patent Nos. 5,478,730; 5,556,769; 5,665,563; 6,168,931; 6,518,058; 6,783,957; 6,869,774; 6,994,986; 7,118,883; 7,189,528; 7,338,789; 7,387,884; 7,399,610; 9,410,148; 9,528,137; 9,951,392; 9,688,994, and 9,783,800. U.S. Published Patent Application Nos. 2009 / 0281280; 2012 / 0171720; 2016 / 0060301; 2016 / 0083688; 2016 / 0209421; 2016 / 0289668; 2017 / 0073381; 2017 / 0306320; 2017 / 0349928; and 2018 / 0016614. Published international applications WO2008 / 059823; WO2011 / 049157; WO2012 / 026566; WO2012 / 074129; WO2012 / 074130; WO2013 / 100132; WO2014 / 119600; WO2016 / 199801; EP2141175; JP2013071904; JP2018509172; and JP2017216961. Non-patent literature: Passioura and Suga, "Flexizymes, their evolutionary history and diverse utilities," Top Curr Chem. 2014:344-45.
[0173] Example 2 – Expansion of chemical substrates in genetic code reprogramming
[0174] See the presentation entitled "Expanding Chemical Substrates in Genetic Code Reprogramming" (Joongoo Lee, Kenneth Schwieter, Do Soon Kim, Jeffrey Moore, and Michael Jewett, to be presented at the 2018 Synthetic biology: Engineering, Evolution, & Design (SEED) conference, Scottsdale, Arizona, June 3-4, 2018), the contents of which are incorporated herein by reference in their entirety.
[0175] summary
[0176] The translation apparatus is the cellular factory for protein synthesis. During protein synthesis, the translating biological machine generates polymers with peptide backbones by coupling α-amino acids according to the coding sequence of an mRNA template. While numerous pioneering efforts have expanded the genetic code for protein synthesis to over 150 non-standard amino acids, the covalent bonds in polymers synthesized by ribosomes have been limited to polypeptide (amide) or polyester bonds. Herein, we explore new environments and monomeric templates that enable the creation of organic sequence-specific polymers (SDPs) with diverse covalent chemical bonds. Using the flexizyme system, we redefine individual codons to generate SDPs with non-peptide backbones under the control of a reprogrammed genetic code using an engineered cell-free translation system.
[0177] Introduction
[0178] Protein synthesis by ribosomes is achieved by the polymerization of amino acids covalently attached to transfer RNA (tRNA) through aminoacylation (i.e., "charging"). Therefore, tRNAs aminoacylated with amino acids are called "charged tRNAs." Ribosomes translate codons present in mRNA by matching them with the corresponding anticodons present on the surface of the charged tRNA. The amino acids on the charged tRNAs are then incorporated into nascent polypeptides corresponding to the translated mRNA via the ribosome.
[0179] In modern organisms, protein enzymes called aminoacyl-tRNA synthetases (ARSs) catalyze the aminoacylation of tRNA. However, ribozymes that aminoacylate tRNAs with activated amino acids have been discovered in vitro and have been named "flexizymes." Flexizymes and their use in gene reprogramming are known in the art. (See, e.g., Ohuchi et al., "The flexizyme system: a highly flexible tRNA aminoacylation tool for the translational apparatus," Curr Opin Chem Biol. 2007 Oct; 11(5):537-42; Xiao et al., "Structural basis for specific tRNA aminoacylation by in vitro selected small ribozymes," Nature 454, 358-361 (2008); Passioura and Suga, "Flexizyme-mediated gene reprogramming as a tool for non-canonical peptide synthesis and drug discovery," Angewandte Chemie, Volume 19, Issue 21, pages 6530-6536, May 17, 2013; and Katoh et al., "Advances in in vitro genetic code reprogramming from 2014 to 2017," Synthetic Biology, Volume 3, Issue 1, May 31, (See, e.g., J. Am. Chem. Soc. 2018, the contents of which are incorporated herein by reference in their entirety.) Flexizymes can be evolved and selected in vitro to catalyze the aminoacylation of tRNAs with non-standard amino acids, and the non-standard amino acids can be incorporated into nascent polypeptides using tRNAs so charged. Thus, the flexizyme system allows for reprogramming of the genetic code by redefining codons typically assigned to natural amino acids to assign non-standard amino acids or other residues, thereby enabling mRNA-directed synthesis of unnatural polypeptides.
[0180] Figure 1 shows the Flexizyme system. Figure 1A) shows the crystal structure of Flexizyme. Figure 1B) shows the acylation of tRNA by Flexizyme and the leaving group commonly used to prepare activated ester substrates. This leaving group can be loaded onto tRNA or a microhelix via Flexizyme.
[0181] result
[0182] Chemical substrates for loading into tRNA or microhelices can be prepared by converting protected α-amino acids or protected β-amino acids into the corresponding esters (see Figures 2A and 2B, respectively).
[0183] Aminoacylation catalyzed by Flexizyme (Fx) was optimized using a microhelix (22 nt) as a tRNA mimic (see Figure 3). The optimization reaction was carried out in 50 mM HEPES-KOH (pH 7.5) or in bicine (pH 8.8) buffer containing 0.3 M MgCl2, 1 μM microhelix, 5 μM Fx, 2.5 mM amino acid substrate (e.g., esterified amino acid substrate), and 20% DMSO. The reaction mixture was incubated at 0°C and monitored for 72 h. The yield of the acylated product was determined by quantitating band intensity using software (ImageJ). Microhelix was commercially obtained (Integarated DNA Technologies (IDT)) and used as received. The tRNAs of interest were acylated with L-Ser, D-Ser, β-Gly, and β-Phe under the same conditions as those used in the microhelix experiments. The reprogrammed tRNAs were then added to a cell-free synthesis platform (PURExpress). The tRNAs corresponding to AUC, ACC, and GCC were reprogrammed with unnatural amino acid substrates using the Fx system (see Figure 4). The unnatural amino acids were incorporated into polypeptides using a cell-free protein synthesis (CFPS) platform (see Figure 5) and the reprogrammed tRNAs (see Figures 6a-f). It was observed that mRNAs have an optimal codon order for the sequential incorporation of amino acids (see Figures 6e and f).
[0184] conclusion
[0185] We designed monomers that form new covalent chemical bonds by ribosomes in nascent sequence-specific polymers, enabling the synthesis of such sequence-specific polymers in a cell-free synthesis (CFPS) platform. Potential polymer backbones include polyester backbones, polythioester backbones, or the general "polyABCer" backbone (see Figure 7). As a proof-of-concept, we found that when tRNA was charged with nine amino acids by our Fx system, the nine amino acids charged to the tRNA were incorporated into polypeptides in the CFPS platform.
[0186] Example 3 – Expansion of chemical substrates in genetic code reprogramming
[0187] See Lee et al., "Expanding the Restrictions of the Second Genetic Code Using Ribozymes," Nat. Commun. 2019, Nov 8;10(1):5097, the contents of which are incorporated herein by reference in their entirety.
[0188] summary
[0189] Site-specific incorporation of non-canonical amino acids into polypeptides through genetic code reprogramming is a powerful approach for generating biobased products that extend beyond natural limitations. A diverse repertoire of chemical substrates can be used in ribosome-mediated polymerization, but most have been limited to amino acids and hydroxy acids. Here, we attempt to identify design rules for flexizyme-mediated charging of non-canonical monomers onto tRNA that could expand the range of substrates for ribosome-mediated polymerization. To achieve this goal, we synthesized 38 new substrates based on four scaffolds (phenylalanine derivatives, benzoic acid derivatives, heteroaromatic monomers, and aliphatic monomers) and found that 32 could be acylated and attached to tRNA under optimized reaction conditions. All of these substrates could be incorporated into the N-terminus of ribosomal peptides using in vitro translation. Our work provides design rules for flexizyme-catalyzed acylation, expanding the range of chemical substrates for repurposing the translational apparatus.
[0190] Introduction
[0191] The translational apparatus is the cellular factory for protein synthesis, incorporating L-α-amino acid substrates from defined genetic templates into sequence-specific polymers (proteins). Protein elongation rates of up to 20 amino acids per second and with remarkable precision (approximately 99.99% fidelity) 1-3 The E. coli protein biosynthetic system (with its ribosomes and associated factors required for polymerization) has incredible catalytic power. This has long motivated efforts to understand and exploit artificial versions of it in biotechnology. However, nature utilizes only a limited set of protein monomers, resulting in a limited set of biopolymers (i.e., proteins). The natural repertoire of ribosomal monomers 4-12Extending this potential could lead to a new class of bio-based products using a wide variety of genetically encoded chemistries. Natural ribosomes have previously been shown to be able to selectively incorporate a wide range of chemical substrates into growing polymer chains, allowing for greater control and flexibility in design, particularly in vitro. 13 These chemical substrates include α- 14 , β- 15 , γ- 16 , D- 17,18 , N-alkylated 19, 20 , non-canonical amino acids 21 , hydroxy acids 22,23 ,peptide 24 , oligomeric foldamer-peptide hybrids 25 , and non-amino carboxylic acids 26, 27 The incorporation of such a broad and diverse set of monomers has implications for the production of novel therapeutic agents, enzymes, and materials, particularly for the site-specific incorporation of non-canonical amino acids into peptides and proteins. 28-34 .
[0192] For a ribosomal monomer to be selectively incorporated into the growing chain by the ribosome, that monomer must be covalently linked (or charged) to a transfer RNA (tRNA) to become an aminoacyl-tRNA substrate. Many strategies have been devised to synthesize such non-canonical aminoacyl-tRNAs, or "misacylated" tRNAs. Classical strategies include chemical aminoacylation, synthesis of 5'-phospho-2'-deoxyribocytidylylriboadenosine (pdCpA) dinucleotides, ester coupling with amino acid substrates, and enzymatic (e.g., T4 RNA ligase) cleavage of tRNAs. 35-39 Unfortunately, chemical aminoacylation is difficult and technically challenging, resulting in the generation of cyclic tRNA by-products that inhibit ribosomal peptide synthesis. 40Another strategy is to engineer protein enzymes called aminoacyl-tRNA synthetases (aaRSs), which naturally charge tRNAs with canonical amino acids, through directed evolution. 41-50 However, aaRSs have a limited range of non-canonical chemical substrates and are generally limited to a narrow range of amino acid analogs that resemble natural amino acids.
[0193] More recently, an alternative approach has been developed to generate misacylated tRNAs using an RNA enzyme known as flexizyme (Fx). Pioneered by Suga and coworkers, this flexible and powerful approach converts the 3'-OH of any tRNA into an activated ester. 52-55 can be exclusively aminoacylated with 51 (Fig. 8a). Through directed evolution and sequence optimization, three different flexizymes (eFx, dFx, and aFx) were generated. 5 have been developed to recognize specific substrate:activating group combinations. 56 revealed that aryl groups, either in the substrate side chain or the leaving group, are crucial for substrate interaction with the catalytic binding pocket of Fx. For example, eFx contains an aryl group and acylates tRNA with acids activated by cyanomethyl esters (CMEs), whereas dFx recognizes non-aryl acids activated by dinitrobenzyl esters (DNBEs). 57 For substrates lacking an aryl group or with low solubility due to the presence of DNBE, (2-aminoethyl)amidocarboxybenzylthioester (ABT) 58 A leaving group-recognizing aFx has been developed that provides the required aryl group and better water solubility (Figure 8a, bottom).
[0194] The unique potential of the flexizyme approach is that virtually any amino acid can be charged to any tRNA, as long as the side chain is stable to the conditions of the acylation reaction (or appropriately protected / deprotected in the case of reactive side chains), allowing specific codons to be reassigned to new amino acids. The development of flexizymes therefore significantly expands the known permissible space of monomers used in translation by genetic code reprogramming. However, the range of incorporated monomers has so far been limited mainly to amino acids. 23 and hydroxy acids 33 Design rules for flexizyme-mediated charging may more efficiently guide the exploration of non-canonical monomers, but they are still being identified. To expand the design space available for ribosome-mediated template-guided polymerization beyond polypeptides or polyesters to polymers, renewed efforts are needed to explore the constraints that limit the range of non-canonical monomer diversity acceptable for both flexizyme-mediated charging and ribosome-mediated translation.
[0195] Here, we attempt to fill this knowledge gap by systematically expanding the range of chemical substrates for flexizyme-mediated charging followed by translation using native ribosomes (Figure 8). Specifically, we synthesized a repertoire of 38 phenylalanine derivatives, benzoic acid derivatives, heteroaromatic monomers, and aliphatic monomers designed based on known compatible scaffolds. We purposefully selected potential substrates that feature chemical moieties inaccessible to peptides synthesized by native ribosomes or their post-translationally modified derivatives, or that may support novel AB polycondensation reactions (rather than amide and ester bonds). After chemically synthesizing activated esters, we evaluated the ability of flexizyme to charge these substrates onto tRNA by varying pH and time, and created optimized acylation conditions. Thirty-two of the 38 substrates were found to charge onto tRNA, revealing trends that will help guide the search for novel monomers more efficiently. To gain insight into substrate-flexizyme compatibility, we also used computer modeling to study the molecular interactions of the substrate with nucleic acid residues in the binding pocket of flexizymes that exhibit high or low acylation yields. Finally, we investigated whether wild-type ribosomes could utilize novel tRNA-monomers in the commercially available PURExpress™ cell-free translation system. Substrate-tRNA fMet N-terminal incorporation of novel monomers from the complex into peptides was possible for 32 substrates, whereas C-terminal incorporation of peptides by wild-type ribosomes was not possible.
[0196] Results and Discussion
[0197] Expanding the substrate repertoire for flexizyme (Fx)-catalyzed RNA acylation To expand the substrate range for Fx-catalyzed tRNA misacylation, we first determined a compatible substrate scaffold. To this end, we benchmarked the molecular structure of phenylalanine activated by CME (Phe-CME, A, Figure 9a, center) as the optimal substrate for eFx. 51, 56, 59, 61The substrate flexibility of eFx was investigated for a series of five substrates with increasing degrees of modification from the parent structure A (B–F, Figure 9a, center). Included among these are B (hydrocinnamic acid), the amine removed from A; C (cinnamic acid), the unsaturated form of B; D and E (benzoic acid and phenylacetic acid, respectively), in which two or one carbon atom is removed from B; and F (propanoic acid), in which the aryl in B is replaced with an aliphatic group.
[0198] First, we investigated the acylation efficiency of A to a small tRNA mimic, microhelical tRNA (mihx, 22 nt), by eFx under previously reported standard acylation conditions (pH 7.5, 0°C). 62The acylation rate was determined using the α,β-unsaturated substrate C (Figure 9a, top). Analysis of the reaction mixture by denaturing acidic polyacrylamide gel electrophoresis (PAGE) showed that 67% of mihx was acylated with A (Figure 9b, lane 1). With this benchmark established, we next screened five substrates for substrate-eFx compatibility. eFx successfully acylated mihx with B in 77% yield, indicating that the amine functionality is not required for aminoacylation (Figure 9b, lane 2). Further removal of the Phe structure from the α,β-unsaturated substrate C proved difficult because it was incompatible with mihx acylation by flexizyme under standard reaction conditions (Figure 9b, lane 3). However, increasing the reaction pH and time (from pH 7.5 to pH 8.8 and from 16 to 120 h; see Figures 13 and 14 for full details) improved the acylation of mihx with C, reaching 44% and 74% after 16 and 120 h, respectively (Figure 9b, lanes 6 and 7). Notably, the newly established pH of 8.8 increased the yields for A and B to 82% and 100%, respectively (Figure 9b, lanes 4 and 5). To a lesser extent, D and E were also acylated to mihx in 16% and 40% yields, respectively (Figure 9b, lanes 8 and 9). As expected, the aliphatic substrate F was not charged to mihx by eFx because the substrate does not contain an aryl group for substrate recognition by eFx (Figure 9b, lane 10). However, by changing the leaving group of the substrate from CME to ABT and using aFx instead of eFx, it was possible to charge the same aliphatic substrate G in 55% yield after 120 h (Figure 9b, lane 11). Thus, using the newly established acylation conditions and the appropriate leaving group and Fx, all five substrates can be successfully charged to the tRNA mimic.
[0199] Next, we attempted to further expand the substrate range by constructing scaffolds B, C, D, and G to identify acceptable substrates that could be used not only by the Fx system but also, later, by the ribosome (see below). To this end, we investigated the mihx-acylation efficiency of eFx and aFx using four sets of scaffold analogs: Phe analogs, including saturated and unsaturated aliphatic scaffolds with aryl groups; benzoic acid derivatives with diverse functional groups; heteroaromatic scaffolds with different electronic properties; and aliphatic scaffolds with various steric hindrances (Figure 10).
[0200] To explore saturated and unsaturated aliphatic scaffolds containing aryl groups, we explored Phe analogs with versatile functions derived from Fx substrates B and C (1-6).
[0201] Under optimal conditions, substrates 1–4 were charged to mihx with eFx in yields of 50–100% after 16 h and 100% after 120 h (Figures 15 and 16). Substrates 5 and 6, which contain an α,β-unsaturated scaffold, showed yields similar to their parent structure C. Both were charged with eFx less efficiently than saturated substrates (30% and 22% yields, respectively), likely due to increased structural rigidity that prevented interactions with the Fx binding pocket.
[0202] To further understand the substrate suitability of eFx for benzoic acid (D), a series of derivatives with varying electronic characteristics and substituent positions (ortho, meta, para) were prepared (electron-poor: 7–14, electron-rich: 15–18). The acylation efficiencies were determined by acid-denaturing PAGE and densimetric analysis (Figures 15, 17, and 18). For the p-nitro-substituted substrate (7), the acylation yield of eFx was found to be 30% after 16 h and 76% after 120 h. For the unsubstituted substrate (D), the acylation yields were found to be 0% at 16 h and 16% at 120 h.
[0203] Similarly, high yields (28–48% at 16 h and 78–100% at 120 h) were observed for electron-poor substrates (8–11) bearing p-nitrile, p-azide, m-formyl, and m-nitromethyl groups, respectively. Conversely, substrates bearing moderately electron-donating groups (e.g., p-methoxy (15), p-ethynyl (16), and p-hydroxymethyl (17)) showed lower conversion rates; no acylation was observed after 16 h and only moderate yields (19–63%) were observed after 120 h. The electron-rich p-amino substrate 18 showed no conversion at all after 120 h. These results indicate a significant electron effect; conversion rates generally increased with electron-poor substrates and decreased with electron-rich substrates.
[0204] We tested this hypothesis by installing an electron-withdrawing nitro group at the meta position of the electron-poor Fx substrate 18 to give substrate 21. As expected, a slight improvement in yield of 10% was observed after 120 h. Swapping the substituent pattern to give substrate 20 (p-nitro and m-amine) further improved the reaction efficiency, resulting in a 55% yield after 120 h. This supports the trend in reactivity based on electronic characteristics. Additionally, ortho-substituent tolerance was observed to be dominated by steric effects. o-Fluoro-12 gave an 82% yield after 120 h, whereas substrates with larger ortho-substituents (o-iodo-13, o-formyl-14) were not charged to MIHx. The correlation between electronic characteristics and Fx-catalyzed acylation was further confirmed by examining the electron-poor heteroaromatic substrates pyridine 22, fluoro-pyridine 23, and coumarin 24. All three substrates were charged in high yields (45–100% at 16 h and 100% at 120 h), following the electronic trend. Conversely, the electron-rich five-membered heteroaromatic substrates (pyrroles 25 and 25a and thiophenes 26 and 26a; see Figure 19 for 25a and 26a) showed no reactivity in the Fx-catalyzed tRNA acylation reaction.
[0205] Finally, the substrate compatibility of aFx was investigated by examining its catalytic activity toward aliphatic variants derived from its substrate G. Linear aliphatic acids were found to be highly preferred substrates; alkenyl (27), cyano (28), and ester (29) analogs were found to be charged in 100% yield after 16 h. Nitroalkane (30) was a viable substrate but in low yield (25% at 16 h and 30% at 120 h). Conversely, the sterically hindered cyclohexyl (31) was charged more slowly (30% at 120 h). Furthermore, bromopropane (32) was only 10% charged after 120 h. This indicates that increased steric bulk further reduced Fx-catalyzed acylation.
[0206] In summary, 32 previously unknown Fx substrates were identified from the 38 analogs tested, significantly expanding the scope of Fx-catalyzed aminoacylation reactions. General design rules for potential Fx substrates were derived based on their molecular characteristics and efficiency in Fx-catalyzed acylation, with greatest success related to i) greater structural similarity to Phe in eFx, ii) electron-reducing features from the carbonyl region, and iii) less steric hindrance at the acylation site.
[0207] To gain further insight into possible constraints on using flexizymes to charge non-canonical chemical substrates onto tRNA, we next utilized computer modeling to better understand our data. 56 suggests that when an aromatic amino acid (such as Phe) is charged by Fx, the phenyl ring of the substrate is positioned against the terminal J1a / 3 base pair of Fx. Notably, the crystallized structures (PDB: 3CUL and 3CUN) contain only residual density for the phenylalanyl-ethyl ester ligand, suggesting a possible location of the substrate conformation in the active site. Rosetta 63To elucidate the molecular interactions of substrates in the Fx binding pocket, we constructed models (data not shown) of tetrahedral intermediates formed with tRNAs containing five representative substrates (A–E), as well as pyrrole-2-carboxylic acid (25, 25a) and 2-thiophenecarboxylic acid (26, 26a), which do not confer acylation yields for Fx catalysis (Figure 11). This modeling supports either a T-shaped configuration interaction between Phe and hydrocinnamic acid (B) or parallel configuration interactions between cinnamic acid (C), benzoic acid (D), and phenylacetic acid (E). Conversely, the pyrrole and thiophene groups fail to form particularly favorable interactions with the terminal J1a / 3 base pair. The absence of these interactions may explain our empirical observation that 25, 25a, and 26, 26a, which contain electron-rich heteroaromatic groups, are electron-poor substrates for eFx.
[0208] Novel Fx substrates are charged to tRNA and incorporated into peptides Next, we investigated whether the newly discovered Fx substrate, which can be charged to tRNA, is accepted by the natural protein translation machinery. Based on our optimized conditions, we used Fx-optimized tRNA instead of mihx. 62 The Fx-catalyzed acylation reaction was carried out using tRNA-monomers. The tRNA-monomers were then purified and added to cell-free protein synthesis reactions to allow translation to proceed, after which the incorporation of the novel substrate into the small reporter peptide was examined by MALDI-TOF mass spectrometry (Figure 12 and data not shown).
[0209] First, a well-established crude extract-based Escherichia coli cell-free protein synthesis (CFPS) method allows for high-level incorporation of non-canonical amino acids. 34, 64-67 However, we were unable to characterize the reporter peptide, likely because active peptidases in the extract digested the peptide. To avoid possible unwanted degradation, we used the commercially available PURExpress™ (Protein Synthesis with Recombinant Elements) system. 68The PURExpress™ system contains the minimal set of components required for protein translation, thereby minimizing any unwanted peptide degradation and allowing for the addition of a custom set of amino acids and tRNAs of interest.
[0210] Previous work, particularly from the Suga lab, has demonstrated that this platform can accelerate peptide synthesis, particularly with the N-terminal incorporation of non-canonical monomers. 25, 60 It was shown that it is suitable for evaluating 69 The reporter peptide encodes the translation initiation codon AUG for the incorporation of a novel Fx substrate into the N-terminus, a streptavidin (Strep) tag, and codons for Ser and Thr. A promoter-controlled DNA template (pJL1_StrepII) (XMWHSPQFEKST (SEQ ID NO: 15) (strep tag; italics) was designed (where X indicates the position of the novel Fx substrate; see SI for details). Peptide synthesis was performed using only the initiation codon AUG and nine amino acids encoding the purification tag (data not shown). Competition between endogenous tRNAs and Fx-charged tRNAs during peptide synthesis was eliminated by omitting the other 11 amino acids to prevent the corresponding endogenous tRNAs from being aminoacylated and used in translation. To this end, PURExpress™ reactions were incubated at 37 °C for 4 h. The synthesized peptides were then purified using Strep-Tactin®-coated magnetic beads (IBA), denatured with SDS, and characterized by MALDI-TOF mass spectrometry (Fig. 12a).
[0211] As a positive control experiment, peptides were prepared in the presence of all 20 natural amino acids and in the absence of any Fx-charged tRNAs, and the reporter mRNA was translated into MWHSPQFEKST (SEQ ID NO: 16) according to the standard genetic code. Indeed, two major peaks corresponding to the theoretical masses of the peptide ions were detected. The N-terminal Met residue was found to be formylated (fM) by formylase present in the PURE system (fMWHSPQFEKST, SEQ ID NO: 17). 70 [M+H]+ = 1405 (observed, obs), 1405 Da (calculated, cal), [M+Na]+ = 1427 (obs), 1427 Da (cal) (Figure 12b).
[0212] As a negative control, PURExpress™ reactions were performed in the presence of only the nine amino acids (W, S, H, P, Q, F, E, K, and T) encoding the residues downstream of the initiation codon; Met or misacylated tRNAfMet was not added to the reaction mixture. The MALDI spectrum shows only a single species for the synthetic peptide, giving masses of 1246 Da ([M+H]+) and 1268 Da ([M+Na]+) (Figure 12c). The observed peak corresponds to the theoretical mass of the peptide with the sequence WHSPQFEKST (SEQ ID NO: 18). This indicates that translation initiation can occur on the following mRNA codon if the amino acid for the initiation codon is not present in the CFPS system, a phenomenon that has been previously reported. 71 .
[0213] To incorporate non-canonical substrates (B-E and G) at the start codon, tRNA fMet The PURExpress™ reaction mixture contained a CAU anticodon corresponding to the AUG codon on the mRNA and all five substrates charged separately. The same amount of precipitated tRNA containing a mixture of charged and uncharged tRNA substrates was added to the PURExpress™ reaction mixture. The endogenous tRNAs charged with Met generated in the PURE system were fMetMethionine was not added to the reaction to avoid the incorporation of Met at the start codon by formylase. All peaks seen in the MALDI spectrum were found to correspond to the theoretical masses of peptides containing the substrate at the N-terminus (Figures 12d-i). It is noteworthy that the N-terminal Trp was found to be non-formylated (Figure 12c) compared to the N-terminal Met in Figure 12b, which was found to be fully formylated. The N-terminal Phe (Figure 12d) was found to be both formylated (fF) and non-formylated (F). This suggests that larger side chains may inhibit formylase from efficiently formylating the residue.
[0214] For other non-canonical substrates (B–G and 1–32, but excluding six substrates that did not show acylation; F, 13, 14, 18, 25, and 26), tRNA fMet The same acylation reaction as above was performed, and then 32 different peptides were synthesized using each substrate at the N-terminus. This indicates that all noncanonical substrates were incorporated into peptides. MALDI spectra were generated for the purified peptides (data not shown). Substrates with higher acylation yields tended to exhibit higher translation efficiencies (data not shown), indicating that the concentration of misacylated tRNAs is a limiting factor for translation. To characterize the N-terminal peptides more rigorously, we additionally quantified peptide yields (data not shown). These data support our hypothesis that this system is limited by misacylated tRNAs.
[0215] Ribosome-mediated polymerization of alternative AB polycondensation reactants (i.e., non-ester and non-amide bonds) may provide a new class of sequence-specific polymers. Misacylated tRNAs that recognize the ACC codon (Thr) on mRNA. GluE2 (GGU) to investigate the incorporation of several substrates at the peptide C-terminus, which would require the formation of a covalent carbon-carbon bond. Unfortunately, our attempts to create biopolymers with such bonds were unsuccessful.
[0216] conclusion
[0217] In this work, we attempted to systematically expand the scope of chemical substrates for translation through the identification of design rules for flexizyme-mediated charging of noncanonical monomers onto tRNA. Beyond commonly used amino acids and hydroxy acids, we demonstrated that tRNA can be acylated with a diverse repertoire of substrates constructed from scaffolds based on phenylalanine, benzoic acid, heteroaromatic, and aliphatic groups. Our rational approach to scaffold design enabled us to better identify design rules for charging novel monomers onto tRNA using flexizymes. As expected, we found that substrates more similar to phenylalanine are preferred for Fx-catalyzed acylation reactions. We also discovered new guiding principles, such as electron-poor substrates being preferred over electron-rich substrates, and that some bulky groups are unfortunately poorly tolerated near the acylation active site. Additionally, by using computer modeling to examine the molecular interactions of key substrates in the flexizyme binding pocket, we found that either T-shaped or parallel configuration interactions appear to be key features that enable charging by flexizymes. Beyond these design rules, we also demonstrated that tRNA-monomers from our extended substrates successfully generate diverse N-functionalized peptides through genetic code reprogramming in the PURExpress™ system. This is important because our data join a growing number of studies demonstrating that ribosomes can polymerize a wide range of substrates, particularly at the N-terminus. While the generation of novel N-terminal peptides per se was not our primary interest, they could be used in many ways by other researchers in the field. For example, peptides containing 4 and 27 at their N-terminus have the potential to combine the advantages of synthetic polymers and sequence-defined peptides by chemically linking the molecules using polymerizable units, potentially leading to novel hybrid materials. Looking to the future, we hope that our work will enable the design and selection of new classes of noncanonical monomers for use in translation.For example, the monomers we describe also begin a step toward a new class of sequenced, defined polymers that are not polyesters or polyamides, perhaps even polymers with carbon-carbon bonds. However, because the shape, physicochemistry, and dynamic properties of the ribosome and its active site have been evolutionarily optimized to work with proteins made up of about 20 canonical amino acids, such progress will need to be supported by additional efforts in engineering the translational apparatus. 72,73 .
