Method for detecting drug-resistant bacteria, bacteria of genus staphylococcus, and bacteria of genus pseudomonas, and uses thereof
By amplifying specific genes of Staphylococcus and Pseudomonas and combining them with the LAMP method, the problem of long detection time for drug-resistant bacteria in existing technologies has been solved, and the effect of rapid identification of infectious pathogens has been achieved.
Patent Information
- Application Number
- JP2024071261
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-04-25
- Publication Date
- 2025-11-07
AI Technical Summary
Current technologies require several days to detect drug-resistant bacteria such as Staphylococcus and Pseudomonas, making it impossible to quickly identify their drug sensitivity and resistance.
Nucleic acid amplification is performed by amplifying specific genes (mecA, spa, tuf, and 16S rRNA) and combined with the LAMP method to rapidly detect drug-resistant bacteria.
It enables rapid identification of infectious pathogens within hours, especially drug-resistant bacteria, within 15 minutes, thus improving detection efficiency.
Smart Images

Figure 2025167011000001_ABST
Abstract
Description
[Technical Field]
[0001] The present disclosure relates to a method for detecting drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria, and uses thereof. [Background technology]
[0002] Antibacterial drugs are widely used to treat bacterial infections. However, the widespread use of these drugs has led to the emergence of drug-resistant bacteria, which has become a problem (Non-Patent Document 1). Therefore, in order to prevent the emergence of these drug-resistant bacteria, it is necessary to minimize the use of broad-spectrum antibacterial drugs and drugs against methicillin-resistant Staphylococcus aureus (MRSA). [Prior art documents] [Non-patent literature]
[0003] [Non-Patent Document 1] WHO, "Antimicrobial Resistance (AMR) Action Plan," April 7, 2023, Ministerial Meeting on International Cooperation and Strengthening of Measures against Infectious Diseases of Global Threat [Non-patent document 2] Tetsuo Yamaguchi, "Infectious Disease Treatment and Countermeasures in the Era of the Action Plan for Countermeasures against AMR: Epidemiological Information and Clinical Features of CA-MRSA in Japan," Journal of the Japanese Society of Chemotherapy, Vol. 67, No. 5, (2019), 567-576 Summary of the Invention [Problem to be solved by the invention]
[0004] In identifying the causative bacteria of infectious diseases, bacteria are generally collected from the affected area and cultured to identify the causative bacteria and evaluate their drug susceptibility and resistance. However, it takes several days to identify the causative bacteria and their drug susceptibility / resistance through the culture test. Therefore, there is a need to speed up the process of identifying the causative bacteria and their drug susceptibility / resistance.
[0005] Therefore, the present disclosure aims to provide a detection method capable of quickly detecting drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria, a method for providing an index for selecting antibacterial agents for bacteria, and a primer set that can be used for these methods. [Means for solving the problem]
[0006] In order to achieve the above-mentioned object, the detection method of the present disclosure, which is also referred to as the "detection method," comprises the steps of nucleic acid amplifying the following target genes (1) to (3) and (4) in a target sample, and detecting the drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria in the sample: (1) mecA gene; (2) the spa gene of Staphylococcus aureus; (3) the tuf and / or rpoB genes of Staphylococcus bacteria; (4) 16S rRNA gene of Pseudomonas bacteria.
[0007] The method for providing an index for selecting an antibacterial agent against bacteria according to the present disclosure (hereinafter also referred to as the "provision method") comprises the steps of nucleic acid amplifying the following target genes (1) to (3) and (4) in a target sample, and presenting candidate antibacterial agents against the bacteria contained in the sample: (1) mecA gene; (2) the spa gene of Staphylococcus aureus; (3) the tuf gene and / or rpoB gene of Staphylococcus aureus; (4) 16S rRNA gene of Pseudomonas bacteria.
[0008] The primer set (hereinafter also referred to as "primer set") for use in detecting drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria of the present disclosure includes a primer set capable of nucleic acid amplification of the following target genes (1) to (3) and (4): (1) mecA gene; (2) the spa gene of Staphylococcus aureus; (3) the tuf gene and / or rpoB gene of Staphylococcus aureus; (4) 16S rRNA gene of Pseudomonas bacteria
[0009] The detection kit for drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria of the present disclosure includes the primer set of the present disclosure and a nucleic acid amplification reagent. [Effects of the Invention]
[0010] The present disclosure provides a detection method capable of rapidly detecting drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria, a method for providing an index for selecting antibacterial agents for bacteria, and a primer set that can be used in these methods. [Brief explanation of the drawings]
[0011]
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
[0012] <Definition> As used herein, the term "drug-resistant bacteria" refers to bacteria that are not susceptible to at least one antibiotic. These antibiotic-resistant bacteria are also generally referred to as antibiotic X-resistant bacteria when combined with antibiotic X to which the bacteria are not susceptible.
[0013] As used herein, the term "Staphylococcus" refers to the Staphylococcus family ( 葡萄球菌科 ) Staphylococcus spp. 葡萄球菌属 The Staphylococcus bacteria are, for example, S. 表皮葡萄球菌 , S. 人葡萄球菌 , S. 头葡萄球菌 , S. 溶血葡萄球菌 , S. 路邓葡萄球菌 , S. 金黄色葡萄球菌 Examples include:
[0014] As used herein, "Staphylococcus aureus" refers to the Staphylococcus aureus strains belonging to the Staphylococcus family ( 葡萄球菌科 ) Staphylococcus spp. 葡萄球菌属 ) Staphylococcus aureus species ( 葡萄球菌属 金黄色葡萄球菌 ) is a bacterium belonging to the family Bacillus subtilis.
[0015] As used herein, "Pseudomonas bacteria" refers to bacteria belonging to the Pseudomonadaceae family ( 假单胞菌科 ) of Pseudomonas spp. 假单胞菌属 The term "Pseudomonas" refers to bacteria belonging to the genus Pseudomonas. An example of the Pseudomonas bacteria is Pseudomonas aeruginosa.
[0016] As used herein, "Pseudomonas aeruginosa" refers to a strain of the Pseudomonadaceae family ( 假单胞菌科 ) of Pseudomonas spp. 假单胞菌属 ) Pseudomonas aeruginosa species ( 假单胞菌属 铜绿假单胞菌 ) is a bacterium belonging to the family Bacillus subtilis.
[0017] As used herein, the term "mecA gene" refers to a gene known to confer methicillin resistance to Staphylococcus bacteria. The mecA gene is known to encode penicillin-binding protein 2a (PBP2a), which has low affinity for penicillin. Staphylococcal cassette chromosome (SCC)mec refers to a mobile genetic element containing mecA. MRSA acquires methicillin resistance by possessing SCCmec, a resistance gene cluster containing mecA. The SCCmec is known to be composed of a mec gene complex consisting of mecA and its regulatory factors, and a ccr gene complex, which is a recombinant gene. The mec gene complex is composed of five types, class AE, and the ccr gene complex is composed of nine types, types 1-9. The SCCmectype is determined by the combination of the mec gene complex and the ccr gene complex. In recent years, the prevalence of methicillin-resistant Staphylococcus aureus (MRSA) has changed significantly, with community-associated MRSA (CA-MRSA) of SCCmec type IV becoming the mainstream. A specific example of the mecA gene is the gene registered at NCBI under Gene ID: KC243783.
[0018] As used herein, the term "spa gene" refers to a gene that encodes protein A, which is present in the cell wall of Staphylococcus aureus and specifically binds to the Fc region of immunoglobulin. A specific example of the spa gene is the gene registered at NCBI under Gene ID: J01786.
[0019] As used herein, the term "tuf gene" refers to a gene encoding the protein elongation factor Tu. Specific examples of the tuf gene of Staphylococcus include the gene registered with NCBI under Gene ID: EU571082. The tuf gene is known to be a highly reliable and reproducible target for analysis in identifying coagulase-negative Staphylococcus (CNS).
[0020] As used herein, the term "rpoB gene" refers to a gene encoding the RNA polymerase B subunit. The rpoB gene has a different nucleotide sequence depending on the bacterial species, and is therefore generally used for bacterial species identification based on its nucleotide sequence, similar to the 16s rRNA gene described below. A specific example of the rpoB gene of Staphylococcus bacteria is the gene registered at NCBI under Gene ID: MG874738.
[0021] As used herein, the term "16s rRNA gene" refers to a gene encoding 16s rRNA, which constitutes ribosomes. The base sequence of the 16s rRNA gene varies depending on the bacterial species, and therefore, the base sequence is generally used for identifying bacterial species. A specific example of the 16s rRNA gene of Pseudomonas aeruginosa is the gene registered at NCBI under Gene ID: NR_026078.
[0022] As used herein, "Methicillin-Resistant Staphylococci" (MRS) refers to methicillin-resistant Staphylococcus bacteria, including Methicillin-Resistant Coagulase-Negative Staphylococci (MRCNS, methicillin-resistant coagulase-negative Staphylococci) and Methicillin-Resistant Staphylococcus Aureus (MRSA). The term "methicillin-resistant" refers to the presence of drug resistance to the antibiotic methicillin (oxacillin). The term "coagulase-negative" refers to a negative result in a coagulase test, which is one of the identification tests for Staphylococcus.
[0023] As used herein, "Methicillin-Resistant Coagulase Negative Staphylococci" (MRCNS) refers to methicillin-resistant coagulase-negative Staphylococcus bacteria. The MRCNS includes, for example, S. 表皮葡萄球菌 , S. 人葡萄球菌 , S. 头葡萄球菌 , S. 溶血葡萄球菌 , S. 路邓葡萄球菌 Examples include methicillin-resistant bacteria such as
[0024] As used herein, "Methicillin-Resistant Staphylococcus Aureus" (MRSA) means methicillin-resistant Staphylococcus aureus.
[0025] As used herein, "Methicillin-Susceptible Coagulase-Negative Staphylococci" (MSCNS) refers to methicillin-sensitive, coagulase-negative Staphylococci. The methicillin resistance refers to drug sensitivity to the antibiotic methicillin. Examples of the MSCNS include methicillin-susceptible bacteria such as S. epidermidis, S. homnis, S. capitis, S. haemolyticus, and S. lugdnensis.
