Luciferase linked immunosorbent assay
A fusion protein combining camelid antibodies and optimized luciferase mutants addresses the challenges of high sample volume and cost in serological tests, enhancing sensitivity and precision for rapid diagnostic assays.
Patent Information
- Application Number
- JP2025129517
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2020-04-27
- Filing Date
- 2025-08-01
- Publication Date
- 2025-11-14
AI Technical Summary
Existing serological tests for detecting immunoglobulins require large sample volumes and are costly, necessitating improvements in sensitivity and precision while reducing sample volume and cost.
Fusion of camelid heavy chain antibody variable domains with optimized luciferase mutants, specifically nanoKAZ luciferase, to create a fusion protein that detects immunoglobulins with reduced sample volumes and enhanced sensitivity.
The fusion protein achieves improved sensitivity and dynamic range with reduced sample volume, enabling rapid diagnostic tests for infectious and allergic diseases.
Smart Images

Figure 2025169947000027 
Figure 2025169947000028 
Figure 2025169947000029
Abstract
Description
[Technical Field]
[0001] The present invention relates to a method for detecting immunoglobulins in a sample, a fusion protein for use in the method, and a mutant luciferase with improved properties that make it particularly usable in the method. [Background technology]
[0002] To test for evidence of a past or current adaptive immune response to infection in a subject, a serological assay for the infectious agent or allergen must be performed using either a rapid diagnostic test or a laboratory-based immunoassay format.
[0003] A wide range of serological tests exist on the market, for example, laboratory-based immunoassays can be enzyme immunoassays (EIA), radioimmunoassays (RIA), fluorescent immunoassays (FIA), chemiluminescent immunoassays (CLIA) or electroluminescent assays (ECL).
[0004] However, whatever protocol is used for serological testing, safety, quality and performance standards (in terms of both analytical and clinical sensitivity and specificity) must be met.
[0005] Most standard serological tests on the market for detecting and / or quantifying immunoglobulins indicative of past or current infection are highly sensitive but require relatively large amounts of plasma (which can be problematic when testing young children) and are limited by their cost and the need for specific equipment to analyze the test results. Therefore, further developments are needed to significantly reduce the sample volume and cost required, while at the same time improving the sensitivity of serological tests without sacrificing the robustness, reproducibility, and precision of the assay. [Prior art documents] [Patent documents]
[0006] [Patent Document 1] International Publication No. 2018 / 197727 [License 2] International Publication No. 2012 / 061530 [License 3] International Publication No. 2014 / 087010 [License 4] U.S. Patent No. 10,259,886 [Non-licensed literature]
[0007] [Non-licensed Document 1] Shimomura O, Masugi T, Johnson FH, Haneda Y., Properties and reaction mechanism of the bioluminescence system of the deep-sea shrimp Oplophorus gracilirostris, Biochemistry. 1978 Mar 21;17(6):994~8 pages [Non-licensed Document 2] Inouye S, Sato J, Sahara-Miura Y, Yoshida S, Hosoya T, Luminescence enhancement of the catalytic 19 kDa protein (KAZ) of Oplophorus luciferase by three amino acid substitutions. Biochem Biophys Res Commun. 2014;445(1):157~162 pages [Non-licensed Document 3] Hall MP, Unch J, Binkowski BF, Valley MP, Butler BL, Wood MG, Otto P, Zimmerman K, Vidugiris G, Machleidt T, Robers MB, Benink HA, Eggers CT, Slater MR, Meisenheimer PL, Klaubert DH, Fan F, Encell LP, Wood KV, Engineered luciferase reporter from a deep sea shrimp utilizing a novel imidazopyrazinone substrate. ACS Chem Biol. 2012 Nov 16;7(11):1848~57 pages [Non-licensed Document 4] Coutantら、2019、2020 [Non-licensed Document 5] blast.ncbi.nlm.nih.gov [Non-licensed Document 6] ftp.ncbi.nlm.nih.gov / pub / factsheets / HowTo_BLASTGuide.pdf [Non-licensed Document 7] Chu J, Oh Y, Sens A, Ataie N, Dana H, Macklin JJ, Laviv T, Welf ES, Dean KM, Zhang F, Kim BB, Tang CT, Hu M, Baird MA, Davidson MW, Kay MA, Fiolka R, Yasuda R, Kim DS, Ng HL, Lin MZ Nat Biotechnol. 2016 Jul;34(7):760~7 pages [Non-licensed Document 8] Hamers-Castermanら1993 Nature, pages 363, 446~448 [Non-licensed Document 9] Harmsen and De Haard 2007 Appl Microbiol Biotechnol., pages 77, 13~22 [Non-licensed Document 10] Muyldermans 2001 J Biotechnol., 74, pages 277~302 [Non-licensed Document 11] Lafayeら2009 Mol Immuno., 46, 695~704 pages [Non-licensed Document 12] Wernery 2001 J Vet Med B Infect Dis Vet Public Health., pages 48, 561~568 [Non-licensed Document 13] Thys 2010 Antiviral Res., 87, pp. 257-264 [Non-licensed Document 14] Lafayeら1995 Res Immunol., 146, 373~82 pages [Non-licensed Document 15] Erratum in: 1996, Res Immunol., 147, 61 [Non-licensed Document 16] Coutantら1999 [Non-licensed Document 17] Shaner Nc, Campbell Re, Steinbach Pa, Giepmans Bng, Palmer Ae, Tsien Ry (2004). Nature Biotechnology, 22(12), pp. 1567~1572 [Non-licensed Document 18] peanut oral immunotherapy study: safety, efficacy and discovery; ClinicalTrials.gov Identifier: NCT02103270, United States [Non-licensed Document 19] Jabs F, Plum M, Laursen NS, Jensen RK, Molgaard B, Miehe M, Trapping IgE in a closed conformation by mimicking CD23 binding prevents and disrupts FcepsilonRI interaction. Nat Commun 2018; 9:7 [Non-Patent Document 20] Hamilton RG et al. 2008 [Non-Patent Document 21] Tsai CT et al., 2018 Summary of the Invention [Means for solving the problem]
[0008] The applicant has now discovered that by fusing the variable domains of camelid heavy chain antibodies (VHHs) to luciferase derived from the catalytic domain of Oplophorus gracilirostris luciferase, it is possible to detect specific immunoglobulins with reduced sample volumes while maintaining the required specificity and sensitivity, while improving the dynamic range and shortening the assay time. The serological assays designed according to the present application may be used in rapid diagnostic tests. Thus, assays can be designed to detect and / or quantify immunoglobulins specific for any infectious disease of interest, as well as allergic or autoimmune diseases.
[0009] The subject of the present invention is therefore - an N-terminal domain comprising an antibody directed against an immunoglobulin, which is a variable domain of a camelid heavy chain antibody (VHH) or a single chain variable fragment (scFV), and - a C-terminal domain comprising a polypeptide having luciferase activity, - has the amino acid sequence of SEQ ID NO: 1, or - a C-terminal domain having at least 80% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 1 It is a fusion protein comprising:
[0010] The applicant also found that the results of this serological test were further improved when a specific mutant of NanoKAZ luciferase was used.
[0011] Thus, the present invention also provides a method for the preparation of a polypeptide having at least 80% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 1, - substitution of tyrosine (Y) with arginine (R) at position corresponding to position 18 of SEQ ID NO: 1; - substitution of leucine (L) with lysine (K) at position corresponding to position 48 of SEQ ID NO: 1; - substitution of isoleucine (I) with alanine (A) at position corresponding to position 56 of SEQ ID NO: 1; - substitution of tyrosine (Y) with phenylalanine (F) at position corresponding to position 116 of SEQ ID NO: 1; - substitution of tryptophan (W) at position corresponding to position 134 of SEQ ID NO: 1 with an amino acid selected from the group consisting of threonine (T) and glutamic acid (E); - substitution of tryptophan (W) at position corresponding to position 163 of SEQ ID NO: 1 with an amino acid selected from the group consisting of threonine (T) and glutamic acid (E); and - substitution of cysteine (C) with serine (S) at position corresponding to position 166 of SEQ ID NO: 1 The present invention relates to a luciferase comprising at least one amino acid substitution selected from the group consisting of: [Brief explanation of the drawings]
[0012] [Figure 1] Schematic representation showing anti-IgE nanobody-luciferase tandem (sdAb026-nanoKAZ) binding to the Fc portion of IgE. [Figure 2] Figure 1 shows the analysis of a dilution series in PBS of recombinant IgE, IgG1 or IgG4 raised against the house dust mite allergen Der p 2 using IgE LuLISA. RLU: relative light units. [Figure 3] 1 is a graph showing the analysis of a dilution series of recombinant human anti-ovalbumin (OVA) IgE in PBS using IgE LuLISA. [Figure 4]1 is a graph showing a comparison of sensitivity between IgE LuLISA and IgE ELISA using recombinant anti-ovalbumin (OVA) IgE. [Figure 5] Graph showing a comparison of the dynamic range and sensitivity of IgE LuLISA using recombinant OVA sIgE versus standard ImmunoCAP. [Figure 6] 1 is a graph showing a comparison of the dynamic range and sensitivity of IgE LuLISA versus standard ImmunoCAP using plasma samples from highly peanut-allergic subjects. [Figure 7] 1 is a graph showing the effect of anti-IgE nanobody-luciferase fusion protein concentration on the bioluminescent detection of IgE by LuLISA. The grey area indicates the values obtained at the sdAb026-nanoKAZ concentration used in all other experiments in this study. [Figure 8] 9 is a graph showing the detection of peanut sIgE by LuLISA using a dilution series of plasma from six peanut-allergic subjects diluted to the indicated concentrations in PBS and incubated with plate-bound peanut extract. Bioluminescent detection of peanut sIgE levels was performed by LuLISA. Arrows indicate the plasma dilutions used in FIG. 9. The gray area indicates the linear range of detection of peanut sIgE LuLISA. [Figure 9] 1 is a graph showing the measurement of sIgE to whole peanut extract using 1 μL of plasma from healthy donors and peanut-allergic subjects. [Figure 10] FIG. 1 is a graph showing the measurement of sIgE to peanut allergen Ara h 1 using 1 μL of plasma from healthy donors and peanut-allergic subjects. [Figure 11] FIG. 1 is a graph showing the measurement of sIgE to peanut allergen Ara h 2 using 1 μL of plasma from healthy donors and peanut-allergic subjects. [Figure 12] 1 is a graph showing a comparison between LuLISA and ImmunoCAP for peanut sIgE in allergic patients. [Figure 13]1 is a graph showing a comparison between LuLISA and ImmunoCAP for Ara h 1 sIgE in allergic patients. [Figure 14] 1 is a graph showing a comparison between LuLISA and ImmunoCAP for Ara h 2 sIgE in allergic patients. [Figure 15] Figure 1 shows IgE LuLISA for strips (A), correlation between IgE LuLISA for strips and ImmunoCAP (B), correlation between IgE LuLISA for strips and plates (C). [Figure 16] Whisker plot of LuLISA for IgG specific for the N protein of SARS-CoV2 (minimum and maximum values of whiskers; boxes: second and third quartiles separated by the median). [Figure 17] Whisker plot of LuLISA for IgG specific to the S protein of SARS-CoV2. [Figure 18] Graph showing correlation between titrations of SARS-CoV2 N protein-specific IgG versus SARS-CoV2 S protein-specific IgG in sera from APHP-Cochin (n=20) and EFS (n=4). [Figure 19] Graph showing correlation between titrations of SARS-CoV1 N protein-specific IgG versus SARS-CoV2 N protein-specific IgG in sera from APHP-Cochin (n=20) and EFS (n=4). [Figure 20] Graph showing correlation between titrations of SARS-CoV1 S protein-specific IgG versus SARS-CoV2 S protein-specific IgG in sera from APHP-Cochin (n=20) and EFS (n=4). [Figure 21] Graph showing correlation between SARS-CoV2 N protein-specific IgG titrations for rapid (5 min) versus conventional (120 min) tests. Mean values are duplicates. [Figure 22] FIG. 1 is a schematic representation of three embodiments of the method of the invention (immobilization of antigen on a support by adsorption, covalent binding, non-covalent binding). DETAILED DESCRIPTION OF THE INVENTION
[0013] Luciferase mutants "Luciferase," as used herein, refers to a type of oxidase enzyme that produces bioluminescence, which is the emission of light produced by a biochemical reaction involving the oxidation of a substrate by an enzyme.