[0218] References
[0219] 1. Edelmann, P. & Gallant, J. Mistranslation in E. coli. Cell 10, 131-137 (1977).
[0220] 2. Precup, J., Ulrich, AK, Roopnarine, O. & Parker, J. Context specific misreading of phenylalanine codons. Mol Gen Genet 218, 397-401 (1989).
[0221] 3. Rodnina, MV & Wintermeyer, W. Fidelity of aminoacyl-tRNA selection on the ribosome: kinetic and structural mechanisms. Annu Rev Biochem 70, 415-435 (2001).
[0222] 4. Cropp, T.A., Anderson, J.C. & Chin, J.W. Reprogramming the amino-acid substrate specificity of orthogonal aminoacyl-tRNA synthetases to expand the genetic code of eukaryotic cells. Nature Protocols 2, 2590-2600 (2007).
[0223] 5. Morimoto, J., Hayashi, Y., Iwasaki, K. & Suga, H. Flexizymes: their evolutionary history and the origin of catalytic function. Acc Chem Res 44, 1359-1368 (2011).
[0224] 6. Albayrak, C. & Swartz, J.R. Cell-free co-production of an orthogonal transfer RNA activates efficient site-specific non-natural amino acid incorporation. Nucleic Acids Res 41, 5949-5963 (2013). 7. Chin, J.W. Expanding and reprogramming the genetic code. Nature 550, 53-60 (2017). 8. Mukai, T., Lajoie, M.J., Englert, M. & Soil, D. Rewriting the genetic code. Annu Rev Microbiol 71, 557-577 (2017).
[0225] 9. Voller, J.S. & Budisa, N. Coupling genetic code expansion and metabolic engineering for synthetic cells. Curr Opin Biotech 48, 1-7 (2017).
[0226] 10. Vargas-Rodriguez, O., Sevostyanova, A., Soil, D. & Crnkovic, A. Upgrading aminoacyltRNA synthetases for genetic code expansion. Curr Opin Chem Biol 46, 115-122 (2018).
[0227] 11. Arranz-Gibertt, P., Vanderschurent, K. & Isaacs, F.J. Next-generation genetic code expansion. Curr Opin Chem Biol 46, 203-211 (2018).
[0228] 12. Tajima, K., Katoh, T. & Suga, H. Genetic code expansion via integration of redundant amino acid assignment by finely tuning tRNA pools. Curr Opin Chem Biol 46, 212-218 (2018).
[0229] 13. Rogers, J.M. & Suga, H. Discovering functional, non-proteinogenic amino acid containing, peptides using genetic code reprogramming. Org Biomol Chem 13, 9353-9363 (2015).
[0230] 14. Obexer, R., Walport, L.J. & Suga, H. Exploring sequence space: harnessing chemical and biological diversity towards new peptide leads. Curr Opin Chem Biol 38, 52-61 (2017).
[0231] 15. Fujino, T., Goto, Y., Suga, H. & Murakami, H. Ribosomal synthesis of peptides with multiple beta-amino acids. J Am Chem Soc 138, 1962-1969 (2016).
[0232] 16. Ohshiro, Y. et al. Ribosomal synthesis of backbone-macrocyclic peptides containing gamma-amino acids. ChemBioChem 12, 1183-1187 (2011).
[0233] 17. Goto, Y., Murakami, H. & Suga, H. Initiating translation with D-amino acids. RNA 14, 1390-1398 (2008).
[0234] 18. Katoh, T., Tajima, K. & Suga, H. Consecutive elongation of D-amino acids in translation. Cell Chem Biol 24, 46-54 (2017).
[0235] 19. Kawakami, T., Ishizawa, T. & Murakami, H. Extensive reprogramming of the genetic code for genetically encoded synthesis of highly N-alkylated polycyclic peptidomimetics. J Am Chem Soc 135, 12297-12304 (2013).
[0236] 20. Iwane, Y. et al. Expanding the amino acid repertoire of ribosomal polypeptide synthesis via the artificial division of codon boxes. Nat Chem 8, 317-325 (2016).
[0237] 21. Terasaka, N., Iwane, Y., Geiermann, A.S., Goto, Y. & Suga, H. Recent developments of engineered translational machineries for the incorporation of non-canonical amino acids into polypeptides. IntJMol Sci 16, 6513-6531 (2015).
[0238] 22. Ohta, A., Murakami, H., Higashimura, E. & Suga, H. Synthesis of polyester by means of genetic code reprogramming. Chem Biol 14, 1315-1322 (2007).19
[0239] 23. Ohta, A., Murakami, H. & Suga, H. Polymerization of alpha-hydroxy acids by ribosomes. ChemBioChem 9, 2773-2778 (2008).
[0240] 24. Goto, Y. & Suga, H. Translation initiation with initiator tRNA charged with exotic peptides. J Am Chem Soc 131, 5040-5041 (2009).
[0241] 25. Rogers, J.M. et al. Ribosomal synthesis and folding of peptide-helical aromatic foldamer hybrids. Nat Chem 10, 405-412 (2018).
[0242] 26. Torikai, K. & Suga, H. Ribosomal synthesis of an amphotericin-B inspired macrocycle. J Am Chem Soc 136, 17359-17361 (2014).
[0243] 27. Kawakami, T., Ogawa, K., Hatta, T., Goshima, N. & Natsume, T. Directed evolution of a cyclized peptoid-peptide chimera against a cell-free expressed protein and proteomic profiling of the interacting proteins to create a protein-protein interaction inhibitor. ACS Chem Biol 11, 1569-1577 (2016).
[0244] 28. Kanter, G. et al. Cell-free production of scFv fusion proteins: an efficient approach for personalized lymphoma vaccines. Blood 109, 3393-3399 (2007).
[0245] 29. Cho, H. et al. Optimized clinical performance of growth hormone with an expanded genetic code. Proc Natl Acad Sci USA 108, 9060-9065 (2011).
[0246] 30. Axup, J.Y. et al. Synthesis of site-specific antibody-drug conjugates using unnatural amino acids. Proc Natl Acad Sci USA 109, 16101-16106 (2012).
[0247] 31. Zimmerman, E.S. et al. Production of site-specific antibody-drug conjugates using optimized non-natural amino acids in a cell-free expression system. Bioconjug Chem 25, 351-361 (2014).
[0248] 32. Raucher, D. & Ryu, J.S. Cell-penetrating peptides: strategies for anticancer treatment. Trends Mol Med 21, 560-570 (2015).
[0249] 33. Despanie, J., Dhandhukia, J.P., Hamm-Alvarez, S.F. & MacKay, J.A. Elastin-like polypeptides: Therapeutic applications for an emerging class of nanomedicines. J Control Release 240, 93-108 (2016).
[0250] 34. Martin, R.W. et al. Development of a CHO-based cell-free platform for synthesis of active monoclonal antibodies. ACS Synth Biol 6, 1370-1379 (2017).
[0251] 35. Heckler, T.G. et al. T4 RNA ligase mediated preparation of novel "chemically misacylated" tRNAPheS. Biochemistry 23, 1468-1473 (1984).
[0252] 36. Robertson, S.A., Noren, C.J., Anthony-Cahill, S.J., Griffith, M.C. & Schultz, P.G. The use of 5'-phospho-2 deoxyribocytidylylriboadenosine as a facile route to chemical aminoacylation of tRNA. Nucleic Acids Res 17, 9649-9660 (1989).
[0253] 37. Robertson, S.A., Ellman, J.A. & Schultz, P.G. A general and efficient route for chemical aminoacylation of transfer RNAs. J Am Chem Soc 113, 2722-2729 (1991).
[0254] 38. Kwiatkowski, M., Wang, J.F. & Forster, A.C. Facile synthesis of N-acyl-aminoacyl-pCpA for preparation of mischarged fully ribo tRNA. Bioconjug Chem 25, 2086-2091 (2014).
[0255] 39. Wang, J.F., Kwiatkowski, M. & Forster, A.C. Ribosomal peptide syntheses from activated substrates reveal rate limitation by an unexpected step at the peptidyl site. J Am Chem Soc 138, 15587-15595 (2016).
[0256] 40. Yamanaka, K., Nakata, H., Hohsaka, T. & Sisido, M. Efficient synthesis of non-natural mutants in Escherichia coli S30 in vitro protein synthesizing system. J Biosci Bioeng 97, 395-399 (2004).
[0257] 41. Liu, D.R. & Schultz, P.G. Progress toward the evolution of an organism with an expanded genetic code. Proc Natl Acad Sci U S A 96, 4780-4785 (1999).
[0258] 42. Wang, L., Brock, A., Herberich, B. & Schultz, P.G. Expanding the genetic code of Escherichia coli. Science 292, 498-500 (2001).
[0259] 43. Nozawa, K. et al. Pyrrolysyl-tRNA synthetase-tRNA(Pyl) structure reveals the molecular basis of orthogonality. Nature 457, 1163-1167 (2009).20
[0260] 44. Hancock, S.M., Uprety, R., Deiters, A. & Chin, J.W. Expanding the genetic code of yeast for incorporation of diverse unnatural amino acids via a pyrrolysyl-tRNA synthetase / tRNA pair. J Am Chem Soc 132, 14819-14824 (2010).
[0261] 45. Neumann, H., Slusarczyk, A.L. & Chin, J.W. De novo generation of mutually orthogonal aminoacyl-tRNA synthetase / tRNA pairs. J Am Chem Soc 132, 2142-2144 (2010).
[0262] 46. Chin, J.W. Expanding and reprogramming the genetic code of cells and animals. Annu Rev Biochem 83, 379-408 (2014).
[0263] 47. Ellefson, J.W. et al. Directed evolution of genetic parts and circuits by compartmentalized partnered replication. Nat Biotechnol 32, 97-101 (2014).
[0264] 48. Schmied, W.H., Elsasser, S.J., Uttamapinant, C. & Chin, J.W. Efficient multisite unnatural amino acid incorporation in mammalian cells via optimized pyrrolysyl tRNA synthetase / tRNA expression and engineered eRFl. J Am Chem Soc 136, 15577-15583 (2014).
[0265] 49. Amiram, M. et al. Evolution of translation machinery in recoded bacteria enables multi-site incorporation of nonstandard amino acids. Nat Biotechnol 33, 1272-1279 (2015).
[0266] 50. Willis, J.C.W. & Chin, J.W. Mutually orthogonal pyrrolysyl-tRNA synthetase / tRNA pairs. Nat Chem 10, 831-837 (2018).
[0267] 51. Saito, H. & Suga, H. A ribozyme exclusively aminoacylates the 3'-hydroxyl group of the tRNA terminal adenosine. J Am Chem Soc 123, 7178-7179 (2001).
[0268] 52. Lee, N., Bessho, Y., Wei, K., Szostak, J.W. & Suga, H. Ribozyme-catalyzed tRNA aminoacylation. Nat Struct Biol 7, 28-33 (2000).
[0269] 53. Murakami, H., Saito, H. & Suga, H. A versatile tRNA aminoacylation catalyst based on RNA. Chem Biol 10, 655-662 (2003).
[0270] 54. Ramaswamy, K., Saito, H., Murakami, H., Shiba, K. & Suga, H. Designer ribozymes: programming the tRNA specificity into flexizyme. J Am Chem Soc 126, 11454-11455 (2004).
[0271] 55. Murakami, H., Ohta, A., Ashigai, H. & Suga, H. A highly flexible tRNA acylation method for non-natural polypeptide synthesis. Nat Methods 3, 357-359 (2006).
[0272] 56. Xiao, H., Murakami, H., Suga, H. & Ferre-D'Amare, A.R. Structural basis of specific tRNA aminoacylation by a small in vitro selected ribozyme. Nature 454, 358-361 (2008).
[0273] 57. Passioura, T. & Suga, H. Flexizyme-mediated genetic reprogramming as a tool for noncanonical peptide synthesis and drug discovery. Chemistry 19, 6530-6536 (2013).
[0274] 58. Niwa, N., Yamagishi, Y., Murakami, H. & Suga, H. A flexizyme that selectively charges amino acids activated by a water-friendly leaving group. Bioorg Med Chem Lett 19, 3892-3894 (2009).
[0275] 59. Saito, H., Watanabe, K. & Suga, H. Concurrent molecular recognition of the amino acid and tRNA by a ribozyme. RNA 7, 1867-1878 (2001).
[0276] 60. Goto, Y. et al. Reprogramming the translation initiation for the synthesis of physiologically stable cyclic peptides. ACS Chem Biol 3, 120-129 (2008).
[0277] 61. Saito, H., Kourouklis, D. & Suga, H. An in vitro evolved precursor tRNA with aminoacylation activity. EMBO J 20, 1797-1806 (2001).
[0278] 62. Goto, Y., Katoh, T. & Suga, H. Flexizymes for genetic code reprogramming. Nat Protoc 6, 779-790 (2011).
[0279] 63. Das, R. & Baker, D. Macromolecular modeling with Rosetta. Annu Rev Biochem 77, 363-382 (2008).
[0280] 64. Carlson, E.D., Gan, R., Hodgman, C.E. & Jewett, M.C. Cell-free protein synthesis: applications come of age. Biotechnol Adv 30, 1185-1194 (2012).
[0281] 65. Kwon, Y.C. & Jewett, M.C. High-throughput preparation methods of crude extract for robust cell-free protein synthesis. Sci Rep 5, 8663 (2015).21
[0282] 66. Jaroentomeechai, T. et al. Single-pot glycoprotein biosynthesis using a cell-free transcription-translation system enriched with glycosylation machinery. Nat Commun 9 (2018).
[0283] 67. Kightlinger, W. et al. Design of glycosylation sites by rapid synthesis and analysis of glycosyltransferases. Nat Chem Biol 14, 627-635 (2018).
[0284] 68. Shimizu, Y. et al. Cell-free translation reconstituted with purified components. Nat Biotechnol 19, 751-755 (2001).
[0285] 69. Iwane, Y., Katoh, T., Goto, Y. & Suga, H. Artificial division of codon boxes for expansion of the amino acid repertoire of ribosomal polypeptide synthesis. Methods Mol Biol 1728, 17-47 (2018).
[0286] 70. Udagawa, T., Shimizu, Y. & Ueda, T. Evidence for the translation initiation of leaderless mRNAs by the intact 70 S ribosome without its dissociation into subunits in eubacteria. J Biol Chem 279, 8539-8546 (2004).
[0287] 71. Oza, JP et al. Robust production of recombinant phosphoproteins using cell-free protein synthesis. Nat Commun 6 (2015).
[0288] 72. Liu, Y., Kim, DS & Jewett, MC Repurposing ribosomes for synthetic biology. Curr Opin Chem Biol 40, 87-94 (2017).
[0289] 73. d'Aquino, AE, Kim, DS & Jewett, MC Engineered ribosomes for basic science and synthetic biology. Annu Rev Chem Biomol Eng 9, 311-340 (2018).
[0290] Materials and Methods
[0291] All reagents and solvents were of commercial grade and, when necessary, purified before use. Dichloromethane was obtained from Grubbs 1 The solution was dried by passage through a column of activated alumina as described by
[14] . Phenylalanine cyanomethyl ester (A) was prepared as recently described. 2t-Butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (ABT) was prepared according to standard procedures. 3 All organic solutions were dried over MgSO4. Thin-layer chromatography (TLC) was performed using glass-backed silica gel (250 μm) plates. Flash chromatography was performed on a Biotage Isolera One automated purification system. Products were visualized using UV light and / or KMnO4. Nuclear magnetic resonance spectra (NMR) were acquired on a Bruker Advance III-500 (500 MHz) or Varian Unity 500 (500 MHz) instrument. Chemical shifts are measured relative to residual solvent peaks set at δ 7.26 and δ 77.0 (CDCl3), and δ 2.50 and δ 39.5 (DMSO-d6) as internal standards. Mass spectra were recorded on a Bruker Amazon SL or Waters Q-TOF Ultima (ESI) and Impact-II or Waters 70-VSE (EI) spectrometers using the ionization methods described.
[0292] General procedure for forming cyanomethyl esters To a glass vial equipped with a stir bar was added the carboxylic acid (1 equiv.), CHCl (1.0 M), trimethylamine (1.5 equiv.), and chloroacetonitrile (1.2 equiv.). After stirring at 25 °C for 16 h, the reaction mixture was diluted with EtOAc and washed with water or brine. The organic phase was dried and concentrated to give the crude product. If necessary, the product was purified by flash column chromatography.
[0293] [ka]
[0294] Cyanomethyl 3-phenylpropanoate (B)Prepared according to the general procedure using 3-phenylpropanoic acid (100 mg, 0.66 mmol), trimethylamine (140 μL, 0.99 mmol), chloroacetonitrile (53 μL, 0.79 mmol), and dichloromethane (0.7 mL). The product was obtained as a clear oil (95 mg, 77%). 1 13C NMR (125 MHz, CDCl3) ppm 171.2, 139.5, 128.6, 128.2, 126.6, 114.3, 48.2, 35.1, 30.5; HRMS (EI): Accurate mass calculated for C11H11NO2 [M]+189.07898, observed value 189.07881.
[0295] [ka]
[0296] trans-Cyanomethyl Cinnamate (C) Prepared according to the general procedure using trans-cinnamic acid (98 mg, 0.66 mmol), triethylamine (140 μL, 0.99 mmol), chloroacetonitrile (53 μL, 0.79 mmol), and dichloromethane (0.7 mL). The product was obtained as a white solid (78 mg, 63%). 1H NMR (500 MHz, CDCl3) δ 7.80 (d, J = 16.0 Hz, 1H), 7.57-7.53 (m, 2H), 7.44-7.40 (m, 3H), 6.46 (d, J =16.1 Hz, 1H), 4.86 (s, 2H);13C NMR (125 MHz, CDCl3) ppm 165.1, 147.7, 133.6, 131.1, 129.0, 128.4, 115.2, 114.5, 48.4; HRMS (EI): Accurate mass calculation for C11H9NO2 [M]+187.0633, observed value 187.0633.
[0297] [ka]
[0298] Cyanomethyl benzoate (D) Prepared according to the general procedure using benzoic acid (81 mg, 0.66 mmol), triethylamine (140 μL, 0.99 mmol), chloroacetonitrile (53 μL, 0.79 mmol), and dichloromethane (0.7 mL). The product was obtained as a clear oil (87 mg, 82%). H NMR (500 MHz, CDCl) δ 8.06 (dd, J = 8.3, 1.4 Hz, 2H), 7.67-7.59 (m, 1H), 7.49 (t, J = 7.8 Hz, 2H), 4.97 (s, 2H); C NMR (125 MHz, CDCl) ppm 164.9, 134.1, 130.0, 128.7, 127.8, 114.4, 48.8; HRMS (EI): exact mass calculated for C H NO [M] 161.0477, found 161.0475.
[0299] [ka]
[0300] 2-Phenylacetic acid cyanomethyl (E)Prepared according to the general procedure using phenylacetic acid (90 mg, 0.66 mmol), triethylamine (140 μL, 0.99 mmol), chloroacetonitrile (53 μL, 0.79 mmol), and dichloromethane (0.7 mL). The product was obtained as a white solid (79 mg, 68%). H NMR (500 MHz, CDCl) δ 7.35-7.23 (m, 5H), 4.70 (s, 2H), 3.70 (s, 2H); C NMR (125 MHz, CDCl) ppm 169.9, 132.2, 129.2, 128.8, 127.6, 114.2, 48.6, 40.4; HRMS (EI): exact mass calculated for C H NO [M] 175.0633, found 175.0634.
[0301] [ka]
[0302] Cyanomethyl valerate (F) Prepared according to the general procedure using valeric acid (72 μL, 0.66 mmol), triethylamine (140 μL, 0.99 mmol), chloroacetonitrile (53 μL, 0.79 mmol), and dichloromethane (0.7 mL). The product was obtained as a clear oil (65 mg, 70%). 1H NMR (500 MHz, CDCl3) δ 4.71 (s, 2H), 2.41 (t, J = 7.5 Hz, 2H), 1.67-1.60 (m, 2H), 1.41-1.30 (m, 2H), 0.92 (t, J = 7.4 Hz, 3H);13C NMR (125 MHz, CDCl3) ppm 172.1, 114.5, 48.1, 33.1, 26.6, 22.1, 13.6; HRMS (CI): Accurate mass calculated for C7H12NO2 [M+H]+142.0868, found 142.0867.
[0303] [ka]
[0304] Cyanomethyl 3-(3,4-dihydroxyphenyl)propanoate (1) Prepared according to the general procedure using 3-(3,4-dihydroxyphenyl)propanoic acid (60 mg, 0.33 mmol), triethylamine (70 μL, 0.5 mmol), chloroacetonitrile (26.5 μL, 0.4 mmol), and dichloromethane (0.2 mL). The product was obtained as a brown solid (40 mg, 55%). 1H-NMR (500 MHz, DMSO-d6) δ 8.73 (s, 1H), 8.67 (s, 1H), 6.61 (d, J = 8.1 Hz, 1H), 6.58 (d, J = 1.9 Hz, 1H), 6.46-6.44 (m, 1H), 4.94 (s, 2H), 2.69-2.68 (m, 2H), 2.66-2.64 (m, 2H);13C NMR (125 MHz, DMSO-d6) ppm 171.9, 145.5, 144.0, 131.3, 119.2, 116.4, 116.1, 115.9, 49.3, 35.2, 29.8;HRMS (EI): Exact mass calculated for C11H11NO4: [M]+ 221.0688, found 221.0690.
[0305] [ka]
[0306] Cyanomethyl 3-(1H-pyrrol-2-yl)propanoate (2)Prepared according to the general procedure using 3-(1H-pyrrol-2-yl)propanoic acid (46 mg, 0.33 mmol), triethylamine (70 μL, 0.5 mmol), chloroacetonitrile (26.5 μL, 0.4 mmol), and dichloromethane (0.2 mL). The product was obtained as a brown solid (45 mg, 77%). 1H-NMR (500 MHz, DMSO-d6) δ 10.54 (s, 1H), 6.58 (d, J = 2.0 Hz, 1H), 5.88 (q, J = 2.7, 3.0, 2.6 Hz, 1H), 5.74 (m, 1H), 4.96 (s, 2H), 2.81 (t, J = 8 Hz, 2H), 2.70 (t, J = 7 Hz, 2H);13C NMR (125 MHz, DMSO-d6) ppm 171.9, 130.0, 116.8, 116.5, 107.6, 105.0, 49.4, 33.6, 22.8;HRMS (EI): Exact mass calculated for C9H10N2O2: [M]+ 178.0742, found 178.0743.
[0307] [ka]
[0308] Cyanomethyl 3-(4-aminophenyl)propanoate (3)Prepared according to the general procedure using 3-(4-aminophenyl)propanoic acid (109 mg, 0.66 mmol), triethylamine (140 μL, 0.99 mmol), chloroacetonitrile (53 μL, 0.79 mmol), and dichloromethane (0.7 mL). The product was obtained as a white solid (123 mg, 55%). 1H NMR (500 MHz, CDCl3) δ 6.98 (d, J = 8.2 Hz, 2H), 6.63 (d, J = 8.2 Hz, 2H), 4.68 (s, 2H), 3.48 (br s, 2H), 2.87 (t, J = 7.7 Hz, 2H), 2.67 (t, J = 7.7 Hz, 2H);13C NMR (125 MHz, CDCl3) ppm 171.4, 144.8, 129.5, 129.0, 115.3, 114.4, 48.1, 35.5, 29.8;HRMS (EI): Accurate mass calculation for C11H12N2O2 [M]+204.0899, actual mass 204.0897.
[0309] [ka]
[0310] Cyanomethyl 3-(4-azidophenyl)propanoate (4)Prepared according to the general procedure using 3-(4-azidophenyl)propanoic acid (126 mg, 0.66 mmol), triethylamine (140 μL, 0.99 mmol), chloroacetonitrile (53 μL, 0.79 mmol), and dichloromethane (0.7 mL). The product was obtained as a red oil (123 mg, 81%). 1H NMR (500 MHz, CD3CN) δ 7.25 (d, J = 8.5 Hz, 2H), 7.00 (d, J = 8.4 Hz, 2H), 4.72 (s, 2H), 2.91 (t, J = 7.6 Hz, 2H), 2.70 (t, J = 7.6 Hz, 2H);13C NMR (125 MHz, CD3CN) ppm 172.4, 139.0, 138.1, 130.8, 119.9, 116.2, 49.6, 35.4, 30.3;HRMS (EI): Accurate calculated mass for C11H10N4O2 [M]+230.0804, measured value 230.0794.
[0311] [ka]
[0312] (E)-3-(3,4-dihydroxyphenyl)acrylate cyanomethyl ester (5)Prepared according to the general procedure using (E)-3-(3,4-dihydroxyphenyl)acrylic acid (59 mg, 0.33 mmol), triethylamine (70 μL, 0.5 mmol), chloroacetonitrile (26.5 μL, 0.4 mmol), and dichloromethane (0.2 mL). The product was obtained as a pink solid (41 mg, 57%). 1H-NMR (500 MHz, DMSO-d6) δ 9.71 (s, 1H), 9.20 (s, 1H), 7.61 (m, 1H), 7.10 (d, J = 1.8 Hz, 1H), 7.07 (dd, J = 8.3, 1.7 Hz, 1H), 6.78 (d, J = 8.4 Hz, 1H), 6.35 (d, J = 16.3 Hz, 1H), 5.06 (s, 2H);13C NMR (125 MHz, DMSO-d6) ppm 165.9, 149.5, 147.9, 146.1, 125.6, 122.5, 116.7, 116.2, 115.6, 112.0, 49.3; HRMS (EI): Exact mass calculated for C11H9NO4: [M]+ 219.0532, found 219.0531.
[0313] [ka]
[0314] (E)-3-(1H-pyrrol-2-yl)acrylate cyanomethyl ester (6)Prepared according to the general procedure using (E)-3-(1H-pyrrol-2-yl)acrylic acid (45 mg, 0.33 mmol), triethylamine (70 μL, 0.5 mmol), chloroacetonitrile (26.5 μL, 0.4 mmol), and dichloromethane (0.2 mL). The product was obtained as a brown solid (24 mg, 43%). 1H-NMR (500 MHz, DMSO-d6) δ 11.65 (s, 1H), 7.56 (d, J = 15.6 Hz, 1H), 7.11 (m, 1H), 6.67 (m, 1H), 6.24 (d, J = 15.8 Hz, 1H), 6.22-6.20 (m, 1H), 5.02 (s, 2H);13C NMR (125 MHz, DMSO-d6) ppm 166.2, 137.3, 128.4, 125.0, 116.8, 116.7, 110.9, 107.8, 49.2;HRMS (EI): Accurate mass calculation for C9H8N2O2: [M]+ 176.0586, actual value 176.0586.
[0315] [ka]
[0316] Cyanomethyl 4-nitrobenzoate (7) Prepared according to the general procedure using 4-nitrobenzoic acid (110 mg, 0.66 mmol), triethylamine (140 μL, 0.99 mmol), chloroacetonitrile (53 μL, 0.79 mmol), and dichloromethane (0.7 mL). The product was obtained as a beige solid (69 mg, 51%). H NMR (500 MHz, CDCl) δ 8.34 (d, J = 8.9 Hz, 2H), 8.26 (d, J = 9.0 Hz, 2H), 5.03 (s, 2H); C NMR (125 MHz, CDCl) ppm 163.2, 151.2, 133.1, 131.2, 123.9, 113.8, 49.5; HRMS (EI): exact mass calculated for C H N O [M] 206.03276, found 206.03188.
[0317] [ka]
[0318] Cyanomethyl 4-cyanobenzoate (8) Prepared according to the general procedure using 4-cyanobenzoic acid (97 mg, 0.66 mmol), triethylamine (140 μL, 0.99 mmol), chloroacetonitrile (53 μL, 0.79 mmol), and dichloromethane (0.7 mL). The product was obtained as a white solid (101 mg, 82%). 1H NMR (500 MHz, CDCl3) δ 8.18 (d, J = 8.5 Hz, 2H), 7.80 (d, J = 8.5 Hz, 2H), 5.01 (s, 2H);13C NMR (125 MHz, CDCl3) ppm 163.4, 132.5, 131.6, 130.5, 124.8, 117.6, 113.9, 49.4; HRMS (EI): Accurate mass calculation for C10H6N2O2 [M]+ 186.0429, observed value 186.0426.