[0026] As used herein, "Methicillin-Susceptible Staphylococcus aureus" (MSSA) refers to methicillin-sensitive Staphylococcus aureus.
[0027] As used herein, "anti-MRSA drugs" refers to antibacterial drugs used to treat MRSA. Examples of anti-MRSA drugs include vancomycin hydrochloride (VCM), teicoplanin (TEIC), arbekacin sulfate (ABK), linezolid (LZD), tedizolid (TZD), and daptomycin (DAP).
[0028] As used herein, "antistaphylococcal antibacterial agents" refer to antibacterial agents used to treat infections caused by bacteria of the genus Staphylococcus. Examples of antistaphylococcal antibacterial agents include cefazolin, cefuroxime, vancomycin, clindamycin, rifampicin, linezolid, tedizolid, quinupristin / dalfopristin, daptomycin, telavancin, dalbavancin, oritavancin, tigecycline, eravacycline, omadacycline, delafloxacin, ceftobiprole, ceftaroline, and lefamulin.
[0029] As used herein, the term "antipseudomonal agent" refers to an antibacterial agent used to treat infections caused by Pseudomonas aeruginosa. Examples of the antipseudomonal agent include β-lactam antibacterial agents such as tazobactam (TAZ), piperacillin (PIPC), ceftazidime, cephem, cefoperazone / sulbactam, and carbapenem, aminoglycoside antibacterial agents, and new quinolone antibacterial agents.
[0030] As used herein, the term "broad-spectrum antibacterial agent" refers to an antibacterial agent that has a wide antibacterial spectrum, rather than targeting specific bacteria. The broad-spectrum antibacterial agent is preferably an antibacterial agent that does not include, for example, methicillin-resistant Staphylococcus aureus and Pseudomonas aeruginosa in its antibacterial spectrum, and specific examples include third-generation cephem antibacterial agents such as cefotax, ceftriaxone, and ceftazidime; fourth-generation cephalosporin antibacterial agents such as cefepime (CFPM), cefpirome (CPR), and cefozopran (CZOP); imipenem (IPM), cilastatin (CS), and paclitaxel. Examples include carbapenem antibiotics such as nipenem (PAPM), betamipron (BP), meropenem (MEPM), biapenem (BIPM), doripenem (DRPM), and tebipenem (TBPM); fluoroquinolone antibiotics such as ciprofloxacin (CPFX), levofloxacin (LVFX), and pazufloxacin (PZFX); and penicillin antibiotics such as tazobactam (TAZ) / piperacillin (PIPC).
[0031] As used herein, the term "subject" refers to an animal or a cell, tissue, or organ derived from an animal, and particularly includes humans. The term "animal" refers to both humans and non-human animals. Examples of non-human animals include mammals such as mice, rats, rabbits, dogs, cats, cows, horses, pigs, monkeys, dolphins, and sea lions.
[0032] As used herein, a "sample" may refer to a substance that contains bacteria, a substance that may contain bacteria, or a substance whose presence or absence of bacteria is unknown. Examples of such samples include biological samples (e.g., biological samples or specimens). Examples of such biological samples include samples containing body fluids, cells, tissues, organs, etc. Specific examples include feces, saliva, samples from the lower respiratory tract (e.g., sputum, tracheal aspirate, and alveolar lavage fluid), samples from the upper respiratory tract (e.g., pharyngeal swabs and nasal secretions), body fluid swabs, whole blood, serum, plasma, cerebrospinal fluid, urine, sweat, semen, vaginal fluid, pus, puncture fluids such as synovial fluid, ascites, and pleural effusion, amniotic fluid, gastric juice, endometrium, vaginal skin, sebum, tongue coating, bile, and the like; specimens such as surgical specimens; and samples from the vicinity of implantable medical devices such as implants. The sample may be liquid or solid. When the sample is solid, the present disclosure preferably prepares a liquid sample by mixing the solid sample with a liquid. Examples of the liquid include water, physiological saline, buffers such as Hank's buffer, Good's buffer (e.g., HEPES buffer, Tricine buffer), Tris buffer, phosphate buffer, and glycine buffer, diethyl pyrocarbonate (DEPC)-treated water, nuclease-free water (non-DEPC-treated), RT-PCR-grade water, ultrapure water, and pure water. When the sample is a human surgical specimen or implant, the sample may include, for example, a wash solution obtained after adding a liquid to the surgical specimen or implant and subjecting it to ultrasonic treatment or other treatment to disrupt biofilms.
[0033] As used herein, "nucleic acid," "polynucleotide," or "oligonucleotide" refers to a polymer of deoxyribonucleotides (DNA), ribonucleotides (RNA), and / or modified nucleotides. The nucleic acid may be a single-stranded or double-stranded nucleic acid molecule. The polynucleotide may be composed of naturally occurring nucleotides, modified or artificial nucleotides, or both.
[0034] As used herein, the term "label" refers to a label used to distinguish a molecule or substance of interest from other molecules or substances. Examples of such labels include fluorescent labels such as fluorescent dyes or fluorescent substances; chemiluminescent labels; enzyme labels such as alkaline phosphatase; and radioisotope (RI) labels.
[0035] As used herein, the term "gene" refers to a factor that determines a genetic trait, and may refer to a "polynucleotide," an "oligonucleotide," and a "nucleic acid."
[0036] As used herein, the term "kit" generally refers to a unit in which the components to be provided (e.g., detection reagent, label, instructions, etc.) are provided separately in two or more compartments. The kit can be suitably used to provide a composition that is not provided in a mixed state, but is preferably mixed immediately before use, for reasons of stability, etc. The kit preferably includes, for example, instructions or instructions on how to use the components to be provided (e.g., detection reagent, etc.), or instructions or instructions describing the processing of the components. As used herein, when the kit is used as a reagent kit, the kit may include instructions, etc., describing how to use the detection reagent, etc.
[0037] As used herein, "instructions" or "instructions" refer to written instructions to a physician or other user on how to use the present disclosure. The instructions include, for example, instructions on how to use the detection method, detection reagent, or kit of the present disclosure. The instructions may be prepared in accordance with a format specified by a regulatory agency of the country in which the present disclosure is implemented (e.g., the Ministry of Health, Labor and Welfare in Japan, the Food and Drug Administration (FDA) in the United States, the European Medicines Agency (EMA) in Europe, etc.), and may clearly state that they have been approved by the regulatory agency. The instructions may be a so-called package insert, and are usually provided in paper form, but are not limited thereto, and may also be provided in the form of, for example, electronic media (e.g., a homepage provided on the Internet, email).
[0038] Sequence information for the proteins described herein or the nucleic acids (e.g., DNA or RNA) encoding them is available from Protein Data Bank, UniProt, GenBank, etc. RNA nucleic acid sequences can also be obtained from the corresponding DNA base sequences using appropriate sequence conversion software, etc.
[0039] The present disclosure will be specifically described below using examples. Unless otherwise specified, each disclosure may incorporate the explanations of other disclosures.
[0040] <Detection method> The present disclosure provides a detection method capable of quickly detecting drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria. The detection method of the present disclosure includes a step (detection step) of nucleic acid-amplifying the target genes (1) to (3) and (4) below in a target sample, and detecting drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria in the sample. (1) mecA gene (2) The spa gene of Staphylococcus aureus (3) the tuf gene and / or rpoB gene of Staphylococcus aureus bacteria (4) 16S rRNA gene of Pseudomonas bacteria
[0041] As a result of extensive research, the present inventors came up with the idea that drug-resistant bacteria such as methicillin-resistant Staphylococcus aureus, Staphylococcus spp., and Pseudomonas spp. could be rapidly evaluated by combining specific target genes and evaluating them using a nucleic acid amplification method. As a result of further research, the present inventors confirmed that drug-resistant bacteria such as methicillin-resistant Staphylococcus aureus, Staphylococcus spp., and Pseudomonas spp. could be rapidly evaluated by targeting the genes (1) to (4) above as the specific target genes and using a nucleic acid amplification method, thereby establishing the present disclosure. According to the present disclosure, identification of causative bacteria of an infection in a subject can be evaluated in a few hours, whereas it conventionally required several days. In particular, by combining this method with the LAMP method, causative bacteria of an infection in a subject can be evaluated in about 15 minutes.
[0042] In the detection method of the present disclosure, the target sample may be pretreated prior to the detection step. Examples of the pretreatment include extraction of nucleic acids, preferably genomic DNA, contained in the sample, sonication, mixing, and mixing with a liquid such as physiological saline. The extraction can be performed by known nucleic acid extraction methods, such as heat treatment, sonication, heat treatment, bead crushing, and magnetic bead treatment. The extraction may be performed using a commercially available kit.
[0043] In the detection step, the target genes (1) to (3) and (4) in the target sample are nucleic acid amplified to detect drug-resistant bacteria, Staphylococcus bacteria and Pseudomonas bacteria in the sample. Specifically, in the detection step, for example, the target genes (1) to (3) and (4) in the target sample are first nucleic acid amplified (amplification step). Specifically, in the amplification step, nucleic acid amplification is performed in the coexistence of the sample and primers capable of amplifying the target genes (1) to (3) and (4). The coexistence can be prepared, for example, by mixing the sample, the primers and the detection probe. The coexistence is preferably carried out in a liquid system (coexistence system or mixed system) containing water, physiological saline, the buffer solution or the like. The order of the contact or mixing is not particularly limited and can be any order. The coexistence system may include a primer set for amplifying any one target gene, a primer set for amplifying multiple target genes, or a primer set for amplifying all target genes. That is, in the amplification step, for example, the nucleic acid amplification and detection may be performed using separate liquid systems for the primer sets for amplifying each of the target genes (1) to (4) and the sample, or the nucleic acid amplification and detection may be performed using a single liquid system for multiple or all of the primer sets for amplifying each of the target genes (1) to (4) and the sample. When the coexistence system includes multiple primer sets, each primer set preferably contains a different label. In the amplification step, for example, a nucleic acid amplification reagent used for nucleic acid amplification is further added to the coexistence system to prepare an amplification reaction system. Next, in the amplification step, for example, a nucleic acid amplification reaction is performed in the amplification reaction system to amplify the target gene in the sample.