[0014] Luciferases include those commonly found in lower organisms, such as bacteria, fungi, insects, dinoflagellates, radiolaria, cnidarians, crustaceans, jellyfish, and cephalopods. Among these various luciferases, Oplophorus luciferase from the deep-sea shrimp Oplophorus gracilirostris has promising properties (Shimomura O, Masugi T, Johnson FH, Haneda Y. Properties and reaction mechanism of the bioluminescence system of the deep-sea shrimp Oplophorus gracilirostris, Biochemistry. 1978 Mar 21;17(6):994-8). However, the 19-kDa luciferase subunit (KAZ) of this heterodimeric structure lacks many of the desirable characteristics of the native enzyme due to instability and poor expression in the absence of the regulatory subunit. Using the natural substrate coelenterazine, activity was increased sevenfold by three amino acid substitutions in the KAZ sequence: V44I, A54I, and Y138I (eKAZ) (Inouye S, Sato J, Sahara-Miura Y, Yoshida S, Hosoya T. Luminescence enhancement of the catalytic 19 kDa protein (KAZ) of Oplophorus luciferase by three amino acid substitutions. Biochem Biophys Res Commun. 2014;445(1):157-162).
[0015] The folding of the enzyme is optimized by mutating hydrophobic amino acids with hydrophilic residues on the protein surface: A4E, F68D, L72Q, M75K, P115E and / or N166R.
[0016] Hall et al. then engineered a luciferase derived from the 19 kDa subunit of luciferase from Oplophorus. These have improved stability and are termed nanoLuc, NLuc, and nanoKAZ, and contain the following mutations: A4E, Q11R, Q18L, L27V, A33N, K43R, V44I, A54I, F68D, L72Q, M75K, I90V, P115E, Q124K, Y138I, and N166R (Hall MP, Unch J, Binkowski BF, Valley MP, Butler BL, Wood MG, Otto P, Zimmerman K, Vidugiris G, Machleidt T, Robers MB, Benink HA, Eggers CT, Slater MR, Meisenheimer PL, Klaubert DH, Fan F, Encell LP, Wood KV, Engineered luciferase reporter from a deep-sea shrimp utilizing a novel imidazopyrazinone substrate. ACS Chem Biol. 2012 Nov 16;7(11):1848~57).
[0017] However, the properties of nanoKAZ luciferase still need to be improved.
[0018] Here, the applicant has found that specific mutants of nanoKAZ have improved solubility and / or catalytic activity and / or photon emission per mole of catalytic substrate, in particular compared to nanoKAZ using newly patented substrates (WO 2018 / 197727; Coutant et al., 2019, 2020).
[0019] Thus, the present invention provides a method for the preparation of a polypeptide having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 1, - substitution of tyrosine (Y) with arginine (R) at position corresponding to position 18 of SEQ ID NO: 1; - substitution of leucine (L) with lysine (K) at position corresponding to position 48 of SEQ ID NO: 1; - substitution of isoleucine (I) with alanine (A) at position corresponding to position 56 of SEQ ID NO: 1; - substitution of tyrosine (Y) with phenylalanine (F) at position corresponding to position 116 of SEQ ID NO: 1; - substitution of tryptophan (W) at position corresponding to position 134 of SEQ ID NO: 1 with an amino acid selected from the group consisting of threonine (T) and glutamic acid (E); - substitution of tryptophan (W) at position corresponding to position 163 of SEQ ID NO: 1 with an amino acid selected from the group consisting of threonine (T) and glutamic acid (E); and - substitution of cysteine (C) with serine (S) at position corresponding to position 166 of SEQ ID NO: 1 The present invention relates to a luciferase comprising at least one amino acid substitution selected from the group consisting of:
[0020] For purposes of comparing two closely related polynucleotide or polypeptide sequences, the "% identity" between a first sequence and a second sequence can be calculated using standard settings by an alignment program, such as BLAST® (available at blast.ncbi.nlm.nih.gov, last accessed March 9, 2015). % identity is calculated by dividing the number of identical residues by the number of residues in the reference sequence and multiplying by 100. The % identity numerical values described above and in the claims are percentages calculated by this method. An alternative definition of % identity is calculated by dividing the number of identical residues by the number of aligned residues and multiplying by 100. An alternative method includes the use of the gap method, where gaps in the alignment, e.g., deletions in one sequence relative to the other, constitute a gap score or gap cost in the scoring parameters. For more information, see the BLAST® fact sheet available at ftp.ncbi.nlm.nih.gov / pub / factsheets / HowTo_BLASTGuide.pdf, last accessed March 9, 2015.
[0021] Luciferase is - substitution of tyrosine (Y) with arginine (R) at position corresponding to position 18 of SEQ ID NO: 1; - substitution of leucine (L) with lysine (K) at position corresponding to position 48 of SEQ ID NO: 1; - substitution of isoleucine (I) with alanine (A) at position corresponding to position 56 of SEQ ID NO: 1; - substitution of tyrosine (Y) with phenylalanine (F) at position corresponding to position 116 of SEQ ID NO: 1; - substitution of tryptophan (W) at position corresponding to position 134 of SEQ ID NO: 1 with an amino acid selected from the group consisting of threonine (T) and glutamic acid (E); - substitution of tryptophan (W) at position corresponding to position 163 of SEQ ID NO: 1 with an amino acid selected from the group consisting of threonine (T) and glutamic acid (E); and - substitution of cysteine (C) with serine (S) at position corresponding to position 166 of SEQ ID NO: 1 or at least 1, 2, 3, 4, 5, 6 or 7 amino acid substitutions selected from the group consisting of:
[0022] In one embodiment, the tryptophan (W) at position 134 of SEQ ID NO: 1 is substituted with a threonine (T). In an alternative embodiment, the tryptophan (W) at position 134 of SEQ ID NO: 1 is substituted with a glutamic acid (E).
[0023] In one embodiment, the tryptophan (W) at position 163 of SEQ ID NO: 1 is substituted with a threonine (T). In an alternative embodiment, the tryptophan (W) at position 163 of SEQ ID NO: 1 is substituted with a glutamic acid (E).
[0024] In one embodiment, the tyrosine (Y) at position corresponding to position 116 of SEQ ID NO: 1 is replaced with a phenylalanine (F).
[0025] In one embodiment, the tryptophan (W) at position corresponding to position 134 of SEQ ID NO: 1 is replaced with a threonine (T).
[0026] In one embodiment, the tryptophan (W) at position corresponding to position 163 of SEQ ID NO: 1 is replaced with a threonine (T).
[0027] In one embodiment, the isoleucine (I) at position corresponding to position 56 of SEQ ID NO: 1 is replaced with an alanine (A).
[0028] In one embodiment, the tyrosine (Y) at position 116 of SEQ ID NO: 1 is replaced with a phenylalanine (F), and the tryptophan (W) at position 134 of SEQ ID NO: 1 is replaced with a threonine (T).
[0029] In one embodiment, the tyrosine (Y) at position 116 of SEQ ID NO: 1 is substituted with a phenylalanine (F), and the cysteine (C) at position 166 of SEQ ID NO: 1 is substituted with a serine (S).
[0030] In one embodiment, a tyrosine (Y) at position 18 of SEQ ID NO: 1 is substituted with an arginine (R), a leucine (L) at position 48 of SEQ ID NO: 1 is substituted with a lysine (K), a tryptophan (W) at position 134 of SEQ ID NO: 1 is substituted with a glutamic acid (E), and a tryptophan (W) at position 163 of SEQ ID NO: 1 is substituted with a glutamic acid (E).
[0031] In one embodiment, the tyrosine (Y) at position 18 of SEQ ID NO: 1 is substituted with arginine (R), the leucine (L) at position 48 of SEQ ID NO: 1 is substituted with lysine (K), the tryptophan (W) at position 134 of SEQ ID NO: 1 is substituted with glutamic acid (E), the tryptophan (W) at position 163 of SEQ ID NO: 1 is substituted with glutamic acid (E), and the cysteine (C) at position 166 of SEQ ID NO: 1 is substituted with serine (S).
[0032] In one embodiment, the tyrosine (Y) at position 18 of SEQ ID NO:1 is substituted with arginine (R), the leucine (L) at position 48 of SEQ ID NO:1 is substituted with lysine (K), the tyrosine (Y) at position 116 of SEQ ID NO:1 is substituted with phenylalanine (F), the tryptophan (W) at position 134 of SEQ ID NO:1 is substituted with glutamic acid (E), and the tryptophan (W) at position 163 of SEQ ID NO:1 is substituted with glutamic acid (E).
[0033] In one embodiment, the tyrosine (Y) at position 18 of SEQ ID NO:1 is substituted with arginine (R), the leucine (L) at position 48 of SEQ ID NO:1 is substituted with lysine (K), the tyrosine (Y) at position 116 of SEQ ID NO:1 is substituted with phenylalanine (F), the tryptophan (W) at position 134 of SEQ ID NO:1 is substituted with glutamic acid (E), the tryptophan (W) at position 163 of SEQ ID NO:1 is substituted with glutamic acid (E), and the cysteine (C) at position 166 of SEQ ID NO:1 is substituted with serine (S).
[0034] The present invention also relates to a luciferase having an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16 and SEQ ID NO:17.
[0035] The amino acid sequences of various luciferases are disclosed in Table 1 below.
[0036] [Table 1A]
[0037] [Table 1B]
[0038] [Table 1C]
[0039] [Table 1D]
[0040] [Table 1E]
[0041] Preferably, the luciferase has the amino acid sequence of SEQ ID NO: 1 to SEQ ID NO: 11, more preferably SEQ ID NO: 2, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 or SEQ ID NO: 11. Most preferably, the luciferase has the amino acid sequence of SEQ ID NO: 8, SEQ ID NO: 11 or SEQ ID NO: 6.
[0042] The present invention also relates to a polypeptide having luciferase activity, comprising two or three amino acid sequences selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16 and SEQ ID NO:17.
[0043] Such polypeptides may have an amino acid sequence selected from the group consisting of SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44 and SEQ ID NO:45.
[0044] The present invention also relates to a polypeptide having luciferase activity, which has the amino acid sequence of SEQ ID NO:46.
[0045] [Table 2A]
[0046] [Table 2B]
[0047] [Table 2C]
[0048] The luciferase of the present invention may have one or more heterologous amino acid sequences at the N-terminus, C-terminus, or both, which optionally interact directly or indirectly with a molecule of interest. The heterologous sequence may be a tag, e.g., a tag for purification purposes, or a peptide or protein of interest. The luciferase may also be bound to an organic molecule (e.g., an organic molecule binder).
[0049] Affinity tags can be used at the C-terminus of the luciferase amino acid sequence for purposes of purification, secondary binding probes, bead binding, or solid substrate attachment. Examples of amino acid sequences for such tags are shown in Table 3 below.
[0050] [Table 3]
[0051] The peptide or protein of interest may be selected from the group consisting of, but is not limited to, a variable domain of a camelid heavy chain antibody (VHH), a single chain variable fragment (scFv), a variable region of a heavy chain (VH), an immunoglobulin (Ig), an interleukin, a cytokine, a chemokine, a receptor ectodomain, a peptide antigen, a peptide allergen, a receptor ectodomain, a viral capsid peptide fragment, a bacterial surface peptide fragment and a cell surface peptide fragment.
[0052] A linker can be inserted between the amino terminus of the peptide of interest (e.g., but not limited to, VHH, scFv, VH, Ig) or organic molecule binder and the carboxy-terminal luciferase to connect the two domains. The linker can have 0 to 10 residues.
[0053] In one embodiment, the amino-terminal and carboxy-terminal luciferase amino acid sequences of a peptide or organic molecule binder of interest may be directly joined, without the use of a linker, to join the two domains.
[0054] The amino acid sequences of the linkers are disclosed in table 4 below.
[0055] [Table 4]
[0056] If necessary or required for detection or measurement purposes, a linker may be inserted between the amino-terminal protein binder domain (including but not limited to, VHH, scFv, VH, Ig), organic molecule binder, or peptide sequence of interest and the carboxy-terminal luciferase to connect the two domains and contain a protease-specific cleavage site for the purpose of releasing the luciferase. The amino acid sequence of such a thrombin-specific cleavage linker is as follows and contains 5 to 14 residues. Thrombin cleavage sites are disclosed in Table 5 below.