[0319] [ka]
[0320] Cyanomethyl 4-azidobenzoate (9) Prepared according to the general procedure using 4-azidobenzoic acid (108 mg, 0.66 mmol), triethylamine (140 μL, 0.99 mmol), chloroacetonitrile (53 μL, 0.79 mmol), and dichloromethane (0.7 mL). The product was obtained as a red oil (89 mg, 67%). 1H NMR (500 MHz, CD3CN) δ 8.02 (d, J = 8.7 Hz, 2H), 7.17 (d, J = 8.7 Hz, 2H), 4.97 (s, 2H);13C NMR (125 MHz, CD3CN) ppm 165.2, 146.8, 132.4, 125.6, 120.2, 116.2, 50.3; HRMS (EI): Accurate mass calculation for C9H6N4O [M]+ 202.0491, measured value 202.0487.
[0321] [ka]
[0322] Cyanomethyl 3-formylbenzoate (10) Prepared according to the general procedure using 3-formylbenzoic acid (99 mg, 0.66 mmol), triethylamine (140 μL, 0.99 mmol), chloroacetonitrile (53 μL, 0.79 mmol), and dichloromethane (0.7 mL). The product was obtained as a clear oil (95 mg, 69%). 1H NMR (500 MHz, CDCl3) δ 10.09 (s, 1H), 8.55 (t, J = 1.7 Hz, 1H), 8.32 (d, J = 7.8 Hz, 1H), 8.16 (d, J = 7.7 Hz, 1H), 7.69 (t, J = 7.7 Hz, 1H), 5.02 (s, 2H);13C NMR (125 MHz, CDCl3) ppm 190.9, 163.9, 136.7, 135.4, 134.3, 131.4, 129.7, 129.0, 114.1, 49.2;HRMS (EI): Accurate mass calculation for C10H6NO3 [M]+ 189.0347, actual value 189.0344.
[0323] [ka]
[0324] Cyanomethyl 3-(nitromethyl)benzoate (11)Prepared according to the general procedure using 3-bromobenzoic acid (500 mg, 2.49 mmol), triethylamine (520 μL, 3.74 mmol), chloroacetonitrile (188 μL, 2.99 mmol), and dichloromethane (2.5 mL). The product was obtained as a white oily solid (579 mg, 97%). 1H NMR (500 MHz, CDCl3) δ 8.20 (dd, J = 1.8, 1.8 Hz, 1H), 8.00 (ddd, J =7.8, 1.7, 1.1 Hz, 1H), 7.76 (ddd, J = 8.0, 2.0, 1.1 Hz, 1H), 7.38 (dd, J = 7.9, 7.9 Hz, 1H), 4.97 (s, 2H);13C NMR (125 MHz, CDCl3) ppm 163.5, 136.9, 132.7, 130.2, 129.6, 128.4, 122.6, 114.2, 49.0;HRMS (EI):C9H6NO2Br Calculated accurate mass for [M]+: 238.95818, found: 238.95761. Following literature procedures, to a flame-dried glass vial under an argon atmosphere was added cyanomethyl 3-bromobenzoate (192 mg, 0.80 mmol), K3PO4 (204 mg, 0.96 mmol), XPhos (23.9 mg, 0.05 mmol), Pd2dba3 (18.3 mg, 0.02 mmol), nitromethane (430 μL, 8.0 mmol), and dioxane (3.6 mL). The reaction mixture was stirred at 70 °C for 24 h. After cooling to room temperature, the mixture was diluted with CHCl2 and washed with 1 M HCl. The organic phase was dried (MgSO4) and concentrated. Flash column chromatography (SiO2, 10-35% ethyl acetate in hexanes) afforded the product as a yellow oil (120 mg, 68%).H NMR (500 MHz, CDCl) δ 8.16 (s, 1H), 8.15 (d, J = 8.7 Hz, 1H), 7.74 (d, J = 7.8 Hz, 1H), 7.59 (dd, J = 7.7, 7.7 Hz, 1H), 5.51 (s, 2H), 4.99 (s, 2H); C NMR (125 MHz, CDCl) ppm 164.0, 135.5, 131.6, 131.5, 130.3, 129.7, 128.9, 114.2, 79.1, 49.1; HRMS (CI): exact mass calculated for CHNO [M+H] 221.0562, found 221.0558.
[0325] [ka]
[0326] Cyanomethyl 2-fluorobenzoate (12)Prepared according to the general procedure using 2-fluorobenzoic acid (92 mg, 0.66 mmol), triethylamine (140 μL, 0.99 mmol), chloroacetonitrile (53 μL, 0.79 mmol), and dichloromethane (0.7 mL). The product was obtained as a red oil (66 mg, 56%). 1H NMR (500 MHz, CDCl3) δ 7.98 (td, J = 7.5, 1.8 Hz, 1H), 7.61 (tdd, J = 7.0, 5.9, 3.3 Hz, 1H), 7.26 (td, J = 7.7, 1.1 Hz, 1H), 7.19 (ddd, J = 10.7, 8.4, 1.1 Hz, 1H), 4.98 (s, 2H);13C NMR (125 MHz, CDCl3) ppm 162.6 (d, 3JCF = 3.6 Hz), 162.2 (d, 1JCF = 262.4 Hz), 135.9 (d, 3JCF = 9.1 Hz), 132.3, 124.2 (d, 3JCF = 4.0 Hz), 117.2 (d, 2JCF = 21.9 Hz), 116.3 (d, 2JCF = 9.3 Hz), 114.2, 48.8; HRMS (EI): Exact mass calculated for C9H6FNO2 [M]+ 179.0383, found 179.0383.
[0327] [ka]
[0328] Cyanomethyl 2-iodobenzoate (13)Prepared according to the general procedure using 2-iodobenzoic acid (164 mg, 0.66 mmol), triethylamine (140 μL, 0.99 mmol), chloroacetonitrile (53 μL, 0.79 mmol), and dichloromethane (0.7 mL). The product was obtained as a red oil (129 mg, 68%). 1H NMR (500 MHz, CDCl3) δ 8.05 (dd, J = 8.0, 1.2 Hz, 1H), 7.88 (dd, J = 7.8, 1.7 Hz, 1H), 7.45 (td, J = 7.6, 1.2 Hz, 1H), 7.23 (td, J = 7.7, 1.7 Hz, 1H), 4.97 (s, 2H);13C NMR (125 MHz, CDCl3) ppm 164.4, 141.9, 133.8, 132.2, 131.6, 128.1, 114.1, 94.7, 49.1;HRMS (EI): Accurate mass calculation for C9H6INO2 [M]+ 286.9443, actual value 286.9448.
[0329] [ka]
[0330] Cyanomethyl 2-formylbenzoate (14) Prepared according to the general procedure using 2-formylbenzoic acid (150 mg, 1.00 mmol), trimethylamine (153 μL, 1.10 mmol), chloroacetonitrile (191 μL, 3.00 mmol), and dichloromethane (2.0 mL). The product was obtained as a clear oil (146 mg, 77%). H NMR (500 MHz, CDCl) δ 10.58 (s, 1H), 7.99 (d, J = 7.5 Hz, 2H), 7.73 (m, 2H), 5.01 (s, 2H); C NMR (125 MHz, CDCl) ppm 191.2, 164.7, 137.2, 133.5, 133.2, 130.5, 129.4, 124.7, 114.0, 49.3; HRMS (EI): exact mass calculated for CHNO [M] 189.0348, found 189.0363.
[0331] [ka]
[0332] Cyanomethyl 4-methoxybenzoate (15) Prepared according to the general procedure using 4-methoxybenzoic acid (100 mg, 0.66 mmol), trimethylamine (140 μL, 0.99 mmol), chloroacetonitrile (53 μL, 0.79 mmol), and dichloromethane (0.7 mL). The product was obtained as a white solid (102 mg, 81%). 1H NMR (500 MHz, CDCl3) δ 8.01 (d, J = 9.0 Hz, 2H), 6.95 (d, J = 8.9 Hz, 2H), 4.93 (s, 2H), 3.88 (s, 3H);13C NMR (125 MHz, CDCl3) ppm 164.6, 164.3, 132.2, 120.1, 114.7, 114.0, 55.5, 48.6; HRMS (EI): Accurate mass calculation for C10H9NO3 [M]+ 191.0582, actual value 191.0581.
[0333] [ka]
[0334] Cyanomethyl 4-ethynylbenzoate (16)Prepared according to the general procedure using 4-ethynylbenzoic acid (96 mg, 0.66 mmol), trimethylamine (140 μL, 0.99 mmol), chloroacetonitrile (53 μL, 0.79 mmol), and dichloromethane (0.7 mL). The product was obtained as a white solid (87 mg, 76%). 1H NMR (500 MHz, CDCl3) δ 8.02 (d, J = 8.5 Hz, 2H), 7.59 (d, J = 8.4 Hz, 2H), 4.97 (s, 2H), 3.29 (s, 1H);13C NMR (125 MHz, CDCl3) ppm 164.3, 132.4, 129.9, 128.1, 127.7, 114.3, 82.4, 81.0, 49.0; HRMS (EI): Exact mass calculated for C11H7NO2 [M]+ 185.0477, observed 185.0476.
[0335] [ka]
[0336] Cyanomethyl 4-(hydroxymethyl)benzoate (17) Prepared according to the general procedure using 4-(hydroxymethyl)benzoic acid (500 mg, 3.29 mmol), triethylamine (700 μL, 4.94 mmol), chloroacetonitrile (266 μL, 3.95 mmol), and dichloromethane (1.2 mL). The product was obtained as a white solid (470 mg, 75%). H NMR (500 MHz, CDCl) δ 8.03 (d, J = 8.0 Hz, 1H), 7.47 (d, J = 7.9 Hz, 1H), 4.96 (s, 2H), 4.79 (s, 2H), 2.10 (br s, 1H); C NMR (125 MHz, CDCl) ppm 164.8, 147.4, 130.3, 126.9, 126.6, 114.5, 64.4, 48.8; HRMS (ESI): exact mass calculated for CHNNaO [M+Na] 214.0480, found 214.0486.
[0337] [ka]
[0338] Cyanomethyl 4-aminobenzoate (18) This was prepared according to the general procedure using 4-(Boc-amino)benzoic acid (78 mg, 0.33 mmol), triethylamine (70 μL, 0.5 mmol), and chloroacetonitrile (26.5 μL, 0.4 mmol) in DMF (0.4 mL). The product was obtained as a white solid (39 mg, 68%). H-NMR (500 MHz, DMSO-d) δ 7.66 (td, J = 8.7 Hz, 2H), 6.59 (td, J = 8.6 Hz, 2H), 6.18 (s, 2H), 5.08 (s, 2H); C NMR (125 MHz, DMSO-d) ppm 165.1, 154.9, 132.2, 117.0, 113.9, 113.3, 49.3; exact mass calculated for C H N O [M] 176.0586, found 176.0585.
[0339] [ka]
[0340] Cyanomethyl 3-hydroxy-4-nitrobenzoate (19)Prepared according to the general procedure using 3-hydroxy-4-nitrobenzoic acid (200 mg, 1.09 mmol), triethylamine (232 μL, 1.64 mmol), chloroacetonitrile (88 μL, 1.31 mmol), and dichloromethane (1.2 mL). The product was obtained as a yellow solid (92 mg, 38%). H NMR (500 MHz, CDCl) δ 10.51 (s, 1H), 8.23 (d, J = 8.8 Hz, 1H), 7.87 (d, J = 1.9 Hz, 1H), 7.65 (dd, J = 8.8, 1.8 Hz, 1H), 5.00 (s, 2H); C NMR (125 MHz, CDCl) ppm 162.9, 154.7, 136.4, 135.4, 125.7, 122.3, 120.8, 113.7, 49.5; HRMS (EI): exact mass calculated for C H NO [M] 222.0276, found 222.0272.
[0341] [ka]
[0342] Cyanomethyl 3-amino-4-nitrobenzoate (20)Prepared according to the general procedure using 3-amino-4-nitrobenzoic acid (198 mg, 1.09 mmol), triethylamine (232 μL, 1.64 mmol), chloroacetonitrile (88 μL, 1.31 mmol), and dichloromethane (1.2 mL). The product was obtained as a yellow solid (210 mg, 87%). 1H NMR (500 MHz, d6-DMSO) δ 8.10 (dd, J = 9.0, 1.0 Hz, 1H), 7.74 (d, J = 1.9 Hz, 1H), 7.65 (s, 2H), 7.09 (dd, J = 8.9, 1.9 Hz, 1H), 5.24 (s, 2H);13C NMR (125 MHz, d6-DMSO) ppm 163.7, 145.7, 133.6, 132.5, 126.5, 121.5, 115.9, 114.5, 50.4;HRMS (ESI): Accurate mass calculation for C9H7N3NaO4 [M+Na]+ 244.0334, actual value 244.0335.
[0343] [ka]
[0344] Cyanomethyl 4-amino-3-nitrobenzoate (21)Prepared according to the general procedure using 4-amino-3-nitrobenzoic acid (198 mg, 1.09 mmol), triethylamine (232 μL, 1.64 mmol), chloroacetonitrile (88 μL, 1.31 mmol), and dichloromethane (1.2 mL). The product was obtained as a yellow solid (120 mg, 49%). H NMR (500 MHz, d-acetone) δ 8.74 (d, J = 1.9 Hz, 1H), 7.96 (dd, J = 8.9, 2.0 Hz, 1H), 7.68 (s, 2H), 7.19 (d, J = 9.0 Hz, 1H), 5.17 (s, 2H); C NMR (125 MHz, d-acetone) ppm 164.3, 150.2, 136.0, 129.9, 120.3, 120.2, 116.3, 116.2, 49.9; HRMS (ESI): exact mass calculated for CHNNaO [M+Na] 244.0334, found 244.0329.
[0345] [ka]
[0346] Cyanomethyl isonicotinate (22) Prepared according to the general procedure using isonicotinic acid (81 mg, 0.66 mmol), triethylamine (140 μL, 0.99 mmol), chloroacetonitrile (53 μL, 0.79 mmol), and dichloromethane (0.7 mL). The product was obtained as a red oil (50 mg, 47%). H NMR (500 MHz, CDCl) δ 8.85 (d, J = 3.9 Hz, 2H), 7.87 (d, J = 6.1 Hz, 2H), 5.01 (s, 2H); C NMR (125 MHz, CDCl) ppm 163.7, 150.9, 135.0, 122.9, 113.8, 49.4; HRMS (EI): exact mass calculated for C H N O [M] 162.0429, found 162.0430.
[0347] [ka]
[0348] 2-Fluoroisonicotinic acid cyanomethyl ester (23) Prepared according to the general procedure using 2-fluoroisonicotinic acid (93 mg, 0.66 mmol), trimethylamine (140 μL, 0.99 mmol), chloroacetonitrile (53 μL, 0.79 mmol), and dichloromethane (0.7 mL). The product was obtained as a white solid (102 mg, 86%). 1H NMR (500 MHz, CDCl3) δ 8.43 (d, J = 5.1 Hz, 1H), 7.77 (m, 1H), 7.52 (dd, J = 2.6, 1.2 Hz, 1H), 5.02 (s, 2H);13C NMR (125 MHz, CDCl3) ppm 164.4 (d, 1JCF = 241.1 Hz), 162.7 (d, 4JCF = 4.5 Hz), 149.4 (d, 3JCF = 14.6 Hz), 140.6 (d, 3JCF = 7.8 Hz), 121.1 (d, 4JCF = 4.9 Hz), 113.8, 110.4 (d, 2JCF = 39.7 Hz), 49.9; HRMS (EI): Exact mass calculated for C8H5FN2O2 [M]+ 180.0335, found 180.0332.
[0349] [ka]
[0350] Cyanomethyl 2-oxo-2H-chromene-3-carboxylate (24)Prepared according to the general procedure using 2-oxo-2H-chromene-3-carboxylic acid (125 mg, 0.66 mmol), triethylamine (140 μL, 0.99 mmol), chloroacetonitrile (53 μL, 0.79 mmol), and dichloromethane (0.7 mL). The product was obtained as a white solid (118 mg, 78%). 1H NMR (500 MHz, CDCl3) δ 8.67 (s, 1H), 7.72 (dd, J = 8.0, 7.5 Hz, 1H), 7.67 (d, J = 7.2 Hz, 1H), 7.40 (d, J = 8.0 Hz, 1H), 7.39 (dd, J = 8.0, 7.5 HRMS (EI): Exact mass calculated for C12H7NNO4 [M]+ 229.0375, found 229.0382.
[0351] [ka]
[0352] 1H-Pyrrole-2-carboxylate cyanomethyl (25) Prepared according to the general procedure using 1H-pyrrole-2-carboxylic acid (37 mg, 0.33 mmol), triethylamine (70 μL, 0.5 mmol), chloroacetonitrile (26.5 μL, 0.4 mmol), and dichloromethane (0.2 mL). The product was obtained as a white solid (24 mg, 49%). H-NMR (500 MHz, DMSO-d) δ 12.15 (s, 1H), 7.13 (m, 1H), 6.91 (m, 1H), 6.23 (m, 1H), 5.12 (s, 2H); C NMR (125 MHz, DMSO-d) ppm 159.4, 126.2, 120.3, 117.2, 116.7, 110.6, 49.2; ESI-MS; mass calculated for C H N O: [M] 150.0429, found 150.0432.
[0353] [ka]
[0354] Cyanomethyl thiophene-2-carboxylate (26) Prepared according to the general procedure using thiophene-2-carboxylic acid (84 mg, 0.66 mmol), triethylamine (140 μL, 0.99 mmol), chloroacetonitrile (53 μL, 0.79 mmol), and dichloromethane (0.7 mL). The product was obtained as a brown oil (72 mg, 79%). H NMR (500 MHz, CDCl) δ 7.89 (dd, J = 3.8, 1.3 Hz, 1H), 7.67 (dd, J = 5.0, 1.3 Hz, 1H), 7.15 (dd, J = 4.9, 3.8 Hz, 1H), 4.94 (s, 2H); C NMR (125 MHz, CDCl) ppm 160.4, 135.2, 134.3, 130.7, 128.2, 114.2, 48.7; HRMS (EI): exact mass calculated for C H NO S [M] 167.0041, found 167.0038.
[0355] General procedure for forming ABT esters Standard Procedure 3 According to the method described in [1], to a glass vial equipped with a stir bar was added tert-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (ABT) (1 equiv.), carboxylic acid (1.4 equiv.), CHCl (0.3 M), DMAP (2.8 equiv.), and EDC·HCl (2.8 equiv.). After stirring at 25 °C for 3 h, the reaction was evaporated under reduced pressure, diluted with EtOAc, and washed with 1 M HCl and saturated NaHCO. The organic phase was dried and concentrated to give the crude Boc-protected product. This Boc-protected product was purified by flash column chromatography. The purified product was dissolved in 4 M HCl·dioxane and stirred for 1 h. Concentration under reduced pressure afforded the product in sufficient purity.
[0356] [ka]
[0357] 2-(4-(((1H-pyrrole-2-carbonyl)thio)methyl)benzamido)ethane-1-aminium chloride (25a) This was prepared according to the general procedure using 1H-pyrrole-2-carboxylic acid (50 mg, 0.45 mmol), ABT (100 mg, 0.32 mmol), DMAP (109 mg, 0.9 mmol), EDC·HCl (171 mg, 0.9 mmol), and dichloromethane (2.0 mL). Flash column chromatography (SiO2 30%–50% ethyl acetate in hexane) afforded the Boc-protected product as a white solid (60 mg, 15%). Boc deprotection using 4 M HCl·dioxane gave the product, which was used without further purification or characterization. Boc-25a:1H NMR (500 MHz, CDCl3) δ 9.26 (s, 1H), 7.77 (d, J = 7.9 Hz, 2H), 7.43 (d, J = 8.1 Hz, 2H), 7.14 (s, 1H), 7.03 (d, J = 11.4 Hz, 2H), 6.29 (d, J = 3.0 Hz, 1H), 4.97 (s, 1H), 4.31 (s, 2H), 3.57 (q, J = 5.1 Hz, 2H), 3.45 - 3.38 (m, 2H), 1.44 (s, 9H). C NMR (125 MHz, CDCl) ppm 180.48, 167.37, 133.06, 129.71, 129.02, 127.32, 123.84, 115.37, 110.92, 42.09, 40.00, 31.91, 28.34. HRMS (ESI): Exact mass calculated for C H N O S [M+H] 404.1644, found 404.1632.
[0358] [ka]
[0359] 2-(4-(((Thiophene-2-carbonyl)thio)methyl)benzamido)ethane-1-aminium chloride (26a). Prepared according to the general procedure using thiophene-2-carboxylic acid (57 mg, 0.45 mmol), ABT (100 mg, 0.32 mmol), DMAP (109 mg, 0.9 mmol), EDC·HCl (171 mg, 0.9 mmol), and dichloromethane (2.0 mL). Flash column chromatography (SiO2 30%–50% ethyl acetate in hexane) afforded the Boc-protected product as a white solid (150 mg, 76%). Boc deprotection using 4 M HCl·dioxane gave the product, which was used without further purification or characterization. Boc-26a:1H NMR (500 MHz, CDCl3) δ 7.84-7.75 (m, 3H), 7.65 (dd, J = 4.9, 1.1 Hz, 1H), 7.44 (d, J = 8.1 Hz, 2H), 7.22 ( br, 1H), 7.13 (dd, J = 4.9, 3.9 Hz, 1H), 5.00 (s, 1H), 4.35 (s, 2H), 3.56 (q, J = 5.1 Hz, 2H), 3.45-3.37 (m, 2H), 1.44 (s, 9H). C NMR (125 MHz, CDCl) ppm 182.92, 167.32, 157.50, 141.52, 141.06, 133.22, 132.98, 131.34, 129.11, 128.38, 128.32, 127.96, 127.39, 126.09, 42.12, 39.99, 32.99, 28.34. HRMS (ESI): Exact mass calculated for C H N O S [M+H] 421.1256, found 421.1249.
[0360] [ka]
[0361] 2-(4-((pentanoylthio)methyl)benzamido)ethane-1-aminium chloride (G). Prepared according to the general procedure using valeric acid (47 μL, 0.43 mmol), ABT (93 mg, 0.30 mmol), DMAP (105 mg, 0.86 mmol), EDC·HCl (165 mg, 0.86 mmol), and dichloromethane (1.0 mL). Flash column chromatography (SiO2 30%–50% ethyl acetate in hexane) afforded the Boc-protected product as a white solid (66 mg, 56%). Boc deprotection using 4 M HCl·dioxane gave the product, which was used without further purification or characterization. Boc-G: 1H NMR (500 MHz, CDCl3) δ 7.73 (d, J = 7.9 Hz, 2H), 7.30 (d, J = 8.0 Hz, 2H), 7.28 (br s, 1H), 5.14 (br s, 1H), 4.11 (s, 2H), 3.52 (q, 5.3 Hz, 2H), 3.37 (m, 2H), 2.56 (t, J = 7.5 Hz, 2H), 1.63 (p, J = 7.5 Hz, 2H), 1.40 (s, 9H), 1.33 (p, J = 7.5 Hz, 2H), 0.89 (t, J = 7.4 Hz, 3H);13C NMR (125 MHz, CDCl3) ppm 198.6, 167.4, 157.5 141.4, 133.0, 128.8, 127.3, 79.9, 43.5, 42.0, 39.9, 32.7, 28.3, 27.6, 22.0, 13.7; HRMS (ESI): Exact mass calculated for C20H31N2O4S [M+H]+ 395.2005, found 395.2009.
[0362] [ka]
[0363] 2-(4-((pent-4-enoylthio)methyl)benzamido)ethane-1-aminium chloride (27). Prepared according to the general procedure using 4-pentenoic acid (44 μL, 0.43 mmol), ABT (93 mg, 0.30 mmol), DMAP (105 mg, 0.86 mmol), EDC·HCl (165 mg, 0.86 mmol), and dichloromethane (1.0 mL). Flash column chromatography (SiO2 30%–50% ethyl acetate in hexane) afforded the Boc-protected product as a white solid (61 mg, 52%). Boc deprotection using 4 M HCl·dioxane gave the product, which was used without further purification or characterization. Boc-15:1H NMR (500 MHz, CDCl3) δ 7.73 (d, J = 8.0 Hz, 2H), 7.30 (d, J = 8.3 Hz, 2H), 7.29 (br s, 1H), 5.77 (ddt, J = 16.8, 10.2, 6.5 Hz, 1H), 5.16 (br s, 1H), 5.04 (dd, J = 17.1, 1.7 Hz, 1H), 4.99 (dd, J = 10.2, 5.1 Hz, 1H), 4.12 (s, 2H), 3.52 (q, 5.2 Hz, 2H), 3.37 (m, 2H), 2.65 (dd, J = 8.3, 6.7 Hz, 2H), 2.40 (tdd, J = 8.5, 5.9, 3.5 Hz, 2H), 1.40 (s, 9H); C NMR (125 MHz, CDCl) ppm 197.8, 167.4, 157.5, 141.3, 135.9, 133.0, 128.8, 127.3, 115.9, 79.9, 42.8, 42.0, 39.9, 32.7, 29.3, 28.3; HRMS (ESI): Exact mass calculated for CHNOS [M+H] 393.1848, found 393.1850.
[0364] [ka]
[0365] 2-(4-(((3-cyanopropanoyl)thio)methyl)benzamido)ethane-1-aminium chloride (28). Prepared according to the general procedure using 3-cyanopropanoic acid (43 mg, 0.43 mmol), ABT (93 mg, 0.30 mmol), DMAP (105 mg, 0.86 mmol), EDC·HCl (165 mg, 0.86 mmol), and dichloromethane (1.0 mL). Flash column chromatography (SiO2 30%–50% ethyl acetate in hexane) afforded the Boc-protected product as a white solid (42 mg, 36%). Boc deprotection using 4 M HCl·dioxane gave the product, which was used without further purification or characterization. Boc-16:1H NMR (500 MHz, CDCl3) δ 7.75 (d, J = 7.9 Hz, 2H), 7.32 (d, J = 8.2 Hz, 2H), 7.27 (br s, 1H), 5.07 (br s, 1H), 4.18 (s, 2H), 3.53 (q, 5.1) 13C NMR (125 MHz, CDCl3) ppm 194.5, 167.2, 157.5, 140.3, 133.4, 128.9, 127.4, 118.0, 80.0, 42.1, 39.9, 38.3, 33.0, 28.3, 12.8; HRMS (ESI): Exact mass calculated for C19H26N3O4S [M+H]+ 392.1644, found 392.1658.
[0366] [ka]
[0367] 2-(4-(((4-Methoxy-4-oxobutanoyl)thio)methyl)benzamido)ethane-1-aminium chloride (29). Prepared according to the general procedure using monomethylsuccinic acid (57 mg, 0.43 mmol), ABT (93 mg, 0.30 mmol), DMAP (105 mg, 0.86 mmol), EDC·HCl (165 mg, 0.86 mmol), and dichloromethane (1.0 mL). Flash column chromatography (SiO2 30%–50% ethyl acetate in hexane) afforded the Boc-protected product as a white solid (57 mg, 45%). Boc deprotection using 4 M HCl·dioxane gave the product, which was used without further purification or characterization. Boc-17:1H NMR (500 MHz, CDCl3) δ 7.73 (d, J = 7.9 Hz, 2H), 7.30 (d, J = 8.0 Hz, 2H), 7.29 (br s, 1H), 5.14 (br s, 1H), 4.13 (s, 2H), 3.67 (s, 13C NMR (125 MHz, CDCl3) ppm 196.8, 172.3, 167.3, 157.5, 141.0, 133.1, 128.9, 127.3, 79.9, 51.9, 42.0, 39.9, 38.1, 32.8, 28.9, 28.3; HRMS (ESI): Exact mass calculated for C20H29N2O6S [M+H]+ 425.1746, found 425.1759.
[0368] [ka]
[0369] 2-(4-(((3-Nitropropanoyl)thio)methyl)benzamido)ethane-1-aminium chloride (30). Prepared according to the general procedure using 3-nitropropionic acid (51 mg, 0.43 mmol), ABT (93 mg, 0.30 mmol), DMAP (105 mg, 0.86 mmol), EDC·HCl (165 mg, 0.86 mmol), and dichloromethane (1.0 mL). Flash column chromatography (SiO2 30%–50% ethyl acetate in hexane) afforded the Boc-protected product as a white solid (57 mg, 46%). Boc deprotection using 4 M HCl·dioxane gave the product, which was used without further purification or characterization. Boc-13:1H NMR (500 MHz, CDCl3) δ 7.76 (d, J = 8.0 Hz, 2H), 7.33 (d, J = 8.2 Hz, 2H), 7.19 (br s, 1H), 4.97 (br s, 1H), 4.70 (t, J = 6.2 Hz, 13C NMR (125 MHz, CDCl3) ppm 194.0, 167.2, 157.6, 140.3, 133.4, 129.0, 127.4 80.1, 69.3, 42.2, 39.9, 39.3, 33.0, 28.3; HRMS (ESI): Exact mass calculated for C18H26N3O6S [M+H]+ 244.0334, found 412.1531.