[0044] The primer set may amplify the entire target gene or a portion of the target gene. The primer set is, for example, a PCR primer set (e.g., a forward primer and a reverse primer) specific to the target gene, and can be designed according to the base sequence of the nucleic acid to be amplified, i.e., the base sequence of the target gene. The base sequences of the primers can be designed, for example, using a primer design tool (software). The primer set can be chemically synthesized, for example, using an automatic DNA synthesizer based on the designed base sequence. The primer set includes two or more types of primers, and may include three or more types depending on the target gene and nucleic acid amplification method.
[0045] The nucleic acid amplification preferably involves amplifying, for example, the following regions (1) to (3) and / or (4): In the nucleic acid amplification, part or all of the following regions (1) to (3) and / or (4) may be amplified, or a region including the region may be amplified: (1) a region in the mecA gene containing the nucleotide sequence of SEQ ID NO: 1 (2) a region in the spa gene containing the base sequence of SEQ ID NO: 2 (3) a region in the tuf gene containing the nucleotide sequence of SEQ ID NO: 3 and / or a region in the rpoB gene containing the nucleotide sequence of SEQ ID NO: 4 (4) A region containing the base sequence of SEQ ID NO: 5 in the 16S rRNA gene
[0046] Partial region of the mecA gene (SEQ ID NO: 1) CAACTAATGAAACAGAAAGTCGTAACTATCCTCTAGGAAAAGCGACTTCACATCTATTAGGTTATGTTGGTCCCATTAACTCTGAAGAATTAAAACAAAAAGAATATAAAGGCTATAAAGATGATGCAGTTATTGGTAAAAAGGGACTCGAAAAACTTTACGATAAAAAGCTCCAACATGAAGATGGCTATCGTGTCACAATCGTTGACGATAATAGCAATACAATCGCACATAC
[0047] Partial region of the spa gene (SEQ ID NO: 2) GGTGATACAGTAAATGACATTGCAAAGCAAACGGCACTACTGCTGACAAAATTGCTGTAGATAACAAATTAGCTGATAAAAACATGATCAAACCTGGTCAAGAACTTGTTGTTGATAAGAAGCAACCAGCAAACCATGCAGATGCTAACAAAGCTCAAGCATTACCAGAAACTGGTGAAGAAAATCCATTCATCGGTACAACTGTATTTGGTGGATTATCATTAGCG
[0048] Partial region of the tuf gene (SEQ ID NO: 3) TGTTCCGTAAATTATTAGACTACGCTGAAGCTGGTGACAACATCGGTGCTTTATTACGTGGTGTTGCTCGTGAAGATGTACAACGTGGTCAAGTATTAGCTGCTCCAGGTTCAATTACACCTCACACAAAATTCAAAGCAGACGTATACGTTTTATCAAAAGATGAAGGTGGACGTCATACTCCATTCTTCTCTAACTATCG
[0049] Partial region of the rpoB gene (SEQ ID NO: 4) ACTTGATGAAAATGGTCGTTTCTTAGATGATGAAGTTGTTTGTCGTTTCCGTGGTAATAACACTGTTATGGCTAAAGAAAAAATGGATTACATGGACGTATCACCAAAACAAGTTGTTTCAGCAGCAACAGCATGTATTCCATTCTTAGAAAATGACGACTCTAACCGTGCGTTAATGGGAGCAAACATGCAACGTCAAGCGGTGCCTTTAA
[0050] Partial region of the 16S rRNA gene (SEQ ID NO: 5) GGGGCCTTCAAACACATGCAAGTCGAGCTTATGAAGGGAGCTTGCCTTGGATTCAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGATAACGTCCGGAAACGCCGCTAATACCGCATACGTCCTGAGGGAGAAAGTCGGGGATCTTCGGACCTCACGCTATCA
[0051] The region (1) corresponds to bases 701 to 935 in the mecA gene of Staphylococcus aureus (NCBI accession number: KC243783.1).
[0052] The region (2) is the 1786th to 2015th bases in the spa gene of Staphylococcus aureus (NCBI accession number: X61307.1) (the region of the F3 primer to B3 primer of the spa gene described below).
[0053] The region (3) is the 127th to 338th bases in the tuf gene of Staphylococcus aureus (NCBI accession number: EU571082) and / or the 363rd to 574th bases in the rpoB gene of Staphylococcus aureus (NCBI accession number: MG874738). S. 表皮葡萄球菌 , S. 人葡萄球菌 , S. 头葡萄球菌 and S. 溶血葡萄球菌 It is preferable to set it in a region specific to the rpoB gene of the gene encoding the rpoB gene.
[0054] Primer sets that can be used to amplify nucleic acids in the regions (1) to (4) include, for example, the following primer sets (A1) to (C1) and / or (D1), and preferably the following primer sets (A1) to (D1). The following primer sets (A1) to (D1) are primer sets that target and can amplify the regions (1) to (4), respectively. (A1) a primer set capable of amplifying a region containing the nucleotide sequence of SEQ ID NO: 1 in the mecA gene; (B1) a primer set capable of amplifying a region containing the nucleotide sequence of SEQ ID NO: 2 in the spa gene; (C1) a primer set capable of amplifying a region in the tuf gene comprising the nucleotide sequence of SEQ ID NO: 3 and / or a region in the rpoB gene comprising the nucleotide sequence of SEQ ID NO: 4; (D1) A primer set capable of amplifying a region containing the nucleotide sequence of SEQ ID NO: 5 in the 16S rRNA gene
[0055] The primer set (A1) above includes, for example, the primer set (A2) below. (A2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 7; A primer set including
[0056] The primer set (A1) is preferably the primer set (A3) or (A4) below. The primer set (A3) or (A4) below is a primer set that can be used, for example, in the LAMP method. When the primer set (A3) or (A4) below is used in combination with the LAMP method, for example, the mecA gene can be detected more quickly, for example, in about 15 minutes. (A3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 7; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 16; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 17; A primer set including (A4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 7; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 16; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 17; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 26; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 27; A primer set including
[0057] [Table 1]
[0058] The primer set (B1) includes, for example, the primer set (B2) below. (B2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; A primer set including
[0059] The primer set (B1) is preferably the primer set (B3) or (B4) below. The primer set (B3) or (B4) below is a primer set that can be used, for example, in the LAMP method. When the primer set (B3) or (B4) below is combined with the LAMP method, for example, it becomes possible to detect the spa gene more quickly, for example, in about 15 minutes. (B3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 18; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 19; A primer set including (B4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 18; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 19; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 28; A primer set including
[0060] [Table 2]
[0061] An example of the primer set (C1) is the primer set (C2) below. In the primer set (C2) below, the primers of SEQ ID NO: 10 and SEQ ID NO: 11 are a primer set for the tuf gene, and the primers of SEQ ID NO: 12 and SEQ ID NO: 13 are a primer set for the rpoB gene. (C2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 11; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; A primer set including
[0062] The primer set (C1) is preferably the primer set (C3) or (C4) below. The primer set (C3) or (C4) below is a primer set that can be used, for example, in the LAMP method. The primer set (C3) or (C4) below, when combined with the LAMP method, enables the detection of the tuf gene and / or the rpoB gene more quickly, for example, in about 15 minutes. In the primer set (C3) below, the primers of SEQ ID NOs: 10, 11, 20, and 21 are the primer set for the tuf gene, and the primers of SEQ ID NOs: 12, 13, 22, and 23 are the primer set for the rpoB gene. Furthermore, in the primer set (C4) below, the primers of SEQ ID NOs: 10, 11, 20, 21, and 29 are the primer set for the tuf gene, and the primers of SEQ ID NOs: 12, 13, 22, 23, 30, and 31 are the primer set for the rpoB gene. (C3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 11; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 20; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 21; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 22; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 23; A primer set including (C4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 11; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 20; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 21; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 29; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 22; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 23; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 30; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 31; A primer set including
[0063] [Table 3]
[0064] [Table 4]
[0065] The primer set (D1) includes, for example, the primer set (D2) below. (D2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer set including
[0066] The primer set (D1) is preferably the primer set (D3) or (D4) below. The primer set (D3) or (D4) below is a primer set that can be used, for example, in the LAMP method. The primer set (D3) or (D4) below, when combined with the LAMP method, enables the 16s rRNA gene to be detected more quickly, for example, in about 15 minutes. (D3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 24; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 25; A primer set including (D4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 24; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 25; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 32; A primer set including
[0067] [Table 5]
[0068] The nucleic acid amplification reaction is, for example, a DNA amplification reaction that uses DNA as a template to amplify a region containing a repetitive sequence in the gene. Examples of the DNA amplification reaction include the polymerase chain reaction (PCR), loop-mediated isothermal amplification (LAMP), isothermal chimeric primer nucleic acid amplification (ICAN), strand displacement amplification (SDA), recombinase polymerase amplification (RPA), and helicase-dependent amplification (HDA). The LAMP method is preferred because it can amplify the target gene more rapidly.
[0069] The reaction conditions for the nucleic acid amplification reaction (for example, temperature, time, and number of cycles) can be appropriately set depending on, for example, the type of nucleic acid amplification reaction, the type of DNA polymerase described below, the primers and the detection probe, and the like.
[0070] The nucleic acid amplification reagent is a reagent capable of amplifying nucleic acid in the sample, and includes, in addition to the primer set, for example, a DNA polymerase, a substrate, a buffer solution, etc. The nucleic acid amplification reagent includes one or more types of reagents.
[0071] The DNA polymerase can be selected depending on the nucleic acid amplification method. For example, a thermostable polymerase can be used as the DNA polymerase, and specific examples include Taq, Tbr, Tfl, Tru, Tth, TTx, Tli, Tac, Tne, Tma, Tih, Tfi, Pfu, Pwo, Kod, Bst, GBD, Sac, Sso, Poc, Pab, Mth, Pho, Pfu, ES4, VENT (trademark), DEEPVENT (trademark), and mutants thereof. The DNA polymerase may also be, for example, a hot-start DNA polymerase.