[0057] [Table 5]
[0058] In particular, the present invention also relates to fusion proteins comprising the luciferase of the present invention, which can be linked to a peptide of interest.
[0059] As mentioned above, the peptide of interest may be selected from the group consisting of, but is not limited to, a camelid heavy chain antibody variable domain (VHH), a single chain variable fragment (scFv), a heavy chain variable region (VH), an immunoglobulin (Ig), an interleukin, a cytokine, a chemokine, a receptor ectodomain, a peptide antigen, a peptide allergen, a receptor ectodomain, a viral capsid peptide fragment, a bacterial surface peptide fragment and a cell surface peptide fragment.
[0060] Preferably, the luciferase or fusion protein comprising a luciferase of the invention is recombinant, meaning that the luciferase or fusion protein is the product of at least one mutation or cloning process or other procedure that results in a luciferase that is different from a luciferase found in nature, in particular a luciferase that is different from a naturally occurring Oplophorus luciferase.
[0061] The present invention also relates to polynucleotides that encode the luciferase of the present invention or fusion proteins comprising the luciferase of the present invention.
[0062] Preferably, the polynucleotides of the present invention are recombinant. As noted above, recombinant means that the polynucleotide is the product of at least one cloning, restriction or ligation step, or other procedure that results in a polynucleotide that differs from that found in nature.
[0063] The polynucleotide may further encode a polypeptide of interest that binds to luciferase, wherein the polypeptide of interest and luciferase can be expressed as a fusion protein.
[0064] Advantageously, the polynucleotide may be codon-optimized for expression of the luciferase of the invention or a fusion protein comprising this luciferase in a host cell.
[0065] The polynucleotide of interest may comprise a nucleotide sequence selected from the group consisting of SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 60, SEQ ID NO: 61, and SEQ ID NO: 62. Such nucleotide sequences for embodiments of expression-optimized polynucleotides are summarized in Table 6 below.
[0066] [Table 6A]
[0067] [Table 6B]
[0068] [Table 6C]
[0069] [Table 6D]
[0070] [Table 6E]
[0071] [Table 6F]
[0072] [Table 6G]
[0073] [Table 6H]
[0074] [Table 6I]
[0075] [Table 6J]
[0076] The present invention also relates to a vector comprising the polynucleotide of the present invention.
[0077] As used herein, vector (or plasmid) refers to a discrete element used to introduce heterologous DNA into cells for either its expression or replication. The selection and use of such vehicles are well known to those of skill in the art. Expression vectors include vectors capable of expressing DNA that is operably linked to control sequences, e.g., promoters, that are capable of affecting the expression of such DNA fragments. Thus, an expression vector refers to a recombinant DNA construct, e.g., a plasmid, phage, recombinant virus, or other vector that, upon introduction into an appropriate host cell, results in expression of cloned DNA. Suitable expression vectors are well known to those of skill in the art.
[0078] A recombinant vector is a vector that contains a recombinant polynucleotide.
[0079] Advantageously, the vector comprises a polynucleotide operably linked to a promoter.
[0080] As used herein, operably linked refers to the functional association of DNA with nucleotide control and effector sequences, such as promoters, enhancers, transcription and translation termination sites, and other signal sequences.
[0081] For example, operably linked DNA to a promoter refers to a physical and functional association between the DNA and the promoter such that transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to, and transcribes the DNA.
[0082] As used herein, a promoter refers to a segment of DNA that controls the transcription of DNA to which it is operably linked.
[0083] The polynucleotide or vector of the present invention can be present in a cell, typically a prokaryotic or eukaryotic cell. The vector can be stored in the cytoplasm, or the polynucleotide can be integrated into the genome using a lentiviral vector or genome editing (i.e., including but not limited to, CRISPR-Cas9).
[0084] Therefore, the present invention also relates to a cell comprising a polynucleotide of the invention or an expression vector of the invention.
[0085] In one embodiment, the luciferase or a fusion protein comprising this luciferase is secreted from prokaryotic or eukaryotic cells and expressed in the cytoplasm or, in the case of bacteria, in the periplasm.
[0086] In one embodiment, the luciferase or a fusion protein comprising this luciferase is synthesized in vitro using a transcription and translation kit.
[0087] The present invention also relates to a non-human transgenic animal comprising a cell or a polynucleotide or a vector of the invention.
[0088] The present invention also provides - a luciferase, a fusion protein containing this luciferase, a polynucleotide, an expression vector or a cell of the invention - Substrate for luciferase The present invention relates to a kit comprising:
[0089] Preferably, the kit comprises a luciferase or fusion protein and a substrate.
[0090] Coelenterazine is the natural substrate for shrimp Oplophorus luciferase, but an increased signal can be obtained with furimazine.
[0091] Consequently, the substrate may be selected from the group consisting of coelenterazine, furimazine or derivatives thereof.
[0092] Derivatives of furimazine and their O-acetylated moieties that are stable as pro-substrates are disclosed in patent application WO 2018 / 197727. Such furimazine derivatives generate better bioluminescent signals in terms of intensity, signal-to-noise ratio, and / or duration.
[0093] As a result, the substrate 8-benzyl-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-((5-ethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-((4,5-dimethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-6-(2-fluorophenyl)-2-(furan-2-ylmethyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-(3-methylbenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-(3-methoxybenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2,8-Dibenzyl-6-(2-fluorophenyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-6-(2,6-difluorophenyl)-2-(furan-2-ylmethyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-6-phenyl-2-((5-(trifluoromethyl)furan-2-yl)methyl)imidazo[1,2-a]pyrazin-3(7H)-one 2,8-Dibenzyl-6-(2,6-difluorophenyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-6-(2-fluorophenyl)-2-((5-methylfuran-2-yl)methyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-((5-cyclopropylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-(3-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-((5-ethylfuran-2-yl)methyl)-6-(2-fluorophenyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-6-(3-fluorophenyl)-2-((5-methylfuran-2-yl)methyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-(2-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-((5-ethylthiophen-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-((4,5-dimethylfuran-2-yl)methyl)-6-(2-fluorophenyl)imidazo[1,2-a]pyrazin-3(7H)-one 2-Benzyl-8-(2-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-Benzyl-8-(3-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-Fluorobenzyl)-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-fluorobenzyl)-2-(3-methylbenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-Fluorobenzyl)-2-(3-methoxybenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-Fluorobenzyl)-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-Fluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-fluorobenzyl)-2-(3-methoxybenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-Fluorobenzyl)-2-(3-methylbenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-((5-ethylfuran-2-yl)methyl)-8-(3-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-chlorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-Fluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-((5-ethylfuran-2-yl)methyl)-8-(2-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-Fluorobenzyl)-6-(2-fluorophenyl)-2-((5-methylfuran-2-yl)methyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-Difluorobenzyl)-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-Difluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-Benzyl-8-(2,3-difluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,6-Difluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-Difluorobenzyl)-2-((4,5-dimethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-Difluorobenzyl)-2-((5-ethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,6-Difluorobenzyl)-2-((5-ethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-((4,5-dimethylfuran-2-yl)methyl)-8-(2-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-((4,5-dimethylfuran-2-yl)methyl)-8-(3-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-Difluorobenzyl)-2-((4-ethyl-5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-difluorobenzyl)-2-((5-ethyl-4-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one and 8-Benzyl-2-(furan-2-ylmethyl)-6-(3-hydroxyphenyl)imidazo[1,2-a]pyrazin-3(7H)-one may be selected from the group consisting of:
[0094] Such substrates are disclosed in WO 2018 / 197727 under the following names: Q3, Q12, Q16, Q21, Q14, Q18, Q20, Q27, Q28, Q29, Q34, Q36, Q41, Q51, Q54, Q56, Q58, Q61, Q72, Q73, Q81, Q82, Q83, Q84, Q85, Q101, Q100, Q99, Q98, Q97, Q96, Q105, Q107, Q108, Q117, Q121, Q124, Q127, Q129, Q131, Q132, Q135, Q143 and Q149, respectively.
[0095] In a preferred embodiment, the substrate is 8-(2,3-difluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one (Q-108 disclosed in Table 1 of WO 2018 / 197727, page 129).
[0096] The present invention also provides - generating a luciferase having the amino acid sequence of SEQ ID NO: 1 or a variant thereof having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 1; - substituting tyrosine (Y) at position 18 of SEQ ID NO: 1 with arginine (R); - substituting lysine (K) for leucine (L) at position corresponding to position 48 of SEQ ID NO: 1; - substituting an alanine (A) for an isoleucine (I) at position corresponding to position 56 of SEQ ID NO: 1; - substituting tyrosine (Y) at position 116 of SEQ ID NO: 1 with phenylalanine (F); - substituting tryptophan (W) at position 134 of SEQ ID NO: 1 with an amino acid selected from the group consisting of threonine (T) and glutamic acid (E); - substituting tryptophan (W) at position 163 of SEQ ID NO: 1 with an amino acid selected from the group consisting of threonine (T) and glutamic acid (E); - replacing cysteine (C) at position 166 of SEQ ID NO: 1 with serine (S), or a combination thereof. At least one, two, three, four, five, six, or seven steps selected from the group consisting of: The present invention also relates to a method for producing the luciferase of the present invention, comprising:
[0097] The present invention also provides - introducing a vector of the invention into a cell under conditions allowing expression of luciferase, and / or - growing the cells of the invention under conditions that allow expression of luciferase The present invention also relates to a method for producing a luciferase of the present invention or a fusion protein comprising the luciferase of the present invention, comprising:
[0098] The present invention also relates to the use of a luciferase of the present invention or a fusion protein comprising a luciferase of the present invention in a light-emitting reaction, which use comprises the addition of a substrate for the luciferase.
[0099] In the present invention, (a) exposing luciferase or a fusion protein to a substrate; (b) detecting the emission of light; The present invention provides a method comprising:
[0100] Prior to exposure, the cells may be introduced with a polynucleotide according to the invention and / or express luciferase or a fusion protein.
[0101] The method may be in vitro, ex vivo or in vivo.
[0102] fusion proteins As mentioned in the Summary of the Invention, the present invention provides: - an N-terminal domain comprising the variable domain of a camelid heavy chain antibody (VHH) or a single chain variable fragment (scFV) directed against an immunoglobulin, and - a C-terminal domain comprising a polypeptide having luciferase activity, - has the amino acid sequence of SEQ ID NO: 1, or a C-terminal domain having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 1; The present invention relates to a fusion protein comprising:
[0103] In one embodiment, the fusion protein comprises: - an N-terminal domain containing a single chain variable fragment (scFV) and directed against an immunoglobulin, and - a C-terminal domain comprising a polypeptide having luciferase activity, - has the amino acid sequence of SEQ ID NO: 1, or a C-terminal domain having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 1; Includes.
[0104] A single-chain variable fragment (scFv) is a fusion protein of the variable regions of the heavy (VH) and light (VL) chains of an immunoglobulin joined to a linker.
[0105] In another embodiment, the fusion protein comprises: - an N-terminal domain directed against immunoglobulins, comprising the variable domain of a camelid heavy chain antibody (VHH), and - a C-terminal domain comprising a polypeptide having luciferase activity, - has the amino acid sequence of SEQ ID NO: 1, or a C-terminal domain having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 1; Includes.