[0370] [ka]
[0371] 2-(4-(((cyclohexanecarbonyl)thio)methyl)benzamido)ethane-1-aminium chloride (31). Prepared according to the general procedure using cyclohexanecarboxylic acid (53 μL, 0.43 mmol), ABT (93 mg, 0.30 mmol), DMAP (105 mg, 0.86 mmol), EDC·HCl (165 mg, 0.86 mmol), and dichloromethane (1.0 mL). Flash column chromatography (SiO2 30%–50% ethyl acetate in hexane) afforded the Boc-protected product as a white solid (77 mg, 61%). Boc deprotection using 4 M HCl·dioxane gave the product, which was used without further purification or characterization. Boc-12:1H NMR (500 MHz, CDCl3) δ 7.72 (d, J = 8.1 Hz, 2H), 7.30 (d, J = 8.2 Hz, 2H), 7.29 (br s, 1H), 5.15 (br s, 1H), 4.08 (s, 2H), 3.52 (q, 5.2) Hz, 2H), 3.37 (m, 2H), 2.48 (tt, J = 11.5, 3.6 Hz, 1H), 1.90 (dd, J = 12.9, 3.3 Hz, 2H), 1.76 (dt, J = 12.7, 3.4 Hz, 2H), 1.69-1.57 (m, 1H), 1.45 (qd, J = 12.0, 3.1 Hz, 2H), 1.40 (s, 9H), 1.31-1.12 (m, 3H); C NMR (125 MHz, CDCl) ppm 202.0, 167.4, 157.4, 141.6, 132.9, 128.8, 127.3, 79.9, 52.7, 41.9, 39.9, 32.3, 29.5, 28.3, 25.5, 25.4; HRMS (ESI): Exact mass calculated for C H NO S [M+H] 421.2161, found 421.2151.
[0372] [ka]
[0373] 2-(4-(((2-Bromo-2-methylpropanoyl)thio)methyl)benzamido)ethane-1-aminium chloride (32). Prepared according to the general procedure using α-bromoisobutyric acid (72 mg, 0.43 mmol), ABT (93 mg, 0.30 mmol), DMAP (105 mg, 0.86 mmol), EDC·HCl (165 mg, 0.86 mmol), and dichloromethane (1.0 mL). Flash column chromatography (SiO2 30%–50% ethyl acetate in hexane) afforded the Boc-protected product as a white solid (93 mg, 68%). Boc deprotection using 4 M HCl·dioxane gave the product, which was used without further purification or characterization. Boc-14:1H NMR (500 MHz, CDCl3) δ 7.74 (d, J = 8.0 Hz, 2H), 7.33 (d, J = 8.4 Hz, 2H), 7.29 (br s, 1H), 5.16 (br s, 1H), 4.12 (s, 2H), 3.52 (q, 5.3) Hz, 2H), 3.38 (m, 2H), 1.93 (s, 6H), 1.40 (s, 9H);13C NMR (125 MHz, CDCl3) ppm 199.1, 167.4, 157.5, 140.4, 133.2, 128.9, 127.4, 79.9, 63.9, 42.0, 39.9, 34.2, 31.3 28.3; HRMS (ESI): Exact mass calculated for C19H28BrN2O4S [M+H]+ 459.0953, found 459.0964.
[0374] Preparation of DNA templates for RNA
[0375] The DNA template was synthesized as previously described using the following primers: 4 .
[0376] 1) Extension (generation of Fx derivatives by extending different 3' ends.
[0377] A. Flexizyme Fx_F: 5'-GTAATACGACTCACTATAGGATCGAAAGATTTCCGC-3' (SEQ ID NO: 1) eFx_R1: 5'-ACCTAACGCTAATCCCCTTTCGGGGCCGCGGAAATCTTTCGATCC-3' (SEQ ID NO: 2) dFx_R1:5'-ACCTAACGCCATGTACCCTTTCGGGGATGCGGAAATCTTTCGATCC-3' (SEQ ID NO: 3) aFx_R1: 5'-ACCTAACGCCACTTACCCCTTTCGGGGGTGCGGAAATCTTTCGATCC-3' (SEQ ID NO: 4)
[0378] 0.5 μL of 200 μM Fx_F primer and 10.5 μL of 200 μM Fx_R1 primer (eFx_R1, dFx_R1, and aFx_R were used to generate eFx, dFx, and aFx, respectively) were added to 99 μL of master mix in a PCR tube (containing 9.9 μL of 10x PCR buffer (500 mM KCl, 100 mM Tris-HCl (pH 9.0), and 1% Triton X-100), 0.99 μL of 250 mM MgCl2, 4.95 μL of 5 mM dNTPs, 0.66 μL of Taq DNA polymerase (NEB), and 82.5 μL of water). The temperature cycling conditions were 95°C for 1 minute, followed by five cycles of 50°C for 1 minute and 72°C for 1 minute. The size of the product was checked in a 3% (w / v) agarose gel.
[0379] 2) PCR amplification
[0380] A. Flexizyme
[0381] Five microliters of the extension product was used as a PCR template. 200 μL of 5x OneTaq® Standard Buffer, 20 μL of 10 mM dNTPs, 5 μL of 200 μM Fx_T7F primer, and 5 μL of 200 μM Fx_R2 (eFx_R2, dFx_R2, and aFx_R2 were used to generate eFx, dFx, and aFx, respectively), 10 μL of OneTaq® Polymerase, and 755 μL of nuclease-free water were mixed in a 1.5 mL microcentrifuge tube. This mixture was transferred to 10 PCR tubes, and the DNA was amplified using the following temperature cycling conditions: 95°C for 1 minute, followed by 12 cycles of 95°C for 40 seconds, 50°C for 40 seconds, and 72°C for 40 seconds. The products were checked on a 3% (w / v) agarose gel. Fx_T7F: 5'-GGCGTAATACGACTCACTATAG-3' (SEQ ID NO: 5) eFx_R2: 5'-ACCTAACGCTAATCCCCT-3' (SEQ ID NO: 6) dFx_R2: 5'-ACCTAACGCCATGTACCCT-3' (SEQ ID NO: 7) aFx_R2: 5'-ACCTAACGCCACTTACCCC-3' (SEQ ID NO: 8)
[0382] The sequence of the final DNA template generated by the PCR reaction eFX 5'-GTAATACGACTCACTATAGGATCGAAAGATTTCCGCGGCCCCGAAAGGGGATTAGCGTTAGGT-3' (SEQ ID NO: 9) dFx 5'-GTAATACGACTCACTATAGGATCGAAAGATTTCCGCATCCCCGAAAGGGTACATGGCGTTAGGT-3' (SEQ ID NO: 10) aFx 5'-GTAATACGACTCACTATAGGATCGAAAGATTTCCGCACCCCCGAAAGGGGTAAGTGGCGTTAGGT-3' (SEQ ID NO: 11)
[0383] B.tRNA
[0384] The DNA template for tRNA preparation was directly amplified from the full-length oligo with a pair of primers corresponding to both the 5' and 3' ends of the template (GluE2_fwd: 5'-GTAATACGACTCACTATAGTCC-3' (SEQ ID NO: 19); GluE2_rev: 5'-TGGCGTCCCCTAGGGGATTCG-3' (SEQ ID NO: 20)). Five μL of DNA template for tRNA (100 μM) was mixed with 5 μL of 200 μM GluE2_fwd and Glu_E2_rev, 200 μL of 5x HF buffer, 10 μL of Phusion polymerase (NEB), 20 μL of 10 mM dNTPs, and 755 μL of water. The temperature cycling conditions were 95°C for 1 minute, followed by 35 cycles of 95°C for 5 seconds, 60°C for 10 seconds, and 72°C for 10 seconds, with a final extension at 72°C for 1 minute. The size of the product was checked in a 3% (w / v) agarose gel.
[0385] Sequence of the final DNA template generated by the PCR reaction GluE2_GGU 5'-GTAATACGACTCACTATAGTCCCCTTCGTCTAGAGGCCCAGGACACCGCCTTGGTAAGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGCCA (SEQ ID NO: 12) fMet_CAU 5'-GTAATACGACTCACTATAGGCGGGGTGGAGCAGCCTGGTAGCTCGTCGGGCTCATAACCCGAAGATCGTCGGTTCAAATCCGGCCCGCAACCA (SEQ ID NO: 13)
[0386] 3) DNA precipitation
[0387] PCR products were combined, extracted with phenol / chloroform / isoamyl alcohol, precipitated, and washed with EtOH. Samples were dried at room temperature for 5 minutes and resuspended in 100 μL of nuclease-free water. DNA concentrations were determined spectrophotometrically (Thermo Scientific NanoDrop 2000C Spectrophotometer).
[0388] In vitro transcription The microhelix (5'-rGrGrCrUrCrUrGrUrUrCrGrCrArGrArGrCrCrGrCrCrA-3' (SEQ ID NO: 21)) was obtained from Integrated DNA Technologies (IDT) and used directly. Flexizyme and tRNA were prepared using the HiScribe T7 High-Yield RNA Synthesis Kit (NEB). For in vitro transcription, 5 μg of DNA template was used with 10 μL each of 10x T7 reaction buffer, ATP, CTP, GTP, UTP, T7 RNA polymerase mix, and nuclease-free water up to 100 μL. The mixture was incubated overnight at 37°C.
[0389] Digestion of DNA template The DNA template was removed by adding 5 μL of DNase I (NEB) and 20 μL of DNase I reaction buffer to 100 μL of the transcription reaction product. The reaction mixture was incubated at 37 °C for 1 h.
[0390] Purification of in vitro transcribed RNA Add the digested transcription reaction to 100 µL of 2x RNA loading dye. 4The mixture was mixed with 1000 kJ / ml and loaded onto a 15% TBE-Urea gel (Invitrogen). The gel was run at room temperature at 160 V in Tris-borate-EDTA (89 mM Tris, 89 mM boric acid, 2 mM EDTA, pH 8.3) buffer for 2.5 hours. The gel was placed on an adhesive film covering a 20 cm x 20 cm TLC silica gel glass plate (EMD Millipore) coated with a fluorescent indicator, and the transferred RNA was visualized by irradiating it with a UV lamp (260 nm). A piece of adhesive film was placed on top of the gel, and the band of the desired size was marked on the film. The RNA product was excised from the gel and added to 2 mL of water. The gel was crushed and then shaken in a cold room for 4 hours. The gel was transferred to a centrifugal filter (EMD Millipore) and centrifuged at 4,000 g for 2 minutes. The flow-through was collected and added to a solution of 120 μL of 5 M NaCl and 5 mL of 100% EtOH. The solution was then placed at -20°C for 16 hours and centrifuged at 15,000 g for 45 minutes at 4°C. The supernatant was removed and the pellet was allowed to dry at room temperature for 5 minutes. The dried RNA pellet was dissolved in nuclease-free water, and the concentration was determined from the absorbance measured on a Thermo Scientific NanoDrop 2000C spectrophotometer.
[0391] Acylation of microhelicesExperiments using microhelices were performed using two types of flexizymes (eFx and aFx). Coupling reactions between activated esters and microhelices were performed as follows: 1 μL of 0.5 M HEPES (pH 7.5) or bicine (pH 8.8), 1 μL of 10 μM microhelix, and 3 μL of nuclease-free water were mixed with 1 μL each of 10 μM eFx, dFx, and aFx in a PCR tube. The mixture was heated to 95°C for 2 minutes and then cooled to room temperature over 5 minutes. 2 μL of 300 mM MgCl2 was added to the cooled mixture and incubated at room temperature for 5 minutes. After incubating the reaction mixture on ice for 2 minutes, 2 μL of 25 mM activated ester substrate in DMSO was added to the reaction mixture. The reaction mixture was further incubated on ice for 6–120 hours in a cold room.
[0392] Acidic PAGE analysis 1 μL of the crude reaction mixture was aliquoted at the desired time points, and the reaction was quenched with 4 μL of acidic loading buffer (150 mM NaOAc, pH 5.2, 10 mM EDTA, 0.02% BPB, 93% formamide). This crude mixture was loaded onto a 20% polyacrylamide gel containing 50 mM NaOAc (pH 5.2) without further RNA precipitation. Electrophoresis was performed in a chilled room using 50 mM NaOAc (pH 5.2) as the running buffer. The gel was stained with GelRed (Biotium) and visualized on a Bio-Rad Gel Doc XR+. The acylation yield was determined by quantifying the intensity of the microhelix band using ImageJ (NIH).
[0393] tRNA acylationThe tRNA acylation reaction was carried out as follows: 2 μL of 0.5 M HEPES (pH 7.5), 2 μL of 250 μM tRNA, 2 μL of 250 μM Fx selected in the microhelix experiment, and 6 μL of nuclease-free water were mixed in a PCR tube. The mixture was heated to 95°C for 2 min and then cooled to room temperature over 5 min. 4 μL of 300 mM MgCl2 was added to the cooled mixture and incubated at room temperature for 5 min. The reaction mixture was then incubated on ice for 2 min, and then 4 μL of 25 mM activated ester substrate in DMSO was added to the reaction mixture. The reaction mixture was further incubated on ice in a cold room for the optimal time determined in the microhelix experiment.
[0394] tRNA sedimentation The mixture from the coupling reaction was added to a 1.5 mL microcentrifuge tube containing 100 μL of EtOH and 40 μL of 0.3 M NaOAc (pH 5.2) and mixed to terminate the reaction. This mixture was centrifuged at 21,000 g for 15 minutes at room temperature, and the supernatant was removed. The RNA pellet was washed with 50 μL of 70% (v / v) ethanol containing 0.1 M NaOAc (pH 5.2), resuspended in this solution by vortexing, and then centrifuged at 21,000 g for 5 minutes at room temperature. This washing step was repeated twice. After discarding the supernatant, the pellet was resuspended in 50 μL of 70% (v / v) ethanol and centrifuged at 21,000 g for 3 minutes at room temperature. The supernatant was removed, and the pellet was dissolved in 1 μL of 1 mM NaOAc (pH 5.2).
[0395] In vitro translationThe reprogrammed genetic code approach was used to generate the PURExpress (Δ aa, Δ tRNA, E6840) system. Six micrograms of misacylated tRNA was dissolved in 1 μL of 1 mM NaOAc (pH 5.2) and added to 9 μL of a solution mixture containing 2 μL of solution A, 1 μL of tRNA, 3 μL of solution B, 1 μL of DNA template (130 ng / μL), 1 μL of nuclease-free water, and 1 μL of a 5 mM amino acid mixture in 20 mM Tris buffer (pH 7.5). The reaction mixture was incubated at 37°C for 4 hours.
[0396] Peptide purification Peptides produced in PURExpress were purified using affinity tag purification technology. 2 μL of a 5% suspension of MagStrep (Type 3) XT beads (iba) was washed twice with 200 μL and 100 μL of Strep-Tactin XT wash buffer (1x) in a 1.5 mL microcentrifuge tube. The buffer was discarded by placing the tube on a magnetic rack. 10 μL of the PURExpress reaction material was mixed with the wet magnetic beads, and the tube containing this mixture was placed on ice for 30 minutes. The mixture was vortexed for 5 seconds every 10 minutes. The tube was returned to the magnetic rack, and the supernatant was removed. The beads were washed twice with 200 μL and 100 μL of wash buffer, and the buffer was discarded. The beads were mixed with 10 μL of 0.1% SDS solution (v / v in water), transferred to a PCR tube, and heated to 95°C for 2 minutes. The SDS solution was separated from the beads on a 96-well magnetic rack and further analyzed by mass spectrometry.
[0397] To calculate the yield of the peptide (NH2-WSHPQFEKST-OH; SEQ ID NO: 14), the histidine-tagged enzyme re-transported to the PURExpress was removed using Ni-NTA-coated magnetic beads (His-Select® Nickel Magnetic Agarose Beads, Sigma). 2 μL of the bead suspension (iba) was washed twice with 200 μL and 100 μL of Strep-Tactin XT Wash Buffer (1×) in a 1.5 mL microcentrifuge tube. The reaction mixture was added to the beads and stirred for 10 minutes at room temperature. The beads were washed on a magnetic rack, and the supernatant was collected. The supernatant was applied to a C18 spin column (Pierce C18 column, Thermo Fisher Scientific) to remove residual nucleic acids and buffer. The column was washed twice with 20% MeCN / water (5% TFA). The peptide was eluted with 80% MeCN / water (5% TFA).
[0398] Peptide characterization 1.5 μL of peptide purified by strep affinity tag was mixed with 1 μL of saturated α-cyano-4-hydroxycinnamic acid (CHCA) in THF containing 0.1% TFA on a MALDI plate. The sample was allowed to dry at room temperature for 30 minutes. MALDI-TOF mass spectra of the peptides were acquired using a Bruker Autoflex III in positive reflectron mode.
[0399] Example 4 - Further examples of substrate synthesis
[0400] Materials and Methods
[0401] All reagents and solvents were of commercial grade and, when necessary, were purified before use. Dichloromethane was dried by passing it through a column of activated alumina.
[0402] (2-(4-(mercaptomethyl)benzamido)ethyl) t-butylcarbamate (ABT) was prepared by standard procedures. 3All organic solutions were dried over MgSO4. Thin-layer chromatography (TLC) was performed using glass-backed silica gel (250 μm) plates. Flash chromatography was performed on a Biotage Isolera One automated purification system. Products were visualized using UV light and / or the use of KMnO4.
[0403] Nuclear magnetic resonance spectra (NMR) were acquired on a Bruker Advance III-500 (500 MHz) or Varian Unity 500 (500 MHz) instrument and processed by MestReNova. Chemical shifts are measured relative to residual solvent peaks set at δ 7.26 and δ 77.0 (CDCl3) and δ 2.50 and δ 39.5 (DMSO-d6) as internal standards. Mass spectra were recorded on a Bruker Amazon SL or Waters Q-TOF Ultima (ESI) and Impact-II or Waters 70-VSE (EI) spectrometers using the ionization methods described.
[0404] General Procedure A for Dinitrobenzyl Ester Formation and Boc Deprotection To a glass vial equipped with a stir bar was added the carboxylic acid (1 equiv.), CHCl (1.0 M), triethylamine (1.5 equiv.), and 3,5-dinotrobenzyl chloride (1.2 equiv.). The reaction mixture was stirred at room temperature for 16 h, then diluted with EtOAc, washed with HCl (0.5 M aqueous solution), NaHCO (4% (w / v) in water), brine, and dried over MgSO. The organic phase was concentrated to give the crude product. This product was purified by flash column chromatography. The resulting fractions containing the product were collected in a 100 mL flask, and the solvent was removed under reduced pressure. 2 mL of HCl (4 N in anhydrous dioxane) was added and stirred at room temperature for 1 h. The resulting product was transferred to a 20 mL glass vial and dried under high vacuum overnight to give the final product.
[0405] General Procedure B for Dinitrobenzyl Ester Formation and Boc DeprotectionTo a flame-dried vial equipped with a septum and stir bar was added the carboxylic acid (1.0 equiv.), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (2.0 equiv.), and dimethylaminopyridine (2.0 equiv.), evacuated, and filled with N 2(g) After flushing three times, anhydrous CHCl (0.1 M) was added via syringe. The reaction was then stirred for 10 minutes, after which dinitrobenzyl alcohol (0.1 M in anhydrous CHCl) was added dropwise via syringe over 60 seconds. The reaction was then stirred at 22 °C for 16 hours. The reaction was diluted with DCM, added to a separatory funnel, rinsed with HCl (1.0 M aqueous solution), HO, NaHCO (3.0 M aqueous solution), dried over NaSO, filtered, and then silica (SiO) was added and concentrated under reduced pressure. The compound / silica mixture was then dried, loaded, and purified by silica gel column chromatography [solvent system: hexane-ethyl acetate; 9:1 to 2:8].
[0406] The resulting oil or solid was placed in a 20 mL scintillation vial equipped with a stir bar, and 2 mL of HCl (4N in anhydrous dioxane) was added and stirred for 4 hours. The solution was concentrated under reduced pressure, after which 5 mL of diethyl ether was added, and the heterogeneous mixture was sonicated for 5 minutes. The mixture was filtered, and the filter cake was rinsed with diethyl ether. The solid was collected and dried under vacuum to yield the final product.
[0407] General Procedure C for the Formation of 4-((2-aminoethyl)carbamoyl)benzyl Thioates and Boc Deprotection To a flame-dried vial equipped with a septum and stir bar was added the carboxylic acid (1.0 equiv.), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (2.0 equiv.), and dimethylaminopyridine (2.0 equiv.), evacuated, and filled with N 2(g)After flushing three times, anhydrous CHCl (0.1 M) was added via syringe. The reaction was then stirred for 10 minutes, after which t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (0.1 M in anhydrous CHCl) was added dropwise via syringe over 60 seconds. The reaction was then stirred at 22 °C for 16 hours. The reaction was diluted with DCM, added to a separatory funnel, rinsed with HCl (1.0 M aqueous solution), HO, NaHCO (3.0 M aqueous solution), dried over NaSO, filtered, and then silica (SiO) was added and concentrated under reduced pressure. The compound / silica mixture was then dissolved and purified by silica gel column chromatography [solvent system: hexane-ethyl acetate; 8:3 to 1:9].
[0408] The resulting oil or solid was placed in a 20 mL scintillation vial equipped with a stir bar, and 2 mL of HCl (4N in anhydrous dioxane) was added and stirred for 4 hours. The solution was concentrated under reduced pressure, after which 5 mL of diethyl ether was added, and the heterogeneous mixture was sonicated for 5 minutes. The mixture was filtered, and the filter cake was rinsed with diethyl ether. The solid was collected and dried under vacuum to yield the final product. [ka]
[0409] 3,5-Dinitrobenzyl-amino-4-butanoate. Prepared according to general procedure A using N-Boc-4-aminobutanoic acid (61.5 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.5 mL). The product was obtained as a white powder (65 mg, 70%). 1H NMR (500 MHz, 500 MHz, DMSO-d6) δ 8.80 (t, J = 2.3 Hz, 1H), 8.59 (d, J = 2.1 Hz, 2H), 5.37 (s, 2H), 2.86-2.79 (m, 2H), 2.58 (t, J = 7.5 Hz, 2H), 1.85 (q, J = 7.6, 7.7, 2H); 13 C NMR (125 MHz, DMSO-d6) ppm 172.4, 148.5 (2C), 141.0, 128.7 (2C), 118.6, 64.2, 38.4, 30.6, 22.7;HRMS (EI):C 11 H 13 N3O6[M+H] + The exact calculated mass is 204.24 and the measured mass is 204.12. [ka]
[0410] 3,5-Dinitrobenzyl 5-aminovalerate. Prepared according to general procedure A using Boc-5-Ava-OH (72 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.5 mL). The product was obtained as a yellow oil (51 mg, 53%). 1 H NMR (500 MHz, DMSO-d6) δ 8.80 (t, J = 2.1 Hz, 1H), 8.67 (d, J = 2.0 Hz, 2H), 5.36 (s, 2H), 2.82-2.77 (m, 2H), 2.49 (t, J = 7.2 Hz, 2H), 1.66-1.54 (m, 4H); 13 C NMR (125 MHz, DMSO-d6) ppm 172.8, 148.5 (2C), 141.0, 128.6 (2C), 118.5, 64.0, 38.8, 33.0, 26.8, 21.7;HRMS (CI):C 12 H 16 N3O6[M+H] +The exact mass calculated is 298.27 and the measured value is 298.11. [ka]
[0411] 3,5-Dinitrobenzyl 6-aminohexanoate. Prepared according to general procedure A using Boc-5-Ahx-OH (76 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.5 mL). The product was obtained as a white solid (64 mg, 62%). 1 H NMR (500 MHz, CDCl3) δ 8.80 (t, J = 2.1 Hz, 1H), 8.66 (d, J = 2.0 Hz, 2H), 5.36 (s, 2H), 2.78-2.72 (m, 2H), 2.45 (t, J = 7.6 Hz, 2H), 1.62-1.53 (m, 4H), 1.38-1.31 (m, 2H); 13 C NMR (125 MHz, DMSO-d6) ppm 173.0, 148.5 (2C), 141.9, 128.5 (2C), 118.5, 63.9, 38.9, 33.5, 27.0, 25.7, 24.2;HRMS (CI):C 13 H 17 N3O6[M+H] + The exact calculated mass is 312.29, and the measured mass is 312.13. [ka]
[0412] 3,5-Dinitrobenzyl 4-(methylamino)butanoate was prepared according to general procedure A using 4-((boc-(methyl)amino)butanoic acid (67 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.5 mL). The product was obtained as a yellow powder (70 mg, 72%).1 H NMR (500 MHz, DMSO-d6) δ 8.72 (s, 1H), 8.59 (s, 2H), 4.76 (s, 2H), 1.82 (q, J = 7.5, 7.5 Hz, 2H),; 13 C NMR (125 MHz, DMSO-d6) ppm 173.9, 148.4, 147.9, 128.6, 126.7 (2C), 117.4, 61.5, 47.9, 32.7 30.9, 21.3;HRMS (EI):C 12 H 15 N3O6[M+H] + The exact mass calculated was 298.10 and the measured value was 298.14. [ka]
[0413] 3,5-Dinitrobenzyl piperidine-4-carboxylate. Prepared according to general procedure A using N-Boc-piperidine-4-carboxylic acid (76 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.5 mL). The product was obtained as a yellow powder (43 mg, 46%). 1 H NMR (500 MHz, 500 MHz, DMSO-d6) δ 8.77 (s, 1H), 8.59 (s, 2H), 4.76 (s, 2H), 3.20 (d, J = 6.8, 2H), 2.90 (q, J = 11.4, 10.9 Hz, 2H), 2.60-2.54 (m, 1H), 2.14 (s, 1H), 1.97 (d, J = 14.9, 2H), 1.73 (qd, J = 11.4, 14.9, 4.0, 2H); 13 C NMR (125 MHz, DMSO-d6) ppm 175.2, 148.4, 148.0, 129.7, 126.7 (2C), 117.3, 61.5, 42.7 (2C), 38.1, 24.9 (2C); HRMS (EI):C 13 H 15 N3O6[M+H]+ The exact calculated mass is 310.10 and the measured mass is 310.02. [ka]
[0414] 3,5-Dinitrobenzyl 2-(piperidin-4-yl)acetate. Prepared according to general procedure A using N-Boc-4-piperidineacetic acid (80 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.3 mL). The product was obtained as a yellow oil (66 mg, 62%). 1 H NMR (500 MHz, DMSO-d6) δ; 8.72 (t, J = 2.0 Hz, 1H), 8.59 (d, J = 1.7 Hz, 2H), 3.15 (d, J = 12.4 Hz, 2H), 2.79 (td, J = 12.7, 2.8 Hz, 2H), 2.37 (d, 2H), 1.99-1.90 (m, 1H), 1.74 (d, J = 14.0 Hz, 2H), 1.33 (qd, J = 12.8, 4.1 Hz, 2H); 13 C NMR (125 MHz, DMSO-d6) ppm 171.7, 148.5 (2C), 141.0, 128.5 (2C), 118.5, 64.0, 43.2 (2C), 30.6, 28.4 (2C); HRMS (EI):C 14 H 17 N3O6[M+H] + The exact calculated mass is 324.31 and the measured mass is 324.09. [ka]
[0415] 3,5-Dinitrobenzyl 2-(piperazin-1-yl)acetate. Prepared according to general procedure A using 2-(4-Boc-1-piperazinyl)acetic acid (80 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.3 mL). The product was obtained as a white powder (87 mg, 82%). 1 H NMR (500 MHz, DMSO-d6) δ; 2.69 (t, J = 4.9 Hz, 4H), 2.98 (t, J = 5.1 Hz, 4H), 3.41 (s, 2H), 5.31 (s, 2H), 8.61 (d, J = 1.1 Hz, 2H), 8.73 (t, J = 2.1, 1H); 13 C NMR (125 MHz, DMSO-d6) 170.0, 148.5 (2C), 140.9, 128.8 (2C), 118.8, 64.0, 57.9, 49.1 (2C), 43.3 (2C);HRMS (EI):C 13 H 16 N4O6[M+H] + The exact mass calculated is 325.11 and the measured value is 325.22. [ka]
[0416] S-(4-((2-aminoethyl)carbamoyl)benzyl) 4-aminobutanethioate. Prepared according to general procedure C using 7-((t-butoxycarbonyl)amino)butanoic acid (50.8 mg, 0.25 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (95.9 mg, 0.50 mmol), dimethylaminopyridine (61.1 mg, 0.50 mmol), and t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (84.6 mg, 0.25 mmol). The product was obtained as a white powder (40.7 mg, 55%). Silica gel column chromatography [solvent system: hexane-ethyl acetate; 1:1, Rf = 0.1].1 H NMR (500 MHz, 500 MHz, DMSO-d6) 13 C NMR (125 MHz, DMSO-d6) HRMS (EI):C 14 H 22 N3O2S [M+H] + The exact calculated mass is 296.1433, and the measured mass is 296.1435. [ka]
[0417] S-(4-((2-aminoethyl)carbamoyl)benzyl) 4-amino-2,2-dimethylbutanethioate. Prepared according to general procedure C using 4-((t-butoxycarbonyl)amino)-2,2-dimethylbutanoic acid (57.8 mg, 0.25 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (95.9 mg, 0.50 mmol), dimethylaminopyridine (61.1 mg, 0.50 mmol), and t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (84.6 mg, 0.25 mmol). The product was obtained as a white powder (51.7 mg, 64%). Silica gel column chromatography [solvent system: hexane-ethyl acetate; 1:1, Rf = 0.1]. 1 H NMR (500 MHz, 500 MHz, DMSO-d6) 13 C NMR (125 MHz, DMSO-d6) HRMS (EI):C 16 H 25 N3O2S [M+H] + The exact calculated mass is 323.1667, and the measured mass is 323.1669. [ka]
[0418] S-(4-((2-aminoethyl)carbamoyl)benzyl) 7-aminoheptanethioate. Prepared according to general procedure C using 7-((t-butoxycarbonyl)amino)heptanoic acid (105.5 mg, 0.43 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (165.1 mg, 0.86 mmol), dimethylaminopyridine (105.2 mg, 0.86 mmol), and t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (145 mg, 0.43 mmol). The product was obtained as a white powder (133.7 mg, 92%). Silica gel column chromatography [solvent system: hexane-ethyl acetate; 1:1, Rf = 0.1]. 1 H NMR (500 MHz, 500 MHz, DMSO-d6) 13 C NMR (125 MHz, DMSO-d6) HRMS (EI):C 17 H 28 N3O2S [M+H] + The exact calculated mass is 338.1902, and the measured mass is 338.1902. [ka]
[0419] (1s,3s)-3-Aminocyclobutane-1-carbothioate S-(4-((2-aminoethyl)carbamoyl)benzyl). Prepared according to general procedure C using (1s,3s)-3-((t-butoxycarbonyl)amino)cyclobutane-1-carboxylic acid (92.5 mg, 0.43 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (165.1 mg, 0.86 mmol), dimethylaminopyridine (105.2 mg, 0.86 mmol), and t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (145 mg, 0.43 mmol). The product was obtained as a white powder (103.3 mg, 78%). Silica gel column chromatography [solvent system: hexane-ethyl acetate; 1:1, Rf = 0.1]. 1H NMR (500 MHz, 500 MHz, DMSO-d6) 13 C NMR (125 MHz, DMSO-d6) HRMS (EI):C 15 H 22 N3O2S [M+H] + The exact calculated mass is 308.1433 and the measured mass is 308.1437. [ka]
[0420] (1r,3r)-3-Aminocyclobutane-1-carbothioate S-(4-((2-aminoethyl)carbamoyl)benzyl). Prepared according to general procedure C using (1r,3r)-3-((t-butoxycarbonyl)amino)cyclobutane-1-carboxylic acid (92.9 mg, 0.43 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (165.6 mg, 0.86 mmol), dimethylaminopyridine (105.4 mg, 0.86 mmol), and t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (145 mg, 0.43 mmol). The product was obtained as a white powder (100.7 mg, 76%). Silica gel column chromatography [solvent system: hexane-ethyl acetate; 1:1, Rf = 0.1]. 1 H NMR (500 MHz, 500 MHz, DMSO-d6) 13 C NMR (125 MHz, DMSO-d6) HRMS (EI):C 15 H 22 N3O2S [M+H] + The exact calculated mass is 308.1433, and the measured mass is 308.1436. [ka]
[0421] (1S,3R)-3-Aminocyclopentane-1-carbothioate S-(4-((2-aminoethyl)carbamoyl)benzyl). Prepared according to general procedure C using (1S,3R)-3-((t-butoxycarbonyl)amino)cyclopentane-1-carvone (98.6 mg, 0.43 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (165.1 mg, 0.86 mmol), dimethylaminopyridine (105.2 mg, 0.86 mmol), and t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (145 mg, 0.43 mmol). The product was obtained as a white powder (91.4 mg, 66%). Silica gel column chromatography [solvent system: hexane-ethyl acetate; 1:1, Rf = 0.1]. 1 H NMR (500 MHz, 500 MHz, DMSO-d6) 13 C NMR (125 MHz, DMSO-d6) HRMS (EI):C 16 H 24 N3O2S [M+H] + The exact calculated mass is 322.1589 and the measured mass is 322.1591. [ka]
[0422] (1S,3R)-3-Aminocyclohexane-1-carbothioate S-(4-((2-aminoethyl)carbamoyl)benzyl). Prepared according to general procedure C using (1S,3R)-3-((t-butoxycarbonyl)amino)cyclohexane-1-carboxylic acid (104.6 mg, 0.43 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (165.1 mg, 0.86 mmol), dimethylaminopyridine (105.2 mg, 0.86 mmol), and t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (145 mg, 0.43 mmol). The product was obtained as a white powder (99.7 mg, 69%). Silica gel column chromatography [solvent system: hexane-ethyl acetate; 1:1, Rf = 0.1]. 1 H NMR (500 MHz, 500 MHz, DMSO-d6) 13 C NMR (125 MHz, DMSO-d6) HRMS (EI):C 17 H 26 N3O2S [M+H] + The exact calculated mass is 336.1746, and the measured mass is 336.1746. [ka]
[0423] (1S,3S)-3-Aminocyclohexane-1-carbothioate S-(4-((2-aminoethyl)carbamoyl)benzyl). Prepared according to general procedure C using (1S,3S)-3-((t-butoxycarbonyl)amino)cyclohexane-1-carboxylic acid (104.1 mg, 0.43 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (165.1 mg, 0.86 mmol), dimethylaminopyridine (105.2 mg, 0.86 mmol), and t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (145 mg, 0.43 mmol). The product was obtained as a yellow powder (95.4 mg, 62%). Silica gel column chromatography [solvent system: hexane-ethyl acetate; 1:1, Rf = 0.1]. 1 H NMR (500 MHz, 500 MHz, DMSO-d6) 13 C NMR (125 MHz, DMSO-d6) HRMS (EI):C 17 H 26 N3O2S [M+H] + The exact calculated mass is 336.1746 and the measured mass is 336.1749. [ka]
[0424] S-(4-((2-aminoethyl)carbamoyl)benzyl) 5-(aminomethyl)furan-3-carbothioate. Prepared according to general procedure C using 5-(((t-butoxycarbonyl)amino)methyl)furan-3-carboxylic acid (60.3 mg, 0.25 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (95.9 mg, 0.50 mmol), dimethylaminopyridine (61.1 mg, 0.50 mmol), and t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (84.6 mg, 0.25 mmol). The product was obtained as a yellow powder (68.5 mg, 82%). Silica gel column chromatography [solvent system: hexane-ethyl acetate; 1:1, Rf = 0.1]. 1 H NMR (500 MHz, 500 MHz, DMSO-d6) 13 C NMR (125 MHz, DMSO-d6) HRMS (EI):C 16 H 20 N3O3S [M+H] + Accurate calculated mass: 334.1225 Measured mass: 334.1225.