[0072] The substrate may be, for example, a deoxynucleoside triphosphate or a mixture thereof, such as deoxycytidine triphosphate (dCTP), deoxyguanosine triphosphate (dGTP), deoxyadenosine triphosphate (dATP), deoxythymidine triphosphate (dTTP), deoxyuridine triphosphate (dUTP), a derivative thereof, or a mixture of two or more thereof. Examples of the mixture include a mixture of dCTP, dGTP, dATP, and dTTP, a mixture of dCTP, dGTP, dATP, and dUTP, or a mixture of dCTP, dGTP, dATP, dTTP, and dUTP.
[0073] Examples of the buffer solution include Tris buffer, Tris-EDTA (TE) buffer, Bis-Tris-Tricine buffer, Bis-Tricine buffer, phosphate buffer, HEPES buffer, Mops buffer, Tes buffer, Taps buffer, Pipes buffer, Caps buffer, and MES buffer.
[0074] The nucleic acid amplification reagent may contain, for example, other components. The other components include, for example, manganese ions (Mn 2+ ), cobalt ions (Co 2+ ), magnesium ions (Mg 2+); salts such as chlorides such as lithium chloride, sodium chloride, potassium chloride, magnesium chloride, manganese chloride, acetates such as lithium acetate, sodium acetate, potassium acetate, magnesium acetate, manganese acetate, sulfates such as potassium sulfate, magnesium sulfate, manganese sulfate; anionic surfactants such as sodium dodecyl sulfate, sodium cholate, sodium deoxycholate, cationic surfactants such as cetyltrimethylammonium bromide; octylphenol ethoxylate, polyoxyethylene lauryl ether, polyoxyethylene oleyl ether, polyoxyethylene stearyl ether, polyoxyethylene sorbitan monolaurate, Triton (registered trademark)-X-100, Triton (registered trademark)-X-102, Triton (registered trademark)-X-114, Triton (registered trademark) Examples of suitable surfactants include nonionic surfactants such as Triton®-X-165, Triton®-X-45, Triton®-X-305, Triton®-X-405, NP40, Brij-35, Brij-58, n-octyl-β-d-glucoside, Tween® 20, Tween® 40, Tween® 60, Tween® 65, and Tween® 80; surfactants such as zwitterionic surfactants such as 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; organic solvents such as methanol, ethanol, isopropanol, acetonitrile, and dimethyl sulfoxide; and molecular chaperones such as α-cyclodextrin, β-cyclodextrin, or γ-cyclodextrin and derivatives thereof, and cycloamylose.
[0075] Next, in the detection step, the target gene is detected based on the nucleic acid amplification (target detection step). Amplification of the target gene may be performed, for example, by detecting an amplified fragment of the amplified target gene after the amplification step. Examples of methods for detecting the amplified fragment include fluorescence detection, electrophoresis using a gel such as agarose gel or acrylamide gel, nucleic acid chromatography, quencher-mediated fluorescence detection, Southern blotting, and Northern blotting. Detection of the amplified fragment may also be detection of the nucleotide sequence of the amplified fragment. Detection of the nucleotide sequence of the amplified fragment can be performed, for example, by short-read sequencing such as Sanger sequencing, sequence-by-synthesis (SBS) sequencing, and pyrosequencing; long-read sequencing such as single-molecule real-time (SMRT) sequencing and nanopore sequencing; and the like. The primer set may include a label, for example, depending on the detection method.
[0076] The target detection step may be carried out in parallel with the amplification step, i.e., the target detection step may be carried out in real time during the amplification step. In this case, the target detection step may be carried out by a fluorescent detection method using an intercalative fluorescent dye or a fluorescently labeled probe, etc.
[0077] The fluorescent intercalating dye is, for example, a dye that binds to double-stranded DNA synthesized by the nucleic acid amplification and emits fluorescence when irradiated with excitation light. When the fluorescent intercalating dye is used, the amount of amplified fragments produced can be measured by measuring the intensity of the fluorescence in the detection step.
[0078] Examples of the fluorescently labeled probe include TaqMan (registered trademark) probes, MolecularBeacons, and cycling probes. The TaqMan probe is an oligonucleotide modified with a fluorescent dye at the 5' end and a quencher substance at the 3' end. Examples of the fluorescent dye include FAM, ROX, Cy5, and Alexa dyes. Examples of the quencher include TAMRA (registered trademark) and Non-Fluorescent Quencher (NFQ).
[0079] Thus, in the target detection step, the presence or absence of each target gene in the sample can be detected by detecting, for example, the presence or absence of an amplified fragment derived from the target gene or the presence or absence of nucleic acid amplification.
[0080] In the detection step, for example, the presence of drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria including Pseudomonas aeruginosa may be evaluated based on the criteria in Table 6 below (evaluation step).
[0081] [Table 6]
[0082] Furthermore, when the tuf gene and rpoB gene of Staphylococcus bacteria are detected as the target genes of (3) in the detection step, the presence of drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria may be evaluated in the evaluation step, for example, based on the criteria in Table 7 below. When the tuf gene and rpoB gene of Staphylococcus bacteria are detected as the target genes of (3), the detection method of the present disclosure enables, for example, more detailed classification of Staphylococcus bacteria. In Table 7 below, other bacteria refers to bacteria that are not classified into any of MRS, MRCNS, MRSA, MRSA, MSCNS, MSSA, and Pseudomonas bacteria, including Pseudomonas aeruginosa. The other bacteria include, for example, S. 缓慢葡萄球菌 , S. 沃氏葡萄球菌 , S.腐生葡萄球菌 Examples include:
[0083] [Table 7]
[0084] According to the detection method of the present disclosure, drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria including Pseudomonas aeruginosa can be rapidly detected.
[0085] <Providing method> In another aspect, the present disclosure provides a method for providing an index for selecting an antibacterial agent against bacteria. The method for providing an index for selecting an antibacterial agent against bacteria of the present disclosure includes a step of nucleic acid amplifying the target genes (1) to (3) and (4) below for a target sample and presenting candidate antibacterial agents against the bacteria contained in the sample (presentation step). (1) mecA gene (2) The spa gene of Staphylococcus aureus (3) tuf gene and / or rpoB gene of Staphylococcus aureus (4) 16S rRNA gene of Pseudomonas aeruginosa
[0086] According to the method provided by the present disclosure, the target genes (1) to (3) and (4) can be nucleic acid amplified to rapidly evaluate the bacteria contained in the sample of the subject, and based on this, candidate antibacterial drugs tailored to the bacteria present in the sample of the subject can be rapidly presented. According to the present disclosure, identification of the causative bacteria of an infection in a subject and selection of an antibacterial drug based on the identification, which conventionally required several days, can now be evaluated in a few hours, and in particular, by combining it with the LAMP method, candidate antibacterial drugs for the causative bacteria of an infection in a subject can be presented in about 15 minutes.
[0087] In the presentation step, the target genes (1) to (3) and (4) below are nucleic acid amplified for a target sample, and candidate antibacterial drugs for bacteria contained in the sample are presented. Specifically, in the presentation step, for example, first, the target genes (1) to (3) and (4) for the target sample are nucleic acid amplified (amplification step), and the target genes are detected based on the nucleic acid amplification (target detection step). The amplification step and the target detection step can be performed in the same manner as the amplification step and the target detection step in the detection method of the present disclosure.
[0088] Next, in the presentation step, the candidate antibacterial drug is presented based on the detection result of the target gene (candidate drug presentation step). For example, in the candidate drug presentation step, the candidate antibacterial drug is presented based on the detection result of the target gene in the following order: First, in the candidate drug presentation step, it is evaluated whether the mecA gene and the 16s rRNA gene are detected. Then, if the mecA gene is detected, the candidate drug presentation step presents, for example, an anti-MRSA drug as the candidate antibacterial drug, assuming that the target sample contains drug-resistant bacteria such as methicillin-resistant bacteria. Furthermore, if the 16s rRNA gene of Pseudomonas bacteria, including Pseudomonas aeruginosa, is detected, the candidate drug presentation step presents the anti-Pseudomonas aeruginosa drug as the candidate antibacterial drug, assuming that the target sample contains Pseudomonas bacteria, including Pseudomonas aeruginosa. On the other hand, if neither the mecA gene nor the 16s rRNA gene is detected, the candidate drug presentation step evaluates whether the tuf gene, the spa gene, and the rpoB gene are detected without presenting the candidate antibacterial drug. If the tuf gene, the spa gene, or the rpoB gene is detected, the candidate drug presentation step presents, for example, the broad-spectrum antibacterial drug as the candidate antibacterial drug, assuming that the target sample contains the Staphylococcus bacteria.
[0089] In the candidate drug presentation step, the candidate antibacterial drugs may be presented based on, for example, the combination of the target genes. In this case, in the candidate drug presentation step, the candidate antibacterial drugs are presented based on, for example, the criteria in Table 8 below.
[0090] [Table 8]
[0091] The detection method of the present disclosure allows for rapid evaluation of the bacteria contained in the subject's sample, and based on this, allows for rapid presentation of candidate antibacterial drugs tailored to the bacteria present in the subject's sample.
[0092] <Primer set> In another aspect, the present disclosure provides a primer set capable of detecting drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria. The primer set for use in detecting drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria of the present disclosure includes a primer set capable of nucleic acid amplification of the following target genes (1) to (3) and (4). (1) mecA gene (2) The spa gene of Staphylococcus aureus (3) tuf gene and / or rpoB gene of Staphylococcus aureus (4) 16S rRNA gene of Pseudomonas bacteria
[0093] The primer set of the present disclosure can amplify the nucleic acids of the target genes (1) to (3) and (4) described above, thereby enabling detection of drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria including Pseudomonas aeruginosa in the sample. The primer set of the present disclosure can identify the causative bacteria of an infection in a subject and suggest candidate antibacterial drugs in a few hours, whereas conventionally it took several days. It is also possible to evaluate the causative bacteria of an infection in a subject and suggest candidate antibacterial drugs in about 15 minutes.
[0094] In the primer set of the present disclosure, the primer set is preferably a primer set capable of amplifying nucleic acids in the following regions (1) to (3) and / or (4): (1) a region in the mecA gene containing the nucleotide sequence of SEQ ID NO: 1 (2) a region in the spa gene containing the base sequence of SEQ ID NO: 2 (3) a region in the tuf gene containing the nucleotide sequence of SEQ ID NO: 3 and / or a region in the rpoB gene containing the nucleotide sequence of SEQ ID NO: 4 (4) A region containing the base sequence of SEQ ID NO: 5 in the 16S rRNA gene
[0095] Examples of primer sets capable of amplifying nucleic acids in the regions (1) to (3) and / or (4) include the primer sets (A1) to (C1) and / or (D1), respectively.