[0106] VHHs are the variable domains of camelid heavy-chain antibodies. Indeed, in members of the Camelidae family, a significant proportion of serum antibodies are homodimeric IgGs with a molecular weight of approximately 80 kD (Hamers-Casterman et al., 1993, Nature, 363, 446-448). Such heavy-chain immunoglobulins (Ig) contain three domains, and these variable regions are called VHHs. Recombinant VHHs (approximately 12-14 kD in size) constitute intact antigen-binding domains and exhibit a broad antigen-binding repertoire. These hypervariable regions are extended and exhibit unique properties, such as the replacement of three or four hydrophobic framework residues (which interact with the VL of conventional antibodies) with more hydrophilic amino acids. To stabilize the extended CDRs, VHHs may have, in addition to the canonical disulfide bonds, an additional disulfide bond between CDR1 and CDR3 in dromedaries and between CDR2 and CDR3 in llamas (Harmsen and De Haard 2007 Appl Microbiol Biotechnol., 77, pp. 13-22; Muyldermans 2001 J Biotechnol., 74, pp. 277-302). The extended CDR3 loop can adopt a convex conformation, whereas the conventional paratope is restricted to a concave or flat conformation (Muyldermans 2001 J Biotechnol., 74, pp. 277-302). These characteristics enable VHHs to recognize unique epitopes with low immunogenicity compared to conventional antibodies (Lafaye et al. 2009 Mol Immuno. 46, 695-704; Wernery 2001 J Vet Med B Infect Dis Vet Public Health. 48, 561-568). Although VHHs are by definition monovalent antibodies that by default exclude any avidity effects, their biological activity, measured in vitro as IC50, can be similar to that of conventional bivalent antibody molecules (Thys et al. 2010 Antiviral Res. 87, 257-264).
[0107] The VHH may be selected from known VHHs. Examples of known VHHs that may be used in accordance with the present invention are disclosed in table 3 below.
[0108] [Table 7]
[0109] Thus, the VHH of the fusion protein according to the invention may have an amino acid sequence selected from the group consisting of SEQ ID NO:57, SEQ ID NO:58 and SEQ ID NO:59.
[0110] VHHs for use in accordance with the present invention may also be selected from a library.
[0111] Methods such as phage display have been described for the selection of antigen-specific VHHs from VHH libraries of immunized camels or llamas. VHH genes are cloned into phage display vectors, antigen binders are obtained by panning, and the selected VHHs are expressed in bacteria. Recombinant VHHs have many advantages over conventional antibody fragments (Fab or scFv), as only one domain needs to be cloned and such VHHs are well expressed, highly soluble in aqueous environments, and stable at high temperatures.
[0112] VHHs can also be custom designed and screened from synthetic libraries derived from camelid VHH scaffolds or humanized scFv scaffolds.
[0113] For example, VHHs are (a) immunizing a camelid, preferably an alpaca (Lama pacos), with an immunoglobulin or a fragment thereof; (b) isolating peripheral lymphocytes of the immunized camelids, obtaining total RNA and synthesizing the corresponding cDNA (methods are known in the art, see e.g., Lafaye et al. 1995 Res Immunol., 146, 373-82; Erratum in: 1996, Res Immunol., 147, 61), (c) constructing a library of cDNA fragments encoding VHH domains; (d) transcribing the VHH domain-encoding cDNA obtained in step (c) into mRNA using PCR, converting the mRNA into a ribosome display format, and selecting the VHH domain by ribosome display; The compound is obtained by a method comprising the steps of:
[0114] A polynucleotide encoding a VHH and a polynucleotide encoding a polypeptide having luciferase activity can be inserted into a vector, and the polynucleotide encoding a VHH and the polynucleotide encoding a polypeptide having luciferase activity can be ligated to express the fusion protein of the present invention.
[0115] The vector can then be introduced into cells, for example by transformation of bacterial cells, to cause the cells to express the fusion protein.
[0116] The N-terminal and C-terminal domains of the fusion protein and / or the VHH and the polypeptide having luciferase activity may be linked via a linker. Preferred linkers have an amino acid sequence selected from the group consisting of GS, AAA, SEQ ID NO:24, SEQ ID NO:25 and SEQ ID NO:26.
[0117] Fusion proteins can contain one or more heterologous amino acid sequences at the N-terminus, C-terminus, or both, and in particular can contain tags for purification purposes, such as poly-histidine tags.
[0118] The present invention also relates to a polynucleotide encoding the fusion protein of the present invention, as well as a vector comprising this polynucleotide.
[0119] Preferably, the fusion proteins of the invention or the polynucleotides encoding them are recombinant.
[0120] Advantageously, the vector comprises a polynucleotide operably linked to a promoter.
[0121] Advantageously, the polynucleotide may be codon-optimized for expression of the fusion protein.
[0122] The polynucleotide or vector of the invention may be present in a cell.
[0123] Therefore, the present invention also relates to a cell comprising a polynucleotide of the invention or a vector of the invention.
[0124] The immunoglobulins generating the VHHs may be of human or non-human animal origin, preferably human.
[0125] The immunoglobulin may be IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgD, or IgE. Preferably, the immunoglobulin is IgG, IgE, IgM, or IgA. The immunoglobulin of interest depends on the purpose of the assay. For example, if the purpose of the assay is to diagnose allergies, IgE is preferred as the primary immunoglobulin, with IgG as the secondary immunoglobulin. IgM can be used to diagnose fresh blood infections. IgG can be used to diagnose old blood infections. IgA can be used to diagnose infections in blood, mucosa, or saliva.
[0126] Typically, immunoglobulins are raised against antigens.
[0127] The antigen may be selected from the group consisting of allergens, viruses, bacteria, fungi and parasites or fragments or parts thereof.
[0128] For example, the allergen may be a component of milk, especially cow's milk, soy, egg, wheat, cod, seafood, shellfish, fish, tree nuts, peanuts, D. pteronyssinus, Alternaria, cat, dog, grass or birch pollen, dust mites, anesthetics (including but not limited to curare), antibiotics (including but not limited to amoxicillin), latex, fabrics, venom (including but not limited to from wasps and bees), primarily proteins.
[0129] The virus can be, for example, Severe Acute Respiratory Syndrome Coronavirus 2 (SARS CoV2) or Severe Acute Respiratory Syndrome Coronavirus 1 (SARS CoV1). Viral fragments can include recombinantly synthesized or expressed isolated proteins from the virus, such as the spike protein (S) or nucleoprotein (N), or fragments corresponding to structural or functional domains, or fragments of any size.
[0130] The immunoglobulin may also be an autoantibody.
[0131] In a preferred embodiment, the VHH is raised against the constant fragment (Fc) of an immunoglobulin.
[0132] In one embodiment, the polypeptide having luciferase activity is a luciferase having the amino acid sequence of SEQ ID NO:1.
[0133] A polypeptide having luciferase activity may have at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% amino acid sequence identity to the amino acid sequence of SEQ ID NO:1.
[0134] In one embodiment, the polypeptide having luciferase activity is a mutant luciferase disclosed above.
[0135] Thus, a polypeptide having luciferase activity may have at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 1; - substitution of tyrosine (Y) with arginine (R) at position corresponding to position 18 of SEQ ID NO: 1; - substitution of leucine (L) with lysine (K) at position corresponding to position 48 of SEQ ID NO: 1; - substitution of isoleucine (I) with alanine (A) at position corresponding to position 56 of SEQ ID NO: 1; - substitution of tyrosine (Y) with phenylalanine (F) at position corresponding to position 116 of SEQ ID NO: 1; - substitution of tryptophan (W) at position corresponding to position 134 of SEQ ID NO: 1 with an amino acid selected from the group consisting of threonine (T) and glutamic acid (E); - substitution of tryptophan (W) at position corresponding to position 163 of SEQ ID NO: 1 with an amino acid selected from the group consisting of threonine (T) and glutamic acid (E); and - substitution of cysteine (C) with serine (S) at position corresponding to position 166 of SEQ ID NO: 1 and at least one amino acid substitution selected from the group consisting of:
[0136] The polypeptide having luciferase activity may have an amino acid sequence selected from the group consisting of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16 and SEQ ID NO:17.
[0137] The polypeptide having luciferase activity may also have an amino acid sequence selected from the group consisting of SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45 and SEQ ID NO:46.
[0138] The present invention also provides - a fusion protein of the invention, and - a substrate for a polypeptide having luciferase activity The present invention relates to a kit comprising:
[0139] As mentioned above, coelenterazine is the natural substrate for shrimp Oplophorus luciferase, but an increased signal can be obtained with furimazine.
[0140] Consequently, the substrate may be selected from the group consisting of coelenterazine, furimazine or derivatives thereof.
[0141] Derivatives of furimazine are disclosed in patent application WO 2018 / 197727. Such derivatives of furimazine generate better bioluminescent signals in terms of intensity, signal-to-noise ratio and / or duration.
[0142] As a result, the substrate 8-benzyl-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-((5-ethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-((4,5-dimethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-6-(2-fluorophenyl)-2-(furan-2-ylmethyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-(3-methylbenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-(3-methoxybenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2,8-Dibenzyl-6-(2-fluorophenyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-6-(2,6-difluorophenyl)-2-(furan-2-ylmethyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-6-phenyl-2-((5-(trifluoromethyl)furan-2-yl)methyl)imidazo[1,2-a]pyrazin-3(7H)-one 2,8-Dibenzyl-6-(2,6-difluorophenyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-6-(2-fluorophenyl)-2-((5-methylfuran-2-yl)methyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-((5-cyclopropylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-(3-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-((5-ethylfuran-2-yl)methyl)-6-(2-fluorophenyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-6-(3-fluorophenyl)-2-((5-methylfuran-2-yl)methyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-(2-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-((5-ethylthiophen-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-benzyl-2-((4,5-dimethylfuran-2-yl)methyl)-6-(2-fluorophenyl)imidazo[1,2-a]pyrazin-3(7H)-one 2-Benzyl-8-(2-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-Benzyl-8-(3-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-Fluorobenzyl)-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-fluorobenzyl)-2-(3-methylbenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-Fluorobenzyl)-2-(3-methoxybenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-Fluorobenzyl)-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-Fluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-fluorobenzyl)-2-(3-methoxybenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-Fluorobenzyl)-2-(3-methylbenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-((5-ethylfuran-2-yl)methyl)-8-(3-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2-chlorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-Fluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-((5-ethylfuran-2-yl)methyl)-8-(2-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(3-Fluorobenzyl)-6-(2-fluorophenyl)-2-((5-methylfuran-2-yl)methyl)imidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-Difluorobenzyl)-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-Difluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-Benzyl-8-(2,3-difluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,6-Difluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-Difluorobenzyl)-2-((4,5-dimethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-Difluorobenzyl)-2-((5-ethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,6-Difluorobenzyl)-2-((5-ethylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-((4,5-dimethylfuran-2-yl)methyl)-8-(2-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 2-((4,5-dimethylfuran-2-yl)methyl)-8-(3-fluorobenzyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-Difluorobenzyl)-2-((4-ethyl-5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one 8-(2,3-difluorobenzyl)-2-((5-ethyl-4-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one and 8-Benzyl-2-(furan-2-ylmethyl)-6-(3-hydroxyphenyl)imidazo[1,2-a]pyrazin-3(7H)-one may be selected from the group consisting of:
[0143] Such substrates are disclosed in WO 2018 / 197727 under the following names: Q3, Q12, Q16, Q21, Q14, Q18, Q20, Q27, Q28, Q29, Q34, Q36, Q41, Q51, Q54, Q56, Q58, Q61, Q72, Q73, Q81, Q82, Q83, Q84, Q85, Q101, Q100, Q99, Q98, Q97, Q96, Q105, Q107, Q108, Q117, Q121, Q124, Q127, Q129, Q131, Q132, Q135, Q143 and Q149, respectively.
[0144] In a preferred embodiment, the substrate is 8-(2,3-difluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one (Q-108 disclosed in Table 1 of WO 2018 / 197727, page 129).
[0145] The kit may also include reagents, controls and / or supports for the detection of luciferase activity.
[0146] Preferably, the antigen is immobilized on a support, which may be a slide, a plate, e.g., a multiwell plate, a strip, e.g., a nitrocellulose or PVDF membrane or a paper strip, a tube, a disk, a loop, a stick, a propeller, a fiber or a collection of fibers.
[0147] The present invention also relates to the use of the fusion protein of the present invention for detecting and / or quantifying immunoglobulins in a sample.
[0148] The sample may be selected from the group consisting of, for example, whole blood, serum, plasma, cerebrospinal fluid, semen, urine, nasopharyngeal smear, oropharyngeal smear, vaginal smear, stool, sweat, saliva, tracheal washings, and bronchial washings.
[0149] The present invention also provides (a) contacting a sample with a fusion protein of the present invention; (b) adding a substrate for a polypeptide having luciferase activity; (c) detecting the luminescence; The present invention relates to a method for detecting the presence of immunoglobulin in a sample, comprising:
[0150] Typically, the polypeptide having luciferase activity is the polypeptide having the luciferase activity of a fusion protein of the invention.