[0425] Example 5 - Further expansion of chemical substrates for genetic code reprogramming
[0426] Field
[0427] We report novel non-canonical substrates that can accept peptide incorporation at either the N- or C-terminus by utilizing flexizyme (Fx), II).
[0428] summary
[0429] Ribosome-mediated polymerization of backbone-elongated monomers into polypeptides is challenging due to the poor compatibility of these monomers with the translational apparatus, which has evolved to use α-L-amino acids. Here, we rationally design 16 non-canonical β-amino acid analogs with cyclic structures to expand the range of substrates that can be incorporated into peptides by the ribosome. These β-amino acids, which are potent helix inducers due to their restricted conformation, are synthesized using flexizyme (a tRNA-synthetase-like ribozyme) and tRNAs with a special D-arm motif for EF-P binding and an engineered T-stem motif with improved EF-Tu binding affinity. Pro1E2 We then demonstrate site-specific incorporation of these cyclic β-amino acids into peptides using wild-type and engineered ribosomes, and compare the efficiency of incorporation of cyclic β-amino acids with the presence of engineered translational machinery and EF-P. We find that EF-P improves the incorporation of cyclic β-amino acids into peptides and expands the scope of ribosome-catalyzed transformations.
[0430] application
[0431] Non-limiting examples of applications of the disclosed technology include: (i) further expanding the scope of non-canonical chemical substrates, allowing the generation of novel functional polymers that can support novel AB polycondensation reactions (rather than amide and ester bonds); (ii) redefining orthogonal tRNAs using non-canonical substrates; (iii) generating engineered peptides by incorporating new groups that are inaccessible to peptides synthesized by natural (or wild-type) ribosomes or their post-translationally modified derivatives; (iv) generating novel protease-resistant peptides that can alter medicinal chemistry; and (v) generating novel polymers with turns and helices that can adapt the polymer for binding to specific proteins.
[0432] advantage
[0433] Non-limiting examples of the advantages of the disclosed technology may include: (i) synthesizing 16 types of non-canonical chemical substrates that cannot be obtained by conventional non-canonical derivatives of alpha-amino acids, beta-amino acids, and hydroxy acids; (ii) expanding the range of substrates compatible with Fx to beta-amino acids with bulky cyclic carbon structures (6-, 5-, 4-, and 3-membered rings) with different chiral centers that may provide diverse helical features in polypeptides; (iii) synthesizing alpha-amino acids, beta-amino acids, and hydroxy acids with bulky cyclic carbon structures (6-, 5-, 4-, and 3-membered rings) with different chiral centers that may provide diverse helical features in polypeptides; To expand the range of substrates compatible with Fx to ter-amino acids and beta-amino acids with bulky cyclic carbon structures (6-, 5-, 4-, and 3-membered rings) that may confer helical features not obtainable by conventional non-canonical derivatives of hydroxy acids; (iv) to synthesize 3,5-dinitrobenzyl-2-aminocyclohexane-1-carboxylate and 3,5-dinitrobenzyl-2-aminocyclopentane-1-carboxylate with four different configurations (1R2R; 1R2S; 1S2R; 1S2S); (v) to synthesize two (vi) To synthesize 3,5-dinitrobenzyl-2-aminocyclobutane-1-carboxylate, S-(4-((2-aminoethyl)carbamoyl)benzyl)-2-aminocyclobutane-1-carbothioate, 3,5-dinitrobenzyl-2-aminocyclopropane-1-carboxylate, and S-(4-((2-aminoethyl)carbamoyl)benzyl)-2-aminocyclopropane-1-carbothioate with different isomers (cis; trans) of 3,5-dinitrobenzyl-2-aminocyclobutane-1-carboxylate, and S-(4-((2-aminoethyl)carbamoyl)benzyl)-2-aminocyclopropane-1-carbothioate; (vi) To optimize the reaction conditions using different incubation times and different pHs. (vii) demonstrating tRNA charging reactions using 16 non-canonical substrates under optimized Fx reaction conditions; (viii) demonstrating the incorporation of bulky beta-amino acids into peptides using wild-type or engineered ribosomes to explore the impact of the translation machinery on a cell-free platform to generate novel polymers; all of which have never been found or studied before;(ix) demonstrate the incorporation of bulky beta-amino acids into peptides using the additional translational apparatus EF-P in the presence of either wild-type or engineered ribosomes to investigate their cooperative activity in protein translation reactions to generate novel polymers; (x) define the most important factors for the incorporation of bulky substrates into polypeptides; (xi) report the charging of eight designed non-canonical substrates to tRNA; (xii) purify peptides from cell-free protein synthesis reactions using reporter peptides (purification tags) containing non-canonical chemical substrates and characterize the peptides by mass spectrometry; and (xiii) demonstrate the ability to incorporate groups using novel monomers, which have previously been revolutionary in medicinal chemistry.
[0434] Description
[0435] Current studies have reported that over 200 non-canonical substrates can be charged to tRNA and incorporated into peptides using the Fx approach, and although many strategies have been devised to synthesize tRNAs charged with non-canonical amino acids, limitations and gaps in the substrate scope still exist.
[0436] Misacylated tRNAs can be synthesized using protected pdCpA followed by enzymatic ligation (e.g., T4 RNA ligase) with a truncated tRNA lacking the 3'-terminal CA nucleotide. However, this method is synthetically cumbersome and often results in poor results due to the generation of cyclic tRNA byproducts that inhibit ribosomal peptide synthesis. Ester bonds for misacylated tRNAs can also be obtained using engineered synthetase / orthogonal tRNA pairs. However, only the high specificity of synthetases for amino acid substrates allows charging of a narrow substrate pool, and therefore extensive work (e.g., directed evolution) is often required to develop new synthetases.
[0437] Another method for generating misacylated tRNAs is through the use of flexizyme (Fx), an artificial ribozyme capable of aminoacylating any tRNA. The Fx system has seen widespread success over the past decade, during which a wide range (>200) of chemical substrates (α-amino acids, β-amino acids, γ-amino acids, D-amino acids, non-canonical amino acids, N-protected (alkylated) amino acids, and hydroxy acids) have been incorporated into ribosomal peptide chains via misacylated tRNAs.
[0438] However, Fx-mediated charging of bulky amino acids with cyclic structures onto tRNA using genetic code reprogramming approaches remains challenging because tRNA-charged substrates are not efficiently accepted by the ribosome, fundamentally limiting the diversity of peptide libraries that can be generated by genetic code reprogramming approaches.
[0439] Here, we investigate the incorporation rate by utilizing the rational design of 16 cyclic β-amino acids compatible with the Fx system. Using the wild-type translational apparatus in a cell-free platform, we demonstrate ribosome-mediated incorporation of substrates into the N-terminus of peptides. Engineered E. coli ribosomes and engineered tRNAs Pro1E2 We also demonstrate that using engineered tRNA with EF-P, which interacts more efficiently with engineered tRNA, the substrate can be incorporated into the C-terminus of the peptide. To our knowledge, this is the first example of the use of engineered ribosomes, engineered tRNA, and their cognate translation machinery to synthesize functionalized peptides with a cyclic β-amino acid at the C-terminus.
[0440] There are no known comprehensive studies on the creation of a novel range of sequence-specific polymers with novel covalent chemical bonds by natural ribosomes that have been evolutionarily optimized to form amide (peptide) bonds using 20 amino acid building blocks.
[0441] Although previous studies have incorporated non-standard chemical substrates into peptides, these studies have primarily focused on the use of amino acid, hydroxy acid, and thio acid variants to expand diversity, limiting the range of polymers that can be produced by this approach to polypeptides, polyesters, and polythioesters. Additionally, these studies have not proposed a comprehensive basis for designing substrates of long carbon chains and cyclic amino acids.
[0442] This comprehensive expansion of synthetic substrates reveals novel non-canonical substrates (beta-cyclic amino acids) that are compatible with Fx, can be charged to tRNA, and incorporated into peptides. Our work also demonstrates that the incorporation of bulky beta-amino acid substrates can be enhanced by the use of engineered tRNAs, engineered ribosomes, and EF-P, and that this set of translational machinery can provide a new platform for generating novel types of functionalized peptides.
[0443] The Fx system makes it possible to expand the existing range of chemical variants, which has mostly been limited to amino acids and hydroxy acids, thereby opening up new, non-canonical categories of synthetic substrates that may form novel covalent bonds in the ribosome. In light of the growing interest in engineering the translation machinery to incorporate non-canonical monomers, this significant expansion of the chemical range may be invaluable for the efficient synthesis of novel non-biological proteins and polyamide-type polymers.
[0444] See the data shown in Figures 23-26.
[0445] Example 6 - Peptides by ribosome-mediated in vitro polymerization of long carbon chain and cyclic amino acids
[0446] See Lee J. et al., "Peptides by Riboxome-Mediated In Vitro Polymerization of Long Carbon Chain and Cyclic Amino Acids," Nat. Commun. 2020 Aug 27;11(1):4304, the contents of which are incorporated herein by reference in their entirety.
[0447] summary
[0448] Ribosome-mediated polymerization of backbone-extended monomers into polypeptides is challenging due to the poor compatibility of the monomers with the translational machinery, leading to the use of α-L-amino acids. Furthermore, the mechanism for acylation (or charging) of these monomers onto transfer RNA (tRNA) to form aminoacyl-tRNA substrates remains a bottleneck. Here, we rationally design non-canonical amino acid analogs with extended carbon chains (γ-, δ-, ε-, and ζ-) or cyclic structures (cyclobutane, cyclopentane, and cyclohexane) to improve tRNA charging. We then demonstrate site-specific incorporation of these non-canonical backbone-extended monomers into peptides at the N- and C-termini using wild-type and engineered ribosomes. This work expands the scope of ribosome-mediated polymerization and sets the stage for new drugs and materials.
[0449] Introduction
[0450] Cellular translation systems (ribosomes and associated components for protein biosynthesis) catalyze the synthesis of sequence-specific polymers (polypeptides) using a set of amino-acylated transfer RNA (tRNA) substrates and a defined set of coding templates (messenger RNAs). In nature, only a limited set of α-L-amino acid monomers is used by this system, thereby limiting the potential diversity of polymers that can be synthesized. However, over the past two decades, efforts to expand the genetic code have shown that natural translation systems can selectively incorporate a wide range of non-canonical monomers. 1 - 5 These monomers include, in particular, α- 6, β- 7 - 9 , γ- 10 - 12 , D- 13 , 14 , aromatic 15 - 17 , aliphatic 15 , 18 , malonyl 16 , N-alkylated 19 , and oligomeric amino acid analogs 10 , 20 , 21 is included (Figure 28a).
[0451] This site-specific incorporation of various chemical entities into peptides and proteins has led to a wave of exciting applications. For example, foldamers incorporated into the N-terminus of peptides have yielded macrocyclic foldamer-peptide hybrids with unique biological activities. 22 In addition, benzoic acid and 1,3-dicarbonyl substrates have been incorporated into a variety of aramid-peptide and polyketide-peptide hybrid molecules. 15 , 16 , which may enable new classes of functional materials and polyketide natural products. Furthermore, β-amino acid peptides have enabled new protease-resistant peptidomimetics. 23 - 27 .
[0452] Access to a wider repertoire of monomers for ribosome-mediated polymerization holds the promise of further increasing the number of polymers that can be synthesized in a sequence-specific manner, which has been called the next "holy grail" of polymer science. 28 For example, polyamides (not polypeptides) utilize a critical set of special molecular architectures to obtain exceptional polymer properties (such as improved thermal stability, modulus, and tensile strength) based on the polymer backbone and chain microstructure (i.e., nylon-6 vs. Kevlar). 29 , 30, Figure 28b). The ability to introduce these architectures into polypeptides and alter their properties could open new opportunities at the intersection of materials science and synthetic biology. However, the direct incorporation of these monomers (long-carbon-chain amino acids (γ- and longer)) has proven challenging for two important reasons. First, natural ribosomes have been evolutionarily optimized for polymerizing α-L-amino acids, making them poorly compatible with backbone-extended monomers. Second, acylation (or charging) of these monomers onto tRNA to form aminoacyl-tRNA substrates is challenging. Because chemical aminoacylation is technically challenging and tedious, and aminoacyl-tRNA synthetases have not evolved for these long-carbon-chain monomers, the flexizyme system (Fx, aminoacyl-tRNA synthetase-like ribozyme) has been the preferred choice. 23 , 31 Efforts to use tRNA-charging tRNA have been unsuccessful due to intramolecular lactam formation after the tRNA charging reaction (Figure 28c). 10 , 12 , 25 , 32 , 33 Taken together, these limitations restricted the range of long-carbon chain (or backbone-extended) amino acid monomers that could be incorporated by the ribosome into sequence-specific polyamides.
[0453] Here, we attempt to address these limitations by investigating the charging of γ-, δ-, ε-, and ζ-amino acids containing long carbon chain structures onto tRNA catalyzed by Fx, and then demonstrate the in vitro incorporation of such amino acid derivatives into peptides by the ribosome. This is in line with our recent work investigating flexizyme design rules involving four chemically diverse scaffolds (phenylalanine, benzoic acid, heteroaromatic, and aliphatic monomers) with different electronic and steric factors. 15 Here, we consider how backbone-extended monomers can avoid the intramolecular nucleophilic attack of the monomer amino group to facilitate tRNA charging. In addition, we focus on long carbon chains and cyclic monomers. This is because various non-canonical α-amino acids can be synthesized. 6 and many works showing the incorporation of β-amino acids.7 , 8 , 25 , 34 This is unique and different from previous work. First, through NMR and LC-MS analysis, we confirm that charging of linear γ-amino acids onto tRNA by Flexizyme fails due to lactam formation (Figure 28c and Figure 33). Next, we circumvent this limitation of Fx-catalyzed tRNA charging by designing an amino acid substrate architecture that controls the intramolecular reaction kinetics of the tRNA:substrate complex by lengthening the carbon chain and / or introducing a rigid central architecture (Figure 28d, top), thereby reducing or completely avoiding lactam formation. We then demonstrate the incorporation of backbone-extended monomers into the N-terminus of a peptide using wild-type ribosomes. Finally, we demonstrate the incorporation of backbone-extended monomers into the N-terminus of a peptide using previously engineered ribosomes with mutations in the peptidyl transferase center (PTC). 24 , 27 , 34 allows for the C-terminal incorporation of these non-canonical amino acids into the peptide (Fig. 28d, bottom).
[0454] result
[0455] Charging of long carbon chains and cyclic amino acids by Flexizyme To gain insight into the possible constraints for charging long-chain carbon amino acid substrates onto tRNA using Fx, 10 substrates (1–5 in Figure 29 and 2i–2v in the Characterization section in the Supplementary Information shown in Example 7) were examined with increasing numbers of carbon atoms in the monomer backbone. Dinitrobenzyl ester (DNB)-derivatized or amino-derivatized benzylthioester (ABT)-activated forms of 3-aminopropanoic acid (1, β-alanine) and 4-aminobutyric acid (2 and 2i) were synthesized for Fx-mediated charging. A tRNA mimic, microhelical tRNA (mihx), was used under conventional Fx reaction conditions. 20 The yield of the Fx-mediated acylation reaction was determined using the method described above. The aminoacylation efficiency was assessed by acid-denaturing polyacrylamide gel electrophoresis (PAGE, Figure 33). 1 was successfully charged, whereas 2, as previously reported, 10 ,25 However, we found that this was not the case (Figure 29a and Figure 33). We tested four additional γ-amino acid substrates (4-methylaminobutyric acid (2ii), 2,2-dimethylaminobutyric acid (2iii), cis- (2iv), and trans-2-aminocyclopropane-1-carboxylic acid (2v)) for Fx-mediated tRNA charging, but found that the γ-amino acid substrates (2 and 2i–v, see the characterization section in the Supplementary Information in Example 7) could not be charged (Figure 33). This indicates that our results are consistent with previous literature and that Fx-mediated charging of γ-amino acid analogs with linear carbon chains is indeed difficult.
[0456] To confirm the hypothesis that the poor tRNA charging results were due to lactam formation, we next investigated whether lactams were observed in the Fx-catalyzed reaction. The Fx-catalyzed acylation reaction of 4-methylaminobutyric acid (2ii) with mihx was set up and monitored over 24 h. Remarkably, LC-MS analysis of the reaction mixture incubated for 24 h yielded a single new peak (2.3 min, bright green, Figure 30a). ESI-MS generated by combining mass spectra across the 2.3 min peak revealed an accurate mass corresponding to the theoretical mass of the lactam, 1-methylpyrrolidin-2-one (Figure 30b). Furthermore, lactams were observed only when both Fx and mihx were present in the reaction mixture, suggesting that lactam formation was catalyzed by these species.
[0457] Next, to further support our hypothesis that the formation of larger rings (greater than five members) is kinetically less favorable than five-membered ring formation, thereby increasing the acylation yield of tRNA, we synthesized the long-chain carbon derivatives 5-aminopentanoic acid (3), 6-aminohexanoic acid (4), and 7-aminoheptanoic acid (5). As expected, higher acylation yields were observed with increasing carbon chain length in the amino acid derivatives (Figures 29a and 33). This further supports the idea that the scarcity of linear γ-amino acids in genetic code reprogramming is due to the propensity for lactam formation between these substrates using Fx-mediated catalysis. Notably, this result is consistent with the general rule for ring-closure reactions, which shows that the rate constant for five-membered ring self-cyclization is greatest. 35 , 36 The rate steadily decreases by 1-2 orders of magnitude (i.e., self-cyclization slows) as the ring size increases from 5 to 10 members. 35 .
[0458] Based on these results, we attempted to design a molecular architecture that would prevent intramolecular lactam formation due to the steric constraints of the amino group and activated ester group. Five substrates (6–10 in Figure 29b) containing a rigid spacer (cyclic, aryl, or vinyl) were synthesized and examined for acylation. Remarkably, all substrates (6–10), which were γ- and δ-amino acids, were successfully charged onto tRNA using Flexizyme. To further expand the range of monomers for various polyamides, we synthesized five additional amino acids (11–15 in Figure 29c) containing a cyclic structure in the central region of the amino acid. When these substrates were charged onto tRNA, we found that the acylation yield increased dramatically compared to other γ-type amino acids. This suggests that the rigid cyclic carbon scaffold effectively prevents intramolecular five-membered lactam formation. This observation supports our recently described design rules for Flexizyme-catalyzed acylation. 15 , as well as another recent report demonstrating the incorporation of cyclic gamma-amino acids into peptides. 12In short, the cyclic structure has less steric hindrance with respect to the carbonyl compared to structures (1–5) and increased electrophilicity compared to complex structures (6–8), allowing for efficient tRNA capture. 15 In the end, 13 non-canonical monomers were found to be charged with efficiencies ranging from 6 to 95%, with (E)-4-aminobut-2-enoic acid (7) in the lowest yield and trans-3-aminocyclobutane-1-carboxylic acid (12) in the highest yield, respectively.
[0459] Ribosome polymerization of backbone-extended monomers. Next, we investigated whether the newly discovered flexizyme substrates charged to tRNA could be accepted by the natural protein translation machinery. The goal was to demonstrate that the ribosome is compatible with these substrates, rather than focusing on a specific application. We performed Fx-catalyzed acylation reactions for tRNA under the same reaction conditions obtained from the acylation reaction of mihx (Figure 33). Previous work has shown that the acylation yields and kinetics between in vitro transcribed tRNA mimics (e.g., mihx or microhelix) and tRNA are comparable. 37 - 41 After Fx-mediated tRNA acylation, unreacted monomers were precipitated by ethanol precipitation. 20 The resulting tRNA fraction containing the tRNA-substrate is then used as a mixture for cell-free protein synthesis containing the minimum set of components required for protein translation. 42 Reactants (PURExpress™) 43 MALDI mass spectrometry was then used to determine whether the non-canonical substrate was incorporated at the N- or C-terminus of a small model streptavidin tag.
[0460] As initiator tRNA, tRNA fMet was selected for N-terminal incorporation studies. For C-terminal incorporation, several tRNAs (fMet, Pro1E2, GluE2, and AsnE2) previously engineered to efficiently incorporate non-canonical amino acids into polypeptides by the ribosome were used.44 No significant difference in incorporation efficiency was observed depending on the codon. 44 was chosen because it has an engineered D-arm and T-stem that interacts with other protein translation factors (e.g., EF-Tu and EF-P) that can be added and supplemented into cell-free translation reactions when needed to promote the incorporation of charged substrates. 8 , 25 , 45 For the codon, AUG (CAU anticodon) was used because it is the canonical initiation codon for N-terminal incorporation. For C-terminal incorporation, the ACC codon (GGU anticodon) was chosen, which decodes the Thr(ACC) codon on the mRNA. This was chosen because threonine is excluded from the polypeptide streptavidin tag (WSHPQFEK) used in our study. This prevented the corresponding endogenous tRNA from being aminoacylated and used in the translation reaction in the tPURExpress™ reaction.
[0461] All 14 substrates are tRNA fMet (CAU) and tRNA Pro1E2(GGU) to generate a set of acylated tRNAs, which were then used in PURExpress™ translation reactions. PURExpress™ reactions were performed in the presence of all E. coli endogenous tRNAs (>46), but using only a polypeptide streptavidin tag (WSHPQFEK) and nine amino acids encoding the non-canonical aminoacyl-tRN substrates. Two different sets of amino acids (X + WSHPQFEK + T and M + WSHPQFEK + X) were used for N-terminal and C-terminal incorporation, respectively, where X indicates the position where the backbone-extended monomer charged by Fx is incorporated (Fig. 29a; for details, see the Supplementary Information in Example 7). After translation (Fig. 31a), it was found that all substrates that could be charged to tRNA were successfully incorporated at the N-terminus of the peptide, confirmed by peaks corresponding to the theoretical mass of the peptide in the MALDI spectrum (Fig. 31b-n). However, attempts to generate peptides containing these amino acids at the C-terminus were unsuccessful (Fig. 32a-c and Fig. 34b, e). This is probably because C-terminal incorporation, which forms an amide bond with the nascent peptide, requires a more precise alignment of the substrate in the PTC. 46 This is because wild-type ribosomes are inefficient at incorporating non-canonical backbone-extended substrates into polypeptides.