[0096] An example of the primer set (A1) is the primer set (A2). The primer set (A1) is preferably the primer set (A3) or (A4). The primer set (A3) or (A4) is a primer set that can be used, for example, in the LAMP method. The primer set (A3) or (A4) enables the mecA gene to be detected more quickly, for example, in about 15 minutes, by the LAMP method.
[0097] An example of the primer set (B1) is the primer set (B2). The primer set (B1) is preferably the primer set (B3) or (B4). The primer set (B3) or (B4) is a primer set that can be used, for example, in the LAMP method. The primer set (B3) or (B4) enables the spa gene to be detected more quickly, for example, in about 15 minutes, by the LAMP method.
[0098] An example of the primer set (C1) is the primer set (C2). The primer set (C1) is preferably the primer set (C3) or (C4). The primer set (C3) or (C4) is, for example, a primer set that can be used in the LAMP method. The primer set (C3) or (C4) enables the tuf gene and / or the rpoB gene to be detected more quickly, for example, in about 15 minutes, by the LAMP method.
[0099] An example of the primer set (D1) is the primer set (D2). The primer set (D1) is preferably the primer set (D3) or (D4). The primer set (D3) or (D4) is, for example, a primer set that can be used in the LAMP method. The primer set (D3) or (D4) can detect the 16s rRNA gene more quickly, for example, in about 15 minutes, when combined with the LAMP method.
[0100] The primer sets of the present disclosure, particularly the primer sets (A3) to (D3) and the primer sets (A4) to (D4), can be suitably used for nucleic acid amplification by the LAMP method, for example.
[0101] The primer set of the present disclosure can be used to carry out the detection method of the present disclosure.
[0102] <Detection kits and reagents> In another aspect, the present disclosure provides a detection kit or detection reagent capable of detecting drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas aeruginosa. The detection kit or test reagent of the present disclosure includes the primer set of the present disclosure and a nucleic acid amplification reagent.
[0103] According to the detection kit or detection reagent of the present disclosure, the primer set can amplify the nucleic acids of the target genes (1) to (3) and (4), thereby enabling detection of drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas aeruginosa in the sample. The detection kit or detection reagent of the present disclosure can identify the causative bacteria of an infection in a subject and suggest candidate antibacterial drugs in just a few hours, which previously required several days. In particular, by combining it with the LAMP method, it is possible to evaluate the causative bacteria of an infection in a subject and suggest candidate antibacterial drugs in about 15 minutes.
[0104] In the detection kit of the present disclosure, each reagent may be in a solid form such as powder or granules, or in a liquid form such as a slurry (suspension), jelly, or solution.
[0105] In the detection kit of the present disclosure, the primer set and the nucleic acid amplification reagent may be contained, for example, as separate components, or may be contained partially or entirely in a mixed or unmixed state. In the detection kit of the present disclosure, when all the reagents are contained in a single container in a mixed or unmixed state, the detection kit of the present disclosure can also be referred to as, for example, a detection reagent.
[0106] The detection kit of the present disclosure may include, for example, instructions or instructions.
[0107] The detection kit of the present disclosure can be suitably used as a test kit, test kit, or research kit for detecting, for example, drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas aeruginosa. [Example]
[0108] The present disclosure will be described in detail below using examples, but the present invention is not limited to the embodiments described in the examples. Unless otherwise specified, commercially available reagents and kits were used according to the attached protocols. In the following description, "mol / l" may also be abbreviated as "M."
[0109] [Example 1] It was confirmed that each primer could be used to detect clinical isolates and standard strains of bacteria.
[0110] (1) Preparation of bacteria A total of 65 types of bacteria were used, including clinical isolates and standard strains. The clinical isolates were 40 positive strains submitted to the bacteriology laboratory as infectious disease specimens from the Department of Orthopedic Surgery at Kansai Medical University General Medical Center between April 1, 2017, and March 31, 2022. The standard strains used were a total of 25 ATCC and NCIMB strains. Bacteria were cultured using a fully automated blood culture system (bioMérieux Japan). The culture period was up to 7 days. The clinical isolates were confirmed positive in blood culture bottles and then inoculated onto agar plates. The agar plates were composed of 5% sheep blood trypticase soy agar (Becton Dickinson Japan) for aerobic bacteria and Brucella HK medium (Kyokuto Pharmaceutical Co., Ltd.) for anaerobic bacteria. The agar plates were evaluated for aerobic bacteria after 1 day, and for anaerobic bacteria after 4 days. Clinically isolated strains were subjected to bacterial identification and susceptibility testing using the VITEK 2 blue system (bioMérieux) and the broth microdilution method cited in the guidelines of the Clinical Laboratory Standards Institute (Reference 1). The results of the identified bacteria are shown in Table 9 below. References: 1Cockerill III FR, Wikler MA, Alder J, Dudley MN, Eliopoulos GM, Ferraro MJ, et al. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically: approved standard. Wayne, Pennsylvania, USA: Clinical and Laboratory Standards Institute; 2012.
[0111] [Table 9]
[0112] Table 9 shows the identified bacteria: 5 strains of MSSA, 15 strains of MRSA, 6 strains of MRCNS, 15 strains of MSCNS, 4 strains of the genus Psudomonas, and 20 strains of other bacteria.
[0113] (2) DNA extraction Bacteria were cultured on 5% sheep blood trypticase soy agar medium (Becton Dickinson Japan, Tokyo). One colony was then cultured in 1.5 ml of 0.5 McFarland solution. The resulting solution was heated at 99°C for 10 minutes in a heat block (Dry Bath Incubator Model: G100, Hangzhou Yooning Instrument Co., Ltd.). The solution was then centrifuged (13,000 rpm, 3 minutes), and the supernatant was collected as a DNA extract.
[0114] (3) Preparation of LAMP reaction solution When detecting gene amplification using Genelyzer FIII (Cannon Medical Systems), the primer preparation solutions shown in Tables 10 to 12 below were used. Each primer was adjusted to 100 pmol / μl. Primer preparation solutions for the mecA gene and the rpoB gene were prepared as shown in Table 10 below. Primer preparation solutions for the tuf gene and the spa gene were prepared as shown in Table 11 below. Primer preparation solutions for the 16s rRNA gene were prepared as shown in Table 12 above. 5.0 μl of each primer preparation solution was added to 5.0 μl of the DNA extract to prepare a LAMP reaction solution. Next, 15.0 μl of Optigene Isothemal Mastermix LAMP reaction enzyme solution was added to perform a nucleic acid amplification reaction.
[0115] [Table 10]
[0116] [Table 11]
[0117] [Table 12]
[0118] When detecting gene amplification using RD-200 (Sysmex Corporation), the primer preparation solutions shown in Tables 13 and 14 below were used. Each primer was adjusted to 100 pmol / μL. Primer preparation solutions for the mecA gene and the rpoB gene were prepared as shown in Table 14 below. Primer preparation solutions for the tuf gene, the spa gene, and the 16s rRNA gene were prepared as shown in Table 15 below. 20.0 μl of each primer preparation solution was added to 2.0 μl of the DNA extract to prepare a LAMP reaction solution. Next, 3 μl of Linoamp CK19 enzyme solution (Sysmex Corporation) was added, and a nucleic acid amplification reaction was carried out using RD200.
[0119] [Table 13]
[0120] [Table 14]
[0121] (4) Reaction by LAMP method Measurements were performed using Genelyzer FIII or RD-200. The reaction conditions were: Amplification at 65°C for 20 minutes, Annealing at 95°C-70°C at 0.05°C / second.
[0122] (5) Detection of nucleic acid amplification using mecA gene primers Nucleic acid amplification was performed on MRSA15 strain and MRCNS6 strain by the LAMP method using the mecA gene primer set ((A4) primer set, primers containing polynucleotides consisting of SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:26, and SEQ ID NO:27). The detection times of amplified fragments in the nucleic acid amplification are shown in Figure 1.
[0123] Figure 1 is a graph showing the distribution of detection times when nucleic acid amplification was performed using a primer set for the mecA gene for MRSA and MRCNS. In Figure 1, the horizontal axis indicates the type of sample, and the vertical axis indicates the time (minutes) until detection of the amplified fragment. As shown in Figure 1, the median detection times for MRSA and MRCNS were 8.00 minutes and 7.88 minutes, respectively. Furthermore, nucleic acid amplification was detected in all methicillin-resistant Staphylococcus aureus strains using the primer set for the mecA gene. In other words, it was found that the primer set for the mecA gene can detect Staphylococcus aureus strains carrying the methicillin resistance gene (mecA gene).
[0124] (6) Detection of Staphylococcal chromosomal cassette mec (SCCmec) type Nucleic acid amplification by the LAMP method was carried out on the 27 MRSA SCCmec Panel strains listed in Table 16 below. Nucleic acid amplification by the LAMP method was carried out in the same manner as in Example 1 (1) to (4) above, except that the bacteria listed in Table 15 below were used instead of the bacteria listed in Table 9 above. Nucleic acid amplification was carried out using Genelyzer FIII and RD-200. The results of the detection time of the amplified fragments in the nucleic acid amplification are shown in Figures 2 and 3.