[0151] Since the immunoglobulin level in a sample can also be measured by an average value for emitted luminescence, the present invention provides a method for quantifying the immunoglobulin level in a sample, comprising: (a) contacting a sample with a fusion protein of the present invention; (b) adding a substrate for a polypeptide having luciferase activity; (c) quantifying the luminescence; The present invention also relates to a method, including:
[0152] Typically, the polypeptide having luciferase activity is the polypeptide having the luciferase activity of a fusion protein of the invention.
[0153] The method of the present invention may also include the step of immobilizing the antigen on a support and / or the step of providing a support on which the antigen is immobilized.
[0154] Immobilization can be achieved either by surface adsorption, chemical bonding or non-covalent interactions.
[0155] The method may include contacting the sample with an immobilized antigen.
[0156] The interaction between the fusion protein and the immunoglobulin can be verified either by dilution, heating, or addition of salts, acids, bases, or organic or inorganic buffers, or any competitor of the interaction, or by lateral flow or acoustic frequencies.
[0157] When detecting luminescence, the number of photons per second can ultimately be counted according to their wavelength.
[0158] The method may also include the step of comparing the emitted luminescence to a control.
[0159] The present invention also provides a method for quantifying immunoglobulin levels per affinity interval in a sample to assess the affinity range of a polyclonal immunoglobulin mixture, comprising: (a) contacting a sample with immobilized antigen in the presence of a dilution series of free antigen; (b) contacting the sample with a fusion protein of the invention; (c) adding a substrate for the polypeptide having luciferase activity; (d) quantifying the luminescence and plotting the light intensity against the antigen concentration; The present invention relates to a method, comprising:
[0160] Typically, the immunoglobulin level to be quantified is an immunoglobulin that generates an antibody to the fusion protein. The antigen is an antigen that generates an immunoglobulin. The polypeptide having luciferase activity is a polypeptide having luciferase activity of the fusion protein of the present invention.
[0161] The present invention is further illustrated by the following figures and examples, however, such examples and figures should not be construed as in any way limiting the scope of the present invention. [Example]
[0162] Example 1 Mutant luciferase with improved properties nanoKAZ / nanoLuc is the result of focused mutagenesis to optimize the enzyme's catalytic domain and minimum light intensity from the luciferase from Pleurotus ostreatus. However, in addition to improving the enzyme's catalytic activity, the mutations were discovered to overcome four issues: 1) enzyme inactivation by reaction products, 2) reaction inhibition by high substrate concentrations, 3) low quantum yield of the oxidation reaction, and 4) the enzyme's tendency to adsorb to material surfaces (tubes, wells, membranes, etc.).
[0163] Materials and Methods nanoKAZ (SEQ ID NO: 1) is an optimized sequence of the catalytic domain of luciferase derived from Pleurotus ostreatus (WO 2012 / 061530).
[0164] The NanoKAZ gene (SEQ ID NO: 33 [jaz526]) was synthesized by Eurofins (Germany) and contains a carboxy-terminal His6 tag and flanking regions corresponding to the pET23 sequence (Novagen). PCR-purified pET23 vector and synthetic gene were constructed using NEBuilder HiFi Assembly Master Mix (New England BioLabs) according to the Gibson method for constructing complementary fragments. Single or double mutations were introduced by PCR into SEQ ID NOs: 2 [jaz544], 3 [jaz583], 4 [jaz584], 5 [jaz560], 6 [jaz585], and 7 [jaz619]. The gene of SEQ ID NO: 40 [jaz536] was synthesized by Eurofins (Germany) and contains a carboxy-terminal His6 tag and flanking regions corresponding to the pET23 sequence (Novagen). Single and double mutations, SEQ ID NOs: 41 [jaz570], 42 [jaz572], and 43 [jaz573], were introduced by PCR. Multiple mutations were introduced by the Gibson method, which involves constructing complementary fragments of the gene carrying specific mutations, using NEBuilder HiFi Assembly Master Mix (New England Biolabs).
[0165] The gene of SEQ ID NO: 42 [JAZ621] with a duplication of SEQ ID NO: 1, SEQ ID NO: 43 [JAZ622] with a double substitution of tyrosine (Y) at position 116 by phenylalanine (F) in the duplication of SEQ ID NO: 1, SEQ ID NO: 44 [JAZ476] with a triple duplication of SEQ ID NO: 1, SEQ ID NO: 45 [JAZ620] with a triple duplication of SEQ ID NO: 1 with a triple substitution of tyrosine (Y) at position 116 by phenylalanine (F), and SEQ ID NO: 46 [Scoprii68] with a substitution of tyrosine (Y) at position 116 by phenylalanine (F) in the Antares sequence encompassing SEQ ID NO: 1 were all synthesized by Eurofins (Germany) and have a carboxy-terminal His6 tag and flanking regions corresponding to the pET23 sequence (Novagen).
[0166] The product (5 mL) was used to transform NEB 5 alpha-competent E. coli and grown overnight on LB / agar / ampicillin in a Petri dish. Isolated colonies were grown in liquid culture, plasmids were isolated, and nucleotide sequencing was performed to confirm the presence of the mutation at the correct position.
[0167] result Mutation of the tyrosine residue at position 116 with phenylalanine (SEQ ID NO: 2 [JAZ544]) increased the catalytic activity of nanoKAZ by 250% for furimazine and 1400% for Q108, relative to nanoKAZ / furimazine. Duplication (SEQ ID NO: 45) or triplicate (SEQ ID NO: 45) of the mutant catalytic domain increased catalytic activity by 2600% and 3500%, respectively. Substrate diffusion rates limited the expected increase in single-domain activity by two or threefold (1400%). We have shown that luciferase activity declines over time at a constant rate depending on the nature of the substrate (Coutant et al. 1999). Activity decline is rapid for Q80 and slower for Q103. Unfortunately, the stronger the luminescence, the faster the enzyme inactivates. A compromise exists between light intensity (flash) and lifetime (glow). We demonstrate that the decline is due to enzyme inactivation. Mutation of cysteine 166 with a serine residue (SEQ ID NO: 7 [JAZ619]) reduces the rate of inactivation.
[0168] Mutation of tryptophan 134 to threonine (SEQ ID NO: 3 [JAZ583]), near the hydrophobic back pocket, moderately reduces inhibition by high substrate concentrations. We counted one photon per 1,460 molecules of furimazine catalyzed by nanoKAZ (SEQ ID NO: 1) at room temperature, the furimazine concentration at maximum reaction rate (54 μM). Substrate selection tunes this quantum yield from ultralow to moderate. Lower substrate concentrations result in higher quantum yields, but unfortunately, photon emission decreases with lower reaction rates. Mutation of tyrosine 116 to phenylalanine (SEQ ID NO: 2 [JAZ544]) moderately increases the number of photons emitted. Mutation of tryptophans 134 (SEQ ID NO: 3 [JAZ583]) and 163 (SEQ ID NO: 4 [JAZ584]), which represent the protein surface, is most effective in improving enzyme solubility and reducing surface adsorption, which contributes to high assay noise.
[0169] The combination of mutations confers improved properties related to light intensity, lifespan, and solubility. The best compromise is chosen according to the light intensity / expected sensitivity, lifespan / experimental duration, and solubility / specific properties required for the applied experimental conditions. - SEQ ID NO: 1 [nanoKAZ, JAZ526] catalytic activity is 100% with furimazine and 250% with Q108. - SEQ ID NO: 2 [JAZ544] Substitution of tyrosine (Y) at position 116 of SEQ ID NO: 1. Catalytic activity is 200% with furimazine and 1450% with Q108 compared to SEQ ID NO: 1. - SEQ ID NO: 3 [JAZ583] Substitution of tryptophan (W) with threonine (T) at position 134 of SEQ ID NO: 1. Catalytic activity with furimazine is 100% of that of SEQ ID NO: 1. - SEQ ID NO: 4 [JAZ584] Substitution of tryptophan (W) with threonine (T) at position 163 of SEQ ID NO: 1. Catalytic activity with furimazine is 50% of that of SEQ ID NO: 1. - SEQ ID NO: 5 [JAZ560] Substitution of isoleucine (I) with alanine (A) at position 56 of SEQ ID NO: 1. Catalytic activity with furimazine is 120% of that of SEQ ID NO: 1, and with Q108 is 600%. - SEQ ID NO: 6 [JAZ585] Substitution of tyrosine (Y) at position 116 by phenylalanine (F) and tryptophan (W) at position 134 by threonine (T) of SEQ ID NO: 1. Catalytic activity is 200% with furimazine and 1400% with Q108 compared to SEQ ID NO: 1. - SEQ ID NO: 7 [JAZ619] Substitution of tyrosine (Y) at position 116 by phenylalanine (F) and cysteine (C) at position 166 by serine (S) of SEQ ID NO: 1. Catalytic activity with furimazine is 200% of that of SEQ ID NO: 1. - SEQ ID NO: 8 [JAZ536] Substitution of tyrosine (Y) at position 18 by arginine (R), leucine (L) at position 48 by lysine (K), tryptophan (W) at position 134 by glutamic acid (E) and tryptophan 163 (W) at position 163 of SEQ ID NO: 1. Catalytic activity with furimazine is 80% of that of SEQ ID NO: 1. - SEQ ID NO: 9 [JAZ570] Substitution of tyrosine (Y) at position 18 by arginine (R), leucine (L) at position 48 by lysine (K), tryptophan (W) at position 134 by glutamic acid (E), tryptophan 163 (W) at position 163 by glutamic acid (E) and cysteine (C) at position 166 by serine (S) of SEQ ID NO: 1. Catalytic activity with furimazine is 150% of that of SEQ ID NO: 1. - SEQ ID NO: 10 [JAZ572] Substitution of tyrosine (Y) at position 18 by arginine (R), leucine (L) at position 48 by lysine (K), tryptophan (W) at position 134 by glutamic acid (E), tryptophan 163 (W) at position 163 by glutamic acid (E) and tyrosine (Y) at position 116 by phenylalanine (F) of SEQ ID NO: 1. Catalytic activity with furimazine is 180% of that of SEQ ID NO: 1. - SEQ ID NO: 11 [JAZ573] Substitution of tyrosine (Y) at position 18 by arginine (R), leucine (L) at position 48 by lysine (K), tryptophan (W) at position 134 by glutamic acid (E), tryptophan (W) at position 163 by glutamic acid (E), tyrosine (Y) at position 116 by phenylalanine (F) and cysteine (C) at position 166 by serine (S) of SEQ ID NO: 1. Catalytic activity with furimazine is 150% of that of SEQ ID NO: 1.
[0170] Some sequences allow for increased signal due to duplication or triplication of catalytic domains. These are primarily used for in vitro or in vivo imaging applications requiring high light intensity for live imaging, fast kinetics, or deep tissue observation. In diagnostics, these applications in assays are not useful due to increased signal and noise. Notably, at low substrate concentrations, activity is limited by the diffusion rate of the substrate to the active site. - SEQ ID NO: 42 [JAZ621] A duplication of SEQ ID NO: 1. Catalytic activity with furimazine is 150% of that of SEQ ID NO: 1. - SEQ ID NO: 43 [JAZ622] A double substitution of tyrosine (Y) at position 116 with phenylalanine (F) in a duplication of SEQ ID NO: 1. Catalytic activity is 560% with furimazine and 2600% with Q108 compared to SEQ ID NO: 1. - SEQ ID NO: 44 [JAZ476] Triple of SEQ ID NO: 1. Catalytic activity with furimazine is 250% of that of SEQ ID NO: 1. - SEQ ID NO: 45 [JAZ620] Triple substitution of tyrosine (Y) at position 116 with phenylalanine (F) in the triplet of SEQ ID NO: 1. Catalytic activity with furimazine is 2500% of that of SEQ ID NO: 1, and with Q108 is 3500%.