[0462] Engineered ribosomes enhance the incorporation of novel monomers Recent advances in research by the Hecht group have demonstrated that an engineered ribosome (named 040329) can facilitate the incorporation of dipeptides into growing polymer chains. 24 , 27 This has been shown to enable the synthesis of ribosomes in vivo and in vitro, where the ribosomes utilize distant amines on the substrate to form amide bonds with the nascent peptide. We also hypothesized that this engineered ribosome would be more tolerant of the backbone-extended monomers described herein. To investigate this, we used previously established protocols. 47The mutant ribosomes were co-expressed in cells using the engineered ribosomes (see Supplementary Information for details). Ribosomes were lysed and purified from these cells by ultracentrifugation on a sucrose cushion (see Supplementary Information for details). The resulting ribosome samples contained a mixture of wild-type and 040329 ribosomes, which were then used in translation assays to determine their activity toward elongated backbone monomers. Based on previous literature, we expected that 040329 ribosomes would constitute approximately 25% of the purified ribosome population. To examine the feasibility of incorporating long-chain carbon amino acids into peptides using the engineered ribosomes, the ribosome mixture (Figure 32d) was purified by fusion of tRNA with Fx. Pro1E2 The PURExpress™ system was loaded with a substrate charged with (GGU). In our MALDI mass spectra, we observed peaks corresponding to the theoretical masses of target peptides containing cis- and trans-3-aminocyclobutane-1-carboxylic acid (ACB, 11 and 12, respectively, from Figure 29) at their C-termini (fMWSHPQFEKS11 / 12 in Figure 32e,f and Figure 34c,f), which were not observed in experiments using wild-type ribosomes alone (Figure 32b,c and Figure 34b,e, 5b,c). The relative yields of target peptides containing cis- and trans-ACB at their C-termini were approximately 11% and 15%, respectively, based on the sum of the full-length and truncated peptide products (fMWSHPQFE, fMWSHPQFEK, and fMWSHPQFEKS, Figure 34).
[0463] Finally, we investigated whether additional amino acids could be elongated after the incorporation of the cis- and trans-ACBs (11 and 12, Figure 32g, h and Figure 34d, g) at the C-terminus. We designed a new plasmid encoding two additional amino acid residues, Ile (AUC) and Ala (GCC), and performed PURExpress™ reactions under the same reaction conditions using a new set of 11 amino acids (M + WSHPQFEK + X + IA). Although inefficient, a peak corresponding to the theoretical mass of the target peptide (fMWSHPQFEKS11 / 12IA) was observed. This demonstrates that the engineered ribosome can continue elongation after the insertion of the cis- and trans-ACBs.
[0464] Consideration
[0465] In this work, we expanded the scope of backbone-extended amino acid substrates for molecular translation. To do so, we investigated the mechanistic aspects that limit the acylation process of γ-amino acids onto tRNA by Fx. Through systematic and rational substrate design, we then demonstrated that a diverse repertoire of 15 amino acids with long carbon chains and cyclic structures can be acylated onto tRNA by Fx in yields ranging from 6 to 95%. We then demonstrated that these charged, acylated tRNA monomers can be used in ribosome-mediated polymerization, expanding the diversity of polyamides that can be produced by ribosomal synthesis.
[0466] While the field of genetic code expansion has incorporated hundreds of non-canonical α-amino acids to date, it was unknown whether ribosomes could incorporate the structures presented here based on backbone-extended (γ-, δ-, ε-, and ζ-) and cyclic (cyclobutane, cyclopentane, and cyclohexane) amino acids. Our work demonstrates that ribosomes can polymerize such structures using a genetic code reprogramming approach. Not surprisingly, incorporation efficiency is low, especially at the C-terminus or mid-chain. This is likely because the shape, physicochemical, and dynamic properties of the ribosome have evolved to operate with canonical α-amino acids, or, in the case of engineered ribosome 040329, β-amino acids. 34 It is likely that wild-type and 040329 ribosomes will still discriminate between the backbone-elongated stereoisomeric monomers introduced here. In the future, the efficiency of incorporation of such substrates may be improved by supplementing the combination of EF-P and engineered tRNAs. 8 , 12 , 48 In addition, in vitro ribosome assembly 49 and select 50 This platform may allow the evolution of ribosomes with altered properties that improve the efficiency of incorporation of backbone-extended monomers into peptides (i.e., forming less truncated products), facilitating the synthesis of polymers composed exclusively of such monomers. Finally, orthogonal engineered ribosomes, either tethered or tethered, may be used. 51 - 55 Extension to cellular systems using tRNAs offers another exciting direction, but will need to address the lack of aminoacyl-tRNA-synthetases (aaRSs) that charge monomers onto tRNAs in cells.
[0467] By expanding the range of long carbon chain and cyclic amino acids available for ribosomal polymerization, we hope this work will motivate new directions in efforts to synthesize non-canonical, sequence-specific polymers. For example, the monomers presented here could be used directly for mRNA or ribosome display to discover innovative peptide drugs, along with in vitro screening and selection methods. 56 Additionally, future work will enable unique functional materials and polymers with defined atomic arrangements, precise monodisperse lengths, and programmed stereochemistry.
[0468] method
[0469] General Fx-mediated acylation reactions
[0470] Acylation of microhelices 1 μL of 0.5 M HEPES (pH 7.5) or bicine (pH 8.8), 1 μL of 10 μM microhelix, and 3 μL of nuclease-free water were mixed with 1 μL each of 10 μM eFx, dFx, and aFx in a PCR tube. The mixture was heated to 95°C for 2 minutes and then cooled to room temperature over 5 minutes. 2 μL of 300 mM MgCl2 was added to the cooled mixture and incubated at room temperature for 5 minutes. The reaction mixture was then incubated on ice for 2 minutes, and then 2 μL of 25 mM activated ester substrate in DMSO was added to the reaction mixture. The reaction mixture was further incubated on ice for 16–120 hours in a cold room.
[0471] tRNA acylationA PCR tube was mixed with 2 μL of 0.5 M HEPES (pH 7.5) or bicine (pH 8.8), 2 μL of 250 μM tRNA, 2 μL of 250 μM Fx selected from the microhelix experiments, and 6 μL of nuclease-free water. The mixture was heated to 95°C for 2 minutes and cooled to room temperature over 5 minutes. 4 μL of 300 mM MgCl2 was added to the cooled mixture and incubated at room temperature for 5 minutes. The reaction mixture was then incubated on ice for 2 minutes, after which 4 μL of 25 mM activated ester substrate in DMSO was added to the reaction mixture. This reaction mixture was further incubated under the optimal reaction conditions determined by the microhelix experiments.
[0472] In vitro synthesis of polyamides
[0473] N-terminal incorporation A T7 promoter-controlled DNA template (pJL1_StrepII) was designed to encode a streptavidin (Strep) tag and additional Ser and Thr codons (XWSHPQFEKST (Strep tag), where X indicates the position of the non-canonical amino acid substrate) as a reporter peptide. The translation initiation codon AUG was used for N-terminal incorporation of the non-canonical amino acid substrate X. Peptide synthesis was performed using only the AUG initiation codon and the nine amino acids encoding the purification tag in the absence of the other 11 amino acids to prevent aminoacylation of the corresponding endogenous tRNA and its use in translation. The PURExpress™ Δ(aa, tRNA) Kit (NEB, E6840S) was used for the polyamide synthesis reaction, and the reaction mixture was incubated at 37°C for 3 hours. The synthesized peptides were then purified using Strep-Tactin® coated magnetic beads (IBA), denatured with SDS, and characterized by MALDI-TOF mass spectrometry.
[0474] C-terminal incorporationThe same plasmid (pJL1_StrepII) encoding the same amino acids (MWSHPQFEKSX, where X indicates the position of the cyclic amino acid) was used for C-terminal integration, and the cyclic amino acid was incorporated into the Thr codon (ACC) using a custom-made PURExpress® Δ(aa, tRNA, ribosome) kit (NEB, E3315Z). For C-terminal integration, the wild-type ribosome provided in the kit was not used. 15 μM (final concentration) of engineered ribosomes was added to a reaction mixture containing only the nine amino acids decoding the Strep tag and incubated at 37 °C for 3 h.
[0475] Central position installation A plasmid (pJL1-StrepII_TIA) engineered to encode an additional Ile and Ala downstream of Thr was used to incorporate cyclic amino acids into the central position of a polyamide (MWSHPQFEKSXIA, where X indicates the position of the cyclic amino acid) (see plasmid map for details). This polyamide was generated using 11 amino acids in the zPURExpress™ Δ(aa, tRNA, ribosome) kit under the same conditions as used for C-terminal incorporation.
[0476] Polyamide purification and characterization As previously described 15 Polyamides containing non-canonical amino acids were purified using affinity tag purification technology and characterized by MALDI spectroscopy. To prepare samples, 1.5 μL of purified peptide (0.1% SDS in water) was dried over 0.5 μL of matrix (α-cyano-4-hydroxycinnamic acid in THF, 10 mg / mL). The dried samples were characterized on a Bruker rapifleX MALDI-TOF and processed using FlexControl v2.0 software (Bruker).
[0477] 040329 Preparation of ribosome-containing cellsA plasmid containing the rrnB operon under the pL promoter (pAM552) was used as a template to generate a modified rrnB gene with mutations 2057AGCGTGA2063 and 2502TGGCAG2507 in the 23S rDNA, referred to as the 040329 mutation. Plasmids containing either the wild-type (WT) or modified (040329) rrnB gene were transformed into POP2136 using electroporation and then plated onto LB-agar containing 100 μg / mL carbenicillin. The plates were incubated at 30°C for 16–18 hours (POP2136 contains the cI repressor, which represses rRNA expression when grown at 30°C). A single colony from the plate was used to inoculate 25 mL of LB-Miller containing 100 μg / mL carbenicillin, and this culture was grown at 30°C for 16–18 hours. When the culture reached saturation, a 2 L culture of 2xYTP containing 100 μg / mL carbenicillin was prewarmed to 42°C and inoculated with 20 mL of the overnight culture. Growth at 42°C eliminated repression of the pL promoter, thereby inducing expression of the rrnB operon encoding the 040329 mutant rRNA. Previous studies suggest that the resulting ribosome population contains up to 20% plasmid-encoded ribosomes. Optical density was measured periodically (every hour, then every 15–30 minutes as the culture approached the target OD) until the culture reached an OD between 0.4 and 0.6. The culture was then pelleted by centrifugation at 8000 × g for 10 minutes. The resulting cell pellet was resuspended in Buffer A (see below for composition) and centrifuged again at 8000 × g for 10 minutes. This resuspension and centrifugation process was repeated twice for a total of three washes. After the final centrifugation, the cell pellet was flash frozen in liquid nitrogen and stored at −80°C until further processing.
[0478] Purification of ribosome mixtureFrozen cell pellets were resuspended in Buffer A at the specified ratio (5 mL of Buffer A per 1 g of cell pellet) and lysed using homogenization at 20,000–25,000 psi. The resulting solution was centrifuged at 12,000 × g for 10 minutes to yield a clear lysate. This clear lysate was then layered onto a sucrose cushion at a uniform volume ratio (1 mL of cell lysate per 1 mL of Buffer B (see below for composition)) and ultracentrifuged at 90,000 × g for 18 hours, resulting in a pellet at the bottom of the ultracentrifuge tube containing the ribosomes. The ribosome mixture was resuspended with gentle shaking in Buffer C (see below for composition) for 4–8 hours at 4°C and then diluted to yield a ribosome concentration of 20–25 μM as measured by absorbance at 260 nm in a spectrophotometer (1 A260 unit = 4.17 × 10 -5 After thorough resuspension and dilution, the samples were aliquoted, flash-frozen in liquid nitrogen, and stored at -80°C until use in the PURE reaction. Although further purification methods (such as sucrose gradients) could have been performed, the decision was made to use a crude mixture to maximize the absolute number of mutant ribosomes present in the ribosome mixture. *Reagents used: Buffer A: 20 mM Tris-HCl (pH 7.2), 100 mM NH4Cl, 10 mM MgCl2, 0.5 mM EDTA, 2 mM DTT; Buffer B: 20 mM Tris-HCl (pH 7.2), 500 mM NH4Cl, 10 mM MgCl2, 0.5 mM EDTA, 2 mM DTT, 37.7% (v / v) sucrose; Buffer C: 10 mM Tris-OAc (pH 7.5), 500 mM NH4Cl, 7.5 mM Mg(OAc)2, 0.5 mM EDTA, 2 mM DTT. Oligos used in the construction of the 040329 ribosomal plasmid: (1) To generate the insert: 5'-AGTGTACCCGCGGCAAGACGAGCGTGACCCGTGAACCTTTACTATAGCTTGA-3' and 5'-GCCCCAGGATGTGATGAGCCCTGCCAGAGGTGCCAAACACCGCCGTC-3', (2) To generate the skeleton: 5'-GGCTCATCACATCCTGGGGCTG-3' and 5'-CGTCTTGCCGCGGGTACACT-3'. The resulting PCR products were subjected to isothermal DNA assembly. 57 was assembled using.
[0479] References
[0480] 1. Dedkova LM, Hecht SM. Expanding the scope of protein synthesis using modified ribosomes. J. Am. Chem. Soc. 2019;141:6430-6447. [PMC free article] [PubMed] [Google Scholar]
[0481] 2. Hammerling MJ, Kruger A, Jewett MC. Strategies for in vitro engineering of the translation machinery. Nucleic Acids Res. 2019;48:1068-1083. [PMC free article] [PubMed] [Google Scholar]
[0482] 3. Arranz-Gibert P, Vanderschuren K, Isaacs FJ. Next-generation genetic code expansion. Curr. Opin. Chem. Biol. 2018;46:203-211. [PMC free article] [PubMed] [Google Scholar]
[0483] 4. Liu Y, Kim DS, Jewett MC. Repurposing ribosomes for synthetic biology. Curr. Opin. Chem. Biol. 2017;40:87-94. [PMC free article] [PubMed] [Google Scholar]
[0484] 5. Chin JW. Expanding and reprogramming the genetic code. Nature. 2017;550:53-60. [PubMed] [Google Scholar]
[0485] 6. Rogers JM, Suga H. Discovering functional, non-proteinogenic amino acid containing, peptides using genetic code reprogramming. Org. Biomol. Chem. 2015;13:9353-9363. [PubMed] [Google Scholar]
[0486] 7. Katoh T, Suga H. Ribosomal incorporation of consecutive beta-amino acids. J. Am. Chem. Soc. 2018;140:12159-12167. [PubMed] [Google Scholar]
[0487] 8. Lee J, et al. Ribosomal incorporation of cyclic β-amino acids into peptides using in vitro translation. Chem. Commun. 2020;56:5597-5600. [PubMed] [Google Scholar]
[0488] 9. Lee J, Torres R, Byrom M, Ellington AD, Jewett MC. Ribosomal incorporation of cyclic β-amino acids into peptides using in vitro translation. Chem. Comm. 2020;56:5597-5600. [PubMed] [Google Scholar]
[0489] 10. Ohshiro Y, et al. Ribosomal synthesis of backbone-macrocyclic peptides containing gamma-amino acids. Chembiochem. 2011;12:1183-1187. [PubMed] [Google Scholar]
[0490] 11. Tsiamantas C, et al. Ribosomal incorporation of aromatic oligoamides as peptide sidechain appendages. Angew. Chem. Int. Ed. 2020;59:4860-4864. [PMC free article] [PubMed] [Google Scholar]
[0491] 12. Katoh T, Suga H. Ribosomal elongation of cyclic gamma-amino acids using a reprogrammed genetic code. J. Am. Chem. Soc. 2020;142:4965-4969. [PubMed] [Google Scholar]
[0492] 13. Goto Y, Murakami H, Suga H. Initiating translation with d-amino acids. RNA. 2008;14:1390-1398. [PMC free article] [PubMed] [Google Scholar]
[0493] 14. Katoh T, Tajima K, Suga H. Consecutive elongation of d-amino acids in translation. Cell Chem. Biol. 2017;24:46-54. [PubMed] [Google Scholar]
[0494] 15. Lee J, et al. Expanding the limits of the second genetic code with ribozymes. Nat. Commun. 2019;10:5097. [PMC free article] [PubMed] [Google Scholar]
[0495] 16. Ad O, et al. Translation of diverse aramid- and 1,3-dicarbonyl-peptides by wild-type ribosomes in vitro. ACS Cent. Sci. 2019;5:1289-1294. [PMC free article] [PubMed] [Google Scholar]
[0496] 17. Kawakami T, Ogawa K, Hatta T, Goshima N, Natsume T. Directed evolution of a cyclized peptoid-peptide chimera against a cell-free expressed protein and proteomic profiling of the interacting proteins to create a protein-protein interaction inhibitor. ACS Chem. Biol. 2016;11:1569-1577. [PubMed] [Google Scholar]
[0497] 18. Torikai K, Suga H. Ribosomal synthesis of an amphotericin-B inspired macrocycle. J. Am. Chem. Soc. 2014;136:17359-17361. [PubMed] [Google Scholar]
[0498] 19. Kawakami T, Ishizawa T, Murakami H. Extensive reprogramming of the genetic code for genetically encoded synthesis of highly N-alkylated polycyclic peptidomimetics. J. Am. Chem. Soc. 2013;135:12297-12304. [PubMed] [Google Scholar]
[0499] 20. Goto Y, Katoh T, Suga H. Flexizymes for genetic code reprogramming. Nat. Protoc. 2011;6:779-790. [PubMed] [Google Scholar]
[0500] 21. Goto Y, Suga H. Translation initiation with initiator tRNA charged with exotic peptides. J. Am. Chem. Soc. 2009;131:5040-5041. [PubMed] [Google Scholar]
[0501] 22. Rogers JM, et al. Ribosomal synthesis and folding of peptide-helical aromatic foldamer hybrids. Nat. Chem. 2018;10:405-412. [PubMed] [Google Scholar]
[0502] 23. Morimoto J, Hayashi Y, Iwasaki K, Suga H. Flexizymes: their evolutionary history and the origin of catalytic function. Acc. Chem. Res. 2011;44:1359-1368. [PubMed] [Google Scholar]
[0503] 24. Maini R, et al. Ribosome-mediated incorporation of dipeptides and dipeptide analogues into proteins in vitro. J. Am. Chem. Soc. 2015;137:11206-11209. [PMC free article] [PubMed] [Google Scholar]
[0504] 25. Fujino T, Goto Y, Suga H, Murakami H. Ribosomal synthesis of peptides with multiple beta-amino acids. J. Am. Chem. Soc. 2016;138:1962-1969. [PubMed] [Google Scholar]
[0505] 26. Melo Czekster C, Robertson WE, Walker AS, Soll D, Schepartz A. In vivo biosynthesis of a beta-amino acid-containing protein. J. Am. Chem. Soc. 2016;138:5194-5197. [PMC free article] [PubMed] [Google Scholar]
[0506] 27. Chen S, Ji X, Gao M, Dedkova LM, Hecht SM. In cellulo synthesis of proteins containing a fluorescent oxazole amino acid. J. Am. Chem. Soc. 2019;141:5597-5601. [PMC free article] [PubMed] [Google Scholar]
[0507] 28. Lutz JF. Sequence-controlled polymerizations: the next Holy Grail in polymer science? Polym. Chem.-UK. 2010;1:55-62. [Google Scholar]
[0508] 29. Holt, D., Jaffe, M., Hancox, N. L. & Harris, B. In Concise Encyclopedia of Composite Materials, 1st edn (ed. Kelly, A.) 125-146 (Pergamon, 1994).
[0509] 30. Agnarsson I, Kuntner M, Blackledge TA. Bioprospecting finds the toughest biological material: extraordinary silk from a giant riverine orb spider. PLoS ONE. 2010;5:e11234. [PMC free article] [PubMed] [Google Scholar]
[0510] 31. Iwane Y, et al. Expanding the amino acid repertoire of ribosomal polypeptide synthesis via the artificial division of codon boxes. Nat. Chem. 2016;8:317-325. [PubMed] [Google Scholar]
[0511] 32. Terasaka N, Iwane Y, Geiermann AS, Goto Y, Suga H. Recent developments of engineered translational machineries for the incorporation of non-canonical amino acids into polypeptides. Int. J. Mol. Sci. 2015;16:6513-6531. [PMC free article] [PubMed] [Google Scholar]
[0512] 33. Obexer R, Walport LJ, Suga H. Exploring sequence space: harnessing chemical and biological diversity towards new peptide leads. Curr. Opin. Chem. Biol. 2017;38:52-61. [PubMed] [Google Scholar]
[0513] 34. Maini R, et al. Protein synthesis with ribosomes selected for the incorporation of beta-amino acids. Biochemistry. 2015;54:3694-3706. [PMC free article] [PubMed] [Google Scholar]
[0514] 35. Illuminati G, Mandolini L, Masci B. Ring-closure reactions .5. Kinetics of 5-membered to 10-membered ring formation from ortho-omega-bromoalkylphenoxides-influence of O-heteroatom. J. Am. Chem. Soc. 1975;97:4960-4966. [Google Scholar]
[0515] 36. Baldwin, J. E. Rules for ring-closure. J. Chem. Soc., Chem. Commun. 734-736 (1976).
[0516] 37. Lee N, Bessho Y, Wei K, Szostak JW, Suga H. Ribozyme-catalyzed tRNA aminoacylation. Nat. Struct. Biol. 2000;7:28-33. [PubMed] [Google Scholar]
[0517] 38. Bessho Y, Hodgson DR, Suga H. A tRNA aminoacylation system for non-natural amino acids based on a programmable ribozyme. Nat. Biotechnol. 2002;20:723-728. [PubMed] [Google Scholar]
[0518] 39. Murakami H, Saito H, Suga H. A versatile tRNA aminoacylation catalyst based on RNA. Chem. Biol. 2003;10:655-662. [PubMed] [Google Scholar]
[0519] 40. Murakami H, Ohta A, Ashigai H, Suga H. A highly flexible tRNA acylation method for non-natural polypeptide synthesis. Nat. Methods. 2006;3:357-359. [PubMed] [Google Scholar]
[0520] 41. Xiao H, Murakami H, Suga H, Ferre-D’Amare AR. Structural basis of specific tRNA aminoacylation by a small in vitro selected ribozyme. Nature. 2008;454:358-361. [PubMed] [Google Scholar]
[0521] 42. Silverman AD, Karim AS, Jewett MC. Cell-free gene expression: an expanded repertoire of applications. Nat. Rev. Genet. 2020;21:151-170. [PubMed] [Google Scholar]
[0522] 43. Shimizu Y, et al. Cell-free translation reconstituted with purified components. Nat. Biotechnol. 2001;19:751-755. [PubMed] [Google Scholar]
[0523] 44. Katoh T, Iwane Y, Suga H. Logical engineering of D-arm and T-stem of tRNA that enhances d-amino acid incorporation. Nucleic Acids Res. 2017;45:12601-12610. [PMC free article] [PubMed] [Google Scholar]
[0524] 45. Katoh T, Wohlgemuth I, Nagano M, Rodnina MV, Suga H. Essential structural elements in tRNA(Pro) for EF-P-mediated alleviation of translation stalling. Nat. Commun. 2016;7:11657. [PMC free article] [PubMed] [Google Scholar]
[0525] 46. d’Aquino AE, Kim DS, Jewett MC. Engineered ribosomes for basic science and synthetic biology. Annu. Rev. Chem. Biomol. 2018;9:311-340. [PubMed] [Google Scholar]
[0526] 47. Cochella L, Green R. Isolation of antibiotic resistance mutations in the rRNA by using an in vitro selection system. Proc. Natl Acad. Sci. USA. 2004;101:3786-3791. [PMC free article] [PubMed] [Google Scholar]
[0527] 48. Tsiamantas C, Kwon S, Douat C, Huc I, Suga H. Optimizing aromatic oligoamide foldamer side-chains for ribosomal translation initiation. Chem. Commun. 2019;55:7366-7369. [PubMed] [Google Scholar]
[0528] 49. Jewett MC, Fritz BR, Timmerman LE, Church GM. In vitro integration of ribosomal RNA synthesis, ribosome assembly, and translation. Mol. Syst. Biol. 2013;9:678. [PMC free article] [PubMed] [Google Scholar]
[0529] 50. Hammerling MJ, et al. In vitro ribosome synthesis and evolution through ribosome display. Nat. Commun. 2020;11:1108. [PMC free article] [PubMed] [Google Scholar]
[0530] 51. Orelle C, et al. Protein synthesis by ribosomes with tethered subunits. Nature. 2015;524:119-124. [PubMed] [Google Scholar]
[0531] 52. Fried SD, Schmied WH, Uttamapinant C, Chin JW. Ribosome subunit stapling for orthogonal translation in E. coli. Angew. Chem. 2015;127:12982-12985. [PMC free article] [PubMed] [Google Scholar]
[0532] 53. Schmied WH, et al. Controlling orthogonal ribosome subunit interactions enables evolution of new function. Nature. 2018;564:444-448. [PMC free article] [PubMed] [Google Scholar]
[0533] 54. Carlson ED, et al. Engineered ribosomes with tethered subunits for expanding biological function. Nat. Commun. 2019;10:3920. [PMC free article] [PubMed] [Google Scholar]
[0534] 55. Aleksashin NA, et al. A fully orthogonal system for protein synthesis in bacterial cells. Nat. Commun. 2020;11:1858. [PMC free article] [PubMed] [Google Scholar]
[0535] 56. Passioura T, Suga H. A RaPID way to discover nonstandard macrocyclic peptide modulators of drug targets. Chem. Commun. 2017;53:1931-1940. [PubMed] [Google Scholar]
[0536] 57. Gibson DG, et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 2009;6:343-345. [PubMed] [Google Scholar]
[0537] 58. Maini R, et al. Incorporation of beta-amino acids into dihydrofolate reductase by ribosomes having modifications in the peptidyltransferase center. Bioorg. Med. Chem. 2013;21:1088-1096. [PubMed] [Google Scholar]
[0538] Example 7 - Supplementary Information for Example 6
[0539] Materials and MethodsAll reagents and solvents were of commercial grade and, when necessary, purified before use. Dichloromethane was obtained from Grubbs 1 The solution was dried by passing it through a column of activated alumina as described by [ 1999 ].
[0540] t-Butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (ABT) was prepared according to standard procedures. All organic solutions were dried over MgSO4. Thin-layer chromatography (TLC) was performed using glass-backed silica gel (250 μm) plates. Flash chromatography was performed on a Biotage Isolera One automated purification system. Products were visualized using UV light and / or the use of KMnO4.
[0541] Nuclear magnetic resonance spectra (NMR) were acquired on a Bruker Advance III-500 (500 MHz) or Varian Unity 500 (500 MHz) instrument and processed by ACD (v12.01) or Mnova (v14). Chemical shifts are measured relative to residual solvent peaks set at δ 7.26 and δ 77.0 (CDCl3) and δ 2.50 and δ 39.5 (DMSO-d6) as internal standards. Mass spectra were recorded on a Bruker Amazon SL or Waters Q-TOF Ultima (ESI) and Impact-II or Waters 70-VSE (EI) spectrometers using the ionization methods described.
[0542] General Procedure A for Dinitrobenzyl Ester Formation and Boc DeprotectionTo a glass vial equipped with a stir bar was added the carboxylic acid (1 equiv.), CHCl (1.0 M), trimethylamine (1.5 equiv.), and 3,5-dinotrobenzyl chloride (1.2 equiv.). After stirring at room temperature for 16 h, the reaction mixture was diluted with EtOAc and washed with HCl (0.5 M aqueous solution), NaHCO (4% (w / v) in water), brine, and dried over MgSO. The organic phase was concentrated to give the crude product, which was purified by flash column chromatography. The resulting fractions containing the product were collected in a 100 mL flask, and the solvent was removed under reduced pressure. 2 mL of HCl (4 N in anhydrous dioxane) was added and stirred at room temperature for 1 h. The resulting product was transferred to a 20 mL glass vial and dried under high vacuum overnight to give the final product.
[0543] General Procedure B for Dinitrobenzyl Ester Formation and Boc Deprotection To a flame-dried vial equipped with a septum and stir bar was added the carboxylic acid (1.0 equiv.), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (2.0 equiv.), and dimethylaminopyridine (2.0 equiv.), evacuated, and flushed with N2 (g) three times, after which anhydrous CHCl2 (0.1 M) was added via syringe. The reaction was then stirred for 10 minutes, after which dinitrobenzyl alcohol (0.1 M in anhydrous CHCl2) was added dropwise via syringe over 60 seconds. The reaction was then stirred at 22 °C for 16 hours. The reaction was diluted with DCM, added to a separatory funnel, rinsed with HCl (1.0 M aq.), HO, NaHCO3 (3.0 M aq.), dried over NaSO4, filtered, added silica (SiO2), and concentrated under reduced pressure. The compound / silica mixture was then dried, loaded, and purified by silica gel column chromatography [solvent system: hexane-ethyl acetate; 9:1 to 2:8].