[0125] [Table 15]
[0126] Figures 2 and 3 are graphs showing the distribution of detection times when nucleic acid amplification was performed using the mecA primer set, as detected by Genelyzer FIII or RD-200, respectively. In Figures 2 and 3, the horizontal axis represents MRSA SCCmec types 1, 2, 3, 4, 5, 6, 9, 10, 11, and 13, respectively, from left to right, and the vertical axis represents the time (minutes) until detection of the amplified fragment. As shown in Figure 2, for SCCmec types 1 to 5, the median detection times were 7.88 minutes, 8.25 minutes, 8.13 minutes, 8.50 minutes, and 9.50 minutes, respectively. For SCCmec types 6, 9, 10, 11, and 13, the detection times were 11.00 minutes, 10.00 minutes, 8.25 minutes, 11.50 minutes, and 9.25 minutes, respectively. As shown in Figure 3, the median detection times for SCC-mec Types 1 to 5 were 10.64, 10.35, 10.13, 10.29, and 11.05 minutes, respectively. Furthermore, the detection times for SCC-mec Types 6, 9, 10, 11, and 13 were 11.43, 10.68, 10.35, 12.12, and 10.55 minutes, respectively. Nucleic acid amplification was detected using the mecA gene primer set in all SCC-mec Type methicillin-resistant Staphylococcus aureus strains. This means that the mecA gene primer set can comprehensively detect all S. aureus strains carrying the SCC-mec Type methicillin resistance gene among MRSA bacteria currently available from the drug-resistant bacteria bank.
[0127] (7) Detection of nucleic acid amplification using a primer set for the spa gene Nucleic acid amplification was performed by the LAMP method for 15 MRSA strains and 5 MSSA strains using the spa gene primer set (B4 primer set, primers containing polynucleotides consisting of SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 18, SEQ ID NO: 19, and SEQ ID NO: 28). Nucleic acid amplification was performed using Genelyzer FIII. The detection times of amplified fragments in the nucleic acid amplification are shown in Figure 4.
[0128] Figure 4 is a graph showing the distribution of detection times when nucleic acid amplification was performed using a primer set for the spa gene for MSSA and MRSA. In Figure 4, the horizontal axis indicates the type of sample, and the vertical axis indicates the time (minutes) until detection of the amplified fragment. As shown in Figure 4, the median detection times for MSSA and MRSA were 5.75 minutes and 5.77 minutes, respectively. Nucleic acid amplification was detected for all Staphylococcus aureus strains using the primer set for the spa gene. Furthermore, nucleic acid amplification was not detected for Staphylococcus bacteria other than Staphylococcus aureus using the primer set for the spa gene. In other words, it was found that the primer set for the spa gene is a Staphylococcus aureus-specific primer.
[0129] (8) Detection of nucleic acid amplification using primers for the tuf gene Nucleic acid amplification was performed by the LAMP method for MSSA5 strain, MRSA15 strain, MRCNS5 strain, and MSCNS12 strain using the tuf gene primer set (primer set (C4), primers containing polynucleotides consisting of the nucleotide sequences of SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 29). Nucleic acid amplification was performed using Genelyzer FIII. The results of the detection time of the amplified fragments in the nucleic acid amplification are shown in Figure 5.
[0130] Figure 5 is a graph showing the distribution of detection times when nucleic acid amplification was performed using a primer set for the tuf gene in MSSA, MRSA, MRCNS, and MSCNS. In Figure 5, the horizontal axis indicates the type of sample, and the vertical axis indicates the time (minutes) until detection of the amplified fragment. As shown in Figure 5, the median detection times for MSSA and MSCNS were 8.00 minutes and 7.25 minutes, respectively. The median detection times for MRSA and MRCNS were 8.00 minutes and 10.05 minutes, respectively. Nucleic acid amplification was detected in Staphylococcus aureus using a primer set for the tuf gene. This indicates that Staphylococcus aureus can be detected using a primer set for the tuf gene.
[0131] (9) Detection of nucleic acid amplification using a primer set for the rpoB gene Nucleic acid amplification of the CNS9 strain was performed by the LAMP method using the primer set for the rpoB gene (primer set (C4), primers containing polynucleotides consisting of the nucleotide sequences of SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 30, and SEQ ID NO: 31). Nucleic acid amplification was performed using an RD200. The detection times for the amplified fragments in the nucleic acid amplification are shown in Figure 6.
[0132] Figure 6 is a graph showing the distribution of detection times when nucleic acid amplification was performed using a primer set for the rpoB gene in CNS. In Figure 6, the horizontal axis indicates the type of sample, and the vertical axis indicates the time (minutes) until the amplified fragment was detected. As shown in Figure 6, the median detection time in CNS was 8.50 minutes. In addition, among CNS, S. 表皮葡萄球菌 , S. 头葡萄球菌 , S. 沃氏葡萄球菌 , S. 溶血葡萄球菌 and S. 人葡萄球菌 These results indicate that the primer set for the rpoB gene can specifically detect these staphylococci.
[0133] (10) Detection of nucleic acid amplification using a primer set for the 16s RNA gene For the detection of three of the four Pseudomonas strains, nucleic acid amplification was performed by the LAMP method using the primer set for the 16s RNA gene ((D4) primer set, primers containing polynucleotides consisting of the nucleotide sequences of SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 32). Nucleic acid amplification was performed using Genelyzer FIII. The results of the detection times for the amplified fragments in the nucleic acid amplification are shown in Figure 7.
[0134] Figure 7 is a graph showing the distribution of detection times when nucleic acid amplification was performed using a primer set for the 16s RNA gene in the genus Pseudomonas. In Figure 7, the horizontal axis indicates the type of sample, and the vertical axis indicates the time (minutes) until the amplified fragment was detected. As shown in Figure 7, the median detection time was 6.75 minutes. In the genus Pseudomonas, the primer set for the 16s RNA gene was used to detect Pseudomonas aeruginosa ( 假单胞菌属 铜绿假单胞菌 ), 假单胞菌属 恶臭假单胞菌 Nucleic acid amplification was detected. P. 产氮假单胞菌 (G) (ATCC 17386 0524P) was not detected, and no other bacteria were detected. It was found that the Pseudomonas genus, including Pseudomonas aeruginosa, which is common in clinical settings, can be detected. In other words, the 16s RNA gene primer set can detect the Pseudomonas genus, including Pseudomonas aeruginosa, which is a clinical problem.
[0135] [Example 2] Each primer was confirmed to be able to detect clinically isolated bacteria.
[0136] The same procedures as in Example 1 (1) to (4) were carried out for clinically isolated strains, except that clinically isolated bacteria were used instead of the bacteria in Table 9. The 100 bacterial strains consisted of 30 MSSA strains, 40 MRSA strains, and 30 Pseudomonas strains. Ten negative control samples were also used. Detection of amplified fragments derived from each gene was carried out using RD200.
[0137] (1) Detection of nucleic acid amplification using a primer set for the mecA gene Nucleic acid amplification was performed on 40 MRSA strains by the LAMP method using the mecA gene primer set ((A4) primer set, primers containing polynucleotides consisting of SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 26, and SEQ ID NO: 27). The detection times of the amplified fragments in the nucleic acid amplification, measured by RD200, are shown in Figure 8.
[0138] Figure 8 is a graph showing the distribution of detection times when nucleic acid amplification was performed using a primer set for the mecA gene for MRSA. In Figure 8, the horizontal axis indicates the type of sample, and the vertical axis indicates the time (minutes) until the amplified fragment was detected. As shown in Figure 8, the median detection time for MRSA was 11.93 minutes. Nucleic acid amplification was not detected for MSSA. In other words, it was found that the primer set for the mecA gene can detect Staphylococcus aureus carrying the methicillin resistance gene (mecA gene).
[0139] (2) Detection of nucleic acid amplification using a primer set for the spa gene Nucleic acid amplification was performed by the LAMP method for 40 MRSA strains and 30 MSSA strains using the spa gene primer set ((B4) primer set, primers containing polynucleotides consisting of SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 18, SEQ ID NO: 19, and SEQ ID NO: 28). Nucleic acid amplification was performed using an RD200. The results of the detection time of the amplified fragments in the nucleic acid amplification are shown in Figure 9.
[0140] Figure 9 is a graph showing the distribution of detection times when nucleic acid amplification was performed using a primer set for the spa gene in MRSA and MSSA. In Figure 9, the horizontal axis indicates the type of sample, and the vertical axis indicates the time (minutes) until detection of the amplified fragment by RD200. As shown in Figure 9, the median detection times for MRSA and MSSA were 10.20 minutes and 9.61 minutes, respectively. Nucleic acid amplification using the primer set for the spa gene was detected in all strains of Staphylococcus aureus. Furthermore, nucleic acid amplification could not be detected in staphylococci using the primer set for the spa gene. In other words, it was found that the primer set for the spa gene is a primer specific to Staphylococcus aureus.
[0141] (3) Detection of nucleic acid amplification using a primer set for the 16s RNA gene Nucleic acid amplification was performed by the LAMP method for MRSA, MSSA, and 30 strains of the genus Pseudomonas using the primer set for the 16s RNA gene ((D4) primer set, primers containing polynucleotides consisting of the nucleotide sequences of SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 24, SEQ ID NO: 25, and SEQ ID NO: 32). The detection times of the amplified fragments in the nucleic acid amplification measured by RD200 are shown in Figure 10.
[0142] Figure 10 is a graph showing the distribution of detection times when nucleic acid amplification was performed using a primer set for the 16s RNA gene for MRSA, MSSA, and the genus Pseudomonas. In Figure 10, the horizontal axis indicates the type of sample, and the vertical axis indicates the time (minutes) until the amplified fragment was detected by RD200. As shown in Figure 10, the median detection time for the genus Pseudomonas was 9.65 minutes. Furthermore, nucleic acid amplification was not detected for MRSA and MSSA. In other words, it was found that the primer set for the 16s RNA gene detects the genus Pseudomonas, including Pseudomonas aeruginosa, but does not react with Staphylococcus aureus.
[0143] Although the present disclosure has been described above with reference to the embodiments and examples, the present disclosure is not limited to the above-described embodiments and examples. Various modifications that can be understood by those skilled in the art can be made to the configuration and details of the present disclosure within the scope of the present disclosure.