[0171] Dual-color applications with a single substrate but two luciferases as reporters can be achieved by using one of the sequences SEQ ID NOS: 1-15 and Antares or Scorpii (SEQ ID NOS: 48), which emits red-shifted photons by resonant energy transfer from nanoKAZ to mOrange, derived from the Discosoma sp. red fluorescent protein (Shaner Nc, Campbell Re, Steinbach Pa, Giepmans Bng, Palmer Ae, Tsien Ry (2004). Nature Biotechnology, 22(12), pp. 1567-1572). Substitution of tyrosine (Y) at position 116 of SEQ ID NO:1 with phenylalanine (F) in the SEQ ID NO:46 [Scorpii68] Antares chimera (Chu J, Oh Y, Sens A, Ataie N, Dana H, Macklin JJ, Laviv T, Welf ES, Dean KM, Zhang F, Kim BB, Tang CT, Hu M, Baird MA, Davidson MW, Kay MA, Fiolka R, Yasuda R, Kim DS, Ng HL, Lin MZ, Nat Biotechnol. 2016 Jul;34(7):760-7). Activity is 800% at 562 nm with Q108, while nanoKAZ emits photons at 460 nm. In addition to dual-color applications with a single substrate, Scorpii used as a reporter is efficient for in vivo imaging with red-shifted light that penetrates thick tissues.
[0172] Example 2 Bioluminescence method for measuring allergen-specific IgE Materials and Methods human plasma Plasma samples from patients with peanut allergy were obtained as part of enrollment in an institutional review board-approved clinical trial of oral immunotherapy in children and adults with peanut allergy (peanut oral immunotherapy study: safety, efficacy and discovery; ClinicalTrials.gov identifier: NCT02103270, USA). Peanut allergy was defined as a response to a double-blind, placebo-controlled food challenge to peanut (with a response elicited by peanut protein ≤500 mg) and a positive skin prick test response to peanut (wheal ≥5 mm). Plasma samples from healthy donors were obtained from the French Blood Bank (Etablissement Francais du Sang, EFS).
[0173] Fusion protein anti-IgE sdAb026-nanoKAZ Design and synthesis of a plasmid (pET23-sdAb026-nanokaz) encoding an anti-IgE nanobody-luciferase fusion protein nanoKAZ is an optimized sequence of the catalytic domain of luciferase derived from Pleurotus ostreatus (WO 2012 / 061530).
[0174] The nanoKAZ gene was synthesized by Eurofins (Germany) and contains a carboxy-terminal His6 tag and flanking regions corresponding to the pET23 sequence (Novagen). The pET23 plasmid was amplified with forward and reverse oligonucleotides (Fwd: 5'CTCGAGCACCACCACCACCACCAC3' (SEQ ID NO: 47); Rvr: 5'GGTATATCTCCTTCTTAAAGTTAAAC3' (SEQ ID NO: 48), Eurofins) using Q5 DNA polymerase and dNTP mix (New England BioLabs). The PCR product was purified on an agarose gel (1%, Macherey Nagel) by electrophoresis. The purified pET23 vector and synthetic gene were assembled (pET23-nanoKAZ) using NEBuilder HiFi Assembly Master Mix (New England BioLabs).
[0175] The sIgE-binding moiety is derived from a humanized alpaca heavy-chain antibody (single-domain antibody, sdAb026) selected against sIgE (Jabs F, Plum M, Laursen NS, Jensen RK, Molgaard B, Miehe M, et al. Trapping IgE in a closed conformation by mimicking CD23 binding prevents and disrupts FcεRI interaction. Nat Commun 2018;9:7, WO 2014 / 087010). sdAb026 recognizes the constant Cε3 region of human IgE. sdAb026 has an affinity for IgE similar to that of the anti-IgE therapeutic antibody omalizumab (KD 1.4 nM vs. 2.6 nM, respectively) and has been reported to inhibit the interaction between IgE and two receptors, FcεRI and CD23.
[0176] The sdab026 gene was synthesized by Eurofins and has flanking regions corresponding to the pET23-nanoKAZ sequence. The sdab026 synthetic gene was amplified with the corresponding forward and reverse oligonucleotides (Fwd: 5'ATGGTCTTCACACTCGAAGATTTC3' (SEQ ID NO: 49); Rvr: 5'CATGGTATATCTCCTTCTTAAAGTTAAA3' (SEQ ID NO: 50); Eurofins) using Q5 DNA polymerase and dNTP mix.
[0177] The PCR product was purified on an agarose gel by electrophoresis. The purified pET23-nanoKAZ vector and sdAb026 synthetic gene were assembled using NEBuilder HiFi Assembly Master Mix (New England Biolabs).
[0178] The constructed product (5 mL) was used to transform NEB 5 alpha-competent E. coli and grown overnight on LB / agar / ampicillin in a Petri dish. Isolated colonies were grown in liquid culture, and plasmids were isolated and sequenced to confirm the presence of the sdab026-nanoKAZ insert.
[0179] The complete sequence of the anti-IgE nanobody luciferase tandem sdAb026-nanoKAZ ([nanobody anti-IgE]-[nanoKAZ]-[His6]) is shown in the table below.
[0180] [Table 8]
[0181] The predicted molecular weight (MW) of sdAb026-nanoKAZ calculated from the sequence is 34.1 kD.
[0182] Expression, purification, and validation of anti-IgE nanobody-luciferase fusion protein (sdAb026-nanoKAZ) High expression in E. coli was achieved by transforming E. coli BL21 (DE3, New England Biolabs) with pET23-sdab026-nanokaz. Cells were grown at 18°C, and IPTG (Sigma-Aldrich) was added to induce sdAb026-nanoKAZ production. Cells were harvested by centrifugation (1.5 L), and the pellet was resuspended in 50 mM Tris-HCl pH 8.0, 50 mM NaCl, supplemented with protease inhibitors (Sigma-Aldrich) and lysozyme (0.1 mg / mL, Sigma-Aldrich). Cells were disrupted by freeze-thaw cycle lysis. DNA was then removed from the sample by adding DNase I (Sigma-Aldrich).
[0183] The crude extract was centrifuged at 1250 g for 30 min. The supernatant was collected and supplemented with NaCl (500 mM), imidazole (20 mM, Sigma-Aldrich), and Triton X-100 (0.1%, Sigma-Aldrich). The clarified lysate was loaded onto an equilibrated Hi-Trap 5 mL column (GE Healthcare) at 4 mL / min using an AKTA pure chromatography system (GE Healthcare). The column was washed with 20 volumes of running buffer (50 mM Tris-HCl pH 8.0, 50 mM NaCl, 20 mM imidazole) at 5 mL / min. sdAb026-nanoKAZ was eluted with a gradient of 20 mM to 200 mM imidazole in 50 mM Tris-HCl pH 8.0, 50 mM NaCl at 5 mL / min, and 1 mL fractions were collected into a 96-deep-well plate (GE Healthcare). Catalytic activity of the fractions was profiled using a Hydex luminometer by diluting the fractions 107-fold into PBS containing 27 μM furimazine. Highly active fractions were pooled and loaded onto a 1 mL HiTrap Q column (GE Healthcare) equilibrated with 50 mM Tris-HCl pH 8.0, 50 mM NaCl. Using an AKTA pure chromatography system, the protein was eluted with 50 mM MES pH 6.5, 50 mM NaCl at 1 mL / min at 18°C. Fractions of 500 μL were collected into 96-deep well plates, and their activity was quantified as described above. Fractions with high activity were pooled. The quality of the purified protein was assessed by loading aliquots (10 μL) onto stain-free SDS gels (4-15% Mini-PROTEAN® TGX Stain-Free™ Protein Gels, Bio-Rad).
[0184] The gel was activated by UV transillumination (Bio-Gel Doc XR imaging system) for 5 minutes. Tryptophan residues were subjected to UV-induced reaction with a trihalo compound, and the fluorescent signal was imaged. UV spectra (240-300 nm) were obtained to assess the concentration of sdAb026-nanoKAZ in the absorbance solution at 280 nm. Specific activity was determined by furimazine in PBS at 23°C, approximately 10% of sdAb026-nanoKAZ. 15 The photons obtained are photons / second / mg. Optimal activity is achieved at substrate (furimazine) concentrations of 10-30 μM (plateauing at approximately 10 times the KM = 2 μM). The dipole moment of substrates exceeding 30 μM within the nanoKAZ catalytic site quenches the photon emission of the catalytic substrate at the active site. The quenching efficiency depends on the dipole moment of the substrate. Substrate catalysis stochastically inactivates nanoKAZ, and the enzyme lifetime depends on the ratio of substrate to catalytic activity. Luminescence intensity was optimized by using optimal conditions based on specific substrate kinetic parameters from a thorough enzymatic study of the catalysis of nanoKAZ and 30 of its mutants, as well as 172 different substrates.
[0185] IgE Luciferase Immunosorbent Assay (LuLISA) Protocol Flat-bottom white 96-well plates (Fluoronunc C96 Maxisorp, Nunc) were coated by adsorption with 50 μL / well of either 10 μg / mL peanut extract (F171, Greer Laboratories), 10 μg / mL Ara H1 (NA-AH1-1, Indoor Technology), 10 μg / mL Ara H2 (RP-AH2-1, Indoor Technology), 5 μg / mL ovalbumin (OVA, Sigma-Aldrich), or 1 μg / mL house dust mite DER p2 (2B12NA-DP2-1, Indoor Technology) in 50 mM NaHCO3 buffer, pH 9.5 (Sigma) for 2 hours at room temperature. Target immobilization is a key factor in the success or failure of the method, as the target must be maximally immobilized while presenting accessible allergen domains for sIgE binding. Charge interactions are favored for adsorption on Maxisorp® plates. Alternatives to adsorption are covalent attachment of targets via carboxy, amine, or sulfhydryl moieties, or glycosylation on the functionalized well surface. Wells were emptied, and the coating was saturated with 100 μg / mL bovine serum albumin (Sigma) in NaHCO3 for 1 h at room temperature. Wells were washed four times with 100 μL of 0.1% PBS / Tween 20. Recombinant anti-OVA human chimeric IgE (clone X4A4D12 / G9 / H8, gift from Arkab), anti-house dust mite p2 human chimeric IgE (clone CH1, gift from Arkab), or plasma from peanut-allergic subjects were diluted as indicated in PBS or with pools of plasma from healthy donors. Sample dilutions were incubated in the respective allergen-coated wells at 50 μL / well for 1 h at room temperature. The wells were washed four times with 100 μL of 0.1% PBS / Tween 20. Purified sdAb026-nanoKAZ (1.10 μg / mL) in PBS was added. 9 RLU.s -1 .mL -1) was added (50 μL / well) and incubated at room temperature for 30 minutes. The wells were washed four times with 100 μL of 0.1% PBS / Tween 20. At this stage, the plate can be stored in PBS until measurement. Immediately before reading, each well was emptied and 50 μL of 27 μM (approximately 10 times the KM of nanoKAZ, 2 μM) furimazine (8-benzyl-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one) was added. The plate was orbitally shaken for 5 seconds, and luminescence intensity was integrated for 1 second per well using a multiwell plate luminometer (LB960 Centro, Berthold).
[0186] For affinity spectrum analysis using the LuLISA competitive assay, mixtures were generated from 0.5 μL of serum or plasma sample at the same concentration in 50 μL by a 3:3 dilution series of free allergen from 10 μM to 0.7 pM in PBS in 16 allergen-coated wells of a 384-well plate, or a 10:10 dilution series of free allergen from 10 μM to 1 pM in 8 allergen-coated wells of a 96-well plate. Values should be appropriate for IgE affinity. Equilibrium or its nearest neighbor was reached by incubation for 1–3 h. Wells were washed four times with 100 μL of 0.1% PBS / Tween 20. Purified sdAb026-JAZ572 (1 ng / mL) is preferred over sdAb026-nanoKAZ, especially at high concentrations of free allergen, due to a stronger signal and weaker background, despite weaker IgE binding to immobilized allergen at very long incubation times. Finally, 0.1% Tween 20, 0.1 mg / mL BSA, or 0.1 mg / mL gelatin can be used to reduce background. Milk should be avoided for IgE assays in potentially allergic patients. Wells were washed four times with 100 μL of 0.1% PBS / Tween 20. Immediately before reading, each well was emptied and 50 μL of 13.5 μM hikazine-108 (8-benzyl-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one) was added. The plate was orbitally shaken for 1 second, and luminescence intensity was integrated for 0.5 seconds per well using a multiwell plate luminometer (LB960 Centro, Berthold). Bioluminescence intensity is shown as a bar graph versus target concentration.