[0544] General Procedure C for the Formation of 4-((2-aminoethyl)carbamoyl)benzyl Thioates and Boc DeprotectionTo a flame-dried vial equipped with a septum and stir bar was added the carboxylic acid (1.0 equiv.), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (2.0 equiv.), and dimethylaminopyridine (2.0 equiv.), evacuated, and flushed with N2 (g) three times, followed by the addition of anhydrous CHCl2 (0.1 M) via syringe. The reaction was then stirred for 10 minutes, after which t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (0.1 M in anhydrous CHCl2) was added dropwise via syringe over 60 seconds. The reaction was then stirred at 22 °C for 16 hours. The reaction was diluted with DCM, added to a separatory funnel, rinsed with HCl (1.0 M aq.), HO, NaHCO3 (3.0 M aq.), dried over NaSO4, filtered, added silica (SiO2), and concentrated under reduced pressure. The compound / silica mixture was then dried, loaded, and purified by silica gel column chromatography [solvent system: hexane-ethyl acetate; 8:3 to 1:9].
[0545] The resulting oil or solid was placed in a 20 mL scintillation vial equipped with a stir bar, and 2 mL of HCl (4N in anhydrous dioxane) was added and stirred for 4 hours. After concentrating the solution under reduced pressure, 5 mL of diethyl ether was added, and the heterogeneous mixture was sonicated for 5 minutes. The mixture was filtered, and the filter cake was rinsed with diethyl ether. The solid was collected and dried under vacuum to give the final product.
[0546] Substrate characterization
[0547] [ka]
[0548] 3,5-Dinitrobenzyl 3-aminopropanoate (1). Prepared according to general procedure A using N-Boc-beta-aryne (62.4 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.5 mL). The product was obtained as a white powder (45 mg, 51%). 1H NMR (500 MHz, DMSO-d6) δ 8.81 (t, J = 2.1 Hz, 1H), 8.70 (s, J = 2.1 Hz, 2H), 5.39 (s, 2H), 3.07 (t, J = 6.7 Hz, 2H), 2.80 (t, J = 7.2 Hz, 2H). C NMR (125 MHz, DMSO-d) ppm 172.3, 148.6, 148.5, 142.3, 129.7 (2C), 118.8, 61.6, 35.2, 31.9; HRMS (m / z): calculated for C H N O [M] 270.2107, found 270.2238
[0549] [ka]
[0550] 3,5-Dinitrobenzyl-amino-4-butanoate (2). Prepared according to general procedure A using N-Boc-4-aminobutanoic acid (71.6 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.5 mL). The product was obtained as a white powder (65 mg, 70%). 1H NMR (500 MHz, 500 MHz, DMSO-d6) δ 8.80 (t, J = 2.3 Hz, 1H), 8.59 (d, J = 2.1 Hz, 2H), 7.98 (s, 3H), 5.37 (s, 2H), 2.86-2.79 (m, 2H), 2.58 (t, J = 7.5 Hz, 2H), 1.85 (q, J = 7.6, 7.7, 2H);13C NMR (125 MHz, DMSO-d6) ppm 172.4, 148.5 (2C), 141.0, 128.7 (2C), 118.6, 64.2, 38.4, 30.6, 22.7;HRMS (m / z): Calculated for C11H13N3O6 [M]+ 204.24, found 204.12.
[0551] [ka]
[0552] S-(4-((2-aminoethyl)carbamoyl)benzyl) 4-aminobutanethioate (2i). Prepared according to general procedure C using 7-((t-butoxycarbonyl)amino)butanoic acid (50.8 mg, 0.25 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (95.9 mg, 0.50 mmol), dimethylaminopyridine (61.1 mg, 0.50 mmol), and t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (84.6 mg, 0.25 mmol). The product was obtained as a white powder (40.7 mg, 55%). Silica gel column chromatography [solvent system: hexane-ethyl acetate; 1:1, Rf = 0.1]. 1H NMR (500 MHz, DMSO-d6) δ 8.76 (s, 1H), 8.15 (s, 3H), 8.06 (s, 3H), 7.79 (d, J = 6.8 Hz, 2H), 7.29 (d, J = 7.1 Hz, 2H), 4.09 (s, 2H), 3.43 (s, 3H), 2.88 (s, 2H), 2.42 (s, 1H), 1.78 (s, 2H). C NMR (126 MHz, DMSO-d) δ 197.20, 166.13, 141.15, 132.63, 128.39, 127.57, 39.87, 38.41, 37.77, 36.96, 31.80, 22.63. HRMS (m / z): calculated for C H N O S [M] 297.1511, found 297.1511.
[0553] [ka]
[0554] 3,5-Dinitrobenzyl 4-(methylamino)butanoate (2ii). Prepared according to general procedure A using 4-((boc-(methyl)amino)butanoic acid (67 mg, 0.33 mmol), trimethylamine (70 μL, 0.50 mmol), 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.5 mL). The product was obtained as a yellow powder (70 mg, 72%). H NMR (500 MHz, DMSO-d) δ 8.86 (s, 2H), 8.72 (s, 1H), 8.59 (s, 2H), 4.76 (s, 2H), δ 2.86 (dq, J = 12.4, 6.9 Hz, 2H), 2.34 (t, J = 7.3 Hz, 2H), 1.81 (p, J = 7.5 Hz, 2H). NMR (125 MHz, DMSOd6) ppm 173.9, 148.4, 147.9, 128.6, 126.7 (2C), 117.4, 61.5, 47.9, 32.7, 30.9, 21.3; HRMS (m / z): calculated for C12H15N3O6 [M]+ 298.10, found 298.14.
[0555] [ka]
[0556] S-(4-((2-aminoethyl)carbamoyl)benzyl) 4-amino-2,2-dimethylbutanethioate (2iii). Prepared according to general procedure C using 4-((t-butoxycarbonyl)amino)-2,2-dimethylbutanoic acid (57.8 mg, 0.25 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (95.9 mg, 0.50 mmol), dimethylaminopyridine (61.1 mg, 0.50 mmol), and t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (84.6 mg, 0.25 mmol). The product was obtained as a white powder (51.7 mg, 64%). Silica gel column chromatography [solvent system: hexane-ethyl acetate; 1:1, Rf = 0.1]. 1H NMR (500 MHz, DMSO-d6) δ 8.77 (s, 1H), 8.13 (s, 4H), 8.03 (s, 3H), 7.82 (d, J = 7.2 Hz, 2H), 7.33 (d, J =7.4 Hz, 2H), 4.11 (s, 2H), 3.47 (s, 3H), 2.92 (s, 2H), 2.61 (s, 2H), 1.90-1.70 (m, 2H), 1.14 (s, 6H). C NMR (126 MHz, DMSO-d) δ 204.04, 166.23, 141.10, 132.71, 128.42, 127.62, 47.78, 38.47, 36.99, 34.93, 31.71, 24.53. HRMS (m / z): calculated for C H N O S [M] 325.1824, found 325.1825.
[0557] [ka]
[0558] rac-cis-3,5-Dinitrobenzyl-2-aminocyclopropane-1-carboxylate (2iv). Prepared according to general procedure A using cis-2-Boc-aminocyclopropane-1-carboxylic acid (66.4 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.5 mL). The product was obtained as a white powder (48.2 mg, 52%). 1H NMR (500 MHz, DMSO-d6) δ 8.82 (t, J = 2.0 Hz, 1H), 8.73 (d, J = 0.9 Hz, 2H), 5.42 (dd, J = 44.2, 13.0 Hz, 2H), 2.34-2.26 (m, 2H), 2.22-2.09 (m, 2H). 13C NMR (126 MHz, DMSO-d6) δ 171.53, 148.54 (2C), 140.65, 129.08 (2C), 118.70, 64.70, 45.95, 25.44, 20.29. HRMS (m / z): calculated for C11H11N3O6 [M]+ 282.0726, found 282.0733.
[0559] [ka]
[0560] rac-trans-3,5-Dinitrobenzyl-2-aminocyclopropane-1-carboxylate (2v). Prepared according to general procedure A using trans-2-Boc-aminocyclopropane-1-carboxylic acid (66.4 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.5 mL). The product was obtained as a white powder (35.3 mg, 38%). 1H NMR (500 MHz, DMSO-d6) δ 8.79 (s, 1H), 8.767 (wide, 2H), 5.36 (wide, 2H), 3.66 (t, J = 22.6 Hz, 1H), 2.74 (t, J = 47.9 Hz, 1H), 1.6-1.2 (m, 2H). 13C NMR (126 MHz, DMSO-d6) δ 172.44, 148.53 (2C), 141.09, 128.61 (2C), 118.57, 64.14, 44.10, 29.51, 26.62. HRMS (m / z): calculated for C11H11N3O6 [M]+ 282.0726, found 282.0729.
[0561] [ka]
[0562] 3,5-Dinitrobenzyl 5-aminovalerate (3). Prepared according to general procedure A using Boc-5-Ava-OH (72 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.5 mL). The product was obtained as a yellow oil (51 mg, 53%). 1H NMR (500 MHz, DMSO-d6) δ 8.80 (t, J = 2.1 Hz, 1H), 8.67 (d, J = 2.0 Hz, 2H), 7.89 (s, 3H), 5.36 (s, 2H), 2.82-2.77 (m, 2H), 2.49 (t, J = HRMS (m / z): Calculated for C12H16N3O6 [M]+ 298.27, Found 298.11
[0563] [ka]
[0564] 3,5-Dinitrobenzyl 6-aminohexanoate (4). Prepared according to general procedure A using Boc-5-Ahx-OH (76 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.5 mL). The product was obtained as a white solid (64 mg, 62%). 1H NMR (500 MHz, CDCl3) δ 8.80 (t, J = 2.1 Hz, 1H), 8.66 (d, J = 2.0 Hz, 2H), 7.87 (s, 3H), 5.36 (s, 2H), 2.78-2.72 (m, 2H), 2.45 (t, J = 7.6 13C NMR (125 MHz, DMSO-d6) ppm 173.0, 148.5 (2C), 141.9, 128.5 (2C), 118.5, 63.9, 38.9, 33.5, 27.0, 25.7, 24.2; HRMS (m / z): [M]+ calculated for C13H17N3O6 312.29, found 312.13.
[0565] [ka]
[0566] S-(4-((2-aminoethyl)carbamoyl)benzyl) 7-aminoheptanethioate (5). Prepared according to general procedure C using 7-((t-butoxycarbonyl)amino)heptanoic acid (105.5 mg, 0.43 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (165.1 mg, 0.86 mmol), dimethylaminopyridine (105.2 mg, 0.86 mmol), and t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (145 mg, 0.43 mmol). The product was obtained as a white powder (133.7 mg, 92%). Silica gel column chromatography [solvent system: hexane-ethyl acetate; 1:1, Rf = 0.1]. 1H NMR (500 MHz, DMSO-d6) δ 8.85 (t, J = 5.5 Hz, 1H), 8.22 (s, 3H), 8.04 (s, 3H), 7.89 (d, J = 8.2 Hz, 2H), 7.37 (d, J = 8.1 Hz, 2H), 4.16 (s, 2H), 2.98 (q, J = 5.5 Hz, 2H), 2.72 (q, J = 6.6 Hz, 2H), 2.61 (t, J = 7.3 Hz, 2H), 2.51 (t, J = 1.9 Hz, 1H), 1.55 (dp, J = 15.9, 7.9, 7.5, 7.3Hz, 4H), 1.38 - 1.21 (m, 4H). 13C NMR (126 MHz, DMSOd6) δ 198.11, 166.32, 141.50, 132.74, 128.48, 127.72, 42.95, 38.62, 38.54, 37.10, 31.82, 27.64, 26.67, 25.44, 24.81. HRMS (m / z): calculated for C17H27N3O2S [M]+ 339.1980, found 339.1982.
[0567] [ka]
[0568] S-(4-((2-aminoethyl)carbamoyl)benzyl) 5-(aminomethyl)furan-3-carbothioate (6). Prepared according to general procedure C using 5-(((t-butoxycarbonyl)amino)methyl)furan-3-carboxylic acid (60.3 mg, 0.25 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (95.9 mg, 0.50 mmol), dimethylaminopyridine (61.1 mg, 0.50 mmol), and t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (84.6 mg, 0.25 mmol). The product was obtained as a yellow powder (68.5 mg, 82%). Silica gel column chromatography [solvent system: hexane-ethyl acetate; 1:1, Rf = 0.1]. 1H NMR (500 MHz, DMSO-d6) δ 8.78 (s, 1H), 8.60 (m, 4H), 8.14 (s, 3H), 7.84 (d, J = 7.6 Hz, 2H), 7.39 (d, J = 7.5 Hz, 2H), 6.88 (s, 1H), 4.29 (s, 2H), 4.05 (s, 2H), 3.47 (d, J = 5.6 Hz, 2H), 2.93 (s, 2H). C NMR (126 MHz, DMSO-d) δ 183.42, 166.23, 150.18, 147.34, 141.06, 132.82, 128.57, 127.67, 126.52, 108.03, 38.48, 37.03, 34.70, 31.45. HRMS (m / z): calculated for C H N O S [M] 335.1304, found 335.1304.
[0569] [ka]
[0570] (E / Z)-3,5-Dinitrobenzyl 4-aminobut-2-enoate (7). Prepared according to general procedure A using (E)-4-((t-butoxycarbonyl)amino)but-2-enoic acid (66.4 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.5 mL). The product was obtained as a yellow powder (24.1 mg, 26%). Silica gel column chromatography [solvent system: hexane-ethyl acetate; 1:1, Rf = 0.1]. 1H NMR (500 MHz, DMSO-d6) δ 8.81 (t, J = 2.2 Hz, 1H), 8.69 (d, J = 2.0 Hz, 2H), 8.39 (s, 3H), 6.97 (m, 1H), 6.34-6.19 (m, 1H), 5.47 (s, 2H), 3.71 (d, J = 5.4 Hz, 2H). 13C NMR (126 MHz, DMSO-d6) δ 164.53, 148.08, 141.86, 140.32, 130.69, 128.28, 122.76, 118.25, 63.95. HRMS (m / z): calculated for C11H12N3O6 [M]+ 282.0726, found 282.0728.
[0571] [ka]
[0572] S-(4-((2-aminoethyl)carbamoyl)benzyl) 3-(aminomethyl)benzothioate (8). Prepared according to general procedure C using 3-(((t-butoxycarbonyl)amino)methyl)benzoic acid (108.1 mg, 0.43 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (165.1 mg, 0.86 mmol), dimethylaminopyridine (105.2 mg, 0.86 mmol), and t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (145 mg, 0.43 mmol). The product was obtained as a white powder (98.9 mg, 67%). Silica gel column chromatography [solvent system: hexane-ethyl acetate; 1:1, Rf = 0.1]. 1H NMR (500 MHz, DMSO-d6) δ 8.79 (t, J = 5.5 Hz, 1H), 8.52 (s, 3H), 8.17 (s, 3H), 7.99 (s, 1H), 7.83 (d, J = 8.2 Hz, 3H), 7.75 (d, J = 8.0 Hz, 1H), 7.50 (t, J = 7.8 Hz, 1H), 7.39 (d, J = 8.1 Hz, 2H), 4.31 (s, 2H), 4.02 (q, J = 5.8 Hz, 2H), 3.44 (q, J = 6.0 Hz, 2H), 2.89 (q, J = 5.9 Hz, 2H). C NMR (126 MHz, DMSO-d) δ 190.32, 166.31, 141.10, 136.24, 135.28, 134.78, 132.92, 129.43, 128.71, 127.78, 127.62, 126.90, 41.66, 38.54, 37.12, 32.16. HRMS (m / z): calculated for C H N O S [M] 345.1511, found 345.1511.
[0573] [ka]
[0574] 3,5-Dinitrobenzyl 2-(piperidin-4-yl)acetate (9). Prepared according to general procedure A using N-Boc-4-piperidineacetic acid (80 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.3 mL). The product was obtained as a yellow oil (66 mg, 62%). 1H NMR (500 MHz, DMSO-d6) δ; 8.72 (t, J = 2.0 Hz, 1H), 8.59 (d, J = 1.7 Hz, 2H), 3.15 (d, J = 12.4 Hz, 2H), 2.79 (td, J = 12.7, 2.8 Hz, 13C NMR (125 MHz, DMSO-d6) ppm 171.7, 148.5 (2C), 141.0, 128.5 (2C), 118.5, 64.0, 43.2 (2C), 30.6, 28.4 (2C); HRMS (m / z): [M]+ calculated for C14H17N3O6 324.31, found 324.09.
[0575] [ka]
[0576] 3,5-Dinitrobenzyl 2-(piperazin-1-yl)acetate (10). Prepared according to general procedure A using 2-(4-Boc-1-piperazinyl)acetic acid (80 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.3 mL). The product was obtained as a white powder (87 mg, 82%). 1H NMR (500 MHz, DMSO-d6) δ; 2.69 (t, J = 4.9 Hz, 4H), 2.98 (t, J = 5.1 Hz, 4H), 3.41 (s, 2H), 5.31 (s, 2H), 8.61 (d, J = 1.1 Hz, 2H), 8.73 (t, J = 2.1, 1H);13C NMR (125 MHz, DMSO-d6) 170.0, 148.5 (2C), 140.9, 128.8 (2C), 118.8, 64.0, 57.9, 49.1 (2C), 43.3 (2C);HRMS (m / z): Calculated value for C13H16N4O6 [M]+ 325.11, actual value 325.22.
[0577] [ka]
[0578] (1s,3s)-3-Aminocyclobutane-1-carbothioate S-(4-((2-aminoethyl)carbamoyl)benzyl) (11). Prepared according to general procedure C using (1s,3s)-3-((t-butoxycarbonyl)amino)cyclobutane-1-carboxylic acid (92.5 mg, 0.43 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (165.1 mg, 0.86 mmol), dimethylaminopyridine (105.2 mg, 0.86 mmol), and t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (145 mg, 0.43 mmol). The product was obtained as a white powder (103.3 mg, 78%). Silica gel column chromatography [solvent system: 1H NMR (500 MHz, methanol-d4) δ 7.81 (d, J = 7.3 Hz, 2H), 7.40 (d, J = 7.3 Hz, 2H), 4.19 (s, 2H), 3.74 (d, J = 10.5 Hz, 1H), 3.65 (s, 2H), 3.29-3.22 (m, 1H), 3.16 (s, 2H), 2.59 (s, 2H), 2.38 (s, 2H). C NMR (126 MHz, methanol-d) δ 199.70, 170.55, 143.56, 133.69, 130.04, 128.84, 42.36, 41.06, 40.33, 38.77, 33.30, 32.37. HRMS (m / z): [M]+ calculated for C15H21N3O2S 309.1511, found 309.1512.
[0579] [ka]
[0580] (1r,3r)-3-Aminocyclobutane-1-carbothioate S-(4-((2-aminoethyl)carbamoyl)benzyl) (12). Prepared according to general procedure C using (1r,3r)-3-((t-butoxycarbonyl)amino)cyclobutane-1-carboxylic acid (92.9 mg, 0.43 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (165.6 mg, 0.86 mmol), dimethylaminopyridine (105.4 mg, 0.86 mmol), and t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (145 mg, 0.43 mmol). The product was obtained as a white powder (100.7 mg, 76%). Silica gel column chromatography [solvent system: hexane-ethyl acetate; 1:1, Rf = 0.1]. 1H NMR (500 MHz, methanol-d4) δ 8.72 (s, 1H), 7.82 (d, J = 8.0 Hz, 2H), 7.43 (d, J = 8.0 Hz, 2H), 4.23 (s, 2H), 3.90 (t, J = 7.7 Hz, 1H), 3.65 (q, J = 5.7 Hz, 2H), 3.50 (dp, J = 10.0, 5.2, 4.2 Hz, 1H), 3.16 (t, J = 5.9 Hz, 2H), 2.69 - 2.56 (m, 2H), 2.45 (q, J = 9.7 Hz, 2H). C NMR (126 MHz, DMSO-d) δ 199.63, 166.26, 141.13, 132.76, 128.49, 127.66, 42.81, 40.90, 38.50, 37.04, 31.92, 29.97. HRMS (m / z): calculated for C H N O S [M] 309.1511, found 309.1512.
[0581] [ka]
[0582] (1S,3R)-3-Aminocyclopentane-1-carbothioate S-(4-((2-aminoethyl)carbamoyl)benzyl) (13). Prepared according to general procedure C using (1S,3R)-3-((t-butoxycarbonyl)amino)cyclopentane-1-carvone (98.6 mg, 0.43 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (165.1 mg, 0.86 mmol), dimethylaminopyridine (105.2 mg, 0.86 mmol), and t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (145 mg, 0.43 mmol). The product was obtained as a white powder (91.4 mg, 66%). Silica gel column chromatography [solvent system: hexane-ethyl acetate; 1:1, Rf = 0.1]. 1H NMR (500 MHz, methanol-d4) δ 7.81 (d, J = 8.3 Hz, 2H), 7.41 (d, J = 8.2 Hz, 2H), 4.20 (s, 2H), 3.23 (p, J = 8.0 Hz, 1H), 3.15 (t, J = 6.0 Hz, 3H), 2.35 (dt, J = 13.5, 7.8 Hz, 1H), 2.16-2.08 (m, 1H), 2.08-2.02 (m, 1H), 2.02-1.93 (m, 1H), 1.89 (dt, J = 13.6, 7.8 Hz, 2H), 1.78-1.66 (m, 1H), 1.40 (d, J = 9.6 Hz, 2H). C NMR (126 MHz, DMSO-d) δ 199.88, 166.31, 141.31, 132.80, 128.53, 127.76, 50.54, 50.35, 38.51, 37.09, 34.12, 31.91, 29.70, 27.39. HRMS (m / z): [M] calculated for C H N O S 323.1667, found 322.1669.
[0583] [ka]
[0584] (1S,3R)-3-Aminocyclohexane-1-carbothioate S-(4-((2-aminoethyl)carbamoyl)benzyl) (14). Prepared according to general procedure C using (1S,3R)-3-((t-butoxycarbonyl)amino)cyclohexane-1-carboxylic acid (104.6 mg, 0.43 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (165.1 mg, 0.86 mmol), dimethylaminopyridine (105.2 mg, 0.86 mmol), and t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (145 mg, 0.43 mmol). The product was obtained as a white powder (99.7 mg, 69%). Silica gel column chromatography [solvent system: hexane-ethyl acetate; 1:1, Rf = 0.1]. 1H NMR (500 MHz, methanol-d4) δ 7.80 (d, J = 8.3 Hz, 2H), 7.39 (d, J = 8.3 Hz, 2H), 4.17 (s, 2H), 3.64 (t, J = 5.9 Hz, 2H), 3.15 (t, J = 5.9 Hz, 3H), 2.73 (tt, J = 3.4 Hz, 1H), 2.20 (d, J = 12.4 Hz, 1H), 2.09 - 1.86 (m, 3H), 1.62-1.24 (m, 4H). C NMR (126 MHz, DMSO-d) δ 201.22, 166.83, 141.85, 133.30, 129.00, 128.23, 46.49, 46.37, 39.04, 37.59, 32.23, 31.04, 28.78, 28.00, 19.92. HRMS (m / z): calculated for C H N O S [M] 337.1824, found 337.1824
[0585] [ka]
[0586] (1S,3S)-3-Aminocyclohexane-1-carbothioate S-(4-((2-aminoethyl)carbamoyl)benzyl) (15). Prepared according to general procedure C using (1S,3S)-3-((t-butoxycarbonyl)amino)cyclohexane-1-carboxylic acid (104.1 mg, 0.43 mmol), 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDCI) (165.1 mg, 0.86 mmol), dimethylaminopyridine (105.2 mg, 0.86 mmol), and t-butyl (2-(4-(mercaptomethyl)benzamido)ethyl)carbamate (145 mg, 0.43 mmol). The product was obtained as a yellow powder (95.4 mg, 62%). Silica gel column chromatography [solvent system: hexane-ethyl acetate; 1:1, Rf = 0.1]. 1H NMR (500 MHz, DMSO-d6) δ 8.77 (t, J = 5.5 Hz, 1H), 8.18 (s, 6H), 7.82 (d, J = 8.4 Hz, 2H), 7.31 (d, J = 8.3 Hz, 2H), 4.11 (s, 2H), 3.46 (q, J = 6.0 Hz, 2H), 3.26-3.18 (m, 1H), 3.08 (t, J = 5.7 Hz, 1H), 2.92 (t, J = 6.1 Hz, 2H), 2.44 (p, J = 1.8 Hz, 1H), 1.96 (ddd, J = 13.5, 7.0, 4.0 Hz, 1H), 1.71 (dtd, J = 12.8, 8.2, 4.2 Hz, 1H), 1.61 (d, J = 5.6 Hz, 2H), 1.46 (qt, J = 7.9, 2.9 Hz, 1H), 1.33 (dtt, J = 12.8, 8.8, 4.2 Hz, 1H). 13C NMR (126 MHz, DMSO-d6) δ 200.74, 166.35, 141.37, 132.82, 128.52, 127.75, 46.01, 45.89, 38.56, 37.11, 31.75, 30.56, 28.30, 27.52, 19.44. HRMS (m / z): calculated for C17H27N3O2S [M]+ 337.1824, found 337.1824.
[0587] Preparation of DNA templates for RNA The DNA templates for preparing flexizyme and tRNA were synthesized as previously described using the following primers: 3 .
[0588] [Table 1]
[0589] Preparation of Fx and tRNA Flexizyme and tRNA were prepared using the HiScribe™ T7 High Yield RNA Synthesis Kit (NEB, E2040S) as previously reported. 3 was purified by
[0590] Additional References
[0591] 1. Pangborn, AB, Giardello, MA, Grubbs, RH, Rosen, RK & Timmers, FJ Safe and convenient procedure for solvent purification. Organometallics 15, 1518-1520 (1996).
[0592] 2. Niwa, N., Yamagishi, Y., Murakami, H. & Suga, H. A flexizyme that selectively charges amino acids activated by a water-friendly leaving group. Bioorg Med Chem Lett 19, 3892-3894 (2009).
[0593] 3. Lee, J. et al. Expanding the limits of the second genetic code with ribozymes. Nat Commun 10, 5097 (2019).
[0594] Example 8 - Ribosomal incorporation of cyclic β-amino acids into peptides using in vitro translation
[0595] See Lee et al., "Ribosomal incorporation of cyclic β-amino acids into peptides using in vitro translation," Chem. Comm., 2020, 56, 5597-5600, the contents of which are incorporated herein by reference in their entirety.
[0596] We demonstrate the in vitro incorporation of cyclic β-amino acids into peptides by ribosomes through genetic code reprogramming. Furthermore, we show that the efficiency of incorporation can be increased through the addition of elongation factor P. This work expands the scope of ribosome-mediated polymerization and sets the stage for new drugs and materials.
[0597] Expanding the natural repertoire of ribosomal monomers could potentially yield new classes of enzymes, drugs, and materials with a variety of genetically encoded chemistries. 1-5 Efforts to expand the genetic code have already shown that natural and engineered translation systems can selectively incorporate a wide range of non-canonical monomers, particularly at the N-terminus. 6 For example, the Flexizyme series 7-9 Genetic code reprogramming using Fx (a transfer RNA (tRNA) synthetase-like ribozyme that charges activated chemical substrates onto tRNA) has led to the generation of amino acids with non-canonical side chains. 10 , β-amino acids 11-13 , N-modified amino acids 14 , hydroxy acids 15,16 Non-amino carboxylic acids 9,17-19 , thioacid 20 , aliphatic 9 , malonyl substrate 19 , long carbon chain amino acids (e.g., γ-, δ-, etc.) 21,22 Incorporation of foldamers is indicated. 23 These achievements have led to the development of novel peptide drugs. 24-26and new classes of sequence-specific polymeric materials (such as aramids or polyamides). 9,19,21 This becomes possible.
[0598] While these works have advanced our understanding of molecular translation, they have also inspired continued research. From a fundamental perspective, exploring the limitations of the natural translation apparatus will help to clarify constraints on the size, shape, and chemistry of monomers that can be polymerized by ribosomes. From an applied perspective, accessing an even broader repertoire of monomers for ribosome-mediated polymerization promises to further increase the number of bio-based products available through biomanufacturing.
[0599] Here, we attempt to investigate the Fx-catalyzed charging of cyclic β-amino acids (cβAAs) onto tRNA and subsequently demonstrate the incorporation of such amino acid derivatives into peptides by the ribosome in vitro. We chose cβAAs because, to our knowledge, they have not yet been incorporated into growing polypeptide chains by the ribosome. Furthermore, their rigid structure should generate distinct features of helical geometry and peptide turns, which may help elucidate the limitations and monomer compatibility of the native translation machinery. Specifically, we investigate three cyclic β-2,3-amino acid derivatives (2-aminocyclobutanecarboxylic acid, 2-aminocyclopentanecarboxylic acid, and 2-aminocyclohexanecarboxylic acid) and their stereoisomers (Figure 35). First, we confirm that cβAAs can be charged onto tRNA. We then evaluate their incorporation into the N- or C-terminus of peptides using an in vitro ribosome-mediated protein synthesis platform (PURExpress™). In addition, the effect of the bacterial protein translation factor elongation factor P (EF-P) on the C-terminal incorporation of different cβAA stereoisomers into peptides is examined in our reactions.