[0144] <Additional Notes> Some or all of the above-described embodiments and examples can be described as, but are not limited to, the following supplementary notes. <Detection method> (Appendix 1) A method for detecting drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria, comprising the steps of nucleic acid amplifying the following target genes (1) to (3) and (4) in a target sample, and detecting drug-resistant bacteria, Staphylococcus bacteria, Pseudomonas aeruginosa, and Pseudomonas bacteria in the sample: (1) mecA gene; (2) the spa gene of Staphylococcus aureus; (3) the tuf and / or rpoB genes of Staphylococcus bacteria; (4) 16S rRNA gene of Pseudomonas bacteria. (Appendix 2) The detection method according to Appendix 1, wherein the nucleic acid amplification is carried out in the following regions (1) to (3) and / or (4): (1) a region in the mecA gene comprising the nucleotide sequence of SEQ ID NO: 1; (2) a region in the spa gene comprising the nucleotide sequence of SEQ ID NO: 2; (3) a region in the tuf gene comprising the nucleotide sequence of SEQ ID NO: 3 and / or a region in the rpoB gene comprising the nucleotide sequence of SEQ ID NO: 4; (4) A region in the 16S rRNA gene comprising the base sequence of SEQ ID NO: 5. (Appendix 3) The detection method according to Appendix 1 or 2, wherein the nucleic acid amplification of the target gene is carried out using the following primer set (A1) to (C1) and / or (D1): (A1) a primer set capable of amplifying a region containing the nucleotide sequence of SEQ ID NO: 1 in the mecA gene; (B1) a primer set capable of amplifying a region containing the nucleotide sequence of SEQ ID NO: 2 in the spa gene; (C1) a primer set capable of amplifying a region in the tuf gene comprising the nucleotide sequence of SEQ ID NO: 3 and / or a region in the rpoB gene comprising the nucleotide sequence of SEQ ID NO: 4; (D1) A primer set capable of amplifying a region containing the nucleotide sequence of SEQ ID NO: 5 in the 16S rRNA gene. (Appendix 4) The detection method according to any one of Appendices 1 to 3, wherein the nucleic acid amplification of the target gene is carried out using the following primer sets (A2) to (C2) and / or (D2): (A2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 7; A primer set comprising: (B2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; A primer set comprising: (C2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 11; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; A primer set comprising: (D2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer set comprising: (Appendix 5) The detection method according to any one of Appendices 1 to 4, wherein the nucleic acid amplification of the target gene is carried out using the following primer sets (A3) to (C3) and / or (D3): (A3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 7; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 16; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 17; A primer set comprising: (B3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 18; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 19; A primer set comprising: (C3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 11; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 20; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 21; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 22; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 23; A primer set comprising: (D3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 24; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 25; A primer set comprising: (Appendix 6) The detection method according to any one of Appendices 1 to 5, wherein the nucleic acid amplification of the target gene is carried out using the following primer sets (A4) to (E4) and / or (F4): (A4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 7; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 16; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 17; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 26; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 27; A primer set comprising: (B4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 18; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 19; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 28; A primer set comprising: (C4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 11; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 20; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 21; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 29; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 22; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 23; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 30; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 31; A primer set comprising: (D4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 24; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 25; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 32; A primer set comprising: (Appendix 7) The detecting step a step of nucleic acid amplifying the target genes (1) to (3) and (4) in the subject sample to detect the target genes; A detection method according to any one of appendix 1 to 6, comprising a step of evaluating the presence of drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria based on the criteria in Table 6. (Appendix 8) the target genes of (3) are the tuf gene and the rpoB gene of Staphylococcus; A detection method according to any one of appendices 1 to 7, comprising a step of evaluating the presence of drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria including Pseudomonas aeruginosa based on the criteria in Table 7. (Appendix 9) 9. The detection method according to any one of appendix 1 to 8, wherein the nucleic acid amplification is nucleic acid amplification by the LAMP method. <Method of providing indicators for selecting antibacterial agents against bacteria> (Appendix 10) A method for providing an index for selecting an antibacterial agent against bacteria, comprising the steps of nucleic acid amplifying the following target genes (1) to (3) and (4) for a target sample and presenting candidate antibacterial agents against the bacteria contained in the sample: (1) mecA gene; (2) the spa gene of Staphylococcus aureus; (3) the tuf gene and / or rpoB gene of Staphylococcus aureus; (4) 16S rRNA gene of Pseudomonas bacteria. (Appendix 11) 11. The method of claim 10, comprising presenting the candidate antibacterial agent based on the criteria of Table 8. (Appendix 12) The method according to claim 10 or 11, wherein the nucleic acid amplification is carried out in the following regions (1) to (3) and / or (4): (1) a region in the mecA gene comprising the nucleotide sequence of SEQ ID NO: 1; (2) a region in the spa gene comprising the nucleotide sequence of SEQ ID NO: 2; (3) a region in the tuf gene comprising the nucleotide sequence of SEQ ID NO: 3 and / or a region in the rpoB gene comprising the nucleotide sequence of SEQ ID NO: 4; (4) A region in the 16S rRNA gene comprising the base sequence of SEQ ID NO: 5. (Appendix 13) The detection method according to any one of Appendices 10 to 12, wherein the nucleic acid amplification of the target gene is carried out using the following primer set (A1) to (C1) and / or (D1): (A1) a primer set capable of amplifying a region containing the nucleotide sequence of SEQ ID NO: 1 in the mecA gene; (B1) a primer set capable of amplifying a region containing the nucleotide sequence of SEQ ID NO: 2 in the spa gene; (C1) a primer set capable of amplifying a region in the tuf gene comprising the nucleotide sequence of SEQ ID NO: 3 and / or a region in the rpoB gene comprising the nucleotide sequence of SEQ ID NO: 4; (D1) A primer set capable of amplifying a region containing the nucleotide sequence of SEQ ID NO: 5 in the 16S rRNA gene. (Appendix 14) The method according to any one of Appendices 10 to 13, wherein the nucleic acid amplification of the target gene is carried out using the following primer sets (A2) to (C2) and / or (D2): (A2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 7; A primer set comprising: (B2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; A primer set comprising: (C2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 11; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; A primer set comprising: (D2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer set comprising: (Appendix 15) The method according to any one of Appendices 10 to 14, wherein the nucleic acid amplification of the target gene is carried out using the following primer sets (A3) to (C3) and / or (D3): (A3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 7; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 16; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 17; A primer set comprising: (B3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 18; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 19; A primer set comprising: (C3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 11; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 20; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 21; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 22; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 23; A primer set comprising: (D3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 24; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 25; A primer set comprising: (Appendix 16) The method according to any one of Appendices 10 to 15, wherein the nucleic acid amplification of the target gene is carried out using the following primer sets (A4) to (C4) and / or (D4): (A4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 7; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 16; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 17; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 26; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 27; A primer set comprising: (B4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 18; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 19; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 28; A primer set comprising: (C4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 11; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 20; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 21; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 29; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 22; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 23; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 30; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 31; A primer set comprising: (D4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 24; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 25; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 32; A primer set comprising: <Primer set> (Appendix 17) A primer set for use in detecting drug-resistant bacteria, Staphylococcus aureus, and Pseudomonas aeruginosa, comprising a primer set capable of amplifying nucleic acids of the following target genes (1) to (3) and (4): (1) mecA gene; (2) the spa gene of Staphylococcus aureus; (3) the tuf gene and / or rpoB gene of Staphylococcus aureus; (4) 16S rRNA gene of Pseudomonas bacteria. (Appendix 18) The primer set according to Appendix 17, wherein the primer set is a primer set capable of amplifying nucleic acids in the following regions (1) to (3) and / or (4): (1) a region in the mecA gene comprising the nucleotide sequence of SEQ ID NO: 1; (2) a region in the spa gene comprising the nucleotide sequence of SEQ ID NO: 2; (3) a region in the tuf gene comprising the nucleotide sequence of SEQ ID NO: 3 and / or a region in the rpoB gene comprising the nucleotide sequence of SEQ ID NO: 4; (4) A region in the 16S rRNA gene comprising the base sequence of SEQ ID NO: 5. (Appendix 19) The detection method according to appendix 17 or 18, wherein the target gene is nucleic acid-amplified using the primer set (A1) to (C1) and / or (D1) below: (A1) a primer set capable of amplifying a region containing the nucleotide sequence of SEQ ID NO: 1 in the mecA gene; (B1) a primer set capable of amplifying a region containing the nucleotide sequence of SEQ ID NO: 2 in the spa gene; (C1) a primer set capable of amplifying a region in the tuf gene comprising the nucleotide sequence of SEQ ID NO: 3 and / or a region in the rpoB gene comprising the nucleotide sequence of SEQ ID NO: 4; (D1) A primer set capable of amplifying a region containing the nucleotide sequence of SEQ ID NO: 5 in the 16S rRNA gene. (Appendix 20) A primer set according to any one of Appendices 17 to 19, comprising the following primer sets (A2) to (C2) and / or (D2): (A2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 7; A primer set comprising: (B2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; A primer set comprising: (C2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 11; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; A primer set comprising: (D2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer set comprising: (Appendix 21) In the nucleic acid amplification, the primer set according to any one of Appendices 17 to 20 includes the following (A3) to (C3) and / or (D3): (A3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 7; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 16; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 17; A primer set comprising: (B3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 18; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 19; A primer set comprising: (C3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 11; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 20; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 21; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 22; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 23; A primer set comprising: (D3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 24; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 25; A primer set comprising: (Appendix 22) In the nucleic acid amplification, the primer set according to any one of Appendices 17 to 21 includes the following (A4) to (C4) and / or (D4): (A4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 7; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 16; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 17; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 26; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 27; A primer set comprising: (B4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 18; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 19; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 28; A primer set comprising: (C4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 11; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 20; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 21; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 29; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 22; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 23; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 30; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 31; A primer set comprising: (D4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 24; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 25; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 32; A primer set comprising: (Appendix 23) A primer set according to any one of Appendices 17 to 22, for use in the LAMP method. (Appendix 24) A primer set according to any one of Appendices 17 to 23, for use in a detection method according to any one of Appendices 1 to 9. <Detection kit> (Appendix 25) A kit for detecting drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria, comprising the primer set according to any one of Appendices 17 to 24 and a nucleic acid amplification reagent. (Appendix 26) A detection kit according to Appendix 25 for use in the detection method according to any one of Appendixes 1 to 9. [Industrial Applicability]
[0145] As described above, according to the present disclosure, drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria can be rapidly detected in a sample. Therefore, the present disclosure is extremely useful, for example, in the field of testing.
Claims
1. A method for detecting drug-resistant bacteria, bacteria of the genus Staphylococcus, and bacteria of the genus Pseudomonas, comprising the steps of nucleic acid amplifying target genes (1) to (3) and (4) below in a subject sample, and detecting drug-resistant bacteria, bacteria of the genus Staphylococcus, and bacteria of the genus Pseudomonas in the sample: (1) mecA gene; (2) the spa gene of Staphylococcus aureus; (3) the tuf gene and / or rpoB gene of Staphylococcus; (4) 16S rRNA gene of Pseudomonas bacteria.
2. The detection method according to claim 1, wherein the nucleic acid amplification is performed on the following regions (1) to (3) and / or (4): (1) a region in the mecA gene comprising the nucleotide sequence of SEQ ID NO: 1; (2) a region in the spa gene comprising the nucleotide sequence of SEQ ID NO: 2; (3) a region in the tuf gene comprising the nucleotide sequence of SEQ ID NO: 3 and / or a region in the rpoB gene comprising the nucleotide sequence of SEQ ID NO: 4; (4) A region containing the base sequence of SEQ ID NO: 5 in the 16S rRNA gene.
3. 3. The detection method according to claim 1, wherein the nucleic acid amplification of the target gene is performed using a primer set of the following primers (A1) to (C1) and / or (D1): (A1) a primer set capable of amplifying a region containing the nucleotide sequence of SEQ ID NO: 1 in the mecA gene; (B1) a primer set capable of amplifying a region containing the nucleotide sequence of SEQ ID NO: 2 in the spa gene; (C1) a primer set capable of amplifying a region in the tuf gene comprising the nucleotide sequence of SEQ ID NO: 3 and / or a region in the rpoB gene comprising the nucleotide sequence of SEQ ID NO: 4; (D1) A primer set capable of amplifying a region containing the base sequence of SEQ ID NO: 5 in the 16S rRNA gene.
4. The detection method according to claim 1 or 2, wherein the nucleic acid amplification of the target gene is performed using the following primer sets (A2) to (C2) and / or (D2): (A2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 7; a primer set comprising: (B2) Primer set: A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; a primer set comprising: (C2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 11; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; a primer set comprising: (D2) Primer set: A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer set comprising:
5. The detection method according to claim 1 or 2, wherein the nucleic acid amplification of the target gene is performed using the following primer set (A3) to (C3) and / or (D3): (A3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 7; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 16; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 17; a primer set comprising: (B3) Primer set: A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 18; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 19; a primer set comprising: (C3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 11; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 20; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 21; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 22; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 23; a primer set comprising: (D3) Primer set: A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 24; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 25; A primer set comprising:
6. The detection method according to claim 1 or 2, wherein the nucleic acid amplification of the target gene is performed using the following primer set (A4) to (E4) and / or (F4): (A4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 7; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 16; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 17; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 26; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 27; a primer set comprising: (B4) Primer set: A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 18; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 19; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 28; a primer set comprising: (C4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 11; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 20; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 21; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 29; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 22; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 23; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 30; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 31; a primer set comprising: (D4) Primer set: A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 24; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 25; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 32; A primer set comprising:
7. The detection step includes a step of nucleic acid amplifying the target genes (1) to (3) and (4) in the subject sample and detecting the target genes; The detection method according to claim 1 or 2, comprising a step of evaluating the presence of drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria based on the criteria in Table 6 below. Table 6
8. The target genes of (3) are the tuf gene and rpoB gene of Staphylococcus bacteria, 3. The detection method according to claim 1 or 2, comprising a step of evaluating the presence of drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria including Pseudomonas aeruginosa based on the criteria in Table 7 below. Table 7
9. 3. The detection method according to claim 1, wherein the nucleic acid amplification is carried out by a LAMP method.
10. A method for providing an index for selecting an antibacterial agent against bacteria, comprising the steps of nucleic acid amplifying the following target genes (1) to (3) and (4) for a target sample and presenting candidate antibacterial agents against the bacteria contained in the sample: (1) mecA gene; (2) the spa gene of Staphylococcus aureus; (3) the tuf gene and / or rpoB gene of Staphylococcus; (4) 16S rRNA gene of Pseudomonas bacteria.
11. The method of claim 10, comprising the step of presenting the candidate antibacterial agent based on the criteria in Table 8 below. Table 8
12. The method according to claim 10 or 11, wherein the nucleic acid amplification is performed on the following regions (1) to (3) and / or (4): (1) a region in the mecA gene comprising the nucleotide sequence of SEQ ID NO: 1; (2) a region in the spa gene comprising the nucleotide sequence of SEQ ID NO: 2; (3) a region in the tuf gene comprising the nucleotide sequence of SEQ ID NO: 3 and / or a region in the rpoB gene comprising the nucleotide sequence of SEQ ID NO: 4; (4) A region containing the base sequence of SEQ ID NO: 5 in the 16S rRNA gene.
13. The detection method according to claim 10 or 11, wherein the nucleic acid amplification of the target gene is carried out using the following primer set (A1) to (C1) and / or (D1): (A1) a primer set capable of amplifying a region containing the nucleotide sequence of SEQ ID NO: 1 in the mecA gene; (B1) a primer set capable of amplifying a region containing the nucleotide sequence of SEQ ID NO: 2 in the spa gene; (C1) a primer set capable of amplifying a region in the tuf gene comprising the nucleotide sequence of SEQ ID NO: 3 and / or a region in the rpoB gene comprising the nucleotide sequence of SEQ ID NO: 4; (D1) A primer set capable of amplifying a region containing the base sequence of SEQ ID NO: 5 in the 16S rRNA gene.
14. The method according to claim 10 or 11, wherein the nucleic acid amplification is performed by amplifying the target gene using the following primer sets (A2) to (C2) and / or (D2): (A2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 7; a primer set comprising: (B2) Primer set: A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; a primer set comprising: (C2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 11; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; a primer set comprising: (D2) Primer set: A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer set comprising:
15. The method according to claim 10 or 11, wherein the nucleic acid amplification is performed by amplifying the target gene using the following primer sets (A3) to (C3) and / or (D3): (A3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 7; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 16; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 17; a primer set comprising: (B3) Primer set: A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 18; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 19; a primer set comprising: (C3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 11; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 20; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 21; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 22; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 23; a primer set comprising: (D3) Primer set: A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 24; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 25; A primer set comprising:
16. The method according to claim 10 or 11, wherein the nucleic acid amplification is performed by amplifying the target gene using the following primer sets (A4) to (C4) and / or (D4): (A4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 7; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 16; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 17; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 26; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 27; a primer set comprising: (B4) Primer set: A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 18; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 19; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 28; a primer set comprising: (C4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 11; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 20; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 21; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 29; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 22; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 23; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 30; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 31; a primer set comprising: (D4) Primer set: A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 24; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 25; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 32; A primer set comprising:
17. A primer set for use in detecting drug-resistant bacteria, Staphylococcus aeruginosa, and Pseudomonas aeruginosa, comprising a primer set capable of nucleic acid amplification of the following target genes (1) to (3) and (4): (1) mecA gene; (2) the spa gene of Staphylococcus aureus; (3) the tuf gene and / or rpoB gene of Staphylococcus; (4) 16S rRNA gene of Pseudomonas bacteria.
18. The primer set according to claim 17, wherein the primer set is a primer set capable of amplifying nucleic acids in the following regions (1) to (3) and / or (4): (1) a region in the mecA gene comprising the nucleotide sequence of SEQ ID NO: 1; (2) a region in the spa gene comprising the nucleotide sequence of SEQ ID NO: 2; (3) a region in the tuf gene comprising the nucleotide sequence of SEQ ID NO: 3 and / or a region in the rpoB gene comprising the nucleotide sequence of SEQ ID NO: 4; (4) A region containing the base sequence of SEQ ID NO: 5 in the 16S rRNA gene.
19. The detection method according to claim 17 or 18, wherein the primer set is any one of the following primer sets (A1) to (C1) and / or (D1) for nucleic acid amplification of the target gene: (A1) a primer set capable of amplifying a region containing the nucleotide sequence of SEQ ID NO: 1 in the mecA gene; (B1) a primer set capable of amplifying a region containing the nucleotide sequence of SEQ ID NO: 2 in the spa gene; (C1) a primer set capable of amplifying a region in the tuf gene comprising the nucleotide sequence of SEQ ID NO: 3 and / or a region in the rpoB gene comprising the nucleotide sequence of SEQ ID NO: 4; (D1) A primer set capable of amplifying a region containing the base sequence of SEQ ID NO: 5 in the 16S rRNA gene.
20. The primer set according to claim 17 or 18, comprising the following primer sets (A2) to (C2) and / or (D2): (A2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 7; a primer set comprising: (B2) Primer set: A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; a primer set comprising: (C2) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 11; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; a primer set comprising: (D2) Primer set: A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer set comprising:
21. The primer set according to claim 17 or 18, which is used in the nucleic acid amplification, comprises the following (A3) to (C3) and / or (D3): (A3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 7; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 16; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 17; a primer set comprising: (B3) Primer set: A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 18; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 19; a primer set comprising: (C3) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 11; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 20; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 21; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 22; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 23; a primer set comprising: (D3) Primer set: A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 24; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 25; A primer set comprising:
22. The primer set according to claim 17 or 18, which is used in the nucleic acid amplification, comprises the following (A4) to (C4) and / or (D4): (A4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 6; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 7; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 16; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 17; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 26; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 27; a primer set comprising: (B4) Primer set: A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 8; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 9; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 18; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 19; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 28; a primer set comprising: (C4) Primer set: A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 10; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 11; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 20; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 21; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 29; and / or a primer set comprising A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 12; A primer containing a polynucleotide consisting of the base sequence of SEQ ID NO: 13; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 22; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 23; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 30; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 31; a primer set comprising: (D4) Primer set: A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 14; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 15; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 24; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 25; A primer comprising a polynucleotide consisting of the base sequence of SEQ ID NO: 32; A primer set comprising:
23. The primer set according to claim 17 or 18, for use in the LAMP method.
24. 19. The primer set according to claim 17 or 18, for use in the detection method according to claim 1 or 2.
25. A kit for detecting drug-resistant bacteria, Staphylococcus bacteria, and Pseudomonas bacteria, comprising the primer set according to claim 17 or 18 and a nucleic acid amplification reagent.
26. 26. The detection kit according to claim 25, for use in the detection method of claim 1 or 2.