[0187] IgE ImmunoCAP ImmunoCAP analysis was performed on shipped samples by Thermo Fisher's Phadia.
[0188] IgE ELISA Protocol Clear flat-bottom 96- or 384-well plates (Maxisorp, Nunc) were coated as described above for 2 hours at room temperature. The wells were emptied, and the coating was saturated with 50 μL of 100 μg / mL bovine serum albumin (Sigma) in PBS for 1 hour at room temperature. The wells were washed four times with 100 μL of 0.1% PBS / Tween 20 (Sigma). Recombinant anti-OVA human chimeric IgE (clone X4A4D12 / G9 / H8, kindly provided by Arkab), anti-house dust mite p2 human chimeric IgE (clone CH1, kindly provided by Arkab), or plasma from a peanut-allergic subject was diluted in PBS and incubated at 50 μL / well in the respective allergen-coated wells for 1 hour at room temperature. The wells were washed four times with 100 μL of 0.1% PBS / Tween 20. 50 μL of goat IgG anti-human IgE conjugated with diluted alkaline phosphatase (1:700 in PBS, Sigma-Aldrich) was added to each well and incubated for 1 hour at room temperature. The wells were washed four times with 100 μL of 0.1% PBS / Tween 20. All wells were emptied, and 50 μL of 1 mg / mL phosphatase substrate pNPP (4-nitrophenyl phosphate disodium salt, Sigma-Aldrich) was added per well and incubated for 3 hours at room temperature or overnight at 4°C. Absorbance was measured at 405 nm using a multiwell plate spectrophotometer (Sapphire, Tecan) and compared with LuLISA results.
[0189] statistical analysis Differences in IgE levels between plasma samples from healthy donors and peanut-allergic subjects were compared using an unpaired Mann-Whitney U test. A P value <0.05 was considered statistically significant.
[0190] Fingerstick blood sample Tests were performed on healthy volunteers and an applied project was set up in which blood samples were taken from a reduced cohort of allergic patients at Trousseau Hospital and subjected to ImmunoCAP and ELISA in parallel with the IgE LuLISA assay.
[0191] Testing was performed using a puncture device with a sterile disposable lancet, as commonly used for glucose assays for diabetic self-testing, after disinfecting the fingertip with alcohol. A fixed μL aliquot was pipetted into 50 μL of a solution of PBS, BSA (50 μg / mL), heparin (10 UI / mL), and sdAb026-nanoKAZ (1 ng) pre-dissolved in a 1000 μL single-use tip, the end of which was surrounded by a paper filter up to a polyethylene filter plug. The diluted blood was filtered through the tip end and added to a 96-well plate pre-coated with specific allergens and incubated at room temperature for 5 minutes. Wells were washed with PBS, and 100 μL of luciferase substrate (furimazine analog) was added. Bioluminescence was immediately measured within 1 second using a plate luminometer (LB960 centro, Berthold). Measurements were performed in parallel with negative and positive controls for internal calibration.
[0192] result Sensitive and specific detection of allergen-specific IgE by luciferase-linked immunosorbent assay (LuLISA) To establish proof-of-concept for the specific detection of sIgE using LuLISA, we prepared dilution series in PBS of recombinant IgE raised against the house dust mite allergen Der p 2, IgG1 (the major IgG subclass), or IgG4 (the major IgG subclass highly produced during allergen-specific immunotherapy). Three groups of samples were analyzed using IgE LuLISA.
[0193] As expected, a concentration-dependent signal occurred only for samples containing anti-Der p 2 sIgE, with a detection limit of approximately 5 × 10 -13 M sIgE (approximately 1 pg / mL; approximately 0.0004 kUA / L) (Fig. 2).
[0194] Similar experiments were performed with recombinant human anti-ovalbumin IgE. Recombinant human anti-ovalbumin (OVA) IgE was diluted in PBS at the indicated concentrations and incubated with plate-bound OVA. Bioluminescence detection of antibody levels was performed by LuLISA using anti-IgE sdAb026-nanoKAZ.
[0195] High sensitivity was also obtained with recombinant anti-ovalbumin (OVA) IgE, which was detectable by LuLISA at concentrations as low as 5 pg / mL (approximately 0.002 kUA / L) (Figures 3 and 4).
[0196] Recombinant anti-ovalbumin (OVA) IgE was diluted in PBS at the indicated concentrations. The levels of OVA sIgE in aliquots of the same diluted samples were assessed using LuLISA or ELISA. The sensitivity of LuLISA was also much higher than that of standard ELISA for the detection of sIgE (Figure 4).
[0197] The dynamic range and sensitivity of IgE LuLISA were then compared to standard ImmunoCAP using recombinant OVA sIgE diluted in pooled plasma from 30 healthy donors (Figure 5). This direct comparison revealed a significant increase (approximately 250-fold) in analytical sensitivity of LuLISA compared to ImmunoCAP (Figure 5).
[0198] A similar experiment was performed with a dilution series of plasma samples from a highly peanut-allergic subject, which was again diluted with a pool of plasma from 30 healthy donors (Fig. 6). ImmunoCAP enabled detection of peanut sIgE in plasma diluted up to 4,050-fold, whereas LuLISA detected peanut sIgE even in allergic plasma diluted 100,000- to 300,000-fold (Fig. 6).
[0199] We next investigated the effect of anti-IgE nanobody-luciferase fusion protein concentration on bioluminescent detection of IgE by LuLISA. Plasma from a peanut-allergic subject (peanut-specific IgE ImmunoCAP value: 2186 kU / L) (1 μL) was diluted in 50 μL of PBS and incubated with plate-bound peanut extract (PBS alone was used as a control). Bioluminescent detection of peanut-specific IgE levels was performed by LuLISA with the indicated concentrations of anti-IgE nanobody-luciferase tandem (sdAb026-nanoKAZ). A dilution series of the anti-IgE nanobody-luciferase fusion protein with this peanut-allergic plasma sample at a fixed (1:50) dilution generated a concentration-dependent signal, confirming the very low bioluminescent background signal of IgE LuLISA (Figure 7).
[0200] Taken together, these results indicate that IgE LuLISA has very high sensitivity and specificity and can therefore potentially be used to quantify IgE in samples from patients with very low sIgE. A major advantage of IgE LuLISA over ImmunoCAP is that it requires very small amounts of sample. In the case of the sample from the peanut-allergic patient used in Figure 6, peanut sIgE could still be detected using less than 1 nanoliter of initial patient sample. Therefore, even when patient sample size is limited, very large-scale screening of sIgE against a range of potential allergens can be envisioned using IgE LuLISA.
[0201] Further validation of this methodology was then sought by measuring sIgE to total peanut extract or the major peanut allergens, Ara h 1 and Ara h 2, using 1 μL of plasma from 31 healthy donors (obtained from the French blood bank EFS and with unknown allergic status) and 82-105 peanut-allergic subjects (collected at the time of enrollment in the Institutional Review Board-approved Peanut Oral Immunotherapy Trial: Safety, Efficacy and Discovery Study; ClinicalTrials.gov identifier: NCT02103270).
[0202] A dilution series of a titrated high peanut sIgE reference sample was used to calibrate the assay to ensure that all plasma samples analyzed within the linear range of detection by our method (Figure 8).
[0203] As expected, significantly higher levels of peanut sIgE, Ara h 1 sIgE and Ara h 2 sIgE were detected in plasma samples from peanut-allergic subjects compared to healthy donors (Figures 9, 10 and 11).
[0204] Direct comparison between LuLISA and ImmunoCAP in allergic patients showed high correlation between both methods (R for peanut sIgE, Ara h 1 sIgE, and Ara h 2 sIgE, respectively). 2 = 0.89, 0.84, and 0.83) (Figures 12, 13, and 14). These correlations were calculated using all plasma samples with sIgE levels above the ImmunoCAP detection cutoff (0.1 kUA / L). This was the case for all samples containing peanut sIgE. However, 17 of 82 samples (19.7%) for Ara h 1 sIgE and 3 of 96 samples (3.1%) for Ara h 2 sIgE were below the detection limit of ImmunoCAP (Figures 12, 13, and 14). However, all of these subjects had an unequivocal clinical response to peanut as assessed by performing a double-blind, placebo-controlled food challenge (DBPCFC) and skin prick testing (Table 4).
[0205] [Table 9]
[0206] Taken together, these results demonstrate that IgE LuLISA is highly sensitive and accurate for the clinical detection of sIgE, requiring only very small amounts of plasma.
[0207] In addition to ImmunoCAP, several other methods for the detection of sIgE have been reported, including IMMULITE and, more recently, isotype-specific agglutination PCR (ISAP) (Hamilton RG et al. 2008; Tsai CT et al. 2018). IMMULITE is considered the closest method to LuLISA because it uses chemiluminescence to detect sIgE. However, the reported detection limit for sIgE by IMMULITE is identical to that of ImmunoCAP (0.1 kUA / L). Similar to LuLISA, sIgE detection by ISAP can be performed using 1 μl of clinical sample. However, the two tests are based on different techniques, as ISAP requires chemically synthesized allergen DNA (for various allergens) and a secondary anti-IgE antibody-DNA conjugate to detect sIgE by quantitative PCR.
[0208] The IgE LuLISA was used in a strip test (lateral flow) for serum IgE to test infants allergic to milk. The results are shown in Figure 15.
[0209] Such tests are intended to prove the application of LuLISA in emergency conditions to detect IgE specific for curare (anesthetic), amoxicillin (antibiotic) and latex (gloves) in patients undergoing surgery, or for the detection of allergies to milk compounds in newborns in pediatric emergency care.
[0210] Fingerstick blood samples are routinely and timely adapted for sIgE LuLISA in patients treated with omalizumab, and the injection dose is adjusted according to the amount of free sIgE detected.
[0211] The small sample volume required and the extension of LuLISA's capabilities to ELISA potentially allow for the broader application of plotting affinity profiles or spectra of serum with two or more IgE species. LuLISA competitive assays are performed using a series of allergen dilutions mixed with a fixed concentration of serum. The amount of IgE detected correlates with light intensity. The amount of IgE detected at each allergen concentration interval is a method for assessing the presence of immunoglobulins with very high (subpicomolar), high (nanomolar), medium (10-100 nanomolar), or low (micromolar or greater) affinity for the allergen. The higher the affinity, the stronger the saturation and aggregation of IgE receptors on the surface of mast cells, basophils, and macrophages, leading to stronger histamine and cytokine responses and a higher risk of anaphylactic shock. The affinity spectrum is a suitable tool for the follow-up of patients under desensitization therapy to guide therapeutic strategies: either discontinue allergen challenge with increasing doses, modify short-term responses with antihistamines, or remove high-affinity IgE with a competitor of the IgG Fc receptor binding site (omalizumab).
[0212] In summary, IgE LuLISA is a new method for ultrasensitive detection of sIgE that requires only very small volumes of plasma sample (less than 1 μL). The use of bioluminescence provides a significant improvement in sensitivity over classical colorimetric (ELISA) or fluorescent (ImmunoCAP) IgE detection methods, as well as an expanded dynamic range of concentrations. The method is fully automatable and uses commercially available plates and a standard luminometer for bioluminescent detection of IgE. Therefore, IgE LuLISA should be significantly more cost-effective than conventional ImmunoCAP.
[0213] Example 3 Luciferase immunosorbent assay for SARS COV-2 serology testing Materials and Methods Human plasma and serum Samples were obtained from sera of the CORSER cohort (n=164; IcareB), from sera from the Observation and Surveillance Protocol of Intensive Care Medicine and Resuscitation of the Assistance Publique des Hopitaux de Paris (APHP) Cochin during long-term follow-up (n=20), and from plasma and serum of healthy donors from the Etablissement Francais du Sang (EFS) (frozen plasma n=20, frozen serum n=20) sampled in December 2019. Pre-pandemic frozen sera from 664 healthy donors were obtained from the French Blood Bank (Etablissement Francais du Sang, EFS).
[0214] Fusion protein anti-IgG nanobody-luciferase Design and synthesis of plasmids encoding anti-IgG Nanobody-luciferase fusion proteins (pET23-fc1-nanoKAZ or pET23-fc10-nanoKAZ, respectively, having fc1 encoding SEQ ID NO:62, fc10 encoding SEQ ID NO:63, and jaz572 encoding SEQ ID NO:10, or pET23-fc1-jaz572 or pET23-fc10-jaz572, respectively, having fc1 encoding SEQ ID NO:62, fc10 encoding SEQ ID NO:63, and jaz572 encoding SEQ ID NO:10). NanoKAZ is an optimized sequence of the catalytic domain of luciferase from Pleurotus ostreatus (International Publication No. 2012 / 061530). Jaz572 (SEQ ID NO: 10) is derived from nanoKAZ and has improved catalytic activity, which increases photon emission and signal, and reduced aggregation and surface adsorption behavior, which reduces noise, contributing to a better signal-to-noise ratio.
[0215] The nanoKAZ and JAZ572 genes were synthesized by Eurofins (Germany) and contain a carboxy-terminal His6 tag and flanking regions corresponding to the pET23 sequence (Novagen). The pET23 plasmid was amplified with forward and reverse oligonucleotides (Fwd: 5'CTCGAGCACCACCACCACCACCAC3' (SEQ ID NO: 47); Rvr: 5'GGTATATCTCCTTCTTAAAGTTAAAC3' (SEQ ID NO: 48), Eurofins) using Q5 DNA polymerase and dNTP mix (New England BioLabs). PCR products were purified on agarose gels (1%, Macherey Nagel) by electrophoresis. The purified pET23 vector and synthetic genes were constructed (pET23-nanoKAZ or pET23-jaz572) using NEBuilder HiFi Assembly Master Mix (New England Biolabs).
[0216] The IgG-binding portion is obtained from a humanized heavy chain antibody (single domain antibody) of an alpaca selected against IgG (U.S. Pat. No. 10,259,886). FC1 recognizes the constant fragment regions of human IgG1, IgG2, IgG3, and IgG4 with the following dissociation constants at equilibrium: KD 0.57 nM, 1.73 nM, 47.8 nM, and 0.30 nM, respectively, and the KD for whole IgG is 3.25 nM (U.S. Pat. No. 10,259,886). FC10 recognizes the constant fragment regions of human IgG1, IgG2, IgG3, and IgG4 with the following dissociation constants at equilibrium: KD 2.62 nM, 7.29 nM, 8.99 nM, and 12.3 nM, respectively, and the KD for whole IgG is 3.25 nM (U.S. Pat. No. 10,259,886).
[0217] The fc1 and fc10 genes were synthesized by Eurofins and have flanking regions corresponding to the pET23-nanoKAZ sequence. The fc1 or fc10 synthetic gene was amplified with the corresponding forward and reverse oligonucleotides using Q5 DNA polymerase and dNTP mix.
[0218] The PCR products were purified on agarose gels by electrophoresis. The purified pET23-nanoKAZ and pET23-jaz572 vectors and the fc1 or fc10 synthetic genes were constructed using NEBuilder HiFi Assembly Master Mix (New England Biolabs).
[0219] The constructed products (5 mL) were transformed into NEB 5 alpha-competent E. coli and grown overnight on LB / agar / ampicillin in Petri dishes. Isolated colonies were grown in liquid culture, and plasmids were isolated and sequenced to confirm the presence of the fc1-nanoKAZ or fc10-nanoKAZ, fc1-jaz573, and fc10-jaz573 inserts.
[0220] The complete sequences of the anti-IgG nanobody-luciferase tandems FC1-nanoKAZ or FC10-nanoKAZ ([nanobody anti-IgG]-[nanoKAZ]-[His6]) are shown as examples in the table below.
[0221] [Table 10A]
[0222] [Table 10B]
[0223] The predicted molecular weights (MW) of FC1-nanoKAZ and FC10-nanoKAZ calculated from the sequences are 34,115 and 33,588 daltons, respectively.
[0224] Expression, purification, and validation of the anti-IgG nanobody-luciferase fusion protein were identical to those of the anti-IgE nanobody nanoKAZ (sdAb026-nanoKAZ). Protocol for detecting IgG specific to the N and S proteins of SARS-COV2 by luciferase-linked immunosorbent assay (LuLISA) IgG Luciferase Immunosorbent Assay (LuLISA) Protocol Flat-bottom white 96- or 384-well plates (Fluoronunc C96 Maxisorp, Nunc) were coated by adsorption with 50 μL / well of either nucleoprotein, spike, or fragments at 1 μg / mL in phosphate-buffered saline, pH 7.4 (Sigma) for 2 hours at room temperature or overnight at 4°C. Adsorption on Maxisorp® plates favors charge interactions. Alternatives to adsorption include covalent attachment of targets via carboxy, amine, or sulfhydryl moieties, or glycosylation on functionalized well surfaces, or coating with poly-lysine. The wells were finally emptied but not necessarily neutralized with BSA (1 mg / mL) or 3% nonfat milk. The wells were washed 3–6 times with 100 μL of 0.1% PBS / Tween 20. Dilutions of serum (typically 1 / 200), plasma, or body fluids in phosphate-buffered saline (PBS) supplemented with a final concentration of 3% nonfat milk, 1 mg / mL bovine serum albumin, 1-3% bovine serum, and / or 0.1% Tween 20 were applied at 50 μL / well to the respective allergen-coated wells and incubated for 30 minutes to 1 hour at room temperature. The wells were washed 3-6 times with 100 μL of 0.1% PBS / Tween 20. Purified VHH-nanoKAZ (5.10 μg / mL) was added at 1 ng / mL in PBS / PBS supplemented with a final concentration of 3% nonfat milk, 1 mg / mL bovine serum albumin, or 1-3% bovine serum and / or 0.1% Tween 20. 7 RLU.s -1 .mL -1) was added (50 μL / well) and incubated at room temperature for 20–30 minutes. The wells were washed four times with 100 μL of 0.1% PBS / Tween 20. The plate can be stored in PBS until measurement at this stage. Immediately before reading, each well was emptied and 50 μL of 27 μM furimazine (8-benzyl-2-(furan-2-ylmethyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one) or 13 μM Q108 was added. The plate was orbitally shaken for 5 seconds, and luminescence intensity was integrated for 0.5–1 second per well using a multiwell plate luminometer (LB960 Centro, Berthold).
[0225] result IgG specific for the N protein of SARS-CoV2 was titrated by luciferase-linked immunosorbent assay (LuLISA) in sera from the CORSER cohort (n=164; IcareB), sera from the observation and monitoring protocol of Intensive Care Medicine and Resuscitation at the Assistance Publique des Hopitaux de Paris (APHP) Cochin during long-term follow-up (n=20), and sera and plasma from healthy donors from the Etablissement Francais du Sang (EFS) sampled in December 2019 (frozen plasma n=20, frozen serum n=20).
[0226] The results are shown in FIG.
[0227] IgG specific for the spike (S) protein of SARS-CoV2 was titrated by LuLISA with sera from the observation and surveillance protocol of the Department of Intensive Care Medicine and Resuscitation of the Assistance Publique des Hopitaux de Paris (APHP) Cochin (n=20) and frozen sera from healthy donors of the EFS (n=4).
[0228] The results are shown in FIG.
[0229] The correlation between titrations of SARS-CoV2 N protein-specific IgG and SARS-CoV2 S protein-specific IgG in sera from APHP-Cochin (n=20) and EFS (n=4) is shown in Figure 18.
[0230] We then compared IgG specific for SARS-CoV1 N protein and SARS-CoV2 N protein and SARS-CoV1 S protein and SARS-CoV2 S protein in patient-derived sera (APHP-Cochin n=20) and frozen sera from healthy donors (EFS n=4).
[0231] The results are shown in Figures 19 and 20.
[0232] A rapid test on a 96-well plate, which can be performed within 5 minutes, was determined by shortening the incubation time in duplicate for sera from APHP-Cochin (n=20) and EFS (n=4): 3 minutes of serum incubation at room temperature or better still 37°C, 17 seconds per washing step (plate washer Zoom HT, Berthold), and 1 minute of anti-IgG VHH-nanoKAZ incubation. Coefficient of determination R 2 The result is shown in FIG.
[0233] References Throughout this application, various references describe prior art to which this invention pertains, the disclosures of such references are hereby incorporated by reference into this application.
Claims
1. - an N-terminal domain comprising the variable domain of a camelid heavy chain antibody (VHH) or a single chain variable fragment (scFV) directed against an immunoglobulin, and - a C-terminal domain comprising a polypeptide having luciferase activity, - has the amino acid sequence of SEQ ID NO: 1, or - a C-terminal domain having at least 80% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 1 A fusion protein comprising:
2. A polypeptide having luciferase activity SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, S 2. The fusion protein of claim 1, having an amino acid sequence selected from the group consisting of:
3. The fusion protein of claim 1 or 2, wherein the VHH is directed against the constant fragment (Fc) of an immunoglobulin.
4. The fusion protein according to any one of claims 1 to 3, wherein the antibody is a VHH.
5. 5. The fusion protein of claim 1, wherein the immunoglobulin is IgE directed against an allergen.
6. 5. The fusion protein of any one of claims 1 to 4, wherein the immunoglobulin is an IgM or IgG directed against the N or S protein of severe acute respiratory syndrome coronavirus 2.
7. - a fusion protein according to any one of claims 1 to 6, and - a substrate for a polypeptide having luciferase activity Kit including:
8. 10. Use of a fusion protein according to any one of claims 1 to 6 for detecting and / or quantifying immunoglobulins in a sample.
9. (a) contacting a sample with the fusion protein of any one of claims 1 to 6; (b) adding a substrate for a polypeptide having luciferase activity; (c) detecting the luminescence; 1. A method for detecting the presence of immunoglobulin in a sample, comprising:
10. 1. A method for quantifying immunoglobulin levels in a sample, comprising: (a) contacting a sample with the fusion protein of any one of claims 1 to 6; (b) adding a substrate for a polypeptide having luciferase activity; (c) quantifying the luminescence; A method comprising:
11. 1. A method for quantifying immunoglobulin levels per affinity interval in a sample to assess the affinity range of a polyclonal immunoglobulin mixture, comprising: (a) contacting the sample with an antigen in the presence of a dilution series of free antigen; (b) contacting the sample with a fusion protein according to any one of claims 1 to 6; (c) adding a substrate for the polypeptide having luciferase activity; (d) quantifying the luminescence and plotting the light intensity against the antigen concentration; A method comprising:
12. having at least 80% amino acid sequence identity to the amino acid sequence of SEQ ID NO: 1; - substitution of tyrosine (Y) with arginine (R) at position corresponding to position 18 of SEQ ID NO: 1; - substitution of leucine (L) with lysine (K) at position corresponding to position 48 of SEQ ID NO: 1; - substitution of isoleucine (I) with alanine (A) at position corresponding to position 56 of SEQ ID NO: 1; - substitution of tyrosine (Y) with phenylalanine (F) at position corresponding to position 116 of SEQ ID NO: 1; - substitution of tryptophan (W) at position corresponding to position 134 of SEQ ID NO: 1 with an amino acid selected from the group consisting of threonine (T) and glutamic acid (E); - a substitution of tryptophan (W) at position 163 of SEQ ID NO: 1 with an amino acid selected from the group consisting of threonine (T) and glutamic acid (E), and - substitution of cysteine (C) with serine (S) at position corresponding to position 166 of SEQ ID NO: 1 A luciferase comprising at least one amino acid substitution selected from the group consisting of:
13. A luciferase having an amino acid sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16 and SEQ ID NO:
17.
14. Use of the luciferase according to claim 12 or 13 in a luminescent reaction.
15. (a) exposing the luciferase of claim 12 or 13 to a substrate; (b) detecting the emission of light; A method comprising:
16. The luciferase according to claim 12 or 13 and - a kit comprising a substrate for luciferase.
17. 17. The kit of claim 7 or 16, wherein the substrate is 8-(2,3-difluorobenzyl)-2-((5-methylfuran-2-yl)methyl)-6-phenylimidazo[1,2-a]pyrazin-3(7H)-one.
Citation Information
Patent Citations
Mutated gene of shrimp luciferase catalytic protein and use thereof
JP2015202096A
Red-shifted luciferase-luciferin pairs for enhanced bioluminescence
US20180057801A1
US10,259,886
USNCT02103270、
Oplophorus-derived luciferases, novel coelenterazine substrates, and methods of use
WO2012061530A2