[0600] The goal of this work was to evaluate the ribosomal synthesis of peptides with site-specifically introduced cβAAs. One key question was to assess the feasibility of incorporating such monomers into the C-terminus of peptides. Before starting the cβAA study, we compared the translation machinery's compatibility with acyclic β-amino acids to that of α-amino acids for C-terminal incorporation. Two cyanomethyl ester (CME) substrates (Figure 36a) derived from α- and β-puromycin (Pu) containing a methoxybenzyl group on the α-carbon were prepared. To eliminate any potential bias that the translation machinery might have toward natural amino acids (both carbon chains and functional groups), we intentionally avoided using the natural functional group (hence the methoxybenzyl group) in the comparison, allowing for a more direct comparison of the monomer backbones.
[0601] A short tRNA mimic (22 nt) called microhelix tRNA (mihx) was used to determine and optimize the Fx-mediated charging yields of α- and β-Pu analogs. 7,8 The yields were determined using an acidic polyacrylamide gel (Figure 39). Both monomers were found to be charged with 31% and 87% efficiency for the α- and β-substrates, respectively.
[0602] Next, we investigated whether the tRNA-charged Fx substrate was accepted by the native protein translation machinery. 11,13,22, We expected this to occur because Fx-mediated tRNA synthesis was observed under the same reaction conditions as those obtained from the mihx experiment. Pro1E2 Acylation of (GGU) was carried out. The unreacted monomer was precipitated with ethanol. 27The resulting tRNA fraction, containing substrate-charged tRNA (α-Pu:tRNA vs. β-Pu:tRNA), was added to an in vitro ribosome-mediated incorporation reaction (Fig. 36a). To normalize for differences in acylation yield, a 2.8-fold larger amount of ethanol-precipitated α-Pu:tRNA sample was added to the final reaction (Fig. 39d). For ribosome-catalyzed incorporation, the PURE system (ΔtRNA, Δaa, NEB) was used, containing the minimal set of components required for protein translation. The reaction was supplemented with only the nine amino acids required for expression of a streptavidin tag (amino acid sequence M+WSHPQFEK), along with a puromycin derivative substrate incorporated downstream of the tag into the template messenger RNA (mRNA) at the ACC codon. After incubation, the resulting peptides were isolated using affinity purification and analyzed by MALDI-based mass spectrometry. As expected, the peak corresponding to the theoretical mass of the peptide containing α-puromycin was approximately 14-fold higher than that of the peptide containing β-puromycin (Figure 36b). This suggests that the native translation system can incorporate monomers with α-amino acid backbones more efficiently than those with β-amino acid backbones, and that efficient incorporation requires the use of engineered ribosomes. 12,28,29 indicates that it requires
[0603] Next, we attempted to investigate the tolerance of natural ribosomes to different levels of steric bulkiness around the amine group. To test this, we designed three cβAAs containing cyclobutyl, cyclopentyl, and cyclohexyl backbones with different stereoisomeric properties (Figure 35). Previous studies 21In our previous work, we synthesized two cyclopropyl ester substrates for Fx-mediated acylation with 2-aminocyclopropanecarboxylic acid (3-cβAA), but these substrates could not be charged onto tRNA by Fx, likely due to the γ-type character within the cyclic chain that drives lactam formation. In this study, we synthesized 10 additional dinitrobenzyl (DNB) ester substrates using cyclobutyl β-amino acids (4-cβAA), which have two isomers (cis and trans), cyclopentyl β-amino acids (5-cβAA), and cyclohexyl β-amino acids (6-cβAA), which have four different stereoisomeric configurations at the α and β carbons (1R,2R, 1R,2S, 1S,2R, and 1S,2S), respectively. Fx-mediated acylation (Figure 39a–c) was performed using mihx to identify the best reaction conditions that provided high acylation yields. Acylation yields for 4-cβAA were observed to be low (0–9%, Figure 37), likely due to the d-type character of the amine on the substrate, which allows efficient formation of a six-membered ring and lactam. This result is consistent with our previous observations, where only 8% acylation was observed with MIHX for 5-aminopentanoic acid. 21 Conversely, the other eight 5- and 6-cβAA substrates showed high acylation yields (30–67%) due to a significant delay in lactam formation through intramolecular nucleophilic attack by the primary amine. Interestingly, the acylation yields varied depending on the substrate conformation, even under the same reaction conditions. This indicates that stereoisomers interact differently with the active sites of tRNA and Fx.
[0604] Next, tRNA fMet The 4-, 5-, and 6-cβAAs, which decode the AUG codon on mRNA, were acylated and attached to the tRNA, allowing for N-terminal substrate incorporation. After acylation, the purified tRNA was used for ribosome-mediated incorporation in a PURE translation reaction, and the resulting peptides were analyzed by mass spectrometry as described above. No peaks corresponding to the theoretical mass of peptides containing 4-cβAA were observed, most likely due to substrate limitation resulting from low acylation yields. However, tRNA fMetWe found that 5- and 6-cbβAAs that could be charged to (CAU) were successfully incorporated into peptides at the N-terminus (Fig. 40a, b), which is in line with previous observations that the native translation machinery is flexible with respect to N-terminal incorporation of extended backbone monomers. 4,6,9,23,24,30 To verify C-terminal incorporation, we used tRNAs that are acylated with 5- and 6-cβAA and decode the Thr(ACC) codon. Pro1E2 The above experiment was repeated using (GGU). Mass spectrometry data revealed limited yields of the desired product, but incorporation of all 5-cβAAs was observed (Figure 38a, peaks indicated by circles), whereas no peak corresponding to (1S,2R)-6-cβAA was observed (Figure 38c). These results suggest that native ribosomes have limitations on elongation using substrates featuring modified backbones, and that not only the position of the primary amine but also the overall steric bulk around the amine may be important.
[0605] To address the poor compatibility of monomers with the translational apparatus, recent work has demonstrated the importance of optimizing the concentration of translation factors, particularly EF-P31. EF-P is a bacterial translation factor that accelerates peptide bond formation between consecutive prolines and has been shown to help alleviate ribosome stalling. In the case of β-amino acids, the use of engineered β-aminoacyl-tRNAs based on tRNAPro with optimized sequences of T-stem and D-arm motifs that interact with EF-Tu and EF-P, respectively, increases incorporation efficiency. 31 .
[0606] EF-P is a tRNA with an engineered D-arm and T-stem. Pro1E2 We hypothesized that this would similarly allow for greater incorporation of charged cβAA. 13 To test this hypothesis, active EF-P was prepared by co-expressing the three accessory genes YjeA, YjeK, and YfcM in E. coli as previously described. 32(See SI for detailed preparation.) Then, purified EF-P (final concentration 10 μM) was added to tRNA Pro1E2 The PURE system contained a substrate charged with (GGU). In the resulting MALDI spectra, peaks corresponding to the theoretical masses of all 5- and 6-cβAA-containing peptides investigated were found with significantly enhanced intensities (Figures 38b, 38d) compared to experiments performed without EFP (Figures 38a, c).
[0607] Taken together, our work expands the scope of backbone-extended amino acid substrates for molecular translation. Specifically, we demonstrate that a diverse repertoire of 10 cβAA amino acids can be acylated onto tRNAs by the Fx system, and that these acylated tRNA-monomers can be used in ribosome-mediated polymerization using wild-type ribosomes. We observed different levels of incorporation efficiency based on stereoisomeric properties, demonstrating that the combination of engineered tRNAs with additional EF-P improves cβAA incorporation.
[0608] Taken together, our results unlock previously inaccessible monomer space for cβAAs. Therefore, we hope this work will motivate new directions for repurposing the translation machinery toward monomers with such non-canonical structures. Ribosomal synthesis of polymers containing site-specifically introduced cβAAs may lead to novel peptide drugs and peptide-based polymers requiring programmed stereochemistry.
[0609] References
[0610] 1. Chin, JW Expanding and reprogramming the genetic code. Nature 550, 53-60 (2017).
[0611] 2. Liu, Y., Kim, D.S. & Jewett, M.C. Repurposing ribosomes for synthetic biology. Curr Opin Chem Biol 40, 87-94 (2017).
[0612] 3. Arranz-Gibertt, P., Vanderschurent, K. & Isaacs, F.J. Nextgeneration genetic code expansion. Current Opinion in Chemical Biology 46, 203-211 (2018).
[0613] 4. Dedkova, L.M. & Hecht, S.M. Expanding the Scope of Protein Synthesis Using Modified Ribosomes. J Am Chem Soc 141, 6430-6447 (2019).
[0614] 5. Hammerling, M.J. et al. In vitro ribosome synthesis and evolution through ribosome display. Nat Commun 11, 1108 (2020).
[0615] 6. Tharp, J.M., Krahn, N., Varshney, U. & Soll, D. Hijacking translation initiation for synthetic biology. Chembiochem (2020).
[0616] 7. Murakami, H., Ohta, A., Ashigai, H. & Suga, H. A highly flexible tRNA acylation method for non-natural polypeptide synthesis. Nat Methods 3, 357-359 (2006).
[0617] 8. Morimoto, J., Hayashi, Y., Iwasaki, K. & Suga, H. Flexizymes: their evolutionary history and the origin of catalytic function. Acc Chem Res 44, 1359-1368 (2011).
[0618] 9. Lee, J. et al. Expanding the limits of the second genetic code with ribozymes. Nat Commun 10, 5097 (2019).
[0619] 10. Rogers, J.M. & Suga, H. Discovering functional, nonproteinogenic amino acid containing, peptides using genetic code reprogramming. Org Biomol Chem 13, 9353- 9363 (2015).
[0620] 11. Fujino, T., Goto, Y., Suga, H. & Murakami, H. Ribosomal synthesis of peptides with multiple beta-amino acids. J Am Chem Soc 138, 1962-1969 (2016). 12. Melo Czekster, C., Robertson, W.E., Walker, A.S., Soll, D. & Schepartz, A. In vivo biosynthesis of a beta-amino acidcontaining protein. J Am Chem Soc 138, 5194-5197 (2016).
[0621] 13. Katoh, T. & Suga, H. Ribosomal incorporation of consecutive beta-amino acids. J Am Chem Soc 140, 12159-12167 (2018).
[0622] 14. Kawakami, T., Ishizawa, T. & Murakami, H. Extensive reprogramming of the genetic code for genetically encoded synthesis of highly N-alkylated polycyclic peptidomimetics. J Am Chem Soc 135, 12297-12304 (2013).
[0623] 15. Ohta, A., Murakami, H., Higashimura, E. & Suga, H. Synthesis of polyester by means of genetic code reprogramming. Chem Biol 14, 1315-1322 (2007).
[0624] 16. Ohta, A., Murakami, H. & Suga, H. Polymerization of alphahydroxy acids by ribosomes. Chembiochem 9, 2773-2778 (2008).
[0625] 17. Torikai, K. & Suga, H. Ribosomal synthesis of an amphotericin-B inspired macrocycle. J Am Chem Soc 136, 17359-17361 (2014).
[0626] 18. Kawakami, T., Ogawa, K., Hatta, T., Goshima, N. & Natsume, T. Directed evolution of a cyclized peptoidpeptide chimera against a cell-free expressed protein and proteomic profiling of the interacting proteins to create a protein-protein interaction inhibitor. ACS Chem Biol 11, 1569-1577 (2016).
[0627] 19. Ad, O. et al. Translation of diverse aramid- and 1,3-dicarbonyl-peptides by wild-type ribosomes in vitro. Acs Central Sci 5, 1289-1294 (2019).
[0628] 20. Fleming, S.R. et al. Flexizyme-enabled benchtop biosynthesis of thiopeptides. J Am Chem Soc 141, 758-762 (2019).
[0629] 21. Lee, J., Schwarz, K.J., Kim, D.S., Moore, J.S. & Jewett, M.C. Ribosome-mediated polymerization of long-carbon chain and cyclic amino acids into peptides in vitro. Submitted (2020).
[0630] 22. Katoh, T. & Suga, H. Ribosomal elongation of cyclic gamma-amino acids using a reprogrammed genetic code. J Am Chem Soc 142, 4965-4969 (2020).
[0631] 23. Rogers, J.M. et al. Ribosomal synthesis and folding of peptide-helical aromatic foldamer hybrids. Nat Chem 10, 405-412 (2018).
[0632] 24. Yin, Y. et al. De novo carborane-containing macrocyclic peptides targeting human epidermal growth factor receptor. J Am Chem Soc 141, 19193-19197 (2019).
[0633] 25. Sakai, K. et al. Macrocyclic peptide-based inhibition and imaging of hepatocyte growth factor. Nat Chem Biol 15, 598-606 (2019).
[0634] 26. Vinogradov, A.A., Yin, Y. & Suga, H. Macrocyclic peptides as drug candidates: recent progress and remaining challenges. J Am Chem Soc 141, 4167-4181 (2019).
[0635] 27. Goto, Y., Katoh, T. & Suga, H. Flexizymes for genetic code reprogramming. Nat Protoc 6, 779-790 (2011).
[0636] 28. Dedkova, L.M. et al. beta-Puromycin selection of modified ribosomes for in vitro incorporation of beta-amino acids. Biochemistry 51, 401-415 (2012).
[0637] 29. Maini, R. et al. Incorporation of beta-amino acids into dihydrofolate reductase by ribosomes having modifications in the peptidyltransferase center. Bioorg Med Chem 21, 1088-1096 (2013).
[0638] 30. Tsiamantas, C., Kwon, S., Douat, C., Huc, I. & Suga, H. Optimizing aromatic oligoamide foldamer side-chains for ribosomal translation initiation. Chem Commun (Camb) 55, 7366-7369 (2019).
[0639] 31. Katoh, T., Wohlgemuth, I., Nagano, M., Rodnina, MV & Suga, H. Essential structural elements in tRNA(Pro) for EFP-mediated alleviation of translation stalling. Nat Commun 7, 11657 (2016).
[0640] 32. Peil, L. et al. Lys34 of translation elongation factor EF-P is hydroxylated by YfcM. Nat Chem Biol 8, 695-697 (2012).
[0641] Example 9 - Supplementary Information for Example 8
[0642] Materials and Methods
[0643] All reagents and solvents were of commercial grade and, when necessary, purified before use. Dichloromethane was obtained from Grubbs 1 The solution was dried by passing it through a column of activated alumina as described by [ 1999 ].
[0644] Substrates containing DNB and CME esters were prepared as previously described. Thin-layer chromatography (TLC) was performed using glass-backed silica gel (250 μm) plates. Products were visualized using UV light and / or the use of KMnO. Flash chromatography was performed on a Biotage Isolera One automated purification system or on silica columns.
[0645] Nuclear magnetic resonance spectra (NMR) were acquired on a Bruker Advance III-500 (500 MHz) instrument and processed by TopSpin. Chemical shifts are measured relative to the residual solvent peaks as an internal standard, set at δ 2.50 and δ 39.5 (DMSO-d6). Mass spectra were recorded on a Bruker Amazon SL (ESI), and data were processed using Compass DataAnalysis 4.2 software (Bruker).
[0646] [ka]
[0647] cis-3,5-Dinitrobenzyl-2-aminocyclobutane-1-carboxylate (1a). Prepared from cis-2-((t-butoxycarbonyl)amino)cyclobutane-1-carboxylic acid (71 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), and 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol) in dichloromethane (0.5 mL). 1H NMR (500 MHz, DMSO-d6) δ 8.82 (s, 1H), 8.74 (s, 2H), 5.42 (dd, J = 14.6 Hz, 2H), 3.95 (s, 1H), 3.61 (br, 1H), 2.30 (br, 2H), and 2.14 (br, 2H). 13C NMR (125 MHz, DMSO-d6) ppm 171.5, 148.5 (2C), 140.6, 129.1 (2C), 118.7, 64.7, 45.9, 40.7. 25.4, 20.2; MS (ESI): mass calculated for C12H13N3O6 [M+H]+ 296.08, found 296.07.
[0648] [ka]
[0649] trans-3,5-Dinitrobenzyl-2-aminocyclobutane-1-carboxylate (1b) was prepared from trans-2-((t-butoxycarbonyl)amino)cyclobutane-1-carboxylic acid (71 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), and 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol) in dichloromethane (0.5 mL). 1H NMR (500 MHz, DMSO-d6) δ 8.81 (t, J = 2.1 Hz, 1H), 8.70 (s, J = 2.1 Hz, 2H), 5.39 (dd, J = 17.5, 13.5 Hz, 2H), 3.87 (br, 1H), 3.65 (m, 2H), 2.80 (m, 3H), 1.95 (m, 1H). 13C NMR (125 MHz, DMSO-d6) ppm 171.7, 148.5 (2C), 140.8, 128.8 (2C), 118.6, 64.6, 46.5, 42.6, 23.9, 19.6; MS (ESI): mass calculated for C12H13N3O6 [M+H]+ 296.08, found 296.05
[0650] [ka]
[0651] (1R,2R)-3,5-dinitrobenzyl 2-aminocyclopentane-1-carboxylate (2a) was prepared using (1R,2R)-2-((t-butoxycarbonyl)amino)cyclopentane-1-carboxylic acid (102 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.5 mL). 1H NMR (500 MHz, DMSO-d6) δ 8.81 (s, 1H), 8.71 (d, J = 2.0 Hz, 2H), 5.40 (dd, J = 21.5, 13.5 Hz, 2H), 3.02 (m, 1H), 2.14 (m, 1H), 2.05 (m, 1H), 1.83 (t, J = 10.5 Hz, 2H), 1.75 (m, 2H). 13C NMR (125 MHz, DMSO-d6) ppm 173.1, 148.5 (2C), 140.8, 128.7 (2C), 118.6, 64.6, 53.8, 48.2, 31.2, 29.6, 23.6; MS (ESI): mass calculated for C13H15N3O6 [M+H]+ 310.09, found 310.09.
[0652] [ka]
[0653] (1R,2S)-3,5-dinitrobenzyl 2-aminocyclopentane-1-carboxylate (2b) was prepared using (1R,2S)-2-((t-butoxycarbonyl)amino)cyclopentane-1-carboxylic acid (102 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.5 mL). 1H NMR (500 MHz, DMSO-d6) δ 8.82 (t, J = 2.0 Hz, 1H), 8.74 (d, J = 2.0 Hz, 2H), 5.40 (m, 2H), 3.73 (br, 1H), 3.20 (dd, J = 15.0, 8.5 Hz, 1H), 2.00 (m, 3H), 1.82 (m, 2H), 1.73 (m, 2H). 13C NMR (125 MHz, DMSO-d6) ppm 171.9, 148.5 (2C), 140.7, 128.9 (2C), 118.6, 64.7, 52.8, 46.3, 30.4, 26.7, 21.6; MS (ESI): mass calculated for C13H15N3O6 [M+H]+ 310.09, found 310.08.
[0654] [ka]
[0655] (1S,2R)-3,5-dinitrobenzyl 2-aminocyclopentane-1-carboxylate (2c) was prepared using (1S,2R)-2-((t-butoxycarbonyl)amino)cyclopentane-1-carboxylic acid (102 mg, 0.33 mmol), triethylamine (70 μL, 0.50 mmol), 3,5-dinitrobenzyl chloride (86 mg, 0.40 mmol), and dichloromethane (0.5 mL). 1H NMR (500 MHz, DMSO-d6) δ 8.81 (t, J = 2.0 Hz, 1H), 8.70 (d, J = 2.0 Hz, 2H), 5.42 (dd, J = 30.5, 13 Hz, 2H), 3.49 (br, 1H), 3.09 (m, 1H), 1.98 (dd, J = 12.5, 7.0 Hz, 1H), 1.82 (m, 1H), 1.75 (dd, J = 24.5, 17 Hz, 2H), 1.64 (d, J = 7 Hz, 1H), 1.43 (t, J = 5 Hz, 3H). 13C NMR (125 MHz, DMSOd6) ppm 172.0, 148.5 (2C), 140.8, 128.8 (2C), 118.6, 64.6, 49.0, 42.6, 27.7, 25.0, 22.6; MS (ESI): mass calculated for C13H15N3O6 [M+H]+ 310.09, found 310.05.
[0656] [ka]
[0657] (1S,2S)-3,5-dinitrobenzyl 2-aminocyclopentane-1-carboxylate (...
Claims
【Request Item 1】 【Chemistry 1】 an acylated tRNA molecule having a formula defined as: tRNA is a transfer RNA linked via a 3' terminal ribonucleotide; R is a group having the formula: 【Chemistry 2】 and n is 0 to 6; R 1 or R 2 is selected from hydrogen, alkyl optionally substituted with amino; heterocycloalkyl; (heterocycloalkyl)alkyl; alkenyl; cyanoalkyl; aminoalkyl; aminoalkenyl; carboxyalkyl; alkylcarboxyalkyl ester; haloalkyl; nitroalkyl; aryl; heteroaryl; (aryl)alkyl; (hetero)alkyl); or (aryl)alkenyl, wherein said aryl, said heteroaryl, said (aryl)alkyl, said (heteroaryl)alkyl, or said (aryl)alkenyl is optionally substituted with one or more substituents selected from alkyl, hydroxyl, hydroxylalkyl, amino, aminoalkyl, azido, cyano, acetyl, nitro, nitroalkyl, halo, alkoxy, and alkynyl; R 1 and R 2 combine to form a carbocyclic ring, optionally 3-, 4-, 5-, 6-, 7-, or 8-membered carbocyclic ring, optionally substituted with one or more substituents selected from alkyl, hydroxyl, hydroxylalkyl, amino, aminoalkyl, azido, cyano, acetyl, nitro, nitroalkyl, halo, alkoxy, and alkynyl).
2. R 1 or R 2 is a substituted (aryl)alkyl or (heteroaryl)alkyl, optionally selected from 3,4-dihydroxyphenyl-methyl, pyrrol-2-yl-methyl, and 4-amino-phenyl-methyl.
3. R 1 or R 2 is a substituted phenyl, optionally selected from 4-nitrophenyl, 4-cyanophenyl, 4-azidophenyl, 3-acetylphenyl, 4-nitromethylphenyl, 2-fluorophenyl, 4-methoxyphenyl, 3-hydroxy-4-nitrophenyl, 3-amino-4-nitrophenyl, and 3-nitro-4-aminophenyl.
4. R 1 or R 2 is heteroaryl or substituted heteroaryl, optionally selected from pyridinyl, fluoropyridinyl, coumarinyl, pyrrolyl, thiophen-2-yl, and 5-aminomethyl-furan-3-yl.
5. R 1 or R 2 contains a primary amine group or a secondary amine group, and optionally R 1 or R 2 is selected from 3-aminopropyl, 4-aminobutyl, 5-aminobutyl, 1,1-dimethyl-3-aminopropanyl, 3-methylamino-propanyl, 6-aminohexyl, 3-amino-1-propenyl, 2-aminocyclobutyl, 2-aminocyclopentyl, and 2-aminocyclohexyl.
6. R 1 or R 2 10. The molecule of claim 1, wherein R 1 is an alkyl group optionally substituted with an amino group.
7. R 1 or R 2 10. The molecule of claim 1, wherein R comprises a cyclic secondary amine such as piperidinyl or piperazinyl, and R is optionally selected from piperidin-4-yl, (piperidin-4-yl)methyl, piperazin-4-yl, and (piperazin-4-yl)methyl.
8. R 1 or R 2 is selected from alkyl, alkenyl, cyanoalkyl, and alkylcarboxylalkyl ester.
9. formula: 【Transformation 3】 2. The molecule of claim 1, having the formula:
10. formula: 【Chemistry 4】 2. The molecule of claim 1, having the formula:
11. formula: 【Transformation 5】 (where X is (CH 2 ) m and m is selected from 1 to 6), the molecule of claim 1.
12. 12. A method for preparing a sequence-specific polymer, wherein the sequence-specific polymer is prepared through translation of an mRNA containing a codon that corresponds to the anticodon of an acylated tRNA molecule of any one of claims 1 to 11, and an R group of the acylated tRNA molecule is incorporated into the sequence-specific polymer during translation of the mRNA.
13. 13. The method of claim 12, which is carried out in vitro.
14. 13. The method of claim 12, which is performed in vivo.
15. 13. The method of claim 12, wherein the codon is the start codon (AUG) of the mRNA.
16. 13. The method of claim 12, wherein the codon is selected from a codon for threonine, a codon for isoleucine, and a codon for alanine.
17. 13. The method of claim 12, wherein the sequence-specific polymer is selected from a polyolefin polymer, an aramid polymer, a polyurethane polymer, a polyketide polymer, a conjugated polymer, a D-amino acid polymer, a β-amino acid polymer, a γ-amino acid polymer, a δ-amino acid polymer, an ε-amino acid polymer, a ζ-amino acid polymer, and a polycarbonate polymer. 【Request Item 18】 【Chemistry 6】 An acylated tRNA molecule having a formula defined as: tRNA is a transfer RNA linked via a 3' terminal ribonucleotide; R is a group having the formula: 【Transformation 7】 and n is 0 to 6; R 1 or R 2 is selected from hydrogen, alkyl optionally substituted with amino; heterocycloalkyl; (heterocycloalkyl)alkyl; alkenyl; cyanoalkyl; aminoalkyl; aminoalkenyl; carboxyalkyl; alkylcarboxyalkyl ester; haloalkyl; nitroalkyl; aryl; heteroaryl; (aryl)alkyl; (hetero)alkyl); or (aryl)alkenyl, wherein said aryl, said heteroaryl, said (aryl)alkyl, said (heteroaryl)alkyl, or said (aryl)alkenyl is optionally substituted with one or more substituents selected from alkyl, hydroxyl, hydroxylalkyl, amino, aminoalkyl, azido, cyano, acetyl, nitro, nitroalkyl, halo, alkoxy, and alkynyl; R 1 and R 2 combine to form a carbocyclic ring, optionally substituted with one or more substituents selected from alkyl, hydroxyl, hydroxylalkyl, amino, aminoalkyl, azido, cyano, acetyl, nitro, nitroalkyl, halo, alkoxy, and alkynyl, optionally 3-, 4-, 5-, 6-, 7-, or 8-membered carbocyclic ring, comprising: (i) Flexizyme (Fx): (ii) the tRNA molecule; and (iii) Formula: 【Transformation 8】 A donor molecule having R is as defined above; LG is a leaving group; wherein X is O or S; and the Fx catalyzes an acylation reaction between the 3'-terminal ribonucleotide of the tRNA and the donor molecule to prepare the acylated tRNA molecule.
19. 20. The method of claim 18, wherein Fx is selected from aFx, dFx, and eFx.
20. 20. The method of claim 18, wherein the tRNA comprises an anticodon selected from the anticodon CAU, the anticodon GGU, the anticodon GAU, or the anticodon GGC.
21. 20. The method of claim 18, wherein LG comprises a cyanomethyl moiety and the donor molecule comprises cyanomethyl ester (CME).
22. 20. The method of claim 18, wherein LG comprises a dinitrobenzyl moiety and the donor molecule comprises a dinitrobenzyl ester (DNB).
23. 20. The method of claim 18, wherein LG comprises a (2-aminoethyl)amidocarboxybenzyl moiety and the donor molecule comprises (2-aminoethyl)amidocarboxybenzyl thioester (ABT).
24. The method of claim 18 is carried out under reaction conditions such that at least about 50% of the tRNA in the reaction mixture is acylated after reacting the reaction mixture for 120 hours, preferably under reaction conditions such that at least about 50% of the tRNA in the reaction mixture is acylated after reacting the reaction mixture for 16 hours.
25. formula: 【Chemistry 9】 A molecule with (where, in this formula, R is of the formula: 【Chemistry 10】 (In this equation, n is 0 to 6; R 1 or R 2 is selected from hydrogen, alkyl optionally substituted with amino; heterocycloalkyl; (heterocycloalkyl)alkyl; alkenyl; cyanoalkyl; aminoalkyl; aminoalkenyl; carboxyalkyl; alkylcarboxyalkyl ester; haloalkyl; nitroalkyl; aryl; heteroaryl; (aryl)alkyl; (hetero)alkyl); or (aryl)alkenyl, wherein said aryl, said heteroaryl, said (aryl)alkyl, said (heteroaryl)alkyl, or said (aryl)alkenyl is optionally substituted with one or more substituents selected from alkyl, hydroxyl, hydroxylalkyl, amino, aminoalkyl, azido, cyano, acetyl, nitro, nitroalkyl, halo, alkoxy, and alkynyl; R 1 and R 2 combine to form a carbocycle, optionally a 3-, 4-, 5-, 6-, 7-, or 8-membered carbocycle, optionally substituted with one or more substituents selected from alkyl, hydroxyl, hydroxylalkyl, amino, aminoalkyl, azido, cyano, acetyl, nitro, nitroalkyl, halo, alkoxy, and alkynyl; LG is a leaving group; X is O or S).
26. LG, 【Chemistry 11】 26. The molecule of claim 25 having a formula selected